Вы находитесь на странице: 1из 308

TEX

. . *

LATEX
cba
2008, 2012, 2013
* e-mail:

E.M.Baldin@inp.nsk.su

LATEX - 2008 ISBN 978-5-9775-0230-6. ,


Creative Commons Attribution-ShareAlike 3.0 Unported (CCBY-SA 3.0). ,
.
LATEX.
, 1300
LATEX 750 , , . , , , , .
, LATEX .
LATEX .
LATEX. , ,

.

The book Computer Typesetting Using LATEX was published by the BHVPetersburg (Russia) publishing house in 2008 under ISBN 978-5-9775-0230-6. Under
the contract with the publishing house, I have now regained exclusive rights to the
content and decided to publish it under a Creative Commons Attribution-ShareAlike
3.0 Unported License (CC-BY-SA 3.0). Please contact me if you require a different
type of copyright license for your purposes.
This book is a guide to using the LATEX document preparation system. It describes
the complete fundamentals of the typesetting and layout processes and covers at least
1300 LATEX commands and about 750 packages, styles, and classes that can be used
in the typesetting of any documents. It also deals with creating presentations, table
layouts, inserting graphics, bibliography and index, and many other tasks. Specific
examples demonstrate that publishing systems using LATEX can handle projects of
any scope and complexity. A major part of the book is devoted to the typesetting of
mathematical text, which is the key differentiator of LATEX compared to other word
processors.
The book was written completely and exclusively by means of LATEX tools. As the
author of both the content and the typesetting, I will greatly appreciate any comments
and useful advice on improving the quality of the electronic version of the book.


1. LATEX,

11

2. LATEX

21

3.

29

4.

45

5.

57

6.

69

7.

79

8. LATEX

97

9.

107

10.

121

11.

149

12. -

163

13.

185

14.

207

15.

221

16.

235

17. TEX Live

247


1. LATEX,
1.1. . . . . . . . . . . . . . . . . . .
1.1.1. . . . . . . . . . .
1.1.2. . . . . . . . . .
1.1.3. TEX . . . . . . . . .
1.1.4. LATEX . . . . . . . . . . . . . .
1.2. LATEX . . . . . . . . . . . . . . . .
1.3. . . . . . . . . . . . . . . . . . . . .
1.3.1.
1.3.2. . . . . . . . . . . .
1.4. . . . . . . . . . . . . . . . . . . . . .
1.4.1. . . . . . . . . . . . . . . . . . . .
1.4.2. . . . . . . . . .
1.4.3. LATEX . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

11
11
11
12
13
13
14
15
16
16
17
17
18
18

2. LATEX
2.1. . . . . . . . . . . . . . . . . . . . . . . . .
2.2. LATEX- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

21
23
24

3.
3.1. . . . . . .
3.2. . . . . . . .
3.2.1. LATEX-
3.2.2. . . . .
3.2.3. . . . . . . . . . .
3.2.4. . . . . .
3.3. . . . . . . . . .
3.3.1. . . . . .
3.3.2. . . . . . . .
3.4. . . . . . .
3.4.1. . . . .
3.4.2. . . . .
3.4.3. .

29
29
31
31
33
34
35
35
35
37
40
40
41
42

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

4.
4.1. . . . . . . . . . . . . . . .
4.2. . . . . . . . . . .
4.3. . . . . . . . . . . .
4.3.1.
4.3.2. . . . . . . . . . . . . . . .
4.3.3. . . . . .
4.3.4. . . . . . . . . . . . . . . . .
4.3.5. . . . . . . . . . . . . . . . .
4.3.6. . . . . . . .
4.3.7. . . . . . .
4.3.8. . . . . . . . . . . . . . . .
4.3.9. . . . . . . . . . . . . . . . .
4.4. . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

45
46
47
48
49
49
50
51
52
52
52
54
54
55

5.
5.1. Encapsulated PostScript . . . . . . . . . . . .
5.2. EPS . . . . . . . . . .
5.3. graphicx . . . . . . . . . . . . . . . . . . . . .
5.3.1. . . . . . .
5.4. . . . . . . . . . . . . . .
5.4.1.
5.4.2. float . .
5.4.3. . . . . . . . . .
5.4.4. . . . . . . . . . .

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.

57
57
59
60
61
62
63
64
65
66

6.
6.1.
6.2. . . . . . . . . . . . . . . . .
6.3. . . . . . . . . . . . . . . .
6.3.1. . . . . . . . . . .
6.3.2. calc . . . . . . .
6.3.3.

. . . . .
. . . . .
. . . . .
. . . . .
. . . . .

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

69
69
71
73
75
75
76

7.
7.1. . . . . . . . .
7.1.1. .
7.1.2. . . . . . . .
7.2. . . . . . . . . . .
7.2.1. . . . .
7.2.2. . . . .
7.2.3. . . . . . . . . .
7.3. . . . . .

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

79
79
81
82
83
83
86
86
88

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

7.3.1. . . . . . . . . . . . . .
7.3.2. . .
7.3.3.
7.3.4. . . . . . . . . . . .
7.3.5. . . . . . . . .
7.3.6. . . .
7.3.7. . .
7.4. . . . . . .

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.

88
89
89
90
90
91
91
91

8. LATEX
8.1. ? . . . . . . . . . . . . .
8.2. . . . . . . . . . . . . . . . . . . . .
8.3. . . . . . . . . . . . . . . . . . . . .
8.3.1. . . . . .
8.3.2. . . . . . . . . . . . . . . . .
8.3.3. . . . . . . . . . .
8.3.4. . . . . . . . . . . . . . . . .
8.3.5. . . . . . . . . . . . . . . . .
8.3.6. . . . . . . . . . . . . .
8.3.7.
8.3.8. . . . . . . . . . . . . .
8.3.9. . . . . . . . . . . .
8.3.10. . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

97
97
98
99
99
100
101
102
102
103
104
104
105
106

9.
9.1. slides . . . . . . . . . . . .
9.2. PDF . . . . . .
9.2.1.
9.2.2. . .
9.2.3. .
9.3. beamer . . . . . . . . . . .

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

107
108
108
109
110
110
111

10.
10.1.
10.2. . . . . . . . . . . . . . . . . .
10.2.1. . . . . . .
10.2.2. . . . . .
10.2.3. . . . . . . . . . . . . .
10.3. . . . . . . . . .
10.4. . . . . . . . . . . . .
10.4.1. . . . . . . . .
10.4.2. . . . . . . . . . . . . . .
10.4.3. . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

121
121
123
125
125
126
126
127
127
129
130

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

10.4.4. . . . . . . . . . .
10.5. . . . . . . . . . . . .
10.6. , .
10.6.1. . . . . .
10.6.2.
10.6.3.
10.6.4. . . . .
10.6.5. WWW- . . . . .
10.7. .
10.7.1. FiXme
10.7.2. lineno
10.7.3. . . . . . .
10.7.4. . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

131
133
137
137
138
140
141
141
143
143
143
144
145


. . . . . . . . . . . . . . . . .
tabbing . . . . . . . . . . . . . . . . . . . . . .
tabular array . . . . . . . . . . . . . . . . .
11.3.1. . . . . . . . . . .
11.3.2.
11.3.3. . . . . . . . . . . . . . . . . . .
11.3.4. . . . . . . . . . .
11.3.5. . . . . . . . . . . . .
11.3.6. tabular . . . . . . . . . . . . . .
11.4. . . . . . . . . . . .
11.5. . . . . . . . . . . . . . . . . . . . . . .
11.6. ? . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.

149
149
150
151
154
155
155
157
158
158
159
161
162

11.
11.1.
11.2.
11.3.

12. -
12.1. . . . . . . . . . . . . . . . . .
12.2. . . . . . . . . . . . . . . . .
12.3. . . . . . . . . . . . . . . .
12.4. BibTEX . . . . . . . . . . . . .
12.5. . . . . . . . . . .
12.6. xindy . . . . . . . . . . . . . . . . . . . . .
12.7. . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

.
.
.
.
.
.
.

163
164
166
168
170
174
178
180

13.
13.1.
13.1.1. . .
13.1.2. .
13.1.3.
13.1.4. . . . . . .

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

185
185
185
186
187
188

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

.
.
.
.
.

13.1.5. . . . . . . . . . . . .
13.1.6. .
13.1.7. . . . . . . .
13.1.8. . . . . . . .
13.1.9. . . . . . . . . . . . . . .
13.1.10. . . . . . . . . . . . .
13.1.11.
13.2. . . . . . . .
13.3. , . . . .
13.4. . . . . . . . . . .
13.5. . . . . . . . .
13.6. . . . . . . . . . . . .
13.7. . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.

189
190
190
191
193
194
195
195
197
199
200
204
205

14.
14.1. . . . . . . . .
14.2. LCD- . . . . . . . . . . . . .
14.3. . . . . . . . . . . . . .
14.4. . . . . .
14.5. . . . . . . . . . .
14.6. LATEX

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

.
.
.
.
.
.

207
207
211
212
214
216
218

15.
15.1. . . . . . . . . . . . . . . .
15.1.1. . . . . .
15.1.2.
15.1.3. . . .
15.1.4. . .
15.2. . . . . . . . . . . . . . . .
15.2.1. . .
15.2.2. . .
15.2.3. .
15.3. . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

221
221
222
223
226
228
229
229
229
231
233

.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.

16.
235
16.1. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
16.2. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238
16.3. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243
17. TEX Live
17.1. . . . . . . . . . .
17.1.1.
17.1.2. . . . . . .
17.1.3. . . . . . . .

. . . . . . . .

. . . . . . . .
. . . . . . . .

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

.
.
.
.

247
247
247
248
248


17.1.4. . . . . . . . . . .
17.1.5. . . . . . . .
17.1.6. . . .
17.1.7. . . . . . . . . . . . . . . .
17.1.8. . . . .
17.1.9. . . . . . . . . . . . .
17.1.10. . . . . . . . . . . . . .
17.1.11. . . . . . . . . . .
17.1.12. . . . . . . .
17.1.13. . . . . . . . . . . . . . . . .
17.1.14. . . . . .
17.1.15. . . . . . . . . .
17.1.16. WWW- . . . . . . . . . .
17.1.17. PDF . . . . . . . . . . . . . . . . .
17.1.18. . . . . . . . . . . . . . . . .
17.1.19. . .
17.1.20. . . . . . . .
17.1.21. . . . . . . . . . . .
17.2. . . . . . . . . . . . . . . . .
17.2.1. . . . . . . . . . . . . .
17.2.2. . . . . . . . . . . . .
17.2.3. . . . . . . . . . . . . . . . .
17.2.4. . . . . . . . . . . . . . . . .
17.2.5. . . . . . . . . . . . . . .
17.3. . . . . . . . . . . .
17.4. . . . . . . . .
17.4.1. , . . . . .
17.4.2. . . . . . . . . . . . .
17.4.3. . . . . . . . . . . . . . . .
17.5. . . . . . . . . .
17.5.1. . . . . . . . . . . . . . . .
17.5.2. . . . . . . . . . . . . . .
17.5.3. , . .
17.5.4. . . . . . . . . . . . . . . . .
17.5.5. . . . . . . . .
17.6. . . . . . . . . . . . .
17.6.1. . .
17.6.2. . . . .
17.6.3. .
17.6.4.
17.7. . . . . . . . . . . . . . . . . . . .
17.7.1. . . . . .
17.7.2. . . . . . . . . .

9
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

249
249
249
249
250
250
250
251
251
251
252
252
252
252
252
253
253
254
254
254
257
257
258
259
259
259
260
260
260
261
261
261
261
262
262
262
262
262
263
263
264
264
264

10

17.7.3. LaTeX . . . . . . . . . . . . . . .
17.8. . . . . . . . . . . . . . . . . . . . . . . . . . .
17.8.1. . . . . . . . . .
17.8.2. . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.8.3. . . . . . . . . . . . . . . . . . . .
17.8.4. tabular . . . . . . . . . . . . . . . . . . . . . . .
17.8.5. . . . . . . . . . . . . . . .
17.8.6. . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.8.7. . . . . . . . . . . . . . . . . . . . . .
17.9. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.9.1. . . . . . . . . . . . . . . . . . .
17.9.2. . . . . . . . . . . . . . . . . . . . . . . . . . . .
17.9.3.
17.9.4. . . . . . . . . . . . . . . . .
17.10. LATEX . . . . . . . . . . . . . . . .
17.10.1. . . . . . . . . . . . . . . . .
17.10.2. . . . . . . . . . . .
17.10.3. . . . . . . . . . . . . . . . . . . . . . .
17.10.4. . . . . . . . . . . . . . . . . . . . . . .
17.10.5. . . . . . . . . . . . . . . . . . . .
17.10.6. . . . . . . . . . . . . . . . . .
17.10.7. . . . . . . . . . . . . . . . . . . .
17.10.8. . . . . . .
17.10.9. . . . . . . . . . . . . . . . .
17.11. - . . . . . . . . . . . .
17.11.1. . . . . . . . . . . . . . . . . . . . . . . . .
17.11.2. . . . . . . . . . . . . . . . . . . . . . . .
17.11.3. . . . . . . . . . . . . . . . . . . . . . .
17.11.4. . . . . . . . . . . . . . . . . . . . . . . . . .
17.12. LATEX . . . . . . . . . . . . . . .
17.12.1. . . . . . . . . . . . .
17.12.2. LATEX . . . . . . . . .
17.12.3. . . . . . . . . . . . . .
17.12.4. . . . . . . . . . . . . . . . . .
17.12.5. . . . . . . . . . . . . . . . . . . . .
17.12.6. . . . . . . . . . . . . . . . . . . . .
17.12.7. LATEX . . . . . . . . . . . . . . . . . . . . . . .
TEX Live . . . . . . . . . . . . . . . . . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

264
266
266
266
266
266
267
267
267
267
267
268
268
268
269
270
270
270
271
271
271
272
272
273
274
274
274
274
275
276
276
276
276
277
277
277
278
279

LATEX,
- ,

;
, .
.

.
, .
// . LATEX , , ,
.

1.1.
, , .
, . , , -
.

1.1.1.
, . , . ,
, , . . .

12

1. LATEX,

1.1.2.
, .
, , , .
, ,
, .

(Donald Ervin Knuth) , . , ,


1 . 1975
,
. : ,
, . . , , . , ,
, ,
.
, .
. , . .
, , .
, 1977 . . . ,
.
, METAFONT ( ) TEX (
) ( 2.7 METAFONT 3.1 TEX).
. METAFONT TEX .
METAFONT 2.71828, TEX 3.141592. , , ,
.
TEX . ,
, . TEX TeX: The Program (ISBN: 0201134373). TEX
,
GPL.
1 http://www-cs-faculty.stanford.edu/~knuth/ .

1.1.

13

. , .
.

1.1.3. TEX
TEX . TEX
(box) (glue). , -, -,
- . , / .
, , , , .
,
, , . ,
. .
. . TEX, .
. , , . TEX . (x), ().
. TEX-
TEX-.

1.1.4. LATEX
, TEX . ,
TEX TEX . , , TEX
, , TEX .
, 80- XX LATEX TEX. LATEX
TEX, .
, . ,
, . LATEX, TEX

, .

