Вы находитесь на странице: 1из 304

TEX

. . *

LATEX
cba
2008, 2012
* e-mail:

E.M.Baldin@inp.nsk.su

LATEX - 2008 ISBN 978-5-9775-0230-6.


Creative Commons Attribution-ShareAlike 3.0 Unported (CC-BY-SA 3.0).
,
.
LATEX.
, 1300
LATEX 750 , , . , , , , .
, LATEX .
LATEX .
LATEX. , ,

.

The book Computer Typesetting Using LATEX was published by the BHVPetersburg (Russia) publishing house in 2008 under ISBN 978-5-9775-0230-6. Under
the contract with the publishing house, I have now regained exclusive rights to the
content and decided to publish it under a Creative Commons Attribution-ShareAlike
3.0 Unported License (CC-BY-SA 3.0). Please contact me if you require a different
type of copyright license for your purposes.
This book is a guide to using the LATEX document preparation system. It describes
the complete fundamentals of the typesetting and layout processes and covers at least
1300 LATEX commands and about 750 packages, styles, and classes that can be used
in the typesetting of any documents. It also deals with creating presentations, table
layouts, inserting graphics, bibliography and index, and many other tasks. Specific
examples demonstrate that publishing systems using LATEX can handle projects of
any scope and complexity. A major part of the book is devoted to the typesetting of
mathematical text, which is the key differentiator of LATEX compared to other word
processors.
The book was written completely and exclusively by means of LATEX tools. As the
author of both the content and the typesetting, I will greatly appreciate any comments
and useful advice on improving the quality of the electronic version of the book.


1. LATEX,

11

2. LATEX

19

3.

27

4.

43

5.

55

6.

67

7.

77

8. LATEX

95

9.

105

10.

119

11.

147

12. -

161

13.

181

14.

203

15.

217

16.

231

17. TEX Live

243


1. LATEX,
1.1. . . . . . . . . . . . . . . . . . .
1.1.1. . . . . . . . . . .
1.1.2. . . . . . . . . .
1.1.3. TEX . . . . . . . . .
1.1.4. LATEX . . . . . . . . . . . . . .
1.2. LATEX . . . . . . . . . . . . . . . .
1.3. . . . . . . . . . . . . . . . . . . . .
1.3.1.
1.3.2. . . . . . . . . . . .
1.4. . . . . . . . . . . . . . . . . . . . . .
1.4.1. . . . . . . . . . . . . . . . . . . .
1.4.2. . . . . . . . . .
1.4.3. LATEX . . . . . . . . . . . . . . .
1.5. . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.

11
11
11
12
13
13
14
15
15
16
16
17
17
18
18

2. LATEX
2.1. . . . . . . . . . . . . . . . . . . . . . . . .
2.2. LATEX- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

19
21
22

3.
3.1. . . . . . .
3.2. . . . . . . .
3.2.1. LATEX-
3.2.2. . . . .
3.2.3. . . . . . . . . . .
3.2.4. . . . . .
3.3. . . . . . . . . .
3.3.1. . . . . .
3.3.2. . . . . . . .
3.4. . . . . . .
3.4.1. . . . .
3.4.2. . . . .
3.4.3. .

27
27
29
29
31
32
33
33
33
35
38
38
39
40

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

4.
4.1. . . . . . . . . . . . . . . .
4.2. . . . . . . . . . .
4.3. . . . . . . . . . . .
4.3.1.
4.3.2. . . . . . . . . . . . . . . .
4.3.3. . . . . .
4.3.4. . . . . . . . . . . . . . . . .
4.3.5. . . . . . . . . . . . . . . . .
4.3.6. . . . . . . .
4.3.7. . . . . . .
4.3.8. . . . . . . . . . . . . . . .
4.3.9. . . . . . . . . . . . . . . . .
4.4. . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

43
44
45
46
47
47
48
49
50
50
50
52
52
53

5.
5.1. Encapsulated PostScript . . . . . . . . . . . .
5.2. EPS . . . . . . . . . .
5.3. graphicx . . . . . . . . . . . . . . . . . . . . .
5.3.1. . . . . . .
5.4. . . . . . . . . . . . . . .
5.4.1.
5.4.2. float . .
5.4.3. . . . . . . . . .
5.4.4. . . . . . . . . . .

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

55
55
57
58
59
60
61
62
63
64

6.
6.1.
6.2. . . . . . . . . . . . . . . . .
6.3. . . . . . . . . . . . . . . .
6.3.1. . . . . . . . . . .
6.3.2. calc . . . . . . .
6.3.3.

. . . . .
. . . . .
. . . . .
. . . . .
. . . . .

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

67
67
69
71
73
73
74

7.
7.1. . . . . . . . .
7.1.1. .
7.1.2. . . . . . . .
7.2. . . . . . . . . . .
7.2.1. . . . .
7.2.2. . . . .
7.2.3. . . . . . . . . .
7.3. . . . . .

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

77
77
79
80
81
81
84
84
86

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

7.3.1. . . . . . . . . . . . . .
7.3.2. . .
7.3.3.
7.3.4. . . . . . . . . . . .
7.3.5. . . . . . . . .
7.3.6. . . .
7.3.7. . .
7.4. . . . . . .

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

86
87
87
88
88
89
89
89

8. LATEX
8.1. ? . . . . . . . . . . . . .
8.2. . . . . . . . . . . . . . . . . . . . .
8.3. . . . . . . . . . . . . . . . . . . . .
8.3.1. . . . . .
8.3.2. . . . . . . . . . . . . . . . .
8.3.3. . . . . . . . . . .
8.3.4. . . . . . . . . . . . . . . . .
8.3.5. . . . . . . . . . . . . . . . .
8.3.6. . . . . . . . . . . . . .
8.3.7.
8.3.8. . . . . . . . . . . . . .
8.3.9. . . . . . . . . . . .
8.3.10. . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

95
95
96
97
97
98
99
100
100
101
102
102
103
104

9.
9.1. slides . . . . . . . . . . . .
9.2. PDF . . . . . .
9.2.1.
9.2.2. . .
9.2.3. .
9.3. beamer . . . . . . . . . . .

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

105
106
106
107
108
108
109

10.
10.1.
10.2. . . . . . . . . . . . . . . . . .
10.2.1. . . . . . .
10.2.2. . . . . .
10.2.3. . . . . . . . . . . . . .
10.3. . . . . . . . . .
10.4. . . . . . . . . . . . .
10.4.1. . . . . . . . .
10.4.2. . . . . . . . . . . . . . .
10.4.3. . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

119
119
121
123
123
124
124
125
125
127
128

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

10.4.4. . . . . . . . . . .
10.5. . . . . . . . . . . . .
10.6. , .
10.6.1. . . . . .
10.6.2.
10.6.3.
10.6.4. . . . .
10.6.5. WWW- . . . . .
10.7. .
10.7.1. FiXme
10.7.2. lineno
10.7.3. . . . . . .
10.7.4. . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

129
131
135
135
136
138
139
139
141
141
141
142
143


. . . . . . . . . . . . . . . . .
tabbing . . . . . . . . . . . . . . . . . . . . . .
tabular array . . . . . . . . . . . . . . . . .
11.3.1. . . . . . . . . . .
11.3.2.
11.3.3. . . . . . . . . . . . . . . . . . .
11.3.4. . . . . . . . . . .
11.3.5. . . . . . . . . . . . .
11.3.6. tabular . . . . . . . . . . . . . .
11.4. . . . . . . . . . . .
11.5. . . . . . . . . . . . . . . . . . . . . . .
11.6. ? . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

147
147
148
149
152
153
153
155
156
156
157
159
160

11.
11.1.
11.2.
11.3.

12. -
12.1. . . . . . . . . . . . . . . . . .
12.2. . . . . . . . . . . . . . . . .
12.3. . . . . . . . . . . . . . . .
12.4. BibTEX . . . . . . . . . . . . .
12.5. . . . . . . . . . .
12.6. xindy . . . . . . . . . . . . . . . . . . . . .
12.7. . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

161
162
164
166
168
172
175
177

13.
13.1.
13.1.1. . .
13.1.2. .
13.1.3.
13.1.4. . . . . . .

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

181
181
181
182
183
184

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

13.1.5. . . . . . . . . . . . .
13.1.6. .
13.1.7. . . . . . . .
13.1.8. . . . . . . .
13.1.9. . . . . . . . . . . . . . .
13.1.10. . . . . . . . . . . . .
13.1.11.
13.2. . . . . . . .
13.3. , . . . .
13.4. . . . . . . . . . .
13.5. . . . . . . . .
13.6. . . . . . . . . . . . .
13.7. . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

185
186
186
187
189
190
191
191
193
195
196
200
201

14.
14.1. . . . . . . . .
14.2. LCD- . . . . . . . . . . . . .
14.3. . . . . . . . . . . . . .
14.4. . . . . .
14.5. . . . . . . . . . .
14.6. LATEX

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

203
203
207
208
210
212
214

15.
15.1. . . . . . . . . . . . . . . .
15.1.1. . . . . .
15.1.2.
15.1.3. . . .
15.1.4. . .
15.2. . . . . . . . . . . . . . . .
15.2.1. . .
15.2.2. . .
15.2.3. .
15.3. . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

217
217
218
219
222
224
225
225
225
227
229

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

16.
231
16.1. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231
16.2. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 234
16.3. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238
17. TEX Live
17.1. . . . . . . . . . .
17.1.1.
17.1.2. . . . . . .
17.1.3. . . . . . . .

. . . . . . . .

. . . . . . . .
. . . . . . . .

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

243
243
243
244
244


17.1.4. . . . . . . . . . .
17.1.5. . . . . . . .
17.1.6. . . .
17.1.7. . . . . . . . . . . . . . . .
17.1.8. . . . .
17.1.9. . . . . . . . . . . . .
17.1.10. . . . . . . . . . . . . .
17.1.11. . . . . . . . . . .
17.1.12. . . . . . . .
17.1.13. . . . . . . . . . . . . . . . .
17.1.14. . . . . .
17.1.15. . . . . . . . . .
17.1.16. WWW- . . . . . . . . . .
17.1.17. PDF . . . . . . . . . . . . . . . . .
17.1.18. . . . . . . . . . . . . . . . .
17.1.19. . .
17.1.20. . . . . . . .
17.1.21. . . . . . . . . . . .
17.2. . . . . . . . . . . . . . . . .
17.2.1. . . . . . . . . . . . . .
17.2.2. . . . . . . . . . . . .
17.2.3. . . . . . . . . . . . . . . . .
17.2.4. . . . . . . . . . . . . . . . .
17.2.5. . . . . . . . . . . . . . .
17.3. . . . . . . . . . . .
17.4. . . . . . . . .
17.4.1. , . . . . .
17.4.2. . . . . . . . . . . . .
17.4.3. . . . . . . . . . . . . . . .
17.5. . . . . . . . . .
17.5.1. . . . . . . . . . . . . . . .
17.5.2. . . . . . . . . . . . . . .
17.5.3. , . .
17.5.4. . . . . . . . . . . . . . . . .
17.5.5. . . . . . . . .
17.6. . . . . . . . . . . . .
17.6.1. . .
17.6.2. . . . .
17.6.3. .
17.6.4.
17.7. . . . . . . . . . . . . . . . . . . .
17.7.1. . . . . .
17.7.2. . . . . . . . . .

9
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

245
245
245
245
246
246
246
247
247
247
248
248
248
248
248
249
249
250
250
250
253
253
254
255
255
255
256
256
256
257
257
257
257
258
258
258
258
258
259
259
260
260
260

10

17.7.3. LaTeX . . . . . . . . . . . . . . .
17.8. . . . . . . . . . . . . . . . . . . . . . . . . . .
17.8.1. . . . . . . . . .
17.8.2. . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.8.3. . . . . . . . . . . . . . . . . . . .
17.8.4. tabular . . . . . . . . . . . . . . . . . . . . . . .
17.8.5. . . . . . . . . . . . . . . .
17.8.6. . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.8.7. . . . . . . . . . . . . . . . . . . . . .
17.9. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.9.1. . . . . . . . . . . . . . . . . . .
17.9.2. . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.9.3.
17.9.4. . . . . . . . . . . . . . . . .
17.10. LATEX . . . . . . . . . . . . . . . .
17.10.1. . . . . . . . . . . . . . . . .
17.10.2. . . . . . . . . . . .
17.10.3. . . . . . . . . . . . . . . . . . . . . . .
17.10.4. . . . . . . . . . . . . . . . . . . . . . .
17.10.5. . . . . . . . . . . . . . . . . . . .
17.10.6. . . . . . . . . . . . . . . . . .
17.10.7. . . . . . . . . . . . . . . . . . . .
17.10.8. . . . . . .
17.10.9. . . . . . . . . . . . . . . . .
17.11. - . . . . . . . . . . . .
17.11.1. . . . . . . . . . . . . . . . . . . . . . . . .
17.11.2. . . . . . . . . . . . . . . . . . . . . . . .
17.11.3. . . . . . . . . . . . . . . . . . . . . . .
17.11.4. . . . . . . . . . . . . . . . . . . . . . . . . .
17.12. LATEX . . . . . . . . . . . . . . .
17.12.1. . . . . . . . . . . . .
17.12.2. LATEX . . . . . . . . .
17.12.3. . . . . . . . . . . . . .
17.12.4. . . . . . . . . . . . . . . . . .
17.12.5. . . . . . . . . . . . . . . . . . . . .
17.12.6. . . . . . . . . . . . . . . . . . . . .
17.12.7. LATEX . . . . . . . . . . . . . . . . . . . . . . .
TEX Live . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

260
262
262
262
262
262
263
263
263
263
263
264
264
264
265
266
266
266
267
267
267
268
268
269
270
270
270
270
271
272
272
272
272
273
273
273
274
275
278
294
304

LATEX,
- ,

;
, .
.

.
, . // . LATEX
, , ,
.

1.1.
, , . , .
, - , -
.

1.1.1.
, . , . ,
, , . . .

12

1. LATEX,

1.1.2.
, .
, , , .
, ,
, .

(Donald Ervin Knuth) , . , ,


1 . 1975
,
. : ,
, . . , , . , ,
, ,
.
, .
. , . .
, , .
, 1977 . . . ,
.
, METAFONT ( ) TEX (
) ( 2.7 METAFONT 3.1 TEX).
. METAFONT TEX .
METAFONT 2.71828, TEX 3.141592. , , ,
.
TEX . ,
, . TEX TeX: The Program (ISBN: 0201134373). TEX
,
GPL.
1 http://www-cs-faculty.stanford.edu/~knuth/ .

1.1.

13

. , .
.

1.1.3. TEX
TEX . TEX
(box) (glue). , -, -,
- . , / .
, , , .
,
, .
, .
.
. . TEX, .
. , , . TEX . (x), ().
. TEX-
TEX-.

1.1.4. LATEX
, TEX . ,
TEX TEX . TEX . ,
, TEX .
, 80- XX LATEX TEX. LATEX
TEX, .
, . ,
, . LATEX, TEX

, .

14

1. LATEX,

1.2. LATEX
LATEX . LATEX ,
, ,
.
LATEX ,
CTAN The Comprehensive TeX Archive Network.
http://www.ctan.org.
CTAN . CTAN ,
TEX , . , CTAN:
ftp://ftp.dante.de/tex-archive/
ftp://ftp.tex.ac.uk/tex-archive/
ftp://ctan.tug.org/tex-archive/
CTAN , , :
ftp://ftp.chg.ru/pub/TeX/CTAN/
ftp://ftp.nsu.ru/mirrors/ftp.dante.de/tex-archive/
CTAN , -
TEX-. ,
perl-, CPAN (The Comprehensive
Perl Archive Network). R2 -,
CRAN (The Comprehensive R Archive Network), Python- PyPI (Python Package Index), - Ruby-
RubyGems Java- CJAN JSAN.
TEX-, TEX User Groups (http://www.tug.org/), TEX Live (http://www.tug.org/texlive/).
TEX Live , CD. GNU/Linux teTeX. TEX Live 1996 . 2003 TEX Live CD
DVD. - . . ,
.
TEX Live . , (http://www.gnu.org/philosophy/free-sw.html) Debian
2 R

1.3.

15

(http://www.debian.org/social_contract#guidelines).
, , FSF.
, ,
TEX Live 2007. , .
MS Windows MiKTEX (http://www.miktex.org/), Mac OS X
MacTEX (http://www.tug.org/mactex/).
Unix- TEX Live, .

1.3.
LATEX
Linux Format (http://www.linuxformat.ru). http://www.inp.nsk.su/~baldin/LaTeX/.

1.3.1.
, ,
, : babel.
, ,
, : lshort.pdf. - CTAN,
{CTAN}.
, , :
\ b e g i n { e q u a t i o n }
\ l a b e l { eq : preamble : ex 1}
\ i n t \ l i m i t s _{\ i n f t y }^{\ i n f t y }
e^{x ^2/2\ sigma ^2}dx=\ s q r t {2\ p i }\ sigma
\ end { e q u a t i o n }
, . .
, ,
, , :
\begin{equation*}
\label{eq:preamble:ex1}
\int\limits_{-\infty}^{\infty}
e^{-x^2/2\sigma^2}dx=\sqrt{2\pi}\sigma
\end{equation*}

/2 2

16

1. LATEX,

1.3.2.
,
LATEX. , , , , .
, , ,
( ) TEX Live 243. ,
, X.
, , :
,
.
 ,
TEX Live.

LATEX, , . .

, .
 ,
.

1.4.
LATEX .
. , TEX,
. , LATEX
.
LATEX . ,
, , .
LATEX , .
 .
, . -, LATEX . CTAN (http://www.ctan.org) TUG (http://www.tug.org).

1.4.

17

1.4.1.
. . TEX [1] TEX.
LATEX , , . TEX ,
, . LATEX. .
.
. . METAFONT [2] , TEX, METAFONT. MetaPost, .
. . [3] . . , TEX METAFONT.
, TEX , .
,
.

1.4.2.
. LATEX [4] .
, .
.
. , . . LATEX
LATEX 2 [5] LATEX. LATEX . .
, .
. , . . LATEX [6] LATEX,
MetaPost PostScript. , TEX
.
. : , PostScript MetaPost. - ,
.
. , . LATEX Web- [7] LATEX WWW.
LATEX. , , . , PDF
. XML .
LATEX 2 . LATEX 2 94 1999 .
: http://xtalk.msk.su/tex/.

18

1. LATEX,

. . : .
.

1.4.3. LATEX
. . LATEX 3- [8]
. . . , ,
. , , ,
: http://www.mccme.ru/free-books/.
. . , . . LATEX - 3- [9]
. , ,
, . , .
: http://www.tutor.nsu.ru/books/tex/.
. . LATEX [10] .
.

1.5.
LATEX CyrTeX-ru.
: https://info.vsu.ru/Lists/CyrTeX-ru/.
CyrTeX-ru-feed@vsu.ru Subscribe me! (
). .
, , , ,
( , ).

LATEX
-
.
.

, LATEX . , . .
.
: , !!! 1 helloworld.tex, :
%
\ documentclass { a r t i c l e }
% ,
%
\ u s e p a c k a g e [ warn ] { mathtext }
% TEX
\ u s e p a c k a g e [ T2A] { f o n t e n c }
%
% cp 1251 u t f 8
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
%
\ usepackage [ english , r u s s i a n ] { babel }
1 , emacs
,.

20

2. LATEX

%
\ usepackage { i n d e n t f i r s t }
%
\ b e g i n { document }
\LARGE , ! ! !
\ end { document }
, %, . ,
\begin{document}, . .
.
tex-. :
> l at ex helloworld . tex
This i s pdfeTeXk , V e r s i o n 3 . 1 4 1 5 9 2 1 . 3 0 . 3 2 . 2 (Web2C 7 . 5 . 5 )
%&l i n e p a r s i n g e n a b l e d .
e n t e r i n g extended mode
( . / helloworld . tex
LaTeX2e <2003/12/01>
...
( . / h e l l o w o r l d . aux ) [ 1 ] ( . / h e l l o w o r l d . aux ) )
Output w r i t t e n on h e l l o w o r l d . d v i ( 1 page , 240 b y t e s ) .
T r a n s c r i p t w r i t t e n on h e l l o w o r l d . l o g .
>
LATEX helloworld.dvi. :
xdvi2 dviout3 :
> xdvi h e l l o w o r l d . dvi
dvi- PostScript4 gv (
Unix) ghostview ( Windows),
PostScript- ( , ), :
> dvips helloworld . dvi
> gv h e l l o w o r l d . ps
> l p r h e l l o w o r l d . ps
2 xdvi Unix- .
.
3 dviout T X Live dvi MS Windows.
E
4 PostScript ,
Adobe Systems. PostScript (ghostscript)
.

2.1.

21

PDF5 , , xpdf , kpdf


Adobe Reader:
> dvips helloworld . dvi
> p s 2 p d f h e l l o w o r l d . ps h e l l o w o r l d . pdf
> kpdf h e l l o w o r l d . pdf
:

, !!!
. 2.1. , !!! LATEX
, LATEX-, , , , , ///.

2.1.
, , LATEX .
latex ,
:
> latex
This i s pdfeTeXk , V e r s i o n 3 . 1 4 1 5 9 2 1 . 3 0 . 3 2 . 2 (Web2C 7 . 5 . 5 )
%&l i n e p a r s i n g e n a b l e d .

LATEX , .
^C (Ctrl+C).
latex,
, LATEX ,
, :
! Undefined c o n t r o l s e q u e n c e .
l . 11 \ e r r o r i n b o d y
?
5 PDF Portable Document Format. , PostScript, Adobe
Systems. .

22

2. LATEX

(?) h, ,
.
? h
The c o n t r o l s e q u e n c e a t t h e end o f t h e top l i n e o f
your e r r o r message was n e v e r \ def ed . I f you have
m i s s p e l l e d i t ( e . g . , \ hobx ) , type I and t h e
c o r r e c t s p e l l i n g ( e . g . , I \hbox ) . O t h e r w i s e j u s t
c o n t i n u e , and I l l f o r g e t about whatever was u n d e f i n e d .
? x
, x
. .
, (?).
 : . .
LATEX , . ,
LATEX, .

2.2. LATEX-
LATEX .
, .
LATEX-.
tex. , , dvi. Dvi device independent
( ) , ,
. , dvi- ,
dvi-.
xdvi dvi- . . , . dvi- dvips.
dvips PostScript, ( PostScript ),
Ghostscript. dvi-

2.2. LATEX-

23

.eps

.bbl
.ind
.aux
.idx
.toc
.lof
.lot

.tex

(.fmt)

LATEX

(.cls, .sty)
(.tfm)
(.fd)

.dvi
dvips
.ps

Log- (.log)
.pk(.mf), .pfb
ps2pdf

.pdf

. 2.2. LATEX-
, , dvi2tty dvi , dvilj dvi PCL HP, dvipdf dvi pdf.
dvi- / dvi- .
Ghostscript (gs) PostScript- (ps) . PDF
PostScript ps2pdf .
LATEX, , eps-. EPS, Encapsulated PostScript, ,
PostScript . , eps-
(BoundingBox). eps, , !!!:
%! PSAdobe2 . 0 EPSF2 . 0
%%C r e a t o r : d v i p s ( k ) 5 . 95b Copyright 2005 R a d i c a l Eye S o f t w a r e
%%T i t l e : h e l l o w o r l d . d v i
%%BoundingBox : 148 651 288 668

24

2. LATEX

%%DocumentFonts : SFRM1728
, :
I. .
fmt . , , LATEX
. .
TEX :
> texconfig init
cls, sty . (cls) \documentclass.
(sty), \usepackage.
tfm .
.
, LATEX.
pfb Type1-.

fd

pk (mf) pk- mf- (METAFONT) .


II. , LATEX-.
latex.
,
,
.
log . , .
.
aux .
toc (table of contents).
lof (list of figures).
lot (list of tables).
bbl , BibTEX.
TEX, .

2.2. LATEX-

25

ind , MakeIndex
xindy.
. idx-. .
LATEX-. latex
pdflatex, pdf-,
png6 pdf.
, .

6 PNG (Portable Network Graphics) , .


,
!
.

, . .

3.1.
LATEX .
, , , . , , ,
. .
. . LATEX .
: \, $, %, _, {, }, &, #, .
. :
: <<\t e x t b a c k s l a s h >>, <<\$>>, <<\%>>, <<\_>>1 , <<\{>>,
<<\}>>, <<\&>>, <<\#>>, <<\^{}>> <<\~{}>>.
. :
1 underscore _ .

28

3.

.
: { }. .
, , .
. LATEX \ (backslash
) , 2 . , . .
, :
\command{}. , LATEX ( \LaTeX) , \LaTeX{}.
. LATEX :
\command [ param 1 ] [ param 2 ] { param 3}{ param 4}
(param1 param2),
(param3 param4).
LATEX . , \textbf{} .
 LATEX ,
. : \chapter,
\section, \subsection .
LATEX
.
. -
, \protect.
. LATEX .

, , .
:
%
\bfseries
%
\ t h i s p a g e s t y l e {empty}
2 . , , , .

3.2.

29

. , \begin{} \end{}, .
:
\ begin { center }

\ end { c e n t e r }
, ,
.

3.2.
. , .

3.2.1. LATEX-
tex- : , ,
. :
%
% , , a r t i c l e book
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , o n e s i d e ] { s c r a r t c l }
%
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
%
\ usepackage [ english , r u s s i a n ] { babel }
\ usepackage { i n d e n t f i r s t }
\ usepackage { misccorr }
%
\ u s e p a c k a g e {. . . }
...
%
\newcommand{\mycommand}{. . . }
\renewcommand{\ oldcommand }{. . . }
...
%
...
%
\ b e g i n { document }
%
\ end { document }

30

3.

\documentclass
. \usepackage
.
,
inputenc , , koi8-r3 , cp8664 ,
cp12515 utf86 (Unicode).
babel, ,
. , (\No),
(\S) .
,
, indentfirst. ,
, babel . misccorr
babel.
. , , LATEX, .
TEX Live , .
language.dat
(fmt-).
, , MiKTeX
MiKTeX Options7 , GNU/Linux texconfig8 . HYPHENATION, latex. 9 language.dat. :
3 koi8-r 8- UNIX- . RFC 1489.
4 cp866 8- , DOS OS/2.
5 cp1251 Windows-1251 8-
Microsoft Windows.
6 UTF-8 (Unicode Transformation Format) ,

.
7 Languages.
General Update Now .
8 texconfig dialog- . .
texconfig .
, , :
texconfig init.
9 $EDITOR.
, vi. vi, :q
vi.

3.2.

31

e n g l i s h hyphen . t e x
r u s s i a n ruhyphen . t e x
. babel. , ,
. , -
:
r u s e n g ruenhyph . t e x
=r u s s i a n
=e n g l i s h
, LATEX
.
.

3.2.2.
\documentclass[]{} , .
, . , ,
article. .
report, book.
, .
, - .
. , revtex4. eskdx ( ),
CTAN TEX Live. , LATEX-, KOMA-Script: scrartcl, scrreprt scrbook article, report
book .
. ,
, . ,
( )
, .
.

32

3.

, , :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , o n e s i d e ] { s c r b o o k }
a4paper ( ,
, a5paper), 12pt ( 10pt 11pt), oneside (
).
, . . . ncc
. CTAN,
TEX Live.

3.2.3.
(sty) , - .
\usepackage[]{}.
,
. LATEX . TEX Live
sty-. , ,
. .
. LATEX, . lh,
Computer Modern. , , . 2001
METAFONT- Type1.
,
pdf- .
LATEX inputenc. .
: koi8-r, cp866, cp1251 utf8.
, . , - , , LATEX
T2A-10 .
t2filter. .
10 cp1251,
.

3.3.

33

:
> locate t 2 f i l t e r . c
{TEXMF}/ texmfd i s t / doc / g e n e r i c / t 2 / e t c / t 2 f i l t e r . c
> cd {TEXMF}/ texmfd i s t / doc / g e n e r i c / t 2 / e t c /
> g c c Wall O2 s o ~/ b i n / t 2 f i l t e r t 2 f i l t e r . c
> l a t e x { } . t e x | t 2 f i l t e r

3.2.4.
, document, .
- , ,
, \end{document}.

3.3.
.
.

3.3.1.
// , .
.
. , % , .
,
.
comment verbatim.
. LATEX
. .
.
:
%

.
.

34

3.

. ,
:

\ par
. \par:
\ par

. . ,
\emph, :
\emph{!:} \textbf{ },
\textit{}, \textsc{},
\textsl{ } .

!: ,
, ,
.

:
\bfseries , \itshape , \scshape \slshape
.
, , :
\textbf{\textit{ }}\par
\textbf{\textmd{\textit{ }}}

\textmd , , , \textbf.
\emph :
{\itshape

\emph{}}

.
.
\normalsize. 3.1
.
 Roman. (Sans
Serif) c \textsf (Typewriter) \texttt.

3.3.

\tiny
\scriptsize
\footnotesize
\small
\normalsize
\large
\Large
\LARGE
\huge
\Huge

35

3.1.
. enumerate, itemize. .
:
\begin{enumerate}
\item :
\begin{inparaenum}
\item , \item , \item .
\end{inparaenum}
\item . \par

:
\begin{itemize}
\item ,
\item .
\end{itemize}
\end{enumerate}

:
1) : ) , ) ,
) .
2) .

:
,
.

\item,
.
inparaenum
inparaitem paralist ( . 131).

3.3.2.
. . , , , ,.

36

3.

, , , , , , , .
, LATEX , .
. LATEX
. :

\,

,
;
;

\ .
,
"=
, ,
: .\,.~ "-- <<>> \@.
: .\,. ( ..),
.~, .~1 ~.\,.\
~.\,.

, - , ,
: . .
. :
. . ( ..), . , . 1
. . . .

LATEX , ,
.
.
, \
~. ,
( ).
\@.
, , \/
: {\LARGE {\itshape }}
{\LARGE {\itshape }\/}.

, . ,
,
.
, . , TEX, - (hyphen), (en-dash), (emdash) .

3.3.

37

, ,
, - .
babel russian
, .
( , ) ,

(1015, 2001 2006) ,
( \LaTeX{} " ) ,
( $ ab=c $ ) .
\ t e x t b f { b a b e l }
. /
"~, ,
"~ , "~ .


", . \ , .
. ":
" .
, ,
.
. , LATEX . , , .
,
, .
\,
: \\ , \TeX\\ .
\ t e x t b f { b a b e l }
"=, ,
"= .
.
\hyphenation{ =}. , . , ,
.

38

3.

\hyphenation , .
\mbox{ }.
. \ldots. , ~ (
).
. 1.5
2 . ,
.
\ t e x t b f { } \ t e x t b f { }
,
" \ t e x t b f { } : \ t e x t b f { \ } , \ t e x t b f { \ } "
\ t e x t b f { } \ , \ t e x t b f { } \
: \ t e x t b f { } \ , \ t e x t b f { } \ .
. babel, , , : ( )
( ):

,
.
: << , , Linux Format > >.

3.4.
LATEX . , , , 20 , ,
, .

3.4.1.
, . titlepage. , ,

3.4.

39

.
. , :
\ t i t l e {\LaTeX , Unix }
\ a u t h o r { . \ ,. ~ \ thanks { em a i l : E .M. Baldin@inp . nsk . su }}
\ d a t e {2002}
\ maketitle
% a r t i c l e
\ begin { abstract }
\LaTeX , Unix .
\ end { a b s t r a c t }
\maketitle , (\title), (\author)
(\date). \thanks . ,
, \and
.
( article) , abstract.
( book) titlepage,
. , ,
.

3.4.2.
\tableofcontents,
. .
, . , , , , .
:
\ s u b s e c t i o n { }
\ l a b e l { sec : base : sec }
. . .
.
\part{} \chapter{}.

40

3.


, article (scrartcl) report,
book (scrbook).
:
\ s e c t i o n { }
\ label { section }
\ s u b s e c t i o n { }
\ label { subsection }
\ s u b s u b s e c t i o n [ ] { - , }
\ label { subsubsection }
\ paragraph {}
\ l a b e l { paragraph }
\ subparagraph {}
\ l a b e l { subparagraph }
,
.
. , ,
,
*, , \section*{}.

3.4.3.
, LATEX TEX TEX,
.
, \label{}.
, . (:) (-).

\label{sec:base: ref }. :
<< >>
~\ref{sec:base:ref}
~\pageref{sec:base:ref}.

3.4.3 40.

3.4.

41

, ( \ref) ( \pageref) LATEX . .


, , , . \label
.
\caption, \item.



. . .
.

TEX , LATEX
. TEX , LATEX ,
.
.
, . . .
.

.
LATEX , TEX-.
(
: http://ru.wikipedia.org ).
TEX (The American
Mathematical Society AMS), TEX,
-TEX. 1987 -TEX
LATEX amsmath.
amsmath LATEX , .
amsmath.

44

4.

, :
\ u s e p a c k a g e {amsmath}
,
, , .
.

4.1.
.
.
LATEX , . , ,
= 2 .
.
1 $$
- \(\). , ,
, . ($) , - , $ 2
-.
, ,
equation. , . :
\begin{equation}
\label{eq:math:ex1}
\int\limits_{-\infty}^{\infty}
e^{-x^2/2}dx=\sqrt{2\pi}
\end{equation}

/2

(4.1)

, \eqref{eq:math:1}3 .
1 : \begin{math}
\end{math}. .
2 L
AT X, E
/.
. ,
, \protect.
, ,
.
3 \label.

