Вы находитесь на странице: 1из 404

I

8
9

10

1.1

1.2

Real-Time

11

1.3

Fluidigm

15

1.4

21

23

2.1

23

2.2

()

27

33

3.1

Affymetrix

33

3.2

BioPlex

37

39

4.1

39

4.2

41

4.3

43

45

5.1

45

5.2

CO2-

48

5.3

49

5.4

52

5.5

54

5.6

62

68

6.1

68

6.2

76

6.3

82

6.4

85

6.5

88

95

7.1

7.2

100

95

7.3

103

105

8.1

105

108

9.1

108

9.2

110

9.3

114

9.4

115

9.5

120

9.6

125

9.7

127

128

10.1 EpMotion

128

10.2

133

10.3

135

10.4 , ChIP,

136

www.helicon.ru

11


11.1

137

11.2

139

144

147

149

152

11.3

153

11.4

154

154

156

159

11.5

164

11.6

166

166

168

11.7

171

11.8 ()

173

11.9

176

176

II

178

III

183

11.10

186

11.11

187

187

3D

188

11.12

192

11.13

195

11.14

197

11.15

199

III

199

II

201

203

205

11.16

208

11.17

209

11.18

210

210

212

217

11.19

220

220

223

226

228

11.20

230

230

235

239

11.21 -

137

241

II

247
248

1.1

248

1.2

253

1.3

256

258

264

265

15-50

266

267

6.1

267

6.2

268

6.3

269

270

7.1

270

7.2

T-

270

271

8.1

271

8.2

271

272

10

273

10.1

273

10.2

273

10.3

274

10.4

274

11

275

III

278

1.1

, Life Technologies (Invitrogen)

278

Life Technologies (Invitrogen)

279

Life Technologies (Invitrogen)

279

1.2

Thermo Fisher Scientific (Fermentas)

277

279

283

2.1

Thermo Fisher Scientific (Fermentas)

283

2.2

Thermo Fisher Scientific (Fermentas)

293

2.3

308

308

309

309

311

311

313

2.4

314

, , -

316

3.1

, , -

316

Life Technologies (Invitrogen)

316

Life Technologies (Invitrogen)

319

(qRT-PCR) Life Technologies (Invitrogen)

320

www.helicon.ru

(qPCR) Life Technologies (Invitrogen)

321

, , - Thermo Fisher Scientific (Fermentas)

321

3.2

Thermo Fisher Scientific (Fermentas)

327

332

4.1

332

Amresco

332

Amresco

333

SYBR (Life Technologies)

334

Thermo Fisher Scientific (Fermentas)

334

4.2

336

336

Life Technologies (Invitrogen)

337

Life Technologies (Invitrogen)

338

4.3

339

, Amresco

339

Life Technologies (Invitrogen)

341

Life Technologies (Invitrogen)

343

Thermo Fisher Scientific (Fermentas)

343

4.4

- -

344

344

357

358

5.1

Thermo Fisher Scientific (Fermentas)

358

5.2

TOPO (Life Technologies)

359

5.3

Gateway

361

362

363

7.1

363

363

365

366

367

(3D)

367

7.2

368

(FBS)

368

369

7.3

370

7.4

371

7.5

372

7.6

374

7.7

375

8
9

10

11

376

8.1

376

378

9.1

378

9.2

379

380

10.1 Thermo Fisher Scientific (Fermentas)

378

10.2

379

Vector NTI

401

11.1 Vector NTI Advance

378

www.helicon.ru

1000-

C1000 Touch

S1000

1.1

1000 Touch S1000 : , .


, 0,2 0,5 96 384 .
, .
C1000 Touch . , S1000
1500 .
S1000 ,

1000 Touch .

:
0,5 0,2 ,
, 48-, 96- 384- .
, 5/.
4- .
, 8 , .
, . .
.
1 000 .
.
.

:
96 0,2 (, ).
2 48 0,2 ( ).
384- ().

C1000/S1000

96 0,2 96- ,
48+48 , 384-

, /

5,0

0-100

+/-0,2

+/-0,4

30-100

24

+/-0,2

1 000

120 90

USB-, .

400

330 x 460 x 200

10,5

1.1

01

1000 Touch 96

BioRad 1851196

1000 Touch 48+48

BioRad 1851148

S1000 96

BioRad 1852196

S1000 48+48

BioRad 1852148

96 1000-

BioRad 1840196

48+48 1000-

BioRad 1840148

T100

T100

T100 Bio-Rad, MyCycler. T100


,

.
:
96- 0,2 , .
.
.
.
.

T100

96 0,2 96- (
)

, /

4-100

+/-0,5

+/-0,5

30-100

24

+/-0,5

500 ,

, 148 (VGA)

USB-, .

1 ()

670

260 x 470 x 230

T100

BioRad 1861096

www.helicon.ru

1.1
Veriti

Veriti

Veriti - . VeriFlex,
,

.

:
96 0,1
0,2 , 384 0,02 60
0,5 .
, 4,25/.
( Fast 96-
0,1 ).
VeriFlex ( ) .
6- (
5) VeriFlex 4 99 C.
Veriti 12 Veriti
.
800 , USB-
.
.

Veriti

96-
0,1

96-
0,2

384-

0,02

4-99,9

0,25

,
Veriflex

, /

<0,5
25C ( 5C
)
4,25


,
,
,

3,35

3,1

2,7

800
800
237 245 485
11,4

01

60-

0,5

Veriti 96- 0,1 Fast Thermal Cycler


Veriti 96- 0,2
Veriti 384- 0,02
Veriti 60- 0,5
VeritiLink

4375305
4375786
4388444
4384638
4393565

1.1

GeneAmp PCR System 9700

01

GeneAmp PCR System 9700

GeneAmp PCR System 9700 ( )


.
:
- 60- 0,5 , 96- 0,2 , 96-
0,2 , 96- 0,2 , 384-
0,02 .
, 5/.
.
,
384 0,02 .
.
:
60 0,5 .
96 0,2 .
96- 0,2 .
384- 0,02 .

GeneAmp 9700 60-/


96-

GeneAmp 9700
96-/
384-

4 :
- 60 0,5 ;
- 96 0,2 ;
- 96- 0,2 ;
- 384- 0,02

, /

5 ( )

4-100

0,25 ( 3599,9)

0,5

0,5

0,25

100

,
,
,

725
300 260 406

300 260 520

11,8 (8,6 + 3,2 96 )

GeneAmp PCR 9700 96-

4314878

GeneAmp PCR 9700 384-

4314487

GeneAmp PCR 9700 96-

4314879

96 0,2 .

4314445

96 0,2

4314443

96- 0,2

4342718

60 0,5 .

4309131

www.helicon.ru

1.1

, . , .

:
10
0,5
4- .
.
, 2/.
, , .

4 10 0,5

, /

2,0

4-99

+/-0,2

+/-0,3

28

95

240 x 210 x 80

01

10

MC-2+

1.2


Real-Time

CFX

01

CFX96 Touch

Real-Time CFX , , ,
.
:
, , 96- 0,2
384- .
CFX96 Touch 6- , CFX384 Touch
5- .
, 5/.
0,2C.
HRM-.
, 8 , .
CFX .
.
, , . ,
, .
.

.
.
.
.
:
CFX
(HRM). FRET.
, - (
), ( ), - (
).

11


Real-Time

www.helicon.ru

1.2

CFX96 Touch

CFX384 Touch

96-

384-

450-684

450-650

515-730

515-690

, /

5,0

2,5

0-100

+/-0,2

+/-0,4

30-100

24

+/-0,2

1000

,
USB-, .
,
,
( ),

120 90
6
400
330 x 460 x 360
21,4

01

12

Real-time CFX96 Touch

BioRad 1855196

Real-time CFX384 Touch

BioRad 1855484

(HRM)

BioRad 1845025

BioRad 1845028

BioRad 1845072

1.2


Real-Time

StepOne StepOnePlus

01

StepOne

StepOne ( 48 ) StepOnePlus ( 96 )
, .
:
3- (StepOne) 4- (StepOnePlus) .
40
.
StepOnePlus VeriFlex,
,
,
.

5.
25.
.
- USB- .
.
, .
StepOne StepOnePlus.

StepOne

StepOnePlus

48

96

48- (0,1 );
8 (0,1 );
(0,1 )

96- (0,1 );
8 (0,1 );
(0,1 )

10-30

/ , /

2,2
1,6

4 100

0,25

0,5

0,1

, ,
FAM, SYBR Green I, VIC, JOE, ROX

FAM, SYBR Green I, VIC, JOE, NED,


TAMRA, ROX
ROX

/ 6,5 , VGA (640480), 32 .

950

246 485 512

23,6

24

Real-time StepOne

4376357

Real-time StepOne

4376373

Real-time StepOne

4376374

Real-time StepOnePlus

4376600

Real-time StepOnePlus

4376598

Real-time StepOnePlus

4376599

13

www.helicon.ru


Real-Time

1.2

Dtprime (-96)

Dtprime (-96)

-96
,
, ,
.

:
4- 5 , 96- , 0,2 .
96- , 96-
, .
5- .
100 ,
. CCD-.
, -96 4- Hex, Fam, Cy5, Rox.
.
.
.

Dtprime (-96)

4- 5 96-
, 0,2

CCD-

470-690

520-750

, /

3,5

0-100

+/-0,3

+/-0,3

30-99

10

400

210 x 540 x 540

( ),

27

01

14

Real-time Dtprime (-96)

-96

1.3



Fluidigm

01

Fluidigm
Fluidigm ,
, SNP
. Fluidigm 2 304 36 960 real-time (~10 ),
. Fluidigm .
, , , , .
:
, , SNP , (Copy Number Variation),
.
. - .
.
. 50 000 , .
. 36 960 .
.

Fluidigm BioMark
HD Real Time PCR

BioMark HD

, ,

.
, , ,
.
:
SNP , , , . 50 000 .
. , .
(CNV), ,
.
.
.
IFC (
IFC ), , .

15

www.helicon.ru



Fluidigm

1.3

BioMark HD

2 304 36 960
(2-3 ), 50 000

475, 530, 575, 632 ()

525, 570, 630, 700 ()

CCD 9 , 12

LED

, 4-99
: >5C/
: >5C/

48.48, 96.96 192.24 Dynamic Arrays


FR48.48 Dynamic Array 12.765 48.770 Digital Arrays

BioMark Data Collection Software


BioMark Real-Time PCR Analysis software
BioMark Genotyping Analysis software
BioMark Digital PCR Analysis software

Pentium 4; 21- LCD ;


1 GB/sec; 40 GB ; DVD;
USB

BioMark HD MX System.
: BioMark Reader; : Real-Time PCR, Digital PCR, Genotyping 20
; IFC Controller MX (48.48)
48.48 Dynamic Array, Digital Array; 1

BMKHD-BMKHD
IFC-MX

EP1

Fluidigm EP1
End Point PCR
Fluidigm EP1 SNP ,
, .
.

:
SNP , , , .
50 000 .
(CNV),
, .

01

IFC ( IFC ), ,
, .

16

1.3



Fluidigm

01

EP1

2 304 36 960 (2-3


), 50 000

485, 530, 580 + 2

525, 570, 630 + 2

CCD

Illumination

175

, 4-99
: >5C/
: >5C/

48.48, 96.96 192.24 Dynamic Arrays


FR48.48 Dynamic Array 12.765 48.770 Digital Arrays

EP1 Data Collection Software


EP1 Genotyping Analysis software
EP1 Digital PCR Analysis software

Pentium 4; 21- LCD ;


EP1 MX + FC1 System.


: EP1 Reader, : Digital PCR, Genotyping 20 ; IFC
Controller MX 48.48 Dynamic Array, Digital Array;
; 1

EP1-EP1
IFC-MX

Fluidigm Access Array System

Access Array System

Fluidigm Access Array System


, NGS (Next Generation
Sequencing) - Ion torrent, ABI Solid, Roche, Illumina.
. , , , .
Access Array, , IFC Controller
AX , .
Fluidigm Access Array System ,
. Access Array 48- , 48 , .
:
(Target Enrichment). , .
- . -
NGS . . .
.
,
.

17

www.helicon.ru



Fluidigm

1.3

Fluidigm Access Array .


: 2 IFC AX (Access Array 48.48) AA-PKG-FC1
48.48 Access Array; ;1

Fluidigm
Dynamic Array
SNP
48.48 Dynamic Array

Dynamic Array
SNP .

Fluidigm IFC . 3- - 48.48, 96.96, 192.24.

48.48
Dynamic Array

96.96
Dynamic Array

192.24
Dynamic Array

2 304

9 216

4 608

48

96

24

48

96

192

96-2304

192-9216

384-4608

01

48.48 Dynamic Array (GT)


( 10 )
96.96 Dynamic Array (GT)
( 10 )
192.24 Dynamic Array (GT)
( 10 )
48.48 Dynamic Array (GE)
( 10 )
96.96 Dynamic Array (GE)
( 10 )

18

BMK-M10-48.48GT
BMK-M10-96.96GT
BMK-M10-192.24GT
BMK-M10-48.48
BMK-M10-96.96

1.3



Fluidigm

01

48.48 Access Array



Access Array . 2 304 , 48 48
. 48

.

48.48 Access Array

48.48 Access Array

2 304

48

48

30

48.48 Access Array


( 10 )

AA-M10-48.48

Digital Array digital PCR


Fluidigm Digital Array
digital PCR . ,

, .
2- :
48.770 Digital Array. 48 ( ) 770 .
36 960
.
12.765 Digital Array. 12 ( ) 765 .
9 180 .

48.770 Digital Array

48.770 Digital Array digital PCR, ( 10


)

BMK-M10-48.770

12.765 Digital Array digital PCR, ( 10


)

BMK-M10-12.765

19

www.helicon.ru

1.4

- -

- -

( )
- .
.

:

, ,
.
.
( ).
, .
30 . - .
.
.
( , ).
.
(1 000 ) .

:
.
.

01

---

1020 600 800

1015 530 535

70

50

20

- --- ( 610)

LS ----1

- --- ( 620)

LS ----2

( 680 )

0.05

(2 .)

0.03

1.4

UVC/T-M-AR UVT-S

01

UVC/T-M-AR

- - . -,
.
:
-
,
.
. ,
( UVC/T-AR).
.
( ).
25 ( UVT-S 30 ).
(15 ) .

- AR -, , .
, , -.
-, / , 100
1 , .

UVC/T-M-AR

UVT-S

690 515 555

1245 580 585

480 x 645

1200 x 520

32

58

- UVC/T-M-AR

UV-cleaner box

- UVT-S

UV-cleaner box 1200

21

www.helicon.ru

2.1

5500 SOLiD System 5500xl SOLiD System


5500 SOLiD

:
99,99% Exact Call Chemistry (ECC) .
.
20 Gb , 300 Gb .
,
.
,
( 1 6 ).

:
:
( SNP, ,
).
.
De novo (, ).
:
(ChIP-Seq).
(MeDIP-Seq).
(RNA-Seq):
(miRNA, siRNA, piRNA, esiRNA).
, , , .
.
- .
:
.
.

01

5500 SOLID 5500xl SOLID -


. SOLiD (Sequencing by
Oligonucleotide Ligation and Detection)

. , .

22

2.1

01

5500 SOLID

5500xl SOLID
-

1 , 6
,

2 ,
6
,

99,99% ( ECC )

, , .

10-15

20-30 ()
30-45 ()

(
), ..

90 .

180 . ()
300 . ()

1
12
6

:
2
24
12
:
3
40
20

(30-
, 100-200
, 100 000 /
)

35, 75, 75+35, 2 60


96 - 6
35 .. - 1 1
75+35 .. 60+60 .. 7 6

5500 SOLID

4452865

5500xl SOLID

4460730

23

www.helicon.ru

2.1

Ion PGMTM Ion ProtonTM


Ion PGMTM

:
( SNP, , ).
.
De novo .
.
.
.

:
.
.
.
2 .
.

02

Ion PGMTM Ion ProtonTM


.
Ion PGMTM
, , 2 .
. Ion
ProtonTM 10 .

, .

Ion PGMTM Ion ProtonTM , .


.
.
, ,
, .
, , Ion PGMTM
Ion ProtonTM
.

24

2.1

Ion PGMTM Ion Proton TM.


: ,
pH- .
, pH- .
. .
,

.

02

Ion ProtonTM

Ion PGMTM

Ion ProtonTM

314 20 . (20 Mb)


316 200 . (200 Mb)
318 2 . (1 Gb)

Proton I 10 . (10 gb)


Proton II 100 .* (100 gb)

314 1,3 .
318 2 . (1 Gb)
318 11 .

Proton I 165 .
Proton II 660 .
Proton III - 1,2 .





Chip-Seq



()

400

200

99,5%
384
de novo;

, SNP
(, , );
;
;
ChIP-Seq, RNA-Seq, RIP-Seq, MeDIP
( )

1,5 (100 .. )

~2 (100 .. )

. 9 A

. 18 A

610 510 530

542 775 474

39

59

* Proton II 2013 .

Ion PGM

TM

Ion Proton

4467542
4476610

25

www.helicon.ru


()

2.2

ABI PRISM,
, , :
. Applied Biosystems
, .





de novo.
.
HLA-.
.
16S .
, , SNPs.

: SSCP, STR, VNTR, CSCE, LOH, MLPA, t-RFLP, , SNP, AFLP.


ABI PRISM :
1. .
2. .
3. .
4. Dell -.
5. (Data Collection Software) , ,
.
6. DNA Sequencing Analysis Software GeneMapper Software .
.

01

:
1. DNA Sequencing Analysis Software , , ,
Applied Biosystems.
2. SeqScape Software , .
3. Variant Reporter Software , .
4. GeneMapper Software , , , ,
.
5. GeneMapper ID-x v1.2 Software AmpFISTR.
6. MicroSEQ ID v2.2 .

26

2.2


()

01

ABI PRISM 3730 3730xl


3730 (48 ) 3730 xl (96 ) ABI
PRISM, .

ABI PRISM 3730

:
48- (3730)
96- (3730 xl).
48 . , ,
.
POP-6 (), POP-7 ().
,
( 3730 48 , 3730 xl 96- ).
.

ABI PRISM 3730

ABI PRISM 3730 xl

48

96

36, 50

50

D-. ,

525-650

. ,

488-514

100 15

96 384-

18 70

,
,
,
, .

3 300
610 610 950

1000 730 890


180
24

ABI PRISM 3730

4441719

ABI PRISM 3730 xl

4441718

27

www.helicon.ru


()

2.2

POP Conformational
Analysis Polymer (CAP)

POP Conformational Analysis Polymer (CAP).


(9%) (25 ).

4340379

POP-7 Polymer for


3730/3730 xl DNA Analyzers, 1 x 28 ml

POP-7 Polymer for 3730/3730 xl DNA Analyzers,



.

4363929
(1 x 28 )
4335615
(5 x 28 )
4363935
(10 x 28 )
4335611
(30 x 28 )

3730 DNA Analyzer Capillary Array, 36 cm

(48 )
36 . 300 .
, .

4331247

3730 DNA Analyzer Capillary Array, 50 cm

(48 )
50 . 300 .
, .

4331250

3730 xl DNA Analyzer


Capillary Array, 50 cm

(96
) 36 3730 xl. 300
.
, , SNP
.

4331244

3730 xl DNA Analyzer


Capillary Array, 50 cm

(96
) 50 3730 xl. 300
.
, , SNP
.

4331246

BigDye Terminator v3.1


Cycle Sequencing Kit

BigDye Terminator v3.1 Cycle Sequencing Kit. ,


de novo
, .

4337454 (24 )

02

3730 Running Buffer, 10X 10-. 100 . 500 .

28

4337455 (100 )
4337456 (1 000
)
4337457 (5 000
)
4335613

3730/3730 xl DNA
Analyzer Sequencing
Standards, BigDye
Terminator v1.1

BigDye Terminator v1.1


3730. 4
hsp69, .
ROX, Rhodamine 6G, Rhodamine 110, TAMRA.

4336799

3730/3730 xl DNA
Analyzer Sequencing
Standards, BigDye
Terminator v3.1

BigDye Terminator v3.1


3730. 4
hsp69, .
ROX, Rhodamine 6G, Rhodamine 110, TAMRA.

4336943

2.2


()

02

ABI PRISM 3500 3500 xl


3500 (8 ) 3500 xl (24 ) ,
,
.

ABI PRISM 3500

:
8- (3500) 24- (3500 xl).

, .
505
, .
(RFID) .

6 .
:
POP-7 .
,
, .

ABI PRISM 3500

ABI PRISM 3500 xl

24

36, 50

,
D-. ,
. ,


,

50
525-650
505
20
96- 8

96 384- ;
8

18 70

3 300

610 610 720

82

, .

24

ABI PRISM 3500


ABI PRISM 3500 xl

4442009
4442010

29

www.helicon.ru


()

2.2

POP-4 Polymer for


3500/3500 xL Genetic
Analyzers
POP-6 Polymer for
3500/3500 xL Genetic
Analyzers
POP-7 Polymer for
3500/3500 xL Genetic
Analyzers

POP-4 ,
/
960 ( 36 ).
POP-6
960
( 50 ).
POP-7
,
, 384 .
(8 , 36 )
.
/ .
(8 , 50 )
.
.
(24 , 36 )

3500 xl.
/ .
(24 , 50 )

3500 xl.
.

3500 Genetic Analyzer


Capillary Array, 36 cm
3500 Genetic Analyzer
Capillary Array, 50 cm
3500 xL Genetic Analyzer
Capillary Array, 36 cm

3500 xL Genetic Analyzer


Capillary Array, 50 cm

BigDye Terminator v3.1


Cycle Sequencing Kit

Anode Buffer Container


(ABC) 3500 Series

Cathode Buffer Container


(CBC) 3500 Series

Conditioning Reagent,
3500 Series

31xx and 3500 Matrix


Standards Kit, BigDye
Terminator v1.1

02

3500/3500 xL Sequencing Install Standard,


BigDye Terminator v1.1

3500/3500 xL Sequencing Install Standard,


BigDye Terminator v3.1

30

BigDye Terminator v3.1 Cycle Sequencing Kit. ,


de novo
, .
1-
,
3500 3500 xl.
. ,

. 4

1-
, 3500.
2 ,
,
.

. ,

. 4 .
3500
Conditioning Reagent 3500. 3500
,
, .

. ,
.
3100/3130/3500 Matrix Standard Set BigDye
Terminator v1.1 (+4C). 2
,
4 ,
, 1 .
ROX, Rhodamine 110, TAMRA, Rhodamine 6G
Sequencing standard v1.1 3500, Sequencing Install Standard, BigDye Terminator v1.1, 4 ./.
4 ,
BigDye Terminator v1.1 (1200
.) /
.
. ROX, Rhodamine 6G, Rhodamine 110, TAMRA
Sequencing Install Standard, BigDye Terminator
v3.1. 4 ,
BigDye Terminator v3.1
(1200 .) /
. .
ROX, Rhodamine 6G, Rhodamine 110, TAMRA

4393715 (384 )
4393710 (960 )
4393717 (384 )
4393712 (960 )
4393708 (384 )
4393714 (960 )
4404683

4404685

4404687

4404689
4337454 (24 )
4337455 (100 )
4337456 (1 000 )
4337457 (5 000 )

4393927

4408256

4393718

4336824

4404314

4404312

2.2


()

02

ABI PRISM 310


ABI PRISM 310
.

ABI PRISM 310

:
24 . , ,
.
: POP-4 ( ), POP-6 ( ), POP Conformation Analysis.
( 5 ).
:
.
.
.
.
.

ABI PRISM 310

47, 61

50

D-. ,

525-650

. ,

488-514

100 15

48 96

60

100 15

610 560 870

94,5

, .

12

ABI PRISM 310

310-00-200/240-W

POP Conformational
Analysis Polymer (CAP)

POP Conformational Analysis Polymer (CAP)


(9%) (25 ).

4340379

POP-4 Polymer for the


310 Genetic Analyzer,
POP

POP-4 ()
( SNP ) 500 402838
(5 ).

POP-6 Polymer for the


310 Genetic Analyzer

POP-6 () ,
, 250 (3 ).

402837

310 Genetic Analyzer


Capillary, 36 cm

36 .
. 1
100 . 5 .

402839

31

www.helicon.ru


()

2.2

310 Genetic Analyzer


Capillary, 50 cm

50 c,
100 .
402840
. 2 .

BigDye Terminator v1.1


Cycle Sequencing Kit

BigDye Terminator v1.1 Cycle


Sequencing Kit.
,
.

02

BigDye Terminator v3.1


Cycle Sequencing Kit

4337449 (24 )
4337450 (100 )
4337451 (1 000 )
4337452 (5 000 )
4337454 (24 )
4337455 (100 )
4337456 (1 000 )
4337457 (5 000 )

310 and 31xx Running


Buffer, 10X

310 (10X), 25 .

402824

310 Genetic Analyzer


Matrix Standards Kit,
dRhodamine

310 Genetic Analyzer Matrix Standards Kit, dRhodamine. 4 ,


(ROX, TAMRA,
Rhodamine 110, Rhodamine 6G).

403046

310 Genetic Analyzer Matrix Standards, BigDye


Terminator v1.1

310 Genetic Analyzer Matrix Standards, BigDye


Terminator v1.1. 4
, (ROX, Rhodamine 6G, TAMRA, Rhodamine 110).

4336805

310 Genetic Analyzer Matrix Standards, BigDye


Terminator v3.1

310 Genetic Analyzer Matrix Standards, BigDye


Terminator v3.1. 4
,
(ROX, Rhodamine 6G, TAMRA, Rhodamine 110).

4336948

310/31xx Genetic Analyzer Sequenc310/31xx Genetic Analyz- ing Standards, BigDye Terminator v1.1. 4
er Sequencing Standards, hsp69,
BigDye Terminator v1.1
() . ROX, Rhodamine 6G,
TAMRA, Rhodamine 110.

4336791

310/31xx Genetic Analyzer Sequenc310/31xx Genetic Analyz- ing Standards, BigDye Terminator v3.1. 4
er Sequencing Standards, hsp69,
BigDye Terminator v3.1
() . ROX, Rhodamine 6G,
TAMRA, Rhodamine 110.

4336935

Hi-Di Formamide

32

BigDye Terminator v3.1 Cycle Sequencing Kit. ,


de novo
, .

4440753 (5 )
4311320 (25 )

3.1


Affymetrix

03

Affymetrix
Affymetrix . Affymetrix
, , , .
Affymetrix , , .
:
:
SNP (CNV). Affymetrix
. , , , (SNP),
(CNV) . 1,8 . .
. , . 1
936 225 .
. Affymetrix , ,
(LOH), (UDP) .
:
.
, 40 , .
3 IVT .
, , , 30- .
. , . Affymetrix miRNA Array - , . , , ,
.

GeneAtlas System

GeneAtlas System

GeneAtlas System - Affymetrix



. GeneAtlas 4
.
:
- :
.
.
.
.
web NetAffx .
GeneAtlas 1 PartekExpress Affymetrix
Edition Ariadne Pathway Explore Affymetrix Edition.

33


Affymetrix

www.helicon.ru
Array strip

3.1

Affymetrix GeneAtlas System


Array strip,
. , .
. Array Strip
GeneAtlasSystem , .

GeneAtlas

LED

530

590

0,1 /2

4-

4- ,

30

12 bits

dat

, dB

<56

Windows XP

226 437 348

11

GeneAtlas System
: , - ,
, , , -,
, 1 Partek Express Ariadne Pathway Explore, Affymetrix
Edition

00-0393

GeneChip Scanner 3000

03

GeneChip Scanner 3000


Affymetrix , SNP ,
,
.
:
GeneChip Scanner 3000 7G -
:
Hybridization Oven 645.
Fluidics Station 450.
GeneChip Scanner 3000 7G.
.
web NetAffx .

34

GeneChip Scanner 3000

3.1


Affymetrix

GeneChip Scanner 3000 7G


Affymetrix.
.

03

GeneChip

GeneChip Scanner 3000

532

570

1,56

<0,5 /2

5-10 ( )

16 bits

Windows XP

330 x 560 x 460

32; 45,5 ( )

GeneChip Scanner 3000 7G, WorldWide GeneChip Scanner 3000 7G


: 450, 645,

00-0213

Affymetrix GeneTitan

GeneTitan

Affymetrix GeneTitan

, , SNP , , ).
192 :

GeneTitan Multi-Channel (MC) 300 .


GeneTitan,
(LED) .

Affymetrix GeneTitan
Array Plates, 16, 24 96 .
,
. . Array Plates
GeneTitan , , SNP .

Array Plates

35


Affymetrix

www.helicon.ru

3.1

GeneTitan Instrument

GeneTitan Multi-Channel
Instrument

SNP

LED

300
(
200700 )

520

53120
60920

570610

59320
67620

(1 ),
,
,

0,667
5
1400 x 840 x 660

140

147,4

03

36

GeneTitan. (LED)

00-0363

GeneTitan Multi-Channel (MC).


300

00-0373

3.2


BioPlex

Bio-Plex 200, Bio-Plex 3D

03

Bio-Plex 3D

Bio-Plex

5 .
- .
:
.
96- .
. Bio-Plex , , SNP, ,
- , (, , ).
:
(96 384 ).
100 ( Bio-Plex 200) 500 ( Bio-Plex 3D) .
.
:
.
.
.
.
.
.
.
.
.
12 .
:
.
.
.
.
.
.
.
: 50 , : IL-2, IL-4, IL-6, IL-8, , -, .
, : , -, , , , ,
.
: , , , ,
, , CRP, , .
: , (p53, 3, STAT2, STAT3, STAT6, p90RSK . .).
: p70, S6, p38, -Jun .
( ): G1G4, M, A, E.
: -2, , , HGF, IL-8, .

37


BioPlex

www.helicon.ru

3.2

:
.
.
.
.
HLA-.
.
~1,52 .
Bio-Plex Pro II
Wash Station, .
, Bio-Plex
.
- .
Bio-Plex, Bio-Rad (http://www.bio-rad.com/bio-plex/x-plex/).

Bio-Plex 200

Bio-Plex 3D

100

500

-
-
, /
, /

532 , >10
635 , 10
20-200
1-2

03

38

Bio-Plex 200

Bio-Plex 200

Bio-Plex 3D

Bio-Plex 3D

4.1

iMark

04

iMark

iMark 96- -
-.
.
:
, U
V- , 8- 12- .
: 400-750 .
6- : 415, 450, 490, 595, 655 750 .
.
3- .
.
(USB 2.0).
.
LCD .
, .
.
.
:
, .
, 405-750 5.

iMark

400-750

, OD

0,0-3,5

, OD

0,001

8 (6 : 415, 450, 490, 595, 655 750 )

96- -, 8 12- -

, USB 2.0

/, 64

100

346 377 164

5,5

iMark

BioRad 1681130
Zemfira

39

www.helicon.ru

4.1

Multiskan FC

Multiskan FC

Multiskan FC 96-
384- .
.

:
96- 384- .
340 850 .
3- : 405, 450 620 .
+4C +50C.
: ,

04

Multiskan FC

340-850

, OD

0-6,0

, OD

0,001

8 (3 : 405 , 450 620 )

96- 384-

, +4C +50C

100

290 400 210

8,5

40

Multiskan FC

51119000

Multiskan FC

51119100

4.2

PW 40

04

PW 40

PW-40
96- . .
:
8- .
, U- V- .
-.
.
.
.
.
.
:
PW-40.
(2 ) .
(2 ).
.
.

PW 40

96-

8-

50-3 000

, %

<2

1-3 599 1 ( )
09,95 0,1 ( )

<52 1

100

530 368 243

11

PW 40

BioRad 85499

41

www.helicon.ru

4.2


Wellwash Wellwash Versa

Wellwash Versa

Wellwash 96- 384- . , .

:
1 x 8 , 1 x 12 Wellwash,
Wellwash Versa 1 x 8, 1 x 12, 2 x 8, 2 x 12, 1 x 16.
1 x 8 2 x 8 ,
(
Wellwash Versa).
, U- V- .
.
, , , .
.
, .
.
.
.
.

WellWash :
WellWash.
(2 ) .
(2 ).
.
WellWash Versa :
WellWash Versa.
2 (2 ) .
2 .
(4 ).
.

Wellwash

Wellwash Versa

96-

96- 384-

1 x 8 , 1 x 12

1 x 8, 1 x 12, 2 x 8, 2 x 12, 1
x 16

,
.

1x82x8

50-400

, %
,
,

50-400 (96), 20-120 (384)


10%
<1,5
1-3 600

100

345 x 385 x 240

04

42

Wellwash
Wellwash Versa

Thermo 5165000
Thermo 5165010

4.3

PSU-2T

04

PSU-2T

PSU-2T 96- .
:
: 1501 000 /.
: 124 .
2 .
IPP-2 2 .
+5 +40.
:
IPP-4 4- .

PTS-60HL/PTS-60HL-4

PTS-60HL

PTS-60HL PST-60HL-4 96 . PTS-60HL - 2- ,


PTS-60HL-4 4- .
:
: 2501 200 /.
: 5 + 60C.
96 .
2 .
2 4 .
, .
.
, .

.
, PTS-60HL/PTS60HL-4, :
.
.
.

PTS-60HL-4

:
IPP-4 4- .

43

www.helicon.ru

4.3

PSU-2T

PST-60HL

PST-60HL-4

, C

25-60

25-60

, /

1501 000

0,1

0,1

2 96-

2 96-

4 96-

1 24

1 96


DC 12 ;
0,5

DC 12 ; 4,16

220 205 90

270 260 125

380 390 140

2,5

250-1 200

04

44

- PSU-2T
PTS-60HL 2-
PTS-60HL-4 4-

BS PSU-2T
BS PST-60 HL
BS PST-60 HL-4

5.1

Countess

05

Countess

Countess , .
5 . 30 .

.
:
, , .
, , .. 30 .
: , , , .
.
:
1. 5 ,
.
2. ( 100 ).
3. .
4. Countess , , USB--.
:
: 560 .
: .
: 104107 -1.
: ( ).
:
, . .
, . . , .
, %. .
, :
( , , ).
.
: , .
: , .

.
Countess , .
:
.jpg.
.pdf.
, Excel, .csv.

45

www.helicon.ru

5.1

Countess

30

, -1

104107

100240 , 50/60

270 200 190

2,1

Countess (c, 100 , 2 )


Countess, 50 . (c 100 , 2 )
Countess, 500 . (c 1 000 , 20 )
Countess, 1 250 . (c 2 000 , 50 )
Countess, 2 500 . ( 5 000 , 100 )
Countess, 5 000 . ( 10 000 , 200 )
Countess , 550 . (C10227+C10312)
Countess , 5 050 . (C10227+C10315)

C10227
C10228
C10312
C10313
C10314
C10315
C10310
C10311

Tali

Tali

Tali
.
25 .
:
( ).
.
(GFP RFP).
.
:
.
.
.
:
.
1075 .
, .
.
. 50 .

05


1 000 . , USB- .csv, .jpg .pdf.

46

5.1

05

Tali

, ,
, ,

560

.csv, .jpg .pdf

53020, 45820

, -1

105107

290 290 440

8,8

Tali (, 100 , )
Tali, 50 . ( 100 )
Tali, 500 . ( 1 000 )
Tali ( )
Tali ( )
Tali ( V Alexa Fluor 488 )

T10796
T10794
T10795
A10786
A10787
A10788

47


CO2-

www.helicon.ru

5.2

CO2- New Brunswick Scientific (Eppendorf)


170R

2- New Brunswick Scientific 2- : R- ( , ) S- ( , ). 3


- 170 , 48 , 14 . 14
.

:



/ .
, , ,
.
.
2.
- .
2.
RS-232.
.
:
( 170R, 170S, 48R).
2 (1-19%) ( 170R, 48R).
( -170).
0,1-19% 2.
.
( 170R).
.
N2.

170R/S

48 R/S

14S

170

48

14

2, %

0,2-20

2, %

0,1

2, %/

0,7

4 50

0,1

540 451 693

401 308 401

233 208 294

685 677 848

484 475 648

313 285 454

90

32

12,5

05

48

2- Galaxy CO14S,
2- Galaxy CO14S 1-19% 2
CO2 Galaxy CO48S,
2- Galaxy CO48R,
2- Galaxy CO48R,
2- Galaxy CO48R, 1-19% O2
2- Galaxy CO48R, , 1-19% O2
2- Galaxy CO170S,
2 Galaxy CO170S
2- Galaxy CO170R,
2- Galaxy CO170R 1-19% O2
2- Galaxy CO170R
2- Galaxy CO170R, , 1-19% O2
(-25 2)

NB CO14S-230-0000
NB CO14S-230-0200
NB CO48S-230-0000
NB CO48R-230-0000
NB CO48R-230-1000
NB CO48R-230-0200
NB CO48R-230-1200
NB CO170S-230-0000
NB CO170S-230-1000
NB CO170R-230-0000
NB CO170R-230-0200
NB CO170R-230-1000
NB CO170R-230-1200
-25 2

5.3

05

BioFlo/CelliGen 115

BioFlo/CelliGen 115

BioFlo 115 CelliGen 115


(, , )
, , .
- ,
.
*:
(BioFlo 115, Basic Fermentation Kit).
(BioFlo 115, Advanced Fermentation Kit) .
(CelliGen 115, Advanced Cell Culture Kit).
* .
BioFlo/CelliGen 115 , , ,
.
:
4- : 1,3/3,0/7,5/14,0
BioFlo/CelliGen 115 1 3 ;
, .
2 : .
2 BioFlo/CelliGen 115: (30-300 /) (25-1 200 /).
: , ,
.

BioFlo 115, Advanced


Fermentation Kit

CelliGen 115, Advanced


Cell Culture Kit

BioFlo 115, Basic Fermentation Kit

( )

pH/DO

(4 )
()

+
+

49

www.helicon.ru

5.3


Advanced Fermentation

501 200 /

Advanced Cell Culture


25200 /

25400 /

Basic Fermentation

+
+

+
+

+
+

pH, .

(2 .)

BioFlo/CelliGen 115

1,3-14

0,4-10,5

, ,

(., ., .)

(, , 2, 2)

2/4

05

BioFlo 115, :
,

50

1,3

0,4-1,0

1369-1151

1369-1161

3,0

0,8-2,2

1369-1152

1369-1162

7,5

2,0-5,6

1369-1155

1369-1165

14,0

4,0-10,5

1369-1150

1369-1160

5.3

05

CelliGen 115,
,

1,3

0,4-1,0

3,0

0,8-2,2

7,5
14,0

2,0-5,6
4,0-10,5

1369-1401

M1369-1171

M1369-1501

M1369-1371

M1369-1402

M1369-1172

M1369-1502

M1369-1372

M1369-1405

M1369-1175

M1369-1505

M1369-1375

M1369-1410

M1369-1170

M1369-1510

M1369-1370

BioFlo 115,
,

1,3

0,4-1,0

M1369-1141

M1369-1631

3,0

0,8-2,2

1369-1142

1369-1632

7,5

2,0-5,6

1369-1145

1369-1635

14,0

4,0-10,5

1369-1140

1369-1640

51

www.helicon.ru

Attune

5.4
Attune

Attune , ( 6 + FSC +
SSC) .
,
, , .

() , .

. Attune
, 10- ( ) .
:
(CV)
.
( 1 000 /). 10 .
. Attune ( 4
) , ..
.
: + (Blue/Violet) + (Red/Blue).

05

Attune , :
.
( , , ) ( , ).
.
, Attune
(100 FITC, 50 R-PE 1 ).

52

5.4

05

, 405

, 488

45040

Blue/Violet

Pacific Blue, Alexa


Fluor 405

PO-PRO-1, DyeCycle Violet, Fixable Violet Dead Cell


Stain, CellTrace Violet, Calcein Violet, SYTOX Blue,
FxCycle Violet, Click-iT Pacific Blue

52231

Blue/Violet

60348

Blue/Violet

53030

Blue/Violet,
Red/Blue

57524

Blue/Violet,
Red/Blue

640LP

Blue/Violet

690/50

Red/Blue

780/60

Red/Blue

660/20

Red/Blue

780/60

Red/Blue

, 638

Qdot 525, Horizon


Fixable Aqua Dead Cell Stain, F2N12S (apoptotic)
V500
Pacific Orange,
Fixable Yellow Dead Cell Stain, F2N12S (live)
Qdot 605
Calcein, Fluo-3/Fluo-4, TO-PRO-1 iodide, CFSE, GFP,
Alexa Fluor 488,
JC-1/DiOC2(3), SYTOX Green, DyeCycle Green, RhoFluorescein
damine 123, YO-PRO-1 iodide, Fixable Green Dead Cell
Stain, Click-iT ALexa Fluor 488
PI, Fura Red AM cell permeant, DyeCycle Orange,
JC-1/DiOC2(3), pHrodo Phagocytosis Particle Labeling
PE
Kit, SNARF (low pH) isomers, SYTOX Orange Dead cell
stain
PE-Alexa Fluor 610,
PerCP, PE-Alexa
Fluor 700, PE-Cy
5.5, TRI-COLOR (TC) JC-1/DiOC2(3), Fixable Red Dead Cell Stain, 7-AAD,
PE-Cy5, PerCP-Cy
SNARF (high pH) isomers, SYTOX AADvanced Dead
5.5, PE-Cy 7, PECell Stain, DyeCycle Ruby
Alexa Fluor 750,
Qdot 655, Qdot
705, Qdot 800
Qdot 705, PerCP,
TRI-COLOR (TC) PEVybrant Dye Cycle Ruby
Cy5, PerCP-Cy5.5,

PE-Cy 5.5
PE-Alexa Fluor 750,
Vybrant Dye Cycle Ruby
Qdot 800, PE-Cy7
Allophycocyanin
Fixable Far Red Dead Cell Stain, Click-iT Alexa Fluor
(APC), Alexa Fluor
647, FxCycle Far Red, SYTOX Red Dead cell stain,
647
TO-PRO-3

APC-Alexa Fluor
Fixable Near-IR Dead Cell Stain, Vybrant Dye Cycle
750, APC-Cy7
Ruby

Attune

8,8 45 17 100
6- , (FSC),
(SSC)

145

,

() , /
, /

,
,

20 000
Minitower Windows XP 24
1
251 000
100 4
100240 , 300
400 580 430
29

Attune Blue/Violet ( )

4445315

Attune Red/Blue ( )

4469120

Attune, 1

4449790

Attune, 6 1

4449791

Attune (10X), 1

4449792

Attune, 500

4449755

Attune (10X), 250

4454955

Attune, 5106 -1, 3

4449754

53

www.helicon.ru

5.5


Forma 900
Forma 902

Thermo
Scientific Forma 900 , ,
50oC 86o. 368 793 .
,
.

:
-50 -86 1.
368, 490, 651 793 .

, .
991, 994, 995 .

127 .
.
, .
, .
.
/ .

902

905

906

907

991

994

995

368

490

651

793

368

490

651

-50 -86



2 ( )

240

300

400

1308 x
584 x
490

1308 x
584 x
643

1308 x
1308 x
930 x
777 x 643
643

1979 x
846 x
836

1979 x
846 x
989

1979 x
1036 x
989

316

346

408

600

216

288

360

1308 x
584 x
490

1308 x
584 x
643

1308 x
777 x 643

1979 x
1189 x
989

1979 x
846 x
836

1979 x
846 x
989

1979 x
1036 x
989

485

316

346

408

230 , 50 , 12 A

05

54

902
905
906
907
991
994
995

Thermo 902
Thermo 905
Thermo 906
Thermo 907
Thermo 991
Thermo 994
Thermo 995

5.5

05


Forma 88000
Forma 88500

Thermo Scientific
Forma 88000 50oC 86o. . 421 949 .
,
. :
, . .

:
-50 -86.
421, 548, 682, 815 949 .
4 .

.
.
(PEP) .
, /.
2,5 - .
.
Forma 88000 .

88300

88400

88500

88600

88700

421

548

682

815

949

600/450

700/525

-50 -86


2/3 ( )

300/225

400/300

500/375
230 , 50

/ ()

12/15

12/16

12/16

12/16

12/15

1301,1 x 451,6
x 718,6

1301,1 x 587,4
x 718,6

1301,1 x 730,3
x 718,6

1301,1 x 873,1
x 718,6

1301,1 x 1016 x
718,6

1981 x 658 x
955

1981 x 822 x
955

1981 x 965 x
955

1981 x 1108 x
955

1981 x 1251 x
955

303

332

355

388

432

88300
88400
88500
88600
88700

Thermo 88300V
Thermo 88400V
Thermo 88500V
Thermo 88600V
Thermo 88700V

55

www.helicon.ru

5.5


Forma 8600
Thermo Scientific Forma 8600 50 86. 85 566 .
, .
:
-50 -86.
85, 360, 481 566 .
12- - -.
.
2,5 - .

803CV

813CV

817CV

820CV

85

360

481

566

-50 -86


2 ( )

63

230 , 50 , 5,4 A

252

348

398

419 x 470 x 470

711 x 1080 x 470

711 x 1494 x 470

711 x 1689 x 470

1113 x 724 x 759

1029 x 1829 x
848

1029 x 2225 x
859

1029 x 2438 x 848

196

325

372

378

230 , 50 , 12 A

803CV
813CV
817CV
820CV

Thermo 803CV
Thermo 813CV
Thermo 817CV
Thermo 820CV

- 40C Forma 7000

05

Thermo Scientific Forma 7000


-10 -40. 368, 490 651 . , , .
:
-10 -40.
368, 490 651 .
, .
, , .
.
(12,7 ), .

56

5.5



05

.
.
5,1 .
2,5 - .

7240V

7320V

7400V

368

490

651

-10 -40

230 , 50 , 12 A

584 1308 490

584 1308 643

777 1309 643

846 1979 836

846 1979 989

1036 1979 989

316

346

408

7240V, , 368 , 10C 40


7320V, , 490 , 10C 40
7400V, , 651 , 10C 40

Thermo 7240V
Thermo 7320V
Thermo 7400V

- 30C Forma FFGL


Thermo Scientific Forma FFGL
,
-30.
133 1 447 .

Forma FFGL2330

:
-30 -20.
133, 326, 659, 826 1 447 .
.
.
0,1.

.
.
.
/ / .
.
- .
.
.
.
.
.

FFGL430V

FFGL1230V

FFGL2330V

FFGL3030V

FFGL5030V

133

326

659

826

1 447

-20 -30

230 , 50 , 6 A

230 , 50 , 8 A

230 , 50 , 12 A

230 , 50 , 12 A

230 , 50 , 12 A

508 508 508

1331 5333 508

1473 737 610

1473 737 762

1473 737 1334

850 660 610

1869 762 610

2012 945 711

2012 945 864

2012 945 1435

100

127

193

202

272

57

www.helicon.ru

5.5

-30C FFGL430V
-30C FFGL1230V
-30C FFGL2330V
-30C FFGL3030V
-30C FFGL5030V

Thermo FFGL430V
Thermo FFGL1230V
Thermo FFGL2330V
Thermo FFGL3030V
Thermo FFGL5030V

- 30C Forma FFPF


Forma FFPF2330

Thermo Scientific Forma FFPF


-30.
133 1 447 ,
250 78 1 064 .

:
-30.
133, 326, 659, 826 1 447 .
.
.
0,1.
(152 ) .
.
.
.
, .
/ / .
.
; .
.
.
.
.

, /-
250 , .
,

,
,
,

FFPF-430V

FFPF-1230V

FFPF-2330V

FFPF-2330V

FFPF-5030V

133/78

326/273

659/532

826/665

1 447/1 064

7
230 , 50 ,
12 A
1473 737
762
2012 945
864
263

14
230 , 50 ,
12 A
1473 737
1334
2012 945
1435
295

-30
7
230 , 50 ,
230 , 50 , 6 A 230 , 50 , 8 A
12 A
1331 533
1473 737
521 508 508
508
610
1869 762
2012 945
850 660 610
610
711
100
145
193
2

05

58

-30C FFPF-430V
-30C FFPF-1230V
-30C FFPF-2330V
-30C FFPF-2330V
-30C FFPF-5030V

Thermo FFPF-430V
Thermo FFPF-1230V
Thermo FFPF-2330V
Thermo FFPF-2330V
Thermo FFPF-5030V

5.5

05

Forma FRGL
Thermo Scientific Forma FRGL
. +1
+8. 133 2 231 .

Forma FRGL1204V

:
+1 +8.
+4.
: 133, 326, 659, 826, 1297, 1 447 2 231 .
.
.
0,1.
; 25 .
.
.
.
, .
/ ( +5,5) ( +1,5) .
.
; .
.
/ .
.
.

FRGL-404V

FRGL-1204V

FRGL-2304V

FRGL-3004V

FRGL-4504V

FRGL-5004V

FRGL-7504V

133

326

659

826

1 297

1 447

2 231

+1 +8

12

230 , 50 ,
, 6

230 , 50 ,
, 6

230 , 50 ,
, 6

230 , 50 ,
, 6

230 , 50 ,
, 6

230 , 50 ,
, 8,5

230 , 50 ,
, 10,5

508 508
508

1331 552
508

1473 737
610

1470 737
762

1473 660
1334

1473 737
1334

1473 737
2057

864 660
610

1869 762
610

2012 945
711

2012
945864

2009 876
1435

2012 945
1435

2012 945
2159

100

127

168

197

304

265

365

+1 +8 FRGL-404V
+1 +8 FRGL-1204V
+1 +8 FRGL-2304V
+1 +8 FRGL-3004V
+1 +8 FRGL-4504V
+1 +8 FRGL-5004V
+1 +8 FRGL-7504V

Thermo FRGL-404V
Thermo FRGL-1204V
Thermo FRGL-2304V
Thermo FRGL-3004V
Thermo FRGL-4504V
Thermo FRGL-5004V
Thermo FRGL-7504V

59

www.helicon.ru

5.5

Forma FRBB
Forma FRBB2304V

Thermo Scientific Forma FRBB


+4. 133 1
447 .

:
+1 +8. +4.
: 133, 326, 659, 826 1 447 .
.
.
0,1.
(152 ) .
.
.
.
, .
/ ( +5,5) ( +1,5) .
.
;
, .
.
/ .
.
.

FRBB-404V

FRBB-1204V

FRBB-2304V

FRBB-3004V

FRBB-5004V

, / -
450 , .

133/64

326/192

659/385

826/426

1 447/770

14

230 , 50 ,
6

230 , 50 ,
6

230 , 50 ,
6

230 , 50 ,
6

230 , 50 ,
8,5

508 508
508

1331 533
508

1473 737
610

1473 737
762

1473 737
1334

850 660
610

1830 762
610

2012 925
711

2012 925
864

2012 925
1435

96

145

213

227

290

1 8

05

60

+1 +8 FRBB-404V
+1 +8 FRBB-1204V
+1 +8 FRBB-2304V
+1 +8 FRBB-3004V
+1 +8 FRBB-5004V

Thermo FRBB-404V
Thermo FRBB-1204V
Thermo FRBB-2304V
Thermo FRBB-3004V
Thermo FRBB-5004V

5.5

05

Forma FRPH
Thermo Scientific Forma FRPH
+1
+8. 326 1 447 .
, .

Forma FRPH3004V

:
: +1 +8.
+4.
326, 659, 826 1 447 .

.
.
.
, , 0,1.
, .
.
.
, .
,
.
/ / .
, , .
.
.
.
.
.

