Вы находитесь на странице: 1из 43

Act 1: Leccin Evaluativa de Pre saberes

1 Puntos: 1 El concepto de clula se puede asemejar con: Seleccione una respuesta. a. Celda

b. Secuencia de ADN c. Envoltura d. Complejo molecular Correcto Puntos para este envo: 1/1. 2 Puntos: 1 El autor Matthias Schleiden y Theodor Schwann, en 1839 postularon: Seleccione una respuesta. a. La Introduccin del trmino clula.

b. La presencia constante de un corpsculo en el interior de las clulas vegetales del la funcin: el ncleo.

c. La Teora Celular. Todo ser vivo est constituido por unidades fundamentales llama los organismos estn compuestos de una o ms clulas. d. La descripcin de las primeras formas de las bacterias. Correcto Puntos para este envo: 1/1. 3 Puntos: 1 El autor Anton Van Leeuwenhoek, en 1670 postul: Seleccione una respuesta. a. La Teora Celular.

b. La presencia constante de un corpsculo en el interior de las clulas vegetale c. La Introduccin del trmino clula. d. La descripcin de las primeras formas de las bacterias. Correcto

Puntos para este envo: 1/1. 4 Puntos: 1 El autor de la formulacin Teora Celular "Todo ser vivo est constituido por unidades fundamentales llamadas clulas" es: Seleccione una respuesta. a. Robert Hooke

b. Anton Van Leeuwenhoek c. Robert Brown d. Matthias Schleiden y Theodor Schwann Correcto Puntos para este envo: 1/1. 5 Puntos: 1 El autor descripcin de las primeras formas de las bacterias es: Seleccione una respuesta. a. Anton Van Leeuwenhoek

b. Matthias Schleiden y Theodor Schwann c. Robert Brown d. Robert Hooke Correcto Puntos para este envo: 1/1. 6 Puntos: 1 La formulacion: Advirti la presencia constante de un corpsculo en el interior de las clulas vegetales del cual se desconoca la funcin, fue propuesta en: Seleccione una respuesta. a. 1655

b. 1831 c. 1839 d. 1670

Incorrecto Puntos para este envo: 0/1. 7 Puntos: 1 La formulacion Descripcin de las primeras formas de las bacterias. fue basada en el uso de: Seleccione una respuesta. a. Microscopio

b. Microscopio ptico rudimentario c. Lentes de aumento d. Lupas Incorrecto Puntos para este envo: 0/1. 8 Puntos: 1 La formulacion del trmino clula, fue basada en el uso de: Seleccione una respuesta. a. Microscopio

b. Lentes de aumento c. Microscopio ptico rudimentario d. Lupas Correcto Puntos para este envo: 1/1. 9 Puntos: 1 La formulacion de la Teora Celular. "Todo ser vivo est constituido por unidades fundamentales llamadas clulas", fue propuesta en: Seleccione una respuesta. a. 1655

b. 1831 c. 1839 d. 1670

Correcto Puntos para este envo: 1/1. 10 Puntos: 1 La formulacion del trmino clula, fue propuesta en: Seleccione una respuesta. a. 1655

b. 1670 c. 1839 d. 1831 Correcto Puntos para este envo: 1/1. Act. 3. Leccin Evaluativa de Reconocimiento

1 Puntos: 1 1. El redescubrimiento de los trabajos de Mendel fue liderado por tres ilustres botnicos entre ellos estaba: Seleccione una respuesta. a. Correns Correcto

b. Morgan c. Linneo d. Fisher Correcto Puntos para este envo: 1/1. 2 Puntos: 1 Al mencionar el siguiente texto las formas orgnicas existentes, proceden de otras distintas que existieron en el pasado mediante un proceso de descendencia con modificacin, se puede relacionar con el concepto de: Seleccione una respuesta. a. Teora geocentrista

b. Teora de la simbiosis

c. Teora de la evolucin d. Teora de la creacin Correcto Puntos para este envo: 1/1. 3 Puntos: 1 El modelo Biolgico empleado por Gregor Mendel en sus trabajos experimentales fue: Seleccione una respuesta. a. Semillas de Pisum Sativum



b. Plantas puras de diferentes caractersticas c. Semillas de diferentes especies vegetales d. Plantas con flores Correcto Puntos para este envo: 1/1. 4 Puntos: 1 1. El germoplasma segn el artculo, puede interpretarse genticamente con: Seleccione una respuesta. a. Clulas Somticas

b. Alosomas c. Autosomas d. Clulas cigticas Correcto Puntos para este envo: 1/1. 5 Puntos: 1 1. El modelo biolgico que ha sido ampliamente empleado en los estudios de la gentica es: Seleccione una respuesta. a. Muss Muscullus Correcto

b. Salmonella c. Pisum sativum d. Drosofila melanogaster Incorrecto Puntos para este envo: 0/1. 6 Puntos: 1 El concepto relacionado con la divisin celular, fue introducido inicialmente por: Seleccione una respuesta. a. Rudolf Virchow Correcto Incorrecto

b. Charles Darwin c. Mathias Schleiden d. Charles Lyell C. Correcto Puntos para este envo: 1/1. 7 Puntos: 1 1. La gentica moderna basa sus principios en: Seleccione una respuesta. a. Las teoras de la evolucin

b. La biologa molecular c. Las leyes de Mendel d. Los postulados de R. Virchow Correcto Puntos para este envo: 1/1. 8 Puntos: 1 1. El somatoplasma segn el artculo, puede interpretarse genticamente con: Seleccione una respuesta. Correcto

a. Alosomas .


b. Clulas germinales c. Autosomas d. Clulas cigticas Incorrecto Puntos para este envo: 0/1. 9 Puntos: 1 1. Segn el artculo, la gentica es considerada como: Seleccione una respuesta. a. Un campo de formacin netamente investigativo

b. Una Ciencia propia e independiente c. Una rama de la Biologa d. Una rama de las ciencias naturales Incorrecto Puntos para este envo: 0/1. 10 Puntos: 1 Genticamente el equilibrio de Hardy Weimberg, es entendido como: Seleccione una respuesta. a. Una aplicacin prctica de la primera ley de Mendel Incorrecto

b. Una Extensin a la primera Ley de Mendel c. Una extensin a la segunda Ley de Mendel d. Una aplicacin prctica de la segunda ley de Mendel Correcto Puntos para este envo: 1/1. Act 4: Leccin Evaluativa de Profundizacin


