Вы находитесь на странице: 1из 74

Cdigo gentico, ADN y ARN

Los cido nuclicos (ADN yARN) llevan informacin y la transforman en protenas. Las protenas controlan la qumica de un ser vivo

Los descubridores de la estructura de doble hlice del ADN, James Watson y Francis Crick, en 1953. Fueron galardonados con el Premio Nbel en Medicina y Fisiologa en 1962.

Rosalind Franklin
El trabajo de difraccin con rayos X de Rosalind Franklin fue fundamental en el desarrollo del modelo del ADN. Franklin muri sin saber que los resultados de sus estudios haban sido informalmente comunicados a Watson y Crick por M. Wilkins. Ellos fueron galardonados con el Premio Nbel en 1962. Rosalind Franklin muri de cncer en 1958 a la edad de 37 aos, posiblemente a causa de los rayos X usados en sus investigaciones. Sin embargo aunque Watson, Crick y Wilson luego dieron crdito a la contribucin de Rosalind Franklin, sta nunca fue nominada o premiada con el Nbel pues ya haba muerto, y el Premio Nbel nunca es pstumo.

James Watson, en 2003, cuando se dio por terminado el Proyecto Genoma Humano, que l dirigi y consiste en determinar las posiciones relativas de todos los nucletidos e identificar los 20.000 a 25.000 genes presentes en los 23 pares de cromosomas del ser humano.

Micropelcula sobre ADN y el Proyecto Genoma Humano


http://www.pbs.org/wgbh/nova/programs/ht/qt/2809_01.html http://www.pbs.org/wgbh/nova/programs/ht/qt/2809_q100_02.html

El ADN: estructura y replicacin


El ADN es un polmero (de cadena doble) de nucletidos. Qu es un nucletido?:

Bases nitrogenadas de los nucletidos que forman los cidos nuclicos

azcar de los cidos nuclicos:

Estructura molecular del ADN

La molcula de ADN tiene la capacidad nica de REPLICARSE. Esto es, sacar una copia de s misma que puede ser transmitida a la descendencia. La replicacin se da en el ncleo, antes de la divisin celular

http://www.youtube.com/watch?v=qy8dk5iS1f0&feature=related

Juego de simulacin de replicacin de DNA http://nobelprize.org/medicine/educational/dna_double_helix/index.html

Replicacin del ADN (cido desoxirribonuclico)

Replicacin del ADN: los nucltidos sueltos en el ncleo se adhieren al lugar indicado: G-C, T-A

Replicacin del ADN: es semiconservativa = se forman dos dobles cadenas idnticas a la original, pero en cada una se conserva una cadena antigua

La replicacin del ADN es catalizada por diferentes enzimas

Videos didcticos sobre el proceso y enzimas que participan:


HTTP://WWW.YOUTUBE.COM/WATCH?V=TEV62ZRM2P0&FEATURE= RELATED EL ANTERIOR EN ESPAOL: HTTP://WWW.YOUTUBE.COM/WATCH?V=-EGKRYDQEHQ HTTP://WWW.YOUTUBE.COM/WATCH?V=WKXGWGN_DGU&FEATUR E=RELATED

La helicasa rompe los puentes de hidrgeno de la doble hlice permitiendo el avance de la horquilla de replicacin. Los nuclesidos solo pueden adicionarse por el extremo 3 La ADN polimerasa sintetiza la cadena complementaria de forma continua en la hebra adelantada y de forma discontnua en la hebra rezagada (donde se producen los fragmentos de Okazaki). El proceso de la replicacin se puede dividir en 3 fases: iniciacin, elongacin y terminacin.