4.2.

45

, equation*4 .
.
amsmath fleqn,
\mathindent. nccmath \fleqn[], fleqn. nccmath \ceqn.
. LATEX
. :
\displaystyle
, ,
\textstyle
,
\scriptstyle
,
\scriptscriptstyle .

.
:
\begin{equation*}
\frac{1}{1+
\frac{1}{1+
\frac{1}{1+
\frac{1}{2}}}}
\end{equation*}
\begin{equation*}
\frac{1}{\displaystyle 1+
\frac{1}{\displaystyle 1+
\frac{1}{\displaystyle 1+
\frac{\displaystyle 1}
{\displaystyle 2}}}}
\end{equation*}

1
1+

1+

1
1+ 1
2

1
1

1+
1+

1
1+

1
2

,
. LATEX, , , .

4.2.
, , . ,
.
4 equation . . (*)
.

46

4.

mathtext ( t2)
. warn,
.
mathtext babel / fontenc:
\ u s e p a c k a g e [ warn ] { mathtext }

\[
v_{}=\frac{S_{}-S_{}}
{\delta t}
\]

\[\] equation*.
. ,
:
\ DelareSmbolFont {T2 A l e t t e r s }{T2A}{cmr}{m}{ i t }
amstext, amsmath, \text, .
:
\[v_{}=
\frac{\text{ }\text{ }}
{\text{ }}\]

, \text . \text .

4.3.
, . ,
, - . .

4.3.

47

4.3.1.
. , ,
. , (,
123, 456, 789) . ,
:

\(3.14159\)\par
\(3,14159\)

3.14159
3, 14159

. , . ,
, , :

\(3.14159\)\par
\(3{,}14159\)

3.14159
3,14159

ncccomma nctools. ,
, , . ,
, = 1, 2, . . . ,
.

4.3.2.
, .
:
\[A_{\text{ }}\quad
B^{\text{ }}\quad
C_n^k\]

, ,
.
: \(a^2+b^2=c^2\), 2 + 2 = 2 .

48

4.

4.3.3.

. . amsfonts, :
\begin{itemize}
\item\(ABCD\) "--- ,
\item\(\mathbf{ABCD}\) "--- ,
\item\(\mathbb{ABCD}\) "--- ,
\item\(\mathcal{ABCD}\) "--- ,
\item\(\mathfrak{ABCD}\) "--- ,
\item\(\mathscr{ABCD}\) "--- mathrsfs.
\end{itemize}

ABCD ,
ABCD ,
ABCD ,

ABCD ,

ABCD ,

A BC D mathrsfs.

, .
( \mathfrak).

. , ,
:

\alpha
\zeta
\lambda
\pi
\phi
\Delta
\Sigma


\beta
\gamma

\eta
\theta

\mu
\nu

\rho
\sigma

\chi
\psi

\Theta
\Lambda
\Upsilon \Phi

\delta
\iota
\xi
\tau
\omega
\Xi
\Psi

\epsilon
\kappa
o
\upsilon
\Gamma
\Pi
\Omega

LATEX ,
.
amssymb:
% \kappa, \epsilon \phi
\renewcommand{\ kappa }{\ varkappa }
\renewcommand{\ e p s i l o n }{\ v a r e p s i l o n }
\renewcommand{\ p h i }{\ v a r p h i }

LATEX . TEX Live
LATEX (The Comprehensive LaTeX Sym-

4.3.

49

bols List symbols-a4.pdf), 3300 , LATEX. , , .


, .
amssymb .

6
=

\hat{a}
\ tilde {a}
\cdot
\neg
\le
\neq
\approx
\angle
\ell

>


\bar{a}
\vec{a}
\pm
\mp
\div
\lor
\forall
\exists
\ge
\ll
\equiv
\sim
\propto
\parallel
\triangle
^ \sphericalangle
\sum
\prod

\dot{a}
\times
\land
\in
\gg
\simeq
\perp
\infty
\varnothing

(6 >)
:
% \le \ge
\renewcommand{\ l e }{\ l e q s l a n t }
\renewcommand{\ ge }{\ g e q s l a n t }

4.3.4.
:
\ s q r t [ ] { }
. .
\[
\overline{
\underline{\Large
\sqrt[3]{a}+\sqrt[2]{b}+\sqrt[99]{g}
}
}
\]

99

, .
, , ,
, .

50

4.

\mathstrut5 . ,
:
\[\Large
\sqrt[3]{\mathstrut a}+
\sqrt[2]{\mathstrut b}+
\sqrt[99]{\mathstrut g}
\]

3
2
99
+ +

4.3.5.
\frac6 :
\[
=\frac{}{}
\]

LATEX, ,
.

4.3.6.
, 2 + + = 0:

\[
x_{1,2}=\frac{-b\pm\sqrt{b^2-4ac}}{2a}
\]

1,2 =

2 4
2


,.

4.3.7.
- . , ,
, . , , .
5
6

strut .
fraction .

4.3.

51

= .
.
. \frac{d F(x)}{dx}. \partial:

\[ f\quad f\quad f \quad f^{n} \]


\[\dot{x}\quad \ddot{x}\quad \ddot{x}\]
\[\frac{d f}{d x}\quad
\frac{d^n f}{d x^n}\quad
\frac{\partial^2 f}{\partial x\partial y}\]

. \int:

\[
\frac{d}{dx}\int F(x) dx=F(x)
\]

() = ()

, ,
,
. , , wasysym
integrals. , .
,
.
,
. :
\[
\int_0^{\infty}\quad
\int\limits_0^{\infty}\quad
\sum_{i=1}^n\quad
\sum\nolimits_{i=1}^n\quad
\]

=1

=1

.
\limits. ,
\sum .
\nolimits.

52

4.

4.3.8.
,
.
, . babel
, .
: \cos, \arccos, \sin, \arcsin, \tg, \arctg, \ctg, \arcctg, \sh, \ch, \th, \cth,
\exp, \ln, \log, \lim, \min \max.
.
\begin{equation*}
\begin{split}
&\log_2 10=\ln10/\ln2\simeq3.32 \\
&\lim_{x\to0}\frac{\sin x}{x}=1\\
&(a+b)^n=\sum_{k=1}^n C^k_n a^kb^{n-k}
\end{split}
\end{equation*}

log2 10 = ln 10/ ln 2 3.32


sin
lim
=1
0

( + ) =

=1

, \log () \lim
() . \DeclareMathOperator:
%
\ DeclareMathOperator {\ l o g l i k e }{ l o g l i k e }
\ DeclareMathOperator {\ liml i k e }{ liml i k e }

( ) ( ).

4.3.9.
. .
, , :
\[ ( \big( \Big( \bigg( \Bigg( \]

((
((

l ( \left),
r ( \right) m:

4.4.

53

\[ \Biggl|\int\Biggl| \Biggm|\int\Biggm|
\Biggr|\int\Biggr|\]

, , . \left \right
.
\[\left(
\left[
\left\langle
\left\{
\left\uparrow
\left\lceil
\left|
\left\lfloor
\text{-}^{10}
\right\rfloor^9
\right|^8
\right\rceil^7
\right\downarrow^6
\right\}^5
\right\rangle^4
\right]^3
\right)^2\]

} 4 3 2
{
8 7 6 5


10

4.4.
,
, , . :
a + b =
= c
. 7 ,
:
%
\newcommand{\hm} [ 1 ] { # 1 \ nobreak \ d i s c r e t i o n a r y {}%
{\ hbox {$\ mathsurround=0pt #1$}}{}}
\hm, , : \(a + b \hm{=} c\).
7

fido7.ru.tex.

54

4.

.
.
(=, >, <, 6, >, =, ); ,
; . - ,
.

. , 13.

, TEX .
, . . . .
TEX ,
- .
. .
LATEX Encapsulated PostScript.

5.1. Encapsulated PostScript


,
Adobe Systems Apple
PostScript. , . PostScript
.
PostScript. , PostScript .
Encapsulated PostScript EPS .
, , eps.

56

5.

PostScript, . LATEX ,
:
%! PSAdobe2 . 0 EPSF2 . 0
%%C r e a t o r : d v i p s ( k ) 5 . 95b Copyright 2005 R a d i c a l Eye S o f t w a r e
%%T i t l e : p i c t u r e . d v i
%%BoundingBox : 127 464 430 667
%%DocumentFonts : SFRM1200 SFRM0800
%%EndComments
PostScript1 . BoundingBox . , .
(bp=1/72 in), 0.351 . .
PostScript- EPS,
, , BoundingBox.
ps2eps . , Ghostscript PostScript:
> g s q dSAFER dNOPAUSE dBATCH sDEVICE=bbox

bbox.
-q, -dNOPAUSE -dBATCH
. -dSAFER , Ghostscript
2 .
EPS- . , PostScript, -
.
- PostScript,
.
, / epstool .
1 . PostScript-
.
.
2 , ,
read-only. , Ghostscript
.

5.2. EPS

57

EPS pstoedit , , . ,
- PostScript- .
, .

5.2. EPS
LATEX
EPS. . -, ,
, .
, convert ImageMagick,
.
: latexdvipsps2pdf pdflatex, PNG3 JPEG4 ,
PDF5 . , . ,
. pdflatex .
JPEG jpeg2ps, CTAN-
{CTAN}/nonfree/support/jpeg2ps. JPEG-,
eps-. JPEG PostSript-. , PostScript Level 2. ,
,
.
sam2p
bmeps. CTAN graphics/sam2p
support/bmeps . sam2p , ,
bmeps PNG JPEG. eps- .
.
bmeps ,
eps-, sam2p .
3 Portable Network Graphics ,
.
4 Joint Picture Experts Group , .
5 Portable Document Format ,
Adobe System.

58

5.

CTAN {CTAN}graphics/a2ping
perl- a2ping.pl. sam2p Ghostscript, - PostScript .

5.3. graphicx

graphicx6 , \includegraphics:
% TeX METAFONT,
% , ...

LATEX

% Neal Tucker
\includegraphics[width=\textwidth]{title.eps}

\textwidth . \includegraphics . =, .
keyval. .
bb
BoundingBox LATEX-, eps. ,
, : [bb=127 464 430 667]. bb ,
: [bbllx=127,bblly=464,bbrx=430,bbry=667].
BoundingBox
viewport - BoundingBox, , trim -
, , .
clip BoundingBox. , .
false. clip true.
.
angle .
6 graphicx graphics .
, .

5.3. graphicx

59

origin , .
origin : l, b, r t , ,
. . , : lt, rt, rb lb. c
.
width .
height .
scale .
keepaspectratio .
A
.

L TEX

LATEX

\includegraphics[trim=110 0 105 100,clip,


width=0.49\textwidth]{title.eps}
\hspace{0.5cm}
\includegraphics[viewport=0 0 100 200,clip,
width=0.49\textwidth,
height=3cm,keepaspectratio,
angle=180,origin=c]{title.eps}

 \includegraphics .
.

5.3.1.
graphicx
. , png-:
\ D e c l a r e G r a p h i c s R u l e { . png }{ e p s } { . bb } { bmeps p3 c #1}
, . png-.
, LATEX.
, eps
Encapsulated PostScript, , dvips . ,
BoundingBox, bb
:
%%BoundingBox : 0 0 848 979

60

5.

png- , , :
> bmeps b . png . bb

, .
. #1 . dvi-.
 ,
. , dvi xdvi -allowshell.
,
. PostScript dvips
-R0. - eps-.
eps :
\ D e c l a r e G r a p h i c s R u l e {}{ e p s }{}{}
MetaPost,
. , ,
BoundingBox , .

5.4.
.
. \includegraphics , .
, LATEX :
(float7 ). , .
figure:
\ b e g i n { f i g u r e } [ ht ]
\ c e n t e r i n g %
\ i n c l u d e g r a p h i c s {}
\ c a p t i o n {}\ l a b e l { f i g : metka }
\ end { f i g u r e }
7 , ,
float. floatraw,
.

5.4.

61

figure :
h ,
t ,
b ,
p , .
figure . h, t b, LATEX
.
LATEX , . , , ,
: [b!].

5.4.1.
, . ,
.
clearpage
LATEX , . -
- . \clearpage.
, , .
, . , afterpage,
:
\ a f t e r p a g e {\ c l e a r p a g e }
\afterpage .
suppressfloats
\suppressfloats . t b
.

62

5.

placeins
placeins . \FloatBarrier.
, , .
. (section) [section]
:
\ usepackage [ s e c t i o n ] { p l a c e i n s }
endfloat
, . endfloat
. .

5.4.2. float
. , , \parbox minipage:
\ parbox [ ] { }{}
\ b e g i n { minipage } [ ] { }

\ end { minipage }
,
. ( [c] ),
([t]) ([b]).
:
\ b e g i n { f i g u r e } [ ht ] \ c e n t e r i n g
\ parbox [ b ] { 0 . 4 9 \ t e x t w i d t h }{\ c e n t e r i n g
\ i n c l u d e g r a p h i c s {-1}
\ c a p t i o n {-1}\ l a b e l { f i g : metka 1}}
\ h f i l \ h f i l%
\ b e g i n { minipage } [ b ] { 0 . 4 9 \ t e x t w i d t h }
\ centering
\ i n c l u d e g r a p h i c s {-2}

5.4.

63

\ c a p t i o n {-2}\ l a b e l { f i g : metka2}
\ end { minipage }
\ end { f i g u r e }
\parbox minipage .
.
.
subfig . .
miniplot , subfig, .
figsize
.
dpfloat ,
. .

5.4.3.





,
LATEX



.


,


,




.
. 1.


-



floatflt wrapfig. , floatflt . 5.1. .
,
. . floatingfigure
wrapfigure .

\ b e g i n { f l o a t i n g f i g u r e } [ ] { }
...
\ end { f l o a t i n g f i g u r e }
floatingfigure
:
rflt ,
lflt ,
vflt ( ).

64

5.

wrapfigure :
\ b e g i n { w r a p f i g u r e } [ ]
{}{}
...
\ end { w r a p f i g u r e }
floatingfigure wrapfigure
. :
r ,
l ,
i ,
o .
,
, ,
.

, . . ,
, , .

nccfloats ncctools, . . :
\ s i d e f i g ( ) ( )
{\ i n c l u d e g r a p h i c s {}}{}
\sidefig ,
. .
. nccfloats.pdf.

5.4.4.
\caption,
.
. ,
. .
.
\protect. \caption
,
,
.
,
\caption . caption ccaption.
caption.pdf ccaption.pdf .

5.4.

65

\usepackage[russian]{babel}
., .
. , , :
\ usepackage { ccaption }
% : .
\ c a p t i o n d e l i m { . } % !
,
, , .
. mcaption margincap:
\ b e g i n { f i g u r e } [ ht ]
\ b e g i n { margincap }{}
\ i n c l u d e g r a p h i c s {}
\ end { margincap }
\ end { f i g u r e }
,
. mcaption.pdf.


- ,
. ,
. ,
. 100% .

LATEX , , . .
.

6.1.

LATEX .
, . 58
\textwidth , , .
\newlength. . ,
- \setlength:
\newlength{\MyLength}
\setlength{\MyLength}{1cm plus 2.5fill minus 5mm}
\addtolength{\MyLength}{5em}
\lstinline!\MyLength! \the\MyLength.

\MyLength
74.69145pt plus 2.5fill minus
14.22636pt.

68

6.

LATEX -
. plus, minus. TEX
.
\setlength . \addtolength ,
. \the .
LATEX - .
, . ,
(in) 2.54 72.27 (1 pt 0.35 mm).
(cm) (mm). LATEX (bp), (dd), (pc) (cc) , .
LATEX (sp),
1/65536 .
: 1ex x, 1em
M. , ,
. , ,
\quad, \hspace{1em}.
\setlength{\MyLength}{1ex}
x \the\MyLength\par
\Large \setlength{\MyLength}{1ex}
x \the\MyLength

x 3.87405pt

x 6.19771pt

fill . TEX , : fil, fill filll, fil fill filll.


.
,
\settowidth:
\settowidth{\MyLength}{ }
\addtolength{\MyLength}{1em}
\centering
\framebox[1.2\MyLength]{ }\par
\framebox[1.2\MyLength]{ }

6.2.

69

\settoheight , \settodepth .
.
FAQ LATEX:
\ makeatletter1
\newcommand{\ maxwidth }{%
\ i f d i m \Gin@nat@width>\ l i n e w i d t h
\ linewidth
\ else
\Gin@nat@width
\fi
}
\ makeatother
\maxwidth ,
:
\ i n c l u d e g r a p h i c s [ width=\maxwidth ] { }
:
( BoundingBox) .
,
, ,
.

6.2.
, , , (counter). LATEX
:
\newcounter{MyCount}
\setcounter{MyCount}{5}
MyCount \arabic{MyCount},
~\alph{MyCount}, \Asbuk{MyCount}.\par
\addtocounter{MyCount}{1550}
\arabic{MyCount} \Roman{MyCount}.

MyCount 5,
e, .
1555 MDLV.

\newcounter . , ,
1 \makeatletter/\makeatother
LATEX-. @
, .

70

6.

. \setnewcounter, -
\addtocounter.
, - , -
. .
, \arabic{}.
\Roman \roman
. : \alph , \asbuk \Asbuk
.
,
( page), ( part, chapter,
section, subsection, subsubsection . .), (footnote),
( figure table) (equation).

\the . .
, , , , \the-,
, ,
:
\renewcommand{\ t h e p a g e }{\Roman{ page }}
,
:
\newcounter{Main}\addtocounter{Main}{10}
\newcounter{Dep}[Main]\addtocounter{Dep}{10}
: \theMain.\theDep\par
\stepcounter{Main}
: \theMain.\theDep

: 10.10
: 11.0

, . Dep Main. ,
(Main) \stepcounter, (Dep) .
(section).
chngcntr ltxmisc
. \counterwithin{Dep}{Main} Dep Main. \counterwithout{Dep}{Main}.
chngcntr.sty.

6.3. . . .

71

\refstepcounter{} \stepcounter ,
, \refstepcounter , \ref, , \the-:
% " "
\ newcounter { Problem } [ s e c t i o n ]
\renewcommand{\ theProblem }{\ t h e s e c t i o n . \ a r a b i c { Problem }}
\ newenvironment { Problem } [ 0 ] {%
\ par \ r e f s t e p c o u n t e r { Problem }%
\ theProblem \ , }%
{\ par }%
Problem . Problem
. \theProblem , .
Problem \refstepcounter{}.
:
\begin{Problem}\label{ex:1}

\end{Problem}
\begin{Problem}\label{ex:2}

\end{Problem}
~\ref{ex:1} ~\ref{ex:2}.

6.2.1
6.2.2
6.2.1 6.2.2.

6.3. . . .
. . . , . , ,
.

:
\newcommand{\ e e }{\ ensuremath { e^{+}e ^{}}\xspace}
,
. \ensuremath
:
\(J/\psi\to\ee\)
\ee{}"=.

/ + + -.

\xspace xspace
, ,
.

72

6.

,
:
\newcommand{ } [ N ] [ . . ] { }
\renewcommand{ } [ N ] [ . . ] { }
\ providecommand { } [ N ] [ . . ] { }
\newcommand . ,
. \renewcommand
. \providecommand
, , ,
.
. /,
(1) (9). 4.4
(\(a + b \hm{=} c\)):
\newcommand{\hm} [ 1 ] { # 1 \ nobreak \ d i s c r e t i o n a r y {}%
{\ hbox {$\ mathsurround=0pt #1$}}{}}
(#) .
, , #1.
(*) \newcommand \hm :
\par. .
:
\newcommand{\exmpl}[1][]%
{<< #1>>}
\exmpl{} \exmpl[].

\newenvironment:
\newenvironment{outlined}%
{\hrule\smallskip\begin{center}}%
{\end{center}\smallskip\hrule}
\begin{outlined}
.
\end{outlined}

\newcommand:
\ newenvironment { } [ N ] [ . . ]%
{, }%
{, }

6.3. . . .
width

reference

73

, .
q

height
depth

width = 288.7318pt

height = 17.27356pt

depth = 4.83911pt

. 6.1. (width), (height) (depth)


, \newcommand, . ,
, . \renewenvironment.

6.3.1.
LATEX TEX, -, , TeX [1] .
,
. , LATEX ,
LATEX--.

6.3.2. calc
calc tools
. calc
:
\theMyCount.\par
\setcounter{MyCount}{\value{MyCount}-1000}
\theMyCount.

1555.
555.

calc \setcounter, \addtocounter, \setlength \addtolength ,


.
\setlength{\MyLength}{
(1em+\widthof{ })*\real{1.2}}
\centering
\framebox[\MyLength]{ }\par
\framebox[\MyLength]{ }

calc \widthof{},
\heightof{} \depthof{} , , .

74

6.

calc, ,
(4mm*2 , 2*4mm ). . \real
, :
\ r a t i o {}{}
calc.pdf.

6.3.3.
xifthen, ifthen. -:
\newcommand{\RusCnt}[1]{%
\ifthenelse{\equal{#1}{1}}{}{}%
\ifthenelse{\equal{#1}{2}}{}{}%
\ifthenelse{\equal{#1}{3}}{}{}%
\ifthenelse{\cnttest{#1}>{3}}{}{}}
\RusCnt{1}, \RusCnt{2}, \RusCnt{3} \RusCnt{4}.

, , .

\ifthenelse ,
, ,
.
1, 2 3
\equal .
, \ifthenelse \cnttest{}{}. calc.
.
, ifthen.
(\value{} )
=, > <.
\isodd{ } ?
\isundefinedcommand{ } ?
\equal{ 1}{ 2} ?
\boolean{ } ?
\lengthtest{ 1 = 2} ? > <.

6.3. . . .

75

\( \) , \AND , \OR
\NOT .
xifthen .
\isnamedefined{ } ?
\isempty ?
\isequivalentto{ 1}{ 2} ?
\cnttest{ 1}{ 2} calc- .
\dimtest{ 1}{ 2} calc- .
. xifthen.pdf.
ifthen \whiledo:
\def\Source{ , , }
\whiledo{\not\equal{\Source}{}}
{ \GetTokens{TokenOne}{TokenTwo}{\Source}%
\fbox{\TokenOne}%
\let\Source\TokenTwo}

,
, , .
\GetTokens tokenizer,
. . , , .
tokenizer.pdf.


- ,
.
.

.
. , , , ,
.
,
.
() , ,
, , . ,
,
.
, . , LATEX
, . , ,
, , .

7.1.
. 7.1 \layout
. .

78

7.


10

1
1
3
5
7
9
11

11

+ \hoffset
\oddsidemargin = 2pt
\headheight = 18pt
\textheight = 635pt
\marginparsep = 12pt
\footskip = 50pt
\hoffset = 0pt
\paperwidth = 597pt

2
4
6
8
10

+ \voffset
\topmargin = -41pt
\headsep = 21pt
\textwidth = 448pt
\marginparwidth = 49pt
\marginparpush = 6pt (not shown)
\voffset = 0pt
\paperheight = 845pt

. 7.1. scrartcl a4paper ( \layout layout)

7.1.

79

. ,
( ).
. ,
.
, . . 7.1
1 ).
2
(

. . \hoffset \voffset (
),
.
, .
7 \textwidth
\texthight
8
. \columnwidth. \linewidth ,
.
3 .
\oddsidemargin
.
\oddsidemargin, \evensidemargin.
4
\topmargin
5 , \headheight ,
6
\headsep .

\footskip .
10
\marginparwidth
9 \marginparsep .
: \marginparpush.

7.1.1.
\paperwidth \paperheight.
LATEX (article, book, report letter) , letter. ,
A4 (210 297 ).
a4paper :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , o n e s i d e ] { s c r b o o k }

80

7.

A5 ( A4) a5paper.

7.1.2.

. 7.2. lscape

- .
(, slides).

. 7.3. rotpages

,
landscape lscape. ,
, 90 . pdflatex
, (
), pdftex - pdflscape.
, ,
portland,
, . \portrait
\landscape . . , .
- 180 1 , rotpages.
\rotboxpages \endrotboxpages, 1 , , .

7.2.

81

. ,
. rotpages-doc.pdf

7.2.
, TEX , , LATEX:
article, book, report latter. ,
, . . , scrartcl, scrbook, scrreprt scrlettr
KOMA-Script, , ,
A4. . .
ncclatex ( ) ncc,
TEX.

7.2.1.
, , . - ,
. , , .
, : geometry, vmargin typearea.
 : !
geometry

geometry ,
:
\ u s e p a c k a g e [ h e i g h t =25cm , a 4 paper , hmargin={3cm , 2 cm } ] { geometry }
keyval, 5. ,
calc.
. geometry.pdf
.
, .
. , , . ,
.

82

7.

vmargin
vmargin . :
\ s e t p a p e r s i z e [ ] { }
: A0, A1, . . . , A9, B0, B1, . . . , B9, C0, . . . , C9, USletter, USlegal
USexecutive. landscape
( ) portrait ( ).
custom :
\ s e t p a p e r s i z e { custom }{}{}
,
:
%
\ s e t m a r g i n s { }{ }%
{ }{ }%
{}{}%
{}{}%
%
\ s e t m a r g n o h f { }{ }%
{ }{ }%
%
\ setmarg { }{ }%
{ }{ }%
vmargin : \setmarginsrb,
\setmargnohfrb, \setmargrb. ,
.
vmargin.pdf.
typearea
typearea KOMA-Script , (scrartcl, scrbook . .),
. , (Jan
Tschichold).
typearea , geometry,
:

7.2.

83

\ u s e p a c k a g e [BCOR8 . 2 5mm] { t y p e a r e a }
BCOR (binding correction) , - .
KOMA-Script,
, typearea, :
% KOMAS c r i p t
\ documentclass [ pagesize ] { scrbook }
% 70 100/16
\ s e t l e n g t h {\ paperwidth }{170mm}
\ s e t l e n g t h {\ p a p e r h e i g h t }{240mm}
%
\ a r e a s e t {130mm}{194mm}
pagesize typearea,
, dvi-
( dvips, xdvi ) . , ,
.
, 5773-90, , (, A1, A2,
A3, A4 ). \paperwidth
\paperheight . typearea \areaset,
, .
KOMA-Script (scrguien.pdf)
Construction of the Page Layout with typearea.
.

typogrid
, , typogrid, . ,
draft, final .
, , columns=. 12.

84

7.

7.2.2.
, .
.
.
:
\ p a g e s t y l e { }
,
\thispagestyle{ }.
:
empty
- .
plain
.
headings ,
.
,
. fancyhdr, 12.2 164,
.

7.2.3.
- A5 PostScript A4,
psutils, , :
> c a t . ps | psbook | psnup 2 > . ps

psbook ,
, psnup -2 . PostScipt . -
, , , ,
, pstops.

pdf-, , Adobe Reader kpdf , . pdf-
pdfpages, pdf- pdf-.
twoup
twoup . booklet, , psbook.

7.2.

85

twoup
booklet twoup:
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt ] { s c r b o o k }
\ usepackage [ p r i n t ] { booklet }
\ u s e p a c k a g e {twoup}
print .
dvips, ,
:
> d v i p s T 2 9 . 6 cm , 2 1 . 0 cm dvi-

pgfpages
pgfpages pgf , . pgfpages TEX
, TEX. pgfpages ,
.
, :
%
\ usepackage { pgfpages }
\ p g f p a g e s u s e l a y o u t {2 on 1 } [ a 4 paper , l a n d s c a p e ,%
b o r d e r s h r i n k =5mm]
\ b e g i n { document }

\ clearpage

\ end { document }
\pgfpagesuselayout
(2 on 1). :
a4paper
A4,
landscape
,
border shrink=5mm 5 .
pgf (pgfmanual.pdf)
Page Management.

86

7.


,

, - .
. 7.4. (
[11])

. 7.5. xdvi draft

7.3.
, , .
LATEX . , . ,
, , , . 7.4.

7.3.1.
TEX (Undefull)
(Overfull), log- , :
O v e r f u l l \ hbox ( 2 6 . 2 pt t o o wide ) i n paragraph a t l i n e s 4756
[ ] [ ] \T2A/cmr/m/n/12
. geometry . pdf
draft:
\ d o c u m e n t c l a s s [ d r a f t , a 4 paper , 1 2 pt , o n e s i d e ] { s c r b o o k }
. 7.5 .
, LATEX , - . ,
, 3.
\linebreak \\. \linebreak
\\ .

7.3.

87

, ,
.
Note microtype () .
pdflatex, TEX.
T2A, . . microtype.pdf.

7.3.2.
. \hspace.
. *-
\hspace*, ,
, .
:
\quad 1em. \qquad \quad, \endspace \quad.
\hfill . \hfill
, . \hfil.
\hrulefill , \hfill, .
\dotfill, .

7.3.3.
.
\noindent. \indent.
LATEX
: center ( ), flushleft (
) flushright ( ).
.
\begin{center}
.
\end{center}
\flushleft .
\flushright .

.
.
.

. ,

88

7.

, , : \centering ( ), \raggedright2 ( )
\raggedleft ( ).

. ragged2e \RaggedRight,
:
\begin{minipage}[t]{0.48\textwidth}
\raggedright

\end{minipage}\rule[-1.8cm]{0.4pt}{2cm}
\begin{minipage}[t]{0.48\textwidth}
\RaggedRight
.
\end{minipage}

, \RaggedRight, .

7.3.4.
. \newpage \pagebreak. \newpage ,
\pagebreak
.
/ - , :
\newcommand{\ l o n g p a g e }{\ e n l a r g e t h i s p a g e {\ b a s e l i n e s k i p }}
\newcommand{\ s h o r t p a g e }{\ e n l a r g e t h i s p a g e {\ b a s e l i n e s k i p }}
\longpage ,
\shortpage, , . \baselineskip .

7.3.5.
. , ,
2 \raggedright

\flushleft .

7.4.

89

, . .
:
\ c l u b p e n a l t y =10000
\ widowpenalty =10000

7.3.6.
\hspace{}
\vspace{}. \vspace*{}
, ,
.
:
\bigskip , \baselineskip. \medskip \bigskip \smallskip 1/4 \bigskip.
\vfill . \vfill
, . \vfil.

7.3.7.
: ,
.
setspace.
\doublespacing, .
setspace \onehalfspacing \singlespacing
.
spacing:
\begin{spacing}{2.5}
<<

>>.
\end{spacing}

spacing ,
.

7.4.
twocolumn:
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , twocolumn ] { s c r a r t c l }

90

7.

. 7.6 .
\twocolumn[].
, ,
, .
\onecolumn,
.
.
.
, ,
. 7.6, . balance preprint .
. 7.7.
\balance.
,
. 7.7. ftnright
tools. ,
. ftnright.pdf
 fixltx2e , .
( ,
) , . .
sttools
sttools , . ,
, .
flushend ,
\raggedend \flushend.
cuted strip, , .
strip . 7.8. ,
.
presfull.pdf.
multicol
multicol tools

7.4.
,

1
?
.
. .
. ,
.
,
.

. .

,
, .
86-

.
, ,


.
!
,
.
, :
?
: .
,
,

. ,

91

. 7.6. twocolumn,


.
!
,
.
, :
?
: .


. .
. ,
.
,
.

,
,
. , ,

1 ? .

1.

. .

,
, .
86-

.
, ,

,

. ,
,

1
?
.
. .
. ,
.
,
.

. .

,
, .
86-

.
, ,


.
!
,
.
, :
?
: .
,

1.

. 7.8.
flushend: strip, cuted

. 7.7.
balanced,
ftnright
,
,
.
, , 1
?
.
. .
. ,
.
,
.

. .

,
, .
86-
. , ,
.
!
,
.

, : ? : . -

. 7.9. multicol:
multicols
2

92

7.

.
.
multicols:
\begin{multicols}{3}
[\section*{}]
\RaggedRight
. .
, ,
.
86- "--
.
\end{multicols}

. .

,
,

.
86

 , , , \RaggedRight
( 7.3.3 . 87).
multicols
. , .
,
.
- -
, multicol
\columnbreak.
multicols . , ,
t b.
, . .
multicol.pdf.
parallel
parallel . Parallel:
\ begin { P a r a l l e l }{0.4\ textwidth }{0.5\ textwidth }
\ P a r a l l e l L T e x t { F i r s t they i g n o r e you , then they l a u g h a t you ,
then they f i g h t you , then you win . }
\ P a r a l l e l R T e x t { ,
, . . }
\ end { P a r a l l e l }

7.4.

93

:
First they ignore you, then they
laugh at you, then they fight you,
then you win.

,
, . .

, . \ParallelLText , \ParallelRText, , .
parallel.pdf

LATEX
LATEX
, ,
.
.

, . .
.
.

8.1. ?
\documentclass.
:
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt ] { s c r a r t c l }
,
.
cls. TEX Live 2007 208
. ,
.
. .
. , . .

96

8. LATEX

, TEX .
(2007 )
papertex (. 8.1 Ignacio Llopis),
LATEX 1 , , LATEX
.

8.2.
, LATEX (6) : article (), book
First heading. Aenean sem
(), report (), proc (), letter
purus, blandit bibendum,
() slides ().
gravida sed.
c article.
\section () . Second heading. Fusce porttitor erat aliquam felis. Integer scelerisque enim at augue.

( abstract).
book ,
Third heading. Donec lectus enim, dapibus sit
amet, condimentum non, viverra eu, augue.
\chapter (). book , . report
TeX
book.
, , .
proc

. 8.1. papertex
article, .
letter. .
. slides
. ,
, .
minimal,
. minimal .
my papertex edition http://nachollopis.com

paper TeX

XI

This is the caption of the main image on


the front page.