14

1. LATEX,

1.2. LATEX
LATEX . LATEX ,
, ,
.
LATEX ,
CTAN The Comprehensive TeX Archive Network.
http://www.ctan.org.
CTAN . CTAN ,
TEX , . , CTAN:
ftp://ftp.dante.de/tex-archive/
ftp://ftp.tex.ac.uk/tex-archive/
ftp://ctan.tug.org/tex-archive/
CTAN , , :
ftp://ftp.chg.ru/pub/TeX/CTAN/
ftp://ftp.nsu.ru/mirrors/ftp.dante.de/tex-archive/
CTAN , -
TEX-. ,
perl-, CPAN (The Comprehensive
Perl Archive Network). R-2 ,
CRAN (The Comprehensive R Archive Network), Python- PyPI (Python Package Index), - Ruby-
RubyGems Java- CJAN JSAN.
TEX-, TEX User Groups (http://www.tug.org/), TEX Live (http://www.tug.org/texlive/).
TEX Live , CD. GNU/Linux teTeX. TEX Live 1996 . 2003 TEX Live CD
DVD. - . . ,
.
TEX Live . , (http://www.gnu.org/philosophy/free-sw.html) Debian
2 R

1.3.

15

(http://www.debian.org/social_contract#guidelines).
, , FSF.
, ,
TEX Live 2007. , .
MS Windows MiKTEX (http://www.miktex.org/), Mac OS X
MacTEX (http://www.tug.org/mactex/).
Unix- TEX Live, .

1.3.
 : TEX!

LATEX, Linux Format (http://www.linuxformat.
ru) 20062007 .
http://www.inp.nsk.su/~baldin/LaTeX/.
LATEX - 2008 ISBN 978-5-9775-0230-6. , Creative Commons Attribution-ShareAlike
3.0 Unported (CC-BY-SA 3.0) CTAN: http://ctan.org/tex-archive/info/
russian/Computer_Typesetting_Using_LaTeX.
,
Google Code GPL v.3
or later ( License): https://code.google.com/p/ctex-ru/
https://ctex-ru.googlecode.com/ ( ctex-ru).
:
> g i t c l o n e h t t p s : / / code . g o o g l e . com/p/ ctex ru /
git. ,
Pro Git http://git-scm.com/book/ru.

e-mail: E.M.Baldin@inp.nsk.su E.M.Baldin@gmail.com. , !

16

1. LATEX,

1.3.1.
, ,
, : babel.
, ,
, : lshort.pdf. - CTAN,
{CTAN}.
, , :
\ b e g i n { e q u a t i o n }
\ i n t \ l i m i t s _{\ i n f t y }^{\ i n f t y }
e^{x ^2/2\ sigma ^2}dx=\ s q r t {2\ p i }\ sigma
\ end { e q u a t i o n }
, . .
, ,
, , :
\begin{equation*}
\int\limits_{-\infty}^{\infty}
e^{-x^2/2\sigma^2}dx=\sqrt{2\pi}\sigma
\end{equation*}

/2 2

1.3.2.
,
LATEX. , , , , .
, , ,
( ) TEX Live 247. ,
, X.
, , :
,
.
 ,
TEX Live.

1.4.

17


LATEX, , . .
 , , .
 ,
.

1.4.
LATEX .
. , TEX,
. , LATEX
.
LATEX . , ,
, , .
LATEX , .
 .
, . -, LATEX . CTAN (http://www.ctan.org) TUG (http://www.tug.org).

1.4.1.
. . TEX [1] TEX.
LATEX , , . TEX ,
, . LATEX. .
.
. . METAFONT [2] , TEX, METAFONT. MetaPost,
.
. . [3] . . , TEX METAFONT.
, TEX , .

18

1. LATEX,

,
.

1.4.2.
. LATEX [4] .
, .
.
. , . . LATEX
LATEX 2 [5]
LATEX. LATEX .
. , .
. , . . LATEX [6] LATEX,
MetaPost PostScript. , TEX
.
. : , PostScript MetaPost. - ,
.
. , . LATEX Web- [7] LATEX WWW.
LATEX. , , . , PDF
. XML .
LATEX 2 . LATEX 2 94 1999 .
: http://xtalk.msk.su/tex/.
. . : .
.

1.4.3. LATEX
. . LATEX 3- [8]
. . . , ,
. , , ,
: http://www.mccme.ru/free-books/.
. . , . . LATEX - 3- [9]
. , ,
, . -

1.4.

19

, .
: http://www.tutor.nsu.ru/books/tex/.
. . LATEX [10] .
.

LATEX
-
.
.

, LATEX . , . .
.
: , !!! 1 helloworld.tex, :
%
\ documentclass { a r t i c l e }
% ,
%
\ u s e p a c k a g e [ warn ] { mathtext }
% TEX
\ u s e p a c k a g e [ T2A] { f o n t e n c }
%
% cp 1251 u t f 8
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
%
\ usepackage [ english , r u s s i a n ] { babel }
1 , emacs
,.

22

2. LATEX

%
\ usepackage { i n d e n t f i r s t }
%
\ b e g i n { document }
\LARGE , ! ! !
\ end { document }
, %, . ,
\begin{document}, . .
.
tex-.
:
> l at ex helloworld . tex
This i s pdfeTeXk , V e r s i o n 3 . 1 4 1 5 9 2 1 . 3 0 . 3 2 . 2 (Web2C 7 . 5 . 5 )
%&l i n e p a r s i n g e n a b l e d .
e n t e r i n g extended mode
( . / helloworld . tex
LaTeX2e <2003/12/01>
...
( . / h e l l o w o r l d . aux ) [ 1 ] ( . / h e l l o w o r l d . aux ) )
Output w r i t t e n on h e l l o w o r l d . d v i ( 1 page , 240 b y t e s ) .
T r a n s c r i p t w r i t t e n on h e l l o w o r l d . l o g .
>
LATEX helloworld.dvi. :
xdvi2 dviout3 :
> xdvi h e l l o w o r l d . dvi
dvi- PostScript4 gv (
Unix) ghostview ( Windows),
PostScript- ( , ), :
> dvips helloworld . dvi
> gv h e l l o w o r l d . ps
> l p r h e l l o w o r l d . ps
2 xdvi Unix- .
.
3 dviout T X Live dvi MS Windows.
E
4 PostScript ,
Adobe Systems. PostScript (ghostscript)
.

2.1.

23

PDF5 , , xpdf , kpdf


Adobe Reader:
> dvips helloworld . dvi
> p s 2 p d f h e l l o w o r l d . ps h e l l o w o r l d . pdf
> kpdf h e l l o w o r l d . pdf
:

, !!!
. 2.1. , !!! LATEX
, LATEX-, , , , , ///.

2.1.
, , LATEX .
latex ,
:
> latex
This i s pdfeTeXk , V e r s i o n 3 . 1 4 1 5 9 2 1 . 3 0 . 3 2 . 2 (Web2C 7 . 5 . 5 )
%&l i n e p a r s i n g e n a b l e d .

LATEX , .
^C (Ctrl+C).
latex,
, LATEX ,
, :
! Undefined c o n t r o l s e q u e n c e .
l . 11 \ e r r o r i n b o d y
?
5 PDF Portable Document Format. , PostScript, Adobe
Systems. .

24

2. LATEX

(?) h, ,
.
? h
The c o n t r o l s e q u e n c e a t t h e end o f t h e top l i n e o f
your e r r o r message was n e v e r \ def ed . I f you have
m i s s p e l l e d i t ( e . g . , \ hobx ) , type I and t h e
c o r r e c t s p e l l i n g ( e . g . , I \hbox ) . O t h e r w i s e j u s t
c o n t i n u e , and I l l f o r g e t about whatever was u n d e f i n e d .
? x
, x
. .
, (?).
 : . .
LATEX , . ,
LATEX, .

2.2. LATEX-
LATEX .
, .
LATEX-.
tex. , , dvi. Dvi device independent
( ) , ,
. , dvi- ,
dvi-.
xdvi dvi- . . , . dvi- dvips.
dvips PostScript, ( PostScript ),
Ghostscript. dvi-

2.2. LATEX-

25

.eps

.bbl
.ind
.aux
.idx
.toc
.lof
.lot

.tex

(.fmt)

LATEX

(.cls, .sty)
(.tfm)
(.fd)

.dvi
dvips
.ps

Log- (.log)

.pk(.mf), .pfb
ps2pdf

.pdf

. 2.2. LATEX-
, , dvi2tty dvi , dvilj dvi PCL HP, dvipdf dvi pdf.
dvi- / dvi- .
Ghostscript (gs) PostScript- (ps) . PDF
PostScript ps2pdf .
LATEX, , eps-. EPS, Encapsulated PostScript, ,
PostScript . , eps-
(BoundingBox). eps, , !!!:
%! PSAdobe2 . 0 EPSF2 . 0
%%C r e a t o r : d v i p s ( k ) 5 . 95b Copyright 2005 R a d i c a l Eye S o f t w a r e
%%T i t l e : h e l l o w o r l d . d v i
%%BoundingBox : 148 651 288 668
%%DocumentFonts : SFRM1728

26

2. LATEX

, :
I. .
fmt . , , LATEX
. .
TEX :
> texconfig init
cls, sty . (cls) \documentclass.
(sty), \usepackage.
tfm .
.
fd

, LATEX.

pfb Type1-.
pk (mf) pk- mf- (METAFONT) .
II. , LATEX-.
latex.
,
,
.
log . , .
.
aux .
toc (table of contents).
lof (list of figures).
lot (list of tables).
bbl , BibTEX.
TEX, .
ind , MakeIndex
xindy.
. idx-. .

2.2. LATEX-

27

LATEX-. latex
pdflatex, pdf-,
png6 pdf.
, .

6 PNG (Portable Network Graphics) , .


,
!
.

, . .

3.1.
LATEX .
, , , . , , ,
. .
. . LATEX .
: \, $, %, _, {, }, &, #, .
. :
: <<\t e x t b a c k s l a s h >>, <<\$>>, <<\%>>, <<\_>>1 , <<\{>>,
<<\}>>, <<\&>>, <<\#>>, <<\^{}>> <<\~{}>>.
. :
1 underscore _ .

30

3.

.
: { }. .
, , .
. LATEX \ (backslash
) , . , . .
, :
\command{}. , LATEX ( \LaTeX) , \LaTeX{}.
. LATEX :
\command [ param 1 ] [ param 2 ] { param 3}{ param 4}
(param1 param2),
(param3 param4).
LATEX . , \textbf{} .
 LATEX ,
. : \chapter,
\section, \subsection .
LATEX
.
. -
, \protect. , :
\ s u b s e c t i o n { \ p r o t e c t \ f o o t n o t e { }}
. LATEX .

, , .
:
%
\bfseries
%
\ t h i s p a g e s t y l e {empty}

3.2.

31

. , \begin{} \end{}, .
:
\ begin { center }

\ end { c e n t e r }
, ,
.

3.2.
. , .

3.2.1. LATEX-
tex- : , ,
. :
%
% , , a r t i c l e book
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , o n e s i d e ] { s c r a r t c l }
%
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
%
\ usepackage [ english , r u s s i a n ] { babel }
\ usepackage { i n d e n t f i r s t }
\ usepackage { misccorr }
%
\ u s e p a c k a g e {. . . }
...
%
\newcommand{\mycommand}{. . . }
\renewcommand{\ oldcommand }{. . . }
...
%
...
%
\ b e g i n { document }
%
\ end { document }

32

3.

\documentclass
. \usepackage
.
,
inputenc , , koi8-r2 , cp8663 ,
cp12514 utf85 (Unicode).
babel, ,
. , (\No),
(\S) .
,
, indentfirst. ,
, babel . misccorr
babel.
. , , LATEX .
TEX Live , .
language.dat
(fmt-).
, , MiKTeX
MiKTeX Options6 , GNU/Linux texconfig7 . HYPHENATION, latex. 8 language.dat. :
2 koi8-r 8- UNIX- . RFC 1489.
3 cp866 8- , DOS OS/2.
4 cp1251 Windows-1251 8-
Microsoft Windows.
5 UTF-8 (Unicode Transformation Format) ,

.
6 Languages.
General Update Now .
7 texconfig dialog- . .
texconfig .
, , :
texconfig init.
8 $EDITOR.
, vi. vi, :q
vi.

3.2.

33

e n g l i s h hyphen . t e x
r u s s i a n ruhyphen . t e x
. babel. , ,
. , -
:
r u s e n g ruenhyph . t e x
=r u s s i a n
=e n g l i s h
, LATEX
.
.

3.2.2.
\documentclass[]{} , .
, . , ,
article. .
report, book.
, .
, - .
. , revtex4. eskdx ( ),
CTAN TEX Live. , LATEX-, KOMA-Script: scrartcl, scrreprt scrbook article, report
book .
. ,
, . ,
( )
, .
.

34

3.

, , :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , o n e s i d e ] { s c r b o o k }
a4paper ( ,
, a5paper), 12pt ( 10pt 11pt), oneside (
).
, . . . ncc
. CTAN,
TEX Live.

3.2.3.
(sty) , - .
\usepackage[]{}.
,
. LATEX . TEX Live
sty-. , ,
. .
. LATEX, . lh,
Computer Modern. , , . 2001
METAFONT- Type1.
,
pdf- .
LATEX inputenc. .
: koi8-r, cp866, cp1251 utf8.
, . , - , , LATEX
T2A-9 .
t2filter. .
9 cp1251,
.

3.3.

35

:
> locate t 2 f i l t e r . c
{TEXMF}/ texmfd i s t / doc / g e n e r i c / t 2 / e t c / t 2 f i l t e r . c
> cd {TEXMF}/ texmfd i s t / doc / g e n e r i c / t 2 / e t c /
> g c c Wall O2 s o ~/ b i n / t 2 f i l t e r t 2 f i l t e r . c
> l a t e x { } . t e x | t 2 f i l t e r

3.2.4.
, document, .
- , ,
, \end{document}.

3.3.
.
.

3.3.1.
// , .
.
. , % , .
,
.
comment verbatim.
. LATEX
. .
.
:
%

.
.

36

3.

. ,
:

\ par
. \par:
\ par

. . ,
\emph, :
\emph{!:} \textbf{ },
\textit{}, \textsc{},
\textsl{ } .

!: ,
, ,
.

:
\bfseries , \itshape , \scshape \slshape
.
, , :
\textbf{\textit{ }}\par
\textbf{\textmd{\textit{ }}}

\textmd , , , \textbf.
\emph :
{\itshape

\emph{}}

.
.
\normalsize. 3.1
.
 Roman. (Sans
Serif) c \textsf (Typewriter) \texttt.

3.3.

\tiny
\scriptsize
\footnotesize
\small
\normalsize
\large
\Large
\LARGE
\huge
\Huge

37

3.1.
. enumerate, itemize. .
:
\begin{enumerate}
\item :
\begin{inparaenum}
\item , \item , \item .
\end{inparaenum}
\item . \par

:
\begin{itemize}
\item ,
\item .
\end{itemize}
\end{enumerate}

:
1) : ) , ) ,
) .
2) .