FRPH 1204V

FRPH 2304V

326

659

FRPH 3004V

FRPH 5004V

826

1 447

+1 +8

12

230 , 50 , 6

230 , 50 , 6

230 , 50 , 6

230 , 50 , 8,5

1320 552 500

1473 737 610

1473 737 762

1473 737 1334

1869 749 610

2012 925 711

2012 915 864

2012 925 1435

145

213

227

290

+1 +8 FRPH 1204V
+1 +8 FRPH 2304V
+1 +8 FRPH 3004V
+1 +8 FRPH 5004V

Thermo FRPH 1204V


Thermo FRPH 2304V
Thermo FRPH 3004V
Thermo FRPH 5004V

61

www.helicon.ru

5.6
Neon

Neon

Neon , ,
(DTTC). .

:

70%.
2104 6106 .
.

.
(), .
.



, pH . 2007
Neon, . , 200 ,
, . ,
, .

:
Neon Neon,
3 :
1. .
2. , .
3. .
.

Neon

() Neon

, ,

0,52,5

10 100

21046106

, .

20

100240 , 5060 , 300

234 300 220

05

62

Neon (, , )
Neon 10 , 50 ( 10 , )
Neon 10 , 192 ( 10 , )
Neon 100 , 50 ( 100 , )
Neon 100 , 192 ( 100 , )
Neon (MPK5000+MPK1096+MPK10096)

MPK5000
MPK1025
MPK1096
MPK10025
MPK10096
MPK5000S

5.6

MicroPulser

05

MicroPulser

, , .
:
.
.
.
.
.
.
.
, , 5 0,1 5
0,2 .

MicroPulser

0,23

15

5 , 5

100120 , 2 220240 , 1 , 5060

290 210 80

2,9

MicroPulser

BioRad 1652100

Bio-Rad, 0,4 , 5 .

BioRad 1652081

Bio-Rad, 0,2 , 5 .

BioRad 1652082

Bio-Rad, 0,1 , 5 .

BioRad 1652083

Bio-Rad, 0,4 , 50 .

BioRad 1652088

Bio-Rad, 0,2 , 50 .

BioRad 1652086

Bio-Rad, 0,1 , 50 .

BioRad 1652089

Bio-Rad, 0,4 , 500 .

BioRad 1652091

Bio-Rad, 0,2 , 500 .

BioRad 1652092

Bio-Rad, 0,1 , 500 .

BioRad 1652093

63

www.helicon.ru

5.6

Gene Pulser Xcell


Gene Pulser Xcell ,
, ,

.
.

Gene Pulser Xcell


.
100 .

:
.
.
.
, , 15 .

Gene Pulser Xcell

: , ; :

0,013

: 105106

0,05-100

9 , 6 , 12

100120 220240 , 5060 , 240

310 300 280

11,6

05

64

Gene Pulse Xcell

BioRad 1652661

Gene Pulse Xcell

BioRad 1652662

Gene Pulse Xcell

BioRad 1652660

Bio-Rad, 0,4 , 5 .

BioRad 1652081

Bio-Rad, 0,2 , 5 .

BioRad 1652082

Bio-Rad, 0,1 , 5 .

BioRad 1652083

Bio-Rad, 0,4 , 50 .

BioRad 1652088

Bio-Rad, 0,2 , 50 .

BioRad 1652086

Bio-Rad, 0,1 , 50 .

BioRad 1652089

Bio-Rad, 0,4 , 500 .

BioRad 1652091

Bio-Rad, 0,2 , 500 .

BioRad 1652092

Bio-Rad, 0,1 , 500 .

BioRad 1652093

5.6

05

Gene Pulser MXcell


Gene Pulser MXcell ,
( ) 96-, 24- 12- .

Gene Pulser MXcell

:
300 .
.

Gene Pulser MXcell

96-, 24- 12-

0,010,5

1051,5107

0,05-999

21

100120 220240 , 5060 , 240

310 300 140

6,6

Gene Pulser MXcell 96-

BioRad 1652670

24- Gene Pulser MXcell

BioRad 1652682

12- Gene Pulser MXcell

BioRad 1652683

Gene Pulser MXcell

BioRad 1652673

Bio-Rad, 0,4 , 5 .

BioRad 1652081

Bio-Rad, 0,2 , 5 .

BioRad 1652082

Bio-Rad, 0,1 , 5 .

BioRad 1652083

Bio-Rad, 0,4 , 50 .

BioRad 1652088

Bio-Rad, 0,2 , 50 .

BioRad 1652086

Bio-Rad, 0,1 , 50 .

BioRad 1652089

Bio-Rad, 0,4 , 500 .

BioRad 1652091

Bio-Rad, 0,2 , 500 .

BioRad 1652092

Bio-Rad, 0,1 , 500 .

BioRad 1652093

65

www.helicon.ru

5.6

Eporator

Eporator

Eporator
.
, ,
USB
.
:
.
.
.
Eppendorf .

05

Eporator

0,22,5

1051,5107

100240 10%, 5060 , 20

275 190 125

66

Eporator
, 1 , 100 , , (50 ./.)
, 2 , 400 , , (50 ./.)
, 4 , 800 , (50 .\.)

Epp 4309 000.019


Epp 4307 000.569
Epp 4307 000.593
Epp 4307 000.623

5.6

Multiporator

05

Multiporator

Multiporator 3 : ( ), /
. Soft Pulse,
( 15 ), .
,
. , .
:
Soft Pulse.
() .
.
.
.
Multiporator ,
.
. .

Multiporator

0,0050,3

0,021,2

0,22,5

106

13106
()

0,15300
1 .

15500
1

5 (

3,3 )

,
,

100240 10%, 5060 , 60


252 342 120
5,5

Multiporator

Epp 4308 000.015

Multiporator ,

Epp 4308 000.023

Multiporator , , ,

Epp 4308 000.040

67

www.helicon.ru

6.1

Eppendorf :
, .
.
.
.
8
( ).
.
:
.
: ( 121C, 20 ).
.
, .
Short-spin .
.
( ).

.

.
.
.
.

.
( ).
(
).
:
: -, , , .

MiniSpin MiniSpin lus

MiniSpin MiniSpin lus

06

MiniSpin - Eppendorf. 12-


1,5/2,0 , 13 400 /
(12 100 g). .
MiniSpin lus 14 500 / (14 100 g), ,
(/) (, g).
:
12 x 1,5/2,0 .
0,2; 0,4; 0,5 0,6 .
-.
13 .
15 30 ( MiniSpin), 15 99 ( MiniSpin plus).
( MiniSpin plus).

68

6.1

06

MiniSpin

MiniSpin lus

, /

13 400

14 500

, g

12 100

14 100

/ g

12 1,5/2,0

13

13

12

12

49

52

30

99

70

85

, /

230/60

225 240 120

4,3

F-55-16-5-PCR:
8 0,2 .
MiniSpin MiniSpin plus.
MiniSpin/MiniSpin plus 13 400/14 500 /.
MiniSpin/MiniSpin plus 9 840/11 520 g.

MiniSpin

Epp MS

MiniSpin plus

Epp MS+

F-55-16-5-PCR

Epp 5452 727.007

0,2 (6 ./.)

Epp 5425 715.005

0,5 0,6 (6 ./.)

Epp 5425 716.001

0,4 (6 ./.)

Epp 5425 717.008

()

Epp 5452 702.000

5418 5418R

5418 / 5418R

18 1,5/2,0 , 14 000 / (16 873 g). 5418R


0 40C.
:
18 x 1,5/2,0 .
0,2; 0,4; 0,5 0,6 .
16 873 x g (14 000 /).
( /
).
.
99 .
0 40C ( 5418R).
FastTemp ( 5418R).

69

www.helicon.ru

6.1

5418

5418R

, /

14 000

, g

16 873

18 1,5/2

max ,

18

11

16

12

51

56

, /

230/60

170

320

210 300 210

300 460 250

( ),

7,7

22,0

Epp 5418 000.017

5418R, F-45-18-11 (18


1,5/2,0 11 )

Epp 5401 000.013

5424 5424R

5424 5424R

24 1,5/2 4- -,
14 680 / (20 238 g).

. 5424R
-10 40C.

06

5418, F-45-18-11 (18


1,5/2,0 11 )

70

:
24 x 1,5/2,0 . 0,2;
0,4; 0,5 0,6 .
20 238 g (14 680 /) 5424 21 130 g (15 000 /) 5424R.
SOFT .
15 .
3 : , - 0,2 , .
30 .
( / ).
: ( ) - ( ).
( 5424).
-10 40C ( 5424R).
Fast temp 4 C 8 ( 5424R).

6.1

06

5424

5424R

, /

14 680

15 000

, g

20 238

21 130

24 1,5/2

max ,

15

16

51

54

, /

230/60

250

350

236 320 227

290 480 260

( ),

13,4

21,0

5424/5424R

FA-45-24-11

FA-45-24-11-Special

F-45-32-5-PCR

F-45-18-11-Kit

24 1,5/2

24 1,5/2

4 8 -

18 1,5/2

-/

, g

20 238

20 238

17 829

17 347

0,2; 0,4; 0,5; 0,6

5424

Epp 5424 000.614

5424 FA-45-24-11

Epp 5424 000.410

5424R

Epp 5404 000.219

5424R FA-45-24-11

Epp 5404 000.014

FA-45-24-11

Epp 5424 702.007

FA-45-24-11-Special

Epp 5424 700.004

F-45-18-11-Kit

Epp 5424 706.002

F-45-32-5-PCR

Epp 5424 704.000

71

6.1

www.helicon.ru

5417R

5417R

30
1,5/2 25 000 g,
. 4 .
, ,
.

06

:
24 x 1,5/2,0 .
0,2; 0,4; 0,5
0,6 .
25 000 x g (16 400 /).
( 11 FA-45-30-11).
Short-Spin .
SOFT .
, .
.
( -9 40C).
4C 16 .
99 .
.
.
FastTemp .
6 ,
.

72

5417R

, /

16 400

, g

25 000

5 1,5/2,0

54

99

, /

230/50

700

310 600 250

( ),

35

6.1

06

5417R

--

F-45-30-11

F-45-30-11

FA-45-24-11

A-8-11

F-45-48PCR

30 1,5/2

30 1,5/2

30 1,5/2

8 1,5-2

6 5
8 48
0,2

,
14 000
g

14 000

16 400

10 000

10 000

,
/

20 800

20 800

25 000

10 600

10 600

(F )

0,2; 0,4; 0,5; 0,6

5417R,

Epp 5417R

F-45-30-11

Epp 5490 015.002

F-45-30-11 ( )

Epp 5490 004.302

F-45-24-11 ( )

Epp 5490 061.004

0,2 (6 ./.)

Epp 5425 715.005

0,4 (6 ./.)

Epp 5425 717.008

0,5 0,6 (6 ./.)

Epp 5425 716.001

-8-11

Epp 5492 008.003

--

Epp 5490 060.008

5430 5430R

5430 5430R



, , , Falcon,
. 30 130 x g (17 500 /). 5430R
-11
40C.
:
30 1,5/2 7 ( ).
30 130 x g (17 500 /).
25 .
50 .
5 .
- .
-11 40C ( 5430R).
FastTemp pro ,
( 5430R).

73

www.helicon.ru

6.1

5430

5430R

, /

17 500

, g

30 130

30 1,5/2

. ,

25

25

67

, /

63
230/60

475

1 050

330 420 250

380 640 300

( ),

29

56

06

5430

74

, g

, /

F-45-3011

30 1,5/2

20 817

14 000

FA-45-3011

30 1,5/2

20 817

14 000

19 090

13 200

0,2; 0,4;
0,5; 0,6

FA-45-2411-Kit

24 1,5/2


-
,

FA-45-2411-HS

24 1,5/2

30 130

17 500

F-45-1817-Cryo

18

8 320

8 900

F-35-6-30

6 15/50

7 197

7 830

15
50

F-45-645-PCR

4 8 -

11 987

11 800

-2-

2 96/384-

2 204

4 680

6.1

5430

Epp 5427 000.011

5430 FA-45-30-11

Epp 5427 000.216

5430R

Epp 5428 000.210

5430R FA-45-30-11

Epp 5428 000.015

F-45-30-11

Epp 5427 712.003

FA-45-30-11

Epp 5427 713.000

FA-45-24-11-Kit

Epp 5427 703.004

FA-45-24-11-HS

Epp 5427 710.000

F-45-18-17-Cryo

Epp 5427 705.007

F-35-6-30

Epp 5427 716.009

F-45-64-5-PCR

Epp 5427 714.006

-2-

Epp 5427 700.005

06

75

www.helicon.ru

6.2

5702, 5702R , 5702RH


5702


.
5702R
9C 40C, 5702RH
-9 +42C.
:
3 000 g (4 400 /).
5- .
At set rpm - .
26 .
/ SOFT .
2- .
.

.
FastTemp .
( 5702R/5702RH).

5702R

5702

5702R

, /

5702RH

4 400

, g

3 000

-9 +40

200

380

, /

-9 +42

230/50

320 400 240

380 580 260

( ),

20

36

5702/5702R

4 x 85
4
x 90

4 400

3 000
, g

1,1 85 (

06

- -4-38

76

- -8-17

F-3530-17

F-4518-17-Cryo

8 15

10 30 15

18 24
1-2
1,5/2,0

4 400

4 400

4 400

4 400

2 800

2 750

1 840

1 770

Falcon

F-4524-11

0,2
1-2
0,6

6.2

5702,

Epp 5702

5702R,

Epp 5702R

5702R,

Epp 5702R/

F-35-35-17 ( 30 15 20
30 )

Epp 5702 704.008

F-35-35-17 ( 10 15 10
10 )

Epp 5702 705.004

F-45-24-11

Epp 5702 746.002

F-45-18-17-Cryo

Epp 5702 747.009

1-2

Epp 5702 752.002

- -4-38 4 85

Epp 5702 720.003

- -4-38

Epp 5702 740.004

4 85

Epp 5702 722.006

2 85

Epp 5702 761.001

4 90

Epp 5702 709.000

2 90

Epp 5702 762.008

85 , 2 .

Epp 5702 721.000

- -8-17

Epp 5702 700.002

06

5804, 5804R , 5810, 5810R


20 800 g , 500
, -, , .
,
. 5810 5810R
/-
- .

5804R

:
200 / 14 000 /
( 10 /).
2 000 ( 5810/5810R).
5810
10 .
14 .
.
.
34 .
.
at set rpm .
-9 +40 (
5804R/5810R).
FastTemp ( 5804R/5810R).

77

www.helicon.ru

6.2

5804

5804R

5810

, /

14 000

, g

20 800

5810R

510

-9 +40

2 000
-

-9 +40

900

1650

900

1650

470 550 340

640 550 340

540 610 350

700 610 350

( ),

55

80

68

99

, /

230/50

06

5804/5804R 5810/5810R

78

, /

, g

5804
5804R

5810
5810R

F-34-6-38

11 000
12 000
(5810R)

15 550
18 500
(5810R)

6 85

F-45-30-11

14 000

20 800

30 2

FA-45-30-11

14 000

20 800

30 2

F-45-48-PCR 12 000

15 250

48 0,2

A-4-81 4 000

3 250/2 600

4 500
96 2

A-4-81-MTP

4 000

2 900

16 96-

A-4-62 4 000

3 200

4 250

A-4-62-MTP

4 000

2 750

16 96-

A-4-44 5 000

4 500

4 100

A-2-DWP

2 250

3 700

6.2

06

5804/5804R 5810/5810R

, /

, g

5804
5804R

5810
5810R

T-60-11

14 000

16 400

60 2

FA-45-6-30 11 000

16 639

6 50

A-2-DWP-AT

3 486

4 96-

4 500

5804

Epp 5804

5804R

Epp 5804R

5810

Epp 5810

5810R

Epp 5810R

F-34-6-38

Epp 5804 727.002

F-45-30-11

Epp 5490 015.002

FA-45-30-11

Epp 5804 726.006

F-45-24-11

Epp 5425 725.000

F-45-48-PCR

Epp 5804 735.005

- A-4-81

Epp 5810 718.007

- A-4-81-MTP

Epp 5810 725.003

- A-4-62

Epp 5810 709.008

- A-4-62-MTP

Epp 5810 711.002

- A-4-44

Epp 5804 709.004

- A-2-DWP

Epp 5804 740.009

T-60-11

Epp 5804 730.003

FA-45-6-30 ,

Epp 5820 715.006

A-2-DWP-AT ,

Epp 5820 710.004

0,2

0,4

0,5

0,6

1,5-2

1,2-5

2,6-7

3-15

7-17

7-18

7-15

15 (Falon)

15-18

18-30

20-30

30-50

50

50 (Falon)

50-75

80-100

85

500

5804/5804R 5810/5810R ( )

F-45-30-11

F-45-30-11

F-45-48-PCR

T-60-11

F-34-6-38

-4-44

-4-62

-4-81

79

www.helicon.ru

6.2

BioSan
LMC-3000

LMC-3000
( 3 000 /) LMC-3000 96-
50 . in vitro
.

:
(
) , .
: , ,
.
.
.
.

06

LMC-3000

, /

3 000

, g

1 700

99

230 , 5060 ,130

470 400 235

13,5

LMC-3000:
R-12/10 - 12 10 . 9 .
R-12/15 - 12 15 .
R-6 - 6 50 .
R-2 - 96- .

80

LMC-3000

BS LMC-3000

LMC-3000 R-12/10

BS LMC-3000/R-12/10

LMC-3000 R-12/15

BS LMC-3000/R-12/15

LMC-3000 R-6

BS LMC-3000/R-6

LMC-3000 R-2

BS LMC-3000/R-2

13 75 (2-5 ), R-12/10, 12 ./.

BS BN-13/75

13 100 (4-8 ) R-12/10, 12 ./.

BS BN-13/100

16 100 (8-9 ) R-12/10, 12 ./.

BS BN-16/100

6.2

LMC-4200R

06

LMC-4200R

( 4 200 /)
LMC-4200R 96-
50 .
-10 +25. in vitro .
:
(, ) , , .
.
.
.

LMC-4200R

-10 +25

, /

4 200 ( 100)

, g

3 370

335

30

, 16 2

, /

230/50

610 460 340

( ),

60

LMC-4200R:
R-12/10 - 12 10 . 9 .
R-12/15 - 12 15 .
R-6 - 6 50 .
R-2 - 96- .

LMC-4200R

BS LMC-4200R

R-12/10

BS R-12/10

R-12/15

BS R-12/15

R-6

BS R-6

R-2

BS R-2

13 75 (2-5 ), R-12/10, 12 ./.

BS BN-13/75

13 100 (4-8 ) R-12/10 12 ./.

BS BN-13/100

16 100 (8-9 ) R-12/10, 12 ./.

BS BN-16/100

81

www.helicon.ru

6.3

Avanti
J-26 XP

J-E

Avanti . , / .
: ,
, ,
.
Avanti J-30I
( 110 500 g 30 000
/) . , . 12 13
.
Avanti J-26 XP 32
,
. , JLA8.1000 6 1 000 g =15 970.
Avanti J-E , /.
, ,
, ,
.

:
, .
.
.
.
.
100 .
.
.
.
.
.

J-30I

J-26 XP

J-E

, /

30 000, 10

26 000, 10

21 000, 50

, g

110 500

82 000

53 300

4 000

6 000

4 000

,
,

1,5-1 000

-10 +40, 1

12/13

2/3
1 99

57

, //

06

82

65

230/50/30 ( )

,
,

10-1 000

-20 +40, 1

865 876 711


310

290

914 800 635


267,4

6.3

06

J-E

J-26 XP

J-30I

Avanti

, /

, g

JA-30.50 Ti


( 34)
rmax =108

30 000

108 860

8 x 50

JA-25.50


( 34)
rmax =108

25 000

75 600

8 x 50

JA-25.15


( 25)
rmax =106

25 000

74 200

24 x 15

JA-21


( 40)
rmax =102

21 000

50 400

18 x 10

JA-20.1


( 23)
rmax =115

20 000

51 500

32 x 15

JA-20


( 34)
rmax =108

20 000

48 400

8 x 50

JA-18.1


rmax =116

18 000

42 100

24 x 1,8

JA-18


( 23)
rmax =132

18 000

47 900

10 x 100

JA-17


( 25)
rmax =132

17 000

39 800

14 x 50

JLA-16.250


( 25)
rmax =134

16 000

38 400

6 x 250

JA-14


( 25)
rmax =137

14 000

30 100

6 x 250

JA-12


( 35)
rmax =144

12 000

23 200

12 x 50

JA-10


( 25)
rmax =158

10 000

17 700

6 x 500

83

www.helicon.ru

6.3

J-E

, /

, g

(
20)
10 000
rmax =166

18 500

6 x 500

JLA-9.1000

(
20)
9 000
rmax =185

16 800

4 x 1000

JS-24.38


rmax =161

24 000

103 900

6 x 38,5

JS-24.15

rmax =171,3

24 000

110 500

6 x 15

JS-13.1

rmax=140

13 000

26 500

6 x 50

JS-7.5

rmax =165

7 500

10 400

4 x 250

rmax =168,5

6 570

10
4

JCF-Z

JE-6B

JE-5.0

06

JLA-10.500

JS-5.9

84

J-30I

J-26 XP

Avanti

5 900

20 000

39 900

660 (
)
1250 (
)
240 (
)

rmax :

=125

=126

6 000

5 040
5 080

4,2
4,8

rmax :

=168 ,

=125 ,

=126

5 000

4 700
3 500
4 230

40
4,0
5,5

Avanti J-30I

Avanti J-30I

Avanti J-26 XP

Avanti J-26 XP

Avanti J-E

Avanti J-E

6.4

06

Avanti
Avanti . /
, .
Avanti J-HC . 9 ( 5 000 /, 7 480 g),
36
. , .
Avanti J6-MI ,
, . , ,
.

J-HC

J-HC

J6-MI

, /

100-10 000, 10

100-6 000

, g

17 700

6 840

-10 +40

-20 +40

9 000

6 000

1,5-2 250

1,8-1 000

1 -99 59 .

, ,
(
)

9 ,

60

63

, //

230/50/30 ( )

860 860 710

910 838 711

300

252

Avanti

, /

, g

J6-MI

J-E

JA-25.50

( 34)
rmax =108

25 000

75 600

8 x 50

JA-21

( 40)
rmax =102

21 000

50 400

18 x 10

JA-20.1

( 23)
rmax =115

20 000

51 500

32 x 15

JA-20

( 34)
rmax =108

20 000

48 400

8 x 50

85

www.helicon.ru

6.4

06

JA-18

86

J6-MI

J-E

Avanti

,
/


, g

( 23)
rmax =132

18 000

47 900

10 x 100

6 000
6 000

4 680
4 520

24 1,8
24 1,8

JA-18.1


( 45)
rmax =116
( 25)
rmax =112

JA-17

( 25)
rmax=132

17 000

39 800

14 x 50

JLA16.250

( 25)
rmax=134

16 000

38 400

6 x 250

JA-14

( 25)
rmax=137

14 000

30 100

6 x 250

JA-12

( 35)
rmax=144

12 000

23 200

12 x 50

JA-10

( 25)
10 000
rmax=158

17 700

6 x 500

JLA10.500

( 20)
rmax=166

10 000

18 500

6 x 500

JLA9.1000

( 20)
rmax=185

9 000

16 800

4 x 1000

JS-13.1


rmax=140

13 000

26 500

6 x 50

JS-7.5


rmax=165

6 000

6 650

4 250

JS-5.2


rmax=226

5 200

6 840

4 1 000
4
12
148

6.4

06

J6-MI

J-E

Avanti

, /

, g

4 200

5 020

6 1 000
6
18
336

JS-4.2


rmax=254

JS-4.2A


rmax=254

4 200

5 020

6 1 000
6
18
336

JS-4.2SM


rmax=248

4 200

4 900

JS-4.2SMA


rmax=248

4 200

4 900

Avanti J-HC

Beckman 367502

Avanti J6-MI

Beckman 360292

87

www.helicon.ru

6.5

Optima L- L-XP
Optima L-100XP

Optima , , ,
.
,
.
10%
.

, , , .
, .

:
602 000 x g (80 000 /) 802 400 g (100 000 /)
.
50 .
, / .
,
.
ESP (Efficient Sedimentation Program) .

Optima .
Optima HEPA-.
XP ,
, .

Optima L-90K L-100K

Optima L-80XP L-100XP

, /

L-90K: 1 000 90 000


L-100K: 1 000 100 000

L-80XP: 1 000 80 000


L-100XP: 1 000 100 000

, /

100

, /

20

10

, g

L-90K: 694 000


L-100K: 802 000

L-80XP: 602 000


L-100XP: 802 400

1 500

230 250
99 59 ,
Hold (
), w2t

, w2t,

, C
, C

0 40 ( 1)
0,5

06


, C

88

999 59 ,
Hold (
), w2t

0,3

5 /10% ( 5 )
15 40

10 40

6.5

06

Optima L-90K L-100K

Optima L-80XP L-100XP

( 0
), ( 0 500
/,
)

10 : 9

,
( 500 /,

),

11 : 9 ,
,

9 +

Optima eXpert

1,0

57

53
220-240 , 20 , 50 ( )

1207 940 673

465

1257 940 673

Optima L- L-XP

, /

, g

100Ti

( 26)
rmax=71,6

100 000

802 000

8 x 6,8

Type 90Ti

( 25)
rmax=76,5

90 000

694 000

8 13,5

70.1Ti

( 24)
rmax=82

70 000

450 000

12 13,5

Type 70Ti

( 23)
rmax=91,9

70 000

504 000

8 39

Type 50.4Ti

( 20)
rmax=111,5

50 000

270 000/312 000

44 6,5

Type 50.2Ti

( 24)
rmax=107,9

50 000

302 000

12 39

Type 45Ti

( 24)
rmax=103,8

45 000

235 000

6 94

Type 42.2Ti

( 30)
rmax=113

42 000

223 000

72 230

89

www.helicon.ru

6.5

06

Optima L- L-XP

90

,
/


, g

Type 25Ti

( 25)
rmax=100,4

25 000

70 300/81
400/
92 500

100 1

19

( 25)
rmax=133,4

19 000

53 900

6 250

NVT 100


( 8) rmax=67

100 000

750 000

8 5,1

NVT 90


( 8) rmax=71,1

90 000

645 000

8 5,1

NVT 65.2


( 8,5)
rmax=87,9

65 000

416 000

16 5,1

NVT 65


( 7,5)
rmax=84,9

65 000

402 000

8 13,5

VTi 90


( 0)
rmax=71,1

90 000

645 000

8 5,1

VTi 65.2


( 0)
rmax=87,9

65 000

416 000

16 5,1

VTi 65.1


( 0)
rmax=84,9

65 000

402 000

8 13,5

VTi 50


( 0)
rmax=86,6

50 000

242 000

8 39

SW60Ti


rmax=63,1

60 000

485 000

6 4

SW 55 Ti


rmax=60,8

55 000

368 000

6 5

6.5

06

Optima L- L-XP

, /

, g

SW41 Ti


rmax=67,4

41 000

288 000

6 13,2

SW40 Ti


rmax=66,7

40 000

285 000

6 14

SW32.1 Ti


rmax=162,8

32 000

187 000

6 17

SW 32 Ti


rmax=152,5

32 000

175 000

6 38,5

SW28.1


rmax=72,9

28 000

150 000

6 17

SW 28


rmax=75,3

28 000

141 000

6 39

CF-32 Ti

32 000

102 000

430

48 000

172 000
160 000

665 (

) 525
( -29)

102 000
96 500

1 675 (

)
1 350
( -29)

Ti-14

Ti-15

32 000

Optima L-90K

Optima L-90K

Optima L-100K

Optima L-100K

Optima L-80XP

Optima L-80XP

Optima L-100XP

Optima L-100XP

91

www.helicon.ru

6.5

Optima MAX-XP
Optima MAX-XP
,
, , , .
, , . eXPert

: , , .
.
.
. 10%
.

Optima MAX-XP

:
150 000 /.
.
.
-.
, , .
.

06

92

Optima MAX-XP

, /

5 000 150 000

, /

1 000

, /

50

, g

1 019 000

64

0,2 8

99 59

, C

0 40 ( 0,1)

, C

10%

, C

15 35

10 : 9 5 000
/

11 : 10

0,7

47

220-240 , 6 , 50 ( )

737 584 409

105

6.5

06

Optima MAX-XP

, /

, g

TLA-120.2

( 30)
rmax=38,9

120 000

627 000

10 x 2,0

TLA-120.1

( 30)
rmax=38,9

120 000

627 000

14 x 0,5

TLA-110

( 28)
rmax=48,5

110 000

657 000

8 x 5,1

TLA-100.3

( 30)
rmax=48,3

100 000

541 000

6 x 3,5

TLA-100

( 30)
rmax=38,9

100 000

436 000

20 x 0,2

TLA-55

( 45)
rmax=55

55 000

186 000

12 x 1,5

MLA-150

( 35)

150 000

1 003 000

8 x 2,0

MLA-130

( 35)
rmax=53,9

130 000

1 019 000

10 x 2,0

MLA-80

( 26)
rmax=61,9

80 000

444 000

8 x 8,0

TLN-120


( 8)
rmax=36,3

120 000

585 000

8 x 1,2

TLN-100


( 9)
rmax=54,2

100 000

450 000

8 x 3,9

MLN-80


( 9)
rmax=54,2

80 000

389 000

8 x 8,0

93

www.helicon.ru

6.5

06

Optima MAX-XP

94

,
/


, g

TLV-100


( 0)
rmax=35,7

100 000

400 000

8 x 2,0

TLS-55


rmax=42,2

55 000

259 000

4 x 2,2

MLS-50


rmax=95,8

50 000

268 000

4 x 5,0

Optima MAX-XP

Optima MAX-XP

7.1

Primo Star

07

PrimoStar

Primo Star - .
,
, ,
. Primo Star
,
.
:
: (), (),
().
: 4-10-40-100, Plan-Achromat.
.
- 30/20.
=0,9/1,25.
.
.

Primo Star

(), (), ()

45

180

40x 1000x ,
4x 100

Siedentopf :
. 40 , :
48 75 , 360, 30 (),
, 50%:50%
(vis:doc),

WF 10x/18 Br. foc.


WF 10x/20 Br. foc.

,

Plan-Achromat 4x/0,1
Plan-Achromat 10x/0,25
Plan-Achromat 40x/0,65
Plan-Achromat 100x/1,25
Plan-Achromat 40x/0,65 Ph2

Abbe 0,9/1,25,
, 18
( ) 20 ( )

,
(6 , 30 ), (LED) (6 , 3 ,
20 )

140 x 135

75 x 30

: 0,3 /, : 4 /,
: 15

: 6,50
: 4,39
: 0,48
: 0,13
: 0,48

Primo Star

Primo Star

95

www.helicon.ru

7.1

AxioLab.A1
AxioLab.A1

Axio Lab.A1 .
Axio Lab.A1 :
. , ,
. .

:

- , , - (), .
IC2S-,
,
. , , .
.
,
.
35 , .
.

07

96

AxioLab.A1

: , ,
- (), (
)

ICS,

A-Plan, N-Achroplan, EC-Plan-Neofluar IC2S

: 35 3 (LED daylight
LED warmlight),

E-PL 10/20 Br. Foc,


E-PL 10/20 Br. foc.

0,9/1,25; 5-
;
( )

75 30 , -

AxioLab.A1

AxioLab.A1

7.1

Axio Scope

AxioScope

07

- Axio Scope - ,
, , ,
.
23 5 , 3- 2- ( 380 560 ). .
:
: , , , - (), , , .
Zeiss C-DIC (- ), , PlusDIC ( ). .
(LED) (FL-LED
Colibri).

Axio Scope

, , , -
(), , ,

12,5-2500

, /; 30, 20, 15 ( )

PL 10x/23 Br. foc.


W-PL 10x/23 Br. foc.
E-PL 10x/23 Br. foc.

0.9/1.25, .. -
0.9, ( )

2 6 : 6 3 + 3

1,25-100 : A-Plan, Achroplan, Plan-Neofluar,


N-Achroplan, 23 ,.EC Epiplan, DIC
5, 10, 20,
(1,6; 2,5)

(LED)
(FL-LED Colibri) (15 000-30 000 ), ,
,
, HXP 120, (12 , 50 )

, (360), ,
, .

Axio Scope

Axio Scope

97

www.helicon.ru

7.1

Axio Imager
Axio Imager
- , .
Axio Imager
.

Axio Imager

:
: , , , - (), -, ,
IC2S-,
,
. , , .
, - .
.
ApoTome D2/Z2 .
LSM 710 3D.
.

Axio Imager

: , , ,
- (), ,

(A1/D1) (M1/Z1)

: (12 , 100 ),
(M1 Z1) (A1 D1); , LED;
, : HBO103
(100 ), 6- 10-

, , ,
( ), , ,
,

, ,
(IC2S-), : 1,25-100, A-Plan, Achroplan, Plan-Neofluar, 1,25; 1,6; 2,5; 4,
ACR

10/20; 10/23; 16/16

6 7

, /;
- 30, 20 ( 55 ), 15 (
)

; (240); (360); ; ,

RS232, TCPIP, USB, CAN, RS232, Closed Loop, Service


interface

TFT- ( M1, Z1),


ApoTome D1/Z1

07

98

Axio Imager

Axio Imager

7.1

07

Axio Examiner
Axio Examiner , , .
, , .

Axio Examiner

:
: ,
, , - (), , .
. , .
, .
.
, .
- .
Axio Vision, :
Physiology ,
.
Dual Camera ,
.

Axio Examiner

: , , ,
- (), ,

4-

0,5x, 1x, 1,6x, 2,5x, 4x 5x,

,
,W N-Achroplan, W Plan-Apochromat, 45 70 , 45 +30
75

,
1,2 - . 0,8, 0,9 1,2 W

Axio Examiner

Axio Examiner

99

www.helicon.ru

7.2

Primo Vert

Primo Vert

Primo Vert
,
. , ,
, .

:
: ; .
, .
: , (Ph1) 10, 20 40 , .
, .
, .
.
15 .
: .
: , , .
Primo Vert .

Primo Vert

: ;

, W 0.8, Plan-Achromat: 4x / 0,1, 4x/0,1 Ph0,


10x/0,25 Ph1 LD Plan-Achromat: 20x/0,3 Ph1, 40x/0,5 Ph1, 20x/0,3 Ph2, 40x/0,5 Ph 2

WF-PL 10x/20 Br. foc.

, 200 239 ,
, () 96-

LD: =0,3 72 =0,4 55

: 5 CMOS, : 8,4, : 800 x 600 ,


USB 2.0, AxioVision LE :
Configuration tool

HAL: 6 , 30 , LED: White light, 3

():
.., (
), , ,
,
, AxioVision LE.

07

100

Primo Vert

Primo Vert

7.2

07

Axio Vert.A1
Axio Vert.A1 - , , , ,
. ,
.

Axio Vert.A1

:
: , , -, , LED- ( ).
IC2S-,
, . , , .
, , (IC2S-).
( ):, LD A-Plan, LD Plan-Neofluar, 2,5-40.
1,25; 1,6; 2; 2,5.
.
, - .
Eppendorf, Narishige, -, .
.

Axio Vert.A1

, , -, , LED- (
)

: , ,
(12 , 35 ), , LED ,
: HBO 50, 3-
( 2 )

0,4 0,55

, (ICS-),
( ): A-Plan, LD A-Plan, LD Plan-Neofluar,
2,5-40, 1,25; 1,6; 2; 2,5

10/20; 10/23; 16/16; 25/10, 23 (W-Pl 10x/23 br foc), : 30

; /
; - 45 30

, , , ;
130 x 85; 130 x 85.

, ,
-,

235 x 560 x 560

Axio Vert.A1

Axio Vert.A1

101

www.helicon.ru

7.2

Axio Observer
Axio Observer

Axio Observer ,
, . :
(1), (D1) (M1).

:

, , , - (), , ,
Carl Zeiss - ( ), , -.
TIRF, LSM P.A.L.M. (Z1).
, (IC2S-), .
( 30 000 ), ,
HBO 103, X-Cite, XBO 75,HXP 120.
(D1, Z1), (Z1).
, , .
5 - .
ACR (D1, Z1).
TFT- .
, , 2, .
ApoTome .
, .
Aqua Stop II.

Axio Observer

, , , Varel-, , -,
,

: (12 , 100 ), ,
LED; (D1, Z1), :
HB103 (100 ), 6-

: =0,35 (, , ); = 0,35 (, , ); =0,55 (, , ); =0,55 (, , , -);


=0,8/1,4; (Z1)

, (IC2S-), 1,25-100, APlan, Achroplan, Plan-Neofluar, LD Plan-Neofluar, Apochromat,


1,25; 1,6; 2,5

10/20; 10/23; 16/16

, /, ACR
(D1, Z1)

, , ,

(D1, Z1), TFT- (Z1)

Aqua Stop II, CO2 pH,


, , TIRF PALM Z1

07

102

Axio Observer

Axio Observer

7.3

07

PALM MicroBeam
Carl Zeiss PALM MicroBeam , , ,
, ,
.

PALM MicroBeam

:
, .
, , .
.
, .
, , , .
, , , , , -, .

.
- 355 .
( ).
,
, , .

. ,
.

, , , , .
( ) . ,
1 064 , .
, ,
.
/
:
() ( , , , , ) ( , , ).
.
, .
, .
().
.
.
.
.
-, , .
.

103

www.helicon.ru


7.3

.
, , .
, .

PALM MicroBeam

Carl Zeiss Axio Observer


, ,

355

, ,

1 064

2 , 10

200 70

200 3

07

104

PALM MicroBeam

Carl Zeiss PALM MicroBeam

8.1

Profinia

08

Profinia

Profinia ,
20 /. , , .
:
20 /, 45 psi.
, 30 .

, Falcon.
. USB flash-
.

Profinia

, /

0,2-20

, psi

45

:
-,

280

, ms/

500

pH

1-14 ()

15 50 Falcon

, .

115 86

490 330 670

28

Profinia

BioRad 6201005

Profinia

BioRad 6200010

pH Profinia

BioRad 6200411

BioRad 6200401

* . .

105

www.helicon.ru

8.1

BioLogic LP

BioLogic LP

Bio-Rad BioLogic
LP
, 40 /. , .
,
,
BioLogic .

:
40 /, 30 psi.
(750 ).
( ) .
50 .
.
.
, .

BioLogic LP

, /

0,04-40

, psi

30

:
-,

254/280

, ms/

500

, .

4-40

240 330 250

19

BioLogic LP (220-240 V)

BioRad 7318301

BioLogic LP Model 2110

BioRad 7318337

BioLogic LP BioFrac

BioRad 7318305

BioFrac

BioRad 7410002

Model 2110

BioRad 7318120

08

* . .

106

8.1

08

BioLogic DuoFlow
BioLogic DuoFlow . BioLogic DuoFlow
80 /
, , 4- QuadTec UV/Vis.

BioLogic DuoFlow

:
80 /, 3 500 psi.
.
.
.
BioFrac.
BioLogic Maximizer 2- .
4- QuadTec UV/Vis.
.
.
.

BioLogic DuoFlow

, /

0,0180

, psi

3 500

:
-,

254/280 , : 214, 365, 405, 436

, ms/

500

pH

1-14

350 410 810

70

Parthfinder Maximizer

QuadTec

Basic

UV
(254/280
)

F10

F40

BioLogic DuoFlow

QuadTec
UV/Vis

BioLogic Maximizer

BioFrac

BioLogic DuoFlow

10 (10 /, 3 500 psi)

7600038

40 (40 /, 1 000 psi)

7604038

10 (10 /, 3 500 psi)

7601138

40 (40 /, 1 000 psi)

7604138

20 (20 /, 3 500 psi)

7602238

80 (80 /, 1 000 psi)

7602248

20 (20 /, 3 500 psi)

7602258

80 (80 /, 1 000 psi)

7602268

107

www.helicon.ru

9.1

SE
C . , ,
.
:
, .
, .
- ,
.
.

SE-1

SE-1

- SE-1 60 . 1 4 . -4 (-).
:
.
.
.

10 .
.
.
(50 ).
:
4 .
, 1,0 , 3, 6, 10, 15.
, 1,5 , 10, 12.
.

SE-2

SE-2

09

SE-2 120 . 1 5 .
-4 (-).
:
.
.
.
18 .
.
.
(100 ).
:
5 .
, 1,0 , 18, 24.
, 1,5 , 18, 24.
.

108

9.1

09

SE-1

SE-2

7,6 x 12,5

11,8 x 17,0

60

120

250

600

265 145 95

345 190 105

S-1

SE-1

S-2

SE-2

Sub Cell

Mini-Sub Cell GT

Sub-Cell
.
:
- .
, .
,
.
,
.
Sub Cell:
.
.
.
.
.

Mini-Sub Cell GT

Wide Mini-Sub Cell GT

Sub Cell GT

Sub-Cell Model 96

Sub Cell Model 192

25 10 25 15

25 15 25 25

7 7 7 10

15 7 15 10

15 10, 15 15
15 20

30

60

120

96

192

270

650

1 000

2 000

3 000

260 120 65

260 200 75

420 200 100

300 290 90

400 290 90

Mini-Sub Cell GT, 7 7

BioRad 1704406

Mini-Sub Cell GT, 7 10

BioRad 1704466

Wide Mini-Sub Cell GT, 15 7

BioRad 1704405

Wide Mini-Sub Cell GT, 15 10

BioRad 1704468

Sub Cell GT System, 15 10

BioRad 1704401

Sub Cell GT System, 15 15

BioRad 1704402

Sub Cell GT System, 15 20

BioRad 1704403

Sub Cell Model 96, 25 10

BioRad 1704502

Sub Cell Model 96, 25 15

BioRad 1704503

Sub Cell Model 192, 25 15

BioRad 1704509

Sub Cell Model 192, 25 25

BioRad 1704511

109

www.helicon.ru

9.2

VE
VE , . , , .

.

VE-10

VE-10
- VE-10
8 9,5 , 30 .

:
30 .

.
1 , , .
,
, .
- VE-10
.

:
.
.
(10 10 ) .
1 .
1 ( 10 15 ).
.

09

:
.
0,75 .
-4 -8.

110

9.2

VE-20

09

VE-20

:
17,8 17,5 40 ( ) 60
30 .
.
Sub Cell:
.
.
.
20
1 .
.
:
.
-8.

VE-10

VE-20

10 10

20 20

8 9,5

17,8 17,5

2 15

2 30

200

1 100

90

420

-4 -8

-8

370

970

VE-10

VE-10

VE-20

VE-20

111

www.helicon.ru

9.2

Mini-PROTEAN Tetra System


Mini-PROTEAN Tetra System

Mini-PROTEAN Tetra System


Mini-PROTEAN.
14 , 60 .

:
4- .
2D-.
.


.
,
.

:
.
.
.
0,75 1,0 10 .

:
0,5, 0,75, 1,0, 1,5 .
5, 9, 10 15 .
.
Mini-Trans-Blot.
.
.

Mini-PROTEAN Tetra System

, .

1-4

, .

4 15

10,1 7,3

10,1 8,2

8,3 7,3

8,6 6,8

,
2

160

320

09

112

550

680

PowerPac Basic PowerPac HV

120 160 180

9.2

09

Mini-PROTEAN Tetra System ( 4 )


0,75 10 .

BioRad 1658000

Mini-PROTEAN Tetra System ( 4 )


1,00 10 .

BioRad 1658001

Mini-PROTEAN Tetra System ( 2 )


0,75 10 .

BioRad 1658002

Mini-PROTEAN Tetra System ( 2 )


1,00 10 .

BioRad 1658003

PROTEAN II xi ell

PROTEAN II xi ell

PROTEAN II xi ell 4-
16 16 16 20 .
:
4 .
.

2D-.
.
.
:
.
.
.
.
15 .
.

Protean II xi Cell 16

Protean II xi Cell 20

20 x 18,3

20 x 22,3

16 16


,
,

,
,

16 20
4 25
350

1 800

1 200
PowerPac Universal PowerPac 3000
260 190 300
11

Protean II xi Cell 16

BioRad 1651803

Protean II xi Cell 20

BioRad 1651813

113

www.helicon.ru

9.3

-4 -8

-4

.
:
.
.
1-2 .
,
.

-4

,
,
,

5 400
5 400

-8

10 800
3 200
80
, , ,

1 16
2
120 60 180
0,85


,
,

-4
-8

PS-400
PS-800

PowerPack

PowerPack Basic

,
, . - .
:
.
.
, .

09

114

PowerPack Basic

,
,
,

,
,

10-300
5-250
20-5 000
10-500
4 400
1 300
1 500
1 250
75
300
400
500
, , ,

9
0-999
99 59
210 245 65
250 285 80
340 x 100 x 75
275 340 100
1,1
2,0
2,85
2,5

PowerPack HC

PowerPac Universal

PowerPack HV

PowerPack Basic
PowerPack H
PowerPack HV
PowerPack Universal

BioRad 1645050
BioRad 1645052
BioRad 1645056
BioRad 1645070

9.4

iBlot

09

iBlot

iBlot , 7
30
. 8 13 .
.

:
(, PVDF ).
.
.
, , .
5,5 6- . ,
(2 ) (7 ), 12 ,
.
:
.
.
.
.
.
.

iBlot . , .
iBlot :
8 8 8 13 .
, Ig .
.
iBlot 30 ( 5 , ).

iBlot

, ,

8 13

8 8, 8 13 E-PAGE

100240 , 5060 , 3,3 A

370 200 110

2,3

115

www.helicon.ru

iBlot ( 2 )
iBlot , 10 ( , 8 13 )
- iBlot , 10 ( , 8 8 )
iBlot PVDF, 10 ( , 8 13 )
- iBlot PVDF, 10 ( , 8 8 )
iBlot , 10 ( , 8 13 )

IB1001EU
IB301001
IB301002
IB401001
IB401002
IB801001

9.4

(8 13 )
- (8 8 )
(8 13 )
Ig
- (8 8 )
Ig

IB711001
IB711002
IB721001
IB721002

IB731001
IB731002
IB741001
IB741002

Trans Blot Turbo

09

TransBlot Turbo

/ Trans
Blot Turbo
. 2D-. 7 8,5 .
,
, . ,
, , .

116

Trans Blot Turbo

13,5 8,5

7 8,5; 13,5 8,5

7 , 3 Mini-PROTEAN TGX (
), 30 ( )

100240 , 50/60 , 175

260 211 204

3,6

Trans-Blot Turbo

BioRad 1704155

, 7 8,5 , PVDF, 10 .

BioRad 1704156

, 8,5 13,5 , PVDF, 10 .

BioRad 1704157

, 7 8,5 , , 10 .

BioRad 1704158

, 8,5 13,5 , , 10 .

BioRad 1704159

9.4

09

Criterion Blotter

Trans-Blot 10 7,5 26,5 28 .


, ,
.
:
. , , , ,
,
.
.
Bio-Rad PowerPac HC Bio-Rad PowerPac Universal.

Mini Trans-Blot

Criterion Blotter

Trans-Blot Cell

Trans-Blot Plus Cell

- ( )

1 ( )
2 ( )
3 ( )

10 7,5

15 9,4

16 20

26,5 28

(:
)

60

30
(
)
60
(

30
(
)
60
(

1560

450

1,3

2,5

12

120 160 180

220 120 150

180 90 240

300 170 390

0,8

1,3

12

Mini Trans-Blot

BioRad 1703930

Mini Trans-Blot, Mini-Protean Tetra

BioRad 1703935

Criterion Blotter

BioRad 1704070

Criterion Blotter

BioRad 1704071

Trans-Blot Cell

BioRad 1703939

Trans-Blot Cell

BioRad 1703910

Trans-Blot Plus

BioRad 1703990

117

www.helicon.ru
BenchPro 4100

9.4

BenchPro 4100
BenchPro 4100 8 , .
:
.
.
.
.


BenchPro 4100

8,5 8,5

18

95

100240 , 5060 , 3 A

470 610 320

13,6

09

118

BenchPro 4100 4 , 12

WP0001

BenchPro 4100, 10 ., . 12 1
.

WP1001

BenchPro 4100, 50 ., . 3 1 .

WP3001

9.4

09

Semi-dry
,
. -. .

Semi-dry

Semi-dry

15 15

50

200 200 40

1,7

Semi-dry

119

www.helicon.ru

-
-

9.5

- ChemiDoc
ChemiDoc

ChemiDoc . CCD
, . , .

:
3- .
4 .
26 35 .
, , .
.
.
.

09

:
, .
.
/ .
.
-.
2-D .
-.
.

120

ChemiDoc

65 535

302 ( 365
254 ) (
, , )

28 36

26 35

-30

600 360 960

32

- ChemiDoc

BioRad 1708280

BioRad 1708283

BioRad 1708284

BioRad 1708285

302

BioRad 1708097

254

BioRad 1708098

365

BioRad 1706887

9.5

-
-

09

- GelDoc EZ
GelDoc EZ , .
, .

GelDoc EZ

:
.
1,4 .
11,2 15 .
, , .
,
.
,
.
.
.

GelDoc EZ

12 , 4096

1,4

11,2 15

430 280 380

7,3

- GelDoc EZ

BioRad 1708270

UV Sample Tray,

BioRad 1708271

White Light Sample Tray,

BioRad 1708272

Blue Sample Tray, GelGreen SYBR

BioRad 1708273

121

www.helicon.ru

-
-

9.5

- Gel Doc XR+


Gel Doc XR+

- Gel Doc XR+


, , , .
:
4 .
.
.
.
.
.
:
.

-.
2-D .
-.
.
.

09

122

Gel Doc XR+

CCD, 12 (4096 )

3-

, 302

EtBR/SYBR Geen BP , 4

28 36

19,4 26

600 360 960

32

- Gel Doc XR+

BioRad 1708195

9.5

-
-

GS-800

09

GS-800

Bio-Rad GS800 , , -, , . , .
:
GS-800 , ,

.
, , - -, , , .
, 3 CCD-, .
.

:
2-D .
.
.
.
-.
.

GS800

800 1600

400-750

, . .

0-3

29 40

36,3

626 473 193.

20,8

GS-800

BioRad 1707983

123

www.helicon.ru

-
-

9.5

- Gel Imager-2
Gel-Imager-2

Gel Imager-2 ,
. .

:
10
.
9 11,5 17 22 .
768 576 .
JPEG-.
, , Sybr Green.
, - . 200 200 .
- . .

09

2 :
Gel-Imager - , , , ,
. , , /.
Gel-nalysis - , , , .

124

Gel Imager-2

17 22

768 576

CCD

0,44


( )

1 .,
EtBR,
,
, Sybr Green

220 220 280

- Gel Imager-2

GI-2

9.6

Vilber Lourmat

09

ECX-26.MX
Vilber Lourmat

Vilber Lourmat
.
Vilber Lourmat :

(25 ).
Ondulex .
-.
.
: .
(70/100%).
.
, ,
.

Super-Bright, , X. WL.