Februarii MMVII k 10:19h

12:34 h First text. Lorem ipsum dolor sit amet, consectetuer


adipiscing elit. In vitae augue. Morbi fermentum, felis accumsan
rhoncus malesuada, metus eros adipiscing dui, vel eleifend nibh velit
ut felis. Pellentesque elementum massa at nisi dapibus mollis. Etiam
cursus. Mauris gravida nibh ut sapien. Vestibulum pretium, felis et.

SECTION A

MAIN INDEX

Second subheading. Facilisis sit amet, elementum nec, interdum


vitae, nunc.

10:23 h Second text. Lorem ipsum dolor sit amet, consectetuer adipiscing elit. In vitae augue. Morbi fermentum, felis accumsan rhoncus malesuada, metus eros adipiscing

dui, vel eleifend nibh velit ut felis.


Pellentesque elementum massa at nisi
dapibus mollis. Etiam cursus. Mauris
gravida nibh ut sapien. Vestibulum
pretium, felis et.

Index item 2. Cras feugiat,


arcu a tincidunt ornare, sem
augue mattis erat. p. ??

Index item 3. Sed sit amet


velit. Duis sit amet nunc.
Aenean vehicula commodo est. Aliquam dignissim
tempor enim. p. ??

SECTION B

Third subheading. Nunc dictum fermentum nunc. Suspendisse


est. Nulla bibendum lacus vel tortor.

10:02 h Third text. Curabitur imperdiet, est

vel commodo eleifend, mi urna vulputate lorem, at


rhoncus diam augue vitae magna. In nisi. Vivamus
elementum blandit sem. Cras sit amet justo. Curabitur diam arcu, elementum commodo, tincidunt
vel, dapibus id, lectus. In egestas nibh nec leo.
Pellentesque ut nisi sed purus rhoncus vehicula.
Donec commodo magna.

TOMORROW
15 k 11 C

Index item 4. Curabitur imperdiet, est vel commodo


eleifend, mi urna vulputate
lorem. p. ??

paper

WEATHER FORECAST

TODAY
13 k 9 C

Index item 1. Cras molestie


dui sed lectus. In purus
justo, lacinia sit amet. p. ??

FRIDAY
12 k 6 C

EDITORS
Ignacio Llopis
lloptor@gmail.com

http://nachollopis.com

1 -
, .

8.3.

97

, , LATEX ,
.
, . , , .
. , .
,
. , -
.
, , .
:
10pt, 11pt, 12pt . ,
.
a4paper .
, LATEX letter.
draft .
, .
oneside/twoside .
twocolumn .

8.3.
, , , .

8.3.1.
. - ,
extsizes (extarticle, extbook, extletter, extproc, extreport), 10-12pt2 . , -
.
2 10pt, 11pt 12pt extsizes 8pt, 9pt, 14pt, 17pt
20pt. .

98

8. LATEX

(amsart, amsbook, amsproc), .


ntgclass3 , , .
KOMA-Script
KOMA-Script. . ,
( ), -
, , LATEX-. scrartcl, scrbook,
scrlttr2, scrreprt.
KOMA-Script
9pt, 14pt 17pt. ,
, KOMA-Script . . , KOMA-Script .
The KOMA-Script bundle (scrguien.pdf) .

.
. 4 LATEX [10].
ncc
: article ( ), preprint (), book () report ().
: ncclatex.pdf.

8.3.2.
letter LATEX, ,
. . , , . . . , . LATEX
letter.
3 ntgclass (artikel1, artikel2 artikel3),
(boek boek3), (brief ) (rapport1 rapport3).
4 , .

8.3.

99

FAQ LATEX (http://www.tex.ac.uk/faq)


newlfm . lfm letter (), f ax () memoranda ( ).
README .
akletter . lettereng.pdf . KOMA-Script
scrlttr2.
ntgclass brief .
- . , cdpbundl,
.

8.3.3.
,

. , 1
4

1.1 eskdx . . . . . . . . . . . . . . . . . . . . . . . . . . .
4
1.2 . . . . . . . . . . . . . . . . . . . . . . .
4
, 2
5
. 2.1 . . . . . . . . . . . . . . . . . . . . .
5
2.2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
6
,
2.2.1 . . . . . . . . . . . . . . . . . .
6
2.2.2 eskdtext . . . . . . . . . . . . . . . . . . . .
8
5 .
2.2.3 eskdgraph . . . . . . . . . . . . . . . . . . .
9
2.2.4 eskdtab . . . . . . . . . . . . . . . . . . . . . 10
2.3 . . . . . . . . . . . . . . . . . . . . . . . 11
eskdx,
2.4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
2.5 . . . 14
2.6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.7 , . . . . . . . . . . . . . 18
, 2.8 . . . . . . . . . . . . . . . . . . . . . 18
2.9 . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.10 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.11 . . . . . . . . . . . . . . . . . 19

2.12 . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.13 , , , .. . . . . . . . . . 20
. 3
21
: eskdtext 3.1 . . . . . . . . . . . . . . . . . . . . . 21
3.2 . . . . . . . . . . . . . . . . . . . . . . . . . . 22
, eskdbtab 3.3 . . . . . . . . . . . . . . . . . . . . . 23
eskdgraph ,
3.4 . . . . . . . . . . . . . . . . 24
. eskdx.pdf eskdx v0.97
.

:
http://lostclus.linux.kiev.ua/eskdx/.
CTAN. 8.2. eskdx
{CTAN}/macros/latex/contrib/eskdx/.
eskdx .
. eskd
. .
.
.
. .
.
. .
.

, .

32

100

8. LATEX

( x). eskd.cls
pscyr6 .
, .
? isov2.cls iso . isoman.pdf
ISO.
ISO 10303 iso10303.

8.3.4.
,
book. ,
, .
book
octavo. scrbook KOMA-Script book. .
.
memoir (memman.pdf)
, . , , ,
. .
- , . .
.
(memmanadd.pdf),
.
,
,
sffms .

8.3.5.
, , .
scrreprt KOMA-Script, report.
6

pscyr .
, .
LATEX. .
: ftp://ftp.vsu.ru/pub/tex/font-packs/pscyr/.

8.3.

101

The quest for

The following formula computes 8 correct digits per


iteration (Ramanujan):


1 X ( 41 )n ( 24 )n ( 43 )n
1
2 2(1103 + 26390n)
=
3

n!
(992 )2n+1
n=0

. 8.3. prosper
- (Eli Billauer) LATEX- HiTech- hitec. .
, , . ? 298,
sffms, . manual nassflow
Center for the Automation of Weapon
and Command Systems, Royal Netherlands Navy.

8.3.6.
,
. ,
. seminar
sides .
.
LATEX , - .
prosper seminar , , , pdf. ppr-prv
prosper.
texpower powersem, slides, texpower.
prosper .

102

8. LATEX


, beamer. beamer
(Till Tantau) . .
.
200 .
LyX (http://www.lyx.org) WYSIWYM , .
, powerdot, LyX.
talk, ,
.
.
a0poster,
. , , LATEX . ,
sciposter .

8.3.7.
LATEX. - . , , /, , : http://www.maik.ru/pub/tex/.
LATEX.
, asaetr American Society for Agricultural Engineers
(ASAE). Maple Technical Newsletter mtn.
jpsj2 .
sibjnm.
Elsevier elsart. nature pdf-
Nature. revtex4.
, , , combine.

8.3.8.
curriculum vitae . ,
.

8.3.

103


,
johndoe
europecv.
vita Education
. ,

Master thesis
IT- .
Experience
curve .
curve
.
Languages
morderncv
,
.
, , . . 8.4. moderncv
, . currvita
.
Any intelligent fool can make things bigger, more complex,
and more violent. It takes a touch of genius and a lot of
courage to move in the opposite direction.

20032006

Master of Design, Valparezzo School of Design.


1st year: 79%

20012003

title

2nd year: 84%

3rd year:

(graduation expected in June 2006)

Bachelor of Design, Being Drawing University.

1st year: 63%

2nd year: 76%

On the design of modern curriculum vits

supervisors

Pr P. Picasso and Pr G. Klimt

description

Study of the complex design of a curriculum vit, also known as rsum. In my opinion,
a good design needs to be show the personality of its author. Some people will thus prefer a
more classic style, and others will be more audacious. . .

February 2006
current
20052006

Maintainer of the a CTAN package, CTAN, World.

Maintainer of the moderncv package, meant to ease the production of beautiful curriculum
vits.

Mathematics tutor, UCL, Louvain-la-Neuve.

Supervision of practical sessions for a mathematical course given to second year engineering
students (course FSAB1104: Numerical Methods).
See www.legat-online.be/b2q1/num.

20042006

Cultural project leader, Tchouque-Tschouk Kot, Louvain-la-Neuve.

Leader of a student home with a cultural project, requiring day to day management as well
as the organization of public events.
See www.organe.be.

19992001

IMO preselected, SBPMef, Wpion.

Advanced mathematical training, as Belgian preselected candidate for the International Mathematical Olympiads, selected by the Belgian mathematical society.
See
imo.math.ca/belgium.html.

French
Dutch

English

Native

Near-native

Very good

Primary education degree obtained in a Dutch college


(Sint-Jozefscollege te Sint-Pieters-Woluwe).

Many journeys in English speaking countries, including the United


States,
the United Kingdom and Kenya.

12 somestreet, 3456 somecity T +12 (3)456 78 90 B jdoe@design.org www.ctan.org

8.3.9.
, .
. ,
ucthesis (UC Berkeley).

disser. TEX Live,
{CTAN}/macros/latex/contrib/disser CTAN-. , - .

104

8. LATEX

8.3.10.
. , CD (cd), (qcm), (assignment),
(ConcProg), (courseoutline coursepaper), (labbook), (stage), (pecha . 8.5),
(flashcards) .
, .

.y
l,
ig,nx, xm,z
e,d
g,px, cxn,
es,x,i
g,d
g,
e.

im,bdxg,c
ig,lxs,bx, x,
ig,b-
es,t
e.

bdxg,n
i,zxn,zx,
e.

rxb,d
,db
l,
os,px, bzx,bx, dx,.

d
g,px, cxn,
is,bx, x,d
e,
im,
i,nx,d
,btx,bx, dx,.

bdxg,d
e,zxn,d
eo
,zs,nxs,lxs,px, dx,.

bg
o,m
ed,px,i
g,g
o.

in,px

r,xd,nxs,bx, x,d
e,
id,d
e,
im,bdxg,d
ei
,
im,d
,s
o,bx, dx,.

bx, x,
o,gxn,d
,s
o,nxs,
or,r
o..

d
e,nx, bx, x,mx, m
o,nxs,d
es,d
g,px, cxn,lx, x,gx, r
e,
es,xs,px, dx,.

. 8.5. - pecha

d
es,

d
e,nx,
im,

im,

d
es,xs,

page 2

This is the short excerpt from the Brahma Story, taken from the Documentation of the cTibTEX package:


:
, ;
, , ;
, .

? . ? .
, , .
, . ,
.
.
.
.
, . .
(\frametitle).
2040 80.
block, theorem, proof example. .
.

106

9.

9.1. slides
LATEX,
. .


slides. ,
=
+
(1 ),
(1)
.

T , C
( J/),

, C
( J/ (X)).

, =
+
(1 ).
(2)
.

.
landscape . 9.1. slides

. slide. .
T

(C)
T

(C)
T

(C)
T

(C)
T

(T )
C

(T)
C

\ d o c u m e n t c l a s s [ a 4 paper , l a n d s c a p e ] { s l i d e s }
...
\ b e g i n { document }
\ begin { s l i d e }
\ begin { center }
\ Large
\ end { c e n t e r }
...
\ end { s l i d e }
\end { document }
seminar slides - (1993 .),
( sem-user.pdf)
slide .
- - - , , slide
seminar .

9.2. PDF
PDF (Portable Document Format) Adobe Systems
1993 . 2006 1.7.
2007 PDF 1.7 ISO 32000. PDF-
,

9.2. PDF

107

(, ). PDF
, JavaScript. 1.6 3D ,
, , .
PDF
, :
.
.
. PDF.
. .

9.2.1.
, PostScript- . ghostscript, ps2pdf ,
PDF:
> p s 2 p d f .ps .pdf
PDF tex-
pdflatex. latex , PDF. pdflatex
, pdf (),
png/jpeg (). pdflatex eps-, , MetaPost.
- pdf PostScript, pdftops xpdf .
> p d f t o p s [ e p s ] pdf-
EPS,
-eps.

PDF Type1.
.

. : ,
, . , ,
.

108

9.

,
Computer Modern ( cm-super).
Type3. cm-super ( TEX Live )
.

9.2.2.
Adobe Reader Ghostscript. - , . Adobe Reader Adobe
Systems. PDF
. , ,
.
Adobe Reader,
, ,
. pdfopen pdfclose ( TEX Live):
> p d f c l o s e f i l e .pdf
# .pdf
> pdfopen f i l e .pdf

Ghostscript .
Ghostscript PDF , . :
. () .
xpdf (http://www.foolabs.com/xpdf/) PDF
, X Window. 3.02, xpdf PDF 1.7. xpdf
, , kpdf .
r. .

9.2.3.
, PDF.
: ,
.
.
hyperref . , manual.pdf.

movie15. : pdflatex, Adobe Reader MS Windows MacOS.

9.3. beamer

109

, , . movie15.pdf.

PDF .
Mac OS MS Windows .
, ,
.

9.3. beamer
, , -
. .
beamer ,
slides,
. , ,
, , LATEX.
(Till Tantau)
.
beamer ,
(beameruserguide.pdf)
http://sourceforge.net/projects/latex-beamer. TEX Live beamer
.
beamer pdflatex,
latex + dvips + ps2pdf . , :
\ d o c u m e n t c l a s s [ h y p e r r e f ={u n i c o d e=t r u e } ] { beamer }
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
beamer hyperref .
,
(, unicode=true ),
.
UTF-8,
beamer:
\ d o c u m e n t c l a s s [ u t f 8 ] { beamer }
\ usepackage [ u t f 8]{ inputenc }
. beamer frame.

110

9.

% ( )
\ usetheme { Madrid }
%
\ u s e o u t e r t h e m e { shadow }
\ t i t l e {}
\ d a t e { }
\ a u t h o r {}
\ b e g i n { document }
%
\ b e g i n { frame }
\ titlepage
\ end { frame }

J/e + e Br(J/ e + e )
..

..

J/e + e Br(J/ e + e )

frame t, .
. ,
beamer section.
frame. , ,
.
\tableofcontents. , ,
pausesections.
%
\ usetheme { M o n t p e l l i e r }
%
%
\ u s e c o l o r t h e m e { dove }
%
\ s e c t i o n {}
\ s u b s e c t i o n {}
\ b e g i n { frame }
\ f r a m e t i t l e {}
...
\ end { frame }

(J/ e + e ) Br(J/ e + e )

( .)
+

d e e
d

f =



1 n 9 2e + e
3
1 + (1 + cos2 )Imf
M 2 4 M
4



3 e + e
(1 + cos2 )2
11

1 + (1 + cos2 )
Ref +
2 M
12
(1 cos )


13
(3 + cos2 )2 o
2
1+
,
+
4
12
(1 cos )2
M
2

W + M

i
2

!1

ln

W
1

me
2

\frametitle.
\framesubtitle.
 dove,
. ,

9.3. beamer

111

PDG 2007

PDG 2007

e + e e + e / total 6% (DASP-1979)

e + e e + e / total 6% (DASP-1979)
e + e + / total
PDG 2007 0.335 0.007 (2.1%)
BaBar (2004) 0.3301 0.0077 0.0073
2.3% 2.2% ISR
CLEO-c (2006) 0.3384 0.0058 0.0071
1.7% 2.1% ISR.

..

(J/ e + e ) Br(J/ e + e )

..

(J/ e + e ) Br(J/ e + e )

. 9.2. , \pause beamer


, , .
.
.

, .
\pause:
\ begin { itemize }
\ item . . .
%
\ pause
\ item . . .
\ end { i t e m i z e }
. 9.2 , . ,
,
.
 (, 1.7%
), , . , \alert. \alert \emph. , \alert
.
\beamerbutton{} .

112

9.

beamer

beamer

()

()

A = B

A = B

theorem, proof, block enumerate

A=C

theorem, proof, block enumerate

A=C

B =C

. 9.3. 1

. 9.4. 2

beamer

beamer

()

()

A = B

A = B

theorem, proof, block enumerate

A=B

theorem, proof, block enumerate

A=B

. 9.5. 3

. 9.6. 4

beamer < > /.


, . beamer \color<34>
3 4 . . : -3,5-9,12,17- ,
: 3, 5 9, 12, 17 .
beamer .
:
%
\ newtheorem {MyTheorem}{ }
\ b e g i n { frame }
%
\ f r a m e t i t l e { \ t e x t b f { beamer }}

9.3. beamer

113

%
\ f r a m e s u b t i t l e { theorem , p r o o f , b l o c k enumerate }
%
\ b e g i n {MyTheorem } [ ]
% 3 4
\ c o l o r <34>[rgb ] { 1 , 0 , 0 } { \ (A=B\ ) }
\ end {MyTheorem}
%
\ begin { proof }
\ b e g i n { enumerate }
% 2
\ item<2> \ (A=C\ )
% 2
\ item <2> \ (B=C\ )
% 3 4
\ item <3,4> \ (A=B\ ) \ q e d h e r e
\ end { enumerate }
\ end { p r o o f }
% ( 4 , )
\ uncover <4>{ \ beamerbutton { }}
% ( 1 3 )
\ b e g i n { b l o c k }<1,3>{ }

\ end { b l o c k }
\ end { frame }
. 9.39.6 , .
beamer ,
. :
\color{} ;
\includegraphics ;
\item ,
itemize enumerate;
theorem ( 13.7 . 201);
prof. , . 2 QED (quod
erat demonstrandum ). \qedhere QED , . QED
, , , .

114

9.

beamer , :
\alert{} ;
\only \visible ;
\invisible \only;
\uncover , \only,
, ;
\alt<>{}{ } ;
block . theorem.


. \label.
, \hyperlink :
\ l a b e l { metka }
\ h y p e r l i n k { metka }{}
LATEX-, , \beamerbutton. :
\ h y p e r t a r g e t < >{}{}
,
.


verbatim lstlistings. , frame fragile.
, , :
\ b e g i n { frame } [ f r a g i l e ]
%
\newcommand{\un }{\ uncover }
\newcommand{\ a l }{\ a l e r t }
\ f r a m e t i t l e {An Algorithm For F i n d i n g Primes Numbers . }

9.3. beamer

Users Guide
to the
Beamer
Class

115

An Algorithm For Finding Primes


Numbers.

Till Tantau

Users Guide
to the
Beamer
Class

An Algorithm For Finding Primes


Numbers.

Till Tantau

int main (void)


{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)

int main (void)


{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)
if (is_prime[i])
{

}
return 0;

return 0;
}

Users Guide
to the
Beamer
Class
Till Tantau

An Algorithm For Finding Primes


Numbers.
int main (void)
{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)
if (is_prime[i])
{
std::cout i " ";
for (int j = i; j < 100;
is_prime [j] = false, j+=i);
}
return 0;
}

Users Guide
to the
Beamer
Class
Till Tantau

An Algorithm For Finding Primes


Numbers.
int main (void)
{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)
if (is_prime[i])
{
std::cout i " ";
for (int j = i; j < 100;
is_prime [j] = false, j+=i);
}
return 0;
}
Note the use of std::.

. 9.7. ( Hannover, , )
\ begin { semiverbatim }
\un<1>{\a l <0>{ i n t main ( v o i d ) } }
\un<1>{\a l <0>{\{}}
\un<1>{\a l <1>{ \ a l <4>{s t d : : } v e c t o r <bool >i s_prime ( 1 0 0 , t r u e ) ; } }
\un<1>{\a l <1>{ f o r ( i n t i = 2 ; i < 1 0 0 ; i ++)}}
\un<2>{\a l <2>{ i f ( i s_prime [ i ] ) } }
\un<2>{\a l <0>{ \{}}
\un<3>{\a l <3>{ \ a l <4>{s t d : : } c o u t << i << " " ; } }
\un<3>{\a l <3>{ f o r ( i n t j = i ; j < 1 0 0 ; } }
\un<3>{\a l <3>{
i s_prime [ j ] = f a l s e , j+=i ) ; } }
\un<2>{\a l <0>{ \}}}
\un<1>{\a l <0>{ r e t u r n 0 ; } }
\un<1>{\a l <0>{\}}}
\ end { s e m i v e r b a t i m }
\ v i s i b l e <4>{Note t h e u s e o f \ a l e r t {\ t e x t t t { s t d : : } } . }
\ end { frame }

116

9.


beamer .
. \usetheme. , .
beamer 2007 : AnnArbor,
Antibes, Bergen, Berkeley, Berlin, Boadilla, CambridgeUS, Copenhagen, Darmstadt, Dresden, Frankfurt, Goettingen, Hannover, Ilmenau, JuanLesPins, Luebeck, Madrid, Malmoe, Marburg, Montpellier, PaloAlto, Pittsburgh, Rochester,
Singapore, Szeged Warsaw.
. \usecolortheme. : albatross, beaver, beetle, crane, dolphin, dove, fly, lily, orchid, rose, seagull, seahorse,
sidebartab, structure, whale wolverine.
. \usefonttheme. : professionalfonts, serif, structurebold, structureitalicserif structuresmallcapsserif.
, ,
, . \useinnertheme. : circles,
inmargin, rectangles, rounded.
,
. \useoutertheme. : infolines, miniframes, shadow, sidebar, smoothbars, smoothtree, split tree.

. , ,
.

128 98 . .
Adobe Reader
Page Scaling ( ) Fit
to Printable Area ( ). pgfpages pgf .
.

9.3. beamer

117

\ usepackage { pgfpages }
\ p g f p a g e s u s e l a y o u t { r e s i z e t o } [ a 4 paper ,%
b o r d e r s h r i n k =5mm, l a n d s c a p e ]
A4 5 . ,
:
\ p g f p a g e s u s e l a y o u t {2 on 1 } [ a 4 paper , b o r d e r s h r i n k =5mm]

draft
. . , ( \includeonly):
\ i n c l u d e o n l y f r a m e s { ex 1 , ex 3}
\ frame [ l a b e l=ex 1 ]
{ . }
\ b e g i n { frame } [ l a b e l=ex 2 ]
ex 2 .
\ end { frame }
\ frame { . }
\againframe:
%ex 1
\ a g a i n f r a m e { ex 1}

beamer multimedia.
\movie \sound
. , ,
Adobe Reader MS Windows MacOS.
.
beamer
.
\ animate< >
.
, Adobe Reader
.

10


,
, ,
!
.

. , 3 27.

10.1.
babel. ,
, , , .
babel:
\ usepackage [ english , r u s s i a n ] { babel }
.
: (afrikaans), (english, USenglish, american, UKenglish, british, canadian, australian, newzealand), (basque), (bulgarian), (breton),
(magyar), (hungarian), (uppersorbian),
(galician), (dutch), (greek, polutonikogreek), (danish), (hebrew), (interlingua), (irish), (icelandic), (spanish), (italian), (catalan),

120

10.

(latin), (bahasa), (austrian, german, germanb, ngerman, naustrian), (lowersorbian), (norsk), (nynorsk),
(polish), (portuges, portuguese, brazilian), (russian), (romanian), (samin), (serbian), (slovak), (slovene), (turkish), (ukrainian), (welsh), (finnish), (french, francais, canadien,
acadian), (croatian), (czech), (swedish), (scottish), (esperanto) (estonian).
\selectlanguage:
{\selectlanguage{english}\chaptername{}}
- "--- \chaptername.

Chapter - .

,
, babel.
otherlanguage:
%
"--- ,
, .
"--- . ~\par
%
\begin{otherlanguage}{english}
%
Science is what we understand well enough to
explain to a computer. Art is everything
else we do. Donald~Knuth
\end{otherlanguage}

, ,
. .
Science is what we understand well enough to explain to a computer. Art is
everything else we do. Donald Knuth

\foreignlanguage{}{}. , , :
\foreignlanguage{english}{\chaptername{}} "--, .

, .

otherlanguage*.
, c (russian)
(english), TEX T2A, , T1, , .
, LATEX-,
Unicode, , xelatex.

10.2.

121

babel ,
.
, , \iflanguage:
\selectlanguage{english}
\iflanguage{russian}{}{not russian}.\par
\selectlanguage{russian}
\iflanguage{russian}{}{not russian}.

not russian.
.

 babel, , .
,
indentfirst. misccorr t2,
babel.

10.2.
. .
LATEX
The Comprehensive LATEX Symbol List. pdf-
symbols-a4.pdf .
,
^ \textasciicircum
~
\textasciitilde

\textasteriskcentered
\
\textbackslash
|
\textbar
{
\textbraceleft
}
\textbraceright

\textbullet

\textdagger

\textdaggerdbl
$
\textdollar
. . . \textellipsis
\textemdash

\textendash

\textexclamdown
> \textgreater
< \textless

\textordfeminine

\textordmasculine

\textparagraph

\textperiodcentered

\textquestiondown

\textquotedblleft

\textquotedblright

\textquoteleft

\textquoteright
\textregistered

\textsection
\textsterling

\texttrademark
_ \textunderscore

\textvisiblespace

122

10.

%
'


\textasteriskcentered

\textbigcircle

\textbrokenbar

\textdagger

\textdblhyphen

\textdiscount

\textinterrobang

\textmusicalnote

\textopenbullet

\textordmasculine

\textperiodcentered
%
\textperthousand

\textquotesingle

\textquotestraightdblbase

\textreferencemark

\textthreequartersemdash
~
\texttwelveudash

(textcomp)
\textbardbl
\textblank
\textbullet
\textdaggerdbl
\textdblhyphenchar
\textestimated
\textinterrobangdown
\textnumero
\textordfeminine
\textparagraph
\textpertenthousand
\textpilcrow
\textquotestraightbase
\textrecipe
\textsection
\texttildelow

(textcomp)
\textdownarrow

\textleftarrow
\textrightarrow

\textuparrow

A
m
|
2


/
6



,

(wasysym)
\hexstar
B
\varhexstar
\ataribox

\bell
\blacksmiley
1
\Bowtie
\brokenvert

\checked
\CheckedBox

\clock
\diameter
L
\DOWNarrow
\frownie

\invdiameter
\kreuz

\LEFTarrow
\lightning
h
\permil
\phone

\pointer
\recorder

\RIGHTarrow
\smiley
2
\Square
\sun
K
\UParrow
\wasylozenge
4
\XBox

10.2.

123

,
$
\$
} \}
{ \}
\dag

\ddag
. . . \dots
\P
\pounds
amssymb
\checkmark r \circledR z \maltese

ASCII-

a
d

A
L

\aa
\dj
\OE

\AA
\L
\oe

\AE
\l
\ss

\ae
\o
\S

SS

\DJ
\O
\SS

10.2.1.

\textbaht

\textcolonmonetary
\textdollaroldstyle

\textflorin

\textnaira

\textwon

(textcomp)
\textcent

\textcurrency
$
\textdong

\textguarani

\textpeso

\textyen

\textcentoldstyle
\textdollar
\texteuro
\textlira
\textsterling

(wasysym)
\currency

\cent

A
C
e

\geneuro
\officialeuro

(eurosym)
B
C \geneuronarrow

\geneurowide

10.2.2.

(textcomp)
\textcircledP
\textcopyleft
\textcopyright
\textregistered \textservicemark \texttrademark

124

10.

10.2.3.
textcomp \newtie,
 a). , (A
A ).
a
\textcircled (

a
A
a
A
A
a
 a
A

\"{A}\"{a}
\^{A}\^{a}
\c{A}\c{a}
\t{A}\t{a}

`a
A`
a
A


a \.{A}\.{a}
\{A}\{a}
A
a \~{A}\~{a}
\{A}\{a}
A

A
. a.
a
A

\d{A}\d{a}
\u{A}\u{a}

Aa
a
A

\k{A}\k{a}
\U{A}\U{a}

a
A
Aa

A
a
a
A

\={A}\={a}
\b{A}\b{a}
\r{A}\r{a}
\v{A}\v{a}

10.3.
, , .
, .
, LATEX
Computer Modern, Type1 cm-super. TEX Live . Computer
Modern ( lh).
Computer Modern (, , )
(. 10.1).
Computer Modern Concrete.
. . Computer Modern Euler . concrete
(. 10.2).
Antykwa Tor
unska . anttor (. 10.3). ,
Euler, euler.
, , . TEX Live .
. Type1 The Font Installation Guide (
fontinstallationguide.pdf).

10.4.

, !!!
Z
(x)2
1

e 22 dx = 1
2 0

. 10.1. Computer Modern

125

, !!!
Z
(x) 2
1

e 22 dx = 1
2 0

. 10.2. Concrete Euler

<<, !!!>>
Z
2
1
(x)
2

e 2 dx = 1
2 0

. 10.3. Antykwa Tor


unska Euler
( )

10.4.
, .

10.4.1.
3.3 . 34 , . . , ,
, .
, LATEX, , .
soul
soul :
\so{},
\ul{} \st{}.

,
.

soul . soul ,
, soul
. . soul.pdf.

126

10.

nccstretch
nccstretch ncctools :
\centering
\stretchwith{\,}{\ }

\stretchwith / , , .

\hrule.
\hrulefill :
\rule[]{}{} :
\centering\rule{2pt}{1cm}
\rule[0.5cm]{0.2\textwidth}{1pt}
\rule{0.2\textwidth}{1pt}
\rule[-0.5cm]{0.2\textwidth}{1pt}
\rule[-1cm]{2pt}{1cm}

. 0 (),
.
.

dashrule. nccrules ncctools , .
- mboxfill ncctools.
\mboxfill:
\mboxfill[1.2\width]{\^{}\_\^{}}

_ _ _ _ _ _ _

,
.
, . . \width.
. mboxfill.pdf.

10.4.

127

10.4.2.
TEX . ,
.
\mbox{}.
37
. \mbox . \fbox
, \mbox. . \makebox
\framebox:
\centering
\framebox[\textwidth][l]{\ }

\framebox[0.5\width][c]{\ }

,
.
: l , r , c , s . \width (
), \totalheight ( ), \height ( ) \depth (
). LATEX
, .
\shabox, shadow,
:

\centering\shabox{ }

.
. 248.
:
\ s e t t o w i d t h { }{ }
\ s e t t o h e i g h t { }{ }
\ s e t t o d e p t h { }{ }
, , .

128

10.

minipage
parbox:
\parbox{0.3\textwidth}
{ :}\quad
\begin{minipage}{0.62\textwidth}
.
4 .
, !
\end{minipage}

.
4
:
. ,
!


float . 62.

10.4.3.
. LATEX quote
( ) quatation ( quote
).
,
:
\begin{quotation}
- ,
.
\end{quotation}

,
:
- ,
.

.
, , ,
epigraph. ,
:
\ e p i g r a p h {}{}
, , . .
.
\epigraphwidth \setlength, , :
\ s e t l e n g t h {\ e p i g r a p h w i d t h } { 0 . 3 \ t e x t w i d t h }
(\chapter) , . . \epigraphhead:
\ c h a p t e r { }
\ e p i g r a p h h e a d [ ] { \ e p i g r a p h {}{}}

10.4.

129

, \unitlength.
70. ,
\dropchapter{}.
epigraph.dtx.

10.4.4.
3.3.1 . 35. :
enumerate ,
itemize
,
description .
\item:
\begin{enumerate}
\item ,\label{ex:first}
\item .
\end{enumerate}
\ref{ex:first}\ldots

1) ,
2) .
1. . .

\item . description,
:
\begin{description}
\item[enumerate] "--- ,
\item[itemize] "--- ,
\item[description] "--- .
\end{description}

enumerate ,
itemize ,
description .

, .
. , ,
enumerate itemize:
1) enumerate
)

A.
2) enumerate
itemize

130

10.

enumerate \item -,
babel :
\renewcommand{\ theenumi }{\ asbuk { enumi }}
.
enumii, enumiii, enumiv .
6.2 . 69.
eqlist
description ,
. ,
eqlist, :
\begin{eqlist*}
\item[enumerate] "--- ,
\item[itemize] "--- ,
\item[description] "--- .
\end{eqlist*}

enumerate ,
itemize
,
description .

eqlist eqlist* , eqlist*


. ,
, \longitem.
eqlist.pdf.
desclist
c eqlist desclist ncctools
\begin{desclist}{\bfseries}
{ \hfill---}[description]
\item[enumerate] ,
\item[itemize] ,
\item[description] .
\end{desclist}

enumerate ,
itemize

description .

desclist , , , ,
, .
desclist.pdf.

10.5.

131

paralist
, ,
, paralist:

\begin{inparaenum}
\item enumerate,
\item itemize
\item description.
\end{inparaenum}

1) enumerate,
2) itemize 3) description.

inparaenum
inparaitem. paralist.dtx.

10.5.
? : ,
, . . . . . .
\section, \subsection, \subsubsection, \paragraph \subparagraph.
.
, , .
\tableofcontents. , tex-, toc.

.
- , - . . 10.4
.
\ d o c u m e n t c l a s s [ 1 0 pt ] { s c r a r t c l }
\ u s e p a c k a g e [ warn ] { mathtext }
\ u s e p a c k a g e [ T2A] { f o n t e n c }
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
\ usepackage [ english , r u s s i a n ] { babel }
\ usepackage { i n d e n t f i r s t }
\ t i t l e { }
\ a u t h o r {. \ ,. ~ }
\ b e g i n { document }
\ m a k e t i t l e {}

132

10.
1.1
.