:
,
.

\item,
.
inparaenum
inparaitem paralist ( . 133).

3.3.2.
. . , , , ,.

38

3.

, , , , , , , .
, LATEX , .
. LATEX
. :

\,

,
;
;

\ .
,
"=
, ,
: .\,.~ "-- <<>> \@.
: .\,. ( ..),
.~, .~1 ~.\,.\
~.\,.

, - , ,
: . .
. :
. . ( ..), . , . 1
. . . .

LATEX , ,
.
.
, \
~. ,
( ), .
\@.
, , \/
: {\LARGE {\itshape }}
{\LARGE {\itshape }\/}.

, . ,
,
.
, . , TEX, - (hyphen), (en-dash), (emdash) .

3.3.

39

, ,
, - .
babel russian
, :
( , ) ,

(1015, 2001 2006) ,
( \LaTeX{} " ) ,
( $ ab=c $ ) .

"~, , "~ .
,
, "~
"~ .

", . \ , .
.
":
" .
, ,
.
. , LATEX . , , .
, ,
, .
\,
: \\ , \TeX\\ .
\ t e x t b f { b a b e l }
"=, ,
"= .
.
\hyphenation{ =}. , . , ,
.

40

3.

\hyphenation , .
\mbox{ }.
. \ldots. , ~ (
).
. 1.5
2 . ,
.
\ t e x t b f { } \ t e x t b f { }
,
" \ t e x t b f { } : \ t e x t b f { \ } , \ t e x t b f { \ } "
\ t e x t b f { } \ , \ t e x t b f { } \
: \ t e x t b f { } \ , \ t e x t b f { } \ .
. babel, , , : ( )
( ):

,
.
: << , , Linux Format > >.

3.4.
LATEX . , , , 20 , ,
, .

3.4.1.
, . titlepage. , ,

3.4.

41

.
. , :
\ t i t l e {\LaTeX , Unix }
\ a u t h o r { . \ ,. ~ \ thanks { em a i l : E .M. Baldin@inp . nsk . su }}
\ d a t e {2002}
\ maketitle
% a r t i c l e
\ begin { abstract }
\LaTeX , Unix .
\ end { a b s t r a c t }
\maketitle , (\title), (\author)
(\date). \thanks . ,
, \and
.
( article) , abstract.
( book) titlepage,
. , ,
.

3.4.2.
\tableofcontents,
. .
, . , , , , .
:
\ s u b s e c t i o n { }
\ l a b e l { sec : base : sec }
. . .
.
\part{} \chapter{}.

42

3.


, article (scrartcl) report,
book (scrbook).
:
\ s e c t i o n { }
\ label { section }
\ s u b s e c t i o n { }
\ label { subsection }
\ s u b s u b s e c t i o n [ ] { - , }
\ label { subsubsection }
\paragraph {}
\ l a b e l { paragraph }
\subparagraph {}
\ l a b e l { subparagraph }
,
.
. , ,
,
*, , \section*{}.

3.4.3.
, LATEX TEX TEX,
.
, \label{}.
, . (:) (-).

\label{sec:base: ref }. :
<< >>
~\ref{sec:base:ref}
~\pageref{sec:base:ref}.

3.4.3 42.

3.4.

43

, ( \ref) ( \pageref) LATEX . .


, , , . \label
.
\caption, \item.



. . .
.

TEX , LATEX
. TEX , LATEX ,
.
.
, . . .
.
.
LATEX , TEX-.
(
: http://ru.wikipedia.org ).
TEX (The American
Mathematical Society AMS), TEX,
-TEX. 1987 -TEX
LATEX amsmath.
amsmath LATEX , .
amsmath.

46

4.

, :
\ u s e p a c k a g e {amsmath}
, , , .
.

4.1.
.
.
LATEX , . , ,
= 2 .
.
1 $$
- \(\). , ,
, . ($) , - , $ 2
-.
, ,
equation. , . :
\begin{equation}
\label{eq:math:ex1}
\int\limits_{-\infty}^{\infty}
e^{-x^2/2}dx=\sqrt{2\pi}
\end{equation}

/2

(4.1)

, \eqref{eq:math:1}3 .
1 : \begin{math}
\end{math}. .
2 L
AT X, E
/.
. ,
, \protect.
, ,
.
3 \label.

4.2.

47

, equation*4 .
.
amsmath fleqn,
\mathindent. nccmath \fleqn[], fleqn. nccmath \ceqn.
. LATEX
. :
\displaystyle
, ,
\textstyle
,
\scriptstyle
,
\scriptscriptstyle .

.
:
\begin{equation*}
\frac{1}{1+
\frac{1}{1+
\frac{1}{1+
\frac{1}{2}}}}
\end{equation*}
\begin{equation*}
\frac{1}{\displaystyle 1+
\frac{1}{\displaystyle 1+
\frac{1}{\displaystyle 1+
\frac{\displaystyle 1}
{\displaystyle 2}}}}
\end{equation*}

1
1+

1+

1
1+ 1
2

1
1

1+
1+

1
1+

1
2

,
. LATEX, , , .

4.2.
, , . ,
.
4 equation . . (*)
.

48

4.

mathtext ( t2)
. warn,
.
mathtext babel / fontenc:
\ u s e p a c k a g e [ warn ] { mathtext }

\[
v_{}=\frac{S_{}-S_{}}
{\delta t}
\]

\[\] equation*.
. ,
:
\ DelareSmbolFont {T2 A l e t t e r s }{T2A}{cmr}{m}{ i t }
amstext, amsmath, \text, .
:
\[v_{}=
\frac{\text{ }\text{ }}
{\text{ }}\]

, \text . \text .

4.3.
, . ,
, - . .

4.3.

49

4.3.1.
. , ,
. , (,
123, 456, 789) . ,
:

\(3.14159\)\par
\(3,14159\)

3.14159
3, 14159

. , . ,
, , :

\(3.14159\)\par
\(3{,}14159\)

3.14159
3,14159

ncccomma nctools. ,
, , . ,
, = 1, 2, . . . ,
.

4.3.2.
, .
:
\[A_{\text{ }}\quad
B^{\text{ }}\quad
C_n^k\]

, ,
.
: \(a^2+b^2=c^2\), 2 + 2 = 2 .

50

4.

4.3.3.

. . amsfonts, :
\begin{itemize}
\item\(ABCD\) "--- ,
\item\(\mathbf{ABCD}\) "--- ,
\item\(\mathbb{ABCD}\) "--- ,
\item\(\mathcal{ABCD}\) "--- ,
\item\(\mathfrak{ABCD}\) "--- ,
\item\(\mathscr{ABCD}\) "--- mathrsfs.
\end{itemize}

ABCD ,
ABCD ,
ABCD ,

ABCD ,

ABCD ,

A BC D mathrsfs.

, .
( \mathfrak).

. , ,
:

\alpha
\zeta
\lambda
\pi
\phi
\Delta
\Sigma


\beta
\gamma

\eta
\theta

\mu
\nu

\rho
\sigma

\chi
\psi

\Theta
\Lambda
\Upsilon \Phi

\delta
\iota
\xi
\tau
\omega
\Xi
\Psi

\epsilon
\kappa
o
\upsilon
\Gamma
\Pi
\Omega

LATEX ,
.
amssymb:
% \kappa, \epsilon \phi
\renewcommand{\ kappa }{\ varkappa }
\renewcommand{\ e p s i l o n }{\ v a r e p s i l o n }
\renewcommand{\ p h i }{\ v a r p h i }

LATEX . TEX Live
LATEX (The Comprehensive LaTeX Sym-

4.3.

51

bols List symbols-a4.pdf), 3300 , LATEX. , , .


, .
amssymb .

6
=

\hat{a}
\ tilde {a}
\cdot
\neg
\le
\neq
\approx
\angle
\ell

>


\bar{a}
\vec{a}
\pm
\mp
\div
\lor
\forall
\exists
\ge
\ll
\equiv
\sim
\propto
\parallel
\triangle
^ \sphericalangle
\sum
\prod

\dot{a}
\times
\land
\in
\gg
\simeq
\perp
\infty
\varnothing

(6 >)
:
% \le \ge
\renewcommand{\ l e }{\ l e q s l a n t }
\renewcommand{\ ge }{\ g e q s l a n t }

4.3.4.
:
\ s q r t [ ] { }
. .
\[
\overline{
\underline{\Large
\sqrt[3]{a}+\sqrt[2]{b}+\sqrt[99]{g}
}
}
\]

99

, .
, , ,
, .

52

4.

\mathstrut5 . ,
:
\[\Large
\sqrt[3]{\mathstrut a}+
\sqrt[2]{\mathstrut b}+
\sqrt[99]{\mathstrut g}
\]

3
2
99
+ +

4.3.5.
\frac6 :
\[
=\frac{}{}
\]

LATEX, ,
.

4.3.6.
, 2 + + = 0:

\[
x_{1,2}=\frac{-b\pm\sqrt{b^2-4ac}}{2a}
\]

1,2 =

2 4
2


,.

4.3.7.
- . , ,
, . , , .
5
6

strut .
fraction .

4.3.

53

= .
.
. \frac{d F(x)}{dx}. \partial:

\[ f\quad f\quad f \quad f^n \]


\[\dot{x}\quad \ddot{x}\quad \ddot{x}\]
\[\frac{d f}{d x}\quad
\frac{d^n f}{d x^n}\quad
\frac{\partial^2 f}{\partial x\partial y}\]

, . \int:

\[
\frac{d}{dx}\int F(x) dx=F(x)
\]

() = ()

, ,
, . , , wasysym integrals. , .
,
.
,
. :
\[
\int_0^{\infty}\quad
\int\limits_0^{\infty}\quad
\sum_{i=1}^n\quad
\sum\nolimits_{i=1}^n\quad
\]

=1

=1

.
\limits. ,
\sum .
\nolimits.

54

4.

4.3.8.
,
. ,
. babel
, .
: \cos, \arccos, \sin, \arcsin, \tg, \arctg, \ctg, \arcctg, \sh, \ch,
\th, \cth, \exp, \ln, \log, \lim, \min \max.
.
\begin{equation*}
\begin{split}
&\log_2 10=\ln10/\ln2\simeq3.32 \\
&\lim_{x\to0}\frac{\sin x}{x}=1\\
&(a+b)^n=\sum_{k=1}^n C^k_n a^kb^{n-k}
\end{split}
\end{equation*}

log2 10 = ln 10/ ln 2 3.32


sin
lim
=1
0

( + ) =

=1

, \log () \lim
() . \DeclareMathOperator:
%
\ DeclareMathOperator {\ l o g l i k e }{ l o g l i k e }
\ DeclareMathOperator {\ liml i k e }{ liml i k e }

( ) ( ).

4.3.9.
. .
, , :
\[ ( \big( \Big( \bigg( \Bigg( \]

((
((

l ( \left),
r ( \right) m:

4.4.

55

\[ \Biggl|\int\Biggl| \Biggm|\int\Biggm|
\Biggr|\int\Biggr|\]

, , . \left \right
.
\[\left(
\left[
\left\langle
\left\{
\left\uparrow
\left\lceil
\left|
\left\lfloor
\text{-}^{10}
\right\rfloor^9
\right|^8
\right\rceil^7
\right\downarrow^6
\right\}^5
\right\rangle^4
\right]^3
\right)^2\]

} 4 3 2
{
8 7 6 5


10

4.4.
,
, , . :
a + b =
= c
. 7 ,
:
%
\newcommand{\hm} [ 1 ] { # 1 \ nobreak \ d i s c r e t i o n a r y {}%
{\ hbox {$\ mathsurround=0pt #1$}}{}}
\hm, , : \(a + b \hm{=} c\).
7

fido7.ru.tex.

56

4.

.
.
(=, >, <, 6, >, =, ); ,
; . - ,
.

. , 13.

, TEX .
, . . . .
TEX ,
- .
. .
LATEX Encapsulated PostScript.

5.1. Encapsulated PostScript


,
Adobe Systems Apple
PostScript. , . PostScript
.
PostScript. , PostScript .
Encapsulated PostScript EPS .
, , eps.

58

5.

PostScript, . LATEX ,
:
%! PSAdobe2 . 0 EPSF2 . 0
%%C r e a t o r : d v i p s ( k ) 5 . 95b Copyright 2005 R a d i c a l Eye S o f t w a r e
%%T i t l e : p i c t u r e . d v i
%%BoundingBox : 127 464 430 667
%%DocumentFonts : SFRM1200 SFRM0800
%%EndComments
PostScript1 . BoundingBox . , .
(bp=1/72 in), 0.351 . .
PostScript- EPS,
, , BoundingBox.
ps2eps . , Ghostscript PostScript:
> g s q dSAFER dNOPAUSE dBATCH sDEVICE=bbox

bbox.
-q, -dNOPAUSE -dBATCH
. -dSAFER , Ghostscript
2 .
EPS- . , PostScript, -
.
- PostScript,
.
, / epstool .
1 . PostScript-
.
.
2 , ,
read-only. , Ghostscript
.

5.2. EPS

59

EPS pstoedit , , . ,
- PostScript- .
, .

5.2. EPS
LATEX
EPS. . -, ,
, .
, convert ImageMagick,
.
: latexdvipsps2pdf pdflatex, PNG3 JPEG4 ,
PDF5 . , . ,
. pdflatex .
JPEG jpeg2ps, CTAN-
{CTAN}/nonfree/support/jpeg2ps. JPEG-,
eps-. JPEG PostSript-. , PostScript Level 2. ,
,
.
sam2p
bmeps. CTAN graphics/sam2p
support/bmeps . sam2p , ,
bmeps PNG JPEG. eps- .
.
bmeps ,
eps-, sam2p .
3 Portable Network Graphics ,
.
4 Joint Picture Experts Group , .
5 Portable Document Format ,
Adobe System.

60

5.

CTAN {CTAN}graphics/a2ping
perl- a2ping.pl. sam2p Ghostscript, - PostScript .

5.3. graphicx

graphicx6 , \includegraphics:
% TeX METAFONT,
% , ...

LATEX

% Neal Tucker
\includegraphics[width=\textwidth]{title.eps}

\textwidth . \includegraphics . =, .
keyval. .
bb
BoundingBox LATEX-, eps. ,
, : [bb=127 464 430 667]. bb ,
: [bbllx=127,bblly=464,bbrx=430,bbry=667].
BoundingBox
viewport - BoundingBox, , trim -
, , .
clip BoundingBox. , .
false. clip true.
.
angle .
6 graphicx graphics .
, .

5.3. graphicx

61

origin , .
origin : l, b, r t , ,
. . , : lt, rt, rb lb. c
.
width .
height .
scale .
keepaspectratio .
A
.

L TEX

LATEX

\includegraphics[trim=110 0 105 100,clip,


width=0.49\textwidth]{title.eps}
\hspace{0.5cm}
\includegraphics[viewport=0 0 100 200,clip,
width=0.49\textwidth,
height=3cm,keepaspectratio,
angle=180,origin=c]{title.eps}

 \includegraphics .
.