- ,

254
15 15

68

ECX-F15.C

20 20

68

ECX-F20.C

21 26

68

ECX-F26.C

20 20

6 15

ETX-F20.C

21 26

6 15

ETX-F26.C

25 35

6 15

ETX-F36.C

20 20

68

TFP-C/WL

312
21 26

68

ECX-26.MX

15 15

68

ECX-F15.M

20 20

68

ECX-F20.M

21 26

68

ECX-F26.M

21 26

6 15

ETX-F26.MX

20 20

6 15

ETX-F20.M

21 26

6 15

ETX-F26.M

25 35

6 15

ETX-F36.M

20 20

68

TFP-M/WL

365
20 20

68

ECX-F20.L

20 20

6 15

ETX-F20.L

25 35

6 15

ETX-F36.L

20 20

68

TFP-L/WL

254 312
20 20

5 8/6 8

TCP-20.MC

21 26

5 8/6 8

TCP-26.MC

20 20

6 15/6 15

TFX-20.MC

21 26

6 15/6 15

TFX-26.MC

125

www.helicon.ru

9.6

- ,

254 365
20 20

5 8/6 8

TCP-20.LC

21 26

5 8/6 8

TCP-26.LC

20 20

6 15/6 15

TFX-20.LC

21 26

6 15/6 15

TFX-26.LC

312 365
20 20

5 8/6 8

TCP-20.LM

21 26

5 8/6 8

TCP-26.LM

21 26

5 8/6 8

TCP-26.LMX

20 20

6 15/6 15

TFX-20LM

21 26

6 15/6 15

TFX-26.LM

Safe Imager 2.0


Safe Imager 2.0

Safe Imager 2.0


,
- .

, , ( 70 ).
470
SYBR Safe,
SYBR Gold, SYBR Green I II SYPRO
Ruby, SYPRO Orange, Pro-Q Diamond Coomassie Fluor Orange.
Safe Imager 2.0 , , , , ,
.

Safe Imager 2.0

19 19

50 000

440510

SYBR Safe, SYBR Gold, SYBR Green I, SYBR Green II

SYPRO Ruby, SYPRO Orange, Pro-Q Diamond, Coomassie


Fluor Orange

09

126

Safe Imager 2.0 (


)

G6600EU

Safe Imager

S37103

Safe Imager 2.0

G6601

9.7

09

FS-20


. , , ,
. ,
, . , : , , .
:
, .
.
.

.
, .

FS-10

FS-20

,
(
( +))

10 10*

20 20*
8

* +/-4 .

10 10
20 20

FS-10
FS-20

Stand

, (, .) ,
,
.
:
.
,
.
, .
, .

Stand

,
,

180 210
225 250

stand

127

www.helicon.ru


EpMotion

10.1

EpMotion , . ,
.
:
-
.
- , .
- .
.
.
, .
:
, , ,
.
,
.
1- 8- ( : 1-50 ; 20-300 ; 40-1 000 ).
; (
, , , ).

epMotion 5070

epMotion 5070

5070 .
:
/ .
.
.
, , -, : 96- 384- .

10

:
4 + 2 .
, : 650 480 630.
.

128

10.1


EpMotion

epMotion 5070 CB

10

epMotion 5070 CB

5070,
, .
, .

epMotion 5073
5073 6 , ,
.
/ .
.
, , -, .
.
( M5073).
:
6 .
2- .
EasyCon , ,
.
CleanCap () HEPA- - .
M5073 Eppendorf:
.
.
.

epMotion 5075

epMotion 5075

5075 5070 , , , ( ), , , .

129

www.helicon.ru
epMotion 5075 LH


EpMotion

10.1

epMotion 5075 LH
5075 LH .
:
/ .
.
, , -,
: 96- 384- .
.

:
12 .
4- .
.
( ) .
3- (0-110).
: / .

epMotion 5075 TMX

epMotion 5075 TMX

5075 TMX 5075 LH, .


, , -,
, .
:
-15 95.
: 300-2 000 /.
: 3 .
:
, .
20% .
.
.
: 2- .

epMotion 5075 VAC

epMotion 5075 VAC

10

5075 VAC 5075 LH,


, .
.

130

10.1


EpMotion

10

:
11 + .
(35 /, 1-99 ).
: 2- .

epMotion 5075

epMotion 5075

5075 MC 5075 LH, Mastercycler Ep.


.
:
-,
.

Mastercycler p.
.
In vitro

, .
:
9 + .
Mastercycler p 96-/384- .
-.
cycle-lock .
- .
Mastercycler Ep 5075 MC, .
.
.
.
.
, : 250 150 110.
MMC.
: , , EpMotion Editor. ,
MMC .
- :
- .
3D-.
-: , , , EpBlue.
EpMotion Editor ( ) EpBlue ( ):
.
, , .
, .
.

131

www.helicon.ru


EpMotion

10.1

EpMotion 5070

5070/5070 CB

, /

200-240/50-60

80

650 480 630

45

EpMotion 5075

5075 LH

5075 TMX
12

5075 VAC

5075 MC

11

0-110

25 95 8

25 4 5

, /

, /

200-240/50-60

1 000

,
,

1070 610 670


85

90

102

:
.
.
- 1-50 , 20-300 , 40-1 000 .
(30 100 ) .
.
96- 384- .
.
.
(Invitrogen, 5 Prime, Promega, Macherey Nagel,
Invitek, Qiagen ).

EpMotion 5070

Epp 5070 000.000

EpMotion 5070

Epp 5070 000.140

EpMotion 5070 CB

Epp 5070 000.700

EpMotion 5070 CB

Epp 5070 000.719

EpMotion 5075 LH

Epp 5075 000.008

EpMotion 5075 LH

Epp 5075 000.750

EpMotion 5075 TMX

Epp 5075 000.733

EpMotion 5075 TMX

Epp 5075 000.784

EpMotion 5075 VAC

Epp 5075 000.016

EpMotion 5075 VAC

Epp 5075 000.768

EpMotion 5075 MC ( Mastercycler ep)

Epp 5075 000.032

EpMotion 5075 MC ( Mastercycler ep)

Epp 5075 000.776

Mastercycler ep gradient Epp

Epp 5341 000.108

Mastercycler ep 384

Epp 5344 000.109

10

EpMotion
. (Eppendorf - www.epmotion.com) .

132

10.2

10

Experion
Experion
, : , , , ,
30-40 .

Experion

:
,
1-4 .
30-40
.
10 260 , 2,5 /.
5 /.
25 12 000
0,5 /.
.
.
:
.
, .
Experion
, ,
.
.
, . .

. Experion .

Experion

- , 90% Pt, 0,5

, 635

, 685

2 200

USB 2.0

150 x 310 x 290

4,58
Experion

, psi

50125

30150

LCD

95 x 260 x 75

1,36
Experion

60

4,5

148 x 63 x 205

2,9

133

www.helicon.ru

10.2

Experion
,
. , ,
, .

Pro260 Chip

RNA HighSens
Chip

RNA StdSens
Chip

110

112

111

52,000 /

10260 kD

2,5 /

DNA 1K Assay

DNA 12K Assay

111
1

25-500 /

200-5 000 /

1006 000 .
5 /

0,550 /
151 500
.

100 /

5017 000
.

0,1 /

Experion . : ,
, ,

BioRad 7017000

Experion . : ,
,

BioRad 7007000*

Experion Pro260 Analysis Kit 10

BioRad 7007101

Experion Pro260 Analysis Kit 25

BioRad 7007102

Experion RNA StdSens Analysis Kit 10

BioRad 7007103

Experion RNA StdSens Analysis Kit 25

BioRad 7007104

Experion RNA HighSens Analysis Kit 10

BioRad 7007105

Experion RNA HighSens Analysis Kit 25

BioRad 7007106

Experion DNA 1K Analysis Kit 10

BioRad 7007107

Experion DNA 12K Analysis Kit 10

BioRad 7007108

10

*- Experion , /.

134

10.3

BenchPro 2100

10

BenchPro 2100

Maxiprep- BenchPro 2100



. ,
. 90-
, .

, , , in vitro, , .
:
750 (transfection-grade) 125 .
2- .
.
5 .
.
BenchPro 2100 80100 psi (550690 ) 3 cfm (1,4 /).

~1

~750

<10 EU/

A260/280

>1,8

BenchPro 2100

12

~90

100125

, kb

2,720

330 530 300

9,1

Maxiprep- BenchPro 2100 ( 2 , 2


)

MC1001

BenchPro 2100, 4

MC2001

BenchPro 2100 MaxiCard

MC3001

BenchPro 2100 MaxiCard

MC4001

135

www.helicon.ru


,
ChIP,

10.4
MAGic

MAGic

MAGic .


.
:
(IP).
(ChIP).
(his-tag).

.

:
: , .
.
.
:
.
MAGic Dynabeads DYNAL . A/G Co-NTA.
MAGic 495C. 4C, .
.
:
: , , .
: 104 50 (ChIP) 1 (IP his-tag).
12 1 .
.
,
. . , ,
, , .
. 10 .
:
IP () .
ChIP ; , , .
his-tag 60 80 () .

MAGic


, C
,

,
,

Dynabeads
112
495
501 000
100240 ; 5060
520 400 400
50

10

MAGic
MAGic A ( IP)
MAGic G ( IP)
MAGic ChIP ( ChIP)
MAGic his-tag (
his-tag)

136

10020D
10040D
10042D
10050D
10030D

11.1

11

Tuttnauer
-2540

, .
.

Tuttnauer

:

.
,
.
.
.
.
100C 134C
100C 137C .
.

-2340

, C

-2540
100134

19

230 470

, , .

-2540

-3850

-3850

-3870

100-137

100-134

100-137

100-134

23

64

254 x 475

384 x 580

85

4
/

./

./

2 200

510 x 540 x 370

33

384 x 760
2

2 400

510 x 545 x 365


37

660 x 695 x 525


63

74

2 700
875 x 665 x 525
67

19 -2340

-2340

23 -2540

-2540

23 -2540

-2540

64 -3850

-3850

64 -3850

-3850

85 -3870

-3870

Tuttnauer
:
23 160 .
(ELV) (MLV) .
316Ti.
IEC/UL/EN61010-1, IEC 61010-2-040, EN 61326.
.
.
4-
.
.
.

137

11.1

www.helicon.ru

,
C

,
,
,

2540 ELV/
MLV

3150 ELV

3170 ELV

3850 ELV/
MLV

3870 ELV/
MLV

5050 ELV/
MLV

5075 ELV/MLV

100-134
23

40

55

62

85

110

160

250 x 400

310 x 500

310 x 700

380 x 490

380 x 690

500 x 500

500 x 750

495 x 645 x
335
57

580 x 780 x
415

580 x 780 x
415

650 x 925 x
500

880 x 780 x
700

650 x 745 x
500
115

880 x 1010 x
700
250

23 2540 ELV/MLV
40 3150 ELV
55 3170 ELV
62 3850 ELV/MLV
85 3870 ELV/MLV
110 5050 ELV/MLV
160 5075 ELV/MLV

2540 ELV/MLV
3150 ELV
3170 ELV
3850 ELV/MLV
3870 ELV/MLV
5050 ELV/MLV
5075 ELV/MLV

Sanyo
:
.
, .
.
(IEC 610102041)
, 65C .
.

.
.
.
.
.

MLS-3781

.
SUS304.
0,240 MPa.

11

138

MLS-2420U

MLS-3020U

, C
,
,

105-125
20
220 450

105-126
48
300 670

,
,
,

1 500
380 x 490 x 840
47

MLS-3751

MLS-3781

115-135
50
75
370 x 415
370 x 630


3
: :

1-, 1
2-, 1
2 000
4 000
478 x 632 x 965
478 x 632 x 748
478 x 632 x 965
61
69
74

20 MLS-2420U
48 MLS-3020U
50 MLS-3751
75 MLS-3781

MLS-2420U
MLS-3020U
MLS-3751
MLS-3781

11.2

11

Eppendorf
Research Plus

Research Plus

Eppendorf Research Plus - ,


.

,
. , , , . ,
, - .
:
.
.
.
-, .
- 80 , .
.
4- .

Research Plus

Epp 3120 000.011

0,1-2,5

Epp 3120 000.020

0,5-10

Epp 3120 000.038

2,0-20

Epp 3120 000.046

10-100

Epp 3120 000.054

20-200

Epp 3120 000.100

30-300

Epp 3120 000.062

100-1 000

Epp 3120 000.070

500-5 000

Epp 3120 000.089

1000-10 000

,
0,1
2,5
0,5
10
2
20
10
100
20
200
30
300
100
1 000
500
5 000
1 000
10 000


, %
12,0
0,7
5,0
0,4
1,5
0,3
1,0
0,2
0,7
0,2
0,7
0,2
0,6
0,2
0,6
0,15
0,6
0,15

(
)
-

Research Plus

Epp 3122 000.019

0,5-10

Epp 3122 000.035

10-100

Epp 3122 000.051

30-300

, %

0,5

8,0

10

1,0

10

2,0

100

0,3

30

1,0

300

0,3

(
)

Research Plus .

139

11.2

www.helicon.ru

Reference

Reference

Eppendorf Reference , ,
. , .
- .
:
.


- .
.
.

11

Reference

Epp 4910 000.085

0,1-2,5

Epp 4910 000.018

0,5-10

Epp 4910 000.034

2,0-20

Epp 4910 000.042

10-100

Epp 4910 000.093

50-200

Epp 4910 000.069

100-1 000

Epp 4910 000.077

500-2 500

, %

0,25

6,0

2,5

0,7

1,8

10

0,4

1,5

20

0,3

10

0,7

100

0,15

50

0,3

200

0,2

100

0,3

1 000

0,2

500

0,3

2 500

0,2

(
)
-

Reference .

140

11.2

11

Thermo Fisher Scientific



- - .
, . .
:
.
.
.
: .
.
.
GLP.
-, .
, .

, %

4650022
4650032
4650042
4650052
4650062
4650072
4650082

10
25
50
100
250
500
1 000

2,5
2,0
2,0
1,5
1,5
1,5
1,0

(
)

4640012

110

4640032

220

4640042

10100

4640052

20200

4640062

1001000

4640072

1 000-10 000

, %

1
10
2
20
10
100
20
200
100
1 000

3,5
1,0
3,0
1,0
3,0
0,8
3,0
0,6
1,5
0,5
0,5
2,0

1 000

(
)

4660012

5-50

4660022

30-300

, %

5
50
30
300

5,0
2,0
2,0
1,5

(
)

141

11.2

www.helicon.ru

- , ,
-, -
. ,
.
:
.









.
.
.
:
.
.
- .
.
.
-, .
, .

, %

4652022
4652132
4652042
4652052
4652142
4652072
4652082

10
20
50
100
200
500
1 000

0,9
0,7
0,6
0,4
0,4
0,3
10,3

(
)

, %

4642022

0,55

0,5
5

4642082

220

4642132

5-50

4642072

10100

4642092

1001 000

4642105

500-5 000

4642112

1 000-10 000

6,0
1,5
3,0
1,0
3,0
0,6
2,5
0,8
1,0
0,6
1,0
0,5
1,0
0,5

2
20
5
50
10
100
100
1 000
500
5 000
1 000
10 000

(
)

11

142

4662022

550

4662031

30300

, %

5
50
30
300

5,0
2,0
2,0
1,5

(
)

11.2

11

Eppendorf
Xplorer

Xplorer

Eppendorf Xplorer
.
, .
- ,
.
. 0,5-10 000 ,
50-1 200 .
.
:
.
.
: , , .
: 0,5-10 000 ( ) 0,5-1 200 (8- ).
.
.
.
.
:
.
( 99 ).
BLOW ( ).
( ).
.
8 .
3 .
.
.
( ).

Xplorer

Epp 4861 000.015

0,5-10

Epp 4861 000.023

5-100

Epp 4861 000.031

15-300

Epp 4861 000.040

50-1 000

Epp 4861 000.058

250-5 000

Epp 4861 000.066

500-10 000

, %

1
10
10
100
30
300
100
1 000
500
5 000
500
5 000

1,8
0,4
1,0
0,2
0,7
0,2
0,6
0,2
0,6
0,15
0,6
0,15

(
)
-

Xplorer

Epp 4861 000.104

0,5-10

Epp 4861 000.120

5-100

Epp 4861 000.147

15-300

Epp 4861 000.163

50-1 200

, %

1
10
10
100
30
300
120
1 200

3,0
0,8
2,0
0,25
1,0
0,25
0,9
0,3

()

143

11.2

www.helicon.ru

Thermo Fisher Scientific


- , ,
. , ,
,
.
. , .
:
.
.
120 - .
: ( ) .
9 .
.
.
:
, .
( ).
( ).
.
.
( ).
(
).
.
( ).

46200002

1-10

46200202

5-50

46200402

5100

46200502

30-300

46200602

100-1 000

46200702

500-5 000

46200802

1 00010 000

,
1
10
5
100
5
100
30
300
100
1 000
500
5 000
1 000
10 000

, %
3,5
1,0
3,0
0,8
3,0
0,8
3,0
0,6
3,0
0,6
3,0
0,6
3,0
0,6

()

11

144

46300002

1-10

46300202

5-50

46300402

30300

46300102

12

110

46300302

12

550

46300502

12

30300

46300702

16

5-50

9420362

,
1
10
5
50
30
300
1
10
5
50
30
300
5
50

, %
12,0
2,4
5,0
1,5
3,0
1,0
12,0
2,4
5,0
1,5
3,0
1,0
5,0
1,5

()

11.2

11



.
.

Easypet

Easypet

:
0,1-100 .
, .
( ) .
( )
(/ ).
: 5 /.
- 7 ,
12 .
.
:
.
PTFE 0,45 ().
NiCd .
0,2 .

S1

S1

:
1-100 .
.
8 .

.
.
(2 /).
: 8 .
NiMH.
170 .
:
.
.
PTFE .
.

Easypet

Ep Easypet

S1

45809501

145

www.helicon.ru

11.2

-
, , , .
.

Multipette plus

Multipette plus
Multipette
. ,
Multipette
.

11

:
, .
100
.
.
1 10 000 .
9 0,1 50 .
20 .
: 1 , 3 , 17 .
(, )
(, ).
.
- .
- .

Multipette Stream Multipette Xstream


Multipette Stream

146

Multipette Stream Multipette Xstream ,


. Multipette
Xstream (, ),
.
:
, , .
:
.
1 10 000 .
9
0,1 50 .
20 .

.
.
.
( , ).
( , ).

11.2

11

Multipette Stream

Multipette Xstream

( )

Multipette plus

Epp 4981 000.019

Multipette Stream c

Epp 4986 000.017

Multipette stream c

Epp 4986 000.025

- Combitips Advanced Eppendorf


Combitips - .

Combitips Advanced

:
20 Combitip.
.
3 .
.
, 25 50 .
Combitip .
, .
.
.
100 .


, .

, .

, .

Eppendorf Quality

PCR Clean

Biopure

0,1

20

Epp 0030 089.405

Epp 0030 089.766

Epp 0030 089.618

0,2

40

Epp 0030 089.413

Epp 0030 089.774

Epp 0030 089.626

0,5

100

Epp 0030 089.421

Epp 0030 089.782

Epp 0030 089.634

1,0

10

200

Epp 0030 089.430

Epp 0030 089.790

Epp 0030 089.642

2,5

25

500

Epp 0030 089. 448 Epp 0030 069.242

Epp 0030 069.242

5,0

50

1 000

Epp 0030 089. 456

Epp 0030 069.269

Epp 0030 069.269

10

100

2 000

Epp 0030 089.464

Epp 0030 089.820

Epp 0030 089.677

25

250

5 000

Epp 0030 089. 472

Epp 0030 089.839

Epp 0030 089.685

50

500

10 000

Epp 0030 089.480

Epp 0030 089.847

Epp 0030 089.693

25, 1
./.

Epp 0030 089.715

50, 1
./.

Epp 0030 089.723

25, 7
./.

Epp 0030 089.731

50, 7
./.

Epp 0030 089.740

Epp 0030 089.758

*8 0,1 10 .

147

11.2

www.helicon.ru

-
. ,
. .

:
44 .
10 5 000 .
7 0,5 50 .
5 .
.
.

0,5

10

50

9404170

1,25

25

125

9404180

2,5

50

250

9404190

100

500

9404200

12,5

250

1 250

9404210

25

500

2 500

9404220

50

1 000

5 000

9404230

11

148

4540002

25 50 , 10 ./.

9420300

25 50 , 5 ./.

9420310

11.2

11

-
- Variespencer

Variespencer

- ,

. , ,
.
:
.
, ,
.
. .
.
32 45 .
:
.
.
.

, %

0,52,5

0,05

32

28, 40, 45

0,6

1-5

0,10

32

28, 40, 45

0,5

2-10

0,20

32

28, 40, 45

0,5

5-25

0,50

45

32, 38, 40

0,5

10-50

1,00

45

32, 38, 40

0,5

20-100

2,00

45

32, 38, 40

0,5

- Varispencer 1

Epp 4960 000.119

- Varispencer 2

Epp 4960 000.027

- Varispencer 3

Epp 4960 000.035

- Varispencer 4

Epp 4960 000.043

- Varispencer 5

Epp 4960 000.051

- Varispencer 6

Epp 4960 000.060

149

www.helicon.ru
-1

11.3

-1
.
:
.
.
( ).
, -.
, .

-1

, /
, /
-
,

, ,
,
,

6
20
16,4 (0,17 /2)
2000
220 , 50
60
500 250 360
11

OM-1

OM-1

- -
FTA-1

( ) (),

.
:
- .
.
- .
0,027
99,9%.

FTA-1

,
,
/
,
,

-500
1
12 , 300 A/3,6
160 x 210 x 340
1,5

11

150

FTA-1

BS FTA-1

11.4

11


Scout Pro (SPS)
. , , .

SPS402F
Ohaus

:
, .
.
.
.
. .
.
.
USB RS232.
200 400 .
:
.
.
.

(),

SPS202F

200

0,01

120

II ()

SPS402F

400

0,01

120

II ()

SPS401F

400

0,1

120

**

SPS601F

600

0,1

165 140

II ()

SPS2001F

2 000

0,1

165 140

**

SPS4001F

4 000

0,1

165 140

**

SPS6000F

6 000

165 140

II ()

* .
** , .

151

11.4

www.helicon.ru

Talent ()

TE 214 S

Talent
.

:
ISO/GMP.
.

.
Talent
. ,
2- .

:
.
.
.
.
.

11

(),

TE 64

60

0,1

90

I ()

TE 124 S

120

0,1

90

I ()

TE 214 S

210

0,1

90

I ()

TE 153 S

150

100

II ()

TE 313 S

310

100

II ()

TE 612

610

10

116

II ()

TE 1502 S

1 500

10

174 x 143

II ()

TE 3102 S

3 100

10

174 x 143

II ()

TE 6101

6 100

100

174

II ()

* .

152

11.4

11


Pioneer (PA)
Pioneer (PA)
,
. ,
.

PA413/PA413C
Ohaus

:
.
.
.
.
RS232.
, ( ).
:
.
.
.

(),

PA213/PA213C

210

0,001

120

II ()

PA413/PA413C

410

0,001

120

II ()

PA512/PA512C

510

0,01

180

II ()

PA2102/PA2102C

2 100

0,01

180

II ()

PA4102/PA4102C

4 100

0,01

180

II ()

PA4101/PA4101C

4 100

0,1

180

III ()

* .
.

153

11.4

www.helicon.ru

Adventurer (AV)
Adventurer - . , .
:
.
.
.
.
SmarText.
.
RS232.
.
.
.
:
.
/.
.
.
.
GLP/GMP.
.

(),

AV213/AV213C

210

0,001

120

II ()

AV413/AV413C

410

0,001

120

II ()

AV412/AV412C

410

0,01

149 162/168 180

II ()

AV812/AV812C

810

0,01

149 162/168 180

II ()

AV2102/AV2102C

2 100

0,01

168 x 180

II ()

AV4102/AV4102C

4 100

0,01

168 x 180

II ()

AV4101/AV4101C

4 100

0,1

149 162/168 180

II ()

AV8101/AV8101C

8 100

0,1

149 162/168 180

II ()

11

* .
.

154

11.4

11

Explorer Pro (EP)


Explorer Pro (EP) , , . .

EP413/EP413C
Ohaus

:
.
.
.
.
.
RS232.
; ; .
:
.
/.
.
.
.
GLP.
.
.

(),

EP413/EP413C

210

0,001

120

II ()

EP613/EP613C

410

0,001

120

II ()

EP4102/EP4102C

4 100

0,01

172 172

II ()

EP6102/EP6102C

6 100

0,01

172 172

II ()

* .
.

Ohaus
:

Pioneer

Adventurer Pro

Explorer

Discovery

155

11.4

www.helicon.ru


Pioneer (PA)
PA114/PA114C

Pioneer (PA) , .

.

Ohaus

:
.
.
.
.


InCal
RS232.
.

:
.
19 .
.

(),

PA64/PA64C

65

0,1

90

I ()

PA114/PA114C

110

0,1

90

I ()

PA214/PA214C

210

0,1

90

I ()

* .
.

Adventurer Pro (AV)


AV114/ AV114C
Ohaus

, . , , .

11

:

.
SmarText.
.
RS232.
.
.

156

.
, .

11.4

11

:
.
.
.
.
.
, .
GLP.

(),

AV114/AV114C

110

0,1

90

I ()

AV264/AV264C

260

0,1

90

I ()

* .
.

Explorer Pro
Explorer Pro . :
.

EP214/EP214
Ohaus

:
.
.
.
, .
RS232.
, .
, .
, .
.
:
.
/.
.

.
GLP/GMP.
.
.
.

(),

EP114/EP114

110

0,1

90

I ()

EP214/EP214

210

0,1

90

I ()

* .
.

157

11.4

www.helicon.ru

Discovery (DV)
DV314C

Discovery (DV) ,

Analytical Plus (AP). DV
.

Ohaus

:
, .
(24 ).
RS232.

.
10 40.



.
.
.
: .

:
/.
.
.
.
.
.
.
GLP/GMP.
.
.
.

(),

DV114C

110

0,1

90

I ()

DV214C

210

0,1

90

I ()

DV314C

310

0,1

90

I ()

DV215CD

81/210

0,01/0,1

90

I ()

11

* .
.

158

11.4

11

Extend (ED)
Sartorius Extend
. ISO, GLP.
:
Extend , .
, , .

.
( : 15 ).
, .
RS232.
.
ISO/GLP.
.
.
.
:
19 .
.
.
.
.
.
.
/ ( ).
.
.
( , ).
( ).
.
:
, , , 999 .

(),

ED 124 S

120

0,1

90

I ()

ED 224 S

220

0,1

90

I ()

ED 153

150

115

II ()

ED 323 S

320

115

II ()

ED 423 S

420

115

II ()

ED 623 S

620

115

II ()

ED 822

820

10

150

II ()

ED 2202 S

2 200

10

180 180

II ()

ED 3202 S

3 200

10

180 180

II ()

ED 4202 S

4 200

10

180 180

II ()

ED 6202 S

6 200

10

180 180

II ()

ED 8201

8 200

100

180 180

II ()

* .
24104-2001 I , II .

159

11.4

www.helicon.ru

Competence (A)
20 : 34 .

A 64

:
0,01 0,1

.
(CPA225D
).
.
isoCAL.
RS232 ,
.
ISO GLP.

:
.
.
.
.

11

(),

A 225 D

80/220

0,01/0,1

80

I ()

A 64

64

0,1

80

I ()

A 124 S

120

0,1

80

I ()

A 224 S

220

0,1

80

I ()

A 324 S

320

0,1

80

I ()

A 323 S

320

110

II ()

A 423 S

420

110

II ()

* .
24104-2001 I , II .

160

11.5

BWT-U

11

BWT-U

BWT-U
8 . .
:
+5
+100.

.
.
.
:
D-1.
LP-1 ( ).

WB-4MS

WB-4MS

WB-4MS
. 4 .
:
+5
+100.
: 3001 000 /.
.

BWT-U

,
D-1

4
5C . t...+100C

0C...+100C

WB-4 MS

0,1

220-240 ; 50-60

1 000

600

280 390 270

340 170 200

( ),

4,9

BWT-U

BS BWT-U

WB-4 MS

BS Bio WB-4MS

D-1

( )

LP-1

161

www.helicon.ru

11.5

TW-2

TW-2

TW-2 4,5
. ,
,
.
:
+80C.
.
.


.
.
, .

TW-2-02

TW-2-02

TW-2-02 , 8,5 , , .
.
:
+100.C
.

11

.
.

162

11.5

TW-2-03

11

TW-2-03

TW-2-03 8,5 , . .
Elmi MS-01
.
:
+90.
.
.
.
Elmi MS-01.
:
MS-01.

TW-2

4,5

+3 +80

TW-2-02

TW-2-03
8,5

+3 +100

0,1

+3 +90

220 ; 50

1 500

480 180 240

( ),

1,4

320 265 260


2,8

TW-2

Elmi TW-2

TW-2-02

Elmi TW-2-02

TW-2-03

Elmi TW-2-03

163

www.helicon.ru

11.6


V-1 plus

V-1 plus

V-1 plus
1,5 50 .
:
1,550 .
:
;
( ).
: 2503 000 /.

4 .
30 .

- V-32

V-32

- V-32 . 32- : 16 1,5 +8 0,5


+8 0,2
15 .

:
: 0,215 .
- 500-3 000 /.
- 3 .
- 2 .
:
10 12 .
15 16 .
50 30 .

V-1 plus

V-32

, /

250-3 000

500-3 000

1,5-50 ()

0,2-15

12 ; 500

90 150 80

120 x 180 x 100

1,1

1,5

11

164

V-1 plus

V-1 plus

- V-32

V-32

11.6

V-3

11

V-3

V-3
0,5 50 . 3 .
:
0,550 .
1003 000 /.
: 30 .
, , .
:
12 1,5 2 .

V-3

, /
,

,
,

100-3 000
0,5-50
12 ; 500
130 60
0,6

V-3
12 1,5 2

V-3
Elmi V-3

Reax-top

Reax-top
Heidolph

Heidolph
50 .
:
, 2 500
/, 1 .

20 .
() 50 .
5 .
:
Reax-top, 1 50 (Heidolph).
Reax-top, 10 Eppendorf, d=10 (Heidolph).

Reax-top

, /
,
,
,
,

2 500
50
42
134 x 105 x 172
3,3

Reax-top
Reax-top, 1 50
Reax-top, 10 Eppendorf, d=10

Heidolph 541-10000-00
Heidolph 549-19000-00
Heidolph 549-01000-00

165

11.6

www.helicon.ru

-
FV-2400

FV-2400

FV-2400 ( ),
.
:

.
2 800 /.
(rcf) 700xg.
- .
- 0,2/0,5/1,5 .

FVL-2400N

FVL-2400N

FVL-2400N ,
,
. .

:
.
,
.
2 800 /.
(rcf) 700xg.
- .
- 0,2/0,5/1,5 .

MSC-3000

MSC-3000 MSC-6000
- MSC-3000 MSC-6000
- , -- , (, , ). 12
, .

11

:
1 000-3 500 /
1 000-6 000 .





166

-- .
1 99 .
(, , ).
: 0-20 .
1 999 .
- 0,2/0,5/1,5 .

11.6


-- - ,
,
12- .
:
- ;
- ;
- .

11

MSC-6000

FV-2400

, /

FVL-2400N
2 800 ()

, g

700

MSC-3000

MS-6000

1 0003 500

1 0006 000

800

2 350

60

99

220-240 ; 5060

/ ; 12 ; 830

120 x 170 x 120

170 220 120

1,7

2,1

190 x 235 x 125


2,5

FV-2400, FVL-2400N MSC-3000


( )
R-1,5

12 1,5

R-0,5/0,2

12 0,5 +12 0,2

R-2/0,5

8 2,0 +8 0,5

R-2/0,5/0,2

6 2,0 6 0,5 +6 0 ,2

SRC-16

2 8 0,2

- FV-2400

BS FV-2400

- FVL-2400N

BS FVL-2400N

- MSC-3000

BS MSC-3000

- MSC-6000

BS MSC-6000

167

11.6

www.helicon.ru

CM-70M-07 CM-70M-09

CM-70M-07

- CM-70M-07 CM-70M-09 ,
12/24
.
:
6 .
,
.








- 0,2/0,5/1,5-2 .
7 000/9 000 /.
.
, .
2 .
.
.
.
, .

11

CM-70M-07

CM-70M-09

, /

2 000-7 000

4 000-9 000

, g

3 200

5 200

0,1-30

/ ; 220-230/24

190 170 115

1,3

168

- CM-70M-07

Elmi CM-70M-07

- CM-70M-09

Elmi CM-70M-09

11.7

-C

11

-1,5--


, , ,
.
-C
.
:
.
- .
, - .
- , .
.
, , 250 .
, .
.
, .
510.150 .
:
Polystone.
.
.

-1,0--

-1,5--

1020 600 1920

1470 685 1785

1015 535 675

1405 620 670

, , 3/,

400

450

65

75

30

39

84

122

-1,0--

LS -1

-1,0-- -

LS -1+

-1,5--

LS -1,5

-1,5-- -

LS -1,5+

169

11.7

www.helicon.ru

ChemFAST Elite

ChemFAST Elite

ChemFast Elite
/, . . 8
:
, , , , , ,
.
HEPA-
, .
:
, .
. - .
, , , .
, .
.
.
.

:
.
.
.
.
.

ChemFast Elite 06

ChemFast Elite 09

ChemFast Elite 12

ChemFast Elite 15

595 x 660 x 1120

750 x 885 x 1118

1185 x 600 660

1500 x 660 x 1120

553 x 600 x 660

823 x 600 x 660

1123 x 600 x 660

1438 x 600 x 660

,
,

88

122

207

210

2 x 15

2 x 18

2 x 30

2 x 36

70

85

100

115

11

170

ChemFAST Elite 06 60

ChemFast Elite 06

ChemFAST Elite 09 90

ChemFast Elite 09

ChemFAST Elite 12 120

ChemFast Elite 12

ChemFAST Elite 15 150

ChemFast Elite 15

11.8


()

11


-
, ,
.

---1,2

:
.
-.

.
.

.
2 ..
-.
( -01--, ).
:
.
.
- 2 .
-.
( -01--).

-01--1,2

-01--1,5

-01--1,8

1105 620 670

1405 620 670

1705 620 670

HEPA

H14

, /

0,45

55

210

510

360

1170 685 1140

1470 685 1835

1770 685 1775

145

160

175

171

11.8


()

www.helicon.ru

- Vis--vis
-01--Vis--vis 1,2

Vis--vis
, .
:
.
( G4, 14).
.
4 .
.
() .

-01--Vis--vis-1,2

-01--Vis--vis-1,5

-01--Vis--vis-1,8

1100 560 670

1400 560 670

1700 560 670

HEPA

H14


, /

0,45

,
210

510

360

1170 685 1115

1470 685 1115

1770 685 1115

145

160

175

-0,1---1,2-
-0I---1,2

11

55

172

1,2-
(). , ,
, .

:
.
( - ,
).
,
.
.
.
- 52 .
( ).

11.8


()

11

-01---1,2-

1105 620 670

HEPA

H14

350 x 650

+45

0,2

, /

0,4

55

405

1170 685 1115

145

-01---1,2

LS -01-1,2

-01---1,5

LS -01-1,5

-01---1,8

LS -01-1,8

-01---Vis--vis-1,2

LS -01 vis--vis

-01---Vis--vis-1,5

LS -01 vis--vis

-01---Vis--vis-1,8

LS -01 vis--vis

-01---1,2

LS 1,2-

173

11.8


()

www.helicon.ru


FlowFAST H
FlowFAST H

()
FlowFAST H , .

:
- AISI304 .
.
.
ECS
.
.
, CO2 .
-, 1 , ( ),
.

FlowFAST H 09

FlowFAST H 12

FlowFAST H 15

FlowFAST H 18

884 734 x 600

1190 734 x 600

1494 734 x 600

1800 734 x 600

884

1 190

1 494

1 800

HEPA

H14

11

<60

230 ; 50

700

900

1 400

1 400

945 1195 x 925

1250 1195 x
925

1555 1195 x
925

1860 1195 x
925

104

122

171

194

174

FlowFAST H 09 90

FlowFAST H 09

FlowFAST H 12 120

FlowFAST H 12

FlowFAST H 15 150

FlowFAST H 15

FlowFAST H 18 180

FlowFAST H 18

11.8


()

11

FlowFAST V
() FlowFAST V , .

FlowFAST V

:
- AISI-304 .
.
.
ECS
.
.
, CO2 .
-, 1 , ( ), .

FlowFAST V 12

FlowFAST V 15

FlowFAST V 18

1190 625 x 710

1495 625 x 710

1800 625 x 710

1 190

1 495

1 800

HEPA

H14

<60

230 ; 50

900

1 400

1 400

1250 1195 x 925

1555 1195 x 925

1860 1195 x 925

192

274

325

FlowFAST V 12 120

FlowFAST V 12

FlowFAST V 15 150

FlowFAST V 15

FlowFAST V 18 180

FlowFAST V 18

175

www.helicon.ru

11.9

I
-

--

---1,2

I . ,
.

:
.
.
.
- .

.
.
.
---1,5 .

:
.
.
- 2 .
( ---1,2).

---1,2

1105 620 670

HEPA

---1,5
1405 620 670
H14

, /

0,7

<55

1 000

210

510

1170 685 1185

1470 685 1865

125

155

11

176

I ---1,2

LS -01-1,2

I ---1,5

LS -01-1,5

11.9

11

II
--

II , , .
HEPA 2 :
( , III-IV 1.3.2322-08,
1.3.2518-09, ) ( III-IV 1.3.2322-08, 1.3.2518-09 II
1.3.1285-03,
).

II
-01--

-01--

:
.

.
DRIVE-N-ROLL - .
.
5- , .
.
.
.
2 .
.
.
2 (4 . -01--1,8).
.
:
.
.
2 .

177

www.helicon.ru

11.9

-01--1,2

-01--1,5

-01--1,8

1105 x 610 x 670

1405 x 610 x 670

1705 x 610 x 670

HEPA

14


, /c

0,35

55-57

1 000

210

510

400

1170 755 1935

1470 755 1995

1770 755 1935

207

251

293

II -01---1,2

LS -01-1,2

II -01---1,5

LS -01-1,5

II -01---1,8

LS -01-1,8

SafeFAST Elite II

SafeFAST Elite

11

178

EN12469:2000, ISO 3
ISO EN 14644-1.

:
- AISI 316L,
.
Du Pont ALESTA AM ( Ag
+ ).
.
-
.
(D
Double Fan).
7 .
.
.
ECS
.
.
- .
bio-dynamic sealing .
.
.
.

11.9

11

:
.
( ).
.
/.
RS232, RS485 RJ45.
D ( ).
.
( 800-1100 ).

SafeFAST Elite 209

SafeFAST Elite 212

SafeFAST Elite 215

SafeFAST Elite 218

887 700 600

1192 x 740x 580

1497 740 580

1802 740 580

HEPA

H14


, /c

0,45

<53

<54

<55

<56

1 100

1 200

, ( 1
)

260

289

470

580

1045 1500 860

1350 x 1500 x 860

1655 1500 860

1960 1500 860

170

195

225

260

1 300

II SafeFAST Elite 209 90 ,


1

SafeFAST Elite 209S

II SafeFAST Elite 212 120 ,


1

SafeFAST Elite 212S

II SafeFAST Elite 215 150 ,


1

SafeFAST Elite 215S

II SafeFAST Elite 218 180 ,


1

SafeFAST Elite 218S

II SafeFAST Elite 209 90 ,


2

SafeFAST Elite 209D

II SafeFAST Elite 212 120 ,


2

SafeFAST Elite 212D

II SafeFAST Elite 215 150 ,


2

SafeFAST Elite 215D

179

www.helicon.ru

11.9

SafeFAST Premium

SafeFAST Premium

, , .
. .
:
.
.










.
.
.
- AISI 316L,
.
Du Pont ALESTA AM ( Ag + ).
.
-
.
.
.
.
ECS
.
.
- .
bio-dynamic sealing .

SafeFAST Premium 212

SafeFAST Premium 215

SafeFAST Premium 218

1192 x 740x 580

1497 x 740x 580

1802 x 740x 580

HEPA

H14


, /c

0,45

42,5

47

49

1200

1300

1300

85

124

165

1350 x 1500 x 860

1655 x 1500 x 860

1960 x 1500 x 860

195

225

260

11

180

II SafeFAST Premium 212, 2

SafeFAST Premium
212

II SafeFAST Premium 215, 2

SafeFAST Premium
215

II SafeFAST Premium 218, 2

SafeFAST Premium
218

11.9

SafeFAST Light

11

SafeFAST Light

II ,
EN-12469:2000, ISO 3 ISO EN 14644-1.
:
.
- AISI 316L, .
Du Pont ALESTA AM ( Ag + ).
.
- .
.
.
.
ECS
.
.
- .
bio-dynamic sealing .
.
.
.
:
.
/.
.

SafeFAST Light

735 x 380 x 600

HEPA

H14

, /c

0,35

53,5

800

175

830 x 650 x 980

90

II SafeFAST Light

Faster SafeFAST Light

181

www.helicon.ru

11.9

II
-01--

II
. .
:
.
.

.
,
.
.
DRIVE-N-ROLL -
.
2 .
.
! .
1 015 3/.
1 000 3/.

-01---1,2 (230.120)

1105 x 610 x 670

HEPA

14

, /c

0,4

55-57

1 000

350

1170 740 2010

265

11

182

II -01-1,2 2

B2 -1,2 [230.120]

11.9

11

CytoFAST Elite
II ,
EN 12469:2000 DIN 12980:2005, ISO 3
ISO EN 14644-1.
:
H14, CytoFAST Elite
.
.
-
AISI 316L, .
Du Pont ALESTA AM ( Ag + ).
.
.
.
.
ECS
.
.
- .
bio-dynamic sealing .
, .
.
.
.
:
.
/.
RS232, RS485 RJ45.
-.
.

CytoFAST Elite 209

CytoFAST Elite 212

CytoFAST Elite 218

885 660 580

1190 660 580

1800 660 580

HEPA

H14


, /c

0,45

53

54

56

1 100

1 200

1 300

317

414

620

1090 2245 785

1395 2245 785

2005 2245 785

215

245

325

II CytoFAST Elite
209 90

CytoFAST Elite 209

II CytoFAST Elite
212 120

CytoFAST Elite 212

II CytoFAST Elite
218 180

CytoFAST Elite 218

183

www.helicon.ru

11.9

III
( )
--

-Protect

-Protect

III
, , . III

I-II .

:

, ,
.
, .
5 .
(
200 ), .
.
3- .
.
.
.
.
.
.
6 .
.

,


, /c


,
,
,
,

-Protect
1175 650 650
1175 650 650
G4+ HEPA H14,
2 x HEPA H14
0,3
5
200
1 100
1690 850 1795
250

11

III -Protect
117,5
III -Protect
177,5

184

1 200
2290 x 850 x 1795
450

LS -Protect
LS -Protect 1,8

11.9

SafeFAST Class 312

11

SafeFAST Class 312

III

EN-12469:2000 NSF ().
:

, .

.
300 0,4 .
HEPA.
.
- AISI 316L,
.
AISI 304L
EN-12469:2000.
Du Pont ALESTA AM ( Ag + ).
.
.
.
.
.
ECS .
.
- .
bio-dynamic sealing .
.

SafeFAST Elite312

1450 x 700 x 600

G3+HEPA
H14, 2 x HEPA
H14,
3 HEPA H14

, /c

0,45

2 000

1500 x 1910 x 876

330

III SafeFAST Elite312

Faster SafeFAST Elite312

185

www.helicon.ru

11.10

FreeZone

FreeZone 12


. 1 18 .

:
.

.
.
.
RS232 .
, (CFC-free).
.
.
.
.

( ):
.
, , .
.

11

FreeZone 1
FreeZone 2,5
FreeZone Plus 2,5
FreeZone Plus 2,5
FreeZone Triad
FreeZone 4,5
FreeZone 4,5
FreeZone Plus 4,5
FreeZone Plus 4,5
FreeZone 6
FreeZone 6
FreeZone Plus 6
FreeZone 12
FreeZone Plus 12
FreeZone 18

,
1
2,5
2,5
2,5
2,5
4,5
4,5
4,5
4,5
6
6
6
12
12
18

:
FreeZone 1, , -50
FreeZone 2,5, , -50
FreeZone Plus 2,5, , -84
FreeZone Plus 2,5, , -84
FreeZone Triad
FreeZone 4,5, , -50
FreeZone 4,5, , -50
FreeZone Plus 4,5, , -84
FreeZone Plus 4,5, , -84
FreeZone 6, , -50
FreeZone 6, , -50
FreeZone Plus 6, , -84
FreeZone 12, , -50
FreeZone Plus 12, , -84
FreeZone 18, , -50
:
Labconco 117 /, 220 , 60
Labconco 195 /, 220 , 60

186

, /.
1
2
2,2
2,2
1,8
2
2
4
4
4
4
4
8
4
10

,
-50
-50
-84
-84
-84
-50
-50
-84
-84
-50
-50
-84
-50
-84
-50

+
+
+
+
+

, /.
117
117
117
117
195
117
117
117
117
195
195
195
195
195
195

Labconco 7740030
Labconco 7670530
Labconco 7670030
Labconco 7420030
Labconco 7400030
Labconco 7750030
Labconco 7751030
Labconco 7386030
Labconco 7387030
Labconco 7752030
Labconco 7753032
Labconco 7934032
Labconco 7754032
Labconco 7960032
Labconco 7755032
Labconco 7739402
Labconco 7739403

11.11

11

3D
, , . , , ,
, . .
. 3D - .
.
:

Minilys

Minilys

Minilys -
. 3- 0,5/2,0 1 7 . : 3 000, 4 000 5
000 /. ,
.

187

www.helicon.ru

Precellys 24-Dual

11.11

Precellys 24-Dual
Precellys 24-Dual
, 12-
0,5/2,0 6
7 .
4 000 6 500 /, 100 / ,
.
.

Precellys 24

Precellys 24
Precellys 24 , 24- 0,5 2,0 . 4 000 6 800 /, 100 /
.
.

11

Precellys 24-Dual Precellys 24 Cryolys - ( , , , .).


.

188

11.11

11

Precellys Lysing Kits - . :

VK01

VK05

VK01-05

CK01

CK14

CK28

CKMix

MK28

Soil Mix

+
+

+
+

Minilys

Precellys 24

Precellys 24-Dual

3 2
3 0,5
1 7

24 2
24 0,5

12 2
12 0,5
6 7

, - /

10

200

100

, /

3 000, 4 000, 5 000

4 0006 800

4 0006 500

, .

5 240

5 90

5 90

5 120

5 120


Cryolys


Cryolys

70

70

70

230

230

230

, /

50-60/1

50-60/1

50-60/1

180 290 380

290 375 370

290 375 370

7,8

29,8

29,8

189

www.helicon.ru

11.11

- Minilys

Precellys 06404.200.RD000

Precellys 24

Precellys 03119.200.RD000

PrecellysDual

Precellys 03119.200.RD010

Cryolys

Precellys 05068.200.RD000

, CK14/VK01, 50 7

Precellys 03961-1-303

, SK38, 50 2

Precellys 03961-1-006

, CK28, 50 2

Precellys 03961-1-002

, CK28, 50 7

Precellys 03961-1-302

, CK14, 50 2

Precellys 03961-1-003

, CK14-0,5mL, 50 0,5

Precellys 03961-1-203

, CK28-R, 50 2

Precellys 03961-1-007

, MK28-R, 50 2

Precellys 03961-1-008

, CKMix, 50 2

Precellys 03961-1-009

, MK28, 50 2

Precellys 03961-1-001

, VK05, . , 50 2

Precellys 03961-1-004

, VK05-0.5mL, . , 50 0,5

Precellys 03961-1-204

, CK01, . , 50 2

Precellys 1012-01

, CK01, . , 50 7

Precellys 03961-1-305

, VK01, . , 50 2

Precellys 03961-1-005

, VK01/VK05, . , 50 7

Precellys 03961-1-304

,
.

SilentCrusher M

SilentCrusher M
Heidolph

3
1 500 .
:
3 1 500 .
5 000 26 000 /.
1 5 000 .
.
.
- .
.

11

:
8 16 .
.

190

11.11

SilentCrusher S

11

SilentCrusher S
Heidolph

0,8 10 .
:
0,8 10 .
75 000 /.
1 5 000 .
.
- .
.
:
3 7 .

SilentCrusher M

SilentCrusher S

3-1 500

0,8-10

26 000

75 000

130

24

1960 510 880

1060 300 650

1,0

0,8

SilentCrusher M

Heidolph 595-06000-00

SilentCrusher S

Heidolph 595-05000-00

Heidolph 570-17000-00

Heidolph 570-31100-00

Heidolph 570-30100-00

8F (3-50 , 0,6 )

Heidolph 596-08010-00

12F (25-250 , 0,6 )

Heidolph 596-12010-00

8G (25-250 , 2,0 )

Heidolph 596-12020-00

18F (100-1 500 , 1,5 )

Heidolph 596-18010-00

18G (100-1 500 , 3,0 )

Heidolph 596-18020-00

3F (0,8-10 , 0,6 )

Heidolph 596-03010-00

5F (2-4 , 0,6 )

Heidolph 596-05010-00

7F (6-10 , 0,6 )

Heidolph 596-07010-00

191

www.helicon.ru

11.12

Concentrator plus

Concentrator plus

, ,
. : , 30, 45 60.

:
.
, 1 400 /.
.
0,2 50 , 96- .
, , 85% , .

Concentrator plus Complete


System
, 30, 45, 60
1 400

1,7
150
350
330 370 230
330 580 290
17
31
Concentrator plus Basic

,
, /
, 3/
,
,
,

:
: 0,2 50 ( 144 ).
- , -, 0,2 , -, , . (20 , 121).

F-45-72-8

72 0,5
70 1,5
70 2,0
48 1,5
48 2,0

8 31
11 41
11 41
11 41
11 47

5490 034.007

F-45-24-12

24 6,0/8,0

12 67100

5490 036.000

F-50-8-16
F-50-8-18
F-45-8-17
F-40-36-12

8 15/20
8 15/20
8 15 Falcon
36 1,5
6 15 Falcon
6 50 Falcon
36 3,0/5,0
16 6,5/10
18 10
12 20
8 25
:
0,2
5- 8-

16 105120
18 105128
17 118123
12 32
17 116123
29.5 116123
15 4548
20 4255
19 66
31 55
24 86105
128 86 27

5490 041.003
5490 042.000
5490 038.002
5490 040.007

F-45-70-11
F-45-48-11

F-35-6-30
F-45-36-15
F-45-16-20
F-40-18-19
F-45-12-31
F-35-8-24

11

A-2-VC

192

5490 032.004
5490 030.001

5490 047.001
5490 035.003
5490 043.006
5490 037.006
5490 044.002
5490 039.009

5490 045.009

26 75

11.12

11

Concentrator plus Basic 48 1,5/2

5305 000.100

Concentrator plus Complete System 48 1,5/2 (F-45-48-11)

5305 000.304

Concentrator plus Complete System


,

5305 000.703

Concentrator plus Complete System

5305 000.509

CentriVap DNA

CentriVap DNA

CentriVap DNA 100, 1 . 1 725 /.


:
, 100, .
, 1 725 /.
.
.
1 999 .
0,5 50 , 96- .
.
.
, 9 .
Quick-Stop .
.
, , , .
CentriVap , : , , . ,
, , , .

Refrigerated CentriVap

Refrigerated CentriVap

,
-4 +100.
,
, , .
:
-4 100.
/.
, 1 725 /.
.

.
( ).
, 9 .
.

193

www.helicon.ru




11.12

- .
/ 1 999 .
- .
.
.