Iniciacin de la replicacin
La enzima helicasa se desplaza a lo largo del ADN en direccin a la horquilla de replicacin, es decir, en direccin 5' 3' en la hebra rezagada y 3' 5' en la hebra adelantada, rompiendo los puentes de hidrgeno que mantienen unida la doble hlice

Elongacin
La ADN polimerasa comienza a aadir nucletidos. As, durante la sntesis, en cada horquilla de replicacin se van formando dos copias nuevas de ADN, pero debido a la unidireccionalidad de la actividad polimerasa la replicacin slo puede ser continua en la hebra adelantada [En la hebra rezagada es discontinua, dando lugar a los fragmentos de Okazaki, que son pegados por la enzima ligasa] La terminacin del proceso se da cuando se llega a un triplete de nucletidos TAC , que corresponde a AUG que significa stop en el ARNm.

EXONES
Los exones son las regiones de un gen que no son separadas durante el proceso de splicing y, por tanto, se mantienen en el ARN mensajero maduro. En los genes que codifican una protena, son los exones los que contienen la informacin para producir la protena codificada en el gen. En estos casos, cada exn codifica una porcin especfica de la protena completa, de manera que el conjunto de exones forma la regin codificante del gen. En eucariotas los exones de un gen estn separados por regiones largas de ADN (llamadas intrones) que no codifican.

Funcin
Si bien se consider en un primer momento que los exones (en comparacin con los intrones) son los que llevan la "informacin" dentro de un gen, se ha demostrado que no siempre es as. As por ejemplo existen pseudogenes que poseen la estructura de un gen activo (incluido sus exones) y sin embargo no se transcriben. A la derecha se puede observar un diagrama mostrando como los exones y los intrones se localizan de manera intercalada en un gen. A cada extremo de un gen existe una regin no traducida del mismo (UTR: UnTraslated Region). La transcripcin de un gen a ADN, genera un RNA mensajero inmaduro. Este ARN mensajero lleva a cabo el proceso de splicing, en el que se escinden los intrones y las regiones no traducidas. Una vez que el ARN mensajero ha madurado, puede ser traducido a una protena.

splicing
Al hablar de splicing, tambin llamado corte y empalme, empalme o ayuste podemos referirnos a: Splicing de ARN: Es un proceso co-transcripcional de corte y empalme de ARN. Este proceso es muy comn en eucariotas, pudindose dar en cualquier tipo de ARN aunque es ms comn en el ARNm. Tambin se ha descrito en el ARNr y ARNt de procariotas y bacterifagos. Splicing de protenas: Es un proceso post-traduccional de corte y empalme de una protena precursora. Este proceso conlleva la eliminacin de una secuencia de aminocidos de la cadena polipeptdica para originar una protena madura. Splicing de ADN: Proceso que consiste en la unin covalente de dos fragmentos de ADN bicatenario, catalizado por una ligasa de ADN..

INTRONES
Un intrn es una regin del ADN que debe ser eliminada del transcrito primario de ARN, a diferencia de los exones que son regiones que codifican para una determinada protena. Los intrones son comunes en todos los tipos de ARN eucariota, especialmente en los ARN mensajeros (ARNm), adems pueden encontrarse en algunos ARNt y ARNr de procariotas. El nmero y longitud de los intrones vara enormemente entre especies, as como entre los genes de una misma especie. Por ejemplo, el pez globo, Takifugu rubripees, tiene pocos intrones en su genoma; mientras que los mamferos y las angiospermas (plantas con flores) suelen presentar numerosos intrones.

Comparacin de la estructura del ADN y ARN


Ver video http://www.youtube.com/watch?v= -Q_Lvzdkexo&feature=related

Comparacin entre ADN y ARN


ADN
Dos cadenas de nucletidos formando una doble hlice Azcar de 5 carbonos Azcar: desoxirribosa bases: A,C,G,T Adenina, Citocina, Guanina, Timina. funcin: informacin de generacin en generacin (replicacin)

ARN
Una sola cadena

Azcar de 5 carbonos Azcar: ribosa


bases: A,C,G,U (el Uracilo reemplaza a la Timina) funcin: sntesis proteica (transcripcin y traduccin)