5.3.1.
graphicx
. , png-:
\ D e c l a r e G r a p h i c s R u l e { . png }{ e p s } { . bb } { bmeps p3 c #1}
, . png-.
, LATEX.
, eps
Encapsulated PostScript, , dvips . ,
BoundingBox, bb
:
%%BoundingBox : 0 0 848 979

62

5.

png- , , :
> bmeps b . png . bb

, .
. #1 . dvi-.
 ,
. , dvi xdvi -allowshell.
,
. PostScript dvips
-R0. - eps-.
eps :
\ D e c l a r e G r a p h i c s R u l e {}{ e p s }{}{}
MetaPost,
. , ,
BoundingBox , .

5.4.
.
. \includegraphics , .
, LATEX :
(float7 ). , .
figure:
\ b e g i n { f i g u r e } [ ht ]
\ c e n t e r i n g %
\ i n c l u d e g r a p h i c s {}
\ c a p t i o n {}\ l a b e l { f i g : metka }
\ end { f i g u r e }
7 , , float.
floatraw.

5.4.

63

figure :
h ,
t ,
b ,
p , .
figure . h, t b, LATEX
.
LATEX , . , , ,
: [b!].

5.4.1.
, . ,
.
clearpage
LATEX , . -
- . \clearpage.
, , .
, . , afterpage,
:
\ a f t e r p a g e {\ c l e a r p a g e }
\afterpage .
suppressfloats
\suppressfloats . t b
.

64

5.

placeins
placeins . \FloatBarrier.
, , .
. (section) [section]
:
\ usepackage [ s e c t i o n ] { p l a c e i n s }
endfloat
, . endfloat
. .

5.4.2. float
. , , \parbox minipage:
\ parbox [ ] { }{}
\ b e g i n { minipage } [ ] { }

\ end { minipage }
,
. ( [c] ),
([t]) ([b]).
:
\ b e g i n { f i g u r e } [ ht ] \ c e n t e r i n g
\ parbox [ b ] { 0 . 4 9 \ t e x t w i d t h }{\ c e n t e r i n g
\ i n c l u d e g r a p h i c s {-1}
\ c a p t i o n {-1}\ l a b e l { f i g : metka 1}}
\ h f i l \ h f i l%
\ b e g i n { minipage } [ b ] { 0 . 4 9 \ t e x t w i d t h }
\ centering
\ i n c l u d e g r a p h i c s {-2}

5.4.

65

\ c a p t i o n {-2}\ l a b e l { f i g : metka2}
\ end { minipage }
\ end { f i g u r e }
\parbox minipage .
.
.
subfig . .
miniplot , subfig, .
figsize
.
dpfloat ,
. .

5.4.3.



,


LATEX

.



,


,



.

. 1.





floatflt wrapfig. , floatflt . 5.1. .
,

CTAN. .
floatingfigure wrapfigure .
\ b e g i n { f l o a t i n g f i g u r e } [ ] { }
...
\ end { f l o a t i n g f i g u r e }
floatingfigure
:
rflt ,
lflt ,
vflt ( ).

66

5.

wrapfigure :
\ b e g i n { w r a p f i g u r e } [ ]
{}{}
...
\ end { w r a p f i g u r e }
floatingfigure wrapfigure
. :
r ,
l ,
i ,
o .
,
, ,
.

, . . ,
, , .

nccfloats ncctools, . . :
\ s i d e f i g ( ) ( )
{\ i n c l u d e g r a p h i c s {}}{}
\sidefig ,
. .
. nccfloats.pdf.

5.4.4.
\caption,
.
. ,
. .
.
\protect. \caption
,
,
.
,
\caption . caption ccaption.
caption.pdf ccaption.pdf .

5.4.

67

\usepackage[russian]{babel}
., .
. , , :
\ usepackage { ccaption }
% : .
\ c a p t i o n d e l i m { . } % !
,
, , .
. mcaption margincap:
\ b e g i n { f i g u r e } [ ht ]
\ b e g i n { margincap }{}
\ i n c l u d e g r a p h i c s {}
\ end { margincap }
\ end { f i g u r e }
,
. mcaption.pdf.


- ,
. ,
. ,
. 100% .

LATEX , , . .
.

6.1.

LATEX .
, . 60
\textwidth , , .
\newlength. . ,
- \setlength:
\newlength{\MyLength}
\setlength{\MyLength}{1cm plus 2.5fill minus 5mm}
\addtolength{\MyLength}{5em}
\lstinline!\MyLength! \the\MyLength.

\MyLength
74.69145pt plus 2.5fill minus
14.22636pt.

70

6.

LATEX -
. plus, minus. TEX
.
\setlength . \addtolength ,
. \the .
LATEX - .
, . ,
(in) 2.54 72.27 (1 pt 0.35 mm).
(cm) (mm). LATEX (bp), (dd), (pc) (cc) , .
LATEX (sp),
1/65536 .
: 1ex x, 1em
M. , ,
. , ,
\quad, \hspace{1em}.
\setlength{\MyLength}{1ex}
x \the\MyLength\par
\Large \setlength{\MyLength}{1ex}
x \the\MyLength

x 3.87405pt

x 6.19771pt

fill . TEX , : fil, fill filll, fil fill filll.


.
,
\settowidth:
\settowidth{\MyLength}{ }
\addtolength{\MyLength}{1em}
\centering
\framebox[1.2\MyLength]{ }\par
\framebox[1.2\MyLength]{ }

6.2.

71

\settoheight , \settodepth .
.
FAQ LATEX:
\ makeatletter1
\newcommand{\ maxwidth }{%
\ i f d i m \Gin@nat@width>\ l i n e w i d t h
\ linewidth
\ else
\Gin@nat@width
\fi
}
\ makeatother
\maxwidth ,
:
\ i n c l u d e g r a p h i c s [ width=\maxwidth ] { }
:
( BoundingBox) .
,
, ,
.

6.2.
, , , (counter). LATEX
:
\newcounter{MyCount}
\setcounter{MyCount}{5}
MyCount \arabic{MyCount},
~\alph{MyCount}, \Asbuk{MyCount}.\par
\addtocounter{MyCount}{1550}
\arabic{MyCount} \Roman{MyCount}.

MyCount 5,
e, .
1555 MDLV.

\newcounter . , ,
1 \makeatletter/\makeatother
LATEX-. @
, .

72

6.

. \setnewcounter, -
\addtocounter.
, - , -
. .
, \arabic{}.
\Roman \roman
. : \alph , \asbuk \Asbuk
.
,
( page), ( part, chapter,
section, subsection, subsubsection . .), (footnote),
( figure table) (equation).

\the . .
, , , , \the-,
, ,
:
\renewcommand{\ t h e p a g e }{\Roman{ page }}
,
:
\newcounter{Main}\addtocounter{Main}{10}
\newcounter{Dep}[Main]\addtocounter{Dep}{10}
: \theMain.\theDep\par
\stepcounter{Main}
: \theMain.\theDep

: 10.10
: 11.0

, . Dep Main. ,
(Main) \stepcounter, (Dep) .
(section).
chngcntr ltxmisc
. \counterwithin{Dep}{Main} Dep Main. \counterwithout{Dep}{Main}.
chngcntr.sty.

6.3. . . .

73

\refstepcounter{} \stepcounter ,
, \refstepcounter , \ref, , \the-:
% " "
\ newcounter { Problem } [ s e c t i o n ]
\renewcommand{\ theProblem }{\ t h e s e c t i o n . \ a r a b i c { Problem }}
\ newenvironment { Problem } [ 0 ] {%
\ par \ r e f s t e p c o u n t e r { Problem }%
\ theProblem \ , }%
{\ par }%
Problem . Problem
. \theProblem , .
Problem \refstepcounter{}.
:
\begin{Problem}\label{ex:1}

\end{Problem}
\begin{Problem}\label{ex:2}

\end{Problem}
~\ref{ex:1} ~\ref{ex:2}.

6.2.1
6.2.2
6.2.1 6.2.2.

6.3. . . .
. . . , . , ,
.

:
\newcommand{\ e e }{\ ensuremath { e^{+}e ^{}}\xspace}
,
. \ensuremath
:
\(J/\psi\to\ee\)
\ee{}"=.

/ + + -.

\xspace xspace
, ,
.

74

6.

,
:
\newcommand{ } [ N ] [ . . ] { }
\renewcommand{ } [ N ] [ . . ] { }
\ providecommand { } [ N ] [ . . ] { }
\newcommand . ,
. \renewcommand
. \providecommand
, , ,
.
. /,
(1) (9). 4.4
(\(a + b \hm{=} c\)):
\newcommand{\hm} [ 1 ] { # 1 \ nobreak \ d i s c r e t i o n a r y {}%
{\ hbox {$\ mathsurround=0pt #1$}}{}}
(#) .
, , #1.
(*) \newcommand \hm :
\par. .
:
\newcommand{\exmpl}[1][]%
{<< #1>>}
\exmpl{} \exmpl[].

\newenvironment:
\newenvironment{outlined}%
{\hrule\smallskip\begin{center}}%
{\end{center}\smallskip\hrule}
\begin{outlined}
.
\end{outlined}

\newcommand:
\ newenvironment { } [ N ] [ . . ]%
{, }%
{, }

6.3. . . .

reference

75

width

height
depth

width = 238.50941pt

height = 14.39926pt

depth = 4.03355pt

. 6.1. (width), (height) (depth)


, \newcommand, . ,
, . \renewenvironment.

6.3.1.
LATEX TEX, -, , TeX [1] .
,
. , LATEX ,
LATEX--.

6.3.2. calc
calc tools
. calc
:
\theMyCount.\par
\setcounter{MyCount}{\value{MyCount}-1000}
\theMyCount.

1555.
555.

calc \setcounter, \addtocounter, \setlength \addtolength ,


.
\setlength{\MyLength}{
(1em+\widthof{ })*\real{1.2}}
\centering
\framebox[\MyLength]{ }\par
\framebox[\MyLength]{ }

calc \widthof{},
\heightof{} \depthof{} , , .

76

6.

calc, ,
(4mm*2 , 2*4mm ). . \real
, :
\ r a t i o {}{}
calc.pdf.

6.3.3.
xifthen, ifthen. -:
\newcommand{\RusCnt}[1]{%
\ifthenelse{\equal{#1}{1}}{}{}%
\ifthenelse{\equal{#1}{2}}{}{}%
\ifthenelse{\equal{#1}{3}}{}{}%
\ifthenelse{\cnttest{#1}>{3}}{}{}}
\RusCnt{1}, \RusCnt{2}, \RusCnt{3} \RusCnt{4}.

, , .

\ifthenelse ,
, ,
.
1, 2 3
\equal .
, \ifthenelse \cnttest{}{}. calc.
.
, ifthen.
(\value{} )
=, > <.
\isodd{ } ?
\isundefinedcommand{ } ?
\equal{ 1}{ 2} ?
\boolean{ } ?
\lengthtest{ 1 = 2} ? > <.

6.3. . . .

77

\( \) , \AND , \OR
\NOT .
xifthen .
\isnamedefined{ } ?
\isempty ?
\isequivalentto{ 1}{ 2} ?
\cnttest{ 1}{ 2} calc- .
\dimtest{ 1}{ 2} calc- .
. xifthen.pdf.
ifthen \whiledo:
\def\Source{ , , }
\whiledo{\not\equal{\Source}{}}
{ \GetTokens{TokenOne}{TokenTwo}{\Source}%
\fbox{\TokenOne}%
\let\Source\TokenTwo}

,
, , .
\GetTokens tokenizer,
. . , , .
tokenizer.pdf.


- ,
.
.

.
. , , , ,
.
,
.
() , ,
, , . ,
,
.
, . , LATEX
, . , ,
, , .

7.1.
. 7.1 \layout
. .

80

7.

10

11

1
1
3
5
7
9
11

+ \hoffset
\oddsidemargin = 17pt
\headheight = 17pt
\textheight = 595pt
\marginparsep = 12pt
\footskip = 47pt
\hoffset = 0pt
\paperwidth = 597pt

2
4
6
8
10

+ \voffset
\topmargin = -25pt
\headsep = 20pt
\textwidth = 418pt
\marginparwidth = 59pt
\marginparpush = 6pt ( )
\voffset = 0pt
\paperheight = 845pt

. 7.1. scrartcl a4paper ( \layout layout)

7.1.

81

. ,
( ).
. ,
.
, . . 7.1
1 ).
2
(

. . \hoffset \voffset (
),
.
, .
7 \textwidth
\texthight
8
. \columnwidth. \linewidth ,
.
3 .
\oddsidemargin
.
\oddsidemargin, \evensidemargin.
4
\topmargin
5 , \headheight ,
6
\headsep .

\footskip .
10
\marginparwidth
9 \marginparsep .
: \marginparpush.

7.1.1.
\paperwidth \paperheight.
LATEX (article, book, report letter) , letter. ,
A4 (210 297 ).
a4paper :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , o n e s i d e ] { s c r b o o k }

82

7.

A5 ( A4) a5paper.

7.1.2.

. 7.2. lscape

- .
(, slides).

. 7.3. rotpages

,
landscape lscape. , , 90
. pdflatex
, ( ),
pdftex
- pdflscape.
, ,
portland,
, . \portrait
\landscape . . , .
- 180 1 , rotpages.
1 , , .

7.2.

83

\rotboxpages \endrotboxpages, . ,
. rotpages-doc.pdf

7.2.
, TEX , , LATEX:
article, book, report letter. ,
, . . , scrartcl, scrbook, scrreprt scrlettr
KOMA-Script, , ,
A4. . .
ncclatex ( ) ncc,
TEX.

7.2.1.
, , . - ,
. , , .
, : geometry, vmargin typearea.
 : !
geometry
geometry ,
:
\ u s e p a c k a g e [ h e i g h t =25cm , a 4 paper , hmargin={3cm , 2 cm } ] { geometry }
keyval, 5. ,
calc.
. geometry.pdf
.
, .

84

7.

. , , . ,
.
vmargin
vmargin . :
\ s e t p a p e r s i z e [ ] { }
: A0, A1, . . . , A9, B0, B1, . . . , B9, C0, . . . , C9, USletter, USlegal
USexecutive. landscape
( ) portrait ( ).
custom :
\ s e t p a p e r s i z e { custom }{}{}
,
:
%
\ s e t m a r g i n s { }{ }%
{ }{ }%
{}{}%
{}{}%
%
\ s e t m a r g n o h f { }{ }%
{ }{ }%
%
\ setmarg { }{ }%
{ }{ }%
vmargin : \setmarginsrb,
\setmargnohfrb, \setmargrb. ,
.
vmargin.pdf.
typearea
typearea KOMA-Script , (scrartcl, scrbook . .),

7.2.