1.1.1 - ,
. .

. .

20 2007 .

1
1.1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1.1.1 . . . . . . . . . . . . . . . . . . . . . . . . . . .

1
2
2

. .

, , 1.1 2
, .

. 10.4.

\ t a b l e o f c o n t e n t s {}
\ s e c t i o n { }
\ label { sec : section }
.
\ s u b s e c t i o n { }
\ label { sec : subsection }
.
\ s u b s u b s e c t i o n [ ] { , }
\ label { sec : subsubsection }
.
.
\ paragraph {}
\ l a b e l { s e c : paragraph }
.
\ subparagraph {}
\ l a b e l { s e c : subparagraph }
.
\ s e c t i o n { , }
. .

10.5.

133

\ s e c t i o n { }
\ label { sec : afterwords }
\ a d d c o n t e n t s l i n e { t o c }{ s e c t i o n }{ }
, , ~\ r e f { s e c : s u b s e c t i o n }
~\ p a g e r e f { s e c : s u b s e c t i o n } ,
.
\ appendix
\ s e c t i o n {}
\ l a b e l { appendix }
\ end { document }
\section ,
\subsection . . tocdepth, , :
\ s e t c o u n t e r { t o c d e p t h }{2}
.
\listoffigures
\listoftables.
lof lot.
-
\ a d d c o n t e n t s l i n e { t o c }{ }{ }
.
(toc, lof lot), . , section, subsection
. LATEX
\protect, .
\appendix .
. \appendix
.
( book , , scrbook) \chapter \part .

134

10.

: \frontmatter ( ), \mainmatter (
) \backmatter.
.
( titlepage) :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt ] { s c r b o o k }
...
%
\ makeindex
\ b e g i n { document }
%
\ frontmatter
\ begin { t i t l e p a g e }

\ end { t i t l e p a g e }
\ t a b l e o f c o n t e n t s {}
%
\ mainmatter
\ c h a p t e r { 1}
\ l a b e l { cha : c h a p t e r 1}
\ c h a p t e r { 2}
\ l a b e l { cha : c h a p t e r 2}
%
\ backmatter
%
\ b i b l i o g r a p h y s t y l e { g o s t 780u}
\ bibliography { b i b f i l e }
%
\ printindex
\ end { document }

10.6. ,

135

10.6. ,

- . , -
,
,
.

10.6.1.
. 131, ,
\label. ASCII-.
aux. ,
( \ref) (\pageref), latex .
, xr.
:
\ u s e p a c k a g e { xr }
\ e x t e r n a l d o c u m e n t [EXT]{ e x t e r n a l d o c }
externaldoc.tex.
, , \ref/\pageref,
EXT-. ,
,
- .
. , equation ( ) theorem (), . ( figure)
( tabular). \label
\caption, .
. ,
amsmath \eqref. \ref
\eqref:
\begin{equation}
\label{eq:1}
x_{1,2}=\frac{-b\pm\sqrt{b^2-4ac}}{2a}
\end{equation}
~\ref{eq:1}\par
~\eqref{eq:1}

1,2 =

2 4
2

10.1
(10.1)

(10.1)

136

10.

, ex
. .
, prettyref .
.
%
\newrefformat{eq}{ \No~\ref{#1}}
: \prettyref{eq:1}

: 10.1

\prettyref
(:), .
 . showkeys.
,
.

10.6.2.
\footnote.
.
. , , , .
.
minipage, :
\begin{minipage}{1.0\linewidth}
\footnote{.}
\footnote[26]{ .}.
\end{minipage}

a z .
a .

\footnote .
, \footnote \protect, :
\ s e c t i o n { \ p r o t e c t \ f o o t n o t e { . } }
, , ,
:
\ f o o t n o t e m a r k [ num ]
\ f o o t n o t e t e x t [ num ] { }

10.6. ,

137

num, \footnote,
. footnote.
nccfoots
nccfoots ncctools
:
\begin{minipage}{1.0\linewidth}
\Footnote{$\alpha$}{.}
\Footnotemark{$\beta$}.
\Footnotetext{$\beta$}{ .}
\end{minipage}

.
.

,
.
footmisc
footmisc ( footmisc.pdf)
. :
perpage
;
para

. , ;
side
;
symbol* ;
norule* .
savefnmark
savefnmark .
:
\saveFN ,
;
\useFN .

\footnote{}\saveFN\oldfoot\par
\useFN\oldfoot

a
a
a

138

10.

10.6.3.
, , .
.
endnotes
endnotes ltxmisc.
: \endnote,
\endnotemark \endnotetext.
\addtoendnotes{}. :
\renewcommand{\ notesname }{ }
\ theendnotes
endnotes
endnotes.sty.
pagenote
endnotes pagenote.
%
\ u s e p a c k a g e [ page ] { p a g e n o t e }
\ makepagenote
...
%
\ p a g e n o t e {}
...
\renewcommand{\ notesname }{ }
\ printnotes
page , . continuous.
.
\printnotes
. \printnotes*
, , . \printnotes*

10.6. ,

139

10.6.4.
, , article, .
\marginpar{}. , , ,
. , , , \reversemarginpar,
\normalmarginpar.
marginnote
\marginpar ,
, ,
. marginnote
, :
\ marginnote [ ] { } [ ]
\marginpar, . ,
. marginnote.pdf.
 , . LATEX mparhack
.
changebar
. changebar .
\cbstart \cbend, .
dvips, pdflatex. . changebar.pdf.

10.6.5. WWW-
, , .
\url .

140

10.

url
url www-,
.
WWW- :
\url{http://www.inp.nsk.su/
~baldin/}.

WWW-
http://www.inp.nsk.su/~baldin/.

%, #, , \. ,
\verb : \url!http://www..ru!.
hyperref
hyperref .

. :
% h y p e r r e f
\ u s e p a c k a g e [ u n i c o d e=t r u e ] { h y p e r r e f }
. ,
. .
pdf-, dvi-, ,
xdvi. unicode=true , .
hyperref
manual.pdf.
, : http://www-sbras.nsc.ru/win/docs/TeX/LaTex2e/docs_koi.html.
 hyperref LATEX.

breakurl

pdflatex hyperref www- ,


latexdvipsps2pdf , .
breakurl.
breakurl hyperref . \burl, \url.
WWW-:
\burl{http://www.inp.nsk.su/~baldin/}.

WWW-: http://www.
inp.nsk.su/~baldin/.

10.7.

141

, preserveurlmacro, \url
\burl. breakurl.pdf.

10.7.
. ,
.

10.7.1. FiXme
. , . .
, -
, .
FiXme :
\fxnote
;
\fxwarning ;
\fxerror
;
\fixme
.
.
draft , , :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , d r a f t ] { s c r b o o k }
, , . draft final
. \listoffixmes
.
\fixme ,
.
fixme. : inline , margin ( ), footnote
index . fixme.pdf.

10.7.2. lineno
lineno .
.
linenumbers.

2
3
4
5

142

3
4
5
6
7
8
9
10
11
12

\linenumbers/\nolinenumbers, , , .
.
,
, \setpagewiselinenumbers.
,
\switchlinenumbers, * ()
.
: \linelabel{ex:lineno}. \ref 9.

lineno.pdf.

10.7.3.
,
,
- ,
draftwatermark.
.
, draftcopy. DRAFT.
dvips, pdflatex.

.
. 10.5 ,
.
,
:

LATEX, Linux .
..

LATEX

10.

e-mail: E.M.Baldin@inp.nsk.su
TEX METAFONT, , .. .

. 10.5. draftwatermark

%
\ usepackage { draftwatermark }
%
\ SetWatermarkScale { 2 . 3 }
%
\ SetWatermarkLightness { 0 . 3 }
%
\ SetWatermarkText {\ t e x t b f { }}

10.7.

143

draftwatermark firstpage, .
0, 1. \SetWatermarkFontSize.
\SetWatermarkAngle{}.
 watermark ncctools , .
bophook, eso-pic wallpaper.

10.7.4.
. ,
.
, ?
\input{ } tex-
. LATEX ,
, \endinput. , \input. .
tex.
, , \include. \includeonly
, .
, . , \include \clearpage, , .
\include:
%
\ input { preheader }
%
\ includeonly {
% intro ,
base ,
% presentation
}
\ b e g i n { document }
\ i n c l u d e { i n t r o } %
\ i n c l u d e { b a s e } %
\ i n c l u d e { p r e s e n t a t i o n } %
\ end { document }

144

10.

\include tex- (
tex ). , .
base.tex.
 \listfiles ,
. .
excludeonly
\includeonly excludeonly , . , .
, , base.tex, \includeonly \excludeonly:
\ i n c l u d e o n l y { i n t r o , base , p r e s e n t a t i o n }
\ excludeonly { intro , presentation }
askinclude
askinclude.

\include. , , .
optional
optional ltxmisc
\opt, :
% v a r i a n t . t e x
\ u s e p a c k a g e [ answer 1 ] { o p t i o n a l }
" .
\ opt { v a r i a n t 1 , answer 1}{\ i n p u t { v a r i a n t 1}}
\ opt { v a r i a n t 2 , answer 2}{\ i n p u t { v a r i a n t 2}}
\ opt {}{ }
\ opt { answer 1}{\ i n p u t { answer 1}}
\ opt { answer 2}{\ i n p u t { answer 2}}

10.7.

145

\AskOption, .
:
\newcommand{\ E x p l a i n O p t i o n s }{ v a r i a n t 1 , v a r i a n t 2 problems ;
answer 1 , answer 2 s o l u t i o n s }
\ AskOption
, :
...
v a r i a n t 1 , v a r i a n t 2 problems ; answer1 , answer2 s o l u t i o n s
S p e c i f y which o p t i o n a l t e x t t o p r o c e s s :
\ UseOption=
:
> l a t e x " \newcommand\ UseOption { answer1 }\ i n p u t { v a r i a n t } "
- Makefile.
optional.sty.

11


, , ,
: . . . .
. .
,

.
.
.
. , . . . , ,
.

11.1.
, LATEX-
. , , . ,
, .
, , ,
.

148

11.

() , ,
. :
( ), 1 ( ), ( ),
( ) ( ).

11.1.
,
.
, , ,
.

. . . .
, ,
. 0.1, .1.
. . . , ..
,
.
, , . .

11.2. tabbing
, ,
tabbing.
1 - . . [11] ,
, , .

11.3. tabular array


\begin{tabbing}
MMMMM \= MMMMM \=
\kill
\textbf{\ } \> \>
\> \> \\

\> \>
\end{tabbing}

149

\\


\=. \kill, , , . ,
\>, \\.
, , .
tabbing
. , , .
LATEX .
, . tabbing
.
LATEX tabbing .
(\) (\ \). / \pushtabs/\poptabs.

11.3. tabular array


LATEX
tabular. array tabular,
, .
\centering
\begin{tabular}[c]{l|ll}
\textbf{\ } & & \\[2mm]\hline
& & \\

& &
\end{tabular}

& .
\\.

150

11.

. .
tabular .
table:
\ b e g i n { t a b l e } [ ht ]
\ c e n t e r i n g%
\ b e g i n { t a b u l a r } [ ] { }

\ end { t a b u l a r }
\ c a p t i o n {}\ l a b e l { tab : metka }
\ end { t a b l e }
. tabular ,
:
t , , ;
c ;
b .
,
.
:
l (left)
;
c (center) ;
r (right) ;
p{} .
.
, :
{n}{ }
n . .
\centering
\begin{tabular}{|*{3}{c|}}
\textbf{} & & \\[2mm]
\hline\hline
& & \\

& &
\end{tabular}

11.3. tabular array

151


|. || . \hline.
.
@{} , . , .
, -
, ,
.
\centering
\begin{tabular}{c||p{2cm}@{$\pm$\ }r|}
\textbf{} & & \\[2mm]
\cline{2-3}
& & \\
\cline{1-1}\cline{3-3}

& & \\ \cline{2-2}


\end{tabular}

,
\ cline { }.
array tools
, tabular, :
m{} , p{},
;
b{} , m{},
.
, array, array.pdf.
tabular .
, :
\centering
\begin{tabular}{r}\hline\hline
\footnote{ }.\\
\hline\hline
\end{tabular}

a .
a

 , ,
, , Publication quality tables in LATEX (booktabs.pdf),
(Simon Fear) booktabs.
, .

152

11.

1.

. 11.1. \caption

1.

. 11.2.
\topcaption topcapt

11.3.1.
(. 5.4.4). ,
, .
, , , .

topcapt, \topcaption,
\caption:
\ b e g i n { t a b l e } [ ht ]
\ t o p c a p t i o n {}\ l a b e l { tab : metka }
\ begin { tabular }
...
\ end { t a b u l a r }
\ end { t a b l e }
topcapt , \caption . 11.1 11.2
. ,
:
\ begin { table }
\ s e t l e n g t h {\ a b o v e c a p t i o n s k i p }{0 pt }
\ s e t l e n g t h {\ b e l o w c a p t i o n s k i p }{10 pt }
\ c a p t i o n {}\ l a b e l { tab : metka }
\ begin { tabular }
...
\ end { t a b u l a r }
\ end { t a b l e }

11.3. tabular array

153

11.3.2.
(), , . :
;
.
, , . .
hhline tools \hhline, , .
hhline.pdf . arydshln
. arydshln-man.pdf .
cellspace
:
\begin{tabular}{c}\hline
$\displaystyle
e = 1+\frac{1}{2}+\frac{1}{6}+\cdots
+ \frac{1}{k!} + \cdots $ \\\hline
\end{tabular}

=1+

1
1
1
+ + +
+
2
6
!

cellspace. , ,
:
\begin{tabular}{Sc}\hline
$\displaystyle
e = 1+\frac{1}{2}+\frac{1}{6}+\cdots
+ \frac{1}{k!} + \cdots $ \\\hline
\end{tabular}

=1+

1
1
1
+ + +
+
2
6
!

l, c r Sl, Sc Sr . S, , S{p{3cm}}.

11.3.3.
\multicolumn{n}{ }{}, : \multirow{n}{}{} .

154

11.

\multicolumn:
\centering
\begin{tabular}{|*{3}{c|}}
\textbf{} & & \\[2mm]
\hline\hline
& \multicolumn{2}{c}{} \\

& &
\end{tabular}

,
, .
\multirow multirow:
\centering
\begin{tabular}{|*{3}{p{1cm}|}}
\textbf{} & & \\[2mm]
\hline\hline
& \multirow{2}{1cm}{} & \\

&
&
\end{tabular}

README .
:
\ multirow { }{}{}
\ multirow { }{}
, , ,
. .
. ,
colortbl:
\centering %
\begin{tabular}{c>{\columncolor{yellow}}cc}
\backslashbox{}{} & & \\
\rowcolor{yellow}
&
& \\

& \multirow{-2}*{} &


\end{tabular}

PP

PP
PP

colortbl .
colortbl.pdf .
\backslashbox{}{},
, slashbox. . slashbox.tex.

11.3. tabular array

155

lh makecell.
\makecell, , . .
. (makecell.pdf)
(makecell-rus.tex).

11.3.4.
. ,

.
dcolumn tools :
\centering
\begin{tabular}{|c|l|D{.}{,}{5}|}
0.3141 & 0.3141 & 0.3141 \\
3.141 & 3.141 & 3.141 \\
31.415 & 31.415 & 31.41 \\
\end{tabular}

0.3141
3.141
31.415

0.3141
3.141
31.415

0,3141
3,141
31,41

: D{delim}{output}{nfruc}, delim , ( ), output , delim (, ), nfrac


(
). dcolumn.pdf.
numprint ( numprint.pdf)
. \numprint :
\numprint[\text{}/\text{}]{299792458}\par
\numprint{2.718281828459045}\par
\numprint{6e23}\par
\numprint{+-0.02}

299 792 458 /


2,718 281 828 459 045
6 1023
0,02

,
. numprint n . ,
, .

156

11.

n- numprint:
\centering
\begin{tabular}{|n{3}{4}|n{2}{3}|n{1}{2}|}
0.3141 & 0.3141 & 0.3141 \\
3.141 & 3.141 & 3.141 \\
31.41 & 31.41 & 31.41 \\
314.1 & 314.1 & 314.1 \\
\end{tabular}

0,314 1
0,314 1 0,314 1
3,141
3,141 3,141
31,41
31,41 31,41
314,1
314,1 314,1

rccol , dcolumn, . ,
, . rccol,
rccol.pdf, .
, .
warpcol . warpcol.pdf
, .

11.3.5.
CSV ( . Comma Separated Values , )
, .
csvtools.
csvtools.pdf , , tex-.

11.3.6. tabular
tabularx tools tabular , X.
\centering
\begin{tabularx}{\textwidth}{|D{.}{,}{4}|X|c|}
0.3141 & & 0.3141 \\
3.141\footnote{ tabularx
}
& 3.141 & 3.141
\end{tabularx}

0,3141

3,141a

3.141

0.3141

3.141

a
tabularx

tabularx .
X p{}, ,

11.4.

157

. , X,
. , ,
(tabularx.pdf).
tabulary tabular, array.
.
tabulary.pdf. .
ctable . \ctable, tabular table.
\ctable
. ctable.pdf.

11.4.
tabular ,
.

: supertabular longtable, .
,
.
, , . : supertabular.pdf supertabular longtable.pdf longtable
tools.
longtable supertabular , LATEX.
, .
supertabular supertabular
mpsupertabular,
minipage, .
xtab
, , xtab.
supertabular . xtab mpxtabular,
xtabular ,

158

11.

minipage, ,
.
xtab :
%
\ t o p c a p t i o n { } \ l a b e l { tab : xtab }
%
\ t a b l e f i r s t h e a d {\ h l i n e & \\\ h l i n e }
%
%
\ t a b l e h e a d {\ multicolumn {2}{ c }%
{\ tablename \ \ t h e t a b l e {} " }\\
\ hline
& \\ \ h l i n e }
%
%
\ t a b l e l a s t h e a d {\ multicolumn {2}{ c }%
{\ tablename \ \ t h e t a b l e {} " }\\
\ hline
& \\ \ h l i n e }
%
\ t a b l e t a i l {\ h l i n e \ multicolumn { 2 } { | r | }%
{ }\\ \ h l i n e }
%
\ t a b l e l a s t t a i l {\ h l i n e }
\ begin { center }
\ begin { xtabular }{| l | p{0.5\ textwidth }|}
x t a b u l a r & t a b u l a r .
,
t a b u l a r , x t a b u l a r \\
...
\\
\ end { x t a b u l a r }
\ end { c e n t e r }
, , xtab.pdf.

11.5.

159

11.5.
,
. \tableofcontents, \listoffigures \listoftables .
\centering
\begin{tabular}{p{0.7\textwidth}@{}r}
1\dotfill & 2 \\
2\dotfill & 10 \\
3\dotfill & 124
\end{tabular}

1 . . . . . . . . . . . . . . . . . . . 2
2 . . . . . . . . . . . . . . . . . . . 10
3 . . . . . . . . . . . . . . . . . . . 124

\dotfill ( ).
listliketab
listliketab
, .
:
\ s t o r e s t y l e o f { enumerate }
\ begin { l i s t l i k e t a b }
\ newcounter {tabenum }\ s e t c o u n t e r {tabenum }{0}
\newcommand{\ nextnum }{\ a d d t o c o u n t e r {tabenum }{1}\ thetabenum . }
\ b e g i n { t a b u l a r }{L>{\ b f }l@{~~~~}>{\ b f }l@{~~~~}>{\ b f } l }
\nextnum &
& & \\
\nextnum & & & \\
\nextnum & &
& \\
\ end { t a b u l a r }
\ end { l i s t l i k e t a b }
\nextnum .
:
1.
2.

3.
listliketab.pdf

160

11.

11.6. ?
tableaux tabvar
.
 .
!

32

()

() +
&

0 +

+
& &

3
2

tabvar tableaux. tabvar.pdf demo.tex.


, -
. pb-diagram ,
:

9.3%

- 0

65 .

6104
420

6.6103

?
/

5
710-

12%

?
+

50

12

.
, ,
,
, .

, , , .
. , .
- . , - , , , , , ,
.
, .
,
.

162

12. -

12.1.
\tableofcontents (toc-) LATEX . \listoffigures
(lof-) \listoftables (lot-).
, 10.5.
- \addtocontents{toc}{}. toc () lof
( ) lot ( ). ,
\protect,
.
shorttoc

. shorttoc :
\ s h o r t t a b l e o f c o n t e n t s { }{1}
, .
(\section), 1.
, tocdepth.
tocloft
. tocloft , ,
. tocloft.pdf. ,
Z, toc or
lof lot, X part, chap, sec, subsec, subsubsec,
fig, tab . , ,
:
\ a d d t o l e n g t h {\ c f t s e c n u m w i d t h }{1 ex }
,
() :
\renewcommand{\ c f t d o t }{\ ensuremath {\ a s t }}
:
\renewcommand{\ c f t c h a p l e a d e r }{\ c f t d o t f i l l {\ c f t c h a p d o t s e p }}
\renewcommand{\ c f t c h a p d o t s e p }{\ c f t d o t s e p }

12.1.

163

tocbibind
1 . \addcontentsline,
, ,
tocbibind. tocbibind
:
notbib
;
notindex ;
nottoc
;
notlot
;
notlof
;
chapter , , ;
section , , ;
numbib
, ;
numindex , ;
none
, .
tocbibind.pdf.
minitoc
, minitoc
6 .
:
\ d o m i n i t o c %
\ d o m i n i l o f %
\ d o m i n i l o t %
\ t a b l e o f c o n t e n t s %
\listoffigures
%
\listoftables
%
\ c h a p t e r { }
\ m i n i t o c %
\ mtcskip
\ m i n i l o f %
\ mtcskip
\ m i n i l o t %
minitoc.pdf.
1 KOMA-Script bibtotoc
idxtotoc .

164

12. -

12.2.

. ,
myheadings :
\ p a g e s t y l e { myheadings }
\ markboth { }{ }
, \markright,
. fancyhdr.
fancyhdr
,
\pagestyle .
..

112

..

cxii

fancyheadings

. 12.1. fancyhdr
fancyhdr . : , , , \textwidth,
, ,
( , , ). fancyhdr:
\ usepackage { fancyhdr }
...
\ b e g i n { document }
\ p a g e s t y l e {empty} %
\ p a g e s t y l e { f a n c y } %

12.2.

165

\ l h e a d {. . }
%
\ chead{~\a r a b i c { page}~} %
\ rhead {}
%
%
\ c f o o t {~\roman{ page}~}
\ l f o o t {\ h s p a c e { 0 . 7cm} }
\ r f o o t { \ t e x t b f { f a n c y h e a d i n g s }}
. 12.1. page
.
/ , , :
\ rhead [ ] { }
, , .
, ,
fancyhdr.pdf.
nccfancyhdr
nccfancyhdr ncctools
fancyhdr. nccfancyhdr , fancyhdr. nccfancyhdr.pdf , , ,
, , .
technics
fancyhdr technics.
, . 12.2.
. ,
inputenc. fancyhdr, technics.sty .

166

12. -

. . E.M.Baldin@inp.nsk.su

technics

30 2007 .

2007

. 12.2. technics

12.3.
. .
. -, , -, , -,
.
.

\ c i t e [ ] { }
BibTEX, 12.4, thebibliography:
\ c i t e [ ] { rozenko 2005}.
\ b e g i n { t h e b i b l i o g r a p h y }{9}
\ b i b i t e m { rozenko 2005} ..
\LaTeX . \ newblock : . ~,
2 0 0 5 . 398~ .
\ end { t h e b i b l i o g r a p h y }
\newblock . thebibliography , . ,
10 , , , 9, ,
99 .

12.3.

167

[1, ].


[1] .. LATEX. : .
, 2005. 398 .

. 12.3.
thebibliography.
, compactbib.
.
.
,
aux.
LATEX.
\cite ,
, LATEX [8, 9, 10]:
\ c i t e { L v o v s k i j 2003 , K o t e l n i k o v 2004 , Rozhenko 2005}

.
, breakcites
ltxmisc.
\cite \nocite. \nocite ,
.
 , - :
\ c i t e { 2004}
...
\ b i b i t e m { 2004}
citehack:
\ usepackage { c i t e h a c k }
, , .

168

12. -

file.tex file.bib
.bst
LATEX
.aux BibT X
E
LATEX
.aux

.bbl

.blg

LATEX
. 12.4. LATEX+BibTEX: tex LATEX-, bib , bst , blg log- BibTEX, bbl
, aux

12.4. BibTEX
. - ,
, 7.80-002 7.1-843 . . , , , , www-.
,
, ,
-.
BibTEX,
thebibliography, . BibTEX ,
Google Scholar (http://scholar.google.com/), , http://arxiv.org
BibTEX.
 , BibTEX, Emacs RefTeX JabRef .
2 , 2000 .
, - - .
3 7.1-2003. .

12.4. BibTEX

169


[1] , . LATEX LATEX 2 : .
. / . , . , . . .: , 1999. 606 .
[2] , . . LATEX. / . . . .:
, 2003. 448 . 3- ., . .
[3] , . . LATEX -. / . . , . . .
: , 2004. 496 . 3- ., . .
[4] , . . LATEX. / . . ; .
. . . : . , 2005. 398 .

. 12.5. , gost780u
 , Emacs Java, gBib KBib Gnome KDE .
bibtex2html html-. ,
.
, BibTEX
bib. \bibliography
LATEX-, :
\ b i b l i o g r a p h y s t y l e {}
\ b i b l i o g r a p h y { bib- }
:
> l a t e x mybook . t e x
> b i b t e x mybook
> l a t e x mybook . t e x
, bib- , aux latex.
LATEX .
plain . . , bibtex
bibtex8, --csfile
4 .
4 L
AT X cp866
E
cp866rus.csf. .

170

12. -

unsrt . plain .
alpha . . .
abbrv . ,
. plain.
BibTEX, 7.80-00
7.1-84: gost780s/gost71s, plain, gost780u/gost71u, unsrt. gost780.pdf gost71.pdf. ,
LATEX, BibTEX-. TEX Live 2007 200 .
:
@book{ Gussens 1999 ,
a u t h o r = {. and . and . } ,
t i t l e = { \LaTeX{ }
\LaTeXe : . . } ,
y e a r = { 1999 } ,
i s b n = {5030033254} ,
p u b l i s h e r = {} ,
a d d r e s s = {. } ,
numpages = { 606 } ,
language = { r u s s i a n } ,
OPTnote = { }
}
at @ .
-. BibTEX ,
5 . , BibTEX .
(BibTEX ).
ritcle . : author, title, journal, year.
: volume, number, pages, month, note, annote.
Book . : author editor, title, publisher, year.
: volume, number, series, address, edition, month, note,
annote.
5 OPT (noteOPTnote),
, .

12.4. BibTEX

171

Booklet . : title. : author,


howpublished, address, month, year, note, annote.
Conference InProceedings , . : author, title. : crossref,
booktitle, pages, year, editor, volume, number, series, address, month, organisation, publisher, note, annote.
Proceedings . : title, year. : booktitle, editor, volume, number, series, address, month,
organisation, publisher, note, annote.
InBook , ,
. : author editor, title,
chapter, publisher year. : volume number, series,
type, address, edition, month, pages, note, annote.
InCollection . : author,
title, booktitle. : crossref, pages, publisher, year, editor,
volume number, series, type, chapter, address, edition, month, note, annote.
Manual . : title. : author, organistaion, address, edition, month, year, note, annote.
PhdThesis . : author, title, school, year.
: address, month, note, annote.
MastersThesis .
PhdThesis.
TechReport . : author, title, institution, year. : type, numer, address, month, note, annote.
Unpublished . :
author, title, note. : month, year, annote.
Misc , .
. : author, title, howpublished, month, year,
note, annote.
. ,
, crossref,
. BibTEX
. ,
author and.
- gost780u/gost71u gost780s/gost71s

172

12. -

file.tex
LATEX
.tex
LATEX

.idx

.ist

MakeIndex
.ind

.ilg

. 12.6. LATEX+MakeIndex : tex LATEX-, idx (), ist , ilg log MakeIndex, ind
numpages language
plain. language russian, ukrainian
english .

12.5.
\makeindex. C, , \index:
\ i n d e x { } . . .
\index , ,
, idx.
idx- . idx- ,
. rumakeindex ind.
:
\ i n p u t {ind-}
\printindex makeidx. \printindex LATEX . makeidx
,
.

12.5.

173


MakeIndex, 110
, 110111
makeindex, . rumakeindex
rumakeindex, 110, 111
xindy, 111
. 12.7.
rumakeindex , sed
LATEX koi8-r

makeindex.
, , , .
makeindex ( makeindex.dvi)
, ,
. , ,
. xindy (. 12.6).
\index !, ", @ |.
.
\index, " ( ). . 12.7
. .

!:
% 110 111
\ i n d e x { ! rumakeindex }
\index
.

174

12. -

| . see:
\ i n d e x { ! makeindex | s e e { rumakeindex }}
makeindex see \see, makeidx.
. 12.7
makeindex.
:
% 110
\ i n d e x { | ( }

% 111
\ i n d e x { | ) }
- .
:
% 110
\ i n d e x {MakeIndex@\ t e x t i t { MakeIndex }textbf
@ \index. , .
splitidx
LATEX
. , . splitidx. mybook.tex
:
%
\ usepackage [ s p l i t ] { s p l i t i d x }
%
\ makeindex
% ( i d x )
\ newindex [ ] { i d x }
% ( aut )
\ newindex [ ] { aut }
...

12.6. xindy

175

%
%
\ i n d e x {}
%
\ s i n d e x [ aut ] { }
%
\ p r i n t i n d e x [ aut ]
%
\ printindex [ idx ]
\newindex,
,
. , \sindex
. mybook.idx . . aut
mybook-aut.idx.
:
>
>
>
>

l a t e x mybook . t e x
rumakeindex mybook . i d x
rumakeindex mybookaut . i d x
l a t e x mybook . t e x

,
TEX ,
16. split splitindex.pl,
.
splitidx.pdf.

12.6. xindy
xindy (http://www.xindy.org/) makeindex.
xindy rumakeindex. xindy . xindy makeindex.
xindy ( c see . 174) ,
.

176

12. -

file.tex
LATEX

.glo

xindy

.tex
LATEX

.xdy

.gls

. 12.8. LATEX+xindy : tex LATEX-,


glo (), xdy
, gls
xindy
.
, , . , xindy
6 LATEX. .
, , .
 , xindy,
. .
xindy perl texindy:
> texindy

L r u s s i a n C koi8 r . i d x

idx- . -L
(, belarusian ukrainian), -C
(, utf-8, cp1251 koi8-u).
texindy xindy, .
xdy. , xindy. Lisp.
-M, .
(,
texindy):
6 xindy GNU/Linux, ,
Debian (Lenny).

12.7.

177

,
, ,
xindy , ; . ; .

. 12.9.
:
word-oder . . , -l;
letter-order . -l;
numeric-sort , 7
13. ;
keep-blanks
;
ignore-hyphen ;
ignore-punctuation .
:
page-ranges .
(, 35, 36, 37 38 ), (3538). -r;
book-order . : , ,
.

12.7.
. ,

178

12. -

. . , , makeidx xindy.
makegloss
\makegloss, ,
\glossary,
\makeglossary. . 12.8 LATEX xindy .
, , makeglos.
makeglos.pdf, makeglos.tex. , .
%
\ u s e p a c k a g e { makeglos }
% g l o
\ makeglossary
...
%
%
\renewcommand{\ g l o s s a r y n a m e }{ }
%
\ a d d c o n t e n t s l i n e { t o c }{ s e c t i o n }{\ g l o s s a r y n a m e }
% g l s
\ p r i n t g l o s s a r y {}
%
\ g l o s s a r y { : ,

,
}
\ g l o s s a r y { : , }
\ g l o s s a r y { xindy | i s {
, }}
\ g l o s s a r y { xindy | s e e { }}
\ g l o s s a r y { xindy | s e e a l s o { }}
.
, is.
\glossary .

12.7.

179

\glossaryname . \glossaryintro,
.
see seealso.
glo- \gsee \galso:
> t e x i n d y . g l o o . g l s M makeglos . xdy \
L r u s s i a n C koi8 r

, texindy
-M makeglos.xdy. , makeglos.
.
gloss
gloss BibTEX.
bib-.
:

@gd{gnu ,
word = {} ,
d e f i n i t i o n = { }
}
gnu , \gloss. word . . hyperref ,
. definition.
:
%
\ usepackage { g l o s s }
% g l s . aux
\ makegloss
...
%
%
\ g l o s s {gnu}
%
\renewcommand{\ g l o s s n a m e }{ }

180

12. -

%
\ p r i n t g l o s s {|<< bib | }
:
tex-,
BibTEX gls.aux, :
> b i b t e x 8 bib- . g l s
tex- ,
tex- .
. gloss.dvi
nomencl
nomencl .
,
, .
%
\ u s e p a c k a g e [ r u s s i a n ] { nomencl }
% nlo
\ makenomenclature
...
%
\ no me n c l a t u r e [W] { \ Warning }{ }
\ no me n c l a t u r e [ E] { \ E r r o r }{}
%
\ printnomenclature
\nomenclature .
, ,
.
.
makeindex
nomencl.ist:
> makeindex . n l o s nomencl . i s t o . n l s

nomencl.pdf.