ADN y ARN (acido ribonucleico) tienen algunas diferencias:

Interaccin entre ADN y ARN: el ARN mensajero (ARNm) copia o transcribe la informacin de un trozo de ADN, y lleva este mensaje al organelo celular que traduce y compone una protena con los aminocidos en la secuencia que indica el mensaje.

http://www.biology.eku.edu/RITCHISO/301notes1.htm

Tipos de ARN: ARNm El ARN mensajero


Copia o transcribe la informacin del ADN del ncleo. Saca la informacin al citoplasma y la lleva al ribosoma La informacin va en tripletes de nucletidos llamados codones

CODN = tres nucletidos que significan un aminocido determinado


El codn TCA del ADN en el ARN mensajero se convierte en AGU que significa agregar el aminocido Serrina (Ser) a la secuencia de aminocidos de la nueva protena que se formar Ver animacin: http://biomodel.uah.es/model4/dna/dnacode.htm

Transcripcin
http://www.youtube.com/watch?v=983lhh2 0rGY

Tipos de ARN: ARNr ARN ribosomal


Constituye el organelo llamado ribosoma All se traduce o se sintetiza la nueva protena en base a la informacin del ARNm, y con la ayuda del ARNt

Tipos de ARN: ARNt ARN de transferencia


Su funcin es llevar aminocidos al ribosoma para la sntesis de la nueva protena. En un extremo lleva un anticodn para identificar al codn del respectivo aminocido

Cmo los anticodones del ARNt identifican al respectivo codn en el ARNm

El ARNt (ARN de transferencia) tiene tres nucletidos (anticodn) que identifican al respectivo codn, y as anexar el aminocido que transportan al ribosoma, para formar o sintetizar una protena

Cmo adquiere su estructura funcional una molcula de RNAt?


VIDEO:
http://www.hhmi.org/biointeractive/media/rnafold-lg.wmv

El cdigo gentico: es el significado de la informacin del ADN:

Cada tres nucletidos codifican a un aminocido distinto, para formar la nueva protena
Pelcula introductoria http://www.pbs.org/wgbh/nova/ge nome/program.html

El cdigo gentico
La secuencia de bases del ARNm es usada por el ribosoma como plantilla para ensamblar la secuencia de aminocidos que formarn el polipptido (protena). El proceso se llama TRADUCCIN, y el diccionario de traduccin es el cdigo gentico. Las palabras del cdigo son los codones, que son tripletes del bases del ARNm. Ej: UUU, CAG,UGA. Hay 64 codones posibles, y cada codn corresponde a uno o ms aminocidos. Por ejemplo, el codn UUU corresponde al aminocido Fenilalanina.

El cdigo gentico
Como solo hay 20 amincidos posibles, algunos son codificados por varios codones distintos. Por ejemplo, el aminocido Isoleucaina es codificado por tres codones distintos: AUU, AUC, AUA. (ver tabla en siguientes slides) Por el hecho de que varios codones pueden corresponder a un solo aminocido, el cdigo gentico es llamado degenerado El cdigo gentico es universal, pues es idntico para todos los seres vivos, desde las bacterias hasta el hombre. Esto tiene implicaciones en la ingeniera gentica entre especies.

El cdigo gentico
Hay algunas raras excepciones a la universalidad del cdigo gentico: algunos codones de stop son usados para codificar aminocidos especiales. La traduccin se realiza en los ribosomas, que estn hechos de ARNr y se encuentran en el citoplasma de la clula.

Un anticodn es una secuencia de tres nucletidos ubicada en el ARNt, complementaria al codn ubicado en el ARNm. Codn: La informacin gentica, en el ARNm, se escribe a partir de cuatro letras, que corresponden a las bases nitrogenadas (A, C, G y U), las cuales van agrupadas de tres en tres. Cada grupo de tres se llama codn y est encargado de codificar un aminocido

Tabla 1: Tabla de codones. Ilustra los 64 tripletes posibles.