85

. , (Jan
Tschichold).
typearea , geometry,
:
\ u s e p a c k a g e [BCOR8 . 2 5mm] { t y p e a r e a }
BCOR (binding correction) , - .
KOMA-Script,
, typearea, :
% KOMAS c r i p t
\ documentclass [ pagesize ] { scrbook }
% 70 100/16
\ s e t l e n g t h {\ paperwidth }{170mm}
\ s e t l e n g t h {\ p a p e r h e i g h t }{240mm}
%
\ a r e a s e t {130mm}{194mm}
pagesize typearea,
, dvi-
( dvips, xdvi ) . , ,
.
, 5773-90, , (, A1, A2,
A3, A4 ). \paperwidth
\paperheight . typearea \areaset,
, .
KOMA-Script (scrguien.pdf)
Construction of the Page Layout with typearea.
.
typogrid
, , typogrid, . ,
draft, final .

86

7.

, , columns=. 12.

7.2.2.
, .
.
.
:
\ p a g e s t y l e { }
,
\thispagestyle{ }.
:
empty
- .
plain
.
headings ,
.
,
. fancyhdr, 12.2 166,
.

7.2.3.
- A5 PostScript A4,
psutils, , :
> c a t . ps | psbook | psnup 2 > . ps
psbook ,
, psnup -2 . PostScipt . -
, , , ,
, pstops.

pdf-, , Adobe Reader kpdf , . pdf-
pdfpages, pdf- pdf-.

7.2.

87

twoup
twoup . booklet, , psbook.
twoup
booklet twoup:
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt ] { s c r b o o k }
\ usepackage [ p r i n t ] { booklet }
\ u s e p a c k a g e {twoup}
print .
dvips, ,
:
> d v i p s T 2 9 . 6 cm , 2 1 . 0 cm dvi-

pgfpages
pgfpages pgf , . pgfpages TEX
, TEX. pgfpages ,
.
, :
%
\ usepackage { pgfpages }
\ p g f p a g e s u s e l a y o u t {2 on 1 } [ a 4 paper , l a n d s c a p e ,%
b o r d e r s h r i n k =5mm]
\ b e g i n { document }

\ clearpage

\ end { document }
\pgfpagesuselayout
(2 on 1). :
a4paper
A4,
landscape
,
border shrink=5mm 5 .
pgf (pgfmanual.pdf)
Page Management.

88

7.


,

, - .
. 7.4. (
[11])

. 7.5. xdvi draft

7.3.
, , .
LATEX . , . ,
, , , . 7.4.

7.3.1.
TEX (Undefull)
(Overfull), log- , :
O v e r f u l l \ hbox ( 2 6 . 2 pt t o o wide ) i n paragraph a t l i n e s 4756
[ ] [ ] \T2A/cmr/m/n/12
. geometry . pdf
draft:
\ d o c u m e n t c l a s s [ d r a f t , a 4 paper , 1 2 pt , o n e s i d e ] { s c r b o o k }
. 7.5 .
, LATEX , - . ,
, 3.
\linebreak \\. \linebreak
\\ .

7.3.

89

, ,
.
Note microtype () .
pdflatex, TEX.
T2A, . . microtype.pdf.

7.3.2.
. \hspace.
. *-
\hspace*, ,
, .
:
\quad 1em. \qquad \quad, \endspace \quad.
\hfill . \hfill
, . \hfil.
\hrulefill , \hfill, .
\dotfill, .

7.3.3.
.
\noindent. \indent.
LATEX
: center ( ), flushleft (
) flushright ( ).
.
\begin{center}
.
\end{center}
\flushleft .
\flushright .

.
.
.

. ,

90

7.

, , : \centering ( ), \raggedright2 ( )
\raggedleft ( ).

. ragged2e \RaggedRight,
:
\begin{minipage}[t]{0.48\textwidth}
\raggedright

\end{minipage}\rule[-1.8cm]{0.4pt}{2cm}
\begin{minipage}[t]{0.48\textwidth}
\RaggedRight
.
\end{minipage}

, \RaggedRight, .

7.3.4.
. \newpage \pagebreak. \newpage ,
\pagebreak
.
/ - , :
\newcommand{\ l o n g p a g e }{\ e n l a r g e t h i s p a g e {\ b a s e l i n e s k i p }}
\newcommand{\ s h o r t p a g e }{\ e n l a r g e t h i s p a g e {\ b a s e l i n e s k i p }}
\longpage ,
\shortpage, , . \baselineskip .

7.3.5.
. , ,
2 \raggedright

\flushleft .

7.4.

91

, . .
:
\ c l u b p e n a l t y =10000
\ widowpenalty =10000

7.3.6.
\hspace{}
\vspace{}. \vspace*{}
, ,
.
:
\bigskip , \baselineskip. \medskip \bigskip \smallskip 1/4 \bigskip.
\vfill . \vfill
, . \vfil.

7.3.7.
: ,
.
setspace.
\doublespacing, .
setspace \onehalfspacing \singlespacing
.
spacing:
\begin{spacing}{2.5}
<<

>>.
\end{spacing}

spacing ,
.

7.4.
twocolumn:
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , twocolumn ] { s c r a r t c l }

92

7.

. 7.6 . \twocolumn[].
, , , . \onecolumn,
. .
.
, ,
. 7.6, . balance preprint .
. 7.7.
\balance.
,
. 7.7. ftnright
tools. ,
. ftnright.pdf
 fixltx2e , .
( ,
) , . .
sttools
sttools , . ,
, .
flushend ,
\raggedend \flushend.
cuted strip, , .
strip . 7.8. ,
.
presfull.pdf.
multicol
multicol tools

7.4.
,

1
?
.
. .
. ,
.
,
.

. .

,
, .
86-

.
, ,


.
!
,
.
, :
?
: .
,
,

. ,

93

. 7.6. twocolumn,


.
!
,
.
, :
?
: .


. .
. ,
.
,
.

,
,
. , ,

1 ? .

1.

. .

,
, .
86-

.
, ,

,

. ,
,

1
?
.
. .
. ,
.
,
.

. .

,
, .
86-

.
, ,


.
!
,
.
, :
?
: .
,

1.

. 7.8.
flushend: strip, cuted

. 7.7.
balanced,
ftnright
,
,
.
, , 1
?
.
. .
. ,
.
,
.

. .

,
, .
86-
. , ,
.
!
,
.

, : ? : . -

. 7.9. multicol:
multicols
2

94

7.

.
.
multicols:
\begin{multicols}{3}
[\section*{}]
\RaggedRight
. .
, ,
.
86- "--
.
\end{multicols}

. .

,
,

.
86

 , , , \RaggedRight
( 7.3.3 . 89).
multicols
. , .
,
.
- -
, multicol
\columnbreak.
multicols . , ,
t b.
, . .
multicol.pdf.
parallel
parallel . Parallel:
\ begin { P a r a l l e l }{0.4\ textwidth }{0.5\ textwidth }
\ P a r a l l e l L T e x t { F i r s t they i g n o r e you , then they l a u g h a t you ,
then they f i g h t you , then you win . }
\ P a r a l l e l R T e x t { ,
, . . }
\ end { P a r a l l e l }

7.4.

95

:
First they ignore you, then they
laugh at you, then they fight you,
then you win.

,
, . .

, . \ParallelLText , \ParallelRText, , .
parallel.pdf

LATEX
LATEX
, ,
.
.

, . .
. ,
.

8.1. ?
\documentclass.
:
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt ] { s c r a r t c l }
,
.
cls. TEX Live 2007 208
. ,
.
. .
. , . .

98

8. LATEX

, TEX .
(2007 )
papertex (. 8.1 Ignacio Llopis),
LATEX 1 , , LATEX
.

8.2.
, LATEX (6) : article (), book
paper TeX
(), report (), proc (), letter
First heading. Aenean sem
purus, blandit bibendum,
() slides ().
gravida sed.
c article.

Second heading. Fusce porttitor erat aliquam felis. Integer scelerisque enim at au \section () .
gue.
( abstract).
book
, \chapter (). book
TeX
, .
report book. ,
. 8.1. papertex
, .
proc article,

. letter.
. .
slides .
, ,
.
minimal,
. minimal my papertex edition http://nachollopis.com
XI

This is the caption of the main image on


the front page.

Februarii MMVII k 10:19h

12:34 h First text. Lorem ipsum dolor sit amet, consectetuer


adipiscing elit. In vitae augue. Morbi fermentum, felis accumsan
rhoncus malesuada, metus eros adipiscing dui, vel eleifend nibh velit
ut felis. Pellentesque elementum massa at nisi dapibus mollis. Etiam
cursus. Mauris gravida nibh ut sapien. Vestibulum pretium, felis et.

SECTION A

MAIN INDEX

Second subheading. Facilisis sit amet, elementum nec, interdum


vitae, nunc.

10:23 h Second text. Lorem ip- dui, vel eleifend nibh velit ut felis.
sum dolor sit amet, consectetuer adip- Pellentesque elementum massa at nisi
iscing elit. In vitae augue. Mor- dapibus mollis. Etiam cursus. Mauris
bi fermentum, felis accumsan rhon- gravida nibh ut sapien. Vestibulum
cus malesuada, metus eros adipiscing pretium, felis et.
SECTION B

Third heading. Donec lectus enim, dapibus sit


amet, condimentum non, viverra eu, augue.

Third subheading. Nunc dictum fermentum nunc. Suspendisse


est. Nulla bibendum lacus vel tortor.

10:02 h Third text. Curabitur imperdiet, est

vel commodo eleifend, mi urna vulputate lorem, at


rhoncus diam augue vitae magna. In nisi. Vivamus
elementum blandit sem. Cras sit amet justo. Curabitur diam arcu, elementum commodo, tincidunt
vel, dapibus id, lectus. In egestas nibh nec leo.
Pellentesque ut nisi sed purus rhoncus vehicula.
Donec commodo magna.

TOMORROW
15 k 11 C

Index item 2. Cras feugiat,


arcu a tincidunt ornare, sem
augue mattis erat. p. ??

Index item 3. Sed sit amet


velit. Duis sit amet nunc.
Aenean vehicula commodo est. Aliquam dignissim
tempor enim. p. ??

Index item 4. Curabitur imperdiet, est vel commodo


eleifend, mi urna vulputate
lorem. p. ??

paper

WEATHER FORECAST

TODAY
13 k 9 C

Index item 1. Cras molestie


dui sed lectus. In purus
justo, lacinia sit amet. p. ??

FRIDAY
12 k 6 C

EDITORS
Ignacio Llopis
lloptor@gmail.com

http://nachollopis.com

1 -
, .

8.3.

99

.
, , LATEX ,
.
, . , , .
. , .
,
. , -
.
, , .
:
10pt, 11pt, 12pt . ,
.
a4paper .
, LATEX letter.
draft .
, .
oneside/twoside .
twocolumn .

8.3.
, , , .

8.3.1.
. - ,
extsizes (extarticle, extbook, extletter, extproc, extreport), 10-12pt2 . , -
2 10pt, 11pt 12pt extsizes 8pt, 9pt, 14pt, 17pt
20pt. .

100

8. LATEX

.
(amsart, amsbook, amsproc), .
ntgclass3 , , .
KOMA-Script
KOMA-Script. . ,
( ), -
, , LATEX-. scrartcl, scrbook,
scrlttr2, scrreprt.
KOMA-Script
9pt, 14pt 17pt. ,
, KOMA-Script . . , KOMA-Script .
The KOMA-Script bundle (scrguien.pdf) .

.
. 4 LATEX [10].
ncc
: article ( ), preprint (), book () report ().
: ncclatex.pdf.

8.3.2.
letter LATEX, ,
. . , , . . . , . LATEX
letter.
3 ntgclass (artikel1, artikel2 artikel3),
(boek boek3), (brief ) (rapport1 rapport3).
4 , .

8.3.

101

FAQ LATEX (http://www.tex.ac.uk/faq)


newlfm . lfm letter (), f ax () memoranda ( ).
README .
akletter . lettereng.pdf . KOMA-Script
scrlttr2.
ntgclass brief .
- . , cdpbundl,
.

8.3.3.
,

. ,
1
4
1.1 eskdx . . . . . . . . . . . . . . . . . . . . . . . . . . .
4
, 1.2 . . . . . . . . . . . . . . . . . . . . . . .
4
. 2
5
2.1 . . . . . . . . . . . . . . . . . . . . .
5
,
2.2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
6
2.2.1 . . . . . . . . . . . . . . . . . .
6
5
.
2.2.2 eskdtext . . . . . . . . . . . . . . . . . . . .
8
2.2.3 eskdgraph . . . . . . . . . . . . . . . . . . .
9
2.2.4 eskdtab . . . . . . . . . . . . . . . . . . . . . 10
2.3 . . . . . . . . . . . . . . . . . . . . . . . 11
eskdx,
2.4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
2.5 . . . 14
2.6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.7 , . . . . . . . . . . . . . 18
, 2.8 . . . . . . . . . . . . . . . . . . . . . 18
2.9 . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.10 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.11 . . . . . . . . . . . . . . . . . 19

2.12 . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.13 , , , .. . . . . . . . . . 20
. 3
21
3.1 . . . . . . . . . . . . . . . . . . . . . 21
: eskdtext 3.2 . . . . . . . . . . . . . . . . . . . . . . . . . . 22
3.3 . . . . . . . . . . . . . . . . . . . . . 23
, eskdbtab 3.4 . . . . . . . . . . . . . . . . 24
eskdgraph ,
. eskdx v0.97
eskdx.pdf
.
. 8.2. eskdx
: http://lostclus.linux.kiev.ua/eskdx/.

CTAN- {CTAN}/macros/latex/contrib/eskdx/.
eskdx .
. eskd
. .
.
.
. .
.
. .
.

, .

32

102

8. LATEX

( x). eskd.cls
pscyr6 .
, .
? isov2.cls iso . isoman.pdf
ISO. ISO 10303 iso10303.

8.3.4.
,
book. ,
, .
book
octavo. scrbook KOMA-Script book. .
.
memoir (memman.pdf)
, . , , ,
. .
- , . .
.
(memmanadd.pdf),
.
,
,
sffms .

8.3.5.
, , .
scrreprt KOMA-Script, report.
6

pscyr .
, .
LATEX. .
: ftp://ftp.vsu.ru/pub/tex/font-packs/pscyr/.

8.3.

103

The quest for

The following formula computes 8 correct digits per


iteration (Ramanujan):


1 X ( 41 )n ( 24 )n ( 43 )n
1
2 2(1103 + 26390n)
=
3

n!
(992 )2n+1
n=0

. 8.3. prosper
- (Eli Billauer) LATEX- HiTech- hitec. .
, , . ? 298,
sffms, . manual nassflow
Center for the Automation of Weapon
and Command Systems, Royal Netherlands Navy.

8.3.6.
,
. ,
. seminar
sides .
.
LATEX , - .
prosper (. 8.3) seminar , ,
, pdf. ppr-prv
prosper.
texpower powersem, slides, texpower.
prosper .

104

8. LATEX


, beamer. beamer
(Till Tantau) . .
.
200 .
LyX (http://www.lyx.org) WYSIWYM , .
, powerdot, LyX.
talk, ,
.
.
a0poster,
. , , LATEX . ,
sciposter .

8.3.7.
LATEX. - . , , /, , : http://www.maik.ru/pub/tex/.
LATEX.
, asaetr American Society for Agricultural Engineers
(ASAE). Maple Technical Newsletter mtn.
jpsj2 .
sibjnm.
Elsevier elsart. nature pdf-
Nature. revtex4.
, , , combine.