1 Puntos: 1

El autor de la publicacin sobre experimentos de hibridacin en plantas, en la que se describen las unidades fundamentales de la herencia (que posteriormente recibirn el nombre de genes), es: Seleccione una respuesta. a. James Watson y Francis Crick

b. Charles Darwin c. Friedrich Miescher d. Gregorio Mendel Correcto Puntos para este envo: 1/1. 2 Puntos: 1 Los modelos matemticos de las frecuencias gnicas en poblaciones mendelianas fueron propuestos por: Seleccione una respuesta. a. Gregorio Mendel

b. James Watson y Francis Crick c. G. H. Hardy y Wilhelm Weinberg d. Friedrich Miescher e. Charles Darwin Incorrecto Puntos para este envo: 0/1. 3 Puntos: 1 La formulacion: "La estructura del ADN es una doble hlice, formada por dos cadenas orientadas en sentidos opuestos - antiparalelas. La estructura de tres dimensiones se mantiene gracias a enlaces de hidrgeno entre bases nitrogenadas que se encuentran orientadas hacia el interior de las cadenas" fue propuesta en el ao: Seleccione una respuesta. a. 1859

b. 1860 c. 1953 d. 1886 Correcto

Puntos para este envo: 1/1. 4 Puntos: 1 Friedrich Miescher (Bioqumico Suizo), en 1871 realiz un trabajo relacionado con: Seleccione una respuesta.

a. La estructura del ADN es una doble hlice, formada por dos cadenas orientadas en - antiparalelas. La estructura de tres dimensiones se mantiene gracias a enlaces de h bases nitrogenadas que se encuentran orientadas hacia el interior de las cadenas. b. Leyes de la herencia c. Aislamiento de ADN en el ncleo de una clula. d. Las caractersticas biolgicas transmitidas de padres a hijos. e. La teora sobre la evolucin de las especies. Correcto Puntos para este envo: 1/1. 5 Puntos: 1 El trabajo realizado por Mendel se puede considerar como: Seleccione una respuesta. a. No coincide con la realidad sobre la expresin gentica

b. Muy poco confiable c. Bastante Experimental d. Bastante terico Correcto Puntos para este envo: 1/1. 6 Puntos: 1 El cientfico que propuso el trmino "gen" y asegur que los cromosomas tienen muchos genes (que son los factores mencionados por Mendel que se transmitan de generacion en generacion) fu: Seleccione una respuesta. a. Walter Sutton

b. Gregorio Mendel

c. James Watson y Francis Crick d. Charles Darwin e. Friedrich Miescher (Bioqumico Suizo) Incorrecto Puntos para este envo: 0/1. 7 Puntos: 1 Eltrabajo de Mendel fue realizado especficamente con: Seleccione una respuesta. a. Plantas con flores

b. Plantas altas c. Plantas sin flores d. Plantas bajas Correcto Puntos para este envo: 1/1. 8 Puntos: 1 El Primer investigador que aisl el ADN en el ncleo de una clula fu: Seleccione una respuesta. a. Charles Darwin

b. Gregorio Mendel c. Friedrich Miescher d. James Watson y Francis Crick Correcto Puntos para este envo: 1/1. 9 Puntos: 1 El autor de la teora sobre la evolucin de las especies, en la que fundamentalmente se explica que las formas orgnicas existentes proceden de otras distintas que existieron en el pasado es: Seleccione una respuesta. a. Friedrich Miescher

b. Charles Darwin c. James Watson y Francis Crick d. Gregorio Mendel Correcto Puntos para este envo: 1/1.

Act 5: Quiz 1 1 Puntos: 1 Suponga que una hembra esta cargada con cinco cras. Si empleamos la siguiente expresin binomial: ( a + b 5 5 4 3 2 2 3 4 5 ) = a + 5a b +10a b + 10a b + 5ab + b . Qu probabilidad existe de que tres de estos sean machos y dos sean hembras?. Seleccione una respuesta. a. El 0.3% Incorrecto

b. El 50% c. El 31% d. El 25% Incorrecto Incorrecto Puntos para este envo: 0/1. 2 Puntos: 1 Si un individuo posee los dos alelos diferentes; por ejemplo: Mm en un gen de tipo Mendeliano, se puede decir que el gen es de tipo: Seleccione una respuesta. a. Codominante

b. Homocigoto c. Puro d. Portador Correcto Correcto Puntos para este envo: 1/1. Correcto

3 Puntos: 1 Segn los resultados obtenidos por Mendel, el carcter rugoso, con respecto al carcter Liso es: Seleccione una respuesta. a. Dominante

b. Portador c. Tiene el mismos grado de dominancia d. Recesivo Incorrecto Incorrecto Puntos para este envo: 0/1. 4 Puntos: 1 Una clula procariota, se diferencia principalmente de una clula eucariota, por: Seleccione una respuesta. a. La clula procariota no se divide Incorrecto

b. La clula procariota tiene membrana celular c. La clula procariota no tiene un ncleo plenamente definido d. La clula procariota posee DNA Correcto Correcto Puntos para este envo: 1/1. 5 Puntos: 1 El modelo biolgico empleado por Gregorio Mendel en sus estudios experimentales fue: Seleccione una respuesta. a. Semillas de Allium Cepa Correcto

b. Semillas de Solanum tuberosum c. Semillas de Vicia Faba d. Semillas de Pisum Sativun Correcto