13

.
, , ,
amsmath:
\ u s e p a c k a g e {amsmath}
, .

13.1.
, amsmath
amsfonts amssymb.

13.1.1.
LATEX .
. ,
.
:
\mathbin . (+),
(), ( );
\mathrel . (>),
(<), (=);

182

13.

\mathop

.
, \sin (sin), \sum ( ), \lim (lim).

:
\mathord . a (),
\zeta (), \to ().
:
\mathopen ;
\mathclose ;
\mathinner . (. . .);
\mathpuct . .

13.1.2.
, LATEX,
The Comprehensive LATEX Symbol List.

pdf- symbols-a4.pdf.

2
3

$
S
8
F
N
s


\aleph
\Box
\Diamond
\emptyset
\forall
\Im
\infty
\nabla
\ni
\Re
\surd
\wp


\angle

\bot

\diamondsuit

\exists

~
\hbar

\imath

\jmath
0

\natural

\partial

\sharp

\top

\backslash
\clubsuit
\ell
\flat
\heartsuit
\in
\mho
\neg
\prime
\spadesuit
\triangle


\mathdollar
. . . \mathellipsis
\mathparagraph
\mathsterling
\mathsection
\mathunderscore
(amssymb)
\backprime
k
\Bbbk
i \beth
\bigstar
 \blacklozenge
 \blacksquare
\blacktriangle
H \blacktriangledown r \circledR
\circledS
{
\complement
k \daleth
\diagdown
 \diagup
\eth

13.1.
`
}
@
O
2

\Finv
\hslash
\nexists
\triangledown

183
\Game
\lozenge
\sphericalangle
\varnothing

]

M

\gimel
\measuredangle
\square
\vartriangle

(wasysym)
\Box
3 \Diamond
 \varangle
\wasytherefore


(Re) (Im)
(\Re) (\Im) .
:
\renewcommand{\Re}{\ t e x t {Re}}
\renewcommand{\Im}{\ t e x t {Im}}

13.1.3.
, .
,
. fixmath was
.
was upgreek,
.

\beta
\gamma
\varepsilon \zeta
\vartheta
\iota
\mu
\nu
\pi
\varpi
\sigma
\varsigma
\phi
\varphi
\omega
\Gamma
\Lambda
\Xi
\Upsilon
\Phi

\alpha
\epsilon
\theta
\lambda
o
\varrho
\upsilon
\psi
\Theta
\Sigma
\Omega

(amssymb)
\digamma \varkappa

\delta
\eta
\kappa
\xi
\rho
\tau
\chi
\Delta
\Pi
\Psi

184

13.

\upalpha
\upepsilon
\uptheta
\uplambda
\uppi
\upsigma
\upphi
\upomega
\Uplambda
\Upupsilon

(upgreek)
\upbeta
\upgamma
\upvarepsilon \upzeta
\upvartheta
\upiota
\upmu
\upnu
\upvarpi
\uprho
\upvarsigma
\uptau
\upvarphi
\upchi
\Upgamma
\Updelta
\Upxi
\Uppi
\Upphi
\Uppsi

\updelta
\upeta
\upkappa
\upxi
\upvarrho
\upupsilon
\uppsi
\Uptheta
\Upsigma
\Upomega

13.1.4.
, , :

\acute{a}
\dot{a}
\hat{a}

\bar{a}

...

\ddot{a}
\mathring{a}

\breve{a}
\dddot{a}
\tilde{a}

\check{a}
\grave{a}
\vec{a}

amsxtra
, :

A\spcheck
A\sphat

A\spdot
.. A\spddot
A\sptilde

...

A\spdddot

, , :
, , `

. amsmath

.
amsfonts :
\[\begin{split}
&\widehat{\text{}}\\
&\widetilde{\text{ }}
\end{split}\]

,
.

13.1.

185

\overleftarrow{abc}

\overrightarrow{abc}
\underline{abc}

\overline{abc}
\overbrace{abc}
\underbrace{abc}

cancel \cancel, \bcancel \xcancel,


, . . \cancelto{}{},
, :
(2(
2
=(
5
(
X2 XX
X
2 = 22

\begin{align*}
&\cancel{2\times2=5} &\xcancel{2+2=3}\\
&\bcancel{2^2=22}
&\cancelto{5}{2+3}
\end{align*}

h
h2(
(
h
2+
=(
3
(
h
5
:

2+
3


13.1.5.
:

\cdotp
\ldotp

...

\cdots
\ldots

:
..
.

\colon

..

\ddots

\vdots

[11] ,
, , \ldots.
.
\cdots. .
\[\begin{split}
&a_1+a_2+\ldots+a_n\\
\text{ \ \ } &a_1, a_2,\ldots,a_n,\\
\text{ !\ } &a_1a_2\cdots a_n
\end{split}\]

1 + 2 + . . . +
1 , 2 , . . . , ,
! 1 2

 amsmath \dots
, \ldots \cdots.

186

13.

13.1.6.
, . , ()
(-), , .
textcomp :
(textcomp)
\textdegree
\textdiv
\textfractionsolidus \textlnot
\textminus
\textonehalf
\textonequarter
\textonesuperior
\textpm
\textsurd
\textthreequarters
\textthreesuperior
\texttimes
\texttwosuperior

13.1.7.
(+)
() .


\amlg
* \ast *
\bigtriangledown \bigtriangleup
\cap

\cdot
\cup
\dagger
\diamond
\div
\mp
\odot
\oplus
\oslash
\pm
 \rhd
\sqcap
\sqcup
\times
\triangleleft
\unlhd
 \unrhd
\vee
\wedge

\bigcirc
\bullet
\circ
\ddagger
\lhd
\ominus
\otimes
\setminus
\star
\triangleright
\uplus
\wr

(amssymb)
Z \barwedge
\boxdot
\boxminus
 \boxplus
 \boxtimes
e \Cap

\centerdot
~ \circledast
} \circledcirc
 \circleddash
d \Cup
g \curlyvee
f \curlywedge
> \divideontimes
u \dotplus
[ \doublebarwedge | \intercal
h \leftthreetimes
n \ltimes
i \rightthreetimes o \rtimes

13.1.
r

\smallsetminus

187
Y

\veebar

(wasysym)
 \lhd
 \LHD
# \ocircle
 \rhd
 \RHD
 \unlhd
 \unrhd

13.1.8.

\approx
\cong
\equiv
\mid
\perp
\sim
\succ

\geq
\ll

\sqsubseteq
\supset

/
u
w
m
2
P
t


\asymp

\dashv
\frown
|= \models
\prec
\simeq
\succeq

.
=


\gg

= \neq

\sqsupseteq
\supseteq


\ne
< \not<
>

\not\approx
\not\asymp

=
\not\equiv
\not\ge

\not\ne
\not\preceq

\not\prec
\not\propto

\not\simeq
\not\sqsubseteq
\not\succ
\not\succeq

\not\supset
\not\supseteq

\notin

\bowtie
\doteq
\preceq
\parallel
\propto
\smile
\vdash
\leq

\subset
\subseteq
\not>
\not\cong
\not\le
\not\perp
\not\sim
\not\sqsupseteq
\not\subset
\not\subseteq

(amssymb)
\approxeq

\backepsilon
v \backsim
\backsimeq

\because
G
\between
\Bumpeq
l \bumpeq
$ \circeq
\curlyeqprec
3 \curlyeqsucc
+ \doteqdot
\eqcirc
; \fallingdotseq
( \multimap
\pitchfork
w \precapprox
4 \preccurlyeq

188

13.
q
v

\precsim
\shortparallel
\succapprox
\therefore
\varpropto
\Vvdash

:
a
<

1
>

'

(amssymb)
\eqslantgtr
0 \eqslantless
= \geqq
\geqslant
\ggg
 \gnapprox
\gneq
\gneqq
 \gnsim
\gtrapprox
m \gtrdot
R \gtreqless

T

/

\gtreqqless
\gvertneqq
\lessapprox

5
l

\gtrless
\leqq
\lessdot

&
6
Q

\gtrsim
\leqslant
\lesseqgtr




\lesseqqgtr
\lll
\lneqq
\ngeq





\lessgtr
\lnapprox
\lnsim
\ngeqq

\lesssim
\lneq
\lvertneqq
\ngeqslant

\ngtr
\nleqslant

\nleq
\nless

\nleqq

*
<
j
c
%
!

(amssymb)
\nsubseteq
+ \nsupseteq
# \nsupseteqq
\sqsubset
= \sqsupset
b \Subset
\subseteqq
( \subsetneq
$ \subsetneqq
\Supset
k \supseteqq
) \supsetneq
\supsetneqq
\varsubsetneq
& \varsubsetneqq
\varsupsetneq
' \varsupsetneqq

/

3


(amssymb)
\ncong
\nmid

\nparallel
\nprec
 \npreceq
.
\nshortmid
\nshortparallel  \nsim
 \nsucc
\nsucceq
2
\nvDash
0 \nvdash
\nVDash
 \precnapprox
 \precnsim
\succnapprox
 \succnsim

J
6
7

(amssymb)
\blacktriangleleft
I \blacktriangleright
\ntriangleleft
5 \ntrianglelefteq
\ntriangleright
4 \ntrianglerighteq

\risingdotseq
\smallfrown
\succcurlyeq
\thickapprox
\Vdash

p
`
%

\shortmid
\smallsmile
\succsim
\thicksim
\vDash

13.1.

189

E
D
B

\trianglelefteq
\trianglerighteq
\vartriangleright

,
C

?
1
<

(wasysym)
\apprge
> \apprle
 \invneg
\Join
; \leadsto
 \logof
\sqsubset
= \sqsupset
 \wasypropto

\triangleq
\vartriangleleft

13.1.9.


x
L99




W
#


\Downarrow
\hookleftarrow
\leadsto
\Leftarrow
\leftharpoonup
\leftrightarrow
\Longleftarrow
\Longleftrightarrow
\Longrightarrow
\mapsto
\nwarrow
\rightarrow
\rightharpoonup
\searrow
\uparrow
\updownarrow

\downarrow
\hookrightarrow
\leftarrow
\leftharpoondown
\Leftrightarrow
\longleftarrow
\longleftrightarrow
\longmapsto
\longrightarrow
\nearrow
\Rightarrow
\rightharpoondown
\rightleftharpoons
\swarrow
\Uparrow
\Updownarrow

(amssymb)
\circlearrowleft

\circlearrowright
\curvearrowleft
y
\curvearrowright
\dashleftarrow
99K \dashrightarrow
\downdownarrows

\downharpoonleft
\downharpoonright

\leftarrowtail
\leftleftarrows

\leftrightarrows
\leftrightharpoons
! \leftrightsquigarrow
\Lleftarrow
"
\looparrowleft
\looparrowright

\Lsh
\rightarrowtail

\rightleftarrows
\rightleftharpoons

\rightrightarrows
\rightsquigarrow

\Rsh

190

13.



:
<
;




\twoheadleftarrow
\upharpoonleft
\upuparrows


\nLeftarrow
8
\nLeftrightarrow
=
\nRightarrow
9

\twoheadrightarrow
\upharpoonright
(amssymb)
\nleftarrow
\nleftrightarrow
\nrightarrow

- (amssymb)
\overleftrightarrow{abc}
\underrightarrow{abc}

\underleftarrow{abc}
\underleftrightarrow{abc}

\xrightarrow{abc}

(amssymb)
\xleftarrow{abc}

13.1.10.
4.3.9 . 52 . LATEX -.

(
]

(
]


)
[
(
)
)
[
{
}
]
{
\{
}

\backslash

\Downarrow

\langle

\lfloor

\rangle

\rfloor
\uparrow

\updownarrow \Updownarrow

[
\}
\downarrow
\lceil
\rceil
\Uparrow

(amssymb)

\lvert
\lVert
|
\rvert
\rVert

\llcorner

\ulcorner

\urcorner

\lrcorner

13.2.

191

13.1.11.
T\

JK

NO
U]

V^
R

QY


S[
\bigcap
\bigcup
LM
\bigodot
\bigoplus
FG
\bigotimes
\bigsqcup
W_
\biguplus
\bigvee
`a
\bigwedge
\coprod
I
H
\int
\oint
X
P
\prod
\sum

(amsmath)
ZZ
ZZZ
RR
RRR
\iint
\iiint
ZZZZ
Z
Z
RRRR
R
R
\iiiint

\idotsint

13.2.
, ,
4.3.7 . 50, . 13.1.11 ,
.
commath
commath ( commath.pdf.) , .
\[\begin{split}
&\dif{x}\quad \Dif{X}\\
&\od{f}{x}\quad \od[2]{f}{x}\\
&\pd{f}{x}\quad \pd[2]{f}{x}\quad
\md{f}{5}{x}{2}{y}{3}\\
&\eval[0]{f(x)}_{x=0}\quad
\eval[2]{f(x)}_{x=0}\quad
\eval{f(x)}_{x=0}\\
&\fullfunction{f}
{\mathbb R}{\mathbb R}{x}{\sqrt{x}}
\end{split}\]

dx

DX

df
dx

d2 f
dx2

f
x

2 f
x2

5 f
x2 y 3

f (x)|x=0
f

f (x)

f (x)

x=0

R
x

x=0

192

13.

esdiff
\frac{\partial^3 f}{\partial x\,\ partial y^2}? , , , esdiff :
\[\begin{split}
&\diff{f}{x}\quad\diff[n]{f}{x}\quad
\diff*{f}{x}{x_0}\quad\diff*[n]{f}{x}{x_0}\\
&\diffp{f}{x}\quad\diffp[3]{f}{x}\quad
\diffp{f}{{x^3}{y^2}}\quad\diffp*{P}{V}{T}
\end{split}\]

df
dx

dn f
dxn

f
x

3f
x3

5f
x3 y 2

df
dx

x0

dn f
dxn x0

P
V T

esdiff.dtx.
esdiff :
text
\textstyle
. \displaystyle;
italic d (). roman;
thin, med big d .
;
thinp, medp bigp , , ;
thinc, medc bigc
\ diffp {f}{{x}{y}}. .
esdiff thinc:
\ usepackage [ thinc ] { e s d i f f }


.
.
wasysym, integrals. euler,
Concrete ( concrete,
10.3 . 124).
\[%
\int\quad\iint\quad\iiint\quad\oint
\]

ZZ

ZZZ

13.3. ,

193
w

\[%\usepackage[integrals]{wasysym}
\int\quad\iint\quad\iiint\quad\oint
\]
\[%\usepackage{concrete}
\int\quad\iint\quad\iiint\quad\oint
\]

x
Z

ZZ

z
ZZZ

13.3. ,

array (. 11.3 . 149).
\[\left(\begin{array}{@{}ccc@{}}
a_{11}&a_{12}&a_{13}\\
a_{21}&a_{22}&a_{23}\\
a_{31}&a_{32}&a_{33} \end{array}\right)
\begin{pmatrix}x_1\\x_2\\x_3\end{pmatrix}=
\begin{pmatrix}b_1\\b_2\\b_3\end{pmatrix}\]

11
21
31

12
22
32


1
1
13
23 2 = 2
3
3
33

array @{} . array matrix


. , .
\begin{gather*}
\begin{matrix}1&2\\3&4\end{matrix}\quad
\begin{pmatrix}5&6\\7&8\end{pmatrix}\quad
\begin{bmatrix}9&A\\B&C\end{bmatrix}\\
\begin{vmatrix}D&E\\F&10\end{vmatrix}\quad
\begin{Vmatrix}11&12\\13&14\end{Vmatrix}
\end{gather*}

1
3

2
4

5
7

6
8


10

11

13

12

14

, ,
\hdotsfor[ ]{ }:
\[\left(\begin{array}{@{}llll@{}}
a_{11}&a_{12}&\ldots &a_{1n}\\
a_{21}&a_{22}&\ldots &a_{2n}\\
\hdotsfor[2.5]{4}\\
a_{n1}&a_{n2}&\ldots &a_{nn}
\end{array}\right)\]

0
a11 a12
Ba21 a22
B
@ . . . . . .
an1 an2

1
. . . a1n
. . . a2n C
C
. . . . . . A
. . . ann

194

13.

tensor
tensor:
\[\begin{split}
&M\indices{^a_b^{cd}_e}\quad
\tensor[^a_b^c_d]{M}{^a_b^c_d}\\
&\tensor*[^*_*]{\prod\nolimits}{^*_*}\quad
\tensor*{M}{*^{i_1}_{m_1}^{i_2}_{m_2}
^{i_3}_{m_3}^{i_4}_{m_4}}\\
&\tensor*[^{14}_6]{\mathrm{C}}{}\quad
\nuclide[14][6]{C}
\end{split}\]

M ab cde
Y

a c
a c
b dM b d
i1 i2 i3 i4
Mm
1 m2 m3 m4

14
14
6C
6C

\indeces,
\tensor, . ,
* , .
. \nulide.
tensor.pdf.
amscd
array, CD, amscd1 , .
\[\begin{CD}
F(X)
@V{\eta_X}VV
G(X)
\end{CD}\]

F (f )

@>{F(f)}>>

F(Y) \\
@VV{\eta_Y}V \\
@<<{G(f)}< G(Y) \\

F (X)

F (Y )
?
?
?
?
X y
y Y
G(X)

G(Y )
G(f )

@>>>, @<<<, @VVV, @AAA , ,


. .
, , , .
, : ,
.
1 amscd -T X, amsmath
E
.

13.4.

195

 amscd ,
, , xypic.

amsmath \binom,
:
( )


( + ) =

\[(x+y)^n=\sum_{k=0}^n\binom{n}{k}x^ky^{n-k}\]

=0

13.4.
LATEX ,
. , ,
(\ partial x\,\ partial y).
.

A B

\(AB\)

A B

\(A B\)

A B

\(A\, B\)

A B

\(A\! B\)

A B

\(A\: B\)

A B

\(A\negmedspace B\)

A B

\(A\; B\)

A B

\(A\negthickspace B\)

\(A\ B\)

A
B

\(A\hspace{5mm}B\)

B
B

\(A\quad B\)

\(A\qquad B\)

\(A\hspace{5mm}B\)

\(A\hphantom{xyz}B\)

A B

\(AxyzB\)

A B
\fbox.

196

13.

\hphantom.
, , . \hphantom
\vphantom \phantom.
\phantom{} ,
, \vhantom ,
.

13.5.
4, , .

, .

, amsmath. , . \allowdisplaybreaks ,
LATEX . \displaybreak,
\\.
 ,
equation equation*:
\begin{equation}\label{eq:ex1}
\fbox{\text{ }}
\end{equation}
\begin{equation*}%
\fbox{\text{ }}
\end{equation*}

(13.1)

align/align*:
\begin{align}
&\fbox{\text{ }}\\
&\fbox{\text{ }}\\
&\fbox{\text{ }}
\end{align}

(13.2)

(13.3)

(13.4)

align \\. &.


- . .

13.5.

197

\begin{align}
x&=\gamma(x-\beta ct) &y&=y\\
ct&=\gamma(ct-\beta x) &z&=z
\end{align}

= ( )

= ( )

(13.5)
(13.6)

align: flalign alignat. alignat , . ,


, 2, 2 2 = 4. , align/align*,
flalign/flalign* , alignat/alignat :
\begin{align*}
x&=\gamma(x-\beta ct) &\quad
ct&=\gamma(ct-\beta x)&\quad
\end{align*}
\begin{flalign*}
x&=\gamma(x-\beta ct) &\quad
ct&=\gamma(ct-\beta x)&\quad
\end{flalign*}
\begin{alignat*}{2}
x&=\gamma(x-\beta ct) &\quad
ct&=\gamma(ct-\beta x)&\quad
\end{alignat*}

= ( )

y&=y\\
z&=z
y&=y\\
z&=z

= ( )

= ( )

= ( )

y&=y\\
z&=z

= ( )

= ( )

=
=

, gather/gather*:
\begin{gather}
\fbox{\text{ }}\\
\fbox{\text{}}\\
\fbox{\text{}}
\end{gather}

(13.7)
(13.8)
(13.9)

multline:
\begin{multline}
\fbox{\text{}}\\
\fbox{\text{}}\\
\shoveleft{\fbox{\text{}}}\\
\fbox{\text{}}
\end{multline}

(13.10)

198

13.

multline, , . , . \shoveleft
, \shoveright, , .
split :
\begin{equation}
\begin{split}
&\fbox{\text{ }}\\
&\fbox{\text{ }}
\end{split}
\end{equation}



(13.11)

split
& align.
 , ,
.
split , . split , .
( centertags amsmath),
amsmath tbtags, , , ,
, ( leqno amsmath).
aligned, gathered alignedat, split, :
\begin{equation}
\begin{aligned}[b]
x&=\gamma(x-\beta ct) \\
ct&=\gamma(ct-\beta x)
\end{aligned}\quad
\begin{gathered}[t]
y=y\\
z=z
\end{gathered}
\end{equation}

= ( )

= ( )

(13.12)

, ,
. :
[c] ( ),
[b] ,
[t] .

13.5.

199


\intertext.
\begin{align}
\begin{cases}
\dot{x}=-R\omega\sin\omega t\\
\dot{y}=\hphantom{-}R\omega\cos\omega t
\end{cases}\\
\intertext{,}
a_{\tau}=0
\end{align}

{
= sin
= cos

(13.13)

,
= 0

(13.14)

\intertext . nccmath \intertext, ,


: \intertext[]{}.
 cases
.
cases
cases
cases ltxmisc numcases :
\begin{numcases}{|x|=}
x, & $x \geq 0$\\
-x, & $x < 0$
\end{numcases}

{
|| =

> 0 (13.15)

< 0 (13.16)

empheq
mh amsmath. empheq,
, :
\begin{empheq}[box=\shadowbox*]{align}
E&=mc^2 \tag{*}\\
Y&= \sum_{n=1}^\infty \frac{1}{n^2}\notag
\end{empheq}

E = mc2

X
1
Y =
2
n
n=1

(*)

empheq.pdf .

200

13.

13.6.
, * , .
, , .
 ,
. \ref ,
\eqref:

~\ref{eq:num1} ~\eqref{eq:num1}.


13.17 (13.17).


. , ,
leqno, amsmath. .
,
\tag \tag* .
\notag.

\newcommand{\mft}[1]{\fbox{\text{#1}}}
\begin{gather}
\mft{{ \No 1}}\label{eq:num1}\\
\mft{{ \No 2}}\notag\\
\mft{{ \No 3}}\tag{$*$}\label{eq:num2}\\
\mft{{ \No 4}}\tag*{$*$}\\
\mft{{ \No 5}}\tag{\ref{eq:num1}$$}\\
\mft{{ \No 6}}\tag{\ref{eq:num2}$$}
\end{gather}

(13.17)

2
3
4
5
6

(*)
*

(13.17 )
(* )

\tag \ref .


.
- , , , .
, , , deleq. deleq.dvi.
amsmath subequations, .

13.7.
\begin{equation}
\fbox{\text{ \No 1}}
\end{equation}
\begin{subequations}
\label{eq:num3}
\begin{equation}
\label{eq:num3-1}
\fbox{\text{ \No 2}}
\end{equation}
\begin{equation}
\fbox{\text{ \No 3}}
\end{equation}
\end{subequations}\par
~\eqref{eq:num3},

~\eqref{eq:num3-1}.

201

(13.18)

(13.19a)

(13.19b)

(13.19), (13.19a).

, \theequation, :
\renewcommand{\ t h e e q u a t i o n }
{\ t h e p a r e n t e q u a t i o n \ asbuk { e q u a t i o n }}
.
 LATEX
, TEX- LATEX TEX.

13.7.
9.3 . 109,
beamer, \newtheorem:
\newtheorem{Thexmpl}{}
\begin{Thexmpl}[ ]
\label{th:Pythagor}
.
\end{Thexmpl}
\begin{Thexmpl}
\label{th:WisdomLaw}
,
.
\end{Thexmpl}
:
~\ref{th:Pythagor},
: ~\ref{th:WisdomLaw}.

1 ( ).

.
2. ,
.
:
1, : 2.

202

13.

\newtheorem :
\ newtheorem {}{}
\ newtheorem { } [ ] { }
\ newtheorem {}{ } [ ]
.
, .
(, section). .
\newtheorem ,
:
\ b e g i n { } [ ]

\ end {}
 nccthm ncctools , . nccthm.pdf [10].

14


+++ .
+++

-

, . . TEX .
. LATEX
.

14.1.
LATEX . , ,
.
, .
-
.
,
. , -
LATEX .

204

14.

verbatim

verbatim,
.
\verb!!.
\verb ( !),
.
, *.
verbatim tools ,
.
\verbatiminput,
.
, , \verb*/\verbatiminput*
verbatim*. *- ,
(\textvisiblespace).
\begin{verbatim*}
\textbf{verbatim}
\end{verbatim*}

\LaTeX{}

\textbf{verbatim}\LaTeX{}

altt
altt , verbatim,
LATEX , ,
, .
\begin{alltt}
\textbf{altt}
\end{alltt}

\LaTeX{}

altt

LATEX

fancyvrb.
fancyvrb.pdf.
listings
listings .
1 , ,
.
, , , , .
1

listings.pdf.

14.1.

205

listings :
Listing 14.1. listings
\ usepackage { l i s t i n g s }
% listings
\ l s t l o a d l a n g u a g e s { [ LaTeX ] TeX , bash , MetaPost , P e r l , C++,make}
%
\ l s t s e t { l a n g u a g e =[LaTeX ] TeX , %
e x t e n d e d c h a r s=t r u e , %
e s c a p e c h a r =| ,
% | LATEX|
frame=tb ,
%
commentstyle=\i t s h a p e , %
s t r i n g s t y l e =\ b f s e r i e s } %
2 \lstloadlanguages. .
\lstset , . .
, , extendedchars=true3 .
escapechar LATEX
. , , LATEX. , (
|) , . escapechar,
escapechar
.
2 listings 1.3c ( ): ABAP, ACSL, Ada (83, 95), Algol (60, 68), Ant, Assembler (x86masm), Awk (gnu, POSIX),
bash, Basic (Visual), C (ANSI, Handel, Objective, Sharp), C++ (ANSI, GNU, ISO, Visual), Caml
(light, Objective), Clean, Cobol (1974, 1985, ibm), Comal 80, csh, Delphi, Eiffel, Elan, erlang,
Euphoria, Fortran (77, 90, 95), GCL, Gnuplot, Haskell, HTML, IDL (empty, CORBA), inform,
Java (empty, AspectJ), JVMIS, ksh, Lisp (empty, Auto), Logo, make (empty, gnu), Mathematica
(1.0, 3.0), Matlab, Mercury, MetaPost, Miranda, Mizar, ML, Modula-2, MuPAD, NASTRAN,
Oberon-2, OCL (decorative, OMG), Octave, Oz, Pascal (Borland6, Standard, XSC), Perl, PHP,
PL/I, Plasm, POV, Prolog, Promela, Python, R, Reduce, Rexx, RSL, Ruby, S (empty, PLUS),
SAS, Scilab, sh, SHELXL, Simula (67, CII, DEC, IBM), SQL, tcl (empty, tk), TeX (AlLaTeX,
common, LaTeX, plain, primitive), VBScript, Verilog, VHDL (empty, AMS), VRML (97), XML,
XSLT.
3 ,
LATEX .

206

14.
frame=<POSITION>
. t , b , l
r . frame=trbl
. frame= . frame=TRBL,
. .

, listings, lst. \lstinline!! \verb!!.


lstlisting:
\begin{lstlisting}[language=Perl,
frame=tlBR,
caption={ }]
#
if (open(CHECK,"<$file")) {
$cmd=$term->readline
("Overwrite (yes/NO): ");
if (lc($cmd) ne "yes") {die;}
close(CHECK);}

Listing 14.2.
#
i f ( open (CHECK, "< $ f i l e " ) ) {
$cmd=$term>r e a d l i n e
( " O v e r w r i t e ( y e s /NO) : " ) ;
i f ( l c ( $cmd ) ne " y e s " ) { d i e ; }
c l o s e (CHECK) ; }

\end{lstlisting}

, . , language
, , frame
, caption .
\lstinputlisting:
%
\ l s t s e t { numbers=l e f t , l a n g u a g e=MetaPost ,
%
%
b a c k g r o u n d c o l o r=\ c o l o r { y e l l o w } ,
frame=shadowbox , r u l e s e p c o l o r =\ c o l o r { b l a c k }}
%
\ l s t i n p u t l i s t i n g [ f i r s t l i n e =16 , l a s t l i n e =24 ,
emph={ f o r s u f f i x e s , t e x t , bpath } ,
emphstyle ={\ b f s e r i e s \ s c s h a p e } ,
emph = { [ 2 ] f i l l , u n f i l l } ,
emphstyle = { [ 2 ] \ b f s e r i e s \ underbar } ] { i n t r o .mp}
1
2
3

v a r d e f drawshadowed ( expr dx , dy ) ( text t ) =


fixsize (t );
forsuffixes s=t :

14.2. LCD-

207

4
f i l l bpath. s s h i f t e d ( dx , dy ) ;
5
u n f i l l bpath. s ;
6
drawboxed ( s ) ;
7 %
draw p i c ( s ) w i t h c o l o r r e d ; %
8
endfor ;
9 enddef ;
firstline secondline ,
.
. numbers=left .
\color,
. -
, backgroundcolor. emph=< >.
,
. emphstyle
.
, , .
float,
.
. , , \lstdefinelanguage. ,
.

14.2. LCD-
LCD- . , - .
LATEX lcd.
\definecolor{darkgreen}{rgb}{0.22,0.26,0.19}
\definecolor{lightgreen}{rgb}{0.05,0.97,0.55}
\LCDcolors{darkgreen}{lightgreen}
\centering
\LARGE\textLCD{12}|Linux Format|\\[2mm]
\LCDcolors{white}{darkgreen}
\small\textLCD{12}|Linux Format|

\definecolor color. \LCDcolors , \textLCD


LCD- . \textLCD -

208

14.

,
.
, .
\DefineLCDchar. ,
5 7 . ,
, , . ,
.
\DefineLCDchar{yo}{01010000001111110001111001000111111}

. 14.1. LCD
\LCD,
,
, - .
,
.
\DefineLCDchar{yo}{01010000001111110001111001000111111}
\definecolor{lightblue}{rgb}{0.9,0.91,0.99}
\definecolor{darkblue}{rgb}{0.14,0.2,0.66}
\LCDcolors{darkblue}{lightblue}
\LCDframe
\setlength{\LCDunitlength}{1.1mm}
\LCD{2}{4}|LF {yo} |
|zone |

14.3.
,
,
. bytefield.
bytefield:
\ b e g i n { b y t e f i e l d }{ }

\ end { b y t e f i e l d }

14.3.

209

15 16

31

hhhh
h
h
hhhh hhhh
hhhh hhhh
h hh
hhh
hhhh
hh h
hhhh
h
hhhh
hhhhhhhh
hhhhh
h
65.527
14.1. UDP
bytefield \wordbox \bitbox, , :
\ wordbox [ ] { }{}
\ b i t b o x [ ] { }{}

. [lrtb] , : l , r , t b .
\\.
UDP4 :
\ b e g i n { b y t e f i e l d }{32}
\ bitheader {0 ,15 ,16 ,31}\\
\ b e g i n { r i g h t w o r d g r o u p }{ }
\ b i t b o x {16}{ }\ b i t b o x {16}{ }\\
\ b i t b o x {16}{ }\ b i t b o x {16}{ }
\ end { r i g h t w o r d g r o u p }\\
\ wordbox [ l r t ] { 1 } { }\\
\ s k i p p e d w o r d s \\
\ wordbox [ l r b ] { 1 } { 6 5 { . } 5 2 7 }
\ end { b y t e f i e l d }
UDP
\bitheader, \wordgroupr \skippedwords .
\bitheader , , , {0-31}.
rightwordgroup
4 User

Datagram Protocol IP.

210

14.

leftwordgroup ,
, .
.

14.4.
, , . . TEX .
LATEX . , , .
.
algorithms
algorithms , .
. algorithmic. .
\begin{algorithmic}[1]
\IF{\(i\leqslant0\)} \STATE \(i\gets1\) \ELSE
\IF{\(i\geqslant0\)} \STATE \(i\gets0\)
\COMMENT{ ~ }
\ENDIF
\ENDIF
\ENSURE \(i\geqslant0\)
\FORALL{\(\xi \in \mathcal{A}\)}
\STATE \(\mathcal{B}\gets\xi^2\)
\ENDFOR
\RETURN \(\mathcal{B}\)
\end{algorithmic}

1: if 6 0 then
2:
1
3: else
4:
if > 0 then
5:
0 {


}
6:
end if
7: end if
Ensure: > 0
8: for all do
9:
2
10: end for
11: return

, .
1, , 2 ,
.
\STATE . \IF{<>}, \ELSIF{<>}, \ELSE \ENDIF.
\FOR \FORALL,
\ENDFOR. \WHILE{<>}
\ENDWHILE, \REPEAT \UNTILL{<>} \LOOP
\ENDLOOP. \REQUIRE, ,

14.4.