CentriVap DNA

, /

Refrigerated CentriVap
1 725

, 3/

2,04

+100

-4

300

350 660 280

373 551 422

31

43

CentriVap DNA -

Labconco 7970011

Refrigerated CentriVap ,

Labconco 7310030

CentriVap ( 12-13
, -55, , )

Labconco 7982011

CentriVap ,
( 12-13 , -55,
, )

Labconco 7984011

CentriVap ,
( 12-13 , -55,
, - , )

Labconco 7983014

:
0,5 50 ( 12 132 ).
- , 4 96 .
,

1,52,0

40

12 55

16

12 95

64

10

13 100

64

12,2 46,5

52

13 51

52

10

13 100

36

11-15

16 100

24

15-19

16 125

18

1,52,0

32

50

28 140

12

0,5

72

1,52,0

60

1,52,0

132

Labconco 7450701

96 0,2

128 86 15

Labconco 7461900

12-13

12-17

28

Labconco 7455100

Labconco 7455000

Labconco 7455200
Labconco 7462900

11

CentriVap DNA Refrigerated CentriVap

194

Diaphragm Vacuum Pump, , 230 , 50

Labconco 7393001

117 /

Labconco 7739402

ChemVac Combination Vacuum 96 /., 230 , 50

Labconco 7584002

11.13

11

GFL .
, . , GFL, DAB
.

-
, , . , ,
.

GFL-2002

:
, .
.
0,43 /,
II ASTM.
.
.
.

GFL-2002

GFL-2004

GFL-2008

GFL-2012

II ASTM


, /

0,43

, /

12

-,

16

24

, /

30

48

72

220

198
220/3

1 500

3 000

6 000

9 000

540 290 420

620 330 460

780 410 540

780 410 670

14

18

32

37


GFL-2100 , .

GFL-2102

:
.

.
, .
0,63 /,
II ASTM.
.

195

www.helicon.ru

11.13

GFL-2102

GFL-2104

GFL-2108

II ASTM

,
/

0,63

, /

, /

72

120

198

220

220 /3

3 500

6 500

11 500

500 260 470

550 280 570

700 390 700

24

30

45

GFL-2302

GFL-2300
.
:
, .
0,63 /,
II ASTM.
.

.

GFL-2302

GFL-2304
II ASTM

, /

0,63

, /

, /

96

144

220

220/3

2 900

5 800

650 365 390

650 365 390

24

25

11

196

, /

GFL-2002

GFL-2004

GFL-2008

12

GFL-2012

GFL-2102

GFL-2104

GFL-2108

GFL-2302

GFL-2304

11.14

MS-3000

11

MS-3000

MS-3000 -.
:
: 03 000 /.
5 .
.
(6 25 )
, PTFE ().

Bio MMS-3000
Bio MMS-3000
. , (, .).

Bio MMS-3000

:
: 03 000 /.
20 .
.
: 320 .
(6 25 )
, PTFE ().

MSH-300
MSH-300 .

.

MSH-300

:
: 2501 250 /.
15 .
: 30-330C.
330C 20 .
12 .
.
(6 25 )
, PTFE ().
: .

197

www.helicon.ru

11.14

MS-3000

Bio MMS-3000

, /

MSH-300

0-3 000

250-1 250

20

15

110 110

160

160

30-330

120 150 65

185 230 75

190 275 100

1,1

1,5

3,3

- MS-3000

MS-3000

- MMS-3000N

Bio MMS-3000

MSH-300

MSH-300

MS-01

MS-01

MS-01 4- ,
.
4- . MS-01
TW-2-03 ELMI.
TW-2.03 MS-01
, , ,
..

:
4-
.
: 801 500 /.
2 .
.
TW-2.03.

:
TW-2.03.

MS-01

, /

80-1 500

( 4 ),

2 ( 8)

210 270 35

1,8

11

198

4- MS-1

Elmi MS-01

11.15

11

III
RiOs 30/50/100/150/200
RiOs III
. 30 200
.

RiOs

:
III ASTM.
30 200 .
.
.
.
.

RiOs

III ASTM

, /

0,25

, /

30/50/100/150/200*

662 441 733

33/34/36/38/40

*- .

III RiOs 30

Millipore ZR0S50030

III RiOs 50

Millipore ZR0S50050

III RiOs 100

Millipore ZR0S50100

III RiOs 150

Millipore ZR0S50150

III RiOs 200

Millipore ZR0S50200

--1812

- 1812-1
-

--1812 (
).
3-5 ., , .
:
.
3-5 .
III ASTM.

199

www.helicon.ru

11.15

--1812-1

--1812-2
III ASTM

, /

0,2

, /

5-7

10-14

390 x 370 x 150

III --1812-1

- --1812-1

III --1812-2

- --1812-2

--18126-1
-

--1812 , III .

.
:
.
.
III ASTM.

11

--18126-1

--18126-2

--18128-4

III ASTM


, /

0,2

, /

390 x 370 x 150

14

25

--18128-6

34
650 x 500 x 250

11

15

20

200

III --18126-1

--18126-1

III --18126-2

- --18126-2

III --18128-4

- --18128-4

III --18128-6

- --18128-6

11.15

11

II
Elix Advantage 3/5/10/15

Elix Advantage

Elix Advantage II (1015 /) .


:
.
3/5/10/15 II .
10-15 /.
o
.
.
50%.
.
.
.
E-POD.
.
.
, .
:
Elix Advantage 3/5/10/15.
II .
TS2.
Millipak-40/ Millipak-40/ BioPak*.
30/60/100 .
30/60 .
30/60 .
45 ./.
* - BioPak , ,
.

Elix Advantage

II ASTM

, /

10

, /

3/5/10/15*

160

500 520 550

24,4-26,6*

*- .

II Elix Advantage 3 (3 /)

Millipore ZRXV003WEU

II Elix Advantage 5 (5 /)

Millipore ZRXV005WEU

II Elix Advantage 10 (10 /)

Millipore ZRXV0010WEU

II Elix Advantage 15 (15 /)

Millipore ZRXV0015WEU

Millipore WMBSMT002

201

www.helicon.ru

11.15

--1(18)

--1(18)-2
-

16-18 /
, .
:
16-18 /.
II ASTM.
,
.

--1(18)-2

--1(18)-4

II ASTM

, /

16

, /

15

30

100

130

,
,

800 x 600 x 200


30

32

11

202

II --1(18)-2

--1(18)-2

II --1(18)-4

--1(18)-4

11.15

11

I
Simplicity

Simplicity

Simplicity (,
).
:
( I ASTM) .
18,2 /.
0,5 .
Simplicity
.
- - .
:
Simplisity UV.
SimpliPak 1.
Simplicity Final Filter 0,05 .
Millex.

Simplicity

I ASTM

, /

18,2

, /

0,5

100

510 590 360

I Simplicity

Millipore SIMS000EU

I Simplisity UV

Millipore SIMSV00EU

SimpliPak 1

Millipore SIPK0SIA1

Simplicity Final Filter 0,05

Millipore SIMFILTER

Millex (10 ./.)

Millipore SLFH02510

203

www.helicon.ru

11.15

Milli Q Advantage

Milli-Q Advantage A10 (EU)

Milli Q (18 /) .
II, III .
:
( I ASTM) .
18,2
/.
2 .
.



3- .
.
GMP.
, .

:
Milli-Q Advantage A10.
.
Q-Gard T1.
Quantum TEX Organex.
40 BioPak*.
* - BioPak , ,
.

11

Milli Q Advantage

I ASTM

, /

18,2

, /

160

497 332 360

16,6

204

I Milli Q Advantage A10

Millipore Z00Q0V0EU

Millipore ZMQSP0D01

Q-Gard T1, 1 /. Milli-Q Advantage

Millipore QGARDT1X1

Quantum TEX (1 /.) Organex

Millipore QTUM0TEX1

11.15

11


( )
DirectQ 3 UV

DirectQ 3 UV

DirectQ 3 UV (III
I ) .
:
( III) ( I)
.
2,4 III , I
0,5 .
- - .
:
Direct-Q 3 Smart.
SmartPak DQ3 Direct-Q 3 (UV).
Millipak Express 20/ BioPak.
* - BioPak , ,
.

DirectQ 3 UV

III I

, III, /

2,4

, I, /

0,5

100

540 420 290

8,1/8,6

Direct-Q 3 UV

ZRQS0P3EU

Direct-Q 3

ZRQS0P3EU

205

www.helicon.ru

11.15

Milli-Q Direct 8/16

Milli-Q Direct 8

Milli-Q Direct (III I


) .

:
( III) ( I) .
8/16 III , I
2- .
.
.
, .

:
Milli-Q Direct 8/16.
3.
Q-Pak TEX.
30/60 .
BioPak.
.
* - BioPak , ,
.

11

Milli-Q Direct

III I

, III, /

8/16*

, I, /

500 420 490

20/21

*- .

206

Milli-Q Direct 8

Millipore ZR0Q00800

Milli-Q Direct 16

Millipore ZR0Q01600

11.15

Milli-Q Integral 3/5/10/15

11

Milli-Q Integral 3

Milli-Q Integral -
( II) ( I) .
:
( II) ( I)
.
3/5/10/15 II , 2 I .
.
.
3- .
.
GMP.
, .
:
Milli-Q Integral 3/5/10/15.
Q-POD.
TS2.
Quantum TEX Organex.
Millipak-40/ Millipak-40/ BioPak*.
30/60/100 .
30/60 .
. 30/60 .
.
* - BioPak , ,
.

Milli-Q Integral

II I

, II, /

3/5/10/15*

, I, /

160

497 332 360

16,6

*- .

Milli-Q Integral 3

Millipore ZRXQ003EU

Milli-Q Integral 5

Millipore ZRXQ005EU

Milli-Q Integral 10

Millipore ZRXQ010EU

Milli-Q Integral 15

Millipore ZRXQ015EU

207

www.helicon.ru

11.16

UVR-M
UVR-M

UVR-M
,
,
, .
:
90% ( ).
15 (Philips).
14 /.
.
.

UVR-M

, /

14

220-240 ; 50-60

125

110 130 665

3,9

11

208

UVR-M

BS UVR-M

11.17

Elmasonic S

11

Elmasonic S
Elma

-

. , .
:
0,8 90 .
.
37 .
.
.
30 80 ( Elmasonic S/).
.
, .
.
.
2 .
.

S 10/S 10 H

0,8

190 85 60

30/90

206 116 178

S 15/S 15 H

1,75

157 137 100

35/95

175 180 212

2,1

S 30/S 30 H

2,75

240 137 100

60/260

300 179 214

3,3

S 40/S 40 H

4,25

240 137 150

120/320

300 179 264

S 60/S 60 H

5,75

300 151 150

150/550

365 186 264

5,1

S 70/S 70 H

6,9

505 137 100

150/750

568 179 214

5,6

S 80/S 80 H

9,4

505 137 150

150/750

568 179 264

6,4

S 100/S 100 H

9,5

300 240 150

150/550

365 278 264

5,9

S 120/S 120 H

12,75

300 240 200

200/1000

365 278 321

7,5

S 180/S 180 H

18,0

327 300 200

200/1000

390 340 321

8,5

S 300/S 300 H

28,0

505 300 200

300/1500

568 340 321

11

S 450 H

45,0

500 300 300

2000

615 370 467

22

S 900 H

90,0

600 500 300

2800

715 570 467

38

* .
:
Hostalen ( ).
.
.
.
, 45 90 .

209

www.helicon.ru

11.18

OD600 DiluPhotometer

OD600 DiluPhotometer
OD600 DiluPhotometer , 600 .
, .

:
600 .

.

, RS232 USB.

.
.
1 0,5 .

OD600

600 20

, .

<2

RS232 USB

, NiMH.

110220 ; 5060 ,

20

180 x 150 x 60

0,6

11

210

OD600 DiluPhotometer, 4 96
1 ( 10)

Implen OD600-10

OD600 DiluPhotometer, 4 96
0,5 ( 20)

Implen OD600-20

OD600 DiluPhotometer, 2 96
0,5 2 96 - 1

Implen OD600-1020

DiluCell 10 - 1 ( 10), 8,5 15


, 96 .

Implen DC-10

DiluCell 20 - 0,5 ( 20), 8,5 15


, 96 .

Implen DC-20

11.18

BioPhotometer plus

11

BioPhotometer plus


.
, , , ..
:
: 230, 260, 280, 340, 405, 490, 550,
595, 650 .
.
100 ,
.
.
( RS232C).
( 10 ).
.
:
Thermal Printer DPU 414.

BioPhotometer plus

230, 260, 280, 340, 405, 490, 550, 595, 650

, .

RS232C, ,

100240 ; 5060

200 320 100

BioPhotometer plus

Epp 6132 000.008

Thermal Printer DPU 414

Epp 6131 011.006

Epp 0013 021.566

UVette, 200 .

Epp 0030 106.318

211

www.helicon.ru

11.18

NanoPhotometer P 360

NanoPhotometer P-Class
IMPLEN NanoPhotometr
P300
( 0,3 ) , ,
10 .
, , , NGS .

11

:
0,3 , .
190 1 100 ( 200 950).
.
.
.
flash ().
( P330 P360).
flash .
.

.
10 .
3,5 .

( 10 ), . ,
, .
, ,

212

11.18

11

:
: , , ;
.
, , , 280 .
, .
, , , .
.
, , .

NanoPhotometer P 360

0,3

1901 100 ( 200950)

3,5

, /

218 750

, /

80543 000

SD-, USB , Bluetooth

2 800 /; 2

90-250 ; 5060 ,

30

140 x 275 x 380

<4,5

NanoPhotometer P 360 - (
lid10, lid50 lid250, , ), (2 )

Implen P-360

NanoPhotometer P 330 - (
lid10 lid50, , )

Implen P-330-31

NanoPhotometer P 330 - (
lid10 lid50, )

Implen P-330-30

NanoPhotometer P 300 - (
lid50, )

Implen P-300-31

NanoPhotometer P 300 - (
lid50)

Implen P-300-30

Lid5. NanoPhotometer(2 , 5, 3,55 )

Implen P-3034-L2

Lid10. NanoPhotometer(1 , 10, 13 )

Implen P-3034-L1

Lid50. NanoPhotometer(0,2 , 50, 0,32


)

Implen P-3034-L02

Lid100. NanoPhotometer(0,1 , 100, 0,32


)

Implen P-3034-L01

Lid250. NanoPhotometer(0,04 , 250,


0,32 )

Implen P-3034-L004

NanoPhotometer, 5

Implen P-31-Pa

213

www.helicon.ru

11.18

SmartSpec Plus

SmartSpec Plus

200 800 .
- , , ,
e, , ,

.
:
.






200 800 .
.
.
.
.
.
( RS232).

11

SmartSpec Plus

200-800

RS232

90260 ; 4763

330 260 140

3,8

214

SmartSpec Plus

BioRad 1702525

( 1-3,5 ,
10 )

BioRad 1702502

( 0,5-1,4 ,
10 )

BioRad 1702503

( 3,5 ,
10 , 100 ./.)

BioRad 2239950

( 1,5 ,
10 , 100 ./.)

BioRad 2239955

11.18

Mark

11

Mark

Mark
: 6
1 536 , , , , . .
:
.
200 1 000 .
, .
.
, .
Microplate Manager.
.
, .
:
Zemfira , .

Mark

200-1 000

, OD

0-4,0

, OD

0,001

6- 1 536 , ,
,

25-45,
0,5

USB 2.0

/, 64

350

544 440 219

27,5

Mark

BioRad 1681150

Zemfira

Zemfira

215

www.helicon.ru

11.18

Biospectrometer

Biospectrometer basic

BioSpectrometer basic Biospectrometer


kinetic 200 830 ,
. Biospectrometer kinetic
+20C +42,

.

:
220 830 .
.
100 .
(>1 000) .
, .
Biospectrometer kinetic +20C +42.
,
, .

11

BioSpectrometer basic

200-830

, C

USB/RS232

100240 ; 5060

30

295 400 150

5,4

Biospectrometer kinetic
+20 +42

5,5

216

BioSpectrometer basic

Epp 6135 000.009

Biospectrometer kinetic

Epp 6136 000.002

11.18

11

VersaFluor

VersaFluor
VersaFluor ,
350-900 . (. . ).

:

350 900 .

10 / (
Hoechst).
.
13,5 , 150300 (
).
:

Hoechst 33258

EX 360/40

170-2420

EM 460/10

170-2421

PicoGreen (Invitrogen)

EX 480/20

170-2427

EM 520/10

170-2424

RiboGreen (Invitrogen)

EX 490/10

170-2422

EM 520/10

170-2424

OliGreen (Invitrogen)

EX 480/20

170-2427

EM 520/10

170-2424

NanoOrange (Invitrogen)

EX 480/20

170-2427

EM 590/10

170-2425

pH

BCECF

EX 490/10

170-2422

EM 520/10

170-2424

EX 490/10

170-2422

EM 520/10

170-2424

EX 510/10

170-2423

EM 620/10

170-2426

MUG (
-)

EX 360/40

170-2420

EM 460/10

170-2421

MUGluc (
-)

EX 360/40

170-2420

EM 460/10

170-2421

wtGFP

EX 390/22

170-2443

EM 510/10

170-2445

EGFP

EX 490/10

170-2422

EM 510/10

170-2445

EBFP

EX 380/30

170-2444

EM 440/10

170-2446

GFPuv

EX 390/22

170-2443

EM 510/10

170-2445

Z-DEVD-AFC (
)

EX 360/40

170-2420

EM 520/10

170-2424


100 .

VersaFluor
VersaFluor ( 3,5 , 12,5 12,5 , 100 .)
VersaFluor ( 350 , 12,5 12,5 , 100 .)
VersaFluor
VersaFluor
VersaFluor (10 )

170-2402
170-2415
170-2416
170-2407
170-2430
170-2412

217

www.helicon.ru
Qubit 2.0

11.18
Qubit 2.0

Qubit 2.0
, Qubit ( Quant-iT).
Qubit
,
, , - .
, , , ,
, , .
Qubit 2.0 :





, .
.
.
.
(120 ).
.

Qubit
Life Technologies (Invitrogen) 5 Qubit,
. , , . (
). . 0,5 .
Qubit:



. , , , , , , ..
: 0,01, 0,25, 12,5 /.
: 5, 3,5, 2,5 .
, .
. 5% 2 .

11

2.0:
: .
.
USB- -: , .
Qubit 2.0 , .

218

11.18

11

Qubit 2.0

1 ,

, ,

200 , 5 , 250

2 3

- 0,5

120

100240 , 5060

130 210 40

340

Qubit 2.0

Q32866

Qubit HS , 100 (
0,2100 )

Q32851

Qubit HS , 500 (
0,2100 )

Q32854

Qubit BR , 100 (
21000 )

Q32850

Qubit BR , 500 (
21000 )

Q32853

Qubit , 100 (
5100 )

Q32852

Qubit , 500 (
5100 )

Q32855

Qubit , 100 (
0,255 )

Q33211

Qubit , 500 (
0,255 )

Q33212

Qubit, 500 . (, 0,5 )

Q32856

Qubit 2.0 (Q32866+Q32851+Q32850+Q32852+ Q33211+Q32856)

Q32871

Qubit 2.0 (Q32866 (5 .)+Q32851+Q32850+Q32852+Q33211+Q32856)

Q32872

Qubit BR , 100 (
201000 )

Q10210

Qubit BR , 500 (
201000 )

Q10211

Qubit , 100 (
1200 )

Q10212

219

www.helicon.ru

11.19


ThermoStat plus

ThermoStat plus

ThermoStat plus -5
+99.
,

.
:
-5C +99C.
.
.
.
, 0,250 .

.
.
.
(RS232 ).
.
:
IsoTherm cool pack, 0 ( ).
, 6 .
IsoTherm , , . IsoTherm .
:
.
1,5-2 12,5 .
Falcon.
24 11-11,9 , 30-76 .
CombiBox .
, IsoTherm Rack IsoTherm.

ThermoStat plus

,
,
, .

-5 +99
1 99:59
100-240 ; 50-60
75
220 250 120
5

11

ThermoStat plus
ThermoStat plus
, IsoTherm Rack IsoTherm:
24 0,5
24 1,5
24 2,0

CombiBox . , : 135 90 60
24 11-11,9 , 30-76
Falcon:
8 15
4 50
1,5-2 12,5
4- ( in-situ )
96 0,2

220

Epp 5352 000.010

Epp 5361 000.015


Epp 5360 000.011
Epp 5362 000.019
Epp 5363 000.012
Epp 5352 100.007
Epp 5364 000.016
Epp 5366 000.013
Epp 5365 000.010
Epp 5367 000.017
Epp 5368 000.010
Epp 5363 007.009

11.19

11

+99C.
Eppendorf 1,5 0,5 .
:
+99C.
1 96 .
40 1,5 +28 0,5 .

+99C.
Eppendorf 1,5 0,5 .
, .
:
+99C.
1 96 .
40 1,5 +28 0,5 .
, , .
, .
.

1 96

220240 ; 5060

,
,

2 96
40 1,5 +28 0,5

99

40
250 120 80

195 185 125


2

TT

TG

221

www.helicon.ru

11.19
TDB-120

TDB-120

TDB-120
, . 5C
+120C.
:
5C +120C.
1 96 ( 1 ).

.
TDB-120 :
-53 (21 0,5 +32 1,5 ).
-103 (21 0,5 +32 1,5 +50 0,2 ).

-100
-100

,

30C +100C.

:
30C
+100C.
, .
.
.
.
/ : 2 16 , LCD.
-100 :
-100 -1 (20 0,5 +12 1,5 ).
-100 -2 (20 1,5 ).

11

222

TDB-120

,
,
, .

5C +120 -10 +100


1 96
-53 -103
-1, -2
220240 ; 5060
100
200 210 100
240 260 165
4,6

-100

TDB-120 -53
TDB-120 -103
CH-100 -1
CH-100 -2

BS TDB-120/53
BS TDB-120/103
BS CH-100/CH-1
BS CH-100/CH-2

11.19

11

Thermomixer compact

Thermomixer compact

Thermomixer compact
, 4C
+99C.
:
4C +99.
300-1 400 /.
: 24 1,5 .
.
short mix.
, .
Thermomixer compact , 24 Eppendorf 1,5 .
:
IsoTherm cool pack, 0 ( ).
, 6 .

Thermomixer comfort

Thermomixer comfort

, 13C +99C.
:
13C +99C.
300-1 500 /.
, 0,550 .
,
.
,
.
short mix.
, .
Thermomixer compact , 24 Eppendorf 1,5 .
:
IsoTherm cool pack, 0 ( ).
, 6 .

223

www.helicon.ru

11.19

Thermomixer compact

Thermomixer comfort

4
+99

13
+99

, /.

300-1 400

300-1 500

1 99:59

100-240 ; 50-60

90

165 240 135

220 250 120

2,4

3,2

Thermomixer comfort

Epp 5355 000.011

, IsoTherm Rack IsoTherm:

BS TS-100C/SC-18

24 0,5

Epp 5361 000.015

24 1,5

Epp 5360 000.011

24 2,0

Epp 5362 000.019

Epp 5363 000.012

96 0,2

Epp 5363 007.009

24 11-11,9 , 30-76

Epp 5364 000.016

Falcon
8 15

Epp 5366 000.013

4 50

Epp 5365 000.010

1,5-2 , 12,5

Epp 5367 000.017

4- ( in-situ )

Epp 5368 000.010

Thermomixer compact 24 1,5 , IsoTherm Back IsoTherm

Epp 5350 000.013

( +100C).

11

TS-100

TS-100

:
+25 +100.
, 250-1 400 /.
2 .
0,22,0 ,
.
, , .
.
.
.

:
20 0,2 +12 1,5 .
20 0,5 +12 1,5 .
20 1,5 .
20 2 .
24 2 .
96 .

224

11.19

TS-100C

11

TS-100

TS 100C TS-100 15C .


:
15C +100C.
, 250-1 400 /.
2 .
0,22,0 , .
, , .

.
.
.
:
20 0,5 +12 1,5 .
20 0,2 +12 1,5 .
20 1,5 .
20 2 .
96- .

TS-100

TS-100C

+25 +100

+4 +100

, /.

250-1 400

1 96

: DC 12 , 4,16

40

60

205 230 130

SC-18/02

SC-18

SC-20

SC-20N

SC-24

SC-96A

TS-100

BS TS-100

TS-100

BS TS-100C

SC-18/02

BS SC-18.02/TS-100

SC-18/02

BS SC-TS-100/18/02

SC-18

BS SC-18/TS-100

SC-18

BS TS-100C/SC-18

SC-20

BS SC-20/TS-100

SC-20

BS SC-TS-100/20C

SC-20N

BS SC-20N/TS-100

SC-20NC

BS SC-TS-100/20N

SC-24

BS SC-24/TS-100

SC-96

BS SC-96/TS-100

SC-96AC

BS SC-TS-100/96AC

225

www.helicon.ru

11.19


BD

BD 115
Binder

,
+5C +100C.

:
: +5C +100C.
C .
0 99 .
APT.Line
.
.
- 2 .
.
.
.

BD 23

BD 53

BD 115

, C

BD 400

BD 720

+5 +100

BD 240

99

20

53

115

240

400

720

222 330
277

400 400
330

600 480
400

800 600
500

1000 800
500

1000 1200
600


,
./.

1
2/3

2/4

2
2/5

2/7

2/10

2/16

230 ; 50

200

680

850

1250

433 492
516

634 617
575

400
834 702
645

1034 822
745

1234 1022
765

1234 1528
865

26

43

61

93

135

191

11

226

BD 23

Binder BD23

BD 53

Binder BD53

BD 115

Binder BD115

BD 240

Binder BD240

BD 400

Binder BD400

BD 720

Binder BD720

11.19

11

240
Binder

KB -5C +100C.
:
-5C +100C.
APT.Line .
0,1C.
.
: / .
.
.
.
0 99 .

23

53

115


, C

240

400

720

-5 +100

99

20

53

115

240

400

700

222 330 277

400 400 330

600 480 400

800 600 500

650 1308
470

1000 1168
600

2/7

2/15

2/14


, ./.

1
2/3

2/4

2/5

230 ,50;60
340

460

433 601 516

634 837 576

834 1022
646

44

72

105

1 200

1 400

2 300

1034 1142
746

884 1850
716

1234 1816
867

147

216

262

23

Binder KB 23

53

Binder KB 53

115

Binder KB 115

240

Binder KB 240

400

Binder KB 400

720

Binder KB 720

227

www.helicon.ru

11.19

ED 53
Binder

BINDER ED +300C.
:
C .
+5C
+300C.
APT.Line
.
0,1C.





0 99 .
.
2 .
.
.
.

ED 23

ED 53


, C

ED 115

ED 400

ED 720

+5 +300

ED 240

99

20

53

115

240

400

720

222 330
277

400 400
330

600 480
400

800 600
500

1000 800
500

1000 1200
500

,
./.

2/3

2/5

2/6

2/7

2/10

2/16

800

1200

1600

2700

3400

5000

433 492
516

634 617
575

834 702
645

1034 822
745

1234 1022
765

1234 1528
865

25

42

57

86

125

174

230 ; 50

11

228

ED 23

Binder D23

ED 53

Binder D53

ED 115

Binder D115

ED 240

Binder D240

ED 400

Binder D400

ED 720

Binder D720

11.19

FD

11

FD 53
Binder

BINDER FD
+300C. .
:
.
: +5C
+300C.
APT.Line .
0,1C.
.
RS422 - DataControlSystem.
- 2 .
.
.

.
0 99 .

FD 23

FD 53

, C

FD 115

FD 240

+5 +300

99

20

53

115

240

222 330 277

400 400 330

600 480 400

800 600 500

2/3

2/5

800

1200

1600

2700

433 492 516

634 617 575

834 702 645

1034 822 745

33

44

62

96


, ./.

2
2/6

2/7

230 ; 50

FD 23

Binder FD23

FD 53

Binder FD53

FD 115

Binder FD115

FD 240

Binder FD240

229

www.helicon.ru

11.20


OS-20

OS-20
OS 20
. .
:
.
20 .
50250 /
.
+5 +40.

PSU-10i PSU-20i
PSU-10i/PSU-20i OS-10/OS-20 , , . , 7 .

PSU-10i

:
.
10 .
50450 /.

35 000 .

.

PSU-20i

11

,
, , .
:
20 .
,
20250 /.
- , 0360,
20250 /.
, ,
05.

35 000 .

.

230

11.20

11

OS-20

PSU-10i

PSU-20i

, /

50-250

30-450

20-250

20

10

20

1-999

1-96

2,5

270 x 260 x 80

220 x 205 x 90

410 410 130

3,4

14

OS-20, PSU-10i ( ):
UP-12: (285 215 ).
Bio PP-4: , VDLR Latex (220 220 ).
-12/100: 100-150 , 12 .
-6/250: 250-300 , 6 .
PSU-20i ( ):
UP-330 430 330 .
P-30/100 30 100 /.
P-16/250 16 250 /.
P-9/500 9 500 /.
P-6/1000 6 1 000 /.
PP-20 .
PP-20-2 .
PP-20-3 .
PP-20-4 .

OS-20

OS-20

OS-20 UP-12

OS-20/UP-12

PSU-10i

PSU-10i

PSU-20i

PSU-20i

UP-12

UP-12

PP-4

PP-4

-12/100

-12/100

-6/250

-6/250

430 330

UP-330

30 . 100 /

P-30/100

16 . 250 /

P-16/250

9 . 500 /

P-9/500

6 . 1 000 /

P-6/1000

PP-20

PP-20-2

PP-20-3

PP-20-4

231

www.helicon.ru
PSU-2T

11.20

PSU-2T
- PSU-2T 96- .
, .
.

:
.
2 .
: 1501 000 /.
: 124 .
IPP-2 2 .
+5 +40.

:
IPP-4 4- .

MR-1

- MR-1

,
. ,
,
.

:
.
7.
: 7,530 /.
: 124 .
+5 +40.

:
-26 26 11 .

3D Multi Bio 3D

11

Multi Bio 3D

232

Multi Bio 3D , , - 3- ( -).


, ,
.
.

11.20

11

:
:
22 ,
0-360,
0-6,
7.
1100 /.
: 0250 .
: 05 .
: 0125 .
+5 +40.

PSU-2T

MR-1

Multi Bio 3D

, /

150-1 000

7,5-30

5-30

22

4-

0,5

220 205 90

220 205 120

170 220 150

2,5

1,6

- PSU-2T

PSU-2T

- MR-1

MR-1

3D Multi Bio 3D

Multi Bio 3D

TP-26 26 11

TP-26

IPP-4 4-

IPP-4

S-4

S-4

S-4
.
, , 1 8 .

, .
:
.
1-8.
: 150 /.
: 1999 .
.

S-4

, /

1-50

1-8

1-999

1,5

220 ; 50

15

347 275 100

3,5

233

www.helicon.ru

11.20

S-3.10 S-3.20

S-3.10

S-3.10 S-3.20
.
.

:
.
10/20 .
: 50500 /.

45 000 .
90 .

S-3.10M

S-3.10L

(
), /

S-3.20L

50-500

10

,
,

S-3.20M

20
90

347 235

410 297

347 275 100

430 230 230

347 275 100

420 310 100

5,5

5,5

347 235
20

11

234

410 297

S-4

S-4

S-3.10M

S-3.10M

S-3.10L

S-3.10L

S-3.20M

S-3.20M

S-3.20L

S-3.20L

11.20

11


Excella

E25

- Excella 60 ,
.
E24 E24R ( ) E25, E25R ( ).
:
.
: 50400 /.
.
60.
E24R E25R .
() .
.
.
,
.
.
RS232.

E24

E24R


( ), /

E25

E25R

50-400

19

25,4

7
60

15
60

7
60

15
60

0,01-99,99

12 (4 2,8 )

24 (4 6 )

460 460

760 460

,
,

514 546 356

850 580 480

560 762 610

1270 770 850

61

82

191

204

Excella E-25R

M1353-0006

Excella E-25

M1353-0002

(46 76) E-25 E-25R

M1250-9920

Excella E-24R

M1352-0006

Excella E-24

M1352-0002

(46 46) -24 -24R

1250-9902

235

www.helicon.ru

11.20

Innova

Innova 40

Innova ( 80)
Excella.
. Innova ,
.
,
.
:
.
: 25500 /.
.
Innova 40R Innova 43R .
80.
.
, -.
.
.
,
.

Innova 40


( ), /

Innova 40R

Innova 43

25-500 25,4 , 25-300


51,0

25-500

Innova 43R

19 25,4

25,4 51

5
80

15
80

7
80

20
80

0,1-99,9

12 (4 3 )

24 (4 6 )

460 460

760 460

514 546 356

883 562 488

559 762 610

1350 840 1040

63

94

191

204

11

236

Innova 43R 25,4

M1320-0006

Innova 43R 51

M1320-0016

Innova 43 25,4

M1320-0002

Innova 40R 19

M1299-0086

Innova 40 19

M1299-0082

11.20

11

Excella Innova

25\25R Innova 43\43R ( 760 460 )

NB M1250-9920

24\24R Innova 40\40R ( 460 460 )

NB M1250-9902

25\25R Innova 43\43R ( 760 460 )

NB M1250-9920

10

NB ACE-10S

25

NB M1190-9004

50

NB M1190-9000

125

NB M1190-9001

250

NB M1190-9002

500

NB M1190-9003

1 000

NB ACE-1000S

2 000

NB ACE-2000S

4 000

NB ACE-4000S

6 000

NB ACE-6000S

60 8-11

NB M1289-0010

44 12-15

NB M1289-0020

31 15-18

NB M1289-0030

23 18-21

NB M1289-0040

16 22-26

NB M1289-0050

16 26-30

NB M1289-0060

(23 3,8 , )

NB M1250-9600

ES-20

ES-20

25 42.
,

,
.
:
.
: 50250 .
10 .
: 25-42.
2,5 .
.
.
.
, 7 .
, .
:
UP-12: (285 215 ).
PP-4: , VDLR Latex (220 220 ).
-12/100: 100-150 , 12 (250 190 ).
-6/250: 250-300 , 6 (250 190 ).

237

www.helicon.ru

11.20
S-20/60

ES-20/60

- S-20/60
, .
( +80)
.
.
:
.
: 50250 .






20 .
: 25-80.
15 .
.
.
, .
- ,
.

:
-30/100: 100 , 30 .
-16/250: 250 , 16 .
-9/500: 500 , 9 .
-6/1000: 1 000 , 6 .
ES-20 ES-20\60 .

ES-20

ES-20/60

, /

50-250

10

25 42

20
25 80
1 96

2,5

15

150

500

340 340 435

590 525 510

15

57

11

238

ES-20,

BS ES-20

ES-20/60,

BS ES-20-60

BS UP-12

, VDLR Latex

BS PP-4

100-150 , 12

BS -12/100

250-300 , 6

BS -6/250

100 , 30

BS -30/100

250 , 16

BS -16/250

500 , 9

BS -9/500

1 000 , 6

BS -6/1000

11.20

11


Bio RS-24

Bio RS-24

- Bio RS-24 .
, , .
:
.
360.
530 /.
1 23 59 .
+5 +40.

Multi Bio RS-24

Multi Bio RS-24

- Multi Bio RS-24


.
.
:
:
, 360, 1100 /;
, 190, 1100 /;
, 05, / 05 .
1 24 .
+5 +40.
PRS-22.
:
PRS-5/12 5 30 (50 ) 12 15 (1,5-15 ).
PRS-10 10 30 (50 ).
PRSC-10 10 30 (50 .)
PRSC-22 22 15 (15 ).

239

www.helicon.ru

11.20

Multi RS-60

Multi RS-60

- Multi RS-60 Multi Bio RS24 ,


PRS-48 48 15 (2-15
). .
:
PRS-8/22 8 30 (50 ) 22
15 (1,5 , 2 , 15 ).
PRS-14 14 30 (50 ).

Bio RS-24

, /

5-30

Multi Bio RS-24

Multi RS-60

1-100 ( )

( )

360

( )

( )

15-90 ( 15)
0-5 ( 1)

0-24

310 x 110 x 175

310 110 175

430 230 230

1,8

3,7

11

240

Bio RS-24

BS Bio RS-24

Multi Bio RS-24

BS Multi Bio RS-24

Multi RS-60

BS Multi RS-60

PRS-4/12

BS PRS-4/12

PRS-5/12

BS PRS-5/12

PRS-10

BS PRS-10

PRS-10

BS PRS-10

PRS-22

BS PRS-22

PRS-8/22

BS PRS-8/22

PRS-14

BS PRS-14

11.21


pH-

- Checker 1

11

Checker 1
Hanna Instruments

-. HI 1270.
:
0,00 14,00.
.
.
3 000 .
.

- ep+

ep+
Hanna Instruments

, , pHep+
- , .
:
0,00 14,00.
.
.
.
200 .
.
10- .
.

Checker 1

pHep+
0,00 14,00

0,01

0,1

0,2

0,1

0 50

66 50 25

150 30 24

52,6

85

- Checker 1

Checker 1

- ep+

ep+

241

www.helicon.ru


pH-

11.21

-- 8314
8314
Hanna Instruments

, , .
:
0,00 14,00.
.
.
-.
: , .

HI 8314

0,00 14,00

0,01

0,01

1999

0 100

0,1

0,4

185 82 45

180

-- 8314

HI 8314

-410

- -410

, - . .

11

242

:
.
.
, .
220 .
.
, (BNC-).
: , 220 -.

11.21


pH-

11

pH-410

0,00 14,00

0,01

0,02

1999

-10 100

0,1

183 84 55

320

- -410

pH-410

- -11

-11

- -11
,
. .
:
-1,99 +19,99
.
.
26 .
.
RS232 - .
.
.

243


pH-

www.helicon.ru

11.21

- Sartorius PP-15, PP-20, -25


-25 - -
pH-/ pH .
-15, PP-25 . : , , .
:
: 1,0010-9 9,99109.
: 7.

PP-20 - -
pH-/ pH . -15, PP-20 .

:
, /: 0,01 3105.
, : 30 20106.
, ppt: 0,01 42,0.
NaCl, ppt: 0,01 70,0.
TDS, /: 0,005 150 000.
: 5.

PP-15 - -
-
PP-15

Sartorius
. . . .

11

- PP:

-2,00 20,00.

.

26 .

.

.

.

.

244

11.21








pH-

11

.
.
GLP, GMP, ISO.
RS-232 .
, .
( 620 ).
.
, .

PY-11 ( 3M KCL).

-10

-11

PP-15

PP-20

-25

0,00 14,00

-1,99 19,99

-2,00 20,00

0,01

0,001

0,05

0,02

-1 800 1 800

0,1

0,3

0,1

-5 105

0 100

-5 105
0,1

0,4

9
220 /50

165 93 33

230 120 80

270

1 400

0,3
220 ;50
265 200 100
2 000

pH- -10 ,

Sartorius PT-10P

- -11 Y-11

Sartorius PB-11

- PP-15 Y-11

Sartorius PP-15

- PP-20 Y-11

Sartorius PP-20

- -25 Y-11

Sartorius PP-25

245

www.helicon.ru

246

www.helicon.ru

1.1


: Eppendorf (), SSI () ULPlast
(). .

Eppendorf epT.I.P.S
,
.
Eppendorf epT.I.P.S. ,
.

(Thermo Fisher Scientific, Biohit, HTL .).
, , .

01

Eppendorf 4- Eppendorf Quality ( ),


PCR clean ( , -, - ), Eppendorf Biopur ( -, , ), PCR clean ( ).
, ,
.
500 ., , (96 .) .

SSI
,
.
SSI Scientific Specialities Inc. . , ( ) . SSI
.
SSI ( , ) , .
SSI ,

- (Eppendorf, Biohit, Gilson, Thermo Fisher Scientific, Rainin, Finnpipette .). .
SSI 1 000 . 25, 50, 96 100 ( ).

248

1.1

01

Omnitip
.
Omnitip 8 12 10 96 . ( 10, 200
300 ), 6 96 . ( 1 000 ).
,
. .
Omnitip (Eppendorf, Thermo Fisher Scientific, HTL, Gilson, Biohit). , .
Omnitip .
257 .

10
10

, .

Epp 0030 000.811

10

34 , epTIPS Standard

Eppendorf

2 x 500 .

Epp 0030 000.838

20

40 , epTIPS Standard

Eppendorf

2 x 500 .

Epp 0030 000.854

20

46 , epTIPS Standard

Eppendorf

2 x 500 .

SSI-4110-00

10

Gilson-

SSI

1 000 .

SSI-4112-00

10

Gilson-

SSI

96 .

SSI-4120-00

10

Eppendorf-

SSI

1 000 .

SSI-4122-00

10

Eppendorf-

SSI

96 .

HT-10-960

10

, 96 .

ULPlast

10 (960
.)

HT-10-E

-10-960

ULPlast

1 .

SSI-4110-00

SSI-4120-00

Epp 0030 000.811

249

www.helicon.ru

1.1

200
200

, .

Epp 0030 000.870

200

53 , epTIPS Standard

Eppendorf

2 x 500 .

SSI-4220-06 NEW

200

SSI

1 000 .

HT-200-960

200

, 96 .

ULPlast

10
(960 .)

HT-200-E

-200-960

ULPlast

1 .

SSI-4220-06

HT-200-960

HT-200-E

300

300

, .

Epp 0030 000.897

300

55 , epTIPS Standard

Eppendorf

2 x 500 .

SSI-4910

300

SSI

1 000 .

HT-300-960

300

, 96 .

ULPlast

10
(960 .)

HT-300-E

HT-200-960 HT-300-960

ULPlast

1 .

1 000

01

1 000

250

, .

Epp 0030 000.919

1 000

71 , epTIPS Standard

Eppendorf

2 x 500 .

SSI-4330-01

1 000

, ,

SSI

1 000 .

SSI-4331-01

1 000

, ,

SSI

100 .

HT-1000-576

1 000

, 96 .

ULPlast

6
(576 .)

HT-1000-E

HT-1000-576

ULPlast

1 .

1.1

SSI-4910-00

HT-300-960

01

HT-1000-576

5 000
5 000

, .

Epp 0030 000.978

5 000

120 , epTIPS Standard

Eppendorf

500 .

SSI-4410-00

5 000

Gilson/HTL-

SSI

250 .

SSI-4420-00

5 000

Eppendorf/Biohit-

SSI

250 .

LT-5

5 000

Thermoelectron-

Thermo Fisher
Scientific

100 .

SSI-4110-00

SSI-4120-00

LT-5

251

www.helicon.ru

1.1

Omnitip:
1) ( ).
2) . .
3) . ,
.
4) .
, .

01

252

1.2

01


.
. , , ,
, .

epT.I.P.S. DualFilter: .
epT.I.P.S. Dualfilter , . - , , , .
.
, , .
( )
Eppendorf , , .
, , , . .

SSI Unitip
.
ULPlast SSI -
. , . ,
, .
, selfsealing, .
() ( , ).
, SSI ULPlast .

253

www.helicon.ru

1.2

, .

Epp 0030 077.504

10

, 34 ,

Eppendorf

10 96 .

Epp 0030 077.512

10

, 40 ,

Eppendorf

10 96 .

SSI-4112-1FS

0,1-10

SSI

96 .

SSI-4122-1FS

10

SSI

96 .

HT-F96S-010

10

ULPlast

96 .

SSI-4112-SFS

SSI-4122-SFS

Epp 0030 077 512

20
20

, .

Epp 0030 077.520

20

, 46 ,

Eppendorf

10 96 .

Epp 0030 077.539

20

, 53 ,

Eppendorf

10 96 .

SSI-4222A1FS

20

SSI

96 .

HT-F96S-020

20

ULPlast

96 .

SSI-4112-SFS

HT-F96S-020

01

254

Epp 0030 077 520

1.2

01

50-100
50-100

, .

Epp 0030 077.547

100

, 53 ,

Eppendorf

10 96 .

SSI-4222B1FS

100

SSI

96 .

SSI-4222-1FS

150

SSI

96 .

HT-F96S-050

50

ULPlast

96 .

HT-F96S-100

100

ULPlast

96 .

SSI-4112-BSFS

HT-F96S-050

HT-F96S-100

200
200

, .

Epp 0030 077.555

200

, 55 ,

Eppendorf

10 96 .

SSI-4912-1FS

270

SSI

96 .

HT-F96S-200

200

ULPlast

96 .

HT-F96S-200

HT-F96S-200

255

www.helicon.ru

1.2

1 000
1000

, .

Epp 0030 077.571

1 000

, 76 ,

Eppendorf

10 96 .

SSI-4331-1FS

1 000

SSI

100 .

HT-F96S-1000

1 000

ULPlast

96 .

HT-F96S-1000

SSI-4331-SFS

Epp 0030 077.571

* Eppendorf
epMotion, SSI ()
.

01


,
SSI , .

256

, .

SSI-1389

10

,
, 0,37 .

SSI

200 .

SSI-1392

10

,
, 0,57 .

SSI

200 .

SSI-1376

200

,
, 0,37 .

SSI

200 .

1.2

01

Eppendorf

Gilson

High Tech Lab

Thermo Fisher Scientific

LM2;
LM10;VE2;VE10;
DV2; DV10
LM20;DV20
LM200; DV50;
DV100; DV200
LM1000; DV1000
LM5000; DV5000
DV8-300
VE20
VE200
VE1000
L2;L10
L20
L200
L1000
L5000
P2
P10
P20
P100
P200
P1000
P5000
ER-2,5
ER-10
ER-20
ER-100
ER-200
ER-300
ER-1000
ER-5000

Biohit

Biohit

Thermo
x

LT-5

49121FS

43311FS

42221FS

4222B1FS

4222A1FS

x
x

41221FS

41121FS

HT-F96S-1000

HT-F96S-200

SSI

HT-F96S-100

HT-F96S-020

HT-F96S-010

4420

4410

Unitip

4330

4910

4220

4120

x
x
x

x
x

x
x

x
x
x

20-200
250
100-1000
30-300*
10
10
2,0-20
5,0-50
10-100
20-200
100-1000
1-5

x
x

2,0-20
5-50, 10-100,
20-200
100-1000
1-5
30-300*
0,2-20
20-200
100-1000
0,1-2,0
2,0-20
20-200
100-1000
1-5
0,1-2,0
0,5-10
2,0-20
10-100
20-200
100-1000
500-5000
0,1-2,5
0,5-10
2,0-20
10-100
20-200
30-300
100-1000
500-5000
0,5-10
2,0-20
5,0-50
10-100
20-200
100-1000
1-5

HT-1000-576

HT-200/300

HT-10
x

10-100

0,1-2,0

SSI

4110

0,5-10
2,0-20
20-200
100-1000
1-5
1,0-10
2-20; 25

Omnitip

HT-F96-050

x
x

x
x

x
x

x
x

x
x
x
x
x

x
x
x
x

x
x
x
x

x
x
x
x

x
x

x
x

x
x

x
x
x

x
x

x
x
x
x

x
x

x
x

x
x
x

x
x

x
x

x
x
x

x
x

x
x
x

x
x
x

x
x
x

x
x

x
x

x
x

x
x

x
x
x

x
x

x
x
x
x
x

x
x
x

x
x
x

x
x
x

x
x

x
x
x

x
x

x
x

x
x

x
x
x
x
x

x
x

x
x
x
x

x
x

x
x
x

x
x
x

x
x

x
x

257

www.helicon.ru


0,2-0,6

2.1


- Eppendorf SSI.
, ,
, .

Eppendorf
-.
Eppendorf Eppendorf.
(0,19 ) ,
. , ,
. 0,2 ,
. , . 1 000 . ,
(PCR Clean).
, . Eppendorf
.

02

SSI
-.
SSI , . (0,20 ) . Ultraflux , , ,
. Ultraflux
, ( 45) , ,
.
SSI Ultraflux .
SSI - (.
. 262).

258

2.1


0,2-0,6

02

0,2
0,2

Epp 0030 124.332

0,2

Eppendorf

1 000 .

SSI-3225

UltraFlux -

0,2

SSI

1 000 .

SSI-3210

0,2

SSI

1 000 .

SSI-3225

SSI-3210

Epp 0030 124.332

0,2
0,2

Epp 0030 124.359

0,2 , ,
8 .

0,2 8

Eppendorf

120 .

Epp 0030 124.839


twin.tec, 8 .,
12

Eppendorf

120 .

SSI-3111

0,2 , 8 .,

0,2 8

SSI

125 .

SSI-3101-00

SSI, 8 .

SSI

125 .

SSI-3105-00

SSI, 8 .

SSI

125 .

SSI-3131

: SSI-3111
SSI-3101

0,2 8

SSI

125 125 .

SSI-3135

: SSI-3111
SSI-3105

0,2 8

SSI

125 125 .
.

SSI-3247 NEW

0,2 ,
UltraFlux 8 .

0,2 8

SSI

120 .

SSI-3248 NEW

0,2 ,
UltraFlux 8 ., ,

0,2 8

SSI

120 .

SSI-3240

0,2 , 8 ., ,

0,2 8

SSI

120 .

SSI-3245

0,2 , 8 ., ,

0,2 8

SSI

120 .

SSI-3246

0,2 , 8 .,

0,2 8

SSI

120 .

SSI-3235

0,2 , 8 ., ,

0,2 8

SSI

125 .

259

www.helicon.ru
SSI-3105


0,2-0,6

SSI-3111-00

SSI-3240-00

SSI-3240-00

02

SSI-3247-00

SSI-3245-00

SSI- 3248-00

260

SSI-3135-40

2.1

2.1


0,2-0,6

02

0,2
0,2

Epp 0030 128.6**

Epp 0030 128.5**

SSI-3400
SSI-3401
SSI-3441
SSI-3450
SSI-3425
SSI-3410
SSI-3411
SSI-3412
SSI-3510
SSI-3615
SSI-3430
SSI-3435 NEW

96- , twin.tec PCR


Plate, , ,
,

96- , twin.tec PCR


Plate, -,
, ,

,
96-,
,
96-, ,
,
96-, c ,
,
96-, c -
,
96-, c -, ABI-
c
, 96
,
48
,
24
-
-, -
,
384-, c
,
384-, c , ABI-

SSI-3400

0,2 96

Eppendorf

25 ./.

0,2 96

Eppendorf

25 ./.

0,2 96

SSI

10 ./.

0,1 96

SSI

20 ./.

0,1 96

SSI

10 ./.

0,2 96

SSI

10 ./.

0,2 96

SSI

10 ./.

0,2 96

SSI

5 2 ./.

0,2 48

SSI

10 2 ./.

0,2 24

SSI

20 2 ./.

SSI
SSI

10 ./.
100

0,025 384

SSI

10 ./.

0,025 384

SSI

10 ./.

SSI-3401-00

SSI-3411

SSI-3410-00

SSI-3425-00

SSI-3441-00

261


0,2-0,6

www.helicon.ru
SSI-3450-00

3435-00

2.1

Epp 0030 128 605

0,5-0,6
0,5-0,6

Epp 0030 121.023


Epp 0030 124.537
SSI-3320
SSI-1111
SSI-1110

0,5-0,6

Eppendorf

0,50,6

Eppendorf

0,50,6

SSI

0,50,6

SSI

0,50,6

SSI

500 .

500 .

1 000 .

1 000 .

1 000 .