Correcto Correcto Puntos para este envo: 1/1. 6 Puntos: 1 Las clulas eucariotas se diferencian de las procariotas por: Seleccione una respuesta. a. Poseen una membrana nuclear que protege el material gentico Correcto

b. Se puede reproducir c. Posee Membrana celular d. Tienen nicamente DNA en el ncleo Correcto Correcto Puntos para este envo: 1/1. 7 Puntos: 1 Por regla general, la suma de probabilidades en un determinado experimento debe ser igual a: Seleccione una respuesta. a. Un medio (1/2)

b. Cero (0) c. Un cuarto (1/4) d. Uno (1) Correcto Correcto Puntos para este envo: 1/1. 8 Puntos: 1 Los coeficientes numricos que hacen falta para completar la expresin binomial siguiente: (a+b) = 1 , 9, 36, 84, y 84, 36, 9, 1 Son: Seleccione una respuesta. a. 126 y 126


b. 100 y 100


c. 116 y 116 d. 122 y 122 Incorrecto Incorrecto Puntos para este envo: 0/1. 9 Puntos: 1 Cuando hablamos del contenido de genes que posee un individuo, nos referimos exactamente a: Seleccione una respuesta. a. Cromosoma

b. Fenotipo c. Gameto d. Genoma Correcto Correcto Puntos para este envo: 1/1. 10 Puntos: 1 La expresin fsica de los genes se evidencia en: Seleccione una respuesta. a. Alelo Correcto

b. Fenotipo c. Genoma d. ADN Incorrecto Incorrecto Puntos para este envo: 0/1. 11 Puntos: 1 Una de las diferencias circunstanciales que existe entre una clula animal y una vegetal es: Seleccione una respuesta. Incorrecto

a. La clula vegetal tiene pared celular y la animal no


b. La clula vegetal tiene nucleolo y la animal no c. La clula animal tiene membrana plasmtica y la vegetal no d. La clula animal tiene mitocondrias y la vegetal no Correcto Puntos para este envo: 1/1. 12 Puntos: 1 La _____________ , es el organelo encargado de suministrar la energa necesaria para el funcionamiento de la clula Seleccione una respuesta. a. Mitocondra

b. Membrana plasmtica c. Cromatina d. Vacuola Incorrecto Puntos para este envo: 0/1. 13 Puntos: 1 Segn los estudios y experimentos realizados por Mendel, se puede decir que el color amarllo de la semilla y la forma lisa de la semilla son caractersticas de tipo: Seleccione una respuesta. a. Dominante Correcto Incorrecto

b. Episttica c. Recesivo d. Codominante Correcto Puntos para este envo: 1/1. 14 Puntos: 1 La parte de la clula eucariota que es considerada como una de las ms importantes es: Seleccione una respuesta.

a. El citoplasma

b. El reticulo endoplsmico c. El ncleo d. La Mitocondria Correcto Puntos para este envo: 1/1. 15 Puntos: 1 La definicin ms apropiada para definir el concepto de genotipo es: Seleccione una respuesta. a. El genotipo son las cractersticas fsicas de un individuo Correcto

b. El genotipo son los genes que posee un individuo y se manifiestan fsicamente mediante el fenotipo c. El genotipo es el resultado de un cruce entre dos inividuos d. El genotipo es la manifestacin fsica del fenotipo Correcto Puntos para este envo: 1/1.


Act. 7. Leccin Evaluativa de Reconocimiento

1 Puntos: 1/1 Mendel cruz guisantes de semillas de color amarillo con guisantes de Semillas de color verde. En la primera generacin, todas fueron amarillas y en F2 de muchos cruces obtuvo 705 amarillas y 224 verdes. Segn los resultados de la F2, los parentales cruzados, debieron ser de genotipo: Seleccione una respuesta. a. Ambos recesivos

b. Ambos Portadores c. Uno portador y el otro puro recesivo d. Uno portador y el otro puro dominante Correcto Puntos para este envo: 1/1.


2 Puntos: 1/1 Cuando un hombre de grupo sanguneo A, se casa con una mujer de tipo sanguneo AB, el hijo resultante de esta pareja muy posiblementeno es de grupo sanguneo: Seleccione una respuesta. a. A

b. AB c. O d. B Correcto Puntos para este envo: 1/1. 3 Puntos: 0/1 En algunas razas de perros, el color negro del pelo es dominante respecto al color marrn, que es recesivo. Al cruzar una hembra negra heterocigota con un perro marrn, esta qued cargada y se sabe que va a tener ocho cachorros. Cuantos de estos se espera sean de color negro y cuantos de color marrn en la descendencia F1?. Seleccione una respuesta. a. 4 negros y 4 marrn Correcto

b. 6 marrn y 2 blancos c. 6 negros y 2 marrn d. Todos negros Incorrecto Puntos para este envo: 0/1. Este envo ha supuesto una penalizacin de 0.1. 4 Puntos: 0/1 Suponga que en el anlisis realizado a un una poblacin de individuos, se obtuvo los siguientes resultados genotpicos: 1200 individuos de genotipo AA, 300 individuos de genotipo Aa y 500 individuos de genotipo aa. De acuerdo a estos valores, se espera que las frecuencias genotpicas para esta poblacin sean: Seleccione una respuesta. a. 0.50 AA, 0.30 Aa y 0.20 aa Incorrecto Incorrecto

b. 0.60 AA, 0.15 Aa y 0.25 aa

c. 0.60 AA, 0.30 Aa y 0.10 aa d. 0.60 AA, 0.20 Aa y 0.20 aa Incorrecto Puntos para este envo: 0/1. Este envo ha supuesto una penalizacin de 0.1. 5 Puntos: 1/1 En una cruza dihbridas entre dos variedades vegetales, se evidenciaron experimentalmente los siguientes resultados fenotpicos en la generacin F1:

303 plantas de semillas amarillas y flor axial 105 plantas de semillas amarillas y flor terminal 104 plantas de semillas verdes y flor axial 32 plantas de semillas verdes y flor terminal