8.3.8.
curriculum vitae . ,
.

8.3.

105


,
johndoe
europecv.
vita Education
. ,
Master thesis

IT- .
Experience
curve, ,
. curve
Languages
.
morderncv
,
.
. 8.4. moderncv
, , . , .
currvita .
Any intelligent fool can make things bigger, more complex,
and more violent. It takes a touch of genius and a lot of
courage to move in the opposite direction.

20032006

Master of Design, Valparezzo School of Design.


1st year: 79%

20012003

title

2nd year: 84%

3rd year:

(graduation expected in June 2006)

Bachelor of Design, Being Drawing University.

1st year: 63%

2nd year: 76%

On the design of modern curriculum vits

supervisors

Pr P. Picasso and Pr G. Klimt

description

Study of the complex design of a curriculum vit, also known as rsum. In my opinion,
a good design needs to be show the personality of its author. Some people will thus prefer a
more classic style, and others will be more audacious. . .

February 2006
current
20052006

Maintainer of the a CTAN package, CTAN, World.

Maintainer of the moderncv package, meant to ease the production of beautiful curriculum
vits.

Mathematics tutor, UCL, Louvain-la-Neuve.

Supervision of practical sessions for a mathematical course given to second year engineering
students (course FSAB1104: Numerical Methods).
See www.legat-online.be/b2q1/num.

20042006

Cultural project leader, Tchouque-Tschouk Kot, Louvain-la-Neuve.

Leader of a student home with a cultural project, requiring day to day management as well
as the organization of public events.
See www.organe.be.

19992001

IMO preselected, SBPMef, Wpion.

Advanced mathematical training, as Belgian preselected candidate for the International Mathematical Olympiads, selected by the Belgian mathematical society.
See
imo.math.ca/belgium.html.

French
Dutch

English

Native

Near-native

Very good

Primary education degree obtained in a Dutch college


(Sint-Jozefscollege te Sint-Pieters-Woluwe).

Many journeys in English speaking countries, including the United


States,
the United Kingdom and Kenya.

12 somestreet, 3456 somecity T +12 (3)456 78 90 B jdoe@design.org www.ctan.org

8.3.9.
, .
. ,
ucthesis (UC Berkeley).

disser. TEX Live,
{CTAN}/macros/latex/contrib/disser CTAN-. , - .
.

106

8. LATEX

8.3.10.
. , CD (cd), (qcm), (assignment),
(ConcProg), (courseoutline coursepaper), (labbook), (stage), (pecha . 8.5),
(flashcards) .
, .

.y
l,
ig,nx, xm,z
e,d
g,px, cxn,
es,x,i
g,d
g,
e.

im,bdxg,c
ig,lxs,bx, x,
ig,b-
es,t
e.

bdxg,n
i,zxn,zx,
e.

rxb,d
,db
l,
os,px, bzx,bx, dx,.

d
g,px, cxn,
is,bx, x,d
e,
im,
i,nx,d
,btx,bx, dx,.

bdxg,d
e,zxn,d
eo
,zs,nxs,lxs,px, dx,.

bg
o,m
ed,px,i
g,g
o.

in,px

r,xd,nxs,bx, x,d
e,
id,d
e,
im,bdxg,d
ei
,
im,d
,s
o,bx, dx,.

bx, x,
o,gxn,d
,s
o,nxs,
or,r
o..

d
e,nx, bx, x,mx, m
o,nxs,d
es,d
g,px, cxn,lx, x,gx, r
e,
es,xs,px, dx,.

. 8.5. - pecha

d
es,

d
e,nx,
im,

im,

d
es,xs,

page 2

This is the short excerpt from the Brahma Story, taken from the Documentation of the cTibTEX package:


:
, ;
, , ;
, .

? . ? .
, , .
, . ,
.
.
.
.
, . .
(\frametitle).
2040 80.
block, theorem, proof example. .
.

108

9.

9.1. slides
LATEX,

. .
T C ,

(C)
(C)
slides.
T = T C + T (1 C ),
(1)
(C)
T T , C
( J/),

. (C)
T , C
( J/ + (X)).

(T )
(T)
C = C T + C (1 T ).
(2)
, .
. 9.1. slides

. landscape
. slide.
1

\ d o c u m e n t c l a s s [ a 4 paper , l a n d s c a p e ] { s l i d e s }
...
\ b e g i n { document }
\ begin { s l i d e }
\ begin { center }
\ Large
\ end { c e n t e r }
...
\ end { s l i d e }
\end { document }
seminar slides - (1993 .),
( sem-user.pdf)
slide .
- - - , , slide
seminar .

9.2. PDF
PDF (Portable Document Format) Adobe Systems
1993 . 2006 1.7.
2007 PDF 1.7 ISO 32000. PDF-
,

9.2. PDF

109

(, ). PDF
, JavaScript. 1.6 3D ,
, , .
PDF
, :
.
.
. PDF.
. .

9.2.1.
, PostScript- . ghostscript, ps2pdf ,
PDF:
> p s 2 p d f .ps .pdf
PDF tex-
pdflatex. latex , PDF. pdflatex
, pdf (),
png/jpeg (). pdflatex eps-, , MetaPost.
- pdf PostScript, pdftops xpdf .
> p d f t o p s [ e p s ] pdf-
EPS,
-eps.

PDF Type1.
.
, ,
. : ,
, . , ,
.

110

9.

,
Computer Modern ( cm-super).
Type3. cm-super ( TEX Live )
.

9.2.2.
Adobe Reader Ghostscript. - , . Adobe Reader Adobe
Systems. PDF
. , ,
.
Adobe Reader,
, ,
. pdfopen pdfclose ( TEX Live):
> p d f c l o s e f i l e .pdf
# .pdf
> pdfopen f i l e .pdf

Ghostscript .
Ghostscript PDF , . :
. () .
xpdf (http://www.foolabs.com/xpdf/) PDF
, X Window. 3.02, xpdf PDF 1.7. xpdf
, , kpdf .
r. .

9.2.3.
, PDF.
: ,
.
.
hyperref . , manual.pdf.

movie15. : pdflatex, Adobe Reader MS Windows MacOS.

9.3. beamer

111

, , . movie15.pdf.

PDF .
, Mac OS MS Windows, .
, ,
.

9.3. beamer
, , -
. .
beamer ,
slides,
. , ,
, , LATEX.
(Till Tantau)
.
beamer ,
(beameruserguide.pdf)
http://sourceforge.net/projects/latex-beamer. TEX Live
beamer .
beamer pdflatex,
latex + dvips + ps2pdf . , :
\ d o c u m e n t c l a s s [ h y p e r r e f ={u n i c o d e=t r u e } ] { beamer }
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
beamer hyperref .
,
(, unicode=true ),
.
UTF-8,
beamer:
\ d o c u m e n t c l a s s [ u t f 8 ] { beamer }
\ usepackage [ u t f 8]{ inputenc }
. beamer frame.

112

9.

% ( )
\ usetheme { Madrid }
%
\ u s e o u t e r t h e m e { shadow }
\ t i t l e {}
\ d a t e { }
\ a u t h o r {}
\ b e g i n { document }
%
\ b e g i n { frame }
\ titlepage
\ end { frame }

J/e + e Br(J/ e + e )
..

..

J/e + e Br(J/ e + e )

frame t, .
. ,
beamer section.
frame. , , , ,
.
\tableofcontents. , ,
pausesections.
%
\ usetheme { M o n t p e l l i e r }
%
%
\ u s e c o l o r t h e m e { dove }
%
\ s e c t i o n {}
\ s u b s e c t i o n {}
\ b e g i n { frame }
\ f r a m e t i t l e {}
...
\ end { frame }

(J/ e + e ) Br(J/ e + e )

( .)
+

d e e
d

f =



1 n 9 2e + e
3
1 + (1 + cos2 )Imf
M 2 4 M
4



3 e + e
(1 + cos2 )2
11

1 + (1 + cos2 )
Ref +
2 M
12
(1 cos )


13
(3 + cos2 )2 o
2
1+
,
+
4
12
(1 cos )2
M
2

W + M

i
2

!1

ln

W
1

me
2

\frametitle.
\framesubtitle.
 dove,
. ,

9.3. beamer

113

PDG 2007

PDG 2007

e + e e + e / total 6% (DASP-1979)

e + e e + e / total 6% (DASP-1979)
e + e + / total
PDG 2007 0.335 0.007 (2.1%)
BaBar (2004) 0.3301 0.0077 0.0073
2.3% 2.2% ISR
CLEO-c (2006) 0.3384 0.0058 0.0071
1.7% 2.1% ISR.

..

(J/ e + e ) Br(J/ e + e )

..

(J/ e + e ) Br(J/ e + e )

. 9.2. , \pause beamer


, , .
.
.

, .
\pause:
\ begin { itemize }
\ item . . .
%
\ pause
\ item . . .
\ end { i t e m i z e }
. 9.2 , . ,
,
.
 (, 1.7%
), , . , \alert. \alert \emph. , \alert
.
\beamerbutton{} .

114

9.

beamer

beamer

theorem, proof, block enumerate

theorem, proof, block enumerate

()

()

A = B

A = B

A=C

A=C

B=C

. 9.3. 1
beamer

. 9.4. 2
beamer

theorem, proof, block enumerate

theorem, proof, block enumerate

()

()

A = B

A = B

A=B

A=B

. 9.5. 3

. 9.6. 4

beamer < > /.


, . beamer \color<34>
3 4 . . : -3,5-9,12,17- ,
: 3, 5 9, 12, 17 .
beamer .
:
%
\ newtheorem {MyTheorem}{ }
\ b e g i n { frame }
%
\ f r a m e t i t l e { \ t e x t b f { beamer }}

9.3. beamer

115

%
\ f r a m e s u b t i t l e { theorem , p r o o f , b l o c k enumerate }
%
\ b e g i n {MyTheorem } [ ]
% 3 4
\ c o l o r <34>[rgb ] { 1 , 0 , 0 } { \ (A=B\ ) }
\ end {MyTheorem}
%
\ begin { proof }
\ b e g i n { enumerate }
% 2
\ item<2> \ (A=C\ )
% 2
\ item <2> \ (B=C\ )
% 3 4
\ item <3,4> \ (A=B\ ) \ q e d h e r e
\ end { enumerate }
\ end { p r o o f }
% ( 4 , )
\ uncover <4>{ \ beamerbutton { }}
% ( 1 3 )
\ b e g i n { b l o c k }<1,3>{ }

\ end { b l o c k }
\ end { frame }
. 9.39.6 , .
beamer ,
. :
\color{} ;
\includegraphics ;
\item ,
itemize enumerate;
theorem ( 13.7 . 205);
proof. , .
2 QED
(quod erat demonstrandum ). \qedhere
QED , . QED
, , , .

116

9.

beamer , :
\alert{} ;
\only \visible ;
\invisible \only;
\uncover , \only,
, ;
\alt<>{}{ } ;
block . theorem.


. \label.
, \hyperlink :
\ l a b e l { metka }
\ h y p e r l i n k { metka }{}
LATEX-, , \beamerbutton. :
\ h y p e r t a r g e t < >{}{}
,
.


verbatim lstlistings. , frame fragile.
, , :
\ b e g i n { frame } [ f r a g i l e ]
%
\newcommand{\un }{\ uncover }
\newcommand{\ a l }{\ a l e r t }
\ f r a m e t i t l e {An Algorithm For F i n d i n g Primes Numbers . }

9.3. beamer

Users Guide
to the
Beamer
Class

117

An Algorithm For Finding Primes


Numbers.

Till Tantau

Users Guide
to the
Beamer
Class

An Algorithm For Finding Primes


Numbers.

Till Tantau

int main (void)


{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)

int main (void)


{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)
if (is_prime[i])
{

}
return 0;

return 0;
}

Users Guide
to the
Beamer
Class
Till Tantau

An Algorithm For Finding Primes


Numbers.
int main (void)
{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)
if (is_prime[i])
{
std::cout i " ";
for (int j = i; j < 100;
is_prime [j] = false, j+=i);
}
return 0;
}

Users Guide
to the
Beamer
Class
Till Tantau

An Algorithm For Finding Primes


Numbers.
int main (void)
{
std::vector<bool> is_prime (100, true);
for (int i = 2; i < 100; i++)
if (is_prime[i])
{
std::cout i " ";
for (int j = i; j < 100;
is_prime [j] = false, j+=i);
}
return 0;
}
Note the use of std::.

. 9.7. ( Hannover, , )
\ begin { semiverbatim }
\un<1>{\a l <0>{ i n t main ( v o i d ) } }
\un<1>{\a l <0>{\{}}
\un<1>{\a l <1>{ \ a l <4>{s t d : : } v e c t o r <bool >i s_prime ( 1 0 0 , t r u e ) ; } }
\un<1>{\a l <1>{ f o r ( i n t i = 2 ; i < 1 0 0 ; i ++)}}
\un<2>{\a l <2>{ i f ( i s_prime [ i ] ) } }
\un<2>{\a l <0>{ \{}}
\un<3>{\a l <3>{ \ a l <4>{s t d : : } c o u t << i << " " ; } }
\un<3>{\a l <3>{ f o r ( i n t j = i ; j < 1 0 0 ; } }
\un<3>{\a l <3>{
i s_prime [ j ] = f a l s e , j+=i ) ; } }
\un<2>{\a l <0>{ \}}}
\un<1>{\a l <0>{ r e t u r n 0 ; } }
\un<1>{\a l <0>{\}}}
\ end { s e m i v e r b a t i m }
\ v i s i b l e <4>{Note t h e u s e o f \ a l e r t {\ t e x t t t { s t d : : } } . }
\ end { frame }

118

9.


beamer .
. \usetheme. , .
beamer 2007 : AnnArbor,
Antibes, Bergen, Berkeley, Berlin, Boadilla, CambridgeUS, Copenhagen, Darmstadt, Dresden, Frankfurt, Goettingen, Hannover, Ilmenau, JuanLesPins, Luebeck, Madrid, Malmoe, Marburg, Montpellier, PaloAlto, Pittsburgh, Rochester,
Singapore, Szeged Warsaw.
. \usecolortheme. : albatross, beaver, beetle, crane, dolphin, dove, fly, lily, orchid, rose, seagull, seahorse,
sidebartab, structure, whale wolverine.
. \usefonttheme. : professionalfonts, serif, structurebold, structureitalicserif structuresmallcapsserif.
, ,
, . \useinnertheme. : circles,
inmargin, rectangles, rounded.
,
. \useoutertheme. : infolines, miniframes, shadow, sidebar, smoothbars, smoothtree, split tree.

. , ,
.

128 98 . .
Adobe Reader
Page Scaling ( ) Fit
to Printable Area ( ). pgfpages pgf .
.