SSI-3225

SSI 3320

SSI-3111

SSI-3401

SSI-3425

SSI-3426

SSI-3441

SSI-3430

SSI-3430

Bio-Rad

iQ5
MiniOpticon
Chromo4
CFX96
CFX384

96
48
96
96
384

+
+
+
+
x

x
x
x
x
x

+
+
+
+
x

+
+
+
x
x

+
+
+
+

+
+
x
x

+
x
x

+
x
x

+
x
+
x
x

x
x
x
x
x

x
x
+
+
x

x
x
x
x
+

MasterCycler ep
realplex

96

GeneAmp SDS 5700


Prism SDS 7000
Prism SDS 7300
Prism SDS 7500
Prism SDS 7500 fast
Prism SDS 7700
Prism SDS 7900
Step One
Step One Plus

96
96
96
96
96
96
96
48
96

+
+
+
+
x
+
x
x
x

x
x
x
x
x
x
x
x
x

+
+
+
+
x
+
x
x
x

+
+
+
+
x
+
x
x
x

+
+
+
+

A
A
A
A
+
A
x
x
x

+
+
+
+
x
+
+
x
x

x
x
x
A
x
x
x

+
+
x
x
x
+
+
x
x

x
x
x
x
x
x
x
+
+

x
x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x
x

Corbet Research

"Rotor-Gene 2000,
3000,6000"

36/72

QIAGEN

Rotor-Gene Q

36/72

Stratagene

MX3000P,MX3005P,
MX4000

96

Eppendorf

02

ABI

SSI-3400

SSI-3248

SSI-3245

SSI-3240

V 0,2 REAL-TIME PCR

: + ; ; ;

262

2.1


0,2-0,6

02

V 0,2

Biorad

PTC-150
Mini
PTC-100
PTC-200
PTC-220
PTC-225
ICycler&MyCycler
C1000
100

16/25
48
60/96
30/48/96/384
30/48/96/384
30/48/96/384
48/96/384
48/96
96

+
+
+
+
+
+
+
x
+

+
+
+
+
+
+

x
+
+
+
+
+
+
x
+

x
+
+
+
+
+
+
x
+

+
+
+
+
+
+

+
+
+
+
+
+
+

x
P
+
+
+
+
+
+
+

x
P
+
+
+
+
A
+
+

x
x
+
+
+
+
+
x
+

x
x
x
x
x
x
x
x

x
x
+
+
+
+
A
+

x
x
+
+
+
+
+
x

77

96

16
25
96
96
384

x
+
+
+
x

+
x
x
x
x

x
x
+
+
x

x
x
+
+
x

+
+
+

+
+

x
x
+
+
x

x
x
+
+
x

x
x
+
+
x

x
x
x
x

x
x
+
+

x
x
x
x
+

96
60
96
384
96
96
60/96/384

+
x
20
x
20
x
x

x
+
x
x
x
x
x

+
x
+
x
+
x
x

+
x
+
x
+
x
x

x
x
+
x
+
x
x

x
x
A
x
A
+
x

+
x
+
x
+
x
+

x
x
x
x
x
x
x

x
x
x
x
x
x
x

x
x
x
+
x
x
+

Corbet Research Palm-Cycler

60/96/384

Stratagene

96

Eppendorf

ABI

MasterCycler & MasterCycler


gradient
MasterCycler & MasterCycler
gradient
MasterCycler personal
MasterCycler personal
MasterCycler ep gradient
MasterCycler ep gradient S
MasterCycler ep 384
GeneAmp 9600
GeneAmp 9700
GeneAmp 9700
GeneAmp 9700
Thermal Cycler 2720
9800 Fast Thermal Cycler
Veriti

Robo-Cycler

SSI-3430

SSI-3441

SSI-3441

SSI-3425

SSI-3401

SSI-3400

SSI-3248

SSI-3245

SSI-3240

SSI-3111

SSI 3320

SSI-3225

: + ; ; ;
20 20
V 0,2

+
+
+
+
+

+
+
+
+
+

x
x
x
x
x

+
+
+
+
+

+
+
+
+
+

x
x
x
x
x

Beckman

CEQ 8000
CEQ 8800

+
+

x
x

x
x

x
x

x
x

x
x

x
x

Amersham

MegaBASE 500
MegaBASE 1000
MegaBASE 4000

x
x
x

x
x
x

x
x
x

+
+
x

x
x
x

x
x
x

x
x
+

SSI-3441

SSI-3410

SSI-3435

+
+
+
+
+

SSI-3425

310
3100
3130
3700
3730

SSI-3450

ABI

SSI-3420

SSI-3400

263


1,5-2

www.helicon.ru

3.1


( 121), ( -80) ( 18 000 g). , ,
. , , . .

. , , .
1,5-2

SSI-1260-00

1,5-1,7

SSI

500 .

SSI-1310-00

2,0

SSI

500 .

SSI-1007-09

SSI

1 .

03

SSI-1310

SSI-1260

264

SSI-1007-09

4.1


0,5-2

04


, 20 000 g, +121
-80. ,
, .
. , , .

0,5-2

SSI-2130
SSI-2140
SSI-2230
SSI-2240



, ,

,
0,5
0,5

SSI
SSI

500 .
500 .

1,5

SSI

500 .

1,5

SSI

500 .

SSI-2330

, ,

2,0

SSI

500 .

SSI-2340

, ,

2,0

SSI

500 .

SSI-2001

SSI

500 .

SSI-2002

SSI

500 .

SSI-2001

SSI-2002

SSI-2140

SSI-2130

SSI-2230

SSI-2240

265


15 50

www.helicon.ru
SSI-2330

5.1

SSI-2340

Falcon

05

,
. . 17 000 g, +121.

Falcon 15-50

266

GR-188271

, , ,
Falcon

15

Greiner Bio-One

100 .

GR-188261

, , ,
Falcon

15

Greiner Bio-One

50 .

GR-227261

, , ,
Falcon

50

Greiner Bio-One

20 .

GR-227270

, , ,
Falcon

50

Greiner Bio-One

25 .

GR-210261

, ,
, Falcon

50

Greiner Bio-One

25 .

GR-210270

,
, Falcon

50

Greiner Bio-One

25 .

6.1

06


, , , .
:
-196 +121.
20 , 121.
:
-90.
15 , 121.

RP-80

1,5-2

80

RP-100

1,5-2

100

SSI-5300-00

- , ,
(32 )

1,52 0,5

32

SSI

SSI-5310-00

- , ,
(64 )

1,52 0,5

64

SSI

SSI-5320-00

- , ,
(96 )

1,52 0,5

96

SSI

SSI-5210-29

-
, , 32 0,2 , 24
- 1,5-2,0 , 16 - 0,5

1,52, 0,5 0,2

32, 24, 16

SSI

SSI-5720

, ,

1-3

81

SSI

SSI-5730

,
,

81

SSI

SSI-5570

,
( 15 )

1015

36

SSI

SSI-5580

,
( 50 )

50

16

SSI

SSI-5410

50, 15, 1,5-2, 0,5

4, 12, 32, 32

SSI

SSI-5210

SSI-5300-00

SSI-5322-29

267

www.helicon.ru
SSI-5410

RP-100

SSI-5720

6.2

SSI-5580

SSI-5730-19

PR-80

0,2

96

SSI

0,2

96

SSI

1,52 0,5

20

SSI

1,52 0,5

20

SSI

SSI-5010


1,52 0,5
-

24

SSI

SSI-5100-43

24

SSI

SSI-5640-T6

SSI-5640-T4
SSI-5610-43
SSI-5610-40

IsoFreeze ,
, +7C x 3,5 , , T
+7C
IsoFreeze ,
, +7C x 3,5 , , T
+7C
IsoFreeze , -20C x 3 ,

IsoFreeze , 0C x 3 ,

06

SSI-5010

SSI-5100-43

268

1,52

SSI-5610-40-43

6.3

06


RA RBA . . . RBA .

RA-20002

0,2

10 20

RA-5005

0,5

5 10

RA-10005

0,5

10 10

RA-20005

0,5

10 20

RBA-20005

0,5

10 20

RA-30005

0,5

10 30

RA-5015

1,5

5 10

RBA-5015

1,5

5 10

RA-7215

1,5

6 12

RBA-12015

1,5

10 12

RA-7215

RA-20002

RA-20005

269


/ T-

www.helicon.ru

7.1


. .
:

(F), V U-.
( ).
96- 8 (12) .
.

.
.

GR-655001

96-

Greiner Bio-One

5 .

GR-655061

96-

Greiner Bio-One

5 .

GR-762071

96- , (12
8 )

Greiner Bio-One

5 .

GR-762070

96- , (12
8 )

Greiner Bio-One

5 .

- ( )
1,2 , (-) , .
-, , .

, , -80
( ).
: , , .

07

- ( )

270

SSI-1710-00

1,2

SSI

1 000 .

SSI-1750-00

1,2

SSI

96 .

SSI-1702-00

- 1,2 ,
8 .

SSI

125 .

8.1

08


. , ,
.

GR-627102

35 10

Greiner Bio-One

10 .

GR-628102

60 15

Greiner Bio-One

20 .

GR-633185

94 15

Greiner Bio-One

20 .

GR-663102

100 15

Greiner Bio-One

20 .


. , .
, .
. ,
. .

GR-604181

( 0,01 )

Greiner Bio-One

GR-710180

( 0,01 )

Greiner Bio-One

GR-606180

( 0,1 )

Greiner Bio-One

GR-607180

( 0,1 )

10

Greiner Bio-One

GR-760180

( 0,2 )

25

Greiner Bio-One

GR-768180

( 0,5 )

50

Greiner Bio-One

271

www.helicon.ru

9.1


. Greiner Bio-One 1,0 5,0
. +121 17 000 g. -.
. , .
.
, .
,
.
Greiner Bio-One , .

09

272

GR-123***

,
, 12,5 42

1,0-1,2

Greiner Bio-One

100 .

GR-121***

,
1,8-2,0
, 12,5 48

Greiner Bio-One

100 .

GR-126***

,
, 12,5 47

2,0-2,2

Greiner Bio-One

100 .

GR-127***

,
, 12,5 83

3,5-4,0

Greiner Bio-One

50 .

GR-124***

,
, 12,5 86

4,5-5,0

Greiner Bio-One

50 .

10.1

10

, : 2, 3, 4.
.
( ).

GR-627160

35 10

Greiner Bio-One

10 .

GR-628160

60 15

Greiner Bio-One

10 .

GR-664160

100 20

Greiner Bio-One

15 .


.
, . 96, 48, 24, 12 6-

GR-657160

6- ,

Greiner Bio-One

GR-665180

12- ,

Greiner Bio-One

GR-662160

24- ,

Greiner Bio-One

GR-677180

48-, ,

Greiner Bio-One

GR-655180

96-, ,

Greiner Bio-One

273

www.helicon.ru

10.2


, . .
:
.
( ).
( ).

, 2

GR-690160

50

25

Greiner Bio-One

10 .

GR-658170

250

75

Greiner Bio-One

5 .

GR-660160

550

175

Greiner Bio-One

5 .

GR-661160

650

175

Greiner Bio-One

4 .

(153 )

10

( ). .

(153 )

274

GR-700370

0,1

Greiner Bio-One

500 .

GR-700361

, ,

0,1

Greiner Bio-One

25 .

GR-612301

, ,

2,5

Greiner Bio-One

500 .

GR-612361

, ,

2,5

Greiner Bio-One

11.1

11

(, )
, .

DG-XS
DG-S
DG-L
DG-M
DG-XL

XS
S
L
M
XL

WRP

50

Eco EG-XS
Eco EG-S
Eco EG-L
Eco EG-M
Eco EG-XL

, ,

XS
S
L
M
XL

Heliomed

50

MANUAL SN209-S
MANUAL SN209-L
MANUAL SN209-M
MANUAL SN209-XL

, ,

S
L
M
XL

Heliomed

50

MANUAL NP409-L
MANUAL NP409-M

, ,

L
M

Heliomed

50

MANUAL SV609-S
MANUAL SV609-L
MANUAL SV609-M

, ,

S
L
M

Heliomed

50

(Parafilm M)
. 10 38 ,
.
(Parafilm M)

, ,

PM996

Parafilm M

0,01 38

Pechiney Plastic
Packaging
Company

275

www.helicon.ru

276

www.helicon.ru

,
Invitrogen

1.1

Life Technologies (Invitrogen)


Invitrogen , :

:
.
.
.
.
:
.
.
.
.
.

.
, Invitrogen:
(, TRIzol) , , .
(silica) PureLink 10
. ( HiPure)
. silica
maxiprep- BenchPro 2100 (. ).
ChargeSwitch , , ,
- , pH .
Dynabeads , (, dT25 ).

10503027

DNAzol

100

10974020

DNAzol BD

100

Plant DNAzol

100

PureLink Mini

mini
, .. 1 .
0,5 .

K182104A

PureLink Pro 96

4 96

K183001

PureLink

50

CS11209

ChargeSwitch Direct

8-

/ ChargeSwitch.

. .

96

10978021
K182000
K182001
K182002

CS11205
CS11206
CS11301
CS18000

01

CS1800010

278

ChargeSwitch Direct

96-
ChargeSwitch Mini

mini

ChargeSwitch

10
50
250

1
10
50
96
960

1.1

,
Invitrogen

01


K210002

PureLink HiPure
(Miniprep)

miniprep .

25

PureLink HiPure
(Midiprep)

midiprep .

25

PureLink HiPure Filter


(Midiprep)

midiprep
.

25

PureLink HiPure
(Maxiprep)

maxiprep .

10

PureLink HiPure Filter


(Maxiprep)

maxiprep
.

10

PureLink HiPure FP (Maxiprep)

maxiprep ,
10
.
60 25

K210008

PureLink HiPure
(Megaprep)

megaprep .
2,5

K210009

PureLink HiPure
(Gigaprep)

gigaprep .
10

K210096

PureLink HQ Mini
96-

30

4 96

ChargeSwitch NoSpin Micro


-

20

ChargeSwitch Mini

S. cerevisiae
ChargeSwitch

K210003
K210004
K210005
K210014
K210015
K210006
K210007
K210016
K210017
K210026
K210027

CS10201
CS1020110
CS10203

100
50
50
25
25

96
960
50


K210012
K210025
K220001

50

PureLink Quick

15 TAE TBE

PureLink Quick Combo



250
50


K310001
K310002


<100 <300 ..
10 .

PureLink

50
250


15596026

100

TRIzol

TRIzol LS

100

TRIzol Max

TRIzol + Max

(100+20)

PureLink Micro Scale


100
1 105 15 .

PureLink Mini

mini 1 20
PureLink /

12183555


TRIzol Plus

PureLink Mini + TRIzol .


50

CS14010

ChargeSwitch

15596018
10296010
10296028
16096020
16096040
12183016
12183020
12183018A

200

200
(200+2 x 20)
50
10
50

50

279

www.helicon.ru

,
Invitrogen

1.1

K155002

RiboMinus

9598%

K155003

RiboMinus

9598%

12

K155004

RiboMinus

9598%

12

K155005

RiboMinus


RiboMinus

A1083708

RiboMinus
99,9%
RNA-Seq


61006
61011
61012

Dynabeads

dT25
2
15 . 5 .

Dynabeads DIRECT


dT25 15 .
5 .

5
10


K157001

PureLink

12280050

PureLink

10 500

50

37011D

Dynabeads SILANE


(, HBV).

96

25

01

DynaMag, .

280

12321D

DynaMag-2

16 1,5 2 .
. 0,4

12320D

DynaMag-Spin

6 1,5

12331D

DynaMag-96 Side

96- .
. 13-

12332D

DynaMag-96 Bottom

96- .

CS15000

MagnaRack

, DynaMag.
ChargeSwitch. 24

CS15096

96-

ChargeSwitch

1.1

,
Invitrogen

01

Life Technologies (Invitrogen)


Qubit (. - )
-, Invitrogen
Quant-iT .

P7581

Quant-iT PicoGreen

0,2100 .
Ex/Em=502/523

1 =2 000

P7589

Quant-iT PicoGreen

Quant-iT PicoGreen+TE+

2 000

O7582

Quant-iT OliGreen

1200 . Ex/
Em=498/518

1 =2 000

O11492

Quant-iT OliGreen

Quant-iT OliGreen+TE+

2 000

R11491

Quant-iT RiboGreen

201000 . Ex/Em=500/525

1 =2 000

R11490

Quant-iT RiboGreen

Quant-iT RiboGreen+TE+

2 000

SYBR . .

281

www.helicon.ru

Fermentas

1.2


Thermo Fisher Scientific (Fermentas)

02

(15-25 ) (80-95%) , ( 25 20000 ), ,


( 200 ) , , ,
.

282

K0502
(K0503)


GeneJet

20
E. coli.
50 (250 ).

K0701
(K0702)


GeneJet

25 - 25
20000 .
50 (250 ).

K0721
(K0722)


GeneJET

, ,

.
50 (250 ).

K0512

,
, , ,

. 100
.

K0731
(K0732)


GeneJET

-
200 ,
, ,
. 50 (250
).

K0691
(K0692)


GeneJET

- 25
20000
. 50 (250
).

K0513


Silica Bead

- 100

. 100
.

EO0461


.
5 . 5 ./.

2.1

02


Thermo Fisher Scientific (Fermentas)
(FastDigest Restriction Endonucleases) , , .
FastDigest 0,2-1 , , , , - 5-15 37o.
. , FastDigest.
,
. FastDigestGreen , .
:
- ;
- - ;
- ;
- - ;
- - .
-20, FastDigest NlaIII ( Hin1II), -70.

1991


FastDigest

13
: BamHI, BglII, EcoRI, EcoRV
(Eco32I), HindIII, KpnI, NdeI, NotI, PstI, SalI, SmaI, XbaI, XhoI.
10 .

10 x FastDigest (1 ) 10 x FastDigest Green (1 ).

FD0994

FastDigest AatII

- GACGT^C.
- AatII.
- 50 .

FD0904

FastDigest Acc65I

- G^GTACC.
- KpnI (GGTAC^C).
- 100 .

FD1484

FastDigest AccI

- GT^(C/A)(G/T)AC.
- XmiI.
- 50 .

FD1794

FastDigest AciI

- C^CGC.
- SsiI.
- 20 .

FD0944

FastDigest AclI

- AA^CGTT.
- Psp1406I.
- 20 .

FD0344

FastDigest AcuI

- CTGAAG(N)16/14^.
- Eco57I.
- 20 .

FD0324

FastDigest AfeI

- AGC^GCT.
- Eco47III.
- 20 .

FD0834

FastDigest AflII

- C^TTAAG.
- BspTI.
- 150 .

FD1464

FastDigest AgeI

- A^CCGGT.
- BshTI.
- 20 .

FD1954

FastDigest AjuI

- ^7/12(N)GAA(N)7TTGG(N)11/6^.
- AjuI.
- 20 .

283

02

www.helicon.ru

284

FD1634

FastDigest AleI

- CACNN^NNGTG.
- OliI.
- 20 .

FD0014

FastDigest AluI

- AG^CT.
- AluI.
- 100 .

FD0024

FastDigest Alw21I

- G(T/A)GC(T/A)^C.
- BsiHKAI.
- 100 .

FD0034

FastDigest Alw26I

- GTCTC(N)1/5^.
- BsmAI.
- 100 .

FD1394

FastDigest AlwNI

- CAGNNN^CTG.
- CaiI.
- 50 .

FD1414

FastDigest ApaI

- GGGCC^C.
- ApaI.
- 300 .

FD0044

FastDigest ApaLI

- G^TGCAC.
- Alw44I.
- 200 .

FD1894

FastDigest AscI

- GG^CGCGCC.
- SgsI.
- 100 .

FD0914

FastDigest AseI

- AT^TAAT.
- VspI.
- 200 .

FD2094

FastDigest AsiSI

- GCGAT^CGC.
SfaAI.
- 100 .

FD0384

FastDigest AvaI

- C^(C/T)CG(G/A)G.
- Eco88I.
- 200 .

FD0314

FastDigest AvaII

- G^G(T/A)CC.
- Eco47I.
- 200 .

FD1564

FastDigest AvrII

- C^CTAGG.
- XmaJI.
- 20 .

FD0054
(FD0055)

FastDigest BamHI

- G^GATCC.
- BamHI.
- 800 .
( - 2500 ).

FD1004

FastDigest BanI

- G^G(C/T)(G/A)CC.
- BshNI.
- 300 .

FD1014

FastDigest BbsI

- GAAGAC(N)2/6^.
- BpiI.
- 20 .

FD2074

FastDigest BbvI

- GCAGC(N)8/12^.
- Lsp1109I.
- 100 .

FD0724

FastDigest BclI

- T^GATCA.
- BclI.
- 300 .

FD1764

FastDigest BfaI

- C^TAG.
- FspBI.
- 50 .

FD0074

FastDigest BglI

- GCCNNNN^NGGC.
- BglI.
- 200 .

2.1

2.1

FD0083
(FD0084)

FastDigest BglII

- A^GATCT.
BglII. - 100 .
( - 200 ).

FD0094

FastDigest BlpI

- GC^TNAGC.
- Bpu1102I.
- 50 .

FD1444

FastDigest Bme1580I

- G(T/G)GC(C/A)^C.
- BseSI.
- 50 .

FD2044

FastDigest BmtI

- GCTAG^C.
- BspOI.
- 20 .

FD1314

FastDigest BplI

- ^8/13(N)GAG(N)5CTC(N)13/8^.
- BplI.
- 20 .

FD0464

FastDigest BpmI

- CTGGAG(N)16/14^.
- GsuI.
- 20 .

FD1184

FastDigest Bpu10I

- CCTNAGC(N)-5/-2^.
- Bpu10I.
- 20 .

FD1974

FastDigest BsaAI

- (C/T)AC^GT(G/A).
- Ppu21I.
- 50 .

FD1714

FastDigest BsaBI

- GATNN^NNATC.
- BseJI.
- 200 .

FD0474

FastDigest BsaHI

- G(G/A)^CG(C/T)C.
- Hin1I.
- 100 .

FD1084

FastDigest BsaJI

- C^CNNGG.
- BseDI.
- 20 .

FD0874

FastDigest BseGI

- GGATG(N)2/0^.
- FokI.
- 100 .

FD0884

FastDigest BseNI

- ACTGG(N)1/-1^.
- BsrI.
- 100 .

FD1454

FastDigest BseXI

- GCAGC(N)8/12^.
- BseXI.
- 20 .

FD0924

FastDigest Bsh1236I

- CG^CG.
- FnuDII.
- 100 .

FD0894

FastDigest BsiEI

- CG(G/A)(C/T)^CG.
- Bsh1285I.
- 100 .

FD0854

FastDigest BsiWI

- C^GTACG.
- Pfl23II.
- 50 .

FD1204

FastDigest BslI

- CCNNNNN^NNGG.
- BseLI.
- 100 .

FD0454

FastDigest BsmBI

- CGTCTC(N)1/5^.
- Esp3I.
- 20 .

FD1814

FastDigest BsmFI

- GGGAC(N)10/14^.
- FaqI.
- 20 .

FD0124

FastDigest Bsp119I

- TT^CGAA.
- AsuII.
- 200 .

02

285

02

www.helicon.ru

286

FD0134

FastDigest Bsp120I

- G^GGCCC.
- ApaI (GGGCC^C).
- 200 .

FD0654

FastDigest Bsp1286I

- G(A/G/T)GC(T/C/A)^C.
- SduI.
- 50 .

FD0933
(FD0934)

FastDigest Bsp1407I

- T^GTACA.
- Bsp1407I.
- 50 .
( - 100 ).

FD1404

FastDigest BspCNI

- CTCAG(N)9/7^.
- BseMII.
- 20 .

FD1284

FastDigest BspHI

- T^CATGA.
- PagI.
- 50 .

FD1744

FastDigest BspMI

- ACCTGC(N)4/8^.
- BveI.
- 50 .

FD1274

FastDigest BsrBI

- GAG^CGG.
- MbiI.
- 100 .

FD1264

FastDigest BsrDI

- GCAATG(N)2/0^.
- BseMI.
- 20 .

FD0184

FastDigest BsrFI

- (G/A)^CCGG(C/T).
- Cfr10I.
- 50 .

FD2134

FastDigest BssHII

- G^CGCGC.
- PteI, BsePI.
- 20 .

FD1024

FastDigest BstXI

- CCANNNNN^NTGG.
- BstXI.
- 100 .

FD0704

FastDigest BstZ17I

- GTA^TAC.
- Bst1107I.
- 100 .

FD0374

FastDigest Bsu36I

- CC^TNAGG.
- Eco81I.
- 50 .

FD0143
(FD0144)

FastDigest ClaI

- AT^CGAT.
- Bsu15I.
- 50 .
( - 100 ).

FD0214

FastDigest Csp6I

- G^TAC.
- RsaI (GT^AC).
- 100 .

FD1884

FastDigest DdeI

- C^TNAG.
- HpyF3I.
- 50 .

FD1703
(FD1704)

FastDigest DpnI

- GA^TC.
- DpnI.
- 50 .
( - 100 ).

FD0224

FastDigest DraI

- TTT^AAA.
- AhaIII.
- 200 .

FD1234

FastDigest DraIII

- CACNNN^GTG.
- AdeI.
- 50 .

FD1724

FastDigest DrdI

- GACNNNN^NNGTC.
- Aasl.
- 25 .

2.1

2.1

FD0334

FastDigest EagI

- C^GGCCG.
- Eco52I.
- 50 .

FD0244

FastDigest Eam1105I

- GACNNN^NNGTC.
- Eam1105I.
- 100 .

FD0234

FastDigest EarI

- CTCTTC(N)1/4^.
- Eam1104I.
- 50 .

FD0254

FastDigest Ecl136II

- GAG^CTC.
- SacI (GAGCT^C).
- 100 .

FD0293
(FD0294)

FastDigest Eco31I

- GGTCTC(N)1/5^.
- Eco31I. - 50 .
( - 100 ).

FD0394

FastDigest Eco91I

- G^GTNACC.
- BstEII.
- 200 .

FD1304

FastDigest EcoNI

- CCTNN^NNNAGG.
- XagI.
- 100 .

FD0264

FastDigest EcoO109I

- (G/A)G^GNCC(C/T).
- EcoO109I.
- 200 .

FD0274
(FD0275)

FastDigest EcoRI

- G^AATTC.
- EcoRI.
- 800 .
( - 2500 ).

FD0303
(FD0304)

FastDigest EcoRV

- GAT^ATC.
- Eco32I.
- 200 .
( - 400 ).

FD0443
(FD0444)

FastDigest EheI

- GGC^GCC.
NarI (GG^CGCC).
- 20 .
( - 50 ).

FD1644

FastDigest Fnu4HI

- GC^NGC.
- SatI.
- 20 .

FD2144

FastDigest FokI

- GGATG(N)9/13^.
- FokI.
- 100 .

FD1664

FastDigest FspAI

- (G/A)TGC^GCA(C/T).
- FspAI.
- 20 .

FD1224

FastDigest FspI

- TGC^GCA.
- NsbI.
- 50 .

FD2184

FastDigest HaeII

- (G/A)GCGC^(C/T).
- BfoI.
- 200 .

FD0154

FastDigest HaeIII

- GG^CC.
- BsuRI.
- 400 .

FD1904

FastDigest HgaI

- GACGC(N)5/10^.
- CseI.
- 20 .

FD1854

FastDigest HhaI

- GCG^C.
- HhaI.
- 200 .

FD0494

FastDigest HincII

- GT(C/T)^(G/A)AC.
- HindII.
- 100 .

02

287

02

www.helicon.ru

288

FD0504
(FD0505)

FastDigest HindIII

- G^ANTC.
- HinfI.
- 400 .

FD0804

FastDigest HinfI

- G^CGC.
- Hin6I
- 200 .

FD0484

FastDigest HinP1I

- GTT^AAC.
- KspAI.
- 50 .

FD1034

FastDigest HpaI

- C^CGG.
- HpaII.
- 200 .

FD0514

FastDigest HpaII

- GTN^NAC.
- MjaIV.
- 20 .

FD1574

FastDigest Hpy8I

- GCNNNNN^NNGC.
- MwoI.
- 20 .

FD1734

FastDigest HpyF10VI

- T^CCGGA.
- BspMII.
- 100 .

FD0534

FastDigest Kpn2I

- GGTAC^C.
- KpnI.
- 300 .

FD0524

FastDigest KpnI

- CG^CGCGCG.
- MauBI.
- 20 .

FD2084

FastDigest MauBI

- ^GATC.
- MboI.
- 50 .

FD0814

FastDigest MboI

-GAAGA(N)8/7^.
- MboII.
- 50 .

FD0824

FastDigest MboII

- C^AATTG.
- MunI.
- 20 . ( - 50 ).

FD0753
(FD0754)

FastDigest MfeI

- A^CGCGT.
- MluI.
- 100 .

FD0564

FastDigest MluI

- GAGTCNNNNN^.
- SchI.
- 100 .

FD1374

FastDigest MlyI

- CCTC(N)7/6^.
- MnlI.
- 50 .

FD1074

FastDigest MnlI

- CG^CCGGCG.
- Sse232I.
- 20 .

FD2024

FastDigest MreI

- TGG^CCA.
- MlsI.
- 50 .

FD1214

FastDigest MscI

- T^TAA.
- SaqAI.
- 50 .

FD2174

FastDigest MseI

- CA(C/T)NN^NN(G/A)TG.
- RseI.
- 20 .

FD2004

FastDigest MslI

- GACNNNN^NNGTC.
- Aasl.
- 25 .

FD0544

FastDigest MspI

- C^CGG.
- HpaII.
- 400 .

2.1

2.1

FD1344

FastDigest MssI

- GTTT^AAAC.
- PmeI.
- 100 .

FD0964

FastDigest Mva1269I

- GAATGC(N)1/-1^.
- BsmI.
- 50 .

FD0554

FastDigest MvaI

- CC^(A/T)GG.
- EcoRII (^CC(A/T)GG).
- 200 .

FD1524

FastDigest NaeI

- GCC^GGC.
- PdiI.
- 50 .

FD0064

FastDigest NciI

- CC^(C/G)GG.
- BcnI.
- 200 .

FD0573
(FD0574)
(FD0575)

FastDigest NcoI

- C^CATGG.
- 20 .
( - 100 ).
( - 300 ).

FD0583
(FD0584)
(FD0585)

FastDigest NdeI

- CA^TATG.
- NdeI. - 100 .
( - 300 .)
( - 1000 .)

FD0973
(FD0974)

FastDigest NheI

- G^CTAGC.
- NheI.
- 50 .
( - 100 .)

FD1834

FastDigest NlaIII

- CATG^.
- Hin1II.
- 100 .
: -70o

FD1154

FastDigest NlaIV

- GGN^NCC.
- BspLI.
- 20 .

FD1514

FastDigest NmuCI

- ^GT(G/C)AC.
- Tsp45I.
- 20 .

FD0593
(FD0594)
(FD0595)
(FD0596)

FastDigest NotI

- GC^GGCCGC.
- NotI.
- 20 .
( - 50 .)
( - 150 .)
( - 250 .)

FD2154

FastDigest NruI

- TCG^CGA.
- RruI.
- 100 .

FD0734

FastDigest NsiI

- ATGCA^T.
- Mph1103I.
- 100 .

FD1474

FastDigest NspI

- (G/A)CATG^(C/T).
- XceI.
- 50 .

FD2204

FastDigest PacI

- TTAAT^TAA.
- PacI.
- 25 .

FD1534

FastDigest PdmI

- GAANN^NNTTC.
- XmnI.
- 100 .

FD0714

FastDigest PflMI

- CCANNNN^NTGG.
- Van91I.
- 100 .

FD1754

FastDigest PfoI

- T^CCNGGA.
- PfoI.
- 20 .

02

289

02

www.helicon.ru

290

FD0364

FastDigest PmlI

- CAC^GTG.
- Eco72I.
- 200 .

FD0764

FastDigest PpuMI

- (G/A)G^G(A/T)CC(C/T).
- Psp5II.
- 50 .

FD1434

FastDigest PshAI

- GACNN^NNGTC.
- BoxI.
- 100 .

FD2064

FastDigest PsiI

- TTA^TAA.
- AanI.
- 20 .

FD2224

FastDigest PspFI

- CCCAG^C.
- PspFI.
- 20 .

FD0614
(FD0615)

FastDigest PstI

- CTGCA^G.
- PstI.
- 800 .
( - 2500 ).

FD1554

FastDigest PsuI

- (G/A)^GATC(C/T).
- PsuI.
- 150 .

FD1334

FastDigest PsyI

- GACN^NNGTC.
- PsyI.
- 100 .

FD0624

FastDigest PvuI

- CGAT^CG.
- PvuI.
- 20 .

FD0634

FastDigest PvuII

- CAG^CTG.
- PvuII.
- 400 .

FD1124

FastDigest RsaI

- GT^AC.
- RsaI.
- 100 .

FD0744

FastDigest RsrII

- CG^G(A/T)CCG.
- CpoI.
- 20 .

FD1133
(FD1134)

FastDigest SacI

- GAGCT^C.
- SacI.
- 100 .
( - 200 ).

FD0644

FastDigest SalI

- G^TCGAC.
- SalI.
- 200 .

FD2164

FastDigest SanDl

- GG^G(A/T)CCC.
- KflI.
- 20 .

FD1934

FastDigest SapI

- GCTCTTC(N)1/4^.
- LguI.
- 20 .

FD0784

FastDigest Sau3AI

- ^GATC.
- Bsp143I, MboI.
- 40 .

FD0194

FastDigest Sau96I

- G^GNCC.
- Cfr13I.
- 100 .

FD1194

FastDigest SbfI

- CCTGCA^GG.
- SdaI.
- 20 .

FD0434

FastDigest ScaI

- AGT^ACT.
- ScaI.
- 100 .

2.1

2.1

FD1424

FastDigest ScrFI

- CC^NGG.
- Bme1390I.
- 100 .

FD2114

FastDigest SexAI

- A^CC(A/T)GGT.
- CsiI.
- 50 .

FD2124

FastDigest SfaNI

- GCATC(N)5/9^.
- BmsI.
- 20 .

FD1164

FastDigest SfcI

- C^T(G/A)(C/T)AG.
- BfmI.
- 20 .

FD1824

FastDigest SfiI

- GGCCNNNN^NGGCC.
- SfiI.
- 150 .

FD0663
(FD0664)

FastDigest SmaI

- CCC^GGG.
- SmaI.
- 100 .
( - 200 ).

FD0404

FastDigest SnaBI

- TAC^GTA.
- Eco105I.
- 50 .

FD1253
(FD1254)

FastDigest SpeI

- A^CTAGT.
- BcuI.
- 20 .
( - 50 ).

FD0604

FastDigest SphI

- GCATG^C.
- PaeI.
- 20 .

FD0774

FastDigest SspI

- AAT^ATT.
- SspI.
- 100 .

FD0424

FastDigest StuI

- AGG^CCT.
- Eco147I.
- 100 .

FD0414

FastDigest StyI

- C^C(A/T)(A/T)GG.
- Eco130I.
- 200 .

FD1244

FastDigest SwaI

- ATTT^AAAT.
- SmiI.
- 200 .

FD1364

FastDigest TaaI

- ACN^GT.
- Tsp4CI.
- 20 .

FD1144

FastDigest TaiI

- ACGT^.
- MaeII (A^CGT).
- 50 .

FD0674

FastDigest TaqI

- T^CGA.
- TaqI.
- 400 .

FD1294

FastDigest TatI

- (A/T)^GTAC(A/T).
- TatI.
- 20 .

FD1654

FastDigest TauI

- GC(C/G)G^C.
- TauI.
- 20 .

FD1784

FastDigest TfiI

- G^A(A/T)TC.
- PfeI.
- 50 .

FD0984

FastDigest Tru1I

- T^TAA.
- MseI.
- 50 .

02

291

02

www.helicon.ru

292

FD1354

FastDigest Tsp509I

- ^AATT.
- TasI.
- 100 .

FD2104

FastDigest TspRI

- NNCA(G/C)TGNN^.
- TscAI.
- 100 .

FD1383
(FD1384)

FastDigest XapI

- (G/A)^AATT(C/T).
- ApoI.
- 50 .
( - 100 ).

FD0684
(FD0685)

FastDigest XbaI

- T^CTAGA.
- XbaI.
- 300 .
( - 750 ).

FD0694
(FD0695)

FastDigest XhoI

- C^TCGAG.
- XhoI.
- 400 .
( - 1200 ).

2.1

2.2

02

Thermo Fisher Scientific (Fermentas)


. :
, , ;
, , ;
.
. -,
- .
(.a.) , 1
60 50 .
.
-20o, Hin1II ( NlaIII), -70o.

Aanl

- TTA^TAA.
Psil.
- 200 ..
- 10 ../.

ER1581
(ER1582)

AarI

- CACCTGC(N)4/8^.
- AarI
- 25 ..
( - 125 ..)
1-3 ../.

ER1721

AasI

- GACNNNN^NNGTC.
- DrdI.
- 300 ..
- 10 ../.

AatII

- GACGT^C.
- AatII.
- 300 ..
( - 1500 ..)
- 10 ../.

Acc65I

- CACNNN^GTG.
- KpnI (GGTAC^C).
- 1000 ..
( - 5000 ..)
- 10 ../.

AdeI

- CACNNN^GTG.
DraIII.
- 500 ..
- 10 ../.

ER1941

Ajil

- CAC^GTC.
BmgBI.
- 200 ..
- 5 ../.

ER1951

Ajul

- ^7/12(N)GAA(N)7TTGG(N)11/6^.
AjuI.
100 ..
- 5 ../.

ER1801

AlfI

- ^10/12(N)GCA-(N)6TGC(N)12/10^.
AflI
- 50 ..
- 2 ../.

ER1491

AloI

- ^7/12-13(N)GAAC(N)6TCC(N)12/-13/7^.
AloI
100 ..
- 2 ../.

ER2061

ER0991
(ER0992)

ER0901
(ER0902)

ER1231

293

www.helicon.ru

ER0011
(ER0012)

AluI

- AG^CT.
AluI
600 ..
( 3000 ..)
- 10 ../.

ER0021

Alw21I

- G(T/A)GC(T/A)^C.
- BsiHKAI
500 ..
- 10 ../.

Alw26I

- GTCTC(N)1/5^.
BsmAI.
1000 ..
- 10 ../.

Alw44I

- G^TGCAC.
ApaLI.
1000 ..
- 10 ../.

ApaI

- GGGCC^C.
ApaI.
3000 ..
( 5000 ..)
- 10 ../.

BamHI (BamHI )

- G^GATCC.
- BamHI 4000 ..
( 5 x 4000 ..)
- 10 ../.
( 20000 ..
- 50 ../).

BauI

- C^ACGAG.
BssSI.
200 ..
- 10 ../.

ER0721
(ER0722)
(ER0725)

BclI

- T^GATCA.
BclI.
1000 ..
( 5000 ..)
( 3000 ..)
- 10 ../.

ER0061

BcnI

- CC^(C/G)GG.
NciI.
1000 ..
- 10 ../.

BcuI

- A^CTAGT.
SpeI.
400 ..
( 2000 ..)
- 10 ../.

Bdal

- ^10/12(N)TGA(N)6TCA(N)12/10^.
BdaI.
50 ..
- 1-3 e.a./.

BfiI

- ACTGGG(N)5/4^.
BmrI.
50 ..
- 2 ../.

ER1161
(ER1162)

BfmI

- C^T(G/A)(C/T)AG.
SfcI.
200 ..
( 1000 ..)
- 10 ../.

ER1501

BfuI

- GTATCC(N)6/5^.
BciVI.
100 ..
- 5 ../.

ER0031

ER0041

ER1411
(ER1415)

ER0051
(ER0052)
(ER0053)

ER1841

ER1251
(ER1252)

ER1961

02

ER1591

294

2.2

2.2

BglI

- GCCNNNN^NGGC.
BglI.
2000 ..
( 5 2000 ..)
- 10 ../.

BglII

- A^GATCT.
BglII.
500 ..
( 2500 ..)
- 10 ../.

Bme1390I

- CC^NGG.
ScrFI.
500 ..
( 2500 ..)
- 10 ../.

BoxI

- GACNN^NNGTC.
PshAI.
500 ..
- 10 ../.

BpiI

- GAAGAC(N)2/6^.
BbsI.
200 ..
( 1000 ..)
- 10 ../.

ER1311
(ER1312)

BplI

- ^8/13(N)GAG(N)5CTC(N)13/8^.
BplI.
100 ..
( 500 ..)
- 5 ../.

ER1181

Bpu10I

- CCTNAGC-5/-2^.
Bpu10I.
200 ..
- 5 ../.

Bpu1102I

- GC^TNAGC.
BlpI.
200 ..
( 1000 ..)
- 10 ../.

BseDI

- C^CNNGG.
BsaJI.
300 ..
( 1500 ..)
- 10 ../.

BseGI

- GGATG(N)2/0^.
FokI.
500 ..
( 2500 ..)
- 10 ../.

ER1711

BseJI

- GATNN^NNATC.
BsaBI.
2000 ..
- 10 ../.

ER1201

BseLI

- CCNNNNN^NNGG.
BslI.
500 ..
- 10 ../.

BseMI

- GCAATG(N)2/0^.
BsrDI.
100 ..
( 500 ..)
- 5 ../.

BseMII

- CTCAG(N)10/8^ .
BspCNI.
100 ..
- 1 ../.

ER0071
(ER0072)

ER0081
(ER0082)

ER1421
(ER1422)

ER1431

ER1011 (ER1012)

ER0091 (ER0092)

ER1081
(ER1082)

ER0871
(ER0872)

ER1261 (ER1262)

ER1401

02

295

www.helicon.ru

ER0881
(ER0882)

BseNI

- ACTGG(N)1/-1^.
BsrI.
1000 ..
( 5000 ..)
- 10 ../.

ER1441

BseSI

- G(T/G)GC(C/A)^C.
- Bme1580I.
500 ..
10 ../.

BseXI

GCAGC(N)8/12^.
BbvI.
100 ..
( 500 ..)
- 3 ../.

Bsh1236I

- CG^CG.
BstUI.
500 ..
( 2500 ..)
- 10 ../.

Bsh1285I

- CG(G/A)(C/T)^CG.
BsiEI.
600 ..
- 10 ../.

BshNI

- G^G(C/T)(G/A)CC.
BanI.
2000 ..
- 10 ../.

BshTI

- A^CCGGT.
AgeI.
200 ..
( 1000 ..)
- 10 ../.

Bsp119I

- TT^CGAA.
BstBI.
2500 ..
- 10 e.a./.

Bsp120I

- G^GGCCC.
ApaI.
1500 ..
- 10 ../.

Bsp1407I

- T^GTACA.
BsrGI.
300 ..
( 1500 ..)
- 10 ../

ER0781
(ER0782)

Bsp143I

- ^GATC.
- Sau3AI.
300 ..
( 1500 ..)
- 10 ../.

ER0111

Bsp68I

- TCG^CGA.
NruI.
800 ..
- 10 ../.

BspLI

- GGN^NCC.
NlaIV.
200 ..
( 1000 ..)
- 10 ../.

BspOI

- GCTAG^C.
BmtI.
200 ..
- 10 ../.

ER1451
(ER1452)

ER0921
(ER0922)

ER0891

ER1001

ER1461
(ER1462)

ER0121

ER0131

ER0931
(ER0932)

ER1151
(ER1152)

02

ER2041

296

2.2

2.2

BspPI

GGATC(N)4/5^.
AlwI.
100 ..
( 500 ..)
- 2 ../.

ER0831

BspTI

- C^TTAAG.
AflII.
1000 ..
- 10 ../.

ER0701

Bst1107I

- GTA^TAC.
BstZ17I.
500 ..
- 10 ../.

BstXI

- CCANNNNN^NTGG.
BstXI.
500 ..
( 2500 ..)
- 10 ../.

ER0141
(ER0142)
(ER0145)

Bsu15I

- AT^CGAT.
ClaI.
600 ..
( 3000 ..)
( 1000 ..)
- 10 ../.

ER0151

BsuRI

- GG^CC.
HaeIII
3000 ..
- 10 ../.

ER1741

BveI

ACCTGC(N)4/8^.
BspMI.
250 ..
- 5 ../.

ER1391

CaiI

- CAGNNN^CTG.
AlwNI.
500 ..
- 10 ../.

Cfr10I

- (G/A)^CCGG(C/T).
BsrFI.
200 ..
- 10 ../.

Cfr13I

- G^GNCC.
Sau96I.
1000 ..
- 10 ../.

Cfr42I

- CCGC^GG.
SacII.
1200 ..
( 5 1200 ..)
( 2000 ..)
- 10 ../.

Cfr9I

- C^CCGGG.
XmaI.
300 ..
( 1500 ..)
- 10 ../.

CfrI

- (C/T)^GGCC(G/A).
EaeI.
200 ..
- 10 ../.

CpoI

- CG^G(A/T)CCG.
RsrII.
200 ..
( 1000 ..)
- 10 ../.

ER1321
(ER1322)

ER1021
(ER1022)

ER0181

ER0191

ER0201
(ER0202)
(ER0205)

ER0171
(ER0172)

ER0161

ER0741
(ER0742)

02

297

www.helicon.ru

ER1901
(ER1902)

Csel

- GACGC(N)5/10^
HgaI.
100 ..
( 500 ..)
- 10 ../.

ER0211

Csp6I

- G^TAC.
- CviQI.
1500 ..
- 10 ../.

DpnI

- Gm6A^TC.
- DpnI.
500 ..
( 2500 ..)
( 1000 ..)
- 10 ../.

DraI
(DraI )

- TTT^AAA.
- DraI.
1500 ..
- 10 ../.
( 7500 ..
- 50 ../).

Eam1104I

CTCTTC(N)1/4^.
- EarI.
300 ..
( 1500 ..)
- 10 ../.

ER0241

Eam1105I

- GACNNN^NNGTC.
- AhdI.
1000 ..
- 10 ../.

ER0251

Ecl136II

- GAG^CTC.
- EcoICRI.
1500 ..
- 10 ../.

Eco105I

- TAC^GTA.
- SnaBI.
600 ..
( 3000 ..)
- 10 ../.

Eco130I

- C^C(A/T)(A/T)GG.
- StyI.
2500 ..
- 10 ../.

ER0421
(ER0422)

Eco147I

- AGG^CCT.
- StuI.
1000 ..
( 5000 ..)
- 10 ../.

ER0281

Eco24I

- G(G/A)GC(C/T)^C.
- BanII.
1500 ..
- 10 ../.

Eco31I

GGTCTC(N)1/5^.
- BsaI.
1000 ..
( 5000 ..)
- 10 ../.

Eco32I
(Eco32I )

- GAT^ATC.
- EcoRV.
2000 ..
( 5 2000 ..)
( 4000 ..)
- 10 ../
( 10000 .. - 50 ../.)

ER1701
(ER1702)
(ER1705)

ER0221
(ER0223)

ER0231
(ER0232)

ER0401
(ER0402)

ER0411

ER0291
(ER0292)

02

ER0301
(ER0302)
(ER0305)
(ER0303)

298

2.2

2.2

Eco47I

- G^G(A/T)CC.
- AvaII.
- 800 ..
( 4000 ..)
- 10 ../.

Eco47III

- AGC^GCT.
- AfeI.
200 ..
( 1000 ..)
- 10 ../.

Eco52I

- C^GGCCG.
- EagI.
500 ..
( 2500 ..)
- 10 ../.

Eco57I

CTGAAG(N)16/14^.
- AcuI.
200 ..
( 1000 ..)
- 5 ../.

ER1671

Eco57MI

- CTG(G/A)AG(N)16/14^.
- Eco57MI.
50 ..
- 2 ../.

ER0361

Eco72I

- CAC^GTG.
- PmlI.
2000 ..
- 10 ../.

Eco81I

- CC^TNAGG.
- Bsu36I.
500 ..
( 2500 ..)
- 10 ../.

Eco88I

- C^(C/T)CG(G/A)G.
- AvaI.
1000 ..
- 10 ../.

ER0391
(ER0392)

Eco91I

- G^GTNACC.
- BstEII.
1000 ..
( 5000 ..)
- 10 ../.

ER0261

EcoO109I

- (G/A)G^GNCC(C/T).
- DraII.
2000 ..
- 10 ../.

EcoRI
(EcoRI )

- G^AATTC.
- EcoRI.
5000 ..
( 5 5000 ..)
( 10000 ..)
- 10 ../.
( 25000 .. - 50 ../.)

ER1921

EcoRII

- CC^(T/A)GG.
- EcoRII.
200 ..
- 10 ../.

ER0441

EheI

- GGC^GCC.
- NarI.
500 ..
- 10 ../.

Esp3I

CGTCTC(N)1/5^.
- BsmBI.
200 ..
( 1000 ..)
- 10 ../.

ER0311
(ER0312)

ER0321
(ER0322)

ER0331
(ER0332)

ER0341
(ER0342)

ER0371
(ER0372)

ER0381

ER0271
(ER0272)
(ER0275)
(ER0273)

ER0451
(ER0452)

02

299

www.helicon.ru

ER1811

FaqI

GGGAC(N)10/14^.
- BsmFI.
100 ..
- 2 ../.

FspAI

- (G/A)TGC^GCA(C/T).
- FspAI.
100 ..
( 500 ..)
- 5 ../.

FspBI

- C^TAG.
- BfaI. 500 ..
( 2500 ..)
- 10 ../.

GsuI

CTGGAG(N)16/14^.
- BpmI.
100 ..
( 500 ..)
- 5 ../.

ER1851

HhaI

- GCG^C.
- HhaI.
2000 ..
- 10 ../.

ER0471

Hin1I

- G(G/A)^CG(C/T)C.
- BsaHI.
300 ..
- 10 ../.

ER1831

Hin1II

- CATG^.
- NlaIII.
300 ..
- 5 ../.

ER1601

Hin4I

^(8/13-14)(N)GA(C/T)(N)5(A/C/G)TC(N)(13-14/8)^
- Hin4I.
50 ..
- 2 ../.

Hin6I

- G^CGC.
- HinPI.
2000 ..
- 10 ../.

HincII

- GT(C/T)^(G/A)AC.
- HindII.
500 ..
( 2500 ..)
- 10 ../.

HindIII
(HindIII )

- A^AGCTT.
- HindIII.
5000 ..
( 5 5000 ..)
( 10000 ..)
- 10 ../.
( 25000 .. - 50 ../.)

HinfI
(HinfI )

- G^ANTC.
- HinfI.
2000 ..
( 5 2000 ..)
- 10 ../.
( 10000 .. - 50 ../.)

HpaII

- C^CGG.
- HpaII.
1000 ..
( 5000 ..)
- 10 ../.

HphI

GGTGA(N)8/7^.
- HphI.
300 ..
( 1500 ..)
- 10 ../.

ER1761
(ER1762)

ER0461
(ER0462)

ER0481

ER0491
(ER0492)

ER0501
(ER0502)
(ER0505)
(ER0503)

ER0801
(ER0802)
(ER0803)

ER0511
(ER0512)

ER1101
(ER1102 )

02

2.2

ER1661
(ER1662)

300

2.2

Hpy8I

- GTN^NAC.
- MjaIV.
200 ..
( 1000 ..)
- 10 ../.

HpyF10VI

- GCNNNNN^NNGC.
- MwoI.
300 ..
( 1500 ..)
- 10 ../.

HpyF3I

- C^TNAG.
- DdeI
500 ..
( 2500 ..)
- 10 ../.

Kpn2I

- T^CCGGA.
- BspEI.
500 ..
( 2500 ..)
- 10 ../.