Teniendo en cuenta los resultados anteriores, se puede decir que: Seleccione una respuesta. a. Una de las variedades que se cruz era pura para dos caractersticas y la otra era portadora b. Las dos variedades que se cruzaron eran puras para las dos caractersticas c. Las dos variedades que se cruzaron eran portadores para las dos caractersticas d. Los resultados obtenidos experimentalmente no estn en concordancia con los que se esperaban tericamente. Correcto Puntos para este envo: 1/1. 6 Puntos: 1/1 <object classid="clsid:38481807-CA0E-42D2-BF39-B33AF135CC4D" id="ieooui">Del cruzamiento de plantas puras de flores purpura con plantas puras de flores blancas, de una descendencia de 3000 individuos, se espera una proporcin fenotpica en la F2 de:</object > Seleccione una respuesta. a. 3000 plantas de flores prpura Coreecto

b. 1500 plantas de flores prpura y 1500 plantas de flores blancas c. 3000 plantas de flores blancas d. 750 plantas de flores blancas y 2250 plantas de flores prpura Correcto Puntos para este envo: 1/1. Correcto

7 Puntos: 1/1 Un organismo heterocigoto normalmente se identifica por que sus genes: Seleccione una respuesta. a. Portan los dos alelos dominantes

b. Portan los dos alelos recesivos c. Portan un alelo dominante y otro recesivo d. No portan alelos dominantes Correcto Puntos para este envo: 1/1. 8 Puntos: 1/1 El pelo corto en los conejos se debe a un gene dominante, sobre el pelo Largo que es recesivo. Una cruza entre un macho de pelo largo y una hembra de pelo corto producen 7 conejos de pelo corto y 5 de pelo largo; segn estos resultados, el genotipo ms probable de la hembra es: Seleccione una respuesta. a. Aa Correcto Correcto

b. a c. AA d. aa Correcto Puntos para este envo: 1/1. 9 Puntos: 1/1 En la siguiente afirmacin si se cruzan dos individuos homocigticos (dominante y recesivo) entre s para un mismo caracter, entonces todos los descendientes, que forman la primera generacin filial, son de genotipo heterocigticos, lo anterior se relaciona con: Seleccione una respuesta. a. La primera Ley de Mendel Correcto

b. La segunda Ley de Mendel c. El equilibrio de Hardy Weimberg

d. Prueba de paternidad. Correcto Puntos para este envo: 1/1. 10 Puntos: 1/1 En los perros el gene A_ es responsable de la audicin normal, en cambio el gene, aa, provoca la sordera. Orejas dobladas hacia el frente ( F_ ) es dominante a orejas erectas ( ff ). El pelo negro ( N_ ) es dominante al pelo marrn ( nn). Si se cruza un perro sordo, orejas erectas y de pelo marrn con una hembra de audicin normal, orejas dobladas hacia el frente y de pelo negro, homocigota para los tres pares de genes. El genotipo que tendr toda la F1 es: Seleccione una respuesta. a. AaFfNn Correcto

b. AAFFNN c. AAFfNn d. AAffNN Correcto Puntos para este envo: 1/1.

Act 8: Leccin Evaluativa de Profundizacin

1 Puntos: 1 El entrecruzamiento se define como: Seleccione una respuesta.

a. Proceso ocurrido cuando un gen solapa o inhibe la manifestacin de otro gen que no es alel

b. Proceso meitico que genera un producto haploide cuyo genotipo difiere de los dos genotipo formaron la clula meiotica diploide.

c. Proceso que ocurre cuando el alelo dominante en un locus produce un fenotipo independien condicin allica del otro locus

d. Proceso en el que el heterocigoto presenta un fenotipo intermedio al que producen los indivi es decir el heterocigoto no manifiesta la misma relacion fenotipica del homocigoto dominante. Incorrecto Puntos para este envo: 0/1. 2 Puntos: 1 Las proporciones fenotipicas de los genes letales son:

Seleccione una respuesta. a. 12:3:1

b. 9:7 c. 9:3:4 d. 1:2 Incorrecto Puntos para este envo: 0/1. 3 Puntos: 1 Al realizar la cruza de prueba a una hembra de pelaje negro portadora, se obtuvo en la descendencia seis individuos. La probabilidad de que todos ellos salgan con el mismo fenotipo de la hembra es de: Seleccione una respuesta. a. 50%

b. 1.56% c. 3% d. 25% Incorrecto Puntos para este envo: 0/1. 4 Puntos: 1 Las proporciones fenotipicas de la epistasis de genes dominantes con recesivos son: Seleccione una respuesta. a. 9:3:4

b. 3:1 c. 7 d. 1:2 e. 13:3 Incorrecto Puntos para este envo: 0/1. 5

Puntos: 1 La Caracteristicas de patas delanteras tiesas es: Seleccione una respuesta. a. Osificacion de las articulaciones. Recesivo.

b. Agua en los espacios subaracndesos. Recesivo. c. Recesivo. d. recesivo Incorrecto Puntos para este envo: 0/1. 6 Puntos: 1 En los perros el gene A_ es responsable de la audicin normal, en cambio el gene, aa, provoca la sordera. Orejas dobladas hacia el frente ( F_ ) es dominante a orejas erectas ( ff ). El pelo negro ( N_ ) es dominante al pelo marrn ( nn). Si se cruza un perro sordo, orejas erectas y de pelo marrn con una hembra de audicin normal, orejas dobladas hacia el frente y de pelo negro, homocigota para los tres pares de genes. El genotipo que tendr toda la F1 es: Seleccione una respuesta. a. AaFfNn

b. AAFFNN c. AAFfNn d. AAffNN Correcto Puntos para este envo: 1/1. 7 Puntos: 1 La epistasis de genes dominantes con recesivos ocurre: Seleccione una respuesta.

a. cuando el genotipo dominante en uno de los locus ( por ejemplo M- ) y el genotipo recesivo n producen el mismo fenotipo, slo resultando dos fenotipos en la F2

b. cuando se genera un producto haploide cuyo genotipo difiere de los dos genotipos haploides meiotica diploide. c. cuando un gen solapa o inhibe la manifestacin de otro gen que no es alelo

d. cuando el alelo dominante en un locus produce un fenotipo independientemente de la condic locus Correcto

Puntos para este envo: 1/1. 8 Puntos: 1 La epistasis dominante doble ocurre: Seleccione una respuesta.