211

, \ENSURE, \RETURN,
\PRINT \COMMENT.
, .
. , . : algorithms.pdf.
algorithmic ,
algorithm,
. algorithm \caption
\label.
algorithms
algorithms algorithmicx.
.
,
. , Pascal, , .
algorithms. algorithm2e. C-.
.
. algorithms.
clrscode
clrscode ,
5 : . , . , . .
.
\begin{codebox}
\Procname{
$\proc{ }$}
\li \For $j \gets 2$ \To $\id{length}[A]$
\li \Do $\id{key} \gets A[j]$
\li $i \gets j-1$
\li \While $i > 0$ and $A[i] > \id{key}$
\li \Do $A[i+1] \gets A[i]$
\li $i \gets i-1$ \End
\li $A[i+1] \gets \id{key}$ \End
\end{codebox}


1 for j 2 to length[A]
2
do key A[j]
3
ij1
4
while i > 0 and A[i] > key
5
do A[i + 1] A[i]
6
ii1
7
A[i + 1] key

5 Introduction to algorithms, Second Edition Thomas H. Cormen, Charles E. Leiserson, Ronald


L. Rivest, Clifford Stein.

212

14.

pseudocode
. (Donald L. Kreher) . (Douglas R. Stinson) Combinatorial Algorithms: Generation,
Enumeration and Search. , : pseudocode. .
,
2005 . .
\begin{pseudocode}{C2F\_}
{\text{}, \text{}}
\PROCEDURE{C2F}{c}
\COMMENT{
$^\circ$$\to$$^\circ$F}\\
f \GETS {9c/5} + 32\\
\RETURN{f}
\ENDPROCEDURE
\MAIN
x \GETS \text{} \\
\WHILE x \leqslant \text{} \DO
\BEGIN
\OUTPUT{x, \CALL{C2F}{x}}\\
x \GETS x+1
\END
\ENDMAIN
\end{pseudocode}

Algorithm 0.1.1: C2F_(, )


procedure C2F(c)
comment: F
f 9c/5 + 32
return (f )
main
x
whilex 6
output (x, C2F(x))
do
xx+1

14.5.
, .
, ,
, .
change log.
:
;
;
;
.

14.5.

213


vhistory
.

Jochen Wertenauer

1.2 29/09/07

()

1.0
1.1
1.2

22/01/04
21/07/07
29/09/07

JW
JW
JW, EMB

owncaptions

. 14.2. vhistory
versionhistory.
\vhEntry:
\ vhEntry {}{}{()}{}
() , . |. :
\ vhEntry { 1 . 1 } { 1 3 . 0 5 . 0 4 } {JW|AK|KL}{ Typos c o r r e c t e d . }
vhistory,
. 14.2.
%
% o w n c a p t i o n s
\ usepackage [ owncaptions ] { v h i s t o r y }
|\ ldots |
%
%
\newcommand{\JW}{ Jochen Wertenauer }
\newcommand{\EMB}{ . }

214

14.

{\renewcommand{\ s e t s e p a r a t o r }{ \and }
\ t i t l e { \ t e x t b f { v h i s t o r y }}
\ a u t h o r {\ v h L i s t A l l A u t h o r s L o n g }
\ d a t e { \ v h C u r r e n t V e r s i o n {} \ vhCurrentDate }
\ maketitle
}
% .
\renewcommand{\ vhhistoryname }{ }
\renewcommand{\ vhversionname }{ }
\renewcommand{\ vhdatename }{}
\renewcommand{\ vhauthorname }{ () }
\renewcommand{\ vhchangename }{ }
%
\ begin { v e r s i o n h i s t o r y }
\ vhEntry { 1 . 0 } { 2 2 / 0 1 / 0 4 } {JW}{ }
\ vhEntry { 1 . 1 } { 2 1 / 0 7 / 0 7 } {JW}{ o w n c a p t i o n s }
\ vhEntry { 1 . 2 } { 2 9 / 0 9 / 0 7 } {JW|EMB}{ }
\ end { v e r s i o n h i s t o r y }
\vhCurrentVersion \vhCurrentDate.
. (. 12.2).
\vhListAllAuthorsLong ,
\newcommand.
 , TEX Live 2007, -
owncaptions, .
21/07/2007 1.3
CTAN ({CTAN}/macros/latex/contrib/vhistory.zip).
vhistory vh_sets_en.pdf.

14.6. LATEX
LATEX- .
.
. Subversion svn,
svn6 .
6 cvs (Concurrent Versions System), rcs rcsinfo.

14.6. LATEX

215

\ u s e p a c k a g e { svn }
\SVN $ Date $
\SVN $Rev$
, \SVN.
Subversion :
> svn p r o p s e t svn : keywords " Date Rev"
> svn commit m " "

svn , commit. Date Rev


.

> svn h e l p p r o p s e t
\SVN $Date$ \SVNDate \SVNTime, .
\SVN $Keyword$, Keyword svn, : \SVNKeyword.
:
\SVN $Date: 2006-11-25 21:02:20 +0600 $
\SVN $Rev: 265 $
\SVNDate\ \SVNTime

25 2006 .
21:02:20
265

\SVNRev

svninfo.
 , LATEX ,
. . ,
. LATEX , , , .

15


,
:
-
, .

LATEX ,
.

15.1.
.
, , , - 1 :
\[\mathbf{p}\psi(\mathbf{x})
\stackrel{\mathrm{def}}{=}
\bra{\mathbf{x}} \mathbf{p} \ket{\psi} =
-i \hbar \nabla \psi(x)\]

def

p(x) = hx| p |i = i~(x)

, , , ,
.
, .
1 \bra \ket braket ltxmisc.
braket.sty.

218

15.

15.1.1.
8.417-2002.
,
, . , , , .
, . \text (. 4.2).
,
. , . :
\(25\,\text{}/\text{}\) (25 /), \(36{,}6^{\circ}\) (36,6 ).
, , : \((1/60)\,\text{}^{1}\), (1/60) 1 .
(\((100.0\pm 0.1)\,\text{}\), (100.0 0.1) )

: \(50\,\text{}\pm1\,\text{}\) (50 1 ).
, , : \(\text{}\cdot\text{}\) ( ).
( ). ,
, .
: /( ), : //, / .
, ( ):
2 1 , 2 . ( ).
, : / ( ).
. : /, : /.

15.1.

219

SIstyle
,
. SIstyle, sistyle.sty.
: \SI , \num ( ) \ang
.
\SI{}{m.kg/(\text{}^3.A)}\quad
\SI{}{(MPa)^{0\pnt 5}}\quad
\SI{}{(MPa)^{\num{0.5}}}\par
$v=\SI{10}{m.s^{-1}}$\quad
$v=\SI{10}{m/s}$\quad
$v=\SI{10}{\tfrac{m}{s}}$\par
\ang{45}\quad \ang{10; 12; 4}

mkg/(3 A) (MPa)0.5 (MPa)0.5


v = 10 ms1 v = 10 m/s v = 10 ms
45 1012 4

\text, .
SIstyle-2.3.pdf ( 2.3 ) ,
.
 SIunits (SIunits.pdf).
unitsdef (unitsdef.pdf) .
units (units.pdf).

15.1.2.

LATEX. ,
, http://arxiv.org2 .
hepparticles
, , (, ) ,
, , , .
2 ,
02/02/2008 461,639 , , ,
.
LATEX-. . , - pdf- PostScript-.

220

15.

hepparticles , :
\begin{itemize}
\item :
\HepParticle{B}{d}{0},
\HepAntiParticle{B}{d}{0}
\item :
\HepGenParticle{q}{d}{},
\HepGenAntiParticle{\ell}{\mu}{}
\item SUSY"=:
\HepSusyParticle{\chi}{1}{},
\HepGenSusyParticle{q}{2}{}
\item :
\HepParticleResonance{J\!/\psi}{1S}{}{\star}
\item :
\HepProcess{\HepParticle{B}{d}{0} \HepTo
\HepParticle{K}{}{-}\HepParticle{\pi}{}{+}}.
\end{itemize}

:
B0d, B 0d
: qd,
SUSY-:
e 1, qe2
: J/(1S)
: B0d K +.

, , \HepProcess \HepTo.
hepparticles.pdf.

, , , ,
.
feyn. ,
feyn.pdf .
feyn:
:
\(\Feyn{fs f gl f glu f fs}\)
:
\[\Diagram{\vertexlabel^a \\
fd \\
& g\vertexlabel_{\mu,c} \\
\vertexlabel_b fu\\
} = ig\gamma_\mu (T^c)_{ab}\]

:
:

efo
fw
fe

= ig (T c )ab

,c



feynmp feynmf . 1995 .
(Torsten Ohl), , () . LATEX -

15.1.

221

, MetaPost3 .
, + Br(/ + )
:

e+
e + e
e

e+

J/

Bre+ e
e

. 15.1. ( feynmp)
, , . eepsiee.tex:
% e e p s i e e . t e x
\ u s e p a c k a g e { feynmp } %
...
\ b e g i n { f m f f i l e }{ eep s i e e } % mp
\ b e g i n { fmfgraph } ( 1 1 0 , 6 2 ) %
\ f m f l e f t { e i , p i } % ( )
\ f m f r i g h t { eo , po} % ( )
\ f m f l a b e l {$ e^$}{ e i } %
\ f m f l a b e l {$ e^+$}{ p i } % +
\ f m f l a b e l {$ e^+$}{po} %
\ f m f l a b e l {$ e^$}{ eo } %
% ,
\ fmf { f e r m i o n }{ e i , J i , p i }
% ,
\ fmf { f e r m i o n }{ po , Jo , eo }
%
\ f m f l a b e l {$\Gamma_{\ e e }$}{ J i }
%
\ f m f l a b e l {$ Br_{\ e e }$}{ Jo }
%
\ fmf { heavy , l a b e l =$J /\ p s i $}{ J i , Jo }
3 Linux Format , MetaPost . CC-BY-SA 3.0
http://www.inp.nsk.su/~baldin/mpost/.

222

15.

\ end { fmfgraph }
\ end { f m f f i l e }
ei Jo
. .
fmffile mp-, META. ee-psi-ee.mp. ,
eepsiee.tex, :
#
>
#
>
#
>

eep s i e e .mp
l a t e x e e p s i e e . tex
eps eep s i e e .mp
mpost eep s i e e .mp

l a t e x e e p s i e e . tex

mpost MetaPost. mpost LATEX.


xdvi dvi- PostScript pdf.
,
feynmf manual.ps.gz.
isotope
, , , . isotope (
isotope.dtx) \isotope,
:
\isotope{Ra}\quad \isotope[228]{Ra}\quad
\isotope[228][88]{Ra}
\[\isotope[A][Z]{X}\to
\isotope[A-4][Z-2]{Y}+\isotope[4][2]{\alpha}\]

Ra
A
ZX

228

Ra

228
88 Ra

4
A4
Z2 Y + 2

15.1.3.
- ,
, LATEX .
circ ,
, ,
. LATEX
circ . , . circ.

15.1.

223

\ u s e p a c k a g e [ b a s i c , box , gate , o l d g a t e , i c , o p t i c s , p h y s i c s ] { c i r c }
:
basic
: , , , , ;
box
, , ;
gate
;
oldgate , ;
ic
( );
optics ;
physics - .
circuit. \begin{circuit} 0 4.
0. .
\begin{circuit}0
\npn1 {?} B l % .
\frompin npn1C %
\- 1 u
% .
\nl\A1 {$I_C$} u % , A1.
\atpin npn1B
%
\- 1 l
% .
\R1 {510 } l % R1.
\- 1 l
% .
\centerto A1
% A1.
\nl\A2 {$I_B$} u % A2.
\frompin A2b % A2 ()
IB A
IC
\vtopin R1l % R1 ().
\frompin A1t % A2 ()
R1
\- 1 u
% .
\.1
% ( ).
510
\frompin A2t % A2
\vtopin .1
% .
\htopin .1
%
\- 1 u
%
\cc\connection1 {$U_b$} c u % .
\frompin npn1E %
\- 1 d
%
\GND1
% .
\end{circuit}

Ub

circ.dvi.
.

224

15.
timeDiv :
5ms/div

Channel A :
1 V/div

Channel B :
1 V/div

XY
ON

F1

F2

OffsetA
0

. 15.2. ( pst-optic)

OffsetB
0

OffsetC
0

. 15.3.
( pst-osci)

-, pst-circ.
pst-circ-doc.pdf
.
MetaPost makecirc.
MakeCirc-en.pdf

15.1.4.
,
.
circ, PSTricks, pst-optic ( pst-optic.pdf,
pst-optic-examples.pdf). , . 15.2 :
\ t e l e s c o p e [ m i r r o r F o c u s =6, posMirrorTwo =5,yBottom=5]
pst-osci. . 15.3
:
\ O s c i l l o [ a m p l i t u d e 1=3.5 , phase 1=90 , a m p l i t u d e 2=3.5 ,
p e r i o d 1=25 , p e r i o d 2=5 , phase 2=60 , L i s s a j o u s=t r u e ]
, , . ,
, pst-osci.pdf

15.2.

225

15.2.
. . : , ,
. , , ,
, .

15.2.1.
, -
, . .
PSTricks, pst-labo, 15.1.4,
.
\psset{glassType=ballon,
unit=0.5cm,
becBunsen,
pince=true}
\pstChauffageTube[becBunsen,
barbotage]

, , , , ,
pst-labo-docEN.pdf.

15.2.2.
, ,
.
.
LATEX.
:
\(\frac{1}{2}\mathrm{H}_2\mathrm{O}\)
\(3\,\mathrm{Cr}_2\mathrm{O}_7^{2-}\)

1
H O
2 2

3 Cr2 O2
7

, .

226

15.

mhchem
mhchem : mhchem.sty rsphrase.sty.
mhchem \ce \bond, . :
\ u s e p a c k a g e [ v e r s i o n =3]{mhchem}
. ,
, .
\ce -
:

H2 O
H+
AgCl2
Y99+
H2 (aq)
(NH4 )2 S
KCr(SO4 )2 12 H2 O
KCr(SO4 )2 12 H2 O
RNO2
-Cl


\ce{H2O}
Sb2 O3
\ce{H+}
CrO24
\ce{AgCl2}
[AgCl2 ]
\ce{Y^{99}+}
Y99+
\ce{H2_{(aq)}}
NO3
\ce{(NH4)2S}

\ce{Sb2O3}
\ce{CrO4^2}
\ce{[AgCl2]}
\ce{Y^{99+}}
\ce{NO3}

\ce{KCr(SO4)212H2O}
\ce{KCr(SO4)2.12H2O}
\ce{RNO2^{.}}
\ce{$\mu\hyphen$Cl}

2 H2 O

\ce{2H2O}

1
2 H2 O

\ce{1/2H2O}

XY
Z

\ce{X=Y#Z}

+
227
90Th

C6 H5 CHO

\ce{^{227}_{90}Th+}

\ce{C6H5CHO}

\bond:
\ce{A\sbond B\dbond C\tbond D}\\
\ce{A\bond{-}B\bond{=}C\bond{#}D}\\
\ce{A\bond{~}B\bond{~-}C}\\
\ce{A\bond{~=}B\bond{~--}C\bond{-~-}D}\\
\ce{A\bond{...}B\bond{....}C}\\
\ce{A\bond{->}B\bond{<-}C}

ABC
D
ABC
D
C
A B
B
C
D
A

ABC
ABC

15.2.

227

 dvi-.
\ce ,
\ce. , .
\centering
\ce{CO2 + C -> 2CO}\\
\ce{CO2 + C <- 2CO}\\
\ce{CO2 + C <=> 2CO}\\
\ce{H+ + OH- <=>> H2O}\\
\ce{$A$ <-> $A$}\\
\ce{CO2 + C ->[\alpha] 2CO}\\
\ce{CO2 + C ->[\alpha][\beta] 2CO}\\
\ce{$A$ ->[\ce{+H2O}] $B$}

CO2 + C 2 CO
CO2 + C 2 CO

CO2 + C

2 CO

H2 O
H+ + OH

CO2 + C
2 CO

CO2 + C
2 CO

+H2 O

rsphrase (Risk and Safety Phrases)


. , . mhchem.pdf.

15.2.3.
TEX . chemtex.
xymtex.
xymtex LATEX
. . ,
. , GUI-, ,
. , xymtex TEX Live
http://homepage3.nifty.com/xymtex/fujitas3/xymtex/indexe.html.
xymtex403b.lzh. ( ) lha.
xymtex texmf :
#
>
#
>
#
>


l h a x xymtex403b . l z h
xymtex
cp r xymtex texmf-local

texhash

228

15.

.
xymtx402403.pdf doc402403. , :
%\ u s e p a c k a g e { xymtexps } %
%\ u s e p a c k a g e { chmstps }
%
%
\ b e g i n {XyMcompd} ( 2 1 0 0 , 1 8 0 0 ) ( 2 0 0 , 0 ) { } { }
\ p y r a n o s e {1 Sa==H; 2 Sb==H; 2 Sa==OH; 3 Sb==H; 3 Sa==OH;
4Sb==HO; 4 Sa==H; 5 Sb==H; 5 Sa==CH$_{3}$;%
1Sb==%
\ r y l ( 8 ==O) { 3 ==%
\ s t e r o i d {3== ( y l ) ; 5A==H; 8B==H; 9A==H;%
{{10}B}==\ l m o i e t y {OHC} ; { { 1 4 }A}==OH;%
{{13}B}==\ l m o i e t y {H$_{3}$C} ; { { 1 6 }B}==OH;%
{{17}B}==\ f i v e h e t e r o v [ e ] { 3 ==O}{4D==O; 1 == ( y l ) }
}
}
}
\ end {XyMcompd}
, , :
O

H3 C
OHC
H
HO
H

H
H

O O
CH3
H

OH

OH

OH

OH

. 15.4.
 GUI- .

15.3.

229

15.3.
,
. , LATEX
. , , texshade, .
AF414973_Fusarium_sporotrichioi
DQ026008_Fusarium_equiseti
AF111054_Fusarium_tricinctum
AF009185_Gibberella_avenacea
044-its1_2006-03-10
121-its1_2006-03-10
027_its1_2006-03-06
090_its1_2006-03-01
025-its1_2006-03-17
026_its1_2006-03-06
consensus

340
.

350
360
370
380
390
400
.
.
.
.
.
.
ACCCTCAAG..CCC.AGCTTGGTGTTGG.GATCTG.TGTGCAA.AC...ACAGT..C...CCC.AAATTGATTGGC
ACCCTCAAG..CTC.AGCTTGGTGTTGGGACTC.GCGGTA.AC..C..CGC.GT...T.CCCC.AAATCGATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTG.CCTTCT.GGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAG..CTC.AGCTTGGTGTTGG.GACTCG.CGGTAAC.CC...GCGTT..C...CCC.AAATCGATTGGC
ACCCTCAAG..CTC.AGCTTGGTGTTGG.GACTCG.CGGTAAC.CC...GCGTT..C...CCC.AAATCGATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAG..CCC.AGCTTTTTGTGGGTGATCTG.TGTGCAA.AC...ACAGT..C...CCC.AAATTGATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTG.CCTTCT.GGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAGccCcCg.G.TTggTGTtGGggatcgGct.tgc.cttCt.ggCggTgccgccCCCgAAATa.ATTGGC

. 15.5. (alignment) Fusarium/Gibberella texshade


texshade . . WWW http://herba.msu.ru/shipunov/software/tex/tex-ru.htm
TEX .

16


;
, .

. , , .

16.1.
, , . ,
, .

verse:
\begin{verse}
\\*
.
\emph{ }
\end{verse}

, \\. (\\),
.

232

16.

verse
verse .
verse.pdf .
\renewcommand{\poemtoc}{subsection}
\poemtitle{}
\settowidth{\versewidth}{ "-- .}
\begin{verse}[\versewidth]
,\\
, ,\\
, ,\\
"--- .
\vin
\vin
\vin
\vin

\\
\\
,\\
.

,\\
,\\
\\
, .\\
\ldots

,
, ,
, ,
.


,
.
,
,

, .
...
. .

\emph{.\,. }
\end{verse}

\poemtoc , . \poemtitle .
\versewidth ,
. verse .
, . \vin .

, .
stage
, , , stage.
stage.sty

16.1.

233

I
(.)
1
( . , , .
. .)

. , ?

.
( ). .
?.. ?

( .)

. 16.1. stage
( ),
.
stage:
% s t a g e
\ documentclass { stage }
\ u s e p a c k a g e [ T2A] { f o n t e n c }
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
\ usepackage [ english , r u s s i a n ] { babel }
\ u s e p a c k a g e { i n d e n t f i r s t }%f i r s t paragraph i n d e n t
\ a u t h o r { . }
\ t i t l e { }
\ b e g i n { document }

234

16.

%
\ a d d c h a r a c t e r { }{ }
\ a d d c h a r a c t e r {}{ }
%
\ act
%
\ pause
%
\ scene
%
\ opensd { . , ,

.
.
. }
%
\ d i a l o g {}{ . , ?}
\ d i a l o g { }{ . }
\ d i a l o g { } { ( ) . . }
\ d i a l o g { }{ ? . . ?}
\ s t a g e { . }
\ end { document }
stage-documentation.pdf.

16.2.
-
. , LATEX
, .
guitar
.
guitar .

16.2.

235

guitar:
\begin{guitar}
[Gm] [Eb], [Gm]
[Eb][D7] , [Gm]
, [A7] [D7]
[Eb] [D7], [Gm]
\end{guitar}

Gm E

Gm

,
E

D7

Gm

,
A7

D7

,
E

D7

Gm

guitar .
guitar.dvi
.
MusiXTEX
musixtex musictex. , .
musixdoc.pdf , , LATEX, musixtex. LATEX , . ,
, , ,
, . MusiXTEX LATEX [6].
, -, , ,
music:

\begin{music}
\startextract
\notes\qu{abcdefghi}\ql{jk}\enotes
\endextract
\end{music}

G2

(
). \startextract/\endextract. TEX . \notes \enotes .
, ,
\startpiece/\endpiece. LATEX . ,
.

236

@ ) @ )

3
2

G 4 @

>
@
3

) @ )
G2 @

>

16.

2
@ ) @ )

>
@
4

) @ )
@

>

. 16.2. . . , musixtex
. 16.2 . . . :
\ b e g i n { music } % . .
\ p a r i n d e n t=0pt%
\ g e n e r a l m e t e r {\ m e t e r f r a c 34}% 3/4
\ g e n e r a l s i g n a t u r e {1}%
%
\newcommand{\ l i f t } [ 2 ] { \ r a i s e #1\ I n t e r l i g n e #2}
\ s t a r t p i e c e%
\ n o t e s%
\ z q l {d}\ l i f t {1}{\ qs }%
\ ibbu 0 s 5\ qb 0{km}\ tbu 0\ qb 0{ o }%
\ ibbu 0 s 0\ zqb 0{m}%
\ l i f t {3}{\qp}%
\qb 0{km}\ tbu 0\ qb 0{ k}%
\ i b l 0 j {6}\ zqb 0{h}%
\ l i f t {3}{\ qs }\ ccu {k}%
\ t b l 0\ zqb 0{ f } \ l i f t {2}{\ qs } \ ccu {k} %
\ e n o t e s%
\ bar%
.
\ e n d p i e c e%
\ end { music }

16.2.

237

musixtex ,
.
MusiXTEX -
.
musixlyr
musixlyr MusiXTEX,
. . 16.3
- . . .
, :
%
% m u s i x l y r
\ u s e p a c k a g e { musixtex }
% m u s i x l y r LATEX
\ input { musixlyr }
%
\ b e g i n { music }
\ p a r i n d e n t=0pt%
\ g e n e r a l m e t e r {\ m e t e r f r a c 44}% 4/4
\ g e n e r a l s i g n a t u r e {1}%
\ nobarnumbers %
%
\ s e t l y r i c s { Egorov }{% Egorov
,
{ } , { } .
{ } ,
_

}
\ a s s i g n l y r i c s 1{ Egorov } %
\ s t a r t p i e c e%
% ,
\ l y r r a i s e {1}{b1.5mm}
\ Notes \qp\ ds \ ca { a c f }\ en \ bar
\ Notesp \ ca {hg }\ qp\ ca { f e }\ ds \ c c a { de }\ en \ a l a l i g n e
%
\ l y r r a i s e {1}{ b0mm}

238

16.

\ Notesp \ha{ f }\ ds \ ca { d e f }\ en \ bar


\ Notesp \ ca { j i }\ qp\ ca { h g f e }\ en \ a l a l i g n e
\ Notesp \ ca { e f }\ qp\ ds \ ca { h i j }\ en \ bar
\ Notesp \ qa {kk }\ ca { j e j k }\ en \ a l a l i g n e
\ Notesp \ ca { j g }\ qp\qp\ ds \ ca { j }\ en \ bar
\ Notesp \ ca { j i }\ ds \ c c a { i i }\ ca { h g f e }\ en \ a l a l i g n e
\NOtes\ i s l u r d 0 f \ha{ f }\ t s l u r 0 f \ ca { f }\ qp\ ca { f }\ en \ bar
\ Notesp \ ca { i j }\ qp\ c c a { h i }\ ca { h g f e }\ en \ bar
\ n o t e s p \wh{d}\ en
\ setdoublebar
\ e n d p i e c e%
\ end { music }
, \setlyrics. (-) .
({}) .
(_) .
mxlyrdoc.dvi .

16.3.
: , .
LATEX
. The Comprehensive
LATEX Symbol List (symbols-a4.pdf).
tipa

(International Phonetic Alphabet IPA).
tipa IPA . :
\textipa{},
\tipaencoding,
IPA.
, ,
:

16.3.

239

G2 44 > ?
(
( (
G2

( ( (

( >

G2 : ( >

>

( ( ?

) )

- -

>

- -

- ,

- -

G2 ( ( >
G2 -

( ( >

( ( ( (

-,

( -

- - - - -

>

( ( ( (

- - -

( ( ( (

- - -

. 16.3. ,
mysixtex mysixlyr
:
[\textepsilon kspl\textschwa%
\textprimstress ne%
\textsci\textesh\textschwa n]
:
\textipa{[Ekspl@"neIS@n]}

: [Ekspl@"neIS@n]
: [Ekspl@"neIS@n]

, .

tipaman.pdf.
HieroTEX
HieroTEX TEX Live.
http://www.iut.univ-paris8.fr/~rosmord/archives/ . HieroTeX-3.5.tgz Type1-

240

$
$1
)
$
+
< N $
I
; $ ; ; <)
2 4

16.

!I
M)
=
((
6

6 0 0

>B

2P

0 0

"

. 16.4. (HieroTEX)
HieroType1-3.1.4.tgz. . HieroTEX .
- sesh, texmf-
texhash. EGypto.pdf. ( hierotex.htx)
:
% h i e r o t e x . htx
% EGypto . t e x h i e r o t e x
\ documentclass { a r t i c l e }
\ u s e p a c k a g e { egypto }
\ usepackage { h i e r o }
\ b e g i n { document }
\ EnColonne [ 1 . 2 \ Htm] {
\ begin { hieroglyph }
G5 <S E1 D40 xa m R1 9 ( t \ s 1 : niwt \ s 1 ) >!
nbty wAH sw \ ! t \ s 1 \ ! i i ( r a : Z1 ) mi m ( p t : pt ) !
sxmG8 F9F9 DsrxaZ2!
( sw : t ) ( b i t : t ) <ramnxpr >! zA \ ! \ ! \ ! ( r a : . )
<G26ms n f r xpr>! O10 nbt Mf (kA : t ) (N3 3 :N3 3 :N3 3 )
mr i i

16.3.

241

\ end { h i e r o g l y p h }}
\ end { document }
sesh LATEX- (
hierotex.tex):
> s e s h < h i e r o t e x . htx > h i e r o t e x . t e x
hieroglyph. pdflatex latex ,
. 16.4. , , , . .

arcs
- ,
arcs:
\underarc{}
\overarc{} .

 LATEX-: http://www.essex.ac.uk/linguistics/external/clmt/latex4ling/, The LaTeX for Linguists.

17

TEX Live
.

.
.
TEX Live CTAN1 .
LATEX,
TEX Live .
,
X .

17.1.
, .
.

17.1.1.
X fontenc LATEX.
X inputenc , .
1 CTAN
(Graham Williams) TeX Catalogue,
http://texcatalogue.sarovar.org html-.

244

17. TEX Live

X babel .
.
10.1 . 119.
, babel, LATEX ( ) (arabtex),
(armtex), (arosgn, bangtex), (burmese),
(vntex), (gurmukhi), (devanagari), (malayalam), (itrans), (oinuit), (ocherokee), (cjk), (cjk), (manjutex),
(montex), (sanskrit), (sinhala), (adami), (ctib4tex, pecha), (enthiop), (osmanian), (telugu) (cjk) .
ucs Unicode.
braille ( ).

17.1.2.
X anttor Antykwa Tor
unska. .
X concrete concrete ( ) euler ( ). . .
. .
cyrillic LATEX. inputenc.
X lh Computer Modern. Type1 cm-super.
X indentfirst .
X t2 . misccorr (
), mathtext (
) citehack ( BibTEX).
X eskdx .
X gost780u gost71u gost 7.80-00 7.1-84
BibTEX.

17.1.3.
extdash ncctools ,
.

17.1.

245

X ncccomma nctools .
icomma was.
X underscore (_) .

17.1.4.
contour .
.
nccstretch ncctools .
X soul , , .
truncate .
ulem .
umoline .

17.1.5.
dashrule .
X mboxfill ncctools .
X nccrules ncctools .

17.1.6.
X lineno .
X ragged2e .
hanging .
X comment , .
shapepar . ,
- .

17.1.7.
X desclist ncctools description.
engrec
.
enumerate enumerate
.
enumitem .

246

17. TEX Live

X eqlist , description, .
etaremune .
expdlist description.
multenum .
X paralist .

17.1.8.
X alltt
LATEX .
fancyvrb .
moreverb verbatim.
X verbatim .

17.1.9.
balancedquotes "" ,
, .
csquotes . . .
X epigraph .
quotchap .

17.1.10.
alnumsec .
chappg
.
fncychap .
Lenny.
nccsect ncctools .
sectionbox . , .
titlesec ,
.
titletoc.
appendix .

17.1.

247

17.1.11.
authblk preprint \author, , ,
.
coverpage CoverPage, .
titling \maketitle.
abstract , .

17.1.12.
crossreference .
lastpage , .
X prettyref .
refcheck , ,
.
X showkeys . .
typedref \ref \figureref, \sectionref \eqref.
\label .
varioref tools .
X xr .

17.1.13.
fixfoot .
X footmisc
.
footnpag .
X ftnright tools .
manyfoot ncctools .
X nccfoots ncctools .
X savefnmark .
.
yafoot pfnote ( ), fnpos (
) dblfnote ( ).

248

17. TEX Live

17.1.14.
endheads .
X endnotes .
X pagenote
.

17.1.15.
X marginnote .
X mparhack LATEX .
X changebar . .

17.1.16. WWW-
X breakurl .
X hyperref .
typehtml carlisle HTML LATEX.
HTML2 HTML3.
X url .
cooltooltips . Adobe Reader 7 .

17.1.17. PDF
cmap pdf-.
pdfcrypt oberdiek pdf-
.

17.1.18.
boites , , .
boxedminipage , - .
boxhandler .
dashbox .
eqparbox ,
.

17.1.

249

fancybox .
nccboxes ncctools . . .
pst-fr3d 3D-.
X shadow \shabox, .

17.1.19.
X draftwatermark DRAFT
- .
draftcopy.
X fixme
.
prelim2e
, .
progress HTML-, .
.
pdfsync pdf-. pdf- . iTeXMac, iTeXMac2, TeXShop emacs (AucTeX) pdf iTeXMac, iTeXMac2, TeXShop, TeXniscope PDFView.
srcltx dvi-. DVI xdvi yap.
snapshot , , ,
. .
X svn svninfo LATEX
svn. cvs,
rcs rcsinfo.
svnkw svn-multi svn.
X vhistory .
vpe srcltx PDF. vpe .

17.1.20.

combine pdfpages.
X askinclude \include.

250

17. TEX Live

X excludeonly , , \include.
chapterfolder , ,
.
import \input,
.
volumes , \includeonly.

17.1.21.
crop (cropmark)
. ncccropmark
ncctools.
fixltx2e LATEX 2 .
mylatex carlisle mylatex.ltx, , . ,
.
morse ( ).
pagesel oberdiek ,
. , / .
totpages , .
wordlike , , . . , , .

17.2.
LATEX ,
, LATEX.

17.2.1.
X amsmath -LATEX. .
amsbsy ( ), amsopn ( ) amstext ( \text,

17.2.

251

). , .
X amssymb . amsfonts (
). .
X amscd . .
amsthm . proof. .
X mh amsmath. mathtools , ntheorem
theorem empheq
.
mhequ .
bezos accents ( ), tensind ( ),
dotlessi ( \dotlessi \dotlessj), esindex, checkend ( ) arabicfront
( ).
breqn .

. .
X cancel \cancel, \bcancel \xcancel, ,
.
X cases numcases subnumcases .
X commath , ,
.
complexity .
dcpic LATEX.
deleq .
easy .
easy ( easy-), easyeqn ( ), easymat ( ), easybmat ( ), easytabl ( ), easyvector (C-
), easybib ( ).
egameps pstricks
(extensive games).
eqname \eqname
.
X esdiff .
esvect , , .

252

17. TEX Live

eulervm Euler.
extarrows extpfeil .
faktor \faktor,
 . amsmath.
flagderiv - (flag
notation).
gauss .
hhtensor , .
karnaugh Karnaugh Maps, Veitch diagram.
maybemath \maybebm \maybeit.
.
nath natural math notation. .
,
.
nccthm ncctools ().
onlyamsmath , LATEX TEX-. .
X pb-diagram .
pst-3dplot . .
pst-bar .
pst-eucl .
pst-func . , , ,
.
qobitree .
sobolev .
sseq ,
spectral sequence charts.
subeqn subequations
.
t-angles (Hopf algebra).
X tableaux, tabvar variations
. .
X tensor .
vector .