U UUU Fenilalanina UUC Fenilalanina UUA Leucina UUG Leucina CUU Leucina CUC Leucina CUA Leucina CUG 4Leucina C UCU Serina UCC Serina UCA Serina UCG Serina CCU Prolina CCC Prolina CCA Prolina CCG Prolina 2 base A UAU Tirosina UAC Tirosina UAA Ocre Parada UAG 3mbar Parada CAU Histidina CAC Histidina CAA Glutamina CAG Glutamina G UGU Cistena UGC Cistena UGA 2palo Parada UGG Triptfano CGU Arginina CGC Arginina CGA Arginina CGG Arginina

1 base

AUU Isoleucina AUC Isoleucina AUA Isoleucina AUG 1Metionina

ACU Treonina ACC Treonina ACA Treonina ACG Treonina

AAU Asparagina AAC Asparagina AAA Lisina AAG Lisina

AGU Serina AGC Serina AGA Arginina AGG Arginina

GUU Valina GUC Valina GUA Valina GUG Valina

GCU Alanina GCC Alanina GCA Alanina GCG Alanina

GAU cido asprtico GAC cido asprtico GAA cido glutmico GAG cido glutmico

GGU Glicina GGC Glicina GGA Glicina GGG Glicina

Transcripcin
El ARNm se forma en el proceso llamado transcripcin. El ARNm transcribe o copia la informacin de la secuencia de bases una de las cadenas del ADN del ncleo, y lo saca al citoplasma. Hay que recordar que en el ARNm la base uracilo est presente en vez de la timina. Por lo tanto al ir copiando el mensaje, las bases se aparean as: U-A, A-T, C-G, G-C

Transcripcin
La cadena de ADN tiene una cadena con sentido, o sea con informacin sobre la secuencia de aminocidos de la protena, y la otra cadena, que es complementaria, es sin sentido. El ARNm copia la cadena sin sentido, siendo as un rplica de la cadena con sentido que lleva el orden de la secuencia de aminocidos

Transcripcin
El proceso de transcripcin empieza cuando la enzima ARN polimerasa se adhiere a un sitio llamado promotor en el DNA. Sitio promotor determina qu cadena se va a transcribir. La ARN polimerasa abre la doble cadena, y cataliza la formacin de enlaces covalentes entre los nucletidos del nuevo ARNm que se est formando.

Los 20 aminocidos en espaol y sus abreviaturas


.

http://cabronio.blogspot.com/2008/08/codones-y-animocidos.html

Traduccin
El mensaje es llevado en la misma molcula de ARNm hacia el ribosoma (ARNr) para ser traducido. El resultado de esa traduccin es la formacin o sntesis de la nueva protena con una secuencia de aminocidos dada por el orden de los codones del ARNm. El ARNt transporta aminocidos especficos para esta sntesis.

Traduccin: pasos
Iniciacin: el ARNm se une al ribosoma y el codn iniciador AUG empieza el proceso. Elongacin: se empiezan a adicionar lo aminocidos llevados por los ARNt Terminacin: se pone el ltimo aminocido cuando se llega al codn de terminacin.

Sntesis de protenas

Sntesis de protenas

Sntesis de protenas

Generalmente, ms de un ribosoma puede estar traduciendo la misma molcula de ARNm al mismo tiempo. Este grupo o complejo de ribosomas actuando a la vez se conoce como polirribosoma o polisoma

replicacin, transcripcin y traduccin


http://www.johnkyrk.com/DNAanatomy.html

Traduccin y sntesis proteica con Mario Bros HTTP://WWW.YOUTUBE.COM/WATCH?V=ZPLNDZKBRPC

Juego de transcripcin y traduccin


Genetic Science Learning Center. "Transcribe y traduce un Gen." Learn.Genetics 15 October 2012 http://learn.genetics.utah.edu/es/units/basi cs/transcribe/