a. cuando se presenta el mismo fenotipo, si intervienen dos genes dominantes o un gen domin los genes recesivos manifiestan un fenotipo diferente; bsicamente sern individuos que no ma condicin

b. cuando los alelos recesivos en uno de los locus o en ambos producen el mismo fenotipo y cu dominantes estan juntos se complementan y dan lugar a otro fenotipo diferente

c. cuando el alelo dominante en un locus produce un fenotipo independientemente de la condic locus d. cuando un gen solapa o inhibe la manifestacin de otro gen que no es alelo Correcto Puntos para este envo: 1/1. 9 Puntos: 1 Las proporciones fenotipicas de la codominancia son: Seleccione una respuesta. a. 9:3:4

b. 1:2 c. 9:7 d. 3:1 e. 1:2:1 Correcto Puntos para este envo: 1/1. 10 Puntos: 1 Las proporciones fenotipicas de la epistasis con efecto acumulativo son: Seleccione una respuesta. a. 9:3:4

b. 1:2 c. 12:3:1

d. 9:6:1 Correcto Puntos para este envo: 1/1.

Act 9: Quiz 2

1 Puntos: 1 Si se cruzan entre si individuos negros y se obtiene en la descendencia: 8 individuos grises, 4 individuos negros y 3 individuos blancos, podemos decir que los resultados obtenidos corresponden a: Seleccione una respuesta. a. Una epistasis dominante doble

b. Una dominancia incompleta o codominancia c. Un cruzamiento de tipo Mendeliano d. Una epistasis recesiva simple Incorrecto Puntos para este envo: 0/1. 2 Puntos: 1 Mendel cruz guisantes de semillas de color amarillo con guisantes de Semillas de color verde. En la primera generacin, todas fueron amarillas y en F2 de muchos cruces obtuvo 705 amarillas y 224 verdes. Segn los resultados de la F2, los parentales cruzados, debieron ser de genotipo: Seleccione una respuesta. a. Uno portador y el otro puro recesivo s Incorrecto

b. Ambos Portadores c. Ambos recesivo d. Uno portador y el otro puro dominante Correcto Puntos para este envo: 1/1. 3 Puntos: 1


Suponga que de una experiencia realizada en el laboratorio con cruzamientos de dos cepas de Drosophila melanogaster se obtuvo los siguientes resultados, los cuales fueron evaluados mediante la prueba de chi cuadrado.

Datos observados (o) 300 moscas de ojos rojos y alas normales 123 moscas de ojos rojos y alas vestigiales 120 moscas de ojos blancos y alas normales 60 moscas de ojos blancos y alas vestigiales

Datos esperados (e) 280 moscas de ojos rojos y alas normales 140 moscas de ojos rojos y alas vestigiales 132 moscas de ojos blancos y alas normales 51 moscas de ojos blancos y alas vestigiales

(o-e) 20 400


(o-e) /e = X 1.42









Valor de chi cuadrado X = 6.15 El valor de chi cuadrado obtenido, esta entre el 10 y 20 % de probabilidad de ocurrencia y es un valor no significativo. Pregunta Los genotipos que usted asignara a cada individuo que particip en el cruzamiento para la obtencin de estos resultados seran tanto para el color rojo de los ojos como para la forma normal de las alas los siguientes: Seleccione una respuesta. a. AA para ojos rojos y Bb para alas normales

b. Aa para ojos rojos y BB para alas normales c. Aa para ojos rojos y Bb para alas normales d. AA para ojos rojos y BB para alas normales Correcto Puntos para este envo: 1/1. 4 Puntos: 1 Un carcter es el rasgo morfolgico o fisiolgico que se transmiten de padres a hijos a travs de los genes, esta definicin se correcponde con: Seleccione una respuesta. a. El cromosoma Correcto

b. El fenotipo del individio c. El genotipo del individuo d. El ADN Correcto Puntos para este envo: 1/1. 5


Puntos: 1 Cuando cruzamos individuos portadores para dos caractersticas, la proporcin que yo espero obtener en la descendencia para el genotipo AaBb es de: Seleccione una respuesta. a. 4/16 Correcto

b. 3/16 c. 1/16 d. 1/2 Correcto Puntos para este envo: 1/1. 6 Puntos: 1 Una alelo hace referencia a una de las formas alternativas de un: Seleccione una respuesta. a. Gen

b. Fenotipo c. Cromosoma d. Locus Incorrecto Puntos para este envo: 0/1. 7 Puntos: 1 Las flores perritos , pueden ser rojas C C , rosadas C C , o blancas C C . Cuando plantas de flores rojas se cruzan con plantas de flores blancas, la probabilidad de que se produzcan descendientes en la F2 homocigotos es de: Seleccione una respuesta. a. 50% Incorrecto
r r r w w w


b. 25% c. 75% d. 100% Incorrecto Puntos para este envo: 0/1.

8 Puntos: 1 El genotipo A A , es letal, A A produce individuos color canela, A A , produce individuos de color beige, B B , 1 2 2 2 produce individuos de cola larga, B B , individuos de cola ligeramente corta y B B , individuos sin cola. Si se 1 2 1 2 cruzan individuos A A B B entre si, el nmero de descendientes esperada en la F1 adulta color canela y sin cola de una descendencia de 12 individuos es: Seleccione una respuesta. a. 12 individuos
1 1 1 2 2 2 1 1

b. 6 individuos c. 4 Individuos d. 2 Individuos Correcto Puntos para este envo: 1/1. 9 Puntos: 1 Suponga que de una experiencia realizada en el laboratorio con cruzamientos de dos cepas de Drosophila melanogaster se obtuvo los siguientes resultados, los cuales fueron evaluados mediante la prueba de chi cuadrado. Datos observados (o) 300 moscas de ojos rojos y alas normales 123 moscas de ojos rojos y alas vestigiales 120 moscas de ojos blancos y alas normales 60 moscas de ojos blancos y alas vestigiales Datos esperados (e) 280 moscas de ojos rojos y alas normales 140 moscas de ojos rojos y alas vestigiales 132 moscas de ojos blancos y alas normales 51 moscas de ojos blancos y alas vestigiales (o-e) 20 400 (o-e)


(o-e) /e = X 1.42









Valor de chi cuadrado X = 6.15 El valor de chi cuadrado obtenido, esta entre el 10 y 20 % de probabilidad de ocurrencia y es un valor no significativo.