KpnI
(KpnI )

- GGTAC^C.
- KpnI.
4000 ..
( 5 4000 ..)
- 10 ../.
( 20000 .. - 50 ../.)

KspAI

- GTT^AAC.
- HpaI.
500 ..
( 2500 ..)
- 10 ../.

LguI

- GCTCTTC(N)1/4^.
- SapI.
100 ..
( 500 ..)
- 5 ../.

Lsp1109I

- GCAGC(N)8/12^.
- BbvI.
200 ..
- 1-3 ../.

LweI

GCATC(N)5/9^.
- SfaNI.
100 ..
( 500 ..)
- 10 ../.

ER2081

MauBI

- CG^CGCGCG.
- MauBI.
100 ..
- 5 ../.

ER1271

MbiI

GAGCGG(-3/-3)^.
- BsrBI.
1000 ..
- 10 ../.

MboI

- ^GATC.
- MboI.
300 ..
( 1500 ..)
- 10 ../.

MboII

GAAGA(N)8/7^.
- MboII.
300 ..
( 1500 ..)
- 5 ../.

ER1571
(ER1572)

ER1731
(ER1732)

ER1881
(ER1882)

ER0531
(ER0532)

ER0521
(ER0522)
(ER0523)

ER1031
(ER1032)

ER1931
(ER1932)

ER2071

ER1621
(ER1622)

ER0811
(ER0812)

ER0821
(ER0822)

02

301

www.helicon.ru

MlsI

- TGG^CCA.
- MscI.
200 ..
( 1000 ..)
- 5 ../.

MluI

- A^CGCGT.
- MluI.
1000 ..
( 5000 ..)
- 10 ../.

MnlI

CCTC(N)7/6^.
- MnlI.
300 ..
( 1500 ..)
- 10 ../.

ER0731
(ER0732)

Mph1103I

- ATGCA^T.
- NsiI.
1000 ..
( 5000 ..)
- 10 ../.

ER2021

MreI

- CG^CCGGCG.
- Sse232I.
300 ..
- 10 ../.

MspI

- C^CGG.
- HpaII.
3000 ..
( 5 3000 ..)
- 10 ../.

MssI

- GTTT^AAAC.
- PmeI.
250 ..
( 1250 ..)
- 5 ../.

MunI

- C^AATTG.
- MfeI.
300 ..
( 1500 ..)
- 10 ../.

Mva1269I

- GAATGC(1/-1)^.
- BsmI.
200 ..
( 1000 ..)
- 10 ../.

MvaI

- CC^(A/T)GG.
- BstNI.
2000 ..
- 10 ../.

NcoI

- ^CATGG.
- NcoI.
500 .
( 2500 ..)
( 1000 ..)
- 10 ../.

NdeI

- CA^TATG.
- NdeI.
500 ..
( 2500 ..)
- 10 ../.

NheI

- G^CTAGC.
- NheI.
500 ..
( 2500 ..)
- 10 ../.

ER1211
(ER1212)

ER0561
(ER0562)

ER1071
(ER1072)

ER0541
(ER0542)

ER1341
(ER1342)

ER0751
(ER0752)

ER0961
(ER0962)

ER0551

ER0571
(ER0572)
(ER0575)

ER0581
(ER0582)

02

ER0971
(ER0972)

302

2.2

2.2

NmuCI

- ^GT(G/C)AC.
- Tsp45I.
200 ..
- 10 ../.

NotI
(NotI )

- GC^GGCCGC.
- NotI.
300 ..
( 1500 ..)
( 500 ..)
- 10 ../.
( 1500 .. - 30-50 ../.)

NsbI

- TGC^GCA.
- FspI.
400 ..
- 10 ../.

OliI

- CACNN^NNGTG.
- AleI.
200 ..
( 1000 ..)
- 10 ../.

PacI

- TTAAT^TAA.
- PacI.
250 ..
( 1250 ..)
- 10 ../.

PaeI

- GCATG^C.
- SphI.
500 ..
( 2500 ..)
- 10 ../.

PagI

- T^CATGA.
- BspHI.
400 ..
( 2000 ..)
- 10 ../.

PasI

- CC^C(A/T)GGG.
- PasI.
200 ..
- 10 ../.

PauI

- G^CGCGC
- BssHII.
200 ..
( 1000 ..)
- 10 ../.

PdiI

- GCC^GGC.
- NaeI.
200 ..
( 1000 ..)
- 10 ../.

ER1531
(ER1532)

PdmI

- GAANN^NNTTC.
- XmnI.
500 ..
( 2500 ..)
- 10 ../.

ER1781

PfeI

- G^A(A/T)TC.
- TfiI.
500 ..
- 10 ../.

ER0851

Pfl23II

- C^GTACG.
- BsiWI.
300 ..
- 2 ../.

ER1751

PfoI

- T^CCNGGA.
- PfoI.
200 ..
- 10 ../.

ER1511

ER0591
(ER0592)
(ER0595)
(ER0593)

ER1221

ER1631
(ER1632)

ER2201
(ER2202)

ER0601
(ER0602)

ER1281
(ER1282)

ER1861

ER1091
(ER1092)

ER1521
(ER1522)

02

303

www.helicon.ru

ER1541

PpiI

- ^7/12(N)GAAC(N)5CTC(N)13/18^.
- PpiI.
50 ..
- 2 ../.

Ppu21I

- (/T)AC^GT(G/A).
- BsaAI.
500 ..
- 10 ../.

Pscl

- A^CATGT.
- PciI.
200 ..
( 1000 ..)
- 10 ../.

Psp1406I

- AA^CGTT.
- AclI.
300 ..
( 1500 ..)
- 10 ../.

Psp5II

- (G/A)G^G(A/T)CC(C/T).
- PpuMI.
500 ..
- 10 ../.

ER0611
(ER0612)

PstI

- CTGCA^G.
- PstI.
3000 ..
( 5 3000 ..)
- 10 ../.

ER1551

PsuI

- (G/A)^GATC(C/T).
- BstYI.
500 ..
- 5 ../.

PsyI

- GACN^NNGTC.
- Tth111I.
1000 ..
- 10 ../.

PvuI

- CGAT^CG.
- PvuI.
300 ..
( 1500 ..)
- 10 ../.

PvuII
(PvuII )

- CAG^CTG.
- PvuII.
2500 ..
( 5000 ..)
- 10 ../.
( 12500 .. - 50 ../.)

RsaI

- GT^AC.
- RsaI.
1000 ..
( 5000 ..)
- 10 ../.

Rsel

- CA(C/T)NN^NN(G/A)TG.
- MslI.
200 ..
( 1000 ..)
- 10 ../.

SacI

- GAGCT^C.
1200 ..
- SacI.
( 5 1200 ..)
( 2000 ..)
- 10 ../.

ER1971

ER1871
(ER1872)

ER0941
(ER0942)

ER0761

ER1331

ER0621
(ER0622)

ER0631
(ER0635)
(ER0633)

ER1121
(ER1122)

ER2001
(ER2001)

02

ER1131
(ER1132)
(ER1135)

304

2.2

2.2

SalI

- G^TCGAC.
- SalI.
1500 ..
( 5 1500 ..)
- 10 ../.

SatI

- GC^NGC.
- Fnu4HI.
200 ..
( 1000 ..)
- 10 ../.

ScaI

- AGT^ACT.
- ScaI.
1000 ..
( 5000 ..)
- 10 ../.

SchI

GAGTC(N)5/5^.
- PleI.
50 ..
- 2 ../.

ER1191
(ER1192)

SdaI

- CCTGCA^GG.
- SbfI.
300 ..
( 1500 ..)
- 10 ../.

ER0651

SduI

- G(G/A/T)GC(C/A/T)^C.
- Bsp1286I.
500 ..
- 10 ../.

ER2091

SfaAI

- GCGAT^CGC.
- AsiSI.
1000 ..
- 10 ../.

ER1821

SfiI

- GGCCNNNN^NGGCC.
- SfiI.
1000 ..
- 10 ../.

Sgel

- m5CNNG(N)9/13^.
- SgeI.
250 ..
- 3 ../.

SgrDI

- CG^TCGACG.
- SgrDI.
200 ..
- 5 ../.

ER1891
(ER1892)

Sgsl

- GG^CGCGCC.
- AscI.
300 ..
( 1500 ..)
- 10 ../.

ER0661
(ER0662)
(ER0663)

SmaI
(SmaI )

- CCC^GGG.
- SmaI. 1200 ..
( 5 1200 ..)
- 10 ../.
( 6000 .. - 50 ../.)

ER1241

SmiI

- ATTT^AAAT.
- SwaI.
1000 ..
- 10 ../.

Smol

- C^T(C/T)(G/A)AG.
200 ..
- SmlI.
- 10 ../.

ER0641
(ER0642)

ER1641
(ER1642)

ER0431
(ER0432)

ER1371

ER2211

ER2031

ER1981

02

305

www.helicon.ru

ER1691

SmuI

CCCGC(N)4/6^.
- FauI.
50 ..
- 1 ../.

SsiI

- CCGC(-3/-1)^.
- AciI.
200 ..
- 10 ../.

SspDI

- G^GCGCC.
- KasI.
250 ..
- 10 ../.

SspI

- AAT^ATT.
- SspI.
500 ..
( 2500 ..)
- 10 ../.

ER1361
(ER1362)

TaaI

- ACN^GT.
- HpyCH4III.
200 ..
( 1000 ..)
- 10 ../.

ER1141

TaiI

- ACGT^.
- MaeII.
400 ..
- 10 ../.

TaqI

- T^CGA.
- TaqI.
3000 ..
( 5 3000 ..)
- 10 ../.

TasI

^AATT.
Tsp509I.
1000 ..
( 5000 ..)
- 10 ../.

ER1291

TatI

(A/T)^GTAC(T/A).
- TatI.
100 ..
- 5 ../.

ER1705

TscAI

NNCA(C/G)TGNN^.
- TspRI.
1000 ..
- 10 ../.

Van91I

CCANNNN^NTGG.
- PflMI.
400 ..
( 2000 ..)
- 10 ../.

ER1301

XagI

- CCTNN^NNNAGG.
- EcoNI.
1000 ..
- 10 ../.

ER1381

XapI

- (G/A)^AATT(C/T).
- ApoI.
500 ..
- 10 ../.

XbaI
(XbaI )

- T^CTAGA.
- XbaI.
1500 ..
( 5 1500 ..)
- 10 ../.
( 7500 ..
- 50 ../.)

ER1791

ER2191

ER0771
(ER0772)

ER0671
(ER0672)

ER1351
(ER1352)

ER0711
(ER0712)

02

ER0681
(ER062)
(ER0683)

306

2.2

2.2

ER1471 (ER1472)

ER0691
(ER0692)
(ER0695)
(ER0693)

ER1561
(ER1562)

ER1481
(ER1482)

XceI

- (G/A)CATG^(C/T).
- NspI.
500 ..
( 2500 ..)
- 10 ../.

XhoI
(XhoI )

- C^TCGAG.
- XhoI.
2000 ..
( 5 2000 ..)
( 5000 ..)
- 10 ../.
( 10000 ..
- 50 ../.)

XmaJI

- C^CTAGG.
- AvrII.
200 ..
( 1000 ..)
- 10 ../.

XmiI

- GT^(C/A)(G/T)AC.
- AccI.
400 ..
( 2000 ..)
- 10 ../.

02

K1441

(MspI/HpaII)

EpiJET


MspI HpaII.
5'-CGG-3'.
5'-CGG-3' HpaII,
MspI. MspI HpaII, ,

1
37o.
5'-CG-3' 5'-CGG-3' .
,
pUC19/SmaI
pUC19/SmaI, 5'-CG-3' .
200 .

307

www.helicon.ru

2.3


,
. , , :
( );
( );
( );
( );
- , , 3;
( );
( ).
-20o.

EL0014
(EL0011)
(EL0012)
EL0016
EL0013

T4 -
T4 -
T4 -


5- 3-
, /. P .
- 5 ../.
- 200 ..
( - 1000 ..).
( 51000 ..)
- 1 ../.
2 500 ..
- 30 ../.
5000 ..

B69

02

EL0021

308

T4 -

, 400 -HCl,
100 MgCl2, 100 , 5 P (pH 7,8 25o).

T4 -

P- -

5- 3-
.

2.3

02

EF0511

EF0651
(EF0652)
(EF0654)

E0031
(E0032)

5- 3- ,
.
.
- 1 ../.
- 500 ..


, FastAP

5- 3- ,
10 37o
.
. 5
75o.
- 1 ../.
- 1000 ..
( 5 1000 ..)
( 300 ..)

T4

- 5-
- ,
-3-. DP
5-
P.
3- .
- 10 ../.
- 500 ..
( 2500 ..)

EP0091
(EP0092)
(EP0094)

0691

EP0041
(EP0042)

E0051
(E0052)
E0054

phi29 -

,
70000
.
35- ()
.
- 10 ../ (0,1 /).
- 250 .. (2,5 )
( - 1000 .. (10 ))
( 5000 .. (50 ))

Bsm - ( )

- Bacillus
smithii, 53
.

( 30 63o) - 60o.
- 8 ../.
- 1600 ..

- I E. coli

- ,
53.
35- (), 53-
.
- 10 ../.
- 500 ..
( - 2500 ..)

- I.
53.
35- () .
- 10 ../.
- 300 ..
( - 1500 ..)
- 2 ../.
- 300 ..

309

www.helicon.ru

E0421
(E0422)

0651
(K0652)

0621
(K0622)

E0061
(E0062)

E0081

E0131
E0133

02

E0101
(E0102)
EP0103

310

2.3

, exo

-
I. 53,
.
- 5 ../.
- 300 ..
( - 1500 ..)


, DecaLabel


. 10-
,
37 o, , exo,

.
,
, .
10 .
( 30 ).


,
DecaLabel


.
10-
,
37o, , exo,

,
dATP,
dCTP.
, .
10 .
( 30 ).

T4 -

53,
53- .
35- ()
.
35- 4 -
200 - I
.
- 5 ../.
- 100 ..
( - 500 ..)

T7 -

- ,

53. 35-
() , 1000
.
- 10 ../.
- 300 ..

SP6 -
SP6 -

- SP6,
SP6-
53
-,
.
.
- 20 ../.
- 2000 ..
- 100 ../.
- 5000 ..

T3 -
T3 -

- 3,
3-
53
-,
.
.
- 20 ../.
- 2000 ..
( - 1000 ..)
- 100 ../.
- 10000 ..

2.3

E0111
(E0112)
EP0113

0441

T7 -
T7 -

- 7,
7-
53
-,
. .
- 20 ../.
- 5000 ..
( 5 5000 ..)
- 100 ../.
- 25000 ..

TranscriptAid
7


in vitro -, T7 . TranscriptAid,
TranscriptAid, I (
), (ATP, TP, GTP, UTP),
, 3 (pH 5,2), ,
,
, - RiboRuler, (200-6000 )
, 0,5 ( 8,0).
50 .

02

E0161
(E0162)

- -,
3--
.

- 20 ../.
- 500 ..
( - 2500 ..)

EM0821

5- - SssI


S--L- 5- 5-CpG-3

. 5-CpG-3
15 37o.
S--L-.
25 .

EN0521
EN0523
EN0525

I ( )
I ( ),

I ( ),

, o
-
5- .

.

( ).

1-2
.
- 1 ../.
- 1000 ..
- 50 ../.
- 1000 ..
- 1 ../.
- 1000 ..

311

www.helicon.ru

B43

I MgCl2

, 100 -HCl
(pH 7,5 25o), 25 MgCl2, 1 Cl2.

IV E. coli (Endo IV)

/

5- ,
3- .
3- 35- .
- 2 ../.
- 100 ..

V T. maritima (Endo V)

3-,
.
3- ( ,
, / ,
, .).
.
,
5- .
.
65-70o.
- 5 ../.
- 250 ..

I E. coli (ExoI)


35
-5- 5- .
3-
.
- 20 ../.
- 4000 ..
( - 20000 ..)

I E. coli (ExoIII)


35- ,
3-,
/- ,
/
.
- 200 ../.
- 4000 ..

53-.
5-
.
- 10 ../.
- 1000 ..
( - 5000 ..)

A (
)

,
3-
( U) 3 3-UMP ,
-3- (3- 3-UMP).
- 10 /.
- 10 .

T1

,
3- G
3-GMP ,
3-GMP.
- 1000 ../.
- 100000 ..
( - 500000 ..)

A/T1


:
A,
3- U, T1,
3- G.
2 / A 500 ../
T1.
1 .

EN0141

EN0581
(EN0582)

EN0191

EN0561
(EN0562)

EN0531

EN0541
(EN0542)

EN0551

02

2.3

EN0591

312

2.3

EN0601
(EN0602)

EN0201
(EN0202)

EN0181

EN0321

I E. coli

,
-3.
- 10 ../.
- 1000 ..
( - 5000 ..)

E. coli

- /- .
- 5 ../.
- 100 ..
( - 500 ..)

(S7 )

/,
-
3- .
,
AT- AU-.
.
- 300 ../.
- 8000 ..

S1



5- . 3- .
.
- 100 ../.
- 10000 ..

02

EN0361
(EN0362)

--

N-
- .
- 1 ../.
- 200 ..
( 5 x 200 ..)

EF0221


.
.

RiboLock

,
1:1.
1, 2, U1, U2, CL3
I .
- 40 ../.
- 2500 ..
( 4 x 2500 ..)
( 24 x 2500 ..)

,
,
, .
- ~600-1000 ../ (~14-22 /).
1 .
( 5 x 1 )

V 10
-HCl (pH 7,4 25o), 100 Cl, 1
, 50% (v/v) .
- 20 /.
0,25 (5 ).

E0381
(E0382)
(E0384)

E0491
(E0492)

B14

313

www.helicon.ru

2.4

02

, , , , , .
. .
, 100% .
-20oC. , (), - .
. ,
, 12 . 50% 3-4 -20oC.

314

BB5

10

: 10 -HCl (pH 7,5 37o),


10 MgCl2, (0,1 /).
5 x 1 .

BG5

10X G

: 10 -HCl (pH 7,5 37o),


10 MgCl2, 50 NaCl, (0,1 /).
5 x 1 .

BO5

10X O

: 50 -HCl (pH 7,5 37o),


10 MgCl2, 100 NaCl, (0,1 /).
5 x 1 .

BR5

10X R

: 10 -HCl (pH 8,5 37o),


10 MgCl2, 100 Cl, (0,1 /).
5 x 1 .

BY5

10X Tango

: 33 - (pH 7,9 37o),


10 , 66 , (0,1 /).
5 x 1 .

B30

: 10 ., 10X G, 10X ,
10 R, 10 TangoTM.
5 x 1 .

B19

: 10 -HCl (pH 7,4 25o), 100 KCl, 1


, 1 , 50% , (0,2 /).
5 x 1

B02

10X Cfr9I

: 10 -HCl (pH 7,2 37o), 5


MgCl2, 200 , (0,1 /).
1 .

B04

10 Cfr10I

: 10 -HCl (pH 8,0 37o), 5


MgCl2, 100 NaCl, 0,02% -100, (0,1 /).
1 .

B12

10X EcoRI

: 50 -HCl (pH 7,5 37o),


10 MgCl2, 100 NaCl, 0,02% -100, (0,1 /).
5 1 .

B13

10 Bsp143I

: 33 - (pH 7,9
37o), 10 , 66 , 0,02%
-100, (0,1 /).
1 .

B22

10 Eco52I

: 10 -HCl (pH 7,5 37o), 3


MgCl2, 100 NaCl, (0,1 /).
1 .

B23

10 SduI, Ppu21I

: 10 -HCl (pH 7,2 37o), 3


MgCl2, 150 NaCl, (0,1 /).
1 .

B24

10X SdaI

: 37 - (pH 7,0 37o),


15 , 150 , (0,1 /).
1 .

B25

10X Eam1105I

: 10 -HCl (pH 7,5 37o), 5


MgCl2, 100 NaCl, (0,1 /).
1 .

2.4

B26

10X Ecl136II, SacI

: 10 ---HCl (pH 6,5


37o), 10 MgCl2, (0,1 /).
1 .

B27

10 AarI, AjiI, Bpu10I, ScaI, PasI

: 10 ---HCl (pH 6,5


37o), 10 MgCl2, 100 KCl, (0,1 /).
1 .

B28

10X TaqI

: 10 -HCl (pH 8,0 37o), 5


MgCl2, 100 NaCl, (0,1 /).
1 .

B29

10X KpnI

: 10 -HCl (pH 7,5 37o), 10


MgCl2, 0,02% -100, (0,1 /).
1 .

B31

10 BseXI

: 50 -HCl (pH 7,5 37o), 2


MgCl2, 100 NaCl, (0,1 /).
1 .

B57

10 BamHI, Lsp1109I

: 10 -HCl (pH 8,0 37o), 5


MgCl2, 100 KCl, 0,02% -100, 1 2-,
(0,1 /).
5 1 .

B59

10 BfuI

: 50 - (pH 7,9 37o), 15


, 150 , (0,1 /).
1 .

02

315

www.helicon.ru

,
, -

, , -

3.1

Life Technologies (Invitrogen)


Invitrogen - Premium , , .
Invitrogen:
.
.
.
.
GC- .
.
.
.
.
(next generation sequencing, NGS).
.
(ChIP).
.
.

- Invitrogen:

Taq (Thermus aquaticus) - 5 000 ..


(3-5-) ,
, . -, 3- .
GB-D (Pyrococcus sp.) 3-5- , 3- . Taq 59 . Taq GB-D
High Fidelity, Discoverase Elongase.
Pfx (Thermococcus sp., KOD) - 3-5- ,
26 , Taq.
Pfx50 (Thermococcus zilligii) -, 50 Taq.
4 000 ..
- Pyrolobus fumarii. (
4- 95C) ( 5 , Taq)
- GC 65%. Invitrogen .. ThermalAce.
5 000 ..
Tsp - , . 500 .., .

Invitrogen :

03

316

Platinum - ,
94.
AccuPrime -,
.
AccuPrime .
PCRX Enhancer - Pyrolobus fumarii GC- . - Taq Platinum Pfx.

3.1

,
, -

, , -

03

10790020
11708013
11708021
11708039
12344024
12344032

12344040
12355012

SuperMix High Fidelity

Taq, GB-D
( 6 Taq=6 x Taq)
12 000 .. .

100

- Pfx Platinum

(26 x Taq) -
Platinum 12 000
.. GC 60 90%
PCRX Enhancer.

100

- Pfx AccuPrime

(26 x Taq)
- Platinum AccuPrime 12 000 ..
.

200

Pfx, Platinum,
SuperMix AccuPrime AccuPrime
- Pfx
(26 x Taq) 15
000 .. .

250
500

1 000

200
100

- Pfx50

(50 x Taq) -
4 000 .. .

SuperMix Platinum
High Fidelity

Taq, GB-D,
Platinum (6 x Taq)
( 15 000 ..)
.

100

- Taq Platinum High Fidelity

Taq, GB-D Platinum


(6 x Taq) ( 20 000 ..)
.

100

- Taq AccuPrime High Fidelity

Taq, GB-D, Platinum AccuPrime (9 x Taq)


( 20 000 ..)
.

200

11495017

PCRX Enhancer

GC-
.
,
Taq Platinum Pfx,
.

250

11508017

- Taq PCRX

, - Taq PCRX
5 000 .. GC

500 .=200

11509015

- Taq Platinum PCRX

, - Taq
Platinum PCRX
5 000 .. GC-
.

500

E0200

-
ThermalAce

- Pyrolobus fumarii
GC- (6590% GC) 5 x
Taq .

200

- AccuPrime
GC-Rich

- Pyrolobus fumarii

5 000 .. GC- (
65% GC) 2 x Taq .

- Tsp Platinum GenoType

Tsp Platinum
500 ..
.

- Discoverase dHPLC

Taq GB-D

(dHPLC) .
5 000 ..
8 x Taq .

12355036

500


12532016
12532024
11304011
11304029
11304102
12346086
12346094

5 000

500
5 000

1 000

GC-

12337016
12337024

200
1 000

11448024
11448032

12607024

250 .=416
2 500 .=4 166

500

317

www.helicon.ru

,
, -

, , -

3.1

A10498

SequalPrep
Long


( 20 000 ..)
4 x Taq.
,

(next generation sequencing).

1 000 .=555

A1051001

SequalPrep

(NGS).

960

- Taq Platinum High Fidelity NGS SequalPrep.


10966018
10966026
10966034

-
Taq Platinum

10966083

Taq Platinum
, (ChIP)
.
qRT-PCR.

100
250
500
5 000

- Pfx Platinum, Pfx50 Taq Platinum High Fidelity ChIP


.

(Multiplex PCR)
:

12339016

12339024

12342010
12342028
12341012
12341020

AccuPrime SuperMix I
AccuPrime SuperMix II

200

1 000

200
Taq, Platinum,
AccuPrime .

1 000
200
1 000

SuperMix AccuPrime - Pfx - Pfx AccuPrime, Taq AccuPrime High Fidelity AccuPrime GC-Rich

03

AccuPrime Taq

- Taq Platinum
AccuPrime AccuPrime
I ( 200 ..,
) II ( 200 4 000
..). , 2
x Taq .
.
-
AccuPrime SuperMix I II.

318

3.1

,
, -

, , -

03

Life Technologies (Invitrogen)


() Invitrogen
: , , , . SuperScript III, , , ,
-, 5- 3- (RACE).

18064022
18064014
18064071


SuperScript II

M-MLV,
H
( 12 300 ..).
42C.

2 000 .


SuperScript III

SuperScript II (M-MLV H) :
1. ( 220
50C). .
2.
50C 60C
.
3.
.

10 000 .
4 10 000 .

18080093

18080044

18080085

12236014

12236022


ThermoScript


( 70C) AMV
H. 70C


.

2 000 .

10 000 .

4 10 000 .

375 .

1 500 .

(qRT-PCR)
Life Technologies (Invitrogen)
Invitrogen (real-time PCR), (qRT-PCR). qRT-PCR:
:
(One-step qRT-PCR) , ,
.
(Two-step qRT-PCR) e , .
.
:
(SYBR-based).
(primer/probe-based).
:
.
( CellsDirect). , .
:
(15 95 1 60C).
(3 95 30 c 60C). Invitrogen,
(EXPRESS CellsDirect), .

319

www.helicon.ru

,
, -

, , -

3.1

qRT-PCR Life Technologies (Invitrogen)


:
SuperScript III Invitrogen.
ThermoScript Platinum ThermoScript.
RNaseOUT - A, B . - . Invitrogen.
- Taq Platinum (. ) Taq Platinum:
. Invitrogen.
SYBR:
SYBR Green I . Molecular Probes (
Invitrogen). - .
.
SYBR GreenER . SYBR Green I, .
(SNP) (HRM).
ROX ( , )
qPCR (SuperMix) 500 .
-- (UDG) dUTP ( dTTP)
. ,
, dU dT. UDG
. UDG , .
One-step qRT-PCR. ,

11781200

EXPRESS Superscript
Universal one-step
qRT-PCR

SuperScript III,
Taq Platinum UDG. .
1 1 0,5 .

500

Platinum ThermoScript one-step qRT-PCR

ThermoScript
.
. UDG.

250

1178101K
11731015
11731023

2500

1250

One-step qRT-PCR. , SYBR


11780200
1178001K

EXPRESS SYBR
GreenER Universal onestep qRT-PCR

SuperScript III,
Taq Platinum, SYBR GreenER UDG.
.

500
2500

One-step qRT-PCR. ,
11753100
11753500

CellsDirect onestep qRT-PCR

110 000 .
SuperScript III, UDG.
.

100
500

Two-step qRT-PCR. ,
11737030
11737038

CellsDirect twostep qRT-PCR

110 000 .
SuperScript III UDG. .

100
500

Two-step qRT-PCR. , SYBR


11738060

03

11738068

320

CellsDirect SYBR
Green two-step qRT-PCR

110 000 .
SuperScript III, SYBR Green I UDG.
.

100
500

3.1

,
, -

, , -

03

(qPCR) Life Technologies (Invitrogen)


Two-step qRT-PCR , ,
Invitrogen (qPCR).

18080051

SuperScript III

.
: -
(endpoint RT-PCR)
. -: Taq Platinum, Taq Platinum High Fidelity Pfx Platinum.

50

18080400

SuperMix SuperScript III


SuperScript III
.

50

SuperScript VILO

. : .
1 2,5 20 .

11754050
11754250

50 20
250 20

qPCR.
11785200
1178501K

Supermix EXPRESS Universal


qPCR

Taq Platinum
UDG. . ROX
.

500
2500

qPCR. SYBR
11784200
1178401K

Supermix EXPRESS SYBR


GreenER Universal qPCR

Taq Platinum,
SYBR GreenER UDG.
. ROX . ,
, SNP
(HRM).

500
2500

, , - Thermo Fisher Scientific (Fermentas)


() , . , ( , ) . in vitro
-,
.
, Taq Thermus aquaticus Pfu- Pyrococcus
furiosus, (. 1).
1. - Fermentas.

dUTP

Taq

5000
10000

++

3'-dA

Taq
Dream

6000
20000

++++

++

3'-dA

Taq
TrueStart Hot
Start

3000
5000

++

+++

3'-dA

Taq
Maxima Hot
Start

3000
5000

++

+++

3'-dA

321

www.helicon.ru

,
, -

, , -

3.1

1. - Fermentas.

dUTP

Pfu

4000
10000

++

Pfu

3000
5000

10000
20000

+++

++

/3'dA

21000
47000

+++

++

3'-dA/


GC-

3000
10000

++

++

3'-dA/

* Taq -.

03

(-, . RT-PCR) . () (),


. (. 2),
.
2. Fermentas.

322

.. 20

20

Maxima

50-55C

60C

20000

85C,
5

200 ..

1 -5

RevertAid Premium

50-55C

60C

20000

85C,
5

200 ..

1 -5

RevertAid H Minus

42-45C

55C

13000

70C,
10

200 ..

0,1 -5

RevertAid

+++

++

3'-dA/

M-MuLV

37C

37C

9000 +

70C,
10

40 ..

100 -5

AMV

45-50C

60C

13000

85C,
5

10 ..

10 -5

++

3.1

,
, -

, , -

03

( , . Real-time PCR, qPCR) - ,


,
. , , ,
. -
, .
-20o.
Taq Pfu -

EP0401
(EP0402)
(EP0405)
(EP0406)

Taq -

- 5 ../.
- 100 ..
( - 500 ..)
( 5 500 ..)
( 10 500 ..)

EP0403
(EP0404)

Taq -

- 1 ../.
- 100 ..
( - 500 ..)

EP0281
(EP0282)

Taq -

- 5 ../.
- 200 ..
( - 500 ..)

EP0283
(EP0284)

Taq -

- 1 ../.
- 200 ..
( - 500 ..)

EP0071
(EP0072)

Taq -

- 5 ../.
- 200 ..
( - 500 ..)

Taq - Dream

- 5 ../.
- 200 ..
( - 500 ..)
( 5 500 ..)
( 20 500 ..)

Taq - Dream Green

Taq - Dream
DreamTaq Green, ,
.
- 5 ../.
- 200 ..
( - 500 ..)
( 5 500 ..)
( 20 500 ..)

Taq - Maxima Hot Start


4 95.
- 5 ../.
- 100 ..
( - 500 ..)
( 5 500 ..)

EP0611
(EP0612)
(EP0613)

Taq - TrueStart Hot Start

1
.
- 5 ../.
- 200 ..
( - 500 ..)
( 5 500 ..)

EP0571
(EP052)

Pfu -

2,5 ../.
- 100 ..
( - 500 ..)

EP0501
(EP0502)

Pfu -

2,5 ../.
- 100 ..
( - 500 ..)

EP0701
(EP0702)
(EP0703)
(EP0704)

EP0711
(EP0712)
(EP0713)
(EP0714)

EP0601
(EP0602)
(EP0603)

323

www.helicon.ru

,
, -

, , -

3.1

0171
0172

1071
1072

1081
1082

1051
1052

1061
1062

0211

0191
(0192)

03

0181
(0182)

324

Master (2)

,
Taq - (0,05 ../), , 0,4
(dATP,
dCTP, dTTP, dGTP) 4 M MgCl2,
- .
200 .
4 1,25 .
1000 .
20 1,25 .

DreamTaq
Master (2)

,
Taq - Dream, DreamTaq KCl
(NH4)2SO4 , ,
(dATP, dCTP, dTTP, dGTP), 4 M
MgCl2.
200 .
4 1,25 .
1000 .
20 1,25 .

DreamTaq
Green Master (2)

,
Taq - Dream, DreamTaq Green,
(dATP, dCTP, dTTP, dGTP), 4 M
MgCl2.
200 .
4 1,25 .
1000 .
20 1,25 .

Maxima
Hot Start Master (2)

,
Taq - Maxima Hot Start, ,
,
(dATP, dCTP, dTTP, dGTP), MgCl2.
100 .
2 1,25 .
500 .
10 1,25 .

Maxima
Hot Start Green Master (2)

,
Taq - Maxima Hot Start, ,
,
(dATP, dCTP, dTTP, dGTP), MgCl2
-,
.
100 .
2 1,25 .
500 .
10 1,25 .


PyroStart Master (2)

,
Taq -
,
18 , -
.
200 .
2 1,25 .

Taq -
- .

.
- 5 ../.
- 100 ..
( - 500 ..)

Taq -
- .

.
Long PCR

.
- 5 ../.
- 100 ..
( - 500 ..)

3.1

,
, -

, , -

03

Taq Pfu -

1091

0221
0222
0223

0241
0242

0251
0252

0231
0232
0233

0261
0262
0263

, ,
, TissueGreen Master
(2), , Taq
- Dream, , ,
, -,

. 2000
.
200 .


Maxima SYBR Green/
ROX Master (2)

, Taq Maxima Hot Start


.
SYBR Green,
ROX
dUTP
- .
200 .
2 1,25 .
1000 .
10 1,25 .
4000 .
4 12,5 .


Maxima SYBR Green/
Fluorescein Master (2)

, Taq Maxima Hot Start


.
SYBR Green I,
dUTP
- .
200 .
2 1,25 .
1000 .
10 1,25 .


Maxima SYBR Green
Master (2), ROX

, Taq Maxima Hot Start


.
SYBR Green I
dUTP - .
ROX
.
200 .
2 1,25 .
1000 .
10 1,25 .


Maxima Probe/ROX
Master (2)

, Taq Maxima Hot Start


.
ROX
dUTP
- .
200 .
2 1,25 .
1000 .
10 1,25 .
4000 .
4 12,5 .


Maxima Probe Master
(2), ROX

, Taq Maxima Hot Start


.
dUTP
- .
ROX
.
200 .
2 1,25 .
1000 .
10 1,25 .
4000 .
4 12,5 .

325

,
, -

www.helicon.ru

, , -

3.1

()

EP0741
(EP0742)
(EP0743)

Maxima

- 200 ../.
- 2000 ..
( - 10000 ..)
( 4 10000 ..)

EP0731
(EP0732)
(EP0733)

RevertAid Premium

- 200 ../.
- 2000 ..
( - 10000 ..)
( 4 10000 ..)

EP0451
(EP0452)

RevertAid H Minus

- 200 ../.
- 10000 ..
( 5 10000 ..)

EP0441
(EP0442)

RevertAid

- 200 ../.
- 10000 ..
( 5 10000 ..)

EP0351
(EP0352)

M-MulV

- 20 ../.
- 1000 ..
( 5000 ..)

EP0641

AMV

- 20 ../.
- 1000 ..

M-MulV ,
RiboLock,
, (
dNTP 10 ), Oligo(dT)18,
,
, , ,
.
20 .
100 .


RevertAid

RevertAid ,
RiboLock,
, (
dNTP 10 ), Oligo(dT)18,
,
, , ,
.
20 .
100 .


RevertAid H Minus

RevertAid H Minus
, RiboLock,
,
( dNTP 10 ),
Oligo(dT)18,
, , ,
, .
20 .
100 .


RevertAid Premium

RevertAid Premium

RiboLock, ,
(
dNTP 10 ), Oligo(dT)18,
,
, .
50 .
200 .


Maxima

Maxima
RiboLock,
,
,
,
.
50 .
200 .

01611
(01612)

01621
(01622)

01631
(01632)

01651
(01652)

03

01641
(01642)

326

3.2

,
, -

03

Thermo Fisher Scientific (Fermentas)


(dNTP) (NTP). , 7,0 NaOH. 4 . ,
dNTP , ,
. ( 99% ).
-20oC, -. 90-95% dNTP 7 , 85-90% dNTP 30 (1 94oC, 3 72oC).
5- 3-,
,
, , , ,
, .
-20oC.

R0141

R0151

R0161

R0171

R0133

R1191

R0501

dATP

2'--5'-.
100 .
- 25 .
- 0,25 .
259 .
15,4103 -1-1 ( 7,0).

dTP

2'--5'-. 100 .
- 25 .
- 0,25 .
271 .
9,1103 -1-1 ( 7,0).

dGTP

2'--5'-.
100 .
- 25 .
- 0,25 .
253 .
13,7103 -1-1 ( 7,0).

dTTP

2'--5'-.
100 .
- 25 .
- 0,25 .
267 .
9,6103 -1-1 ( 7,0).

dUTP

2'--5'-.
100 .
- 25 .
- 0,25 .
262 .
10,0103 -1-1 ( 7,0).

dITP

2'--5'-.
100 .
- 25 .
- 0,25 .
249 .
12,2103 -1-1 ( 7,0).

dm6ATP

2'--N6--5'-.
10 .
- 1 .
- 0,1 .
265 .
15,4103 -1-1 ( 7,0).

327

www.helicon.ru

,
, -

3.2

R0421

R0431

R0101

R0081

R0091 R1101

dm4TP

2'--N4--5'-.
10 .
- 1 .
- 0,1 .
274 .
13,6103 -1-1 ( 7,0).

dm5TP

2'--5--5'-.
10 .
- 1 .
- 0,1 .
279 .
8,77103 -1-1 ( 7,0).

-12-dUTP

-5(6)--[5-{3-}-2'-5'-].
1 .
- 25 .
- 25 .
495 .
70,0103 -1-1 ( 9,0).
495 , 520 ( 9,0).

-11-dUTP

---[5-{3-}-2'--5'].
1 .
- 50 .
- 50 .
240 289 .
10,7103 -1-1
7,1103 -1-1 ( 7,0) .

-dUTP

5-[3-]-2'--5'-.
240 290 .
11,9103 -1-1
7,8103 -1-1 ( 7,0) .
10 .
- 1 .
- 100 .
50 .
2,5 .
- 50 .

R0181
R0182
R0186

R0241
R0242

03

328

dNTP

100 dATP, dTTP, dGTP, dCTP.


.
- 25 dNTP.
- 0,25 dNTP.
2500 (0,2
dNTP 50 ).
- 100 dNTP.
- 1 dNTP.
10000 (0,2
dNTP 50 ).
- 500 dNTP.
- 5 dNTP.
50000 (0,2
dNTP 50 ).

dNTP, 2 M


(dATP, dTTP, dGTP, dCTP),
2 .
- 8 dNTP.
- 1 .
200 (0,2
dNTP 50 ).
- 40 dNTP.
51 .
1000 (0,2
dNTP 50 ).

3.2

,
, -

03

dNTP, 10 M

(dATP,
dTTP, dGTP, dCTP), 10 .
- 8 dNTP.
0,2 .
200 (0,2
dNTP 50 ).
- 40 dNTP.
1 .
1000 (0,2
dNTP 50 ).
- 200 dNTP.
5 x 1 .
5000 (0,2
dNTP 50 ).

dNTP, 25 M


(dATP, dTTP, dGTP, dCTP), 25 .
- 100 dNTP.
- 1 .
2500 (0,2
dNTP 50 ).
- 500 dNTP.
51 .
12500 (0,2
dNTP 50 ).

R0251

dNTP/dUTP, 2 M


(dATP, dGTP, dCTP) dUTP, 2 .
- 10 dNTP.
- 1 .
200 (0,2
dNTP 50 ).

ATP

-5'-.
100 .
- 25 .
- 0,25 .
259 .
15,4103 -1-1 ( 7,0).

TP

-5'-.
100 .
- 25 .
- 0,25 .
271 .
9,0103 -1-1 ( 7,0).

GTP

-5'-.
100 .
- 25 .
- 0,25 .
253 .
13,7103 -1-1 ( 7,0).

UTP

-5'-.
100 .
- 25 .
- 0,25 .
262 .
10,0103 -1-1 ( 7,0).

-UTP

5-[3-]--5'-.
50
2,5 .
- 50 .
240 290 .
11,9103 -1-1 7,8103 -1-1 (
7,0) .

R0191
R0192
R0193

R1121
R1122

R0441

R0451

R0461

R0471

R1091

329

,
, -

www.helicon.ru

3.2

SO100

SO101

SO113

SO114

SO115

SO501

SO511

SO116

03

SO117

330

M13/pUC (-20), 17-

,
5'- lacZ:
5'-d(GTAAAACGACGGCCAGT)-3'.
- 10 (56,6 /).
- 0,1 .. 260 (3,3 ; 600 ).
- 60 .

M13/pUC (-26),
17-

,
5'- lacZ:
5'-d(CAGGAAACAGCTATGAC)-3'.
- 10 (56,6 /).
- 0,1 .. 260 (3,3 ; 600 ).
- 60 .

M13/pUC (-40), 17-

,
5'- lacZ:
5'-d(GTTTTCCCAGTCACGAC)-3'.
- 10 (56,6 /).
- 0,1 .. 260 (3,3 ; 600 ).
- 60 .

M13/pUC (-46), 22-

,
5'- lacZ:
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'.
- 10 (73,2 /).
- 0,1 .. 260 (3,3 ; 450 ).
- 45 .

M13/pUC (-46), 24-

,
5'- lacZ:
5'-d(GAGCGGATAACAATTTCACACAGG)-3'.
- 10 (79,9 /).
- 0,1 .. 260 (3,3 ; 420 ).
- 42 .

pJET1.2 , 23-

,
eco47IR
pJET1.2,
Eco32I:
5'-d(CGACTCACTATAGGGAGAGCGGC)-3'.
- 10 (76,6 /).
- 0,2 .. 260 (6,7 ; 870 ).
- 87 .

pJET1.2 ,
24-

,
eco47IR
pJET1.2,
Eco32I:
5'-d(AAGAACATCGATTTTCCATGGCAG)-3'.
- 10 (79,9 /).
- 0,2 .. 260 (6,7 ; 840 ).
- 84 .

SP6 , 18-

,
- SP6:
5'-d(ATTTAGGTGACACTATAG)-3'
- 10 (59,9 /).
- 0,1 .. 260 (3,3 ; 560 ).
- 56 .

SP6 , 24-

,
- SP6:
5'-d(CATACGATTTAGGTGACACTATAG)-3'
- 10 (79,9 /).
- 0,1 .. 260 (3,3 ; 420 ).
- 42 .

3.2

,
, -

03

SO118

SO119

SO120

SO131 (SO132)

SO142

SO181

T7 , 20-

,
- 7:
5'-d(TAATACGACTCACTATAGGG)-3'.
- 10 (66,6 /).
- 0,1 .. 260 (3,3 ; 500 ).
- 50 .

T3 , 17-

,
- 3:
5'-d(ATTAACCCTCACTAAAG)-3'
- 10 (56,6 /).
- 0,1 .. 260 (3,3 ; 600 ).
- 60 .

T3 , 24-

,
- 3:
5'-d(GCGCGAAATTAACCCTCACTAAAG)-3'.
- 10 (79,9 /).
- 0,1 .. 260 (3,3 ; 420 ).
- 42 .

Oligo(dT)18

18-
, :
5'-d()-3'.
- 100 (0,5 /).
- 30 .
- 60 .
( - 60 .
- 120 .)


:
5'-d(NNNNNN)-3'.
- 100 (0,2 /).
- 24 .
- 120 .


,
.
3'-,
- 3'-5'-
:
5'-d(NpNpNpNpNpSNpSN)-3'.
- 500 (1,1 /).
- 110 .
- 100 .

331

www.helicon.ru

4.1

Amresco
ITM

ITM

0710

Amresco

Biotechnology Grade

100

ITM , . , ITM,
. ITM (0,10),
.
SFRTM (Super Fine Resolution)

SFRTM

J234

Amresco

Biotechnology Grade

25

SFR (Super Fine Resolution), AMRESCO , ,


1,000 bp. SFRTM ,
2%. 2% 5%,
. SFRTM ,
.
TM

3:1 HRBTM

3:1 HRBTM

E776

Amresco

Biotechnology Grade

25

3:1 HRB (High Resolution Blend),


. 3:1 HRBTM 1,000 b
. (2,000 /2)
, .

04

TM

332

(bp)

Agarose I

0,8
1,00
1,20
2,00

80022,000
50010,000
4007,000
2505,000

TAE
TAE/TBE
TAE/TBE
TBE

Agarose SFR

2,00
3,00
4,00
5,00

5002,000
1001,200
50500
20250

TAE/TBE
TAE/TBE
TAE/TBE
TAE/TBE

Agarose 3:1
HRB

1,00
2,00
3,00
4,00

5002,000
250750
125500
50250

TBE
TBE
TBE
TBE

Agarose II

0,50
0,80
1,00
2,00

2,00020,000
50015,000
20010,000
1001,000

TAE/TBE
TAE/TBE
TAE/TBE
TAE/TBE

Agarose III

0,50
0,70

10,00040,000
1,00020,000

TAE
TAE

Agarose IV

0,50
1,00

10,0002,000,000
3,000500,000

TAE
TAE

4.1

04

, /2

, -mr

Agarose I

87-89

1,200*

0,10

Agarose SFR

65-69

860*

0,13

Agarose 3:1 HRB

85-89

2,000*

0,12

Agarose II

62-69

250

0,15

Agarose III

93-96

2,000

0,06

Agarose IV

87-89

3,200*

0,12

1,5% .
, 50

, 50

K915

Amresco

1,6

Ultra Pure Grade

TAE .
(1) TAE : 0,04 -; 0,001 ; pH 8.0.
, 10

, 10

0658

Amresco

500

Ultra Pure Grade

TBE . TBE
.
(1) TAE : 0,089 ; 0,089 ; 0,002 ; pH 8.3.

Amresco
(Bromophenol Blue, Sodium Salt)

0312

Amresco

ACS Grade

C19H10Br4O5SBr4Na MW: 691.95



.
FF (Xylene Cyanole FF)

FF

0819

Amresco

10

Ultra Pure Grade

C25H27N2O6S2Na MW: 538.60



.
(Ethidium bromide)

0492

Amresco

Biotechnology Grade

C21H20N3Br MW: 394.3



. 0.5 / 10
. , 0.5-1 / .

333

www.helicon.ru

4.1

G-250 (Coomassie brilliant Blue G-250)



G-250

0615

Amresco

Ultra Pure Grade

C47H48N3O7S2Na MW: 854.0



R-250 (Coomassie brilliant Blue R-250)


R-250

0472

Amresco

Ultra Pure Grade

10

C45H44N3O7S2Na MW: 826.0


SYBR (Life Technologies)


SYBR ,
.
(, Safe Imager 2.0, . -)
One-step qRT-PCR. ,

SYBR Green I (10


000X )

. 20
254 . qPCR
(. )

500

SYBR Green II (10


000X )

.
100 254

S11494

SYBR Gold


300 (25 /1 )

500

S33102

SYBR Safe

()

400

S7563
S7567
S7585
S7564
S7568

S7586

1
20 50
500
1
20 50


Thermo Fisher Scientific (Fermentas)

04

, . - ( , FF
G), ; , ; (), . - .
+4oC 12 ,
-20oC.

334

4.1

TopVision

: (EEO) - 0,05-0,13; 1%-


>1200 /2; 1,5%- >2500 /2;
36 1,5oC; 88 1,5oC;
<7%.

0,4-5%.
100 .
( 500 ).

TopVision

: (EEO) <0,12; 1%-


250 /2; 24-28oC;
<65,5oC; <7%.

0,7-2%,

(0461).
25 .

50X TAE

: 40 , 20 , 1
. pH 50X TAE - 8,4.
0,22 .

.
- - 1500
, .
1 .

52

10X TE

: 89 , 89 , 2
. pH 10X TE - 8,3.
0,22 .

.
- - 1500
.
1 .

R0611

6X

: 10 M T-HCl (pH 7,6), 0,03% ,


0,03% FF, 60% , 60 M .
.
5 x 1 .

R0621

6X MassRuler

: 10 M T-HCl (pH 7,6), 0,03% ,


60% , 60 M .
.
5 x 1 .

R0631

6X Orange

: 10 M T-HCl (pH 7,6), 0,15% G, 0,03%


FF, 60% , 60 M .
.
5 x 1 .

R1161

6X TriTrack

: 10 M T-HCl (pH 7,6), 0,03%


, 0,03% FF, 0,15% G, 60% , 60
M .
.
5 x 1 .

R1151

: 0,03% , 0,03%
FF, 60% , 1% , 100 M ,
7,6. ,
-
6X
(,

, ).
- -
-.
5 x 1 .

R0641

: 95% , 0,025% ,
0,025% , 0,025% FF, 0,025%
, 0,5 M .
.

.
1 .

R0491
(R0492)

R0801

49

2X

04

335

www.helicon.ru

4.2


()

H-0104

AppliChem

Standard grade, extrapure

500

.
.

- .

0486

Amresco

ACS Grade

10

. . - (N,N-methylene-bis-acrylamide).
(ammonium persulphate APS)
, , SO4-..
-

0172

Amresco

Ultra Pure Grade

50

. . - (N,N-methylene-bis-acrylamide).

0227

Amresco

Biotechnology Grade

100

(sodium dodecyl sulfate SDS)


. , , .

.

0497

Amresco

Ultra Pure Grade

500

04

- , ,
.

336

4.2

04

0322

Amresco

Ultra Pure Grade

500

, ,
2-

0105

Amresco

Biotechnology Grade

500

- , .

0167

Amresco

500

Biotechnology Grade

- ,
/ .
/

19:1

29:1

37,5:1 (30.0:0.8)

Life Technologies (Invitrogen)


:
. -.
.
.
.

SimplyBlue
SafeStain


PVDF Coomassie G-250. :
(12 ) (3 ).
770 .
.

SilverQuest


(0,3 ), -.


SYPRO Ruby

. : (90
) ( ).
0,25 1 .
(, Safe Imager
2.0, .
-).

LC6060
LC6065

LC6070
S12001
S12000
S21900
S11791

C33250

3,5

1 =25 -
200
1
5


SYPRO Ruby

( 0,25
/2) ,
-.

200 =1040

Coomassie Fluor Orange


. 3060 ,
. 4 1
. (,
Safe Imager 2.0, .
- ).

337

www.helicon.ru

4.2


Pro-Q Diamond

Multiplexed
Proteomics 1

P21857


Pro-Q Emerald
300

3 . 300
.

1 =10

M33307

Multiplexed
Proteomics 1

1 Pro-Q Emerald 300+S12000. 500


.

1 =20

P33301
P33300
P33302
M33306
M33305

200
1
5
P33301+S12001
P33300+S12000


LC6030

His-tag
InVision


His-Tag 3 .
.

500

LC6033

InVision
Histag

LC6030+ His-Tag BenchMark.

1 =20

LC6090

Lumio Green

CCXXCC
in
vitro.

1 =100

IB7710

Novex



PVDF
. 10 .

1 =10

Life Technologies (Invitrogen)

04

Invitrogen , , ,
, .