9.3. beamer

119

\ usepackage { pgfpages }
\ p g f p a g e s u s e l a y o u t { r e s i z e t o } [ a 4 paper ,%
b o r d e r s h r i n k =5mm, l a n d s c a p e ]
A4 5 . ,
:
\ p g f p a g e s u s e l a y o u t {2 on 1 } [ a 4 paper , b o r d e r s h r i n k =5mm]

draft
. . , ( \includeonly):
\ i n c l u d e o n l y f r a m e s { ex 1 , ex 3}
\ frame [ l a b e l=ex 1 ]
{ . }
\ b e g i n { frame } [ l a b e l=ex 2 ]
ex 2 .
\ end { frame }
\ frame { . }
\againframe:
%ex 1
\ a g a i n f r a m e { ex 1}

beamer multimedia.
\movie \sound
. , ,
Adobe Reader MS Windows MacOS.
.
beamer
.
\ animate< >
.
, Adobe Reader
.

10


,
, ,
!
.

. , 3 29.

10.1.
babel. ,
, , , .
babel:
\ usepackage [ english , r u s s i a n ] { babel }
.
: (afrikaans), (english, USenglish, american, UKenglish, british, canadian, australian, newzealand), (basque), (bulgarian), (breton),
(magyar), (hungarian), (uppersorbian),
(galician), (dutch), (greek, polutonikogreek), (danish), (hebrew), (interlingua), (irish), (icelandic), (spanish), (italian), (catalan),

122

10.

(latin), (bahasa), (austrian, german, germanb, ngerman, naustrian), (lowersorbian), (norsk), (nynorsk),
(polish), (portuges, portuguese, brazilian), (russian), (romanian), (samin), (serbian), (slovak), (slovene), (turkish), (ukrainian), (welsh), (finnish), (french, francais, canadien,
acadian), (croatian), (czech), (swedish), (scottish), (esperanto) (estonian).
\selectlanguage:
{\selectlanguage{english}\chaptername{}}
- "--- \chaptername.

Chapter - .

,
, babel.
otherlanguage:
%
"--- ,
, .
"--- . ~\par
%
\begin{otherlanguage}{english}
%
Science is what we understand well enough to
explain to a computer. Art is everything
else we do. Donald~Knuth
\end{otherlanguage}

, ,
. .
Science is what we understand well enough to explain to a computer. Art is
everything else we do. Donald Knuth

\foreignlanguage{}{}. , , :
\foreignlanguage{english}{\chaptername{}} "--, .

, .

otherlanguage*.
, c (russian)
(english), TEX T2A, , T1, , .
, LATEX-,
Unicode, , xelatex.

10.2.

123

babel ,
. ,
, , \iflanguage:
\selectlanguage{english}
\iflanguage{russian}{}{not russian}.\par
\selectlanguage{russian}
\iflanguage{russian}{}{not russian}.

not russian.
.

 babel, , . ,
,
indentfirst. misccorr t2,
babel.

10.2.
. .
LATEX
The Comprehensive LATEX Symbol List. pdf-
symbols-a4.pdf .
,
^ \textasciicircum
~
\textasciitilde

\textasteriskcentered
\
\textbackslash
|
\textbar
{
\textbraceleft
}
\textbraceright

\textbullet

\textdagger

\textdaggerdbl
$
\textdollar
. . . \textellipsis
\textemdash

\textendash

\textexclamdown
> \textgreater
< \textless

\textordfeminine

\textordmasculine

\textparagraph

\textperiodcentered

\textquestiondown

\textquotedblleft

\textquotedblright

\textquoteleft

\textquoteright
\textregistered

\textsection
\textsterling

\texttrademark
_ \textunderscore

\textvisiblespace

124

10.

%
'


\textasteriskcentered

\textbigcircle

\textbrokenbar

\textdagger

\textdblhyphen

\textdiscount

\textinterrobang

\textmusicalnote

\textopenbullet

\textordmasculine

\textperiodcentered
%
\textperthousand

\textquotesingle

\textquotestraightdblbase

\textreferencemark

\textthreequartersemdash
~
\texttwelveudash

(textcomp)
\textbardbl
\textblank
\textbullet
\textdaggerdbl
\textdblhyphenchar
\textestimated
\textinterrobangdown
\textnumero
\textordfeminine
\textparagraph
\textpertenthousand
\textpilcrow
\textquotestraightbase
\textrecipe
\textsection
\texttildelow

(textcomp)
\textdownarrow

\textleftarrow
\textrightarrow

\textuparrow

A
m
|
2


/
6



,

(wasysym)
\hexstar
B
\varhexstar
\ataribox

\bell
\blacksmiley
1
\Bowtie
\brokenvert

\checked
\CheckedBox

\clock
\diameter
L
\DOWNarrow
\frownie

\invdiameter
\kreuz

\LEFTarrow
\lightning
h
\permil
\phone

\pointer
\recorder

\RIGHTarrow
\smiley
2
\Square
\sun
K
\UParrow
\wasylozenge
4
\XBox

10.2.

125

,
$
\$
} \}
{ \}
\dag

\ddag
. . . \dots
\P
\pounds
amssymb
\checkmark r \circledR z \maltese

ASCII-

a
d

A
L

\aa
\dj
\OE

\AA
\L
\oe

\AE
\l
\ss

\ae
\o
\S

SS

\DJ
\O
\SS

10.2.1.

\textbaht

\textcolonmonetary
\textdollaroldstyle

\textflorin

\textnaira

\textwon

(textcomp)
\textcent

\textcurrency
$
\textdong

\textguarani

\textpeso

\textyen

\textcentoldstyle
\textdollar
\texteuro
\textlira
\textsterling

(wasysym)
\currency

\cent

A
C
e

\geneuro
\officialeuro

(eurosym)
B
C \geneuronarrow

\geneurowide

10.2.2.

(textcomp)
\textcircledP
\textcopyleft
\textcopyright
\textregistered \textservicemark \texttrademark

126

10.

10.2.3.
textcomp \newtie,
 a). , (A
A ).
a
\textcircled (

a
A
a
A
A
a
 a
A

\"{A}\"{a}
\^{A}\^{a}
\c{A}\c{a}
\t{A}\t{a}

`a
A`
a
A


a \.{A}\.{a}
\{A}\{a}
A
a \~{A}\~{a}
\{A}\{a}
A

A
. a.
a
A

\d{A}\d{a}
\u{A}\u{a}

Aa
a
A

\k{A}\k{a}
\U{A}\U{a}

a
A
Aa

A
a
a
A

\={A}\={a}
\b{A}\b{a}
\r{A}\r{a}
\v{A}\v{a}

10.3.
, , .
, .
, LATEX
Computer Modern, Type1 cm-super. TEX Live . Computer
Modern ( lh).
Computer Modern (, , )
(. 10.1).
Computer Modern Concrete.
. . Computer Modern Euler . concrete
(. 10.2).
Antykwa Tor
unska . anttor (. 10.3). ,
Euler, euler.
, , . TEX Live .
. Type1 The Font Installation Guide (
fontinstallationguide.pdf).

10.4.

, !!!
Z
(x)2
1

e 22 dx = 1
2 0

. 10.1. Computer Modern

127

, !!!
Z
2
1
(x)
2

e 2 dx = 1
2 0

. 10.2. Concrete Euler

<<, !!!>>
Z
(x)2
1

e 22 dx = 1
2 0

. 10.3. Antykwa Tor


unska Euler
( )

10.4.
, .

10.4.1.
3.3 . 36 , . . , ,
, .
, LATEX, , .
soul
soul :
\so{},
\ul{} \st{}.

,
.

soul . soul ,
, soul
. . soul.pdf.

128

10.

nccstretch
nccstretch ncctools :
\centering
\stretchwith{\,}{\ }

\stretchwith / , , .

\hrule.
\hrulefill :
\rule[]{}{} :
\centering\rule{2pt}{1cm}
\rule[0.5cm]{0.2\textwidth}{1pt}
\rule{0.2\textwidth}{1pt}
\rule[-0.5cm]{0.2\textwidth}{1pt}
\rule[-1cm]{2pt}{1cm}

. 0 (),
.
.

dashrule. nccrules ncctools , .
- mboxfill ncctools.
\mboxfill:
\mboxfill[1.2\width]{\^{}\_\^{}}

_ _ _ _ _ _ _

,
.
, . . \width.
. mboxfill.pdf.

10.4.

129

10.4.2.
TEX . ,
.
\mbox{}.
39
. \mbox . \fbox
, \mbox. . \makebox
\framebox:
\centering
\framebox[\textwidth][l]{\ }

\framebox[0.5\width][c]{\ }

,
.
: l , r , c , s . \width (
), \totalheight ( ), \height ( ) \depth (
). LATEX
, .
\shabox, shadow,
:

\centering\shabox{ }

.
. 252.
:
\ s e t t o w i d t h { }{ }
\ s e t t o h e i g h t { }{ }
\ s e t t o d e p t h { }{ }
, , .

130

10.

minipage
parbox:
\parbox{0.3\textwidth}
{ :}\quad
\begin{minipage}{0.62\textwidth}
.
4 .
, !
\end{minipage}

.
4
:
. ,
!


float . 64.

10.4.3.
. LATEX quote
( ) quatation ( quote
).
,
:
\begin{quotation}
- ,
.
\end{quotation}

,
:
- ,
.

.
, , ,
epigraph. ,
:
\ e p i g r a p h {}{}
, , . .
.
\epigraphwidth \setlength, , :
\ s e t l e n g t h {\ e p i g r a p h w i d t h } { 0 . 3 \ t e x t w i d t h }
(\chapter) , . . \epigraphhead:
\ c h a p t e r { }
\ e p i g r a p h h e a d [ ] { \ e p i g r a p h {}{}}

10.4.

131

, \unitlength.
70. ,
\dropchapter{}.
epigraph.dtx.

10.4.4.
3.3.1 . 37. :
enumerate ,
itemize
,
description .
\item:
\begin{enumerate}
\item ,\label{ex:first}
\item .
\end{enumerate}
\ref{ex:first}\ldots

1) ,
2) .
1. . .

\item . description,
:
\begin{description}
\item[enumerate] "--- ,
\item[itemize] "--- ,
\item[description] "--- .
\end{description}

enumerate ,
itemize ,
description .

, .
. , , enumerate itemize:
1) enumerate
)

A.
2) enumerate
itemize


132

10.

enumerate \item -,
babel :
\renewcommand{\ theenumi }{\ asbuk { enumi }}
.
enumii, enumiii, enumiv .
6.2 . 71.
eqlist
description ,
. ,
eqlist, :
\begin{eqlist*}
\item[enumerate] "--- ,
\item[itemize] "--- ,
\item[description] "--- .
\end{eqlist*}

enumerate ,
itemize
,
description .

eqlist eqlist* , eqlist*


. ,
, \longitem.
eqlist.pdf.
desclist
c eqlist desclist ncctools
\begin{desclist}{\bfseries}
{ \hfill---}[description]
\item[enumerate] ,
\item[itemize] ,
\item[description] .
\end{desclist}

enumerate ,
itemize

description .

desclist , , , ,
, .
desclist.pdf.

10.5.

133

paralist
, ,
, paralist:

\begin{inparaenum}
\item enumerate,
\item itemize
\item description.
\end{inparaenum}

1) enumerate,
2) itemize 3) description.

inparaenum
inparaitem. paralist.dtx.

10.5.
? : ,
, . . . . . .
\section, \subsection, \subsubsection, \paragraph \subparagraph.
.
, , .
\tableofcontents. , tex-, toc.

.
- , - . . 10.4
.
\ d o c u m e n t c l a s s [ 1 0 pt ] { s c r a r t c l }
\ u s e p a c k a g e [ warn ] { mathtext }
\ u s e p a c k a g e [ T2A] { f o n t e n c }
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
\ usepackage [ english , r u s s i a n ] { babel }
\ usepackage { i n d e n t f i r s t }
\ t i t l e { }
\ a u t h o r {. \ ,. ~ }
\ b e g i n { document }
\ m a k e t i t l e {}

134

10.
1.1.
.

1.1.1. - ,
. .

. .

1 2013 .

1.
1.1. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1.1.1. . . . . . . . . . . . . . . . . . . . . . . . . . . .

1
1
2

A.

1.

. .

, , 1.1 1
, .

A.

. 10.4.

\ t a b l e o f c o n t e n t s {}
\ s e c t i o n { }
\ label { sec : section }
.
\ s u b s e c t i o n { }
\ label { sec : subsection }
.
\ s u b s u b s e c t i o n [ ] { , }
\ label { sec : subsubsection }
.
.
\paragraph {}
\ l a b e l { s e c : paragraph }
.
\subparagraph {}
\ l a b e l { s e c : subparagraph }
.
\ s e c t i o n { , }
. .

10.5.

135

\ s e c t i o n { }
\ label { sec : afterwords }
\ a d d c o n t e n t s l i n e { t o c }{ s e c t i o n }{ }
, , ~\ r e f { s e c : s u b s e c t i o n }
~\ p a g e r e f { s e c : s u b s e c t i o n } ,
~ .
\appendix
\ s e c t i o n {}
\ l a b e l { appendix }
\end { document }
\section ,
\subsection . . tocdepth, , :
\ s e t c o u n t e r { t o c d e p t h }{2}
.
\listoffigures
\listoftables.
lof lot.
-
\ a d d c o n t e n t s l i n e { t o c }{ }{ }
.
(toc, lof lot), . , section, subsection
. LATEX
\protect, .
\appendix .
. \appendix
.
( book , , scrbook) \chapter \part .

136

10.

: \frontmatter ( ), \mainmatter (
) \backmatter.
.
( titlepage) :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt ] { s c r b o o k }
...
%
\ makeindex
\ b e g i n { document }
%
\frontmatter
\begin { t i t l e p a g e }

\end { t i t l e p a g e }
\ t a b l e o f c o n t e n t s {}
%
\mainmatter
\ c h a p t e r { 1}
\ l a b e l { cha : c h a p t e r 1}
\ c h a p t e r { 2}
\ l a b e l { cha : c h a p t e r 2}
%
\backmatter
%
\ b i b l i o g r a p h y s t y l e { g o s t 780u}
\ bibliography { b i b f i l e }
%
\ printindex
\end { document }

10.6. ,

137

10.6. ,

- . , -
,
,
.

10.6.1.
. 133, ,
\label. ASCII-.
aux. ,
( \ref) (\pageref), latex .
, xr.
:
\ u s e p a c k a g e { xr }
\ e x t e r n a l d o c u m e n t [EXT]{ e x t e r n a l d o c }
externaldoc.tex.
, , \ref/\pageref,
EXT-. ,
,
- .
. , equation ( ) theorem (), . ( figure)
( tabular). \label
\caption, .
. ,
amsmath \eqref. \ref
\eqref:
\begin{equation}
\label{eq:1}
x_{1,2}=\frac{-b\pm\sqrt{b^2-4ac}}{2a}
\end{equation}
~\ref{eq:1}\par
~\eqref{eq:1}

1,2 =

2 4
2

10.1
(10.1)

(10.1)

138

10.

, ex
. .
, prettyref .
.
%
\newrefformat{eq}{ \No~\ref{#1}}
: \prettyref{eq:1}

: 10.1

\prettyref
(:), .
 . showkeys.
,
.

10.6.2.
\footnote.
.
. , , , .
.
minipage, :
\begin{minipage}{1.0\linewidth}
\footnote{.}
\footnote[26]{ .}.
\end{minipage}

a z .
a .