Pregunta: Los dos caracteres dominantes para estas especies cruzadas son:

Seleccione una respuesta. a. Ojos Rojos y alas normales Correcto

b. Ojos blancos y alas vestigiales c. Ojos Rojos y alas vestigiales d. Alas blancos y alas normales Correcto Puntos para este envo: 1/1. 10 Puntos: 1 En una interaccin gentica de tipo epstasis dominante simple, se obtienen fenotipos en relacin : Seleccione una respuesta. a. 9:7

b. c. 15:1 d. 9:3:4 e. 12:3:1 Correcto Puntos para este envo: 1/1. 11 Puntos: 1 Del cruzamiento de plantas puras de flores purpura con plantas puras de flores blancas, de una descendencia de 3000 individuos, se espera una proporcin fenotpica en la F2 de: Seleccione una respuesta. a. 1500 plantas de flores purpura y 1500 plantas de flores blancas b. 3000 plantas de flores blancas c. 3000 plantas de flores purpura d. 750 plantas de flores blancas y 2250 plantas de flores purpura Correcto Puntos para este envo: 1/1. 12 Puntos: 1 En una cruza dihbridas entre dos variedades vegetales, se evidenciaron experimentalmente los siguientes resultados fenotpicos en la generacin F1: 303 plantas de semillas amarillas y flor axial 105 plantas de semillas amarillas y flor terminal Correcto Correcto

104 plantas de semillas verdes y flor axial 32 plantas de semillas verdes y flor terminal Teniendo en cuenta los resultados anteriores, se puede decir que: Seleccione una respuesta. a. Las dos variedades que se cruzaron eran portadores para las dos caractersticas Correcto

b. Las dos variedades que se cruzaron eran puras para las dos caractersticas c. Los resultados obtenidos experimentalmente no estn en concordancia con los que se esperaban tericamente d. Una de las variedades que se cruz era pura para dos caractersticas y la otra era portadora Correcto Puntos para este envo: 1/1. 13 Puntos: 1 La proporcin fenotpica obtenida en un cruce monohibrido de una F1 X F1 heterocigota es: Seleccione una respuesta. a. 3:1 Correcto

b. 2:1 c. 4:1 d. 15:1 Correcto Puntos para este envo: 1/1. 14 Puntos: 1 En la ley de segregacin independiente, las proporciones que Mendel obtuvo en sus experimentos fueron: Seleccione una respuesta. a. 9:3:3:1

b. 3:1 c. 27:9:9.9:3.3:3:1 d. 1:1 Incorrecto Puntos para este envo: 0/1.


15 Puntos: 1 En algunas razas de perros, el color negro del pelo es dominante respecto al color marrn, que es recesivo. Al cruzar una hembra negra heterocigota con un perro marrn, esta qued cargada y se sabe que va a tener ocho cachorros. Cuantos de estos se espera sean de color negro y cuantos de color marrn en la descendencia F1?. Seleccione una respuesta. a. 4 negros y 4 marrn

b. Todos negros c. 6 marrn y 2 blancos d. 6 negros y 2 marrn Incorrecto Puntos para este envo: 0/1.


Act 11: Leccin Evaluativa de Reconocimiento

1 Puntos: 1 El autor de la formulacin Teora Celular. Todo ser vivo est constituido por unidades fundamentales llamadas clulas. Todos los organismos estn compuestos de una o ms clulas. es: Seleccione una respuesta. a. Matthias Schleiden y Theodor Schwann

b. Robert Hooke c. Anton Van Leeuwenhoek d. Robert Brown Incorrecto Puntos para este envo: 0/1. 2 Puntos: 1 El autor Robert Hooke, en 1655 postul: Seleccione una respuesta.

a. Teora Celular. Todo ser vivo est constituido por unidades fundamentales llamada organismos estn compuestos de una o ms clulas. b. Descripcin de las primeras formas de las bacterias.

c. Introduccin del trmino clula. Del griego kytosy celda y del latn cella espacio vac

d. Advirti la presencia constante de un corpsculo en el interior de las clulas vegeta desconoca la funcin: el ncleo. Incorrecto Puntos para este envo: 0/1. 3 Puntos: 1 Con relacin al cdigo gentico y a la sntesis de protenas, seale la afirmativa FALSA. Seleccione una respuesta. a. En la molcula de ADN, encontramos siempre desoxirribosa y cinco tipos de bases: adenina, guanina, citosina, timina y uracilo b. La mutacin constituye una alteracin en la secuencia de bases Incorrecto nitrogenadas de un segmento de ADN y puede ser provocada por radiaciones, por rayos csmicos, por rayos-X, o an por exposicin a los rayos ultravioleta del sol c. Los cidos nucleicos pueden aparecer libres en la clula o pueden estar asociados las protenas, formando los cromosomas y ribosomas en la forma de molculas complejas de nucleoprotenas. d. Dos grandes etapas estn relacionadas con la sntesis de las protenas: la transcripcin, que comprende el pasaje del cdigo gentico del ADN para el RNA, y la traduccin, que comprende el trabajo del RNA de organizar los aminocidos en la secuencia determinada por el cdigo gentico Incorrecto Puntos para este envo: 0/1. 4 Puntos: 1 La mutacin en un gen, por consecuencia de la sustitucin de una nica base en la estructura del ADN, puede acarrear modificaciones importantes en la actividad biolgica de la protena codificada por ese gen. Considere que la estructura normal de un RNA mensajero de un pptido y su estructura alterada en virtud del cambio de una nica base en el gen correspondiente son: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) La tabla a continuacin identifica algunos codones

Aminocido alanina


cido asprtico cistena glicina cido glutmico fenilalanina metionina triptfano treonina

GAC,GAU UGC, UGU CGA, GGC, GGG, GGU GAA, GAG UUC, UUU AUG UGG Seleccione una respuesta. a. alanina y cido glutmico b. treonina y triptfano c. fenilalanina y cido asprtico d. lisina y cistena Incorrecto