338

LC5800


Novex Sharp

2 250

LC5801


Novex Sharp

(3,5260 ),
12
, . 11
10 .

LC5699


HiMark

.
9 31460 .

250

LC5688


HiMark

.
9 40500 .

250

LC0725


NativeMark

.
8 201236

5 50

LC5602

MagicMark

9 (20200 )
IgG.

250

2 250

4.3

04

, Amresco
TotalBLOT+TM

TotalBLOT+TM

E576

Amresco

30 3
15 15
10 10

TotalBLOT+TM .
.
BIO-BLOCKTM

BIO-BLOCKTM 1 X PBS

E671

Amresco

Biotechnology Grade

BIO-BLOCKTM 1 X TBS

E667

Amresco

Biotechnology Grade

BIO-BLOCK 1 PBS BIO-BLOCKTM 1 TBS .


TM

,
0%

0594

Amresco

50
100

,
45%

0652

Amresco

50
100

,
50%

0973

Amresco

50
100

, northern Southern, .
northern

TotalBLOTTM

northern

E679

Amresco

TotalBLOTTM northern.
. .
:
Agarose I...................................10 .
10X MOPS.................................2 x 500 .
37% Formaldehyde..................200 .
20X SSC Buffer........................4 .

339

www.helicon.ru

4.3

Southern

TotalBLOTTM

Southern

E682

Amresco

TotalBLOTTM Southern.
. .
:
Agarose I...................................10 .
TBE Buffer.................................10 Ready-Pack.
(Tris-Borate-EDTA)
Depurination Solution..............1 .
Denaturing Solution.................1 .
Neutralizing Solution................1 .
20 X SSC Buffer.......................4 .
(Denhardt)

100 X

E257

Amresco

Biotechnology Grade

10
50

50 X

E717

Amresco

Biotechnology Grade

50

0198

Amresco

Ultra Pure Grade

50
250

, 50%

E516

Amresco

Biotechnology Grade

100

.
8000 (PEG 8000)

8000

0159

Amresco

Biotechnology Grade

500
1
2,5

8000, 30%
1.6 NaCl

E523

Amresco

Biotechnology Grade

100
500

8000 .

0507

Amresco

High Purity Grade

500
1

04

340

4.3

04

SSC , 20 X

SSC , 20 X

0804

Amresco

Ultra Pure Grade

1 SSC 150 15 .
SSPE , 20 X

SSPE , 20 X

0810

Amresco

Ultra Pure Grade

1 X SSPE 150 10 1 .

Life Technologies (Invitrogen)


:
:
.
.
:
.
, .
(. ).
(. -)
iBlot ( )
. , , 40 .
BenchPro 4100 ( 8
95 ).
Invitrogen (invitrogen.com/antibodies)
Invitrogen 1,5 . , . , .

Novex WesternBreeze , . :
,
,
( , ).
, , ,
.

WesternDot 625 .
WesternDot 625 CdSe, .
:
: .
.
: .
( , Safe Imager 2.0, .
-).
625 ( ). -
.
.
.
.
WesternDot 625 ,
.
Novex WesternBreeze WesternDot 625 .

341

www.helicon.ru

4.3

LC2000

, 8,3 x 7,3 ,
0,2

20 .

2 250

LC2009

, 8,5 x 13,5 ,
0,2

16 .

2 250

LC2001

, 8,3 x 7,3 ,
0,45

20 .

250

LC2006

, 8,5 x 13,5 ,
0,45

16 .

250

LC2002

PVDF, 8,3 x 7,3


, 0,2

20 .

5 50

LC2005

PVDF Invitrolon, 8,3 x 7,3 , 0,45

20 .

250

LC2007

PVDF Invitrolon, 8,5 x 13,5 ,


0,45

16 .


WB7050



WesternBreeze

WB7003

WesternBreeze

L8455

. / 80 = 20
PVDF .
-


(HRP)

2 100 = 20
-
25

04

342

WP20005

Novex ECL

WB7103

WesternBreeze

WB7105

WesternBreeze

WB7107

WesternBreeze

WB7104

WesternBreeze

WB7106

WesternBreeze

WB7108

WesternBreeze

W10132

WesternDot 625

W10142

WesternDot 625

(
BCIP/NBT)

.
.

1 = 20
-
1 = 20
-
1 = 20
-
1 = 20
-

(
CDP-Star) 1 = 20
. -
5 .
1 = 20
-

.
(
).

1 = 20
-
1 = 20
-

4.3

04

Life Technologies (Invitrogen)


iBlot iBlot (. -).
-:
- - I E. coli .
ULS (Universal Linkage System) N-7. Invitrogen
Ulysis Alexa Fluor .
, in situ (ISH).

18247015


BioNick

-
50500 .. 1
1 .

50

U21650

Ulysis
Alexa
Fluor 488

1 =5 4

U21651

Ulysis
Alexa
Fluor 532

1 =20

U21652

Ulysis
Alexa
Fluor 546

U21654

Ulysis
Alexa
Fluor 594

1 =20

U21660

Ulysis
Alexa
Fluor 647

1 =20

,
Alexa Fluor .
15 .

1 =20

Thermo Fisher Scientific (Fermentas)

0661
(0662)

1001
(1002)

R0821
(R0822)

R0841
(R0842)

, -, /, .
,
, 5-4--3- (BCIP) (NBT)
,
, ,
/ .
-20o.
10 .
( 30 ).

,
SensiBlot Plus

6,6
.
.
+18-25o.
- 10 (20 20 ).
( - 1 (30 3 )).

- 5--4--3 (BCIP-T)

.
.
-20o .
1 .
( - 5 ).

(NBT)

,
5--4--3-
(BCIP) (BCIP-T).
.
- +4 -20o .
1 .
( - 5 ).

343

www.helicon.ru


- -

4.4

- 8 48502 (..) . ,
, SYBR Green I.
- :
;
;
, ;
, - , ;
.
- :
1. No Limits -.
2. GeneRuler OGeneRuler -.
3. MassRuler -.
4. FastRuler HK-.
5. ZipRuler HK-.
6. ORangeRuler -.
7. - .
8. - 174, R322 U19.
- 100 6000 , . , -.

04

No Limits -
No Limits - 36
( 10 20000 ). , ,
.
-
. -
. . No Limits
.
-, . (-):
10 -HCl (pH 7,6), 1 . : -20.

344

SM1391

NoLimits , 10 ..

10 .
10 .
0,5 /.

SM1381

NoLimits , 15 ..

15 .
10 .
0,5 /.

SM1401

NoLimits , 20 ..

20 .
10 .
0,5 /.

SM1761

NoLimits , 25 ..

25 .
10 .
0,5 /.

SM1411

NoLimits , 35 ..

35 .
10 .
0,5 /.

SM1421

NoLimits , 50 ..

50 .
10 .
0,5 /.

4.4


- -

SM1431

NoLimits , 75 ..

75 .
10 .
0,5 /.

SM1441

NoLimits , 100 ..

100 .
10 .
0,5 /.

SM1601

NoLimits , 150 ..

150 .
10 .
0,5 /.

SM1611

NoLimits , 200 ..

200 .
10 .
0,5 /.

SM1451

NoLimits , 250 ..

250 .
10 .
0,5 /.

SM1621

NoLimits , 300 ..

300 .
10 .
0,5 /.

SM1631

NoLimits , 400 ..

400 .
10 .
0,5 /.

SM1641

NoLimits , 500 ..

500 .
10 .
0,5 /.

SM1461

NoLimits , 600 ..

600 .
10 .
0,5 /.

SM1651

NoLimits , 700 ..

700 .
10 .
0,5 /.

SM1471

NoLimits , 750 ..

750 .
10 .
0,5 /.

SM1481

NoLimits , 800 ..

800 .
10 .
0,5 /.

SM1661

NoLimits , 850 ..

850 .
10 .
0,5 /.

SM1491

NoLimits , 900 ..

900 .
10 .
0,5 /.

SM1671

NoLimits , 1000 ..

1000 .
10 .
0,5 /.

SM1681

NoLimits , 1200 ..

1200 .
10 .
0,5 /.

SM1691

NoLimits , 1500 ..

1500 .
10 .
0,5 /.

SM1701

NoLimits , 2000 ..

2000 .
10 .
0,5 /.

SM1571

NoLimits , 2500 ..

2500 .
10 .
0,5 /.

SM1711

NoLimits , 3000 ..

3000 .
10 .
0,5 /.

SM1501

NoLimits , 3500 ..

3500 .
10 .
0,5 /.

04

345

www.helicon.ru

- -

SM1721

NoLimits , 4000 ..

4000
.
10 .
0,5 /.

SM1731

NoLimits , 5000 ..

5000
.
10 .
0,5 /.

SM1511

NoLimits , 6000 ..

6000
.
10 .
0,5 /.

NoLimits , 7000 ..

7000
.
10 .
0,5 /.

SM1521

NoLimits , 8000 ..

8000
.
10 .
0,5 /.

SM1751

NoLimits , 10000 ..

10000
.
10 .
0,5 /.

SM1531

NoLimits , 15000 ..

15000
.
10 .
0,5 /.

SM1771

NoLimits , 17000 ..

17000
.
10 .
0,5 /.

NoLimits , 20000 ..

20000
.
10 .
0,5 /.

SM1741

SM1541

4.4

GeneRuler OGeneRuler -

04

GeneRuler - 50
10000 , .

. .
- (10 -HCl, pH 7,6, 1 ). : -20.
4
(0031).
GeneRuler - (10
-HCl, pH 7,6, 10 , 0,005% , 0,005% FF, 10% ) . : +4o 6 ,
-20o.
OGeneRuler - GeneRuler - .
G. OGeneRuler -: 10 -HCl, pH 7,6,
10 , 0,025% G, 0,005% FF, 10% .
GeneRuler OGeneRuler - (R0611 R0631 ).

346

4.4

SM0311
(SM0312)
SM0313
(SM0314)
SM1163

SM1331
(SM1332)
SM1333
(SM1334)
SM1343

SM0331
(SM0332)
SM0333
(SM0334)
SM1173

SM0241
(SM0242)
SM0243
(SM0244)
SM1143


- -

GeneRuler -, 1000 ..
GeneRuler -, 1000 ..,

O'GeneRuler -, 1000 ..,

14
250-10000 : 250, 500, 750, 1000, 1500, 2000,
2500, 3000, 3500, 4000, 5000, 6000, 8000, 10000. ,
1000, 3000 6000 ..,
.

(0,7-1,2%) .
- 5 50 .
( - 25 50 ).
- 0,5 /.
- 5 50 .
( - 50 ).
- 0,1 /.
- 5 50 .
- 0,1 /.

GeneRuler -, 1000 .. Plus


GeneRuler -, 1000 .. Plus,

OGeneRuler -, 1000 .. Plus,

15
75-20000 : 75, 200, 300, 400, 500, 700, 1000,
1500, 2000, 3000, 4000, 5000, 7000, 10000, 20000. ,
1000, 1500 5000 ..,
.

(0,7-1,2%) .
- 5 50 .
( - 25 50 ).
- 0,5 /.
- 5 50 .
( - 50 ).
- 0,1 /.
- 5 50 .
- 0,1 /.

GeneRuler -, 100-10000 ..
GeneRuler -, 100-10000 ..,

OGeneRuler -, 100-10000 ..,

21 10010000 : 100, 200, 300, 400, 500, 600, 700, 800, 900,
1000, 1200, 1500, 2000, 2500, 3000, 3500, 4000, 5000, 6000, 8000,
10000. , 500, 1000
3000 .., .

(0,7-1,2%) .
- 5 50 .
( - 25 50 ).
- 0,5 /.
- 5 50 .
( - 50 ).
- 0,1 /.
- 5 50 .
- 0,1 /.

GeneRuler -, 100 ..
GeneRuler -, 100 ..,

O'GeneRuler -, 100 ..,

10 1001000 : 100, 200, 300, 400, 500, 600, 700, 800, 900,
1000. , 500 ..,
.

(0,7-1,2%) (4-8%) .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
( - 5 50 ).
- 0,1 /.
- 50 .
- 0,1 /.

04

347

www.helicon.ru

SM0321
(SM0322)
SM0323
(SM0324)
SM1153

SM0371
(SM0372)
SM0373 SM1133

SM1191
(SM1192)
SM1193 SM1203

04

SM1351
(SM1352)
SM1353

348

- -

4.4

GeneRuler -, 100 .. Plus


GeneRuler -, 100 .. Plus,

O'GeneRuler -, 100 ..
Plus,

14
100-3000 : 100, 200, 300, 400, 500,
600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000. ,
500 1000 ..,
.

(0,7-1,2%) .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
( - 5 50 ).
- 0,1 /.
- 50 .
- 0,1 /.

GeneRuler -, 50 ..
GeneRuler -, 50 ..,

O'GeneRuler -, 50 ..,

13
50-1000 : 50, 100, 150, 200, 250, 300, 400, 500,
600, 700, 800, 900, 1000. ,
250 500 .., .


(0,7-1,2%) (4-8%) .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.
- 50 .
- 0,1 /.

GeneRuler -, 10-300 ..
GeneRuler -, 10-300 ..,

O'GeneRuler -, 10-300 ..,

11
10-300 : 10, 15, 20, 25, 35, 50, 75, 100, 150,
200, 300. , 50 ..,
.

(4,5-5,0%) .
(8-10%) .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.
- 50 .
- 0,1 /.

GeneRuler -, 25-700 ..
GeneRuler -, 25-700 ..,

O'GeneRuler -, 25-700 ..,

10
25-700 : 25, 50, 75, 100, 150, 200,
300, 400, 500, 700. ,
100 300 .., .

(4,55,0%) .
(8-10%) .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.
- 50 .
- 0,1 /.

GeneRuler -, 10171-48502
..
GeneRuler -, 10171-48502
..,

8
10171-48502 : 10171, 12119, 13825, 15258,
17000, 20555, 24508, 48502.

(0,3-0,5%) .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.

SM1211
(SM1212)
SM1213 SM1223

4.4

SM1551
(SM1552)
SM1553
SM1563


- -

GeneRuler -
GeneRuler -
O'GeneRuler -

9 100-5000
: 100, 300, 500, 750, 1000, 1500, 2000, 3000, 5000.
, 500 1500 ..,
.
(1,7-2,5%)
(, ).
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.
- 50 .
- 0,1 /.

04

MassRuler -
MassRuler - 80 10000 . . - . MassRuler -
, (10 -HCl, pH 7,6,
10 , 0,005% , 10% ) . :
+4o 6 , -20o.
- 1 6X MassRuler (R0621).

SM0383

SM1263

SM1273

SM0393

SM1243

MassRuler -, 80-1031 ..,


11 80-1031
: 80, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1031.

(1,7-2,5%) .
2 x 500 .
- 60,8 /.

MassRuler -, 100-1000 ..
Forward, -

6 100-1000
: 100, 200, 300, 500, 700, 1000.
- .

(0,7-2,0%)
(, ).
2 x 500 .
- 28 /.

MassRuler -, 100-1000 ..
Reverse, -

6 100-1000
: 100, 200, 300, 500, 700, 1000.
- .

(0,7-2,0%)
(, ).
2 x 500 .
- 28 /.

MassRuler - , 150010000 ..,

9 150010000 : 1500, 2000, 2500, 3000, 4000, 5000, 6000,


8000, 10000.
(0,7-1,2%) .
2 x 500 .
- 42,2 /.

MassRuler -, 1500-10000 ..
Forward, -

6 150010000 : 1500, 2000, 3000, 5000, 7000, 10000.


-
.
(0,7-1,5%)
(,
).
2 x 500 .
28,5 /.

349

www.helicon.ru

SM1253

SM0403

SM1283

SM1293


- -

4.4

MassRuler -, 1500-10000
.. Reverse, -

6
1500-10000 : 1500, 2000, 3000, 5000,
7000, 10000. -
.
(0,71,5%)
(, ).
2 x 500 .
28,5 /.

MassRuler -, 80-10000
.,

20
80-1000 : 80, 100, 200, 300, 400, 500, 600, 700,
800, 900, 1031, 1500, 2000, 2500, 3000, 4000, 5000, 6000,
8000, 10000.
(1,0-1,2%) .
2 x 500 .
- 103 /.

MassRuler -, 100-10000
. Forward,

12
100-1000 : 100, 200, 300, 500, 700, 1000, 1500,
2000, 3000, 5000, 7000, 10000. .

(0,7-1,5%)
(, ).
2 x 500 .
56,5 /.

MassRuler -, 100-10000
. Reverse,

12
100-1000 : 100, 200, 300, 500, 700, 1000,
1500, 2000, 3000, 5000, 7000, 10000.
- .

(0,7-1,5%)
(,
).
2 x 500 .
56,5 /.

FastRuler HK-
FastRuler - 10 1000 , 48- 96-.
-
. . ( 8-14 ,
10-20 ). ,
. .
: +4o 6 , -20o.
- 1 6X MassRuler
(R0621) 1 6X Orange (R0631).

04

SM1233

350

FastRuler -, 10-200 ..,



10-200 : 10, 20, 50, 100, 200,

4 .
4%-
. ,
10 -HCl, pH 7,6, 10 , 0,025%
G, 0,005% FF, 10% .
2 x 500 .
- 22,2 /.

4.4

SM1103

SM1113

SM1123


- -

FastRuler -, 50-1500 ..,


50-1500
: 50, 200, 400, 850, 1500.
2%- .
, 10 HCl, 7,6, 10 , 0,005% , 10% .
2 x 500 .
- 20 /.

FastRuler -, 100-5000 ..,


100-5000
: 100, 400, 850, 2000, 5000.

1%- .
, 10 -HCl, 7,6, 10 , 0,005%
, 10% .
2 x 500 .
- 20 /.

FastRuler -, 500-10000 ..,


500-10000
: 500, 1000, 2000, 4000, 10000.

1%- .
, 10 -HCl, 7,6, 10 , 0,005%
, 10% .
2 x 500 .
- 20 /.

04

ZipRuler HK-

SM1373

ZipRuler-
-

-,
. ZipRuler I
100-10000 : 100, 300, 500, 850, 1200, 2000, 3000,
5000, 10000. , 500
5000 .., . ZipRuler I
, 10 -HCl, pH 7,6,
10 , 0,025% G, 0,005% FF, 10%
. ZipRuler II
200-20000 : 200, 400, 700, 1000, 1500, 2500, 4000,
7000, 20000. , 1500 ..,
. ZipRuler II
, 10 -HCl, 7,6, 10 ,
0,005% , 10% .
ZipRuler -
5%-
.
: +4o
6 , -20o.
1 6X Orange
(R0631).
ZipRuler ( I II)
2 x 50 .
0,1 /.

351

www.helicon.ru


- -

4.4

ORangeRuler -
ORangeRuler -
10 6000 .
. ORangeRuler - - ,
10, 15, 20, 50, 100, 200 500 .
, (10 -HCl, 7,6, 10
, 0,025% G, 0,005% FF, 10% ) . ORangeRuler - ,
. : +4o 6 , -20o.
- 1 6X Orange (R0631).

SM1303

SM1313

SM1323

SM0613

04

SM0623

352

O'RangeRuler -, 5 ..,

19 10-100
.
5 ..: 10, 15, 20, 25, 30, 35, 40, 45, 50 .. ,
50 100 ..,
.
5%- (8-10%)
.
50 .
0,1 /.

O'RangeRuler -, 10 ..,

15 10-150
.
10 ..: 10, 20, 30, 40, 50 .. ,
50, 100 150 ..,
.
(4,5-5,0%) (8-10%) .
50 .
0,1 /.

O'RangeRuler -, 20 ..,

15 20-300
.
20 ..: 20, 40, 60, 80, 100, 120 .. ,
100, 200 300 ..,
.
(3,5-4,0%) (8-10%) .
50 .
0,1 /.

O'RangeRuler -, 50 ..,

20 50-1000
.
50 ..: 50, 100, 150, 200, 250, 300 .. ,
200, 500 1000 ..,
.
(1,7-2,5%)
(4-8%) .
25 .
0,05 /.

O'RangeRuler -, 100 ..,


15 100-1500
.
100 ..: 100, 200, 300, 400, 500, 600 .. ,
500, 1000 1500 ..,
.
(1,7-2,5%)
(4-8%) .
25 .
0,05 /.

4.4

SM0633

SM0643

SM0653


- -

O'RangeRuler -, 200 ..,


15 200-3000 .
200 ..: 100,
200, 400, 600, 800, 1000 .. ,
1000, 2000 3000 .., .
(0,8-1,2%) .
25 .
0,05 /.

O'RangeRuler -, 500 ..,


12 500-6000 .
500 ..: 500,
1000, 1500, 2000, 2500, 3000 .. ,
2000 6000 .., .
(0,8-1,2%) .
25 .
0,05 /.

O'RangeRuler -, 100+500 ..,


32 100-6000 .
SM0623 SM0643.
100 ..
100 1500 .. 500 .. 1500 6000 .. ,
500, 1000, 1500, 2000 6000
.. .
(1,0-1,2%) .
25 .
0,05 /.

04

-
, . - .
.
. - (10 -HCl, pH 7,6, 1 ).
: -20. 4 (0031). ,
(0051 0421). /PstI .
/HindIII /EcoRI+HindIII ,
(10 -HCl, pH 7,6, 10 , 0,005% , 0,005%
FF, 10% ) . :
+4o 6 , -20o.
- 6X (R0611)
2 10 ( ).

SM0281

SM0101
(SM0102)
SM0103

/EcoRI


EcoRI, -
. 6
3530-21226 : 3530, 4878, 5643, 5804, 7421, 21226.

0,7%- .
- 5 50 .
- 0,5 /.

/HindIII
/HindIII


HindIII.
8 125-23130 : 125, 564,
2027, 2322, 4361, 6557, 9416, 23130.
1%- .
- 5 50 .
( - 25 50 ).
- 0,5 /.
- 5 50 .
- 0,1 /.

353

www.helicon.ru

SM0191
(SM0192)
SM0193

SM0291

SM1051

SM0111

04

SM0161

354


- -

4.4

/EcoRI+HindIII
/EcoRI+HindIII


EcoRI HindIII.
13 12521226 : 125, 564, 831, 947, 1375, 1584, 1904,
2027, 3530, 4268, 4973, 5148, 21226.
1%-
. ,
125 ..,
.
- 5 50 .
( - 25 50 ).
- 0,5 /.
- 5 50 .
- 0,1 /.

-pUC mix -


Eco130I
Eco81I pUCGK57
HindIII, - .
14 74-19329 : 74,
421, 697, 925, 1150, 1489, 1882, 2322, 2690, 3280, 4254,
5526, 7743, 19329.
1%- . ,
74 ..,
.
- 50 .
- 0,5 /.

/Eco47I (AvaII)


Eco47I,
AvaII, -
. 36
23-8126 : 23, 29, 32, 42, 45, 67, 73, 88,
151, 215, 242, 272, 308, 310, 345, 398, 433, 511, 513, 590,
597, 894, 974, 985, 1284, 1420, 1611, 1951, 2005, 2134, 2555,
2606, 3676, 6442, 6555, 8126.
1,5%-
. , 23, 29, 32,
42, 45, 67, 73, 88, 151, 215, 242, 272 ..,
.
- 5 50 .
- 0,5 /.

/Eco91I (BstEII)


Eco91I,
BstEII,
- . 14
117-8453 : 117,
224, 702, 1264, 1371, 1929, 2323, 3675, 4324, 4822, 5687,
6369, 7242, 8453.
1,0%- .
, 117 224 ..,
.
- 5 50 .
- 0,5 /.

/Eco130I (StyI)


Eco130I,
StyI, -
. 11
74-19329 : 74, 421, 925, 1489, 1882,
2690, 3472, 4254, 6223, 7743, 19329.
1,0%-
. ,
74 ..,
.
- 5 50 .
- 0,5 /.

4.4

SM0231

SM0361


- -

mix -


. 14
1503-48502 : 1503, 8271, 8614,
10086, 12220, 15004, 17053, 19397, 23994, 24508, 29946, 33498,
38416, 48502.
0,7%- . ,
1503 ..,
.
5 50 .
- 0,5 /.

/PstI


PstI, -
. 29
15-11501 : 15, 72, 87, 94, 150, 164, 200, 211, 216,
247, 264, 339, 448, 468, 514, 805, 1093, 1159, 1700, 1986, 2140,
2443, 2459, 2556, 2838, 4507, 4749, 5077, 11501.
1,5%-
. , 15, 72,
87, 94, 150, 164, 200, 211 216 ..,
.
- 5 50 .
- 0,5 /.

04

- 174, R322 U19


, . - .
.
. - (10 -HCl, pH 7,6, 1 ). : -20.
4 (0031). , pUC mix, 174 /HinfI pUC19 /MspI
(0051 0421).
pUC mix, 174 /BsuRI, pBR322 /AluI pUC19 /MspI , (10 -HCl, pH 7,6, 10 , 0,005% ,
0,005% FF, 10% ) . : +4o 6 , -20o.
- 6X
(R0611) - 2 10 ( ).

SM0271

pBR322 /BsuRI (HaeIII)


pBR322 BsuRI,
HaeIII, -
. 22 8-587
: 8, 11, 18, 21, 51, 57, 64, 80, 89, 104, 123, 124, 184,
192, 213, 234, 267, 434, 458, 502, 540, 587.

2,5%- 5,0%-
.
, 8, 11, 18 21 ..,
.
- 50 .
- 0,5 /.

355

www.helicon.ru

SM0301
(SM0302)
SM0303

SM0251
(SM0252)
SM0253

SM0261

SM0121 SM0123

04

SM0221
(SM0222)
SM0223

356


- -

4.4

pUC mix -
pUC mix -


pUC19 pUC57
MspI, DraI HindIII. 17
19-1118 : 19, 26, 34, 34,
67, 110, 111, 147, 190, 242, 331, 404, 489, 501, 692, 881, 1118.

1,7%-
5,0%- .
, 19 26 ..,
.
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.

174 /BsuRI (HaeIII)


174 /BsuRI (HaeIII)


174 BsuRI,
HaeIII.
11 72-1353 : 72, 118,
194, 234, 271, 281, 310, 603, 872, 1078, 1353.

1,7%- 5,0% .
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.

174 /HinfI


174 HinfI,
- . 21
24-726 : 24, 40, 42, 48,
66, 66, 82, 100, 118, 140, 151, 200, 249, 311, 413, 417, 427, 500,
553, 713, 726.
2,5%-
5,0%- .
, 24 40 ..,
.
- 50 .
- 0,5 /.

pBR322 /AluI
pBR322 /AluI


pBR322 AluI.
17 11-908
: 11, 15, 19, 46, 49, 57, 63, 90, 100, 226, 257,
281, 403, 521, 656, 659, 908.

1,7%-
. , 11, 15,
19, 46, 49, 57 63 ..,
. 5%-
-
- 257, 403, 656 659
.
- 50 .
- 0,5 /.
- 50 .
- 0,1 /.

pUC19 /MspI (HpaII)


pUC19 /MspI (HpaII)


pUC19 MspI,
HpaII.
13 26-501
: 26, 34, 34, 67, 110, 111, 147, 190, 242, 331, 404,
489, 501.
1,7% 5,0%- . ,
26 ..,
.
- 50 .
( - 5 50 ).
- 0,5 /.
- 50 .
- 0,1 /.

4.4


- -

04

-
- . 1
( 6,0). 4 (0031). -.
- (47,5% , 0,0125% , 0,0125% , 0,0125% FF, 0,0125% , 0,75 )
.
: -20o 6 , -70o.
- 2X (R0641) - 1 .

SM1831
SM1833

SM1821
SM1823

RiboRuler P-, 100-1000

RiboRuler P-, 100-1000


,

7 - 100-1000
: 100, 200, 300, 400, 600, 800, 1000.

(1,7-2,5%) (4-8%) .
5 20 .
- 70 /.
5 40 .
- 35 /.

RiboRuler P-, 200-6000

RiboRuler P-, 200-6000


,

8 - 2006000 : 200, 500, 1000, 1500, 2000, 3000, 4000,


6000.
(0,8-1,5%) .
5 20 .
- 60 /.
5 40 .
- 30 /.

357

www.helicon.ru

5.1


Thermo Fisher Scientific (Fermentas)
- ,
. : 1) ,
, ; 2) , 3) ; 4)
; 5) ;
6) . , -. .
-20oC.

K1231
(K1232)

K1213
(K1214)

K1422
(K1423)

05

K0771

K2710 (K2711)

358


, CloneJET


pJET1.2/blunt.
5 99% .
-
- .
20 .
( 40 ).


, InsT/Aclone


3'-dA-,
pTZ57R/T. 1 ,
90%.
10 .
( 30 ).

4 -
,
5 .
50 .
( 150 ).

5 (0,5-5 )
, 5'- ,
.
4 -
, T4 , ,
.
50 .


, TransformAid


E. coli .
107 1 .
- 1-2,5 .
20 .
( 40 ).

5.2

TOPO

05

TOPO
10 Invitrogen TOPO.
TOPO .
:
95%.
5 .
.
: 4 000 .
.

:
.
.
in vitro.
.
E. coli.
.
Gateway (. )

TOPO
I
I, .
. I (C/T)
CCTT 3-, . . I
, 3-, .
TOPO
TOPO 3- I
. ( 5 )
().

TOPO TA 3-T 3-A - Taq .
Zero Blunt TOPO , ccdB.
Directional TOPO .
5- (GGTG), (CACC).
, TOPO
TOPO , .

One Shot : .
MAX Efficiency (108109 / ).
-.
T1R , T1 T5.

359

www.helicon.ru

TOPO

5.2

E. coli
109 /.
:
One Shot MAX Efficiency DH5-T1R - DH5. ,
( ) - , .
109 /.
One Shot Mach1-T1R DH5-T1R
: 50 ( 1,5 , , ).
4 . TOPO Mach1 2
.
One Shot TOP10 , ( ). DH10B.
One Shot TOP10F TOP10 F- .
:
One Shot TOP10 Electrocomp TOP10, .

K450002

TOPO TA Cloning
OneShot TOP10
PureLink Quick
(Miniprep)


PureLink (.

)

20

K280020

Zero Blunt
TOPO One Shot
TOP10


.
(T7, T3, M13F, M13R).

20

K475010

TOPO XL
One Shot TOP10

K460001

TOPO TA Cloning
Dual Promoter


TOPO TA
3 00010 000 ..

10

in vitro

TOPO TA
OneShot TOP10F. T7 SP6.

20

K457501

TOPO TA Cloning

One Shot TOP10

K10001


Champion pET100 Directional TOPO BL21
Star (DE3) One Shot


(T7, T3, M13F, M13R).

.

20

E. coli
,
, .

20


K480001


pcDNA3.1V5-His TOPO TA

One
Shot TOP10. CMV -
V5 6xHis.

20

K830001

pcDNA3.3-TOPO TA
Cloning

35 ,
CMV. .
One Shot TOP10.

20

K244020


pcDNA3.2/GW/D-TOPO


. One Shot TOP10.

20

K495000

ViraPower Directional
TOPO


Stbl3.

05

Gateway
K240020


pENTRD-TOPO
One Shot TOP10


pENTRD-TOPO Gateway.

20

K250020


pCR8GWTOPO TA

TOPO TA
pCR8GWTOPO Gateway.

20

TOPO. invitrogen.com/vectors.

360

5.3

Gateway

05

Gateway
Gateway , . 1 500
Gateway.
:
99%.
1 .
.
.
.
.
.
:
:
.
.
.
.
In vitro.
Multisite cloning: 4 .
.

Gateway

Gateway E.coli.
attP attB E.coli. -
(Int) (IHF). attL attR, attP attB. attL attR
attP attB.

Gateway BP in vitro attB (attB1 attB2)
attP (attP1 attP2) . , att attL1 attL2 attR1 attR2 .
, attB1 attP1 attP2 .., . Gateway
LR. BP LR Gateway.
:
1. , att. :
TOPO (. TOPO) att;
, attB, pDONR;
, , pENTR;
Ultimate ORF.
2. - att ,
E.coli.

11828029

Gateway

One Shot ccdB
Survival

Gateway
.

11803012

Gateway pDEST17

E.coli.

K496000

ViraPower Gateway

12537100

MultiSite Gateway Pro Plus

Multisite cloning

20

Invitrogen , Gateway.
invitrogen.com/vectors.

361

www.helicon.ru

6.1

Life Technologies (Invitrogen)


Invitrogen :
( .. Lipofectamine 2000, 13 000 ).
Neon (. )
TOPO
Gateway (. ).

, Invitrogen, , :
:
.
(siRNA).
siRNA in vivo.
:
, 293, CHO .
, .
:
.
-.
.
.
.
:
.
.

15338100

Lipofectamine LTX
Plus

Invitrogen.

, .

Lipofectamine RNAiMAX

siRNA,
.

Lipofectamine 2000

siRNA.
.

FreeStyle MAX

,
CHO 293.

13778075
13778150
11668027
11668019
11668500
16447100

06

16447500

362

1377501



Invivofectamine 2.0

1377505


Invivofectamine 2.0

siRNA in vivo.

0,75
1,5
0,75
1,5
15
1
15
1
( 1 )
1
( 5 )

7.1

07



Invitrogen GIBCO , ,
:
L--L- GlutaMAX-I, ,
. , GlutaMAX-I , .
Advanced MEM, DMEM, DMEM/F-12 RPMI 1640, 5090% .
.
GIBCO .

31095029

MEM ,

500

MEM ,

500

31095052
21090022
21090055
41090028
61100053
61100087
61100103
11700077
12492013
12492021
41965039
41965062
11960044
11960085
61965026
61965059
31885023
31885049
11880028
11880036
21885025
21885108
52100021
52100039
52100047
31600083
31600091
12491015
12491023

MEM ,
GlutaMAX-I
MEM ,

10 500
10 500

MEM .
,
.. HeLa, BHK-21, 293,
HEP-2, HT-1080, MCF-7,
.

MEM ,

500
1
10
50
10
500

Advanced MEM

10 500

DMEM 4,5 / ,

500

DMEM 4,5 / ,

500

DMEM 4,5 / ,
GlutaMAX-I

500

DMEM 1 / ,

500

DMEM 1 / ,
,

DMEM 1 / ,
GlutaMAX-I
DMEM 4,5 / ,

DMEM 1 / ,

Advanced DMEM

10 500
10 500
10 500
10 500
DMEM
: ,
, , HUVEC, ,
HeLa, 293, Cos-7 PC-12.

500
10 500
500
10 500
5
10
50
10
50
500
10 500

363

www.helicon.ru

11320074

DMEMF-12

21331020
21331046
31331028
31331093
32500035
32500043
12634010
12634028
21875034
21875091
31870025
31870074
61870010
61870044
51800019
51800035
51800043
12633012
12633020
31550023
31550031
41550021
41550088
21765029
21765037
31765027
31765068
21700026
21700018
31150022

31150030
41150020
41150087
22350029
22350078
31100027
31100019
10012011
10012037
21980032
21980065
31980022
31980048
42200014
42200030
31985047
31985054
51985026
51985042

07

22600134

DMEMF-12

500
500

DMEMF-12
DMEMF-12 GlutaMAX-I

10 500
DMEMF-12
: MDCK, ,
.

500
10 500
10
50
500

Advanced DMEM/F-12

10 500

RPMI 1640

500

RPMI 1640

500

RPMI 1640
GlutaMAX-I

10 500
10 500

, .

RPMI 1640

F10
GlutaMAX-I

10 500
1
50
500
10 500

CHO,

.

500
10 500
500
10 500
500

F12 ()

F12 ()
GlutaMAX-I

500

10

Advanced RPMI 1640


F10

10 500

CHO.

500
10 500


F12 ()

199

500

199
GlutaMAX-I

500

199
, 25 HEPES

50
10 500
10 500

.

500
10 500

199

199
, 25
HEPES

50
10
500

IMDM
IMDM GlutaMAX-I
IMDM
Opti-MEM I Reduced
Serum

Opti-MEM I Reduced
Serum GlutaMAX-I
Opti-MEM I Reduced Serum

7.1

10 500

.

500
10 500
1
10
500

10 500
MEM,
50%. 500
(. 10 500
)
10

invitrogen.com GIBCO: HEPES,


, .

364

7.1

07

(SFM)

CD , .
, AGT, , pH.

12681011
12681029

CD OptiCHO AGT

CHO
( +40%
).

A1122201
12610010
12055091
12055083
11279023

12372001

12529001

1 000

AIM V

T- ,
.

500

CD Hybridoma

CD Hybridoma AGT

1
10
100
10 = 520

CD 293

1 000
1

CD 293 AGT

293 .

10
100
10 = 559

12661013


(PEM)

11681020

VP-SFM

12559027
12559001

1 000
1 000

12529003

12559019

10

CHO DHFR-.

12529020
12529012

CD DG44

12372003
11913019

6 1 000

100

12372025
12372017

1 000

CD OptiCHO

A1122204
A1122205

VP-SFM AGT

PER.C6

1 000
1 000

VERO.
.

12559003

1
10
100
10 = 567

, .

Sf-900 III SFM

SFM
Sf9 Sf21 .

500

21720024


Drosophila

S2.

500

10486025

Express Five SFM

SFM
BTI-TN-5B1-4 (High Five).

1 000

12658019
12658027
11605045
11605086

1 000
500
10 500

365

www.helicon.ru

7.1


Invitrogen GIBCO :
(ESC).
(iPSC).
(MSC).
(NSC).
(HSC).

07

366

A1000701

StemPro hESC SFM

SFM ESC
,
,
.

1
( 500 )

10829018

KnockOut DMEM

12660012

KnockOut DMEM/F12

10828028


Knockout

ESC iPSC.
, ,
,
.

500

A1014201

CELLstart CTS

ESC, MSC
NSC .
.

A1033201

StemPro MSC SFM

SFM MSC

( 5 ).

1
( 500 )

12746012

MesenPRO RS

MSC 1
2% .
( 500 )

A1050901

StemPro NSC SFM

SFM NSC
,
.

1
( 500 )

21103049

Neurobasal


NSC .

500

10888022

Neurobasal-A

NSC .

500

10639011

StemPro-34 SFM

SFM
, .

500

500
500

7.1

07


Neurobasal, NSC CO2-,
GIBCO, Neurobasal .

A1247501

Hibernate-A


48 .

500

A1247601

Hibernate-E


48
.

500

A1261301

GIBCO

500

(3D)
.
,
. in vivo ,
. GIBCO (, , ,
, ), 3D .

12760013


Geltrex

3D ,
, iPSC.

12760021
A1048001
A1048002


Geltrex

ESC

1
5
1

Geltrex,
ESC .

12684015

96-

12684023

24-

12684031
12684049

3D AlgiMatrix

,
() ,
,
.

5 96-

4 24-

A1098201

6-
+A1091501

A1098202

4 6-
+A1091501

A1091501


AlgiMatrix

50

A1134001


AlgiMatrix

, .

50

367

www.helicon.ru

7.2

(FBS)
2/3 GIBCO (Invitrogen) . GIBCO 50- . , .

:
FBS 0,1 .
FBS Heat-Inactivated 56C.
.
FBS Gamma-Irradiated - .
:
:
.
.
(BVD, PI3, IBR).
:
pH.
.
:
.
.
.
:
.
.
.
FBS:
.
(USDA-Approved).
.
.
(EU-Approved).
FBS GIBCO :
FBS (Certified.
FBS (Qualified/EU-Approved).
FBS.
FBS

16000036
16000044
10082139

07

10082147

368

FBS, Certified,

Premium FBS.
. 10 EU/,
15 /.

FBS, Certified,
Heat-Inactivated,

100
500
100
500

7.2

07

FBS

10099133
10099141
10100139
10100147
26140087
26140079
16140063
16140064
10270098
10270106
10500056
10500064
10109163

FBS, Qualified,
FBS, Qualified,
Heat-Inactivated,

100
.
100 EU/, 30 /.

100
100

50 EU/, 25 /.

500
100
500

FBS, EU-Approved
(:
)
FBS, EU-Approved
(:
), Heat-Inactivated

500
500

FBS, Qualified,
FBS, Qualified,
Heat-Inactivated,

100
500
.

100
500

FBS, EU-Approved,
Gamma-Irradiated

500

FBS
12676011
12676029
16250086
16250078
26400036
26400044
16141061
16141079
12662011
12662029

50

FBS, , USDAApproved

.
.

FBS, <5 / IgG,

IgG .

FBS, ,

10
( NaCl).
.

100

FBS

,

.

100

FBS

100
:
-, . 500

500
100
500
500

500

16170086

1236 .

14 . ,
.

16170078
16010167
16010159
16050130
16050122
26050070
26050088

,

, Heat-Inactivated,

100
500
100
500
100

,
.

500
100
500

369

www.helicon.ru

7.3


Invitrogen 300 150 GIBCO.
GIBCO:
:
.
.
: GM-CSF, G-CSF M-CSF.
(TNF).
:
.
.
.
.
GIBCO:
:
(FGF).
(TGF).
(BMP).
(EGF).
(PDGF).
(VEGF).
.
(TPO).
:
.
.

07

invitrogen.com/cytokines.

370

7.4

07


Invitrogen :
.
:
.
.
.
/ .

11805017
11593027
10177012
11815024
11815032
15160047
15160070
21810031
21850029
11860038

D
, ,
,

(100X)

10 / .

5
200
5
5
25
100
20 100
100
25 MU
100

.
15710049
15710080
15750037
15750045
15750078
15750094
15750102

100
20 100
20
100
10 10
20 20
20 100

(10 /)

(50 /)

15070063

-
(5 000:5 000)

(5 000 ./) (5 /).

100

15140148
15140122
15140130

-
(10 000:10 000)

(10 000 ./) (10 /).

20
100
20 100

15640055

- (PSN)

(5 /), (5 /)
(10 /).

100

.
15290018
15290026
15290059
15340029

Fungizone

250 / B.

20
50
20 50
20

.
15240096
15240062
R01510

- (100X)

(10 000 ./), (10 /)


B (25 /).

- (500X)

(1 /) B (125 /).

20
100
10 1

/
R21001
A1113903
A1113902
11811023
11811031
11811064
11811098
10131019
10131027
10687010
11814019
A1113803
A1113802
R25001
R25005

S
S (10 /)

Geneticin (G418 )

Geneticin (G418 , 50 /)
B (50 /)

(10 /)
Zeocin (100 /)

50
10 1
20
1
5
10
25
20
100
20
500
10 1
20
8 1,25
50

371

www.helicon.ru

7.5

,
. GIBCO ( Invitrogen) , , .

25050014

, 0,25%

100

100

15090046

, 2,5% (10X)


,
.

27250018

(1:250)

25050030

20 100
100


25300054
25300062
25300096

100
, 0,05%,

25300104
15400054
25200056
25200072


,
.

, 0,5% (10X),
, 0,25%,

500
20 100
10 500
100

100
500

TrypLE

- TrypLE :
: , .
: .
/.
.
, .
.
TrypLE , .

12604013
12604021
12604039

100

12605028
12605036
12563011
12563029


.

TrypLE Express

07

A1217703

372

TrypLE Select (10X)

20 100
5
100
500
20 100
100

TrypLE Select

A1217701
A1217702

500


TrypLE Express

12604054
12605010

TrypLE :
A549 .

500
100
500
20 100

7.5

07

A1110501

StemPro Accutase

100

15040033

, 1:5 000

100

17100017

, , .

17101015

II

, , ,
.

17104019

IV

17105041

Bacillus polymyxa
.
.

373

www.helicon.ru

7.6


Invitrogen GIBCO cGMP ISO
, pH, , , .
:
- (DPBS).
(HBSS).
- (PBS).
(EBSS).
(DPBS)

14040083
14040091
14040166

100
DPBS

pH .

14040174

14190185

20 100
10 500

14190086
14190094

500

100
DPBS

DPBS
TrypLE (.
)

14190169

500
20 100
10 500

invitrogen.com DPBS 10X .

(HBSS)
24020083
24020091
24020141

100
HBSS ,

24020133
14025050
14025100

500
pH
,
.

14170146

10 500
100
20 100
HBSS
TrypLE (.
)

14175046
14175137

500

HBSS ,

14170138
14175053

10 500
500

HBSS ,

14170070
14170088

20 100

10 500
100
500

HBSS ,

20 100

14175129

10 500

invitrogen.com DPBS 10X .

PBS
10010015
10010056
70011036
70011051
20012019
20012068
70013016
70013065

500

PBS, pH 7,4

10 500
500

PBS, pH 7,4 (10X)


PBS, pH 7,2

10 500
KH2PO4 + NaCl + Na2HPO4.

PBS

14155048

EBSS ,

24010043

EBSS ,

10 500
500

PBS, pH 7,2 (10X)

18912014

500

10 500
100 =
50

07

(EBSS)

374


CO2.

500
500

7.7

07


, Invitrogen GIBCO . :
.
.
.
, .
GIBCO 4 :
.
.
.
.

17001082


AmnioMAX-C100

17001074
12556015
12556023

90
450

AmnioMAX-C100

12558011

AmnioMAX-C100
()

11269016
11269032

AmnioMAX II

15
75
17001082+12556015

2- AmnioMAX.
AmnioMAX-C100,
pH-.

100


12260014

MarrowMAX


.
.

100


12557013
12557021

PB-MAX

RPMI,

.

100
500


10575090

, 0,075

4 100

10576015

,
M (PHA)

in vitro.

10

10582013


, pH 6,8

50 = 50

15210040

KaryoMAX Colcemid, 10 /
, (HBSS)

15212012

KaryoMAX Colcemid,
10 /, PBS

10
, .
10

. .

375

www.helicon.ru

8.1


Molecular Probes ( Invitrogen)
:
.
.
().
().
.
:
.
.
.
:
.
.
.
4 :
.
.
/.
.
Invitrogen , .
.
, , invitrogen.com/cellstaintool .

Molecular Probes , , .
BacMam
BacMam ( ) .
BacMam , -, :
. ,
.
, , .
, Probe content + FP:
Probe content , (, CellLight) ( Premo).
FP , , GFP.

08

.
Molecular Probes ( Organelle Lights Cellular Lights) BacMam 1.0 ~50% ~10%
.
( ) >50%
.
BacMam 2.0 ( CellLight Premo)
(>50%) T- (~50%).

376

8.1

08

BacMam :

612

BacMam:
.
.
.
.
, 90 (: B- T-).
5 4 .
: .
(, ), .
, BacMam .
:
BacMam.
( ) MitoTracker LysoTracker.
: .
.
CellLight Premo ( BacMam 2.0)
CFP

GFP

RFP

C10606

C10608

C10602

C10603

: 2B

C10594

C10595

C10590

C10591

C10592

C10593

P36235

P36235

C10596

C10597

C10586

C10587

C10604

C10582

C10613

C10614

MAP4

C10598

C10599

C10600

C10601

377

www.helicon.ru

9.1


Invitrogen 3,5 . :
:
( 3,2 .).
(, His-Tag) (, GFP).
(, BrdU, .).
.
.
.
( ).
TR-FRET.
Invitrogen:
.
, , .
( ).
.
.
Invitrogen
( ):
(PE) (APC).
(FITC PerCP).
Alexa Fluor.
Pacific Blue Pacific Orange.
.
Qdot.
(HRP AP).
.

09

( , , , ,
) invitrogen.com/antibodies.

378

9.2

09


Invitrogen 750 . ( , , , ) invitrogen.com/antibodies. , , : (.
).
Premium
Invitrogen Premium Secondaries Molecular
Probes, Alexa Fluor Qdot, Image-iT FX.
Alexa Fluor (, Alexa Fluor
488 ), ( pH 4 10),
.
Qdot CdSe , . , , , ( 5
).
Image-iT FX :
IgG , Alexa Fluor. (highly cross-adsorbed, HCA) IgG ,
, /, .
ProLong Gold
.
Image-iT FX . .
50100 .

I37150

Image-iT FX 1

Alexa Fluor 350

I37151

Image-iT FX 2

Alexa Fluor 488

I37152

Image-iT FX 3

Alexa Fluor 555

I37153

Image-iT FX 4

Alexa Fluor 594

I37154

Image-iT FX 5

Alexa Fluor 647

I37155

Image-iT FX 6

Alexa Fluor 350

I37156

Image-iT FX 7

Alexa Fluor 488

I37157

Image-iT FX 8

Alexa Fluor 555

I37158

Image-iT FX 9

Alexa Fluor 594

I37159

Image-iT FX 10

Alexa Fluor 647

379

www.helicon.ru

Fermentas

10.1


Thermo Fisher Scientific (Fermentas)
, , ,
, , .
- , .

R0581
(R0582)

R0603
(R0601)

R0861
(R0862)

R1021

R0971

R1181

10

R0561
R0551

380

,
0,22 . - ,
, E. coli .
-20oC.
4 1,25 .
( 30 ).

,
(DEPC)

, ,
0,22 .
- , .
in vivo.
-20oC.
5 1 .
( 30 ).

1,4- (DTT)

- C4H10O2S2. 154,25.
99% SH-
.
,
in vitro,
. DTT .
.
+4oC.
5 .
( 25 ).

0,5 M

(EDTA), pH 8,0

0,22 .
- .
, .
,
.
+4oC.
5 1 .

25

0,22 .
.
- .
-20oC.
4 1,25 .

3 M
, pH 5,2

0,22 ,
, - .
.
+4oC.
5 1 .

,
. ,
50000 , 8
.
, ,
.
,
, .

8 (>20 )
.
, ,
, -.
-20oC.
20 /.
2 0,25 .
2 0,1 .

10.1

Fermentas

R0391
(R0392)
(R0393)
R1171

R0401
(R0402)
(R0404)
R0941

R0851
(R0852)

R0811
(R0812)

--D (IPTG)
--D (IPTG),

.
- C9H18O5S. 238,3. ,
, 99%. IPTG
lac- -, ,
.
, lac-.
5--4--3---D- (X-Gal)
- . IPTG ( 100 ).
+4oC.
1 .
( 5 ).
( 25 ).
, IPTG,
0,22 . -
.
-20oC.
100 .
10 1,5 .

5--4--3--D- (X-Gal)
5--4-3---D (X-Gal),

-. - C14H15BrClNO6.
408,6. ,
, 99%. X-Gal
, . X-Gal
- ,
- ,
-
. - X-Gal
( 20 /).
-20oC .
0,5 .
( 2 1 ).
( 1 ).
X-Gal ,
0,22 .
- IPTG (R1171).
+4oC, 1 .
20 /.
10 .

5--4--3--D-
(X-Gluc)

-.
- C14H13BrClNO7 C6N13N. 521,8. ,
,
97%.
-, ,
gusA, X-Gluc
, .
X-Gluc gusA ,
, E. coli,
. - X-Gluc
( 100 ).
-20oC .
0,1 .
( 0,5 ).

5-
(5-FOA)

5--6- (5- ). - C5H3FN2O4


H2O. 192,1. ,
, 98%. 5-FOA
ura3,
-5--. , ,
5-FOA 5-, . 5-FOA
, ,

. 5-FOA .
- 5-FOA ( 100 /).
-20oC .
1 .
( 5 ).

10

381

www.helicon.ru

10.2


-,
H-0102

________________________________________________________
[9002-18-0]
, % ...................................................... <22
(1,5%), C ........................ 35,5-36
, /2. .........................................................................<900
pH (1,5%) ..................................................................................6,0-7,5
.