17.2.

253

venn (MetaPost).
X was fixmath ( ), gensymb ( , , ),
icomma ( ), upgreek (
up ).
X wasysym . integrals .

17.2.2.
ascii IBM ASCII.
X algorithms, algorithmic, algorithmicx, algorithm2e,
clrscode pseudocode .
basix BASIC, TEX. : {CTAN}/macros/generic/basix/. TEX Live .
X bytefield .
cursor L- .
examplep LATEX MetaPost.
codep ( code, ,
) examplep (
).
, , .
keystroke . PostScript- pdf .
X lcd LCD-.
X listings .
method .
pst-dbicons ER-.
pst-uml UML-.
semantic , T-.

17.2.3.
astro cmastro
, .
braket - .
X circ LATEX
METAFONT.
X feyn .

254

17. TEX Live

X feynmf
LATEX METAFONT/MetaPost.
X hepparticles .
X isotope .
pst-circ .
X pst-optic .
X pst-osci .
X SIstyle . SIunits.
slashed carlisle - . \slashed,
/ def
, :
= .
timing LATEX METAFONT.
units . , .
unitsdef .

17.2.4.
bpchem , , .
chemarr oberdiek .
chemarrow .
chemcompounds . .
chemcono .
cryst .
X mhchem ,
(
).
X pst-labo
pstricks.
r-und-s ( ).
X xymtex LATEX
. chemtex .
http://homepage3.nifty.com/xymtex/fujitas3/xymtex/indexe.html.
TEX Live-2007 .

17.3.

255

17.2.5.
biocon .
dichokey
.
dnaseq -.
pst-pdgr .
X texshade (nucleotide and peptide alignments).
textopo ,
(membrane protein topology plots).
labbook .

17.3.
answers
.
assignment .
courseoutline coursepaper
.
eCards - . pdf Adobe Reader.
X exam , .
examdesign .
exercise .
flashcards .
interactiveworkbook pdf-. pdf Adobe Reader.
probsoln
- , .
qcm .

17.4.
. LATEX.

256

17. TEX Live

17.4.1. ,
dramatist .
ednotes .
ledmac . TEX- edmac. ledpar
.
play .
parrun , .
poemscol , .
sides . plari.
X stage .
verse .

17.4.2.
pst-tree
pstricks.
arcs (\underarc) (\overarc) .
cbcoptic .
covington , , --, ,
,
.
engpron , ,
(Daniel Jones English Pronouncing Dictionary)
lexikon .
linguex .
phonetic .
rst .
synttree .
X tipa (International Phonetic Alphabet).
teubner babel, greek .
xytree .

17.4.3.
abc LATEX ABC- ( ASCII-). abcm2ps.

17.5.

257

ConcProg . concprog.
cd cd-cover CD-.
X guitar .
musictex MusicTEX ,
LATEX.
X musixtex MusiXTEX MusicTEX .
X musixlyr musixtex .
songbook
.

17.5.
- , - .

17.5.1.
TEX-
. .
, ,
.
cooking .
.
cuisine cooking.

17.5.2.
cchess .
chess .
skak PGN (Portable Game Notation) .
skaknew , skak.
texmate .

17.5.3. ,
backgammon .
crosswrd . cwpuzzle.
dice , .
, epsdice.

258

17. TEX Live

othello .
psgo .
sudoku sudoku.

17.5.4.
advdate ltxmisc , , , , \today.
calendar .
calxxxx . .
china2e .
clock .
datetime . isodate.
weekday .

17.5.5.
bizcard .
labels - .
ticket , , .

17.6.
, , ,
. .

17.6.1.
float . floatraw.
rotfloat float, .

17.6.2.
boxhandler figure table.
dpfloat ,
. .
X floatflt , .
nccfloats ncctools
.

17.6.

259

sidecap , .
X wrapfig , .
X miniplot , subfig, .
photo .
picinpar . wrapfig . , .
plates ,
, (). , .
X subfig . .

17.6.3.
capt-of
.
captcont .
X caption , . ccaption.
X mcaption .
subfloat , .
X topcapt \topcaption, \caption,
.

17.6.4.
X endfloat .
figcaps preprint , . ,
.
hvfloat
.
X placeins ,
.

260

17. TEX Live

17.7.
. , ,
.

17.7.1.
bmpsize oberdiek . .
figsize
.
X graphicx .
epstopdf oberdiek eps- pdflatex, epstopdf .
nccpic ncctools graphicx
.
hilowres
, , .
, .
rotating .
watermark ncctools , ,
. bophook, eso-pic wallpaper.

17.7.2.
aurora dvips .
.
X color .
colorinfo .
xcolor .

17.7.3. LaTeX
bardiag PSTricks.
bez123 .
coordsys ,
. picture.
curve2e pict2e.
curves .
picture.

17.7.

261

ebezier . picture.
ecltree . picture.
epic picture.
epic eepic.
histogr . picture.
pdftricks pstricks pdflatex.
pict2e picture, .
pgf A Portable Graphic Format for TEX.
LATEX, tex.
pstricks Postcript LATEX.
pst-node ( ), pst-plot
( ), pst-tree ( ).
pst-3d -3D, , .
pst-barcode .
pst-blur .
pst-coil .
pst-eps eps-.
pst-fill .
pst-geo .
pst-gr3d 3D-.
pst-grad RGB- HSB-.
pst-infixplot .
pst-lens .
pst-light3d 3D- , .
pst-math ,
PostScript.
pst-pdf pdf-.
pst-poly .
pst-text .
pst-slpe .
pst-vue3d 3D- .
pst-xkey xkey - pstricks.
scalebar .
xypic TEX.

262

17. TEX Live

17.8.
, .
,
.
X booktabs .
.

17.8.1.
X arydshln .
delarray ( ) array.
X hhline .

17.8.2.
X cellspace ,
.
X colortbl , .
X makecell .
, , \makecell.
X multirow , . bigdelim ( ) bigstrut ( ).
X slashbox , .

17.8.3.
X dcolumn tools
. rccol warpcol.
X numprint
, .

17.8.4. tabular
array tabular array .
.
blkarray carlisle blockarray, array, tabular.
tabularht oberdiek tabular , .

17.9.

263

X tabularx tools tabular


.
X tabulary tabular .
X ctable .

17.8.5.
X longtable . .
ltxtable carlisle longtable tabularx.
X supertabular
longtable, .
X xtab supertabular longtable.

17.8.6.
X listliketab .

17.8.7.
X csvtools CSV-.

17.9.
() , ,
, , . LATEX , ,
.
X afterpage
.
everypage .
microtype pdftext. .
( T2A). .

17.9.1.
X lscape landscape,
.
X portland .

264

17. TEX Live

X pdflscape oberdiek lscape. pdf- , landscape,


.
X rotpages
, , . , ,
.

17.9.2.
chngpage .
X geometry .
X layout .
pdfscreen pdf- .
X pgfpages pgf ,
.
pdfpages pdf- pdf-.
X twoup .
booklet.
rmpage .
typearea KOMA-Script .
fullpage preprint 1.5 .
savetrees . , ?
stdpage , ,
.
X typogrid . .
X vmargin .

17.9.3.
X setspace .
nccparskip ncctools .

17.9.4.
X balance preprint
.

17.10. LATEX

265

dblfloatfix ( midfloat sttools) (


fixltx2e).
X multicol tools .
X parallel .
.
parcolumns sauerj .
X sttools , ,
. stfloats (
), floatpag ( ,
), flushend ( ), cuted ( / ), marginal ( ) midfloat (
).

17.10. LATEX
article (), book (), report (), proc (), letter () slides ( ) , .
. .
X KOMA-Script . scrartcl (), scrreprt (), scrbook () scrlttr2 ().
X ncclatex, , ncc. , , , , . [10]
.
hc KOMA-Script hcart
(), hcreport (), hcletter ().
hcslides.
ntgclass (artikel1, artikel2 artikel3), (boek
boek3), (brief ) (rapport1 rapport3).
.

266

17. TEX Live

extsizes , 10pt, 11pt 12pt 8pt, 9pt, 14pt, 17pt


20pt. extarticle, extbook, extletter, extproc, extreport.
X minimal , , .

17.10.1.
X eskdx . : eskdtext ( ), eskdbtab
( ) eskdgraph ( , ).
isostds ISO
(iso) ISO 10303 (iso10303).

17.10.2.
letter scrlttr2
KOMA-Script .
adrconv directory ,
BibTEX .
adrlist .
X akletter letter.
beletter .
X cdpbundl .
envlab US Postal Service.
dinbrief g-brief . dinbrief
dinbrief-gui Tcl/Tk.
facsimile fax .
formlett mailing .
lettre .
X newlfm ,
. fancyhdr geometry.

17.10.3.
book , , scrbook KOMA-Script.
X memoir ,
.
X octavo : , .
X sffms .

17.10. LATEX

267

17.10.4.
report, ,
, , scrreprt KOMA-Script.
X hitec HiTech.
refman refart refrep, , Adobe.

17.10.5.
X slides
.
a0poster .
X beamer .
powerdot .
prosper seminar slides. ppr-prv , prosper.
sciposter .
X seminar slides .
talk beamer . .
texpower , . powersem.
seminar ifmslide pdflatex. pdfslide.

ppower4,
PDF-.

17.10.6.
.
, .
X disser , , .
. ,

268

17. TEX Live

TEX Live-2007, CTAN-


{CTAN}/macros/latex/contrib/disser.
ebsthesis European
Business School.
hepthesis . PhD
(HEP).
pittetd University of Pittsburgh.
gatech-thesis Georgia Institute of Technology.
muthesis University of Man.
uaclasses University of Arizona.
ucthesis UC Berkeley.
uiucthesis University of Illinois.
umich-thesis University of Michigan.
uwthesis University of Washington.
york-thesis York University ().

17.10.7.
X curve CurVe .
europecv , .
moderncv .
vita,
currvita cv.

17.10.8.
,
.
aaai AAAI (American Association for Artificial Intelligence).
aastex AASTeX American Astronomical Society.
abstbook .
acmconf ACM (Association for Computing Machinery). acm.
active-conf ACTIVE ().
aguplus AGUTeX AGU (American Geophysical Union).
aiaa-tc , AIAA (American Institute of
Aeronautics and Astronautics). aaainamed.

17.10. LATEX

269

X - amsart (), amsbook () amsproc


().
apa American Psychological Association.
apacite apa apalike.
asaetr American Society for Agricultural Engineers (ASAE).
ascelike American Society of Civil Engineers. .
cc computational-complexity Computational
Complexity.
X combine . .
X elsart , Elsevier.
jpsj2 Journal of the Physical Society of Japan.
iagproc IAG (International Association of Geodesy).
IEEEconf IEEEtran IEEE (Institute of Electrical and Electronics Engineers).
mtn Maple Technical Newsletter.
nature , pdf-
Nature. .
X nccproc , .
nrc1 nrc2 nrc National Research Council ().
X revtex4 . ,
/ (http://www.maik.ru/pub/tex/).
ptptex PTPTeX (Progress of Theoretical Physics), .
X sibjnm .
siggraph Siggraph.
smfart smfbook .
spie SPIE.

17.10.9.
LATEX,
.
X papertex LATEX.
leaflet - .

270

17. TEX Live

17.11. -
. . -
.

17.11.1.
X minitoc .
multitoc .
X shorttoc .
X tocbibind , , .
X tocloft , , , .
tocvsec2 .

17.11.2.
X fancyhdr .
X nccfancyhdr ncctools fancyhdr.
X technics , fancyhdr
.
.

17.11.3.
amsrefs BibTEX .
authorindex .
backref hyperref , .
babelbib
babel. .
bibcheck ltxmisc ,
thebibliography .
bibtopic
.
bibunits
, , \part.
X breakcites ltxmisc \cite
. .
camel BibTEX .

17.11. -

271

cite , cite ( ), overcite (


), drftcite ( ) chapterbib (
).
X citehack t2 \cite.
citeref .
X compactbib thebibliography
.
custom-bib .
doipubmed (\doi, \pubmed \citeurl)
.
footbib
.
harvard Harvard.
multibbl .
multibib .
natbib . .
notoccite
, / BibTEX- unsrt.

17.11.4.
X gloss BibTEX.
index .
X makeidx LATEX .
X makeglos .
X nomencl . .
robustindex . ,
, .
X splitindex
.
X varindex . , , , .

272

17. TEX Live

17.12. LATEX
,
- .
, .
perltex PerlTEX. perl LATEX.

17.12.1.
arrayjob LATEX .
binhex , .
X chngcntr
.
clefval /
. - .
engord oberdiek
.
dcounter ncctools ,
.
fmtcount (, , ) .
sublabel preprint
, 4a, 4b, 4c .
zahl2string sauerj .

17.12.2. LATEX
X calc .
fltpoint .
refcount oberdiek ,
.
fp , , .

17.12.3.
ifdraft oberdiek
draft/final.
ifmtarg ltxmisc . ,
.

17.12. LATEX

273

ifpdf oberdiek \ifpdf latex pdflatex.


X ifthen , \ifthenelse ( ) \whiledo ().
xifthen.
labelcas .
multido \multido.
stdclsdv .

17.12.4.
acronym .
makecmds \makecommand, \makeenvironment
\provideenvironment, , , , .
optparams sauerj
. .
robustcommand .
toolbox ,
.
twoopt oberdiek
, .

17.12.5.
coolstr . ASCII-,
. \substr, ,
.
keyval =.
processkv sauerj =.

.
X tokenizer .
xkeyval keyval.
=.

17.12.6.
attachfile2 oberdiek PDF.
fink ,
\finkfile.
embedfile oberdiek PDF.

274

17. TEX Live

extract , .
filecontents LATEX-
\include.
newfile / .
X optional , , .
versions ,
.

17.12.7. LATEX
afterpackage ncctools ,
.
X doc .
.
X docstrip , doc.
blindtext .
lipsum.
diagnose .
dialogl LATEX-.
export / LATEX .
makedtx dtx-.
msg . , .
xdoc , , doc.

TEX Live

275

TEX Live
CD TEX Live-2007. LATEX http://www.tug.org/texlive/.

CD, TEX Live :
i386-linux
GNU/Linux x86;
powerpc-darwin MacOSX PowerPC1 ;
win32
32- Windows, 9x .
texmf-doc/doc/russian/texlive-ru/
html- pdf-: live.html live.pdf .
,
.

GNU/Linux
GNU/Linux, , Debian (Lenny), TEX Live LATEX .
, TEX Live.
GNU/Linux Mac OS X
CD :
> sh . / i n s t a l l t l . sh
. , . .
1 . ,
.
, PATH, , :
#
>
>
>

bash . b a s h _ p r o f i l e
TEXLIVE=/u s r / l o c a l / t e x l i v e /2007/
PATH=$TEXLIVE/ b i n / i 3 8 6 l i n u x :$PATH
e x p o r t PATH
1 , T X Live Mac OS X, E
MacTEX (http://www.tug.org/mactex/). TEX Live .

276

TEX Live

tex-
. - LATEX. ,
: emacs2 vim.
, , . , Kile (KDE Integrated
LATEX Environment) LyX (WYSIWYM ).

Windows3
Windows MiKTEX
(http://www.miktex.org/). LATEX
CTAN, TEX Live
MiKTEX.
TEX Live Windows
tlpmgui.exe, setup-win32
. CD, .
. tlpmgui.exe (scheme-full) , , Language
Collection. Install, perl , .
( ). , GhostScript
PostScript dvi- dviout. , .
.
, .
LATEX Windows
.
gsview (http://www.ghostgum.com.au/).
PostScript. , 2 L
AT X AucT X RefT X. E
E
E
preview-latex.
3 L
AT X, , ,
E
GNU/Linux . ,.

TEX Live

277


.
Adobe Reader (http://www.adobe.com/products/reader/) pdf-.
tex-. :
TeXnicCenter (http://www.toolscenter.org/)
. dvi-;
WinEdt (http://www.winedt.com/) ShareWare . 5.5,
TEX Live-2007;
Notepad++ (http://notepad-plus.sourceforge.net/ru/site.htm)
, ;
emacs vim, GNU/Linux.
TEX Live-2007 . http://tug.org/texlive/bugs.html.
 , . mktexmf TEX-.

lh.

texmf.cnf. :
MKTEXPK = 1
MKTEXMF = 1
MKTEXTFM = 1
MKTEXFMT = 1

/TeXLive2007/texmf-var/web2c/.
> kpsewhich texmf . c n f
. latex, . 4 , dvi-
. , ,
.
4 ,
Q (to run quietly).
, .


A
\AA, 123
\aa, 123
abstract, 39
\act, 233
\acute, 184
\addcharacter, 233
\addcontentsline, 133, 163
\addtocontents, 162
\addtocounter, 70, 73
\addtoendnotes, 138
\addtolength, 68, 73
\AE, 123
\ae, 123
\afterpage, 61
\againframe, 117
\aleph, 182
\alert, 111, 114
algorithm, 211
algorithmic, 210, 211
align, 196198
align*, 196, 197
alignat, 197
aligned, 198
alignedat, 198
\allowdisplaybreaks, 196
\alph, 70
\alpha, 48, 183
\alt, 114
\amlg, 186
\AND, 75
\and, 39
\ang, 219
\angle, 49, 182
\appendix, 133

\apprge, 189
\apprle, 189
\approx, 49, 187
\approxeq, 187
\arabic, 70
\arccos, 52
\arcctg, 52
\arcsin, 52
\arctg, 52
\areaset, 83
array, 149, 193, 262
\Asbuk, 70
\asbuk, 70
\AskOption, 145
\ast, 186
\asymp, 187
\ataribox, 122
\author, 39, 247
B
\backepsilon, 187
\backmatter, 134
\backprime, 182
\backsim, 187
\backsimeq, 187
\backslash, 182, 190
\backslashbox, 154
\balance, 90
\bar, 49, 184, 236, 237
\barwedge, 186
\baselineskip, 88, 89
\Bbbk, 182
\bcancel, 185, 251
\beamerbutton, 111, 113, 114
\because, 187
\begin, 29


\bell, 122
\beta, 48, 183
\beth, 182
\between, 187
\bfseries, 34
\bibitem, 166
\bibliography, 169
\Big, 52
\big, 52
\bigcap, 191
\bigcirc, 186
\bigcup, 191
\Bigg, 52
\bigg, 52
\bigodot, 191
\bigoplus, 191
\bigotimes, 191
\bigskip, 89
\bigsqcup, 191
\bigstar, 182
\bigtriangledown, 186
\bigtriangleup, 186
\biguplus, 191
\bigvee, 191
\bigwedge, 191
\binom, 195
\bitbox, 209
\bitheader, 209
\blacklozenge, 182
\blacksmiley, 122
\blacksquare, 182
\blacktriangle, 182
\blacktriangledown, 182
\blacktriangleleft, 188
\blacktriangleright, 188
block, 105, 113, 114
blockarray, 262
bmatrix, 193
\bond, 226
\boolean, 74
\bot, 182
\Bowtie, 122
\bowtie, 187

279
\Box, 182, 183
\boxdot, 186
\boxminus, 186
\boxplus, 186
\boxtimes, 186
\bra, 217
\breve, 184
\brokenvert, 122
\bullet, 186
\Bumpeq, 187
\bumpeq, 187
\burl, 140, 141
bytefield, 208, 209
C
\cancel, 185, 251
\cancelto, 185
\Cap, 186
\cap, 186
\caption, 41, 64, 135, 152, 211, 259
cases, 199
\cbend, 139
\cbstart, 139
CD, 194
\cdot, 49, 186
\cdotp, 185
\cdots, 185
\ce, 226, 227
\cent, 123
center, 87
\centerdot, 186
\centering, 88
\ceqn, 45
\cftchapdotsep, 162
\cftchapleader, 162
\cftdot, 162
\cftdotfill, 162
\cftdotsep, 162
\cftsecnumwidth, 162
\ch, 52
\chapter, 28, 39, 96, 128, 133
\check, 184
\checked, 122

280
\CheckedBox, 122
\checkmark, 123
\chi, 48, 183
\circ, 186
\circeq, 187
\circlearrowleft, 189
\circlearrowright, 189
\circledast, 186
\circledcirc, 186
\circleddash, 186
\circledR, 123, 182
\circledS, 182
circuit, 223
\cite, 166, 167, 270, 271
\citeurl, 271
\clearpage, 61, 143
\clock, 122
\clubsuit, 182
\cnttest, 74, 75
code, 253
\colon, 185
\color, 112, 113, 207
\columnbreak, 92
\columncolor, 154
\columnwidth, 79
\COMMENT, 211
comment, 33
\complement, 182
\cong, 187
\coprod, 191
\cos, 52
\counterwithin, 70
\counterwithout, 70
\ctable, 157
\ctg, 52
\cth, 52
\Cup, 186
\cup, 186
\curlyeqprec, 187
\curlyeqsucc, 187
\curlyvee, 186
\curlywedge, 186
\currency, 123


\curvearrowleft, 189
\curvearrowright, 189
D
\dag, 123
\dagger, 186
\daleth, 182
\dashleftarrow, 189
\dashrightarrow, 189
\dashv, 187
\date, 39
\ddag, 123
\ddagger, 186
\dddot, 51, 184
\ddot, 51, 184
\ddots, 185
\DeclareMathOperator, 52
\definecolor, 207
\DefineLCDchar, 208
\Delta, 48, 183
\delta, 48, 183
\depth, 127
\depthof, 73
desclist, 130
description, 129, 130, 245, 246
\diagdown, 182
\Diagram, 220
\diagup, 182
\dialog, 233
\diameter, 122
\Diamond, 182, 183
\diamond, 186
\diamondsuit, 182
\Dif, 191
\dif, 191
\diff, 192
\diffp, 192
\digamma, 183
\dimtest, 75
\displaybreak, 196
\displaystyle, 45, 192
\div, 49, 186
\divideontimes, 186


\DJ, 123
\dj, 123
document, 33
\documentclass, 24, 30, 31, 95
\doi, 271
\dominilof, 163
\dominilot, 163
\dominitoc, 163
\dot, 49, 51, 184
\doteq, 187
\doteqdot, 187
\dotfill, 87, 159
\dotlessi, 251
\dotlessj, 251
\dotplus, 186
\dots, 123, 185
\doublebarwedge, 186
\doublespacing, 89
\DOWNarrow, 122
\Downarrow, 189, 190
\downarrow, 189, 190
\downdownarrows, 189
\downharpoonleft, 189
\downharpoonright, 189
\dropchapter, 129
E
\ell, 49, 182
\ELSE, 210
\ELSIF, 210
\emph, 34, 111
empheq, 199
\emptyset, 182
\EnColonne, 240
\end, 29, 33
\endextract, 235
\ENDFOR, 210
\ENDIF, 210
\endinput, 143
\ENDLOOP, 210
\endnote, 138
\endnotemark, 138
\endnotetext, 138

281
\endpiece, 235
\endrotboxpages, 80
\endspace, 87
\ENDWHILE, 210
\enotes, 235237
\ENSURE, 211
\ensuremath, 71
enumerate, 35, 113, 129, 130, 245
\epigraph, 128
\epigraphhead, 128
\epigraphwidth, 128
\epsilon, 183
\eqcirc, 187
eqlist, 130
eqlist*, 130
\eqname, 251
\eqref, 44, 135, 200, 247
\eqslantgtr, 188
\eqslantless, 188
\equal, 74
equation, 44, 45, 135, 196
equation*, 45, 46, 196
\equiv, 49, 187
\eta, 48, 183
\eth, 182
\eval, 191
\evensidemargin, 79
example, 105
\excludeonly, 144
\exists, 49, 182
\exp, 52
F
\faktor, 252
\fallingdotseq, 187
\fbox, 127, 195
\Feyn, 220
\feyn, 220
figure, 60, 61, 135, 258
\figureref, 247
\finkfile, 273
\Finv, 183
\fixme, 141

282
flalign, 197
flalign*, 197
\flat, 182
\fleqn, 45
\FloatBarrier, 62
floatingfigure, 63, 64
\flushend, 90
flushleft, 87
\flushleft, 87, 88
flushright, 87
\flushright, 87
\fmf, 221
fmffile, 222
fmfgraph, 221
\fmflabel, 221
\fmfleft, 221
\fmfright, 221
\footnote, 136, 137
\footnotemark, 136
\footnotesize, 35
\footnotetext, 136
\footskip, 79
\FOR, 210
\FORALL, 210
\forall, 49, 182
\foreignlanguage, 120
\frac, 50, 51, 192
frame, 109, 110, 114
\framebox, 127
\framesubtitle, 110, 112
\frametitle, 105, 110, 112
\frontmatter, 134
\frown, 187
\frownie, 122
\fullfunction, 191
\fxerror, 141
\fxnote, 141
\fxwarning, 141
G
\galso, 179
\Game, 183
\Gamma, 48, 183


\gamma, 48, 183
gather, 197
gather*, 197
gathered, 198
\ge, 49, 187
\generalmeter, 236, 237
\generalsignature, 236, 237
\geneuro, 123
\geneuronarrow, 123
\geneurowide, 123
\geq, 187
\geqq, 188
\geqslant, 49, 188
\GetTokens, 75
\gg, 49, 187
\ggg, 188
\gimel, 183
\gloss, 179
\glossary, 178
\glossaryintro, 179
\glossaryname, 178, 179
\gnapprox, 188
\gneq, 188
\gneqq, 188
\gnsim, 188
\grave, 184
\gsee, 179
\gtrapprox, 188
\gtrdot, 188
\gtreqless, 188
\gtreqqless, 188
\gtrless, 188
\gtrsim, 188
guitar, 235
\gvertneqq, 188
H
\hat, 49, 184
\hbar, 182
\hdotsfor, 193
\headheight, 79
\headsep, 79
\heartsuit, 182

283

\height, 127
\heightof, 73
\HepAntiParticle, 220
\HepGenAntiParticle, 220
\HepGenParticle, 220
\HepGenSusyParticle, 220
\HepParticle, 220
\HepParticleResonance, 220
\HepProcess, 220
\HepSusyParticle, 220
\HepTo, 220
\hexstar, 122
\hfil, 87
\hfill, 87
\hhline, 153
hieroglyph, 240, 241
\hline, 151
\hm, 53
\hoffset, 79
\hookleftarrow, 189
\hookrightarrow, 189
\hphantom, 195, 196
\hrule, 126
\hrulefill, 87, 126
\hslash, 183
\hspace, 87, 89, 195
\hspace*, 87
\Huge, 35
\huge, 35
\hyperlink, 114
\hyphenation, 37, 38

\in, 49, 182


\include, 143, 144, 249, 250, 274
\includegraphics, 5860, 113
\includeonly, 117, 143, 144, 250
\indeces, 194
\indent, 87
\index, 172174
\infty, 49, 182
inparaenum, 131
inparaitem, 35, 131
\input, 143, 172, 250
\int, 51, 191, 192
\intercal, 186
\intertext, 199
\invdiameter, 122
\invisible, 114
\invneg, 189
\iota, 48, 183
IPA, 239
\isempty, 75
\isequivalentto, 75
\isnamedefined, 75
\isodd, 74
\isotope, 222
\isundefinedcommand, 74
\item, 35, 41, 113, 129, 130
itemize, 35, 113, 129
\itshape, 34

I
\idotsint, 191
\IF, 210
\iflanguage, 121
\ifpdf, 273
\ifthenelse, 74, 273
\iiiint, 191
\iiint, 191, 192
\iint, 191, 192
\Im, 182, 183
\imath, 182

K
\kappa, 183
\ket, 217
\kill, 149
\kreuz, 122

J
\jmath, 182
\Join, 189

L
\L, 123
\l, 123
\label, 40, 41, 44, 114, 135, 211, 247
\Lambda, 48, 183

284
\lambda, 48, 183
\land, 49
landscape, 80, 263, 264
\landscape, 80
\langle, 190
\LARGE, 35
\Large, 35
\large, 35
\LaTeX, 28
\layout, 77, 78
\LCD, 208
\LCDcolors, 207
\lceil, 190
\ldotp, 185
\ldots, 38, 185
\le, 49, 187
\leadsto, 189
\left, 52, 53
\LEFTarrow, 122
\Leftarrow, 189
\leftarrow, 189
\leftarrowtail, 189
\leftharpoondown, 189
\leftharpoonup, 189
\leftleftarrows, 189
\Leftrightarrow, 189
\leftrightarrow, 189
\leftrightarrows, 189
\leftrightharpoons, 189
\leftrightsquigarrow, 189
\leftthreetimes, 186
leftwordgroup, 210
\lengthtest, 74
\leq, 187
\leqq, 188
\leqslant, 49, 188
\lessapprox, 188
\lessdot, 188
\lesseqgtr, 188
\lesseqqgtr, 188
\lessgtr, 188
\lesssim, 188
\lfloor, 190


\LHD, 187
\lhd, 186, 187
\lightning, 122
\lim, 52, 182
\limits, 51
\linebreak, 86
\linelabel, 142
linenumbers, 141
\linenumbers, 142
\linewidth, 79
\listfiles, 144
listliketab, 159
\listoffigures, 133, 159, 162
\listoffixmes, 141
\listoftables, 133, 159, 162
\ll, 49, 187
\llcorner, 190
\Lleftarrow, 189
\lll, 188
\ln, 52
\lnapprox, 188
\lneq, 188
\lneqq, 188
\lnsim, 188
\log, 52
\logof, 189
\longitem, 130
\Longleftarrow, 189
\longleftarrow, 189
\Longleftrightarrow, 189
\longleftrightarrow, 189
\longmapsto, 189
\longpage, 88
\Longrightarrow, 189
\longrightarrow, 189
longtable, 157
\LOOP, 210
\looparrowleft, 189
\looparrowright, 189
\lor, 49
\lozenge, 183
\lrcorner, 190
\Lsh, 189


\lstdefinelanguage, 207
\lstinline, 206
\lstinputlisting, 206
lstlisting, 206
\lstloadlanguages, 205
\lstset, 205
\ltimes, 186
\lVert, 190
\lvert, 190
\lvertneqq, 188
\lyrraise, 237
M
\mainmatter, 134
\makeatletter, 69
\makeatother, 69
\makebox, 127
\makecell, 155, 262
\makecommand, 273
\makeenvironment, 273
\makegloss, 178
\makeglossary, 178
\makeindex, 172
\makenomenclature, 180
\makepagenote, 138
\maketitle, 39, 247
\maltese, 123
\mapsto, 189
margincap, 65
\marginnote, 139
\marginpar, 139
\marginparpush, 79
\marginparsep, 79
\marginparwidth, 79
\markright, 164
\mathbb, 48
\mathbcal, 48
\mathbf, 48
\mathbin, 181
\mathclose, 182
\mathdollar, 182
\mathellipsis, 182
\mathfrak, 48

285
\mathindent, 45
\mathinner, 182
\mathop, 182
\mathopen, 182
\mathord, 182
\mathparagraph, 182
\mathpuct, 182
\mathrel, 181
\mathring, 184
\mathsection, 182
\mathsterling, 182
\mathstrut, 50
\mathunderscore, 182
matrix, 193
\max, 52
\maxwidth, 69
\maybebm, 252
\maybeit, 252
\mbox, 38, 127
\mboxfill, 126
\md, 191
\measuredangle, 183
\medskip, 89
\medspace, 195
\meterfrac, 236, 237
\mho, 182
\mid, 187
\min, 52
\minilof, 163
\minilot, 163
minipage, 62, 63, 128, 136, 157, 158
\minitoc, 163
\models, 187
\movie, 117
\mp, 49, 186
mpsupertabular, 157
mpxtabular, 157
\mtcskip, 163
\mu, 48, 183
multicols, 91, 92
\multicolumn, 153, 154
\multido, 273
\multimap, 187

286
\multirow, 153, 154
multline, 197, 198
music, 235237
N
\nabla, 182
\natural, 182
\ncong, 188
\ne, 187
\nearrow, 189
\neg, 49, 182
\negmedspace, 195
\negthickspace, 195
\neq, 49, 187
\newblock, 166
\newcommand, 72, 73, 214
\newcounter, 69
\newenvironment, 72
\newindex, 175
\newlength, 67
\newpage, 88
\newtheorem, 112, 201, 202
\newtie, 124
\nexists, 183
\nextnum, 159
\ngeq, 188
\ngeqq, 188
\ngeqslant, 188
\ngtr, 188
\ni, 182
\nLeftarrow, 190
\nleftarrow, 190
\nLeftrightarrow, 190
\nleftrightarrow, 190
\nleq, 188
\nleqq, 188
\nleqslant, 188
\nless, 188
\nmid, 188
\No, 30
\nocite, 167
\noindent, 87
\nolimits, 51


\nolinenumbers, 142
\nomenclature, 180
\normalmarginpar, 139
\normalsize, 34, 35
\NOT, 75
\not, 187
\notag, 200
\notes, 235237
\notesname, 138
\notin, 187
\nparallel, 188
\nprec, 188
\npreceq, 188
\nRightarrow, 190
\nrightarrow, 190
\nshortmid, 188
\nshortparallel, 188
\nsim, 188
\nsubseteq, 188
\nsucc, 188
\nsucceq, 188
\nsupseteq, 188
\nsupseteqq, 188
\ntriangleleft, 188
\ntrianglelefteq, 188
\ntriangleright, 188
\ntrianglerighteq, 188
\nu, 48, 183
\nulide, 194
\num, 219
numcases, 199, 251
\numprint, 155
\nVDash, 188
\nvDash, 188
\nvdash, 188
\nwarrow, 189
O
\O, 123
\o, 123
\ocircle, 187
\od, 191
\oddsidemargin, 79