Incorrecto Puntos para este envo: 0/1. 5 Puntos: 1 La formulacion Teora Celular. Todo ser vivo est constituido por unidades fundamentales llamadas clulas. Todos los organismos estn compuestos de una o ms clulas. fue propuesta en: Seleccione una respuesta. a. 1655

b. 1831 c. 1839 d. 1670 Incorrecto Puntos para este envo: 0/1. 6 Puntos: 1 La formulacion Introduccin del trmino clula. Del griego kytosy celda y del latn cella espacio vaco. fue basada en el uso de: Seleccione una respuesta. a. Lentes de aumento b. Microscopio

c. Lupas d. Microscopio ptico rudimentario Correcto Puntos para este envo: 1/1. 7 Puntos: 1 La formulacion Advirti la presencia constante de un corpsculo en el interior de las clulas vegetales del cual se desconoca la funcin: el ncleo. fue propuesta en: Seleccione una respuesta. a. 1839

b. 1655 c. 1831 d. 1670 Incorrecto Puntos para este envo: 0/1. 8 Puntos: 1 La formulacion Descripcin de las primeras formas de las bacterias. fue propuesta en: Seleccione una respuesta. a. 1831

b. 1670 c. 1655 d. 1839 Correcto Puntos para este envo: 1/1. 9 Puntos: 1 El autor de la formulacin Descripcin de las primeras formas de las bacterias. es: Seleccione una respuesta.

a. Matthias Schleiden y Theodor Schwann b. Robert Brown c. Robert Hooke d. Anton Van Leeuwenhoek Correcto Puntos para este envo: 1/1. 10 Puntos: 1 La formulacion Teora Celular. Todo ser vivo est constituido por unidades fundamentales llamadas clulas. Todos los organismos estn compuestos de una o ms clulas. fue basada en el uso de: Seleccione una respuesta. a. Microscopio ptico rudimentario b. Lentes de aumento c. Lupas d. Microscopio Incorrecto Puntos para este envo: 0/1.

Act 12: Leccin Evaluativa de Profundizacin

1 Puntos: 1 El autor de la publicacin sobre experimentos de hibridacin en plantas, en la que se describen las unidades fundamentales de la herencia (que posteriormente recibirn el nombre de genes), es: Seleccione una respuesta. a. Gregorio Mendel

b. Friedrich Miescher c. James Watson y Francis Crick

d. Charles Darwin Correcto Puntos para este envo: 1/1. 2 Puntos: 1 El primer trabajo de aislamiento de ADN en el ncleo de una clula fue realizado en el ao: Seleccione una respuesta. a. 1859

b. 1871 c. 1860 d. 1953 e. 1886 Incorrecto Puntos para este envo: 0/1. 3 Puntos: 1 Si tenemos un individuo que en uno de sus genes posee los siguientes alelos MnTT,podemos considerar que el individuo es: Seleccione una respuesta. a. Puro para las dos caractersticas

b. Portador para la primera caracterstica y puro para la segunda c. Portador para las dos caractersticas d. Puro para la primera caracterstica y portador para la segunda Correcto Puntos para este envo: 1/1. 4 Puntos: 1 El trabajo "Mendel's Principles of Heredity: A defense" fue publicado en el ao: Seleccione una respuesta. a. 1953

b. 1886 c. 1859 d. 1905 e. 1860 Incorrecto Puntos para este envo: 0/1. 5 Puntos: 1 El silenciamiento gnico mediante iRNA es un proceso que ocurre en las clulas de manera natural. La conservacin del silenciamiento por accin del iRNA es debida a la expresin de unos RNAs pequeos no codificantes llamados microRNAs (miRNAs). Estos miRNAs son crticos para el desarrollo normal y la fisiologa de los tejidos en mamferos. De acuerdo a la anterior informacin usted puede decir que es:

Seleccione una respuesta. a. Parcialmente Verdadera

b. Completamente Falsa c. Parcialmente Falsa d. Completamente Verdadera Incorrecto Puntos para este envo: 0/1. 6 Puntos: 1 La introduccin de un RNA de doble hebra (dsRNA) en una clula u organismo inicia una cascada de eventos, los cuales culminan con la degradacin del mRNA de secuencia homologa al dsRNA originalmente introducido.


I El dsRNA es capaz de interrumpir de manera secuencia especfica el flujo de informacin gentica desde el DNA hasta las protenas. II El fenmeno de silenciamiento de genes por RNAi interfiere en forma especfica con el flujo de informacin gnica.

De acuerdo a lo anterior, marque la opcin correcta de acuerdo al siguiente protocolo: A. si de la Tesis se deducen los postulados I y II

B. si de la Tesis se deduce solo el postulado I. C. se de la Tesis slo se deduce el postulado II. D. si ninguno de los postulados se deducen de la Tesis.

Seleccione una respuesta. a. D

b. C c. A d. B Incorrecto Puntos para este envo: 0/1. 7 Puntos: 1 El descubrimiento del DNAi ha sido el pilar estructural para el desarrollo de nuevas herramientas genticas con la capacidad de silenciar cualquier gen del genoma de manera especfica mediante el empleo de pequeas molculas de DNA de doble cadena denominados DNA interferentes pequeos. De acuerdo a esta informacin usted puede asegurar que es: Incorrecto

Seleccione una respuesta. a. Parcialmente Verdadera

b. Completamente Verdadera c. Completamente Falsa d. Parcialmente Falsa Correcto Puntos para este envo: 1/1. 8 Puntos: 1 Son componentes de Clula Eucariota: Seleccione al menos una respuesta. a. Citoesqueleto Correcto

b. Ribosoma c. Retculo Endoplasmtico Liso d. Mitocondria e. Sistema de Membranas f. Membrana plasmtica g. Citoplasma h. Retculo Endoplasmtico Rugoso i. Ncleo j. Complejo de Golgi Parcialmente correcto Puntos para este envo: 0.9/1. 9 Puntos: 1 Los modelos matemticos de las frecuencias gnicas en poblaciones mendelianas fueron propuestos en: Seleccione una respuesta. a. 1953

b. 1886 c. 1860 d. 1908 e. 1859 Correcto Puntos para este envo: 1/1. 10 Puntos: 1 El Premio Nobel de Medicina en el 2006 fue otorgado a los cientficos estadounidenses Andrew Fire y Craig Mello, PORQUE descubrieron un mecanismo fundamental para controlar el flujo de informacin gentica, el cido ribonucleico de interferencia (RNAi).