Biotechnology Grade

Amresco

Am-0710
________________________________________________________
[9012-36-6]
(1,5%), /2. ..........................................................>1200
(1,5%), C............................ 36-39
, C ................................................... 87-89
O (-mr).................................................................................... <0,10
, %............................................................................... <0,15
, - ...................
.

LE

Biotechnology Grade

Amresco

B-5000

________________________________________________________
[9012-36-6]
(1,5%), /2 . ........................................................... 1200
(1,5%), C............................ 34-38
, C ................................................... 87-89
O (-mr) ......................................................................................0,13
, - ...................

SFR


Biotechnology Grade

Amresco

Am- J234
________________________________________________________
[9012-36-6]
(1,5%), /2. ............................................................ >500
(1,5%), C............................ <30,0
, C.................................................... <70,0
O (-mr).................................................................................... <0,12
, % .............................................................................. <0,11
, %...................................................................<7,0
, %................................................................ <0,.35
, - ...................

3:1 HRB


Biotechnology Grade

Amresco

Am-E776
________________________________________________________
[9012-36-6]
(1,5%), /2. .......................................................... >2000
(1,5%), C.............................34-38
, C ....................................................85-89
O (-mr) ....................................................................................<0,12
(%)............................................................................... <0,10
, - ...................

-5- (A),
,
Ultra Pure Grade
C10H13N5O10P2Na2 2H2O MW: 507.17

Amresco

Am-0160
________________________________________________________
[16178-48-6]
Em (259 nm, , pH 7.0)............................. >14500
AT, %............................................................................................ <1,0
A250/A260 ......................................................................... 0,74-0,82
A280/A260 ......................................................................... 0,13-0,19
, %............................................................... <0,002
, %..................................................... <8,0
-200

-5- (A),
,
Ultra Pure Grade
C10H12N5O7PNa2 6H2O MW: 499.19

Amresco

Am-0634

________________________________________________________
[16178-48-6]
Em (258 nm, , pH 7.0)............................. >11000
A250/A260.......................................................................... 0,79-0,90
A280/A260 ........................................................................0,180,22
, %............................................................... <0,002
-200

-5- (A),
,
Ultra Pure Grade
C10H14O13N5P3Na2 3H2O MW: 605.24

Amresco

Am-0220

________________________________________________________
[987-65-5]
, %...................................................................................>98,0
Em (259 nm, , pH 7.0)............................. >14700
, %............................................................... <0,003
A250/A260 ........................................................................0,750,81
A280/A260 ......................................................................... 0,14-0,18
AM & A, %.............................................................................. <0,5

10

-200

382

10.2

High Purity Grade


NaN3 MW: 65.01

2K Standart Grade, extrapure


C3H5NO MW: 71.08

Amresco

Am-O639

______________________________________________________________
[26628-22-8]
, %............................................................................................... >99,0
/, C............................................ >320

2,2--(3--6 , ()
2,2-AZINO-bis(3-ETHYLBENZTHIAZOLINE-6SULFONIC ACID) DIAMMONIUM SALT
Ultra Pure Grade
C18H24N6O6S4 MW: 548.70

Amresco

Am-0400

______________________________________________________________
[30931-67-0]
...................................................
E Max @225 nm...................................................................................>48150
E Max @342 nm . ................................................................................ >37400
,% ..................................................................<5,0

2,2--(3--6 , ()
(10/140 )
Amresco

AppliChem

H-0104

______________________________________________________________
[79-06-1]
, %............................................................................................... >99.0
, C................................................................. 84-86
pH (10%, 0,1M NaCl) @25C ...............................................................5.0-7.0
, %........................................................... <0,05
(40%, ), mhos..........................................................<25
, %.............................................................................................. <0,001
, %.............................................................................................. <0,001
, - ................................

/- 19:1
40% (W/V)
Ultra Pure Grade

40% (w/v) (38%) -


(2%) 19:1.

Bio-Rad

BR-1610144

______________________________________________________________
, mhos...............................................................................<10
, - ................................
2-80

/- 29:1

______________________________________________________________

40% (W/V)
Ultra Pure Grade

, .................................................................................138-142
Max (1 Ta/100 ), nm..................................................... 336346

Bio-RaD

Am-0895

2-8
0


Ultra Pure Grade
C3H5NO MW: 71.08

Amresco

Am-O341

______________________________________________________________
[79-06-1]
, %............................................................................................... >99,9
, C ................................................................ 84-86
pH (10%, 0,1M NaCl) @25C .............................................................5,56,5
, %......................................................... <0,001
(40%, ), mhos . .........................................................<5
, %............................................................................................<0,0001
, - ................................

10

40% (w/v) (38.67%) -


(1.33%) 29:1.

BR-1610146

______________________________________________________________
, mhos..............................................................................<10
, - ................................
2-80

/- 37.5:1 (30:0,8)
40% (W/V)
Ultra Pure Grade

40% (w/v) (38,96%) -


(1,04%) 37.5:1.

Bio-Rad

BR-1610148

______________________________________________________________
, mhos...............................................................................<10
, - ................................
2-80

383

www.helicon.ru
, , V
HEAT SHOCK ISOLATION
Biotechnology Grade

Amresco

Am-0332

________________________________________________________
[9048-46-8]
, %.................................................................................. >98,0
, %......................................................<5,0
pH (5%, ) @25C ........................................................... 6,57,5
, %............................................................... <0,001
, - ...................
2-80

COLD ALCOHOL ISOLATION


Biotechnology Grade

Amresco

Am-0903

________________________________________________________
[9048-46-8]
, %.................................................................................. >99,0
, %......................................................<5,0
pH (1%, ) @25C ............................................................ 5,0-5,4
, %............................................................... <0,005
, - ...................
2-80

Ultra Pure Grade


C62H86N12O16 MW: 1255.4

Amresco

Am-J608

________________________________________________________
[50-76-0]
, HPLC %........................................................................ >98.0
, C ...............................................242-250
0,1% (DMSO)
2-8
0


.

.

ACS Grade
H8N2O8S2 MW: 228.19

Amresco

Am-0486

________________________________________________________
[7727-54-0]
, %.................................................................................. >98,0
, %............................................................................... <0,001
, %............................................................... <0,005
, %................................................................................. <0,001
, %....................................................................... <0,00005

(A)
.

10

10.2


Ultra Pure Grade
H8N2O4S MW: 132.14

Amresco

Am-0191

________________________________________________________
[7783-20-2]
, %.................................................................................. >99,5
pH (5%, ) @25C ............................................................ 5,0-6,0
, % . ..........................................................................<0,0005
, %.............................................................<0,0002
, %...............................................................................<0,0005
, %.................................................................................<0,0020

, , V

384


Ultra Pure Grade
C2H7NO2 MW: 77.08

Amresco

Am-0103

________________________________________________________
[631-61-8]
, %...................................................................................>97,0
Abs.@280 nm (1 M, Water)........................................................<0,01
Abs.@354 nm (1 M, Water)........................................................<0,01
pH (5%, ) @25C .............................................................6.7-7.3
, %............................................................................. <0,001
, %.............................................................................<0,0005
, %............................................................................... <0,001
, %.............................................................<0,0005
, %...............................................................................<0,0005
2-80


ACS Grade
NH4Cl MW: 53.49

Amresco

Am-0621

________________________________________________________
[12125-02-9]
, %.................................................................................. >99,5
pH (5%, ) @25C ........................................................... 4,55,5
, %............................................................................<0,0002
, %............................................................................. <0,002
, %............................................................................... <0,001
, %.............................................................<0,0005
, %...............................................................................<0,0002


USP Grade
C16H18N3NaO4S MW: 371.39

Amresco

Am-O339
________________________________________________________
[69-52-3]
pH (1%, ) @25C .......................................................... 8,0-10,0
, %.......................................................................<0,2
2-80

10.2

L-,

Amresco

Amresco

USP Grade
C16H19N3O4S 3H2O MW: 403.46

Am-O741
______________________________________________________________
[7177-48-2]
pH (1%, ) @25C ......................................................................... 3,5-6,0
2-80

B
USP Grade
C47H73NO17 MW: 924.1

10

USP Grade
C6H14N4O2 HCl MW: 210.66

Am-O877
______________________________________________________________
[1119-34-2]
, % ..................................................................................... 98,5-101,5
, %...................................................................<0,2
, % . ..................................................................................... 16,5-17,1
, %............................................................................................ <0,03
, %............................................................................<0,002

Amresco

Am-0414
______________________________________________________________
[1397-89-3]
A, %.................................................................................. <15,0
-200


-IRRADIATED
Tissue Culture Grade

L-
ACS Grade
C6H8O6 MW: 176.13

Amresco

Am-O143
______________________________________________________________
[50-81-7]
, %............................................................................................... >99,0
, %............................................................................<0,002
, %.............................................................................................. <0,001

20 10 /.

Amresco

L-

______________________________________________________________
[69-53-4]
pH (1%, ) @25C ....................................................................... 8,0-10,0

Amresco

C16H18N3O4SNa MW: 371.39

Am-E477

2-80

,
Ultra Pure Grade
C27H44N10O6 2HCl MW: 677.6

Amresco

Am-J581

______________________________________________________________
[37691-11-5]
, %......................................................................<5
2-80

High Purity Grade

USP Grade
C6H8O6 MW: 176.13

Am-O764
______________________________________________________________
[50-81-7]
, % ..................................................................................... 99,0-100,5
, %............................................................................<0,002

L-

High Purity Grade


C4H8N2O3 MW: 132.12

Amresco

Am-94341
______________________________________________________________
[70-47-3]
, %............................................................................................... >99,0
, %.............................................................................................. <0,05
, %............................................................................................ <0,05

Amresco

L-

______________________________________________________________
[9087-70-1]
, KIU/................................................................................>4500

Amresco

Am-E429

2-80

High Purity Grade


C4H7NO4 MW: 133.10

Am-O192

______________________________________________________________
[56-84-8]
, %...................................................................................................>98
, %...................................................................<0,2

385

www.helicon.ru

-
.

Amresco

-
.

Ultra Pure Grade
C7H8N2 HCl H2O MW: 156.65

Amresco

Am-O616

________________________________________________________
[1670-14-0]
Em (230 nm, )............................................................ >9500
, C ....................................................77-87
2-80

Ultra Pure Grade


C16H24N2O4 MW: 308.4

Amresco

Am-J579

________________________________________________________
[58970-76-6]
, % ................................................................................. >99,0
, C..................................................... >200
-200

Am-O715

________________________________________________________
[6976-37-0]
(%)................................................................................ > 99.0
pKa @25C ...................................................................... 6.45 - 6.65
(C) ........................................... 102 - 106
pH (1.0%, ) @25C ...................................................... 8.8 - 9.6

,

C20H10N2O4Na2 MW: 388.30

H-0204

________________________________________________________
[979-88-4]
, %.................................................................................. >99,0
562......................................................................................... <0,025

H3BO3 MW: 61.83

H-0202

________________________________________________________
[10043-35-3]
, %.................................................................................. >98,0

D-
Amresco

R-250
. R-250

Reagent Grade
C10H16N2O3S MW: 244.31

Am-O340

________________________________________________________
[58-85-5]
, %.................................................................................. >99,0
, % .............................................................. <0,001

-
Ultra Pure Grade
C7H10O2N2 MW: 154.17

Amresco

Am-O172

________________________________________________________
[110-26-9]
, % ................................................................................. >99,0
Abs.@290 nm (1%, ).............................................................<0,2
, mhos.................................................................<10
, %............................................................. <0,001

10.2

BIS-(2-HYDROXYETHYL)
IMINOTRIS(HYDROXYMETHYL) METHANE
Ultra Pure Grade
C8H19NO5 MW: 209.20

G-250
. G-250

2-80

10

. -5- (A),
,

-
.

386

,
ACS Grade
C19H9Br4O5SNa MW: 691.94

Amresco

Am-O312

________________________________________________________
[62625-28-9]

10.2

5--4--3---d-
. -

5--4--3- (BCIP)

ICN

Amresco

______________________________________________________________
[56-81-5]
, %............................................................................................... >99,0
, %............................................................................<0,005
- . ..................................................

5-BROMO-4-CHLORO-3-INDOLYL PHOSPHATE
Ultra Pure Grade
C8H6BrCINO4P C7H9N MW: 433.6

Am-O885

______________________________________________________________
[6578-06-9]
(U.V.), % . ................................................................................... >99,0
(, %................................................................ >99,0
, %...........................................................................................<0,1
-200

5--4--3-/ (BCIP/INT)
Biotechnology Grade

BCIP/NBT
.
- .
Northern/Southern .

Amresco

Am-E692

______________________________________________________________
pH @25C ............................................................................................ 9,4-9,6
2-80

(G418)
Ultra Pure Grade
C20H40N4O10 2H2SO4 MW: 692.7

Amresco

Am-E859

______________________________________________________________
[108321-42-2]
, U/..................................................................................... >500
, %................................................................ <10,0
2-80


Tissue Culture Grade

Amresco

Am-O304

______________________________________________________________
[1405-41-0]
, %................................................................ <18,0
pH (4%, ) @25C ......................................................................... 3,5-5,5
2-80

8-
ACS Grade
C9H7NO MW: 145.16

Amresco

Am-O155

______________________________________________________________
[148-24-3]
, C ..........................................................72,5-74,0
, %............................................................................................ <0,02

10

Molecular Biology Grade


C3H8O3 MW: 92.09

I-193996

Ultra Pure Grade


C3H8O3 MW: 92.09

ICN
I-800687
______________________________________________________________
[56-81-5]
, %............................................................................................... >99,5
, %.............................................................................. <0,02

,
Biotechnology Grade
C3H8O3 MW: 92.09

Amresco

Am-E520
______________________________________________________________
[56-81-5]
, )................................................................................................. >99,0
, %......................................................................... <0,0005
- . ..................................................

-
High Purity Grade
C4H8N2O3 MW: 132.12

Amresco

Am-O137

______________________________________________________________
[556-50-3]
, %............................................................................................... >99,0
, %...................................................................<0,2
, %............................................................................<0,002
, %............................................................................................ <0,03
, %.............................................................................................. <0,02

Biotechnology Grade
C2H5NO2 MW: 75.07

Amresco

Am-O167

______________________________________________________________
[56-40-6]
, %............................................................................................... >99,0
Abs.@280nm (1 M, )...................................................................... <0,10
, %...................................................................<0,2
, %............................................................................<0,002

387

www.helicon.ru

Amresco

Am-O399

Amresco
Am-O380

________________________________________________________
[70-18-8]
, %.................................................................................. >98,0
, % .....................................................<1,0
, %................................................................................. <0,002
, %................................................................................... <0,001

________________________________________________________
[593-84-0]
, %.................................................................................. >99,0
, C ............................................... 118-121
Abs.@280 nm (70%, )..........................................................<0,8
. .......................................

2-80

High Purity Grade


C20H32N6O12S2 MW: 612.63

Amresco

Am-O524

________________________________________________________
[27025-41-8]
, %.................................................................................. >95,0
, %......................................................<8,0
, %................................................................................. <0,002
, % .................................................................................. <0,001
2-80

D-,
Biotechnology Grade
C6H12O6 MW: 180.16

Amresco

Am-O304

________________________________________________________
[50-99-7]
, %.................................................................................. >99,8
, %......................................................<0,2
, %..................................................................................<0,01
, %............................................................................. <0,005
, %.............................................................<0,0005
, %...............................................................................<0,0005
- . .....................................

Biotechnology Grade
CH5N3 HSCN MW: 118.16

X- (-GAL)

(5-BROMO-4-CHLORO-3-INDOLYL-b-D-GALACTOPYRANOSIDE)
Molecular Biology Grade
C14H15BrClNO6 MW: 408.64

USBiological

U-X1000

________________________________________________________
[7240-90-6]
, %.................................................................................. >99,0
-200

I ( I)
BOVINE PANCREAS
Ultra Pure Grade

Amresco

Am-O649

________________________________________________________
[9003-98-9]
@25C, U/mg........................................................ >1800
- ......................................................
PRODUCT CODE SIZE

-200

Reagent Grade
MW: 10,000

D-,

Am-O665

10.2

USP Grade
C6H12O6 H2O MW: 198.17

Roquette

H-0401

________________________________________________________
[5996-10-1]
, %.................................................................................. >99,0
, %........................................................ 8,3
, %.............................................................<0,0005

Amresco

________________________________________________________
[9004-54-0]
, %.....................................................<3,0
pH (6%, ) @25C ............................................................ 5,0-7,0
PRODUCT CODE SIZE


Ultra Pure Grade

MW 500,000 .

Am-O198

Biotechnology Grade
CH5N3 HCl MW: 95.53

Amresco
Am-O287

________________________________________________________
[50-01-1]
, %.................................................................................. >99,5
Abs.@260 nm (6 M, )........................................................ <0,03
Abs.@230 nm (6 M, ).........................................................<0,15
, .....................
, C ............................................... 181-187

10

,
High Purity Grade
C10H17N3O6S MW: 307.33

388

Amresco

________________________________________________________
[9011-18-1]
, %.................................................................................. >98,0
, %....................................................<10,0
, %............................................................... <0,005
, %................................................................................. <0,001
pH (1%, ) @25C ............................................................ 6,4-8,0

10.2

2--5-

3,3- (DAB)

10 .

1 100 M 2--5, pH 7.0.

H-40-1.0

______________________________________________________________
dATP Na4 ............................................................................................ 100 mM
dCTP Na4 . .......................................................................................... 100 mM
dGTP Na4 ........................................................................................... 100 mM
dTTP Na4 ............................................................................................ 100 mM
-200

5/240
Biotechnology Grade

Amresco

Am-E733

______________________________________________________________
pH (1 ./10 ) ...................................................................... 4,8-5,2
-200

2--5-

3,3-,

Amresco

______________________________________________________________
dATP Na4 .............................................................................................. 25 mM
dCTP Na4 . ............................................................................................ 25 mM
dGTP Na4 ............................................................................................. 25 mM
dTTP Na4 .............................................................................................. 25 mM

______________________________________________________________
[7411-49-6]
, %............................................................................................... >98,0
, % ...........................................................8,0-12,0

0,4 2--5-,
pH 7.0 25 M.

H-4044-0.4

-200

7
ICN

I-7667095

______________________________________________________________
.

.
.
, .
, .

7-PF

Reagent Grade
C12H14N4 4HCl MW: 360.12

Am-O430

-200

(DMSO)
ACS Grade
C2H6SO MW: 78.13

Amresco

Am-E174

______________________________________________________________
[67-68-5]
Abs.@350-400 nm.................................................................................. <0,01
Abs.@330 nm.......................................................................................... <0,02
Abs.@310 nm.......................................................................................... <0,06
Abs.@290 nm.......................................................................................... <0,18
Abs.@270 nm.......................................................................................... <0,40
, %............................................................................................... >99,9

ICN
I-7667125

DL- (DTT)

Amresco

______________________________________________________________
.
.
, .
, .
.

Biotechnology Grade
C4H10O2S2 MW: 154.25

Am-O281

______________________________________________________________
[3483-12-3]
, %............................................................................................... >99,4
Abs.@283 nm (0,02 M, )................................................................ <0,05
, C ................................................................ 39-43
-200

3,3- (DAB)

(DEPC)

Amresco

Amresco


Biotechnology Grade

Am-E885

______________________________________________________________
2-80

10

High Purity Grade


C6H10O5 MW: 162.14

Am-E174

______________________________________________________________
[1609-47-8]
, %............................................................................................... >97,0
2-80

389

www.helicon.ru

.
--D-
High Purity Grade
C24H46O11 MW: 510.6

Amresco

Am-J424

________________________________________________________
[69227-93-6]
, %.................................................................................. >99,0
Abs.@225 nm (1%, ).............................................................<0,1
Abs.@260 nm (1%, ).......................................................... <0,06
Abs.@280 nm (1%, ).......................................................... <0,04
Abs.@340 nm (1%, ).......................................................... <0,02
pH (1%, ) @25C ................................................................... 5-8

I.S.H.A.
H-0601

________________________________________________________
pH (2%,) @25C ............................................................. 6,4-7,2

(IPTG)

ISOPROPYL-b-D-THIOGALATOPYRANOSIDE
Analytical Grade
C9H18O5S MW: 238.31

Anatrace

An-I1003

________________________________________________________
[367-93-1]
, % ....................................................................................99,5

10.2


2-
ACS Grade
K2HPO4 MW: 174.18

Amresco

Am-O705

________________________________________________________
[7758-11-4]
, %.................................................................................. >98,0
, %......................................................<1,0
pH (5%, ) @25C ............................................................ 8,5-9,6
, %............................................................................... <0,003
, %.............................................................. <0,001
, %............................................................................. <0,005
, %.............................................................<0,0005
, %................................................................................. <0,001
, %................................................................................... <0,05

,
1-
ACS Grade
KH2PO4 MW: 136.09

Amresco

Am-O781

________________________________________________________
[7778-77-0]
, %.................................................................................. >99,0
, %......................................................<0,2
pH (5%, ) @25C ............................................................4,1-4,.5
, %............................................................................... <0,001
, %.............................................................. <0,001
, %............................................................................. <0,003
, %............................................................... <0,001
, %................................................................................. <0,002
, %................................................................................. <0,005

-200

ACS Grade
KC2H3O2 MW: 98.14

Amresco

Am-O698

________________________________________________________
[127-08-2]
, %.................................................................................. >99,0
pH (5%, ) @25C ............................................................ 6,5-9,0
, %............................................................................... <0,003
, %.............................................................................. <0,001
, %............................................................................. <0,002
, %................................................................................ <0,002
, %............................................................................... <0,005
, %.............................................................<0,0005
, %...............................................................................<0,0005
, %..................................................................................... <0,03


ACS Grade
KCl MW: 74.55

Amresco

Am-O395

________________________________________________________
[7447-40-7]
, % .........................................................................99,0-100,5
pH (5%, ) @25C ............................................................ 5,4-8,6
, %................................................................................ <0,002
, %............................................................................... <0,003
, %............................................................................<0,0005
, , , %................................................. <0,001
, %............................................................................... <0,002
, %.............................................................<0,0005
, %...............................................................................<0,0003
, %................................................................................. <0,005

Amresco

________________________________________________________
[1310-58-3]
, %.................................................................................. >99,0
, % ..................................................10-15
, %............................................................... <0,003
, % . ................................................................................<0,0001

________________________________________________________
[7447-40-7]
, % ....................................................................................99,0

Reagent Grade
KOH MW: 56.11

10

Am-O489

390

KCl MW: 74.55

H-1101

10.2

,
Reagent Grade
CaCO3 MW: 100.1

Amresco

Am-O179

G-250

Ultra Pure Grade


C47H48N3O7S2Na MW: 854.04

Amresco

Am-O615

______________________________________________________________
[471-34-1]
, %............................................................................................... >98,0
, %............................................................................<0,003
, %...........................................................................................<0,005
, %...................................................................................... <0,0003
, %..................................................................................................<1,0

______________________________________________________________
[6104-58-1]
Em (595 nm, )............................................................................. >36300

R-250

,
ACS Grade
CaCl2 2H2O MW: 147.02

Amresco

Am-O556

______________________________________________________________
[10035-04-8]
, % ..................................................................................... 99,0-105,0
, %.................................................................. <0,01
pH (5%, ) @25C ......................................................................... 4,5-8,5
, %............................................................................................ <0,01
, %................................................................................................<0,005
, %......................................................................... <0,0005
, %.............................................................................................. <0,001
, %.............................................................................................<0,005
, %.................................................................................................. <0,01
, %................................................................................................ <0,02


USP Grade
C18H36N4O11 H2SO4 MW: 582.58

Amresco

Am-O408

______________________________________________________________
[25389-94-0]
pH (1%, ) @25C ......................................................................... 6,5-8,5

,
Analytical Grade
C21H17O5SNa MW: 404.4

Amresco

Am-O500

______________________________________________________________
[62625-29-0]
pH (0,1%, ) @ 25C ..................................................................... 7,3-8,3


.
FF

ACID BLUE 147


Ultra Pure Grade
C25H27N2O6S2Na MW: 538.60

Amresco

Am-O819

______________________________________________________________
[2650-17-1]
Em (614 nm, )............................................................................. >30000
.Max, . ..........................................................................................612-616

10

Ultra Pure Grade


C45H44N3O7S2Na MW: 825.99

Amresco

Am-O472

______________________________________________________________
[6104-59-2]
Em (550 nm, )............................................................................. >33000

Ultra Pure Grade


C20H38N6O4 1/2H2SO4 H2O MW: 493.62

Amresco

Am-J580

______________________________________________________________
[103476-89-7]
-200

,
Ultra Pure Grade

Amresco

Am-O663

______________________________________________________________
[12650-88-3]
. ................................................................................
. ........................................................................
-200


ACS Grade
C6H8O7 MW: 192.1

Amresco

Am-O529

______________________________________________________________
[77-92-9]
, %............................................................................................... >99,5
, %........................................................<0,005
, %............................................................................................ <0,001
, %........................................................................................... <0,001
, %..........................................................................................<0,002
, %........................................................................................... <0,0003
, %.......................................................................................... <0,.0002


Biotechnology Grade
LiCl MW: 42.39

Amresco

Am-O416

______________________________________________________________
[7447-41-8]
, %............................................................................................... >99,0
, %.............................................................................................. <0,001

391

www.helicon.ru
,
Analytical Grade
C4H6O4Mg 4H2O MW: 214.5

Amresco

Am-O131

________________________________________________________
[16674-78-5]
, %.................................................................................. >99,0
, %..................................................................................<0,01
, %.............................................................................. <.0,05
, %....................................................................................<0,01

,
ACS Grade
MgSO4 7H2O MW: 246.48

Amresco

Am-O662

2-
b-MERCAPTOETHANOL
Biotechnology Grade
C2H6OS MW: 78.13

Amresco

Am-O482

________________________________________________________
[60-24-2]
, %.................................................................................. >99,0
, .....................

4-,
, (MUP)
Ultra Pure Grade
C10H9O6PNa2 3H2O MW: 356.17

Amresco

,
ACS Grade
MgCl2 6H2O MW: 203.3

________________________________________________________
[145224-94-8]
, %.................................................................................. >99,0
pKa @25C .........................................................................6,05-6,15

Am-O288

________________________________________________________
[7791-18-6]
, % .........................................................................99,0-102,0
, % .............................................................................. <0,001
, %............................................................................<0,0005
, %............................................................................. <0,002
, %................................................................................... <0,005
, %..................................................................................<0,01
, %................................................................................. <0,005
, %............................................................................. <0,005
, %.............................................................<0,0005
, %...............................................................................<0,0005
, %..........................................................................<0,0005
, %................................................................................... <0,005

10.2

Am-O740


Molecular Biology Grade

ICN

I-194836

________________________________________________________
[8020-83-5]
@40C ................................................................ 14,2-17,0
1=0,84 .


Ultra Pure Grade

ICN

I-151694

________________________________________________________
[8020-83-5]
@40C ............................................................... 14.2 - 17.0
1 = 0.84 .

10

________________________________________________________
[10034-99-8]
, % .........................................................................98,0-102,0
pH (5%, ) @25C ............................................................ 5,0-8,2
, %.............................................................................<0,0005
, %............................................................................... <0,002
, %................................................................................. <0,02
, %.............................................................<0,0005
, %...............................................................................<0,0005
, %..........................................................................<0,0005
, %................................................................................... <0,005
, %................................................................................. <0,005
, %............................................................................. <0,005

Amresco

392

________________________________________________________
[22919-26-2]
Em (320 ) . .........................................................................>13900
pH (1%, ) @25C ............................................................ 7,5-8,5
-200

, (MES) ,
Ultra Pure Grade
C6H13O4NS H2O MW: 213.2

Amresco

Am-E169

(MOPS)

3-[N-MORPHOLINO]PROPANE-SULFONIC ACID
Ultra Pure Grade
C7H15NO4S MW: 209.27

Amresco

Am-O670

________________________________________________________
[1132-61-2]
(%)................................................................................. >99.0
pKa (25C) ............................................................................ 7.0 - 7.4

Ultra Pure Grade


CH4N2O MW: 60.06

Amresco

Am-O568

________________________________________________________
[57-13-6]
, %.................................................................................. >99,5
Abs.@280 (5 M, )......................................................... <0,05
, C ...............................................132-135
, %.............................................................................<0,0005
, %.............................................................<0,0005
, %...............................................................................<0,0001
(5 M, ), hmos..............................................<15
- ....................

10.2

Amresco

Amresco

USP Grade
CH4N2O MW: 60.06

Am-O378

______________________________________________________________
[57-13-6]
, % ..................................................................................... 99,0-100,5
, C ............................................................132-135
, %............................................................................................ <0,007
, %.......................................................................................... <0,010
, %............................................................................<0,002

(NAD)

b-NICOTINAMIDE ADENINE DINUCLEOTIDE,


TRIHYDRATE
Reagent Grade
C21H27N7O14P2 3H2O MW: 717.47

Amresco

Am-O455

______________________________________________________________
[53-84-9]
, %...................................................................................................>97
(pH 7.0), .............................................................................. 259-260
A250/A260 ........................................................................................... 0,78-0,88
A280/A260 .............................................................................................. 0,7-0,27
-200

(NADH)

b-NICOTINAMIDE ADENINE DINUCLEOTIDE,


REDUCED, DISODIUM SALT, TRIHYDRATE
Reagent Grade
C21H27N7O14P2Na2 3H2O MW: 763.4

Amresco

Am-O384

______________________________________________________________
[606-68-8]
, %............................................................................................... >92,0
-200


High Purity Grade
C12H12N2O3 MW: 232.24

Amresco

Am-O677

______________________________________________________________
[389-08-2]
, %...................................................................................................>98
, C ............................................................225-231
, %............................................................................<0,002

,
ACS Grade
C2H3O2Na MW: 82.03

Amresco

Am-O602

______________________________________________________________
[127-09-3]
, %............................................................................................... >99,0
pH (5%, ) @25C ......................................................................... 7,0-9,2
, %............................................................................................<0,002
, %........................................................................................... <0,001
, %..........................................................................................<0,003
, %............................................................................................<0,005
, %.............................................................................................<0,002
, %............................................................................ <0,001
, %.............................................................................................. <0,001

10

ACS Grade
C2H3O2Na 3H2O MW: 136.1

Am-O530

______________________________________________________________
[6131-90-4]
, % ..................................................................................... 99,0-101,0
pH (5%, ) @25C ......................................................................... 7,5-9,2
, %............................................................................................ <0,001
, %........................................................................................ <0,0005
, %..........................................................................................<0,002
, %............................................................................................<0,005
, %.............................................................................................<0,002
, %......................................................................... <0,0005
, %........................................................................................... <0,0005
, %.................................................................................................. <0,05

NaOH MW: 40.00

H-1410

______________________________________________________________
[1310-73-2]
, %............................................................................................... >99,0

(SDS)
Biotechnology Grade
C12H25NaO4S MW: 288.38

Amresco

Am-O227

______________________________________________________________
[151-21-3]
, %............................................................................................... >99,0
Abs.@260 nm (3%, )..........................................................................<0,1
Abs.@280 nm (3%, )..........................................................................<0,1
, %......................................................................... <0,0005
. ....................................................
PRODUCT CODE SIZE

,
ACS Grade
Na2CO3 MW: 105.99

Amresco

Am-O530

______________________________________________________________
[497-19-8]
, % .............................................................................................. >99,5
, %............................................................................................ <0,001
, % .......................................................................... <0,001
, % .......................................................................................... <0,001
, %..............................................................................................<0,005
, %............................................................................<0,003
, %.............................................................................................. <0,03
, %.............................................................................................<0,005
, %......................................................................... <0,0005
, %........................................................................................... <0,0005
, %................................................................................................<0,005

393

www.helicon.ru

Reagent Grade
C15H28NO3Na MW: 293.39

Amresco

Am-O719

________________________________________________________
[137-16-6]
, %.................................................................................. >95,0
pH (10%, ) @25C .......................................................... 7,5-8,5

(),

ACS Grade
Na2SO4 MW: 142.04

Amresco

Am-O836

________________________________________________________
[7757-82-6]
, %................................................................................... >99,0
pH (5%, ) @25C ............................................................ 5,2-9,2
, %............................................................................... <0,001
, %............................................................<0,0005
, %.............................................................<0,0005
, %................................................................................. <0,001
, %.............................................................................. <0,001
, %..................................................................................<0,01
, %................................................................................ <0,005
, %................................................................................... <0,002

10.2

,
1-,
ACS Grade
NaH2PO4 H2O MW: 138

Amresco

Am-O823

________________________________________________________
[10049-21-5]
, % .........................................................................98,0-102,0
pH (5%, ) @25C .............................................................4,1-4,5
, %.............................................................................<0,0005
, %.............................................................. <0,001
, %............................................................................. <0,003
, %............................................................... <0,001
, %................................................................................. <0,001

,
1-,
USP Grade
NaH2PO4 2H2O MW: 156

Amresco

Am-O823

________________________________________________________
[10049-21-5]
(%) ...................................................................................99,9
(%)............................................................................ < 0.005
(%).............................................................. < 0.02
(%)........................................................................... < 0.003
(%)............................................................. < 0.001
(%)............................................................................< 0.0012


USP Grade
NaCl MW: 58.44

H-1401

Am-O558

Akzo Nobel Salz

________________________________________________________
[7647-14-5]
, %................................................................................ >99,99

,
2-,
ACS Grade
Na2HPO4 7H2O MW: 268.1

Amresco

Am-O348

________________________________________________________
[7782-85-6]
, % .........................................................................98,0-102,0
, % .................................................. 43-50
pH (5%, ) @25C ............................................................ 8,7-9,3
, %............................................................................... <0,001
, %............................................................................... <0,001
, %............................................................................. <0,005
, %............................................................... <0,001
, %................................................................................. <0,001

USP Grade

Amresco

________________________________________________________
[1405-10-3]
pH (3.3%, ) @25C ....................................................... 5.0 - 7.5

o---D-
Ultra Pure Grade
C12H15O8N MW: 301.25

Amresco

Am-O789

________________________________________________________
[369-07-3]
-200

-40 (NONIDET P-40)


OCTYLPHENOXYPOLYETHOXYETHANOL
Reagent Grade

Amresco

Am-E109

________________________________________________________
(20C) (/) . ................................................ 1.05 - 1.07

10

394

10.2

N---D-

Reagent Grade
C14H26O6 MW: 292.38

USP Grade

Am-O479

______________________________________________________________
[1405-20-5]
pH (0.5%, ) @25C .................................................................... 5.0 - 7.5

Amresco

Amresco

Am-O319

______________________________________________________________
[29836-26-8]
(%)............................................................................................. > 98.0

2-80

-20

G,

8000
(PEG-8000)

Amresco

Amresco

USP Grade
C16H17N2O4SNa MW: 356.37

Am-O242

______________________________________________________________
[69-57-8]
(U/) . .................................................................... 1500 - 1750
pH (6%, ) @25C ....................................................................... 5.0 - 7.5
(%).................................................................< 1.5

Biotechnology Grade
HOCH2CH2(OCH2CH2)NOH MW: 7000-9000

Am-O159

______________________________________________________________
[25322-68-3]
(%)............................................................................................. > 99.0
pH (5%, ) @25C ....................................................................... 5.0 - 7.0
. ...................................................

Amresco

Amresco

______________________________________________________________
[26305-03-3]
(C) ................................................. 231.0 - 232.8

______________________________________________________________
[6226-79-5]
Em (520nm, ................................................................................>27000
(%).................................................................< 5.0

Ultra Pure Grade


C34H63N5O9 MW: 685.90

High Purity Grade


C22H12N4Na4O13S4 MW: 760.61

Am-J583

Am-O860

2-80


Bacteriological Grade

Amresco

Am-J636

______________________________________________________________
[73049-73-7]


Reagent Grade

TRITIRACHIUM ALBUM
Biotechnology Grade

Amresco

Am-O706

______________________________________________________________
[39450-01-6]
@37C (U/).........................................................................> 30
. ....................................................
-200

Amresco

______________________________________________________________

Am-O417

(U/........................................................... 100

Ultra Pure Grade


C22H29N7O5 2HCl MW: 544.4

-200

Amresco

(PIPES),

______________________________________________________________
[58-58-2]
(%).................................................................................................> 98
(C) ........................................................ 165 - 172

PIPERAZINE-N,N-BIS[2-ETHANESULFONIC ACID]
High Purity Grade
C8H17N2O6S2 1.5Na MW: 670.67

Amresco

Am-O169

______________________________________________________________
[100037-69-2]
(%) ............................................................................................ > 99.0
pKa (25C) .................................................................................... 6.70 - 6.90
(%)..............................................................................................< 1.0
(%)........................................................................< 0.0001

10

Am-J593

(RNase A)
High Purity Grade

Amresco

Am-O675

______________________________________________________________
[9001-99-4]
(@37C) (U/)......................................................................> 60
-200

395

www.helicon.ru

(RNase Inhibitor)
HUMAN PLACENTAL SOURCE
Biotechnology Grade

Amresco

Am-E633

________________________________________________________
@25C (U/l).............................................................> 10
. .......................................
-200


(RNase Inhibitor)

C T (O)

Certifiable Grade
C20H19N4Cl MW: 350.8

Amresco

Am-O574

________________________________________________________
[477-73-6]
(%)..................................................... > 80.0
() .................................... 527 - 533

D-

High Purity Grade


C6H14O6 MW: 182.18

Amresco

H-0904

________________________________________________________
[50-70-4]
(%)................................................................................ > 98.0
(%)............................................................................ < 0.005
(%)..............................................................................< 0.01
(%)............................................................. < 0.001

________________________________________________________
@25C (U/l) ................................................................. 5
. .......................................
-200

Am-O691

D-

High Purity Grade


C5H10O5 MW: 150.13

Amresco

Am-O671

________________________________________________________
[50-69-1]
(%)................................................................................ > 98.0
(%)............................................................. < 0.001
2-80


Biotechnology Grade
RbCl MW: 120.9

Amresco

Am-O632

________________________________________________________
[7791-11-9]
(%)................................................................................ > 99.0
(%).................................................................................< 0.01
(%).................................................................................< 0.01
(%)................................................................................< 0.01

Streptomyces Avidinii
Biotechnology Grade

Amresco

Am-E497

________________________________________________________
[9013-20-1]
(U/ ).............................................................. > 17
, .....................
PRODUCT CODE SIZE

-200

USP Grade
(C21H39N7O12)2 3H2SO4 MW: 1457.38

Amresco

Am-O382

________________________________________________________
[3810-74-0]
(%) ..................................................< 5.0
pH (20%, ) @25C ........................................................ 4.5 - 7.0
2-80

C12H22O11 MW: 342.3

TAE

H-1807

25 0.04 M , 0.04 M
, 0.001 M ETA.

Panreac Quimica S.A.

________________________________________________________
[57-50-1]
(%)................................................................................ > 99.0
(%)...........................................................< 0.0005

25X
Ultra Pure Grade

Amresco

Am-O796

________________________________________________________
pH @25C ............................................................................ 8.2 - 8.4

10

396

10.2

HUMAN PLACENTAL SOURCE

10.2

N-TRIS(HYDROXYMETHYL)METHYL-3-AMINOPROPANESULFONIC
ACID
High Purity Grade
C7H17NO6S MW: 243.30

Amresco

Am-J562

______________________________________________________________
[29915-38-6]
(%).................................................................................................> 99
(%)....................................................................... < 0.0005
pH (5%, ) @25C ...................................................................... 5.0 - 6.5

,
Biotechnology Grade
C7H16NO6SNa MW: 265.3

Amresco

3,3,5,5-
(TMB)
High Purity Grade
C16H20N2 2HCl MW: 313.30

Amresco

Am-O759

______________________________________________________________
[64285-73-0]
(%)............................................................................................. > 98.0
Em (285).........................................................................................> 18000
2-80

,
USP Grade
C22H24N2O8 HCl MW: 480.90

Amresco

Am-O422

Am-J598

______________________________________________________________
[91000-53-2]
(%).................................................................................................> 98
pH (1%, ) @25C ...................................................................10.1 - 10.7

______________________________________________________________
[64-75-5]
pH (1%, ) @25C ....................................................................... 1.8 - 2.8
(%).................................................................< 2.0
(%)..........................................................................< 0.005

-200

20

(MTT)

Amresco

Amresco

POLYOXYETHYLENE-20-SORBITAN MONOLAURATE
Reagent Grade

Am-O777

______________________________________________________________
[9005-64-5]
(%).......................................................................... < 0.001

80

Ultra Pure Grade


C18H16N5SBr MW: 414.3

Am-O793

______________________________________________________________
[298-93-1]
(%)............................................................................................. > 98.0
(C)................................................................ > 187
2-80

POLYOXYETHYLENE-20-SORBITAN MONOOLEATE
Reagent Grade


(SOYBEAN)

Am-O777

Amresco

Amresco

______________________________________________________________
[9005-65-6]
(%).......................................................................... < 0.001

Reagent Grade

Am-K213

______________________________________________________________
[9035-81-8]
(U/)................................................................................> 7,000

-200

(TEMED)

Ultra Pure Grade


C6H16N2 MW: 116.21

Alfa Aesar

L-0847

______________________________________________________________
[110-18-9]
(%)............................................................................................. > 99.0
(C) . .......................................................... 119 - 121

10


Bacteriological Grade

Amresco

Am-J859

______________________________________________________________
[9000-71-9]
pH (6%, ) @25C ........................................................................6.8 - 7.5
. ........................................................................

397

www.helicon.ru

High Purity Grade


C4H11NO3 C2H4O2 MW: 181.19

Amresco

Am-O189

________________________________________________________
[6850-28-8]
(%)................................................................................ > 98.0
(%)....................................................< 0.3
pH (1% M, ) @25C........................................................6.0 - 7.0
(%)............................................................ < 0.001

T() (RIS)
TRIS(HYDROXYMETHYL)AMINOMETHANE
Ultra Pure Grade
C4H11NO3 MW: 121.14

Amresco

Am-O497

________________________________________________________
[77-86-1]
(%) ............................................................................... > 99.9
Abs.@280nm (1 M, )........................................................ < 0.05
(%)............................................................................< 0.0001


Ultra Pure Grade
C4H11NO3 HCl MW: 157.64

Amresco

Am-O234

________________________________________________________
[1185-53-1]
(%)................................................................................ > 99.5
(%).............................................................................. < 0.001
(%)............................................................................< 0.0001
(%)................................................................................< 0.0001
(%)............................................................................< 0.0001
(%)........................................................................< 0.0001
(%)...........................................................................< 0.0001
(%).................................................................................< 0.0001
pH (0.1 M, ) @25C . ................................................... 4.2 - 4.9

X-100

T-OCTYLPHENOXYPOLYETHOXYETHANOL
Reagent Grade
C34H62O11 MW: 647(Avg.)

Amresco

Am-O694

________________________________________________________
[9002-93-1]
pH (5%, ) @25C .......................................................... 6.0 - 8.0

N-TRIS(HYDROXYMETHYL)METHYLGLYCINE
Ultra Pure Grade
C6 H13NO5 MW: 179.2

Amresco

Am-E170

________________________________________________________
[5704-04-1]
(%)................................................................................ > 99.0
pKa @25C ....................................................................... 8.10 - 8.20
(C) ............................................182 - 188

10

(PMSF)
High Purity Grade
C6H5CH2SO2F MW: 174.20

Amresco

Am-O754

________________________________________________________
[329-98-6]
(%) .............................................................................. 8 99.0
(C) ................................................ 91 - 95

(FITC)
I
Conjugation Grade
C20H11O5NCS MW: 389.40

Amresco

Am-O633

________________________________________________________
[3326-32-7]
I (%)..................................................................................> 90
Em (499nm, , NaOH)...............................................> 75000
2-80

100

Biotechnology Grade

Amresco

Am-E404

________________________________________________________
1 100 ,
:
................................................................. 137 mM
................................................................... 10 mM
.................................................................... 2.7 mM
pH @25C ............................................................................. 7.3 - 7.5

D-

High Purity Grade


C6H12O6 MW: 180.16

Amresco

Am-O226

________________________________________________________
[57-48-7]
(%) ............................................................................... > 99.0
(%) ..................................................< 0.5
(%) . ........................................................< 0.0005
(%)............................................................................ < 0.018
(%)........................................................................... < 0.025
(%) ........................................................< 0.0005

(HEPES),

N-[2 HYDROXYETHYL] PIPERAZINE


-N-[2-ETHANESULFONIC ACID]
High Purity Grade
C8H18N2O4S MW: 238.30

Amresco

Am-O511

________________________________________________________
[7365-45-9]
(%)................................................................................ > 99.0
pKa @20C ........................................................................7.45 - 7.65

398

10.2

10.2

(HEPES),

Amresco

Amresco

High Purity Grade


C8H17N2O4SNa MW: 260.30

Am-O485

______________________________________________________________
[75277-39-3]
(%)............................................................................................. > 99.0
(%).................................................................< 3.0
pKa . ............................................................................................... 7.45 - 7.65
(%)........................................................................< 0.0001

Ultra Pure Grade


C31H41N7O6 MW: 605.04

Amresco

Am-J584

______________________________________________________________
[9076-44-2]
. ...................................................................... 5%
-200

USP Grade
C11H12Cl2N2O5 MW: 323.13

Amresco

Am-O230

______________________________________________________________
[56-75-7]
(%) .................................................................................. 97.0 - 103.0
(C) ........................................................ 149 - 153
pH (2.5%, ) @25C .................................................................... 4.5 - 7.5

4--1-
Ultra Pure Grade
C10H7OCl MW: 178.58

Amresco

Am-O398

______________________________________________________________
[604-44-4]
(%)............................................................................................. > 99.0
(%) . ........................................................< 0.1
(C) ........................................................ 118 - 121
-200

Ultra Pure Grade


C27H46O MW: 386.67

Amresco

Am-O433

______________________________________________________________
[57-88-5]
(C) ........................................................ 146 - 150
(%)................................................................< 0.3

10

Ultra Pure Grade


CsCl MW: 168.36

Am-J415

______________________________________________________________
[7647-17-8]
(%)............................................................................................. > 99.9
Abs.@260nm (50%, ).................................................................... < 0.05
(%).........................................................................................< 0.0001
(%) ........................................................................................< 0.0001
(%).............................................................................................< 0.0001
(%).............................................................................................< 0.0001
(%).............................................................................................. < 0.03
(%)............................................................................................ < 0.03
(%).............................................................................................. < 0.001
(%).............................................................................................. < 0.001
(%).........................................................................................< 0.0001
(%)..........................................................................................< 0.0001


Biotechnology Grade
CsCl MW: 168.36

Amresco

Am-O887

______________________________________________________________
[7647-17-8]
(%)............................................................................................... > 99.5
Abs.@260nm (50%, ).......................................................................< 0.1
- . .................................................
(%).................................................................................................< 0.1
(%)...............................................................................................< 0.1
(%)................................................................................................ < 0.05
(%)..............................................................................................< 0.005
(%).........................................................................................< 0.0001
l (%).........................................................................................< 0.0001
(%) ........................................................................................< 0.0001

(CTAB)
High Purity Grade
C19H42NBr MW: 364.09

Amresco

Am-O833

______________________________________________________________
[57-09-0]
(%)............................................................................................. > 99.0

(CHAPS)

3-[CYCLOHEXYLAMINO]-1-PROPANESULFONIC ACID
High Purity Grade
C9H19NO3S MW: 221.32

Amresco

Am-O465

______________________________________________________________
[1135-40-6]
(%)............................................................................................. > 99.0
pKa @25C ................................................................................... 10.3 - 10.5

399

www.helicon.ru
(CHAPS),

3-[CYCLOHEXYLAMINO]-1-PROPANE-SULFONIC
ACID
Ultra Pure Grade
C9H18NO3SNa MW: 243.31

Amresco

Am-J620

________________________________________________________
Purity (%) ............................................................................................
.........8 87

(CHAPSO)

3-[(3-CHOLAMIDOPROPYL) DIMETHYLAMMONIO]2-HYDROXY-1-PROPANESULFONATE
Ultra Pure Grade
C32H58N2O8S MW: 630.90

Amresco

Am-E320

________________________________________________________
[82473-24-3]
(0.5M, ) (mhos).......................................< 100
Abs.@260 nm (1%, )......................................................... < 0.05

(CHES)

2-[N-CYCLOHEXYLAMINO] ETHANESULFONIC ACID


High Purity Grade
C8H17NO3S MW: 207.29

Amresco

Am-O392

________________________________________________________
[103-47-9]
(%)................................................................................ > 99.0
pKa @25C ........................................................................... 9.3 - 9.7

ETHYLENEGLYCOL BIS(2-AMINOETHYL ETHER)N,N,N,N-TETRAACETIC ACID


Ultra Pure Grade
C14H24N2O10 MW: 380.35

Amresco

Am-O732

________________________________________________________
[67-42-5]
(%)................................................................................. > 97.0
/ (C)................................. . > 238

ETHYLENEDIAMINETETRAACETIC ACID
Ultra Pure Grade
C10H16N2O8 MW: 292.25

Amresco

Am-O322

________________________________________________________
[60-00-4]
(%)................................................................................ > 99.5
pH (5%, ) @25C ......................................................... 2.5 - 3.5
(%)............................................................. < 0.001
(%).............................................................................. < 0.005
(%)............................................................................< 0.0005

10

400

10.2

, ,
Biotechnology Grade
C10H14N2O8Na2 2H2O MW: 372.24

Amresco

Am-O105

________________________________________________________
[6381-92-6]
(%) .............................................................................. 8 99.0
pH (5%, ) @25C ......................................................... 4.0 - 6.0
(%) . ......................................................... 7 0.005
(%) ............................................................................... 7 0.01
- . ....................................

USP Grade
C37H67NO13 MW: 733.94

Amresco

Am-O219

________________________________________________________
[114-07-8]
(%) ......................................................................85.0 - 100.5
(%) .............................................................................< 0.3


Biotechnology Grade
C21H20BrN3 MW: 394.32

Amresco

Am-O492

________________________________________________________
[1239-45-8]
(%)................................................................................ > 98.0
(%)....................................................< 5.0
(%)............................................................< 0.1


10 mg/ml
Biotechnology Grade

Amresco

Am-X328

________________________________________________________
(%)................................................................................ > 98.0
(%)....................................................< 8.0
(%)............................................................< 0.1
- . .....................................

High Purity Grade


HOCH2CH2OH MW: 62.07

Amresco

Am-O582

________________________________________________________
[107-21-1]
(%) ............................................................................... > 99.0
(%)............................................................................< 0.0005

11.1

Vector NTI Advance

11

Vector NTI Advance


Invitrogen Vector NTI Advance 11.5 Vector NTI, . 5 ,
.
.
Vector NTI: .
, .
.
, Gateway TOPO.
- in silico.
.
BLAST PubMed Entrez.
.
Clone2Seq: 2 in silico.
VectorSelector: /.
ReGENerator: : , .
AlignX: :
.
, , , .
ContigExpress: .
, , SNP, .
, Phred Quality Values.
, .
BioAnnotator: .
Pfam, PROSITE, BLOCKS.
-
GenomBench: 1 Mb.
1 Mb DAS (Distributed Annotation System).
, , .

A13786

Vector NTI Advance

12605050

Vector NTI Advance

12605103

3- Vector NTI Advance

12605099

1- Vector NTI Advance

A13785

3- Vector NTI Advance

A13784

1- Vector NTI Advance

,
.

,
1 3 .

invitrogen.comVectorNTI , , .

401

www.helicon.ru

402