Ejercicio:
Dada la siguiente cadena de ADN que acaba de ser abierta por la enzima helicasa:

TACTACGGCATAGAGTCGATTGCGAAT
a) Construir su cadena complementaria del ARNm

b) Construir la protena resultante de la traduccin de ese ARNm, utilizando el cdigo gentico. (Tener en cuenta la tabla con los codones del ARNm y los respectivos aminocidos)

Los cromosomas de eucariotas estn constituidos por ADN y protenas (histonas). en las bacterias el ADN est desnudo en el citoplasma.

El ADN se encuentra compactado o condensado en el ncleo. Un primer nivel de condensacin se forma gracias a la unin de cierto tipo de protenas, denominadas histonas, a manera de un collar de cuentas: el ADN rodea un ncleo compuesto por ocho histonas. Este ncleo rodeado por ADN, ms el ADN espaciador entre las cuentas, se denomina nucleosoma y fue descubierto en 1975 por Roger Kornberg, Dean Hewish y Leigh Burgoyne. Cada nucleosoma contiene un pedazo de ADN de 146 nucletidos ms ocho histonas.
http://aportes.educ.ar/biologia/nucleo-teorico/estado-delarte/una-gran-biblioteca-cromosomas-ygenes/como_entra_todo_el_adn_en_el_n.php

http://www.cbs.dtu.dk/staff/dave/roanoke/fig6_10.jpg

Vista al microscopio de los cromosomas tal como se ven en el ncleo durante la divisin celular (metafase). El ADN ya est replicado y forma los dos brazos del cromosoma (cromtidas) unidos en un punto (centrmero)

PRCTICA 1. Tome nota de la informacin anterior. 2. Haga clic aqu para ver un video acerca de los genes # 1. 3. Haga clic aqu # 2 4. Haga clic aqu # 3 5. Haga clic aqu ( http://nobelprize.org/educational_games/medicine/dna_double_helix/dnahelix.html ) para jugar un juego de ADN

ACTIVIDAD DE INVESTIGACIN: LA EXPRESIN GNICA Objetivo: Entender cmo funciona la traduccin y el cdigo gentico. Orientaciones: Te proponemos realizar un pster que puedes colocar en tu clase, confeccionado con imgenes y textos obtenidos de Internet. Se trata de presentar de una forma esquemtica y visual, qu es la traduccin, cmo funciona y qu es el cdigo gentico. Recursos: http://www.monografias.com/trabajos/sinteproteinas/sinteproteinas.shtml http://www.arrakis.es/~lluengo/sintesisproteinas.html http://www.lab314.com/mitocondria/elemen/codigo.htm http://www.ucm.es/info/genetica/AVG/practicas/secuencia/Codigen.htm http://www.uprm.edu/biology/cursos/genetica/codigo_files/frame.htm http://www.um.es/~molecula/dupli02.htm http://www.rothamsted.bbsrc.ac.uk/notebook/courses/guide/trad.htm http://www.es.embnet.org/~lmc/Tema18.pdf http://www.genome.gov/sglossary.cfm?key=expresi%F3n%20g%E9nica http://www.unavarra.es/genmic/curso%20microbiologia%20general/08expresion%20de%20la%20informacion%20genetica.htm http://www.biologia.edu.ar/adn/adntema2.htm http://laguna.fmedic.unam.mx/~evazquez/0403/introduccion%20traduccion.html http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/Codons.html http://www.amsci.org/amsci/issues/Comsci98/compsci9801.html http://www.kazusa.or.jp/codon/ Aqu puedes construir tu propia protena, traduciendo un RNA-m: http://gslc.genetics.utah.edu/es/units/basics/transcribe/ Para terminar comprueba aqu lo que has aprendido: http://www.ucm.es/info/genetica/AVG/problemas/Codigo.htm

FIN

Похожие интересы