\odot, 186
\OE, 123
\oe, 123
\officialeuro, 123
\oint, 191
\Omega, 48, 183
\omega, 48, 183
\ominus, 186
\onecolumn, 90
onehalfspacing, 89
\onehalfspacing, 89
\only, 114
\opensd, 233
\oplus, 186
\opt, 144
\OR, 75
\oslash, 186
otherlanguage, 120
otherlanguage*, 120
\otimes, 186
\overarc, 241, 256
\overbrace, 185
\overleftarrow, 185
\overleftrightarrow, 190
\overline, 185
\overrightarrow, 185
P
\P, 123
\pagebreak, 88
\pagenote, 138
\pageref, 41, 135
\pagestyle, 164
\paperheight, 79, 83
\paperwidth, 79, 83
\par, 34, 72
\paragraph, 131
Parallel, 92
\parallel, 49, 187
\ParallelLText, 93
\ParallelRText, 93
parbox, 128
\parbox, 62, 63

287
\part, 39, 133, 270
\partial, 51, 182
\pause, 111, 233
\pd, 191
\permil, 122
\perp, 49, 187
\pgfpagesuselayout, 85
\phantom, 196
\Phi, 48, 183
\phi, 183
\phone, 122
\Pi, 48, 183
\pi, 48, 183
picture, 260, 261
\pitchfork, 187
\pm, 49, 186
pmatrix, 193
\poemtitle, 232
\poemtoc, 232
\pointer, 122
\poptabs, 149
portrait, 80
\portrait, 80
\pounds, 123
\prec, 187
\precapprox, 187
\preccurlyeq, 187
\preceq, 187
\precnapprox, 188
\precnsim, 188
\precsim, 188
\prettyref, 136
\prime, 182
\PRINT, 211
\printglossary, 178
\printindex, 172
\printnomenclature, 180
\printnotes, 138
\printnotes*, 138
Problem, 71
\prod, 49, 191
prof, 113
proof, 105, 113, 251

288
\propto, 49, 187
\protect, 28, 44, 64, 133, 136, 162
\providecommand, 72
\provideenvironment, 273
pseudocode, 212
\Psi, 48, 183
\psi, 48, 183
\pubmed, 271
\pushtabs, 149
Q
\qedhere, 113
\qquad, 87, 195
\quad, 68, 87, 195
quatation, 128
quote, 128
R
\raggedend, 90
\raggedleft, 88
\RaggedRight, 88, 92
\raggedright, 88
\rangle, 190
\rceil, 190
\Re, 182, 183
\real, 74
\recorder, 122
\ref, 41, 71, 135, 142, 200, 247
\refstepcounter, 71
\renewcommand, 72
\renewenvironment, 73
\REPEAT, 210
\REQUIRE, 210
\RETURN, 211
\reversemarginpar, 139
\rfloor, 190
\RHD, 187
\rhd, 186, 187
\rho, 48, 183
\right, 52, 53
\RIGHTarrow, 122
\Rightarrow, 189
\rightarrow, 189


\rightarrowtail, 189
\rightharpoondown, 189
\rightharpoonup, 189
\rightleftarrows, 189
\rightleftharpoons, 189
\rightrightarrows, 189
\rightsquigarrow, 189
\rightthreetimes, 186
rightwordgroup, 209
\risingdotseq, 188
\Roman, 70
\roman, 70
\rotboxpages, 80
\rowcolor, 154
\Rsh, 189
\rtimes, 186
\rule, 126
\rVert, 190
\rvert, 190
S
\S, 30, 123
\saveFN, 137
\scene, 233
\scriptscriptstyle, 45
\scriptsize, 35
\scriptstyle, 45
\scshape, 34
\searrow, 189
section, 110
\section, 28, 96, 131, 133, 162
\section*, 40
\sectionref, 247
\see, 174
\selectlanguage, 120
semiverbatim, 114
\setcounter, 73, 133
\setlength, 67, 68, 73, 128
\setlyrics, 237, 238
\setmarginsrb, 82
\setmargnohfrb, 82
\setmargrb, 82
\setminus, 186


\setnewcounter, 70
\setpagewiselinenumbers, 142
\settodepth, 69, 127
\settoheight, 69, 127
\settowidth, 68, 127
\SetWatermarkAngle, 143
\SetWatermarkFontSize, 143
\SetWatermarkLightness, 142
\SetWatermarkScale, 142
\SetWatermarkText, 142
\sh, 52
\shabox, 127, 249
\sharp, 182
\shortmid, 188
\shortpage, 88
\shortparallel, 188
\shorttableofcontents, 162
\shoveleft, 198
\shoveright, 198
\SI, 219
\sidefig, 64
\Sigma, 48, 183
\sigma, 48, 183
\sim, 49, 187
\simeq, 49, 187
\sin, 52, 182
\sindex, 175
singlespacing, 89
\singlespacing, 89
\skippedwords, 209
\slashed, 254
slide, 106
\slshape, 34
\small, 35
\smallfrown, 188
\smallsetminus, 187
\smallskip, 89
\smallsmile, 188
\smile, 187
\smiley, 122
\so, 125, 126
\sound, 117
spacing, 89

289
\spadesuit, 182
\spcheck, 184
\spdddot, 184
\spddot, 184
\spdot, 184
\sphat, 184
\sphericalangle, 49, 183
split, 198
\sptilde, 184
\sqcap, 186
\sqcup, 186
\sqrt, 49, 50
\sqsubset, 188, 189
\sqsubseteq, 187
\sqsupset, 188, 189
\sqsupseteq, 187
\Square, 122
\square, 183
\SS, 123
\ss, 123
\st, 125
\stage, 233
\star, 186
\startextract, 235
\startpiece, 235237
\STATE, 210
\stepcounter, 70, 71
\stretchwith, 126
strip, 90, 91
subequations, 200, 252
subnumcases, 251
\subparagraph, 131
\subsection, 28, 131, 133
\Subset, 188
\subset, 187
\subseteq, 187
\subseteqq, 188
\subsetneq, 188
\subsetneqq, 188
\substr, 273
\subsubsection, 131
\succ, 187
\succapprox, 188

290
\succcurlyeq, 188
\succeq, 187
\succnapprox, 188
\succnsim, 188
\succsim, 188
\sum, 49, 51, 182, 191
\sun, 122
supertabular, 157
\suppressfloats, 61
\Supset, 188
\supset, 187
\supseteq, 187
\supseteqq, 188
\supsetneq, 188
\supsetneqq, 188
\surd, 182
\SVN, 215
\SVNDate, 215
\SVNKeyword, 215
\SVNTime, 215
\swarrow, 189
\switchlinenumbers, 142
T
tabbing, 148, 149
table, 150, 258
\tableofcontents, 39, 110, 131, 159, 162
tabular, 135, 149151, 156, 262, 263
tabularx, 156
\tag, 200
\tag*, 200
\tau, 48, 183
\tensor, 194
\text, 46, 218, 219, 250
\textasciicircum, 121
\textasciitilde, 121
\textasteriskcentered, 121, 122
\textbackslash, 121
\textbaht, 123
\textbar, 121
\textbardbl, 122
\textbf, 28, 34
\textbigcircle, 122


\textblank, 122
\textbraceleft, 121
\textbraceright, 121
\textbrokenbar, 122
\textbullet, 121, 122
\textcent, 123
\textcentoldstyle, 123
\textcircled, 124
\textcircledP, 123
\textcolonmonetary, 123
\textcopyleft, 123
\textcopyright, 123
\textcurrency, 123
\textdagger, 121, 122
\textdaggerdbl, 121, 122
\textdblhyphen, 122
\textdblhyphenchar, 122
\textdegree, 186
\textdiscount, 122
\textdiv, 186
\textdollar, 121, 123
\textdollaroldstyle, 123
\textdong, 123
\textdownarrow, 122
\textellipsis, 121
\textemdash, 121
\textendash, 121
\textepsilon, 239
\textesh, 239
\textestimated, 122
\texteuro, 123
\textexclamdown, 121
\textflorin, 123
\textfractionsolidus, 186
\textgreater, 121
\textguarani, 123
\texthight, 79
\textinterrobang, 122
\textinterrobangdown, 122
\textipa, 239
\textit, 34
\textLCD, 207
\textleftarrow, 122


\textless, 121
\textlira, 123
\textlnot, 186
\textmd, 34
\textminus, 186
\textmusicalnote, 122
\textnaira, 123
\textnumero, 122
\textonehalf, 186
\textonequarter, 186
\textonesuperior, 186
\textopenbullet, 122
\textordfeminine, 121, 122
\textordmasculine, 121, 122
\textparagraph, 121, 122
\textperiodcentered, 121, 122
\textpertenthousand, 122
\textperthousand, 122
\textpeso, 123
\textpilcrow, 122
\textpm, 186
\textprimstress, 239
\textquestiondown, 121
\textquotedblleft, 121
\textquotedblright, 121
\textquoteleft, 121
\textquoteright, 121
\textquotesingle, 122
\textquotestraightbase, 122
\textquotestraightdblbase, 122
\textrecipe, 122
\textreferencemark, 122
\textregistered, 121, 123
\textrightarrow, 122
\textsc, 34
\textschwa, 239
\textsci, 239
\textsection, 121, 122
\textservicemark, 123
\textsf, 34
\textsl, 34
\textsterling, 121, 123
\textstyle, 45, 192

291
\textsurd, 186
\textthreequarters, 186
\textthreequartersemdash, 122
\textthreesuperior, 186
\texttildelow, 122
\texttimes, 186
\texttrademark, 121, 123
\texttt, 34
\texttwelveudash, 122
\texttwosuperior, 186
\textunderscore, 121
\textuparrow, 122
\textvisiblespace, 121, 204
\textwidth, 58, 67, 79, 164
\textwon, 123
\textyen, 123
\tg, 52
\th, 52
\thanks, 39
\the, 68, 70, 71
thebibliography, 166168, 270, 271
\theendnotes, 138
\theequation, 201
theorem, 105, 113, 114, 135, 251
\therefore, 188
\Theta, 48, 183
\theta, 48, 183
\thickapprox, 188
\thicksim, 188
\thickspace, 195
\thispagestyle, 84
\tilde, 49, 184
\times, 49, 186
\tiny, 35
\tipaencoding, 239
\title, 39
titlepage, 38, 39, 134
\to, 182
\today, 258
\top, 182
\topcaption, 152, 259
\topmargin, 79
\totalheight, 127

292
\triangle, 49, 182
\triangledown, 183
\triangleleft, 186
\trianglelefteq, 189
\triangleq, 189
\triangleright, 186
\trianglerighteq, 189
\twocolumn, 90
\twoheadleftarrow, 190
\twoheadrightarrow, 190
U
\ul, 125
\ulcorner, 190
\uncover, 113, 114
\underarc, 241, 256
\underbrace, 185
\underleftarrow, 190
\underleftrightarrow, 190
\underline, 185
\underrightarrow, 190
\unitlength, 129
\unlhd, 186, 187
\unrhd, 186, 187
\UNTILL, 210
\upalpha, 184
\UParrow, 122
\Uparrow, 189, 190
\uparrow, 189, 190
\upbeta, 184
\upchi, 184
\Updelta, 184
\updelta, 184
\Updownarrow, 189, 190
\updownarrow, 189, 190
\upepsilon, 184
\upeta, 184
\Upgamma, 184
\upgamma, 184
\upharpoonleft, 190
\upharpoonright, 190
\upiota, 184
\upkappa, 184


\Uplambda, 184
\uplambda, 184
\uplus, 186
\upmu, 184
\upnu, 184
\Upomega, 184
\upomega, 184
\Upphi, 184
\upphi, 184
\Uppi, 184
\uppi, 184
\Uppsi, 184
\uppsi, 184
\uprho, 184
\Upsigma, 184
\upsigma, 184
\Upsilon, 48, 183
\upsilon, 48, 183
\uptau, 184
\Uptheta, 184
\uptheta, 184
\upuparrows, 190
\Upupsilon, 184
\upupsilon, 184
\upvarepsilon, 184
\upvarphi, 184
\upvarpi, 184
\upvarrho, 184
\upvarsigma, 184
\upvartheta, 184
\Upxi, 184
\upxi, 184
\upzeta, 184
\urcorner, 190
\url, 139141
\usecolortheme, 116
\useFN, 137
\usefonttheme, 116
\useinnertheme, 116
\useoutertheme, 116
\usepackage, 24, 30, 32
\usetheme, 116


V
\value, 74
\varangle, 183
\varepsilon, 48, 183
\varhexstar, 122
\varkappa, 48, 183
\varnothing, 49, 183
\varphi, 48, 183
\varpi, 183
\varpropto, 188
\varrho, 183
\varsigma, 183
\varsubsetneq, 188
\varsubsetneqq, 188
\varsupsetneq, 188
\varsupsetneqq, 188
\vartheta, 183
\vartriangle, 183
\vartriangleleft, 189
\vartriangleright, 189
\Vdash, 188
\vDash, 188
\vdash, 187
\vdots, 185
\vec, 49, 184
\vee, 186
\veebar, 187
\verb, 140, 204, 206
\verb*, 204
verbatim, 204
verbatim*, 204
\verbatiminput, 204
\verbatiminput*, 204
verse, 231, 232
\versewidth, 232
versionhistory, 213
\vfil, 89
\vfill, 89
\vhantom, 196
\vhCurrentDate, 214
\vhCurrentVersion, 214
\vhEntry, 213
\vhListAllAuthorsLong, 214

293
\vin, 232
\visible, 114
Vmatrix, 193
vmatrix, 193
\voffset, 79
\vphantom, 196
\vspace, 89
\vspace*, 89
\Vvdash, 188
W
\wasylozenge, 122
\wasypropto, 189
\wasytherefore, 183
\wedge, 186
\WHILE, 210
\whiledo, 75, 273
\widehat, 184
\widetilde, 184
\width, 126, 127
\widthof, 73
\wordbox, 209
\wordgroupr, 209
\wp, 182
\wr, 186
wrapfigure, 63, 64
X
\XBox, 122
\xcancel, 185, 251
\Xi, 48, 183
\xi, 48, 183
\xleftarrow, 190
\xrightarrow, 190
\xspace, 71
xtab, 158
xtabular, 157
Z
\zeta, 48, 182, 183


A
a0poster, 102, 267
aaai, 268
aaai-named, 268
aastex, 268
abc, 256
abstbook, 268
abstract, 247
accents, 251
acm, 268
acmconf, 268
acronym, 273
active-conf, 268
adami, 244
adrconv, 266
adrlist, 266
advdate, 258
afterpackage, 274
afterpage, 61, 263
aguplus, 268
aiaa-tc, 268
akletter, 99, 266
algorithm2e, 211, 253
algorithmic, 210, 253
algorithmicx, 211, 253
algorithms, 210, 211, 253
alltt, 246
alnumsec, 246
altt, 204
amsart, 98, 269
amsbook, 98, 269
amsbsy, 250
amscd, 194, 195, 251
amsfonts, 48, 181, 184, 251

amsmath, 43, 45, 46, 135, 181, 184, 185,


191, 194196, 198200, 250
252
amsopn, 250
amsproc, 98, 269
amsrefs, 270
amssymb, 48, 49, 123, 181183, 186
190, 251
amstext, 46, 250
amsthm, 251
amsxtra, 184
answers, 255
anttor, 124, 244
apa, 269
apacite, 269
apalike, 269
appendix, 246
arabicfront, 251
arabtex, 244
arcs, 241, 256
armtex, 244
arosgn, 244
array, 151, 157, 194, 262
arrayjob, 272
article, 31, 39, 40, 79, 81, 96, 139, 265
artikel1, 98, 265
artikel2, 98, 265
artikel3, 98, 265
arydshln, 153, 262
asaetr, 102, 269
ascelike, 269
ascii, 253
askinclude, 144, 249
assignment, 104, 255
astro, 253
attachfile2, 273


aurora, 260
authblk, 247
authorindex, 270
B
babel, 30, 31, 37, 38, 46, 52, 119121,
130, 244, 256, 270
babelbib, 270
backgammon, 257
backref, 270
balance, 90, 264
balanced, 91
balancedquotes, 246
bangtex, 244
bardiag, 260
basix, 253
beamer, 102, 109114, 116, 117, 201,
267
beletter, 266
bez123, 260
bezos, 251
bibcheck, 270
bibtopic, 270
bibunits, 270
bigdelim, 262
bigstrut, 262
binhex, 272
biocon, 255
bizcard, 258
blindtext, 274
blkarray, 262
bmpsize, 260
boek, 98, 265
boek3, 98, 265
boites, 248
book, 31, 39, 40, 79, 81, 96, 100, 133,
265, 266
booklet, 84, 85, 264
booktabs, 151, 262
bophook, 143, 260
boxedminipage, 248
boxhandler, 248, 258
bpchem, 254

295
braille, 244
braket, 217, 253
breakcites, 167, 270
breakurl, 140, 248
breqn, 251
brief, 98, 99, 265
burmese, 244
bytefield, 208, 253
C
calc, 7375, 81, 272
calendar, 258
calxxxx, 258
camel, 270
cancel, 185, 251
capt-of, 259
captcont, 259
caption, 64, 259
carlisle, 248, 250, 254, 262, 263
cases, 199, 251
cbcoptic, 256
ccaption, 64, 259
cchess, 257
cd, 104, 257
cd-cover, 257
cdpbundl, 99, 266
cellspace, 153, 262
changebar, 139, 248
chappg, 246
chapterbib, 271
chapterfolder, 250
checkend, 251
chemarr, 254
chemarrow, 254
chemcompounds, 254
chemcono, 254
chemtex, 227, 254
chess, 257
china2e, 258
chngcntr, 70, 272
chngpage, 264
circ, 222, 224, 253
cite, 271

296
citehack, 167, 244, 271
citeref, 271
cjk, 244
clefval, 272
clock, 258
clrscode, 211, 253
cm-super, 108, 124, 244
cmap, 248
cmastro, 253
codep, 253
color, 207, 260
colorinfo, 260
colortbl, 154, 262
combine, 102, 249, 269
commath, 191, 251
comment, 245
compactbib, 167, 271
complexity, 251
computational-complexity, 269
ConcProg, 104, 257
concrete, 124, 192, 244
contour, 245
cooking, 257
coolstr, 273
cooltooltips, 248
coordsys, 260
courseoutline, 104, 255
coursepaper, 104, 255
CoverPage, 247
covington, 256
crop, 250
crossreference, 247
crosswrd, 257
cryst, 254
csquotes, 246
csvtools, 156, 263
ctable, 157, 263
ctib4tex, 244
cuisine, 257
currvita, 103, 268
cursor, 253
curve, 103, 268
curve2e, 260


curves, 260
custom-bib, 271
cuted, 90, 91, 265
cv, 268
cwpuzzle, 257
cyrillic, 244
D
dashbox, 248
dashrule, 126, 245
datetime, 258
dblfloatfix, 265
dblfnote, 247
dcolumn, 155, 156, 262
dcounter, 272
dcpic, 251
delarray, 262
deleq, 200, 251
desclist, 130, 245
devanagari, 244
diagnose, 274
dialogl, 274
dice, 257
dichokey, 255
dinbrief, 266
directory, 266
disser, 103, 267
dnaseq, 255
doc, 274
docstrip, 274
doipubmed, 271
dotlessi, 251
dpfloat, 63, 258
draftcopy, 142, 249
draftwatermark, 142, 143, 249
dramatist, 256
drftcite, 271
E
easy, 251
easybib, 251
easybmat, 251
easyeqn, 251


easymat, 251
easytabl, 251
easyvector, 251
ebezier, 261
ebsthesis, 268
eCards, 255
ecltree, 261
edmac, 256
ednotes, 256
eepic, 261
egameps, 251
elsart, 102, 269
embedfile, 273
empheq, 199, 251
endfloat, 62, 259
endheads, 248
endnotes, 138, 248
engord, 272
engpron, 256
engrec, 245
enthiop, 244
enumerate, 245
enumitem, 245
envlab, 266
epic, 261
epigraph, 128, 246
epsdice, 257
epstopdf, 260
eqlist, 130, 246
eqname, 251
eqparbox, 248
esdiff, 192, 251
esindex, 251
eskd, 99
eskdbtab, 99, 266
eskdgraph, 99, 266
eskdtext, 99, 266
eskdx, 31, 99, 244, 266
eso-pic, 143, 260
esvect, 251
etaremune, 246
euler, 124, 192, 244
eulervm, 252

297
europecv, 103, 268
eurosym, 123
everypage, 263
exam, 255
examdesign, 255
examplep, 253
excludeonly, 144, 250
exercise, 255
expdlist, 246
export, 274
extarrows, 252
extarticle, 97, 266
extbook, 97, 266
extdash, 244
extletter, 97, 266
extpfeil, 252
extproc, 97, 266
extract, 274
extreport, 97, 266
extsizes, 97, 266
F
facsimile, 266
faktor, 252
fancybox, 249
fancyhdr, 84, 164, 165, 266, 270
fancyvrb, 204, 246
fax, 266
feyn, 220, 253
feynmf, 220, 222, 254
feynmp, 220, 221
figcaps, 259
figsize, 63, 260
filecontents, 274
fink, 273
fixfoot, 247
fixltx2e, 90, 250, 265
fixmath, 183, 253
fixme, 141, 249
flagderiv, 252
flashcards, 104, 255
float, 60, 258
floatflt, 63, 258

298
floatpag, 265
floatraw, 60, 258
fltpoint, 272
flushend, 90, 91, 265
fmtcount, 272
fncychap, 246
fnpos, 247
fontenc, 46, 243
footbib, 271
footmisc, 137, 247
footnpag, 247
formlett, 266
fp, 272
ftnright, 90, 91, 247
fullpage, 264
G
g-brief, 266
gatech-thesis, 268
gauss, 252
gensymb, 253
geometry, 81, 82, 264, 266
gloss, 179, 271
gost, 244
gost71s, 171
gost71u, 171, 244
gost780s, 171
gost780u, 169, 171, 244
graphics, 58
graphicx, 58, 59, 260
guitar, 234, 235, 257
gurmukhi, 244
H
hanging, 245
harvard, 271
hc, 265
hcart, 265
hcletter, 265
hcreport, 265
hcslides, 265
hepparticles, 220, 254
hepthesis, 268


hhline, 153, 262
hhline.pdf, 153
hhtensor, 252
hierotex, 239
hilowres, 260
histogr, 261
hitec, 101, 267
hvfloat, 259
hyperref, 108, 109, 140, 179, 248, 270
I
iagproc, 269
icomma, 245, 253
IEEEtran, 269
ifdraft, 272
ifmslide, 267
ifmtarg, 272
ifpdf, 273
ifthen, 74, 75, 273
import, 250
indentfirst, 30, 121, 244
index, 271
inputenc, 30, 32, 165, 243, 244
interactiveworkbook, 255
iso, 100, 266
iso10303, 100, 266
isodate, 258
isostds, 266
isotope, 222, 254
itrans, 244
J
jpsj2, 102, 269
K
karnaugh, 252
keystroke, 253
keyval, 58, 81, 273
KOMA-Script, 31, 8183, 98100, 163,
264267
L
labbook, 104, 255
labelcas, 273


labels, 258
lastpage, 247
latter, 81
layout, 78, 264
lcd, 207, 253
leaflet, 269
ledmac, 256
ledpar, 256
letter, 79, 96, 98, 265, 266
lettre, 266
lexikon, 256
lh, 32, 124, 155, 244, 277
lineno, 141, 245
linguex, 256
lipsum, 274
listings, 204206, 253
listliketab, 159, 263
longtable, 157, 263
lscape, 80, 263, 264
lstlistings, 114
ltxmisc, 70, 138, 144, 167, 199, 217,
258, 270, 272
ltxtable, 263
M
mailing, 266
makecell, 155, 262
makecirc, 224
makecmds, 273
makedtx, 274
makeglos, 178, 179, 271
makeidx, 172, 174, 271
malayalam, 244
manjutex, 244
manual, 101
manyfoot, 247
marginal, 265
marginnote, 139, 248
mathtext, 46, 244
mathtools, 251
maybemath, 252
mboxfill, 126, 245
mcaption, 65, 259

299
memoir, 100, 266
method, 253
mh, 199, 251
mhchem, 226, 254
mhequ, 251
microtype, 87, 263
midfloat, 265
minimal, 96, 266
miniplot, 63, 259
minitoc, 163, 270
misccorr, 30, 121, 244
moderncv, 103, 268
montex, 244
morderncv, 103
moreverb, 246
morse, 250
movie15, 108
mparhack, 139, 248
msg, 274
mtn, 102, 269
multenum, 246
multibbl, 271
multibib, 271
multicol, 9092, 265
multido, 273
multimedia, 117
multirow, 153, 154, 262
multitoc, 270
musictex, 235, 257
musixlyr, 237, 257
musixtex, 235237, 257
muthesis, 268
mylatex, 250
mysixlyr, 238
mysixtex, 238
N
nassflow, 101
natbib, 271
nath, 252
nature, 102, 269
ncc, 32, 81, 98, 265
nccboxes, 249

300
ncccomma, 47, 245
ncccropmark, 250
nccfancyhdr, 165, 270
nccfloats, 64, 258
nccfoots, 137, 247
ncclatex, 81, 265
nccmath, 45, 199
nccparskip, 264
nccpic, 260
nccproc, 269
nccrules, 126, 245
nccsect, 246
nccstretch, 126, 245
nccthm, 202, 252
ncctools, 64, 126, 130, 137, 143, 165,
202, 244247, 249, 250, 252,
258, 260, 264, 270, 272, 274
nctools, 47, 245
newfile, 274
newlfm, 99, 266
nomencl, 180, 271
notoccite, 271
nrc, 269
nrc1, 269
nrc2, 269
ntgclass, 98, 99, 265
ntheorem, 251
numprint, 155, 156, 262
O
oberdiek, 248, 250, 254, 260, 262, 264,
272, 273
ocherokee, 244
octavo, 100, 266
oinuit, 244
onlyamsmath, 252
optional, 144, 145, 274
optparams, 273
osmanian, 244
othello, 258
overcite, 271
P
pagenote, 138, 248


pagesel, 250
papertex, 96, 269
paralist, 35, 131, 246
parallel, 92, 265
parcolumns, 265
parrun, 256
pb-diagram, 160, 252
pdfcrypt, 248
pdflatex, 260
pdflscape, 80, 264
pdfpages, 84, 249, 264
pdfscreen, 264
pdfslide, 267
pdfsync, 249
pdftricks, 261
pecha, 104, 244
perltex, 272
pfnote, 247
pgf, 85, 116, 261, 264
pgfpages, 85, 116, 264
phonetic, 256
photo, 259
picinpar, 259
pict2e, 260, 261
pittetd, 268
placeins, 62, 259
plain, 172
plari, 256
plates, 259
play, 256
poemscol, 256
portland, 80, 263
powerdot, 102, 267
powersem, 101, 267
ppower4, 267
ppr-prv, 101, 267
prelim2e, 249
preprint, 90, 247, 259, 264, 272
prettyref, 136, 247
probsoln, 255
proc, 96, 265
processkv, 273
progress, 249


prosper, 101, 267
pscyr, 100
pseudocode, 212, 253
psgo, 258
pst-3d, 261
pst-3dplot, 252
pst-bar, 252
pst-barcode, 261
pst-blur, 261
pst-circ, 224, 254
pst-coil, 261
pst-dbicons, 253
pst-eps, 261
pst-eucl, 252
pst-fill, 261
pst-fr3d, 249
pst-func, 252
pst-geo, 261
pst-gr3d, 261
pst-grad, 261
pst-infixplot, 261
pst-labo, 225, 254
pst-lens, 261
pst-light3d, 261
pst-math, 261
pst-node, 261
pst-optic, 224, 254
pst-osci, 224, 254
pst-pdf, 261
pst-pdgr, 255
pst-plot, 261
pst-poly, 261
pst-slpe, 261
pst-text, 261
pst-tree, 256, 261
pst-uml, 253
pst-vue3d, 261
pst-xkey, 261
PSTricks, 224, 225
pstricks, 251, 254, 256, 261
ptptex, 269

301
Q
qcm, 104, 255
qobitree, 252
quotchap, 246
R
r-und-s, 254
ragged2e, 88, 245
rapport1, 98, 265
rapport3, 98, 265
rccol, 156, 262
rcs, 214, 249
rcsinfo, 214, 249
refart, 267
refcheck, 247
refcount, 272
refman, 267
refrep, 267
report, 31, 40, 79, 81, 96, 100, 265, 267
revtex4, 31, 102, 269
rmpage, 264
robustcommand, 273
robustindex, 271
rotating, 260
rotfloat, 258
rotpages, 80, 264
rsphrase, 227
rst, 256
S
sanskrit, 244
sauerj, 265, 272, 273
savefnmark, 137, 247
savetrees, 264
scalebar, 261
sciposter, 102, 267
scrartcl, 31, 40, 81, 82, 98, 265
scrbook, 31, 40, 81, 82, 98, 100, 133,
265, 266
scrlettr, 81
scrlttr2, 98, 99, 265, 266
scrreprt, 31, 81, 98, 100, 265, 267
sectionbox, 246

302
semantic, 253
seminar, 101, 106, 267
setspace, 89, 264
sffms, 100, 101, 266
shadow, 127, 249
shapepar, 245
shorttoc, 162, 270
showkeys, 136, 247
sibjnm, 102, 269
sidecap, 259
sides, 101, 256
siggraph, 269
sinhala, 244
SIstyle, 219, 254
SIunits, 219, 254
skak, 257
skaknew, 257
slashbox, 154, 262
slashed, 254
slides, 80, 96, 101, 106, 109, 265, 267
smfart, 269
smfbook, 269
snapshot, 249
sobolev, 252
songbook, 257
soul, 125, 245
spie, 269
splitidx, 174
splitindex, 271
srcltx, 249
sseq, 252
stage, 104, 232, 233, 256
stdclsdv, 273
stdpage, 264
stfloats, 265
sttools, 90, 265
subeqn, 252
subfig, 63, 259
subfloat, 259
sublabel, 272
sudoku, 258
supertabular, 157, 263
svn, 214, 249


svn-multi, 249
svninfo, 215, 249
svnkw, 249
synttree, 256
T
t-angles, 252
t2, 46, 121, 244, 271
table, 157
tableaux, 160, 252
tabular, 151, 157, 262
tabularht, 262
tabularx, 156, 263
tabulary, 157, 263
tabvar, 160, 252
talk, 102, 267
technics, 165, 166, 270
telugu, 244
tensind, 251
tensor, 194, 252
teubner, 256
texmate, 257
texpower, 101, 267
texshade, 229, 255
textcomp, 122124, 186
textopo, 255
ticket, 258
timing, 254
tipa, 239, 256
titlesec, 246
titletoc, 246
titling, 247
tocbibind, 163, 270
tocloft, 162, 270
tocvsec2, 270
tokenizer, 75, 273
toolbox, 273
tools, 73, 90, 151, 153, 155157, 204,
247, 262, 263, 265
topcapt, 152, 259
totpages, 250
truncate, 245
twoopt, 273


twoup, 84, 85, 264
typearea, 8183, 264
typedref, 247
typehtml, 248
typogrid, 83, 264
U
uaclasses, 268
ucs, 244
ucthesis, 103, 268
uiucthesis, 268
ulem, 245
umich-thesis, 268
umoline, 245
underscore, 245
units, 219, 254
unitsdef, 219, 254
unsrt, 271
upgreek, 183, 184, 253
url, 140, 248
uwthesis, 268
V
variations, 252
varindex, 271
varioref, 247
vector, 252
venn, 253
verbatim, 33, 114, 204, 246
verse, 232, 256
versions, 274
vhistory, 213, 214, 249
vita, 103, 268
vmargin, 81, 82, 264
vntex, 244
volumes, 250
vpe, 249
W
wallpaper, 143, 260
warpcol, 156, 262
was, 183, 245, 253
wasysym, 51, 122, 123, 183, 187, 189,
192, 253

303
watermark, 143, 260
weekday, 258
wordlike, 250
wrapfig, 63, 259
X
xcolor, 260
xdoc, 274
xifthen, 74, 75, 273
xkey, 261
xkeyval, 273
xr, 135, 247
xspace, 71
xtab, 157, 158, 263
xymtex, 227, 254
xypic, 195, 261
xytree, 256
Y
yafoot, 247
york-thesis, 268
Z
zahl2string, 272


[1] . . TEX. .: , 2003. 560 .
[2] . . METAFONT. .: , 2003. 384 .
[3] . . . .: , 2003. 686 .
[4] . LATEX. .: , 2000. 172 .
[5] ., ., . LATEX
LATEX 2 . .: , 1999. 606 .
[6] ., ., . LATEX
. .: , 2002. 621 .
[7] ., . LATEX Web-. .: , 2001. 604 .
[8] . . LATEX. .: , 2003.
448 .
[9] . ., . . LATEX -. : , 2004. 496 .
[10] . . LATEX / . . . .
: . , 2005. 398 .
[11] . . -. .: -,
2003. 500 .