De acuuerdo a lo anterior marque o seleccione la letra correspondiente teniendo en cuenta lo siguiente:

A. ambas afirmaciones son verdaderas y la segunda es una razn o explicacin correcta de la primera B. ambas afirmaciones son verdaderas pero la segunda NO es una razn o explicacin de la primera C. la primera afirmacin es verdadera pero la segunda es falsa D. la primera afirmacin es falsa pero la segunda es verdadera Seleccione una respuesta. a. D

b. A c. B d. C Incorrecto Puntos para este envo: 0/1. Incorrecto

Act 13: Quiz tres

1 Puntos: 1 Dada la siguiente cadena de ADN; ACGTTTCGAAATCGAA; la hebra complementara de ARNm, que se copiara a partir de esta sera: Seleccione una respuesta. a. ACGTTTCGAAATCGAA

b. TGCAAAGCTTTAGCTT c. UGCAAAGCUUUAGCUU d. TGCAAACGAAATCGAA Incorrecto Puntos para este envo: 0/1. 2 Puntos: 1 Suponga que 5000 clulas masculinas, entran a realizar el proceso meitico, el nmero total de clulas sexuales viables (espermatozoides) para la reproduccin al final del proceso, (por la va normal) es de: Seleccione una respuesta. a. 20000 Clulas Correcto


b. 2500 clulas

c. 5000 Clulas d. 10000 Clulas Correcto Puntos para este envo: 1/1. 3 Puntos: 1 Las preguntas que encontrara a continuacin consta de un enunciado y cuatro opciones de respuesta identificadas como 1,2,3,4. Dos de estas opciones responden correctamente la pregunta. Usted debe elegir las respuestas adecuadas y contestar la respuesta de acuerdo a las siguientes instrucciones: Si 2 y 3 son correctas marque A Si 1 y 3 son correctas marque B Si 2 y 4 son correctas marque C Si todas son correctas marque D El ciclo celular completo consta de: 1. Dos etapas conocidas como citocinesis y mitosis 2. G1, S y G2 que hacen parte de la interfase 3. La fase m, la cual tiene 4 fases conocidas como profase, metafase, anafase y telofase. 4.La fase de interfase y metafase Seleccione una respuesta. a. A

b. B c. C d. D Incorrecto Puntos para este envo: 0/1. 4 Puntos: 1


Dada la siguiente cadena de ADN: AATCGATTG, la hebra de ARNt, que se construye a partir de la hera de ARNm es: Seleccione una respuesta.


b. AATCGATTG c. AAUCGAUUG d. UUAGCUAAC Incorrecto Puntos para este envo: 0/1. 5 Puntos: 1 _________________, se considera como el conjunto de pautas que rigen la transferencia de la informacin contenida en el mRNA para la sntesis de las protenas. Seleccione una respuesta. a. El ARNm Incorrecto

b. El ARNt c. El codn d. El cdigo gentico Correcto Puntos para este envo: 1/1. 6 Puntos: 1 Suponga que usted tiene la siguiente clula de un macho en intefase meitica con cuatro cromosomas marcados genticamente como se muestra a continuacin: Correcto

Uno de los productos meiticos obtenidos al final de la meiosis I, es: Seleccione una respuesta. a. ABb y X

b. AXD Y c. AbD Y d. AXY Incorrecto Puntos para este envo: 0/1. 7 Puntos: 1


Un investigador, interesado en producir en un tubo de ensayo una protena, en las mismas condiciones en que esa sntesis ocurre en las clulas, utiliz ribosomas de clulas de ratn, RNA mensajero de clulas de mono, RNA transferencia de clulas de conejo y aminocidos activos de clulas de sapo. La protena producida tendra una secuencia de aminocidos idntica a la de Seleccione una respuesta. a. Sapo

b. Mono c. Ratn d. Conejo Correcto Puntos para este envo: 1/1. 8 Puntos: 1


Durante la primera divisin meitica de una clula 2n con 30 cromosomas en fase G2, es normal encontrar en los dos productos de esta primera fase: Seleccione una respuesta. a. Celulas con 45 cromosomas

b. Clulas con 15 cromosomas cada una

Correcto, se ontienen clulas con la gentica, es decir, clulas con 15 cro

c. Clulas con 30 cromosomas cada una d. Clulas con 5 cromosomas Correcto Puntos para este envo: 1/1. 9 Puntos: 1 En la ley de segregacin independiente, las proporciones que Mendel obtuvo en sus experimentos fueron: Seleccione una respuesta.

a. 9:3:3:1

b. 1:1 c. 27:9:9.9:3.3:3:1 d. 3:1 Incorrecto Puntos para este envo: 0/1. 10 Puntos: 1 Las preguntas que encontrara a continuacin constan de un enunciado y cuatro opciones de respuesta identificadas como 1,2,3,4. Dos de estas opciones responden correctamente la pregunta. Usted debe elegir las respuestas adecuadas y contestar la respuesta de acuerdo a las siguientes instrucciones: Si 2 y 3 son correctas marque A Si 1 y 3 son correctas marque B Si 2 y 4 son correctas marque C Si todas son correctas marque D Incorrecto

El Acido Desoxirribo Nucleico (ADN) constituye el material gentico de todo ser vivo, ya que contiene la informacin para la sntesis de protenas especificas que permiten la vida, y adems 1. Es una molcula polimrica formada por repeticiones de .azcar desoxirribosa, fosfato y una base nitrogenada. 2. Entre las bases se establecen siempre tres puentes de .hidrgeno 3. La doble cadena tiene orientacin opuesta es decir antiparalela 4. El ADN es monocatenario Seleccione una respuesta. a. A

b. B c. C d. D Correcto Puntos para este envo: 1/1.