\footnote .
, \footnote \protect, :
\ s e c t i o n { \ p r o t e c t \ f o o t n o t e { . } }
, , ,
:
\ f o o t n o t e m a r k [ num ]
\ f o o t n o t e t e x t [ num ] { }

10.6. ,

139

num, \footnote,
. footnote.
nccfoots
nccfoots ncctools
:
\begin{minipage}{1.0\linewidth}
\Footnote{$\alpha$}{.}
\Footnotemark{$\beta$}.
\Footnotetext{$\beta$}{ .}
\end{minipage}

.
.

,
.
footmisc
footmisc ( footmisc.pdf)
. :
perpage
;
para

. , ;
side
;
symbol* ;
norule* .
savefnmark
savefnmark .
:
\saveFN ,
;
\useFN .

\footnote{}\saveFN\oldfoot\par
\useFN\oldfoot

a
a
a

140

10.

10.6.3.
, , .
.
endnotes
endnotes ltxmisc.
: \endnote,
\endnotemark \endnotetext.
\addtoendnotes{}. :
\renewcommand{\ notesname }{ }
\ theendnotes
endnotes
endnotes.sty.
pagenote
endnotes pagenote.
%
\ u s e p a c k a g e [ page ] { p a g e n o t e }
\ makepagenote
...
%
\ p a g e n o t e {}
...
\renewcommand{\ notesname }{ }
\ printnotes
page , . continuous.
.
\printnotes
. \printnotes*
, , . \printnotes*

10.6. ,

141

10.6.4.
, , article, .
\marginpar{}. , , ,
. , , , \reversemarginpar,
\normalmarginpar.
marginnote
\marginpar ,
, ,
. marginnote
, :
\ marginnote [ ] { } [ ]
\marginpar, . ,
. marginnote.pdf.
 , . LATEX mparhack
.
changebar
. changebar .
\cbstart \cbend, .
dvips, pdflatex. . changebar.pdf.

10.6.5. WWW-
, , .
\url .

142

10.

url
url www-,
.
WWW- :
\url{http://www.inp.nsk.su/
~baldin/}.

WWW-
http://www.inp.nsk.su/~baldin/.

%, #, , \. ,
\verb : \url!http://www..ru!.
hyperref
hyperref .

. :
% h y p e r r e f
\ u s e p a c k a g e [ u n i c o d e=t r u e ] { h y p e r r e f }
. ,
. .
pdf-, dvi-, ,
xdvi. unicode=true , .
hyperref
manual.pdf.
, : http://www-sbras.nsc.ru/win/docs/TeX/LaTex2e/docs_koi.html.
 hyperref LATEX.

breakurl

pdflatex hyperref www- ,


latexdvipsps2pdf , .
breakurl.
breakurl hyperref . \burl, \url.
WWW-:
\burl{http://www.inp.nsk.su/~baldin/}.

WWW-: http://www.
inp.nsk.su/~baldin/.

10.7.

143

, preserveurlmacro, \url
\burl. breakurl.pdf.

10.7.
. ,
.

10.7.1. FiXme
. , . .
, -
, .
FiXme :
\fxnote
;
\fxwarning ;
\fxerror
;
\fixme
.
.
draft , , :
\ d o c u m e n t c l a s s [ a 4 paper , 1 2 pt , d r a f t ] { s c r b o o k }
, , . draft final
. \listoffixmes
.
\fixme ,
.
fixme. : inline , margin ( ), footnote
index . fixme.pdf.

10.7.2. lineno
lineno .
.
linenumbers.

2
3
4
5

144

3
4
5
6
7
8
9
10
11
12
13

\linenumbers/\nolinenumbers, , , .
. ,
, \setpagewiselinenumbers.
, \switchlinenumbers, * ()
.
: \linelabel{ex:lineno}. \ref 9. hyperref (
).
lineno.pdf.

10.7.3.
LATEX, Linux .
..

LATEX

10.

e-mail: E.M.Baldin@inp.nsk.su
TEX METAFONT, , .. .

. 10.5. draftwatermark

,
,
- ,
draftwatermark.
.
, draftcopy.
DRAFT. dvips,
pdflatex.

.
. 10.5 ,
.
,
:

%
\ usepackage { draftwatermark }
%
\ SetWatermarkScale { 2 . 3 }
%
\ SetWatermarkLightness { 0 . 3 }
%
\ SetWatermarkText {\ t e x t b f { }}

10.7.

145

draftwatermark firstpage, .
0, 1. \SetWatermarkFontSize.
\SetWatermarkAngle{}.
 watermark ncctools , .
bophook, eso-pic wallpaper.

10.7.4.
. ,
.
, ?
\input{ } tex-
. LATEX ,
, \endinput. , \input. .
tex.
, , \include. \includeonly
, .
, . , \include \clearpage, , .
\include:
%
\ input { preheader }
%
\ includeonly {
% intro ,
base ,
% presentation
}
\ b e g i n { document }
\ i n c l u d e { i n t r o } %
\ i n c l u d e { b a s e } %
\ i n c l u d e { p r e s e n t a t i o n } %

146

10.

\ end { document }
\include tex- (
tex ). , .
base.tex.
 \listfiles ,
. .
excludeonly
\includeonly excludeonly , . , .
, , base.tex, \includeonly \excludeonly:
\ i n c l u d e o n l y { i n t r o , base , p r e s e n t a t i o n }
\ excludeonly { intro , presentation }
askinclude
askinclude.

\include. , , .
optional
optional ltxmisc
\opt, :
% v a r i a n t . t e x
\ u s e p a c k a g e [ answer 1 ] { o p t i o n a l }
" .
\ opt { v a r i a n t 1 , answer 1}{\ i n p u t { v a r i a n t 1}}
\ opt { v a r i a n t 2 , answer 2}{\ i n p u t { v a r i a n t 2}}
\ opt {}{ }

10.7.

147

\ opt { answer 1}{\ i n p u t { answer 1}}


\ opt { answer 2}{\ i n p u t { answer 2}}
\AskOption, .
:
\newcommand{\ E x p l a i n O p t i o n s }{ v a r i a n t 1 , v a r i a n t 2 problems ;
answer 1 , answer 2 s o l u t i o n s }
\ AskOption
, :
...
v a r i a n t 1 , v a r i a n t 2 problems ; answer1 , answer2 s o l u t i o n s
S p e c i f y which o p t i o n a l t e x t t o p r o c e s s :
\ UseOption=
:
> l a t e x " \newcommand\ UseOption { answer1 }\ i n p u t { v a r i a n t } "
- Makefile.
optional.sty.

11


, , ,
: . . . .
. .
,

.
.
.
. , . . . , ,
.

11.1.
, LATEX-
. , , . ,
, .
, , ,
.

150

11.

() , ,
. :
( ), 1 ( ), ( ),
( ) ( ).

11.1.
,
.
, , ,
.

. . . .
, ,
. 0.1, .1.
. . . , ..
,
.
, , . .

11.2. tabbing
, ,
tabbing.
1 - . . [11] ,
, , .

11.3. tabular array


\begin{tabbing}
MMMMM \= MMMMM \=
\kill
\textbf{\ } \> \>
\> \> \\

\> \>
\end{tabbing}

151

\\


\=. \kill, , , . ,
\>, \\.
, , .
tabbing
. , , .
LATEX .
, . tabbing
.
LATEX tabbing .
(\) (\ \). / \pushtabs/\poptabs.

11.3. tabular array


LATEX
tabular. array tabular,
, .
\centering
\begin{tabular}[c]{l|ll}
\textbf{\ } & & \\[2mm]\hline
& & \\

& &
\end{tabular}

& .
\\.

152

11.

. .
tabular .
table:
\ b e g i n { t a b l e } [ ht ]
\ c e n t e r i n g%
\ b e g i n { t a b u l a r } [ ] { }

\ end { t a b u l a r }
\ c a p t i o n {}\ l a b e l { tab : metka }
\ end { t a b l e }
. tabular ,
:
t , , ;
c ;
b .
,
.
:
l (left)
;
c (center) ;
r (right) ;
p{} .
.
, :
{n}{ }
n . .
\centering
\begin{tabular}{|*{3}{c|}}
\textbf{} & & \\[2mm]
\hline\hline
& & \\

& &
\end{tabular}

11.3. tabular array

153


|. || . \hline.
.
@{} , . , .
, -
, ,
.
\centering
\begin{tabular}{c||p{2cm}@{$\pm$\ }r|}
\textbf{} & & \\[2mm]
\cline{2-3}
& & \\
\cline{1-1}\cline{3-3}

& & \\ \cline{2-2}


\end{tabular}

,
\ cline { }.
array tools
, tabular, :
m{} , p{},
;
b{} , m{},
.
, array, array.pdf.
tabular .
, :
\centering
\begin{tabular}{r}\hline\hline
\footnote{ }.\\
\hline\hline
\end{tabular}

a .
a

 , ,
, , Publication quality tables in LATEX (booktabs.pdf),
(Simon Fear) booktabs.
, .

154

11.

1.

. 11.1. \caption

1.

. 11.2.
\topcaption topcapt

11.3.1.
(. 5.4.4). ,
, .
, , , .

topcapt, \topcaption,
\caption:
\ b e g i n { t a b l e } [ ht ]
\ t o p c a p t i o n {}\ l a b e l { tab : metka }
\ begin { tabular }
...
\ end { t a b u l a r }
\ end { t a b l e }
topcapt , \caption
. 11.1 11.2 . , :
\ begin { table }
\ s e t l e n g t h {\ a b o v e c a p t i o n s k i p }{0 pt }
\ s e t l e n g t h {\ b e l o w c a p t i o n s k i p }{10 pt }
\ c a p t i o n {}\ l a b e l { tab : metka }
\ begin { tabular }
...
\ end { t a b u l a r }
\ end { t a b l e }

11.3. tabular array

155

11.3.2.
(), , . :
;
.
, , . .
hhline tools \hhline, , .
hhline.pdf . arydshln
. arydshln-man.pdf .
cellspace
:
\begin{tabular}{c}\hline
$\displaystyle
e = 1+\frac{1}{2}+\frac{1}{6}+\cdots
+ \frac{1}{k!} + \cdots $ \\\hline
\end{tabular}

=1+

1
1
1
+ + +
+
2
6
!

cellspace. , ,
:
\begin{tabular}{Sc}\hline
$\displaystyle
e = 1+\frac{1}{2}+\frac{1}{6}+\cdots
+ \frac{1}{k!} + \cdots $ \\\hline
\end{tabular}

=1+

1
1
1
+ + +
+
2
6
!

l, c r Sl, Sc Sr . S, , S{p{3cm}}.

11.3.3.
\multicolumn{n}{ }{}, : \multirow{n}{}{} .

156

11.

\multicolumn:
\centering
\begin{tabular}{|*{3}{c|}}
\textbf{} & & \\[2mm]
\hline\hline
& \multicolumn{2}{c|}{} \\

& &
\end{tabular}

,
, .
\multirow multirow:
\centering
\begin{tabular}{|*{3}{p{1cm}|}}
\textbf{} & & \\[2mm]
\hline\hline
& \multirow{2}{1cm}{} & \\

&
&
\end{tabular}

README .
:
\ multirow { }{}{}
\ multirow { }{}
, , ,
. .
. ,
colortbl:
\centering %
\begin{tabular}{c>{\columncolor{yellow}}cc}
\backslashbox{}{} & & \\
\rowcolor{yellow}
&
& \\

& \multirow{-2}*{} &


\end{tabular}

PP
PP
PP

colortbl .
colortbl.pdf .
\backslashbox{}{}, , slashbox ( CTAN
).
. slashbox.tex.

11.3. tabular array

157

lh makecell.
\makecell, , . .
. (makecell.pdf)
(makecell-rus.tex).

11.3.4.
. ,

.
dcolumn tools :
\centering
\begin{tabular}{|c|l|D{.}{,}{5}|}
0.3141 & 0.3141 & 0.3141 \\
3.141 & 3.141 & 3.141 \\
31.415 & 31.415 & 31.41 \\
\end{tabular}

0.3141
3.141
31.415

0.3141
3.141
31.415

0,3141
3,141
31,41

: D{delim}{output}{nfruc}, delim , ( ), output , delim (, ), nfrac


(
). dcolumn.pdf.
numprint ( numprint.pdf)
. \numprint :
\numprint[\text{}/\text{}]{299792458}\par
\numprint{2.718281828459045}\par
\numprint{6e23}\par
\numprint{+-0.02}

299 792 458 /


2,718 281 828 459 045
6 1023
0,02

,
. numprint n . ,
, .

158

11.

n- numprint:
\centering
\begin{tabular}{|n{3}{4}|n{2}{3}|n{1}{2}|}
0.3141 & 0.3141 & 0.3141 \\
3.141 & 3.141 & 3.141 \\
31.41 & 31.41 & 31.41 \\
314.1 & 314.1 & 314.1 \\
\end{tabular}

0,314 1
0,314 1 0,314 1
3,141
3,141 3,141
31,41
31,41 31,41
314,1
314,1 314,1

rccol , dcolumn, . ,
, . rccol,
rccol.pdf, .
, .
warpcol . warpcol.pdf
, .

11.3.5.
CSV ( . Comma Separated Values , )
, .
csvtools.
csvtools.pdf , , tex-.

11.3.6. tabular
tabularx tools tabular , X.
\centering
\begin{tabularx}{\textwidth}{|D{.}{,}{4}|X|c|}
0.3141 & & 0.3141 \\
3.141\footnote{ tabularx
}
& 3.141 & 3.141
\end{tabularx}

0,3141

3,141a

3.141

0.3141

3.141

a
tabularx

tabularx .
X p{}, ,

11.4.

159

. , X,
. , ,
(tabularx.pdf).
tabulary tabular, array.
.
tabulary.pdf. .
ctable . \ctable, tabular table. \ctable .
ctable.pdf.

11.4.
tabular ,
.

: supertabular longtable, .
,
.
, , , . : supertabular.pdf supertabular longtable.pdf longtable
tools.
longtable supertabular , LATEX.
, .
supertabular supertabular
mpsupertabular,
minipage, .
xtab
, , xtab.
supertabular . xtab mpxtabular,
xtabular ,

160

11.

minipage, ,
.
xtab :
%
\ t o p c a p t i o n { } \ l a b e l { tab : xtab }
%
\ t a b l e f i r s t h e a d {\ h l i n e & \\\ h l i n e }
%
%
\ t a b l e h e a d {\ multicolumn {2}{ c }%
{\ tablename \ \ t h e t a b l e {} " }\\
\ hline
& \\ \ h l i n e }
%
%
\ t a b l e l a s t h e a d {\ multicolumn {2}{ c }%
{\ tablename \ \ t h e t a b l e {} " }\\
\ hline
& \\ \ h l i n e }
%
\ t a b l e t a i l {\ h l i n e \ multicolumn { 2 } { | r | }%
{ }\\ \ h l i n e }
%
\ t a b l e l a s t t a i l {\ h l i n e }
\ begin { center }
\ begin { xtabular }{| l | p{0.5\ textwidth }|}
x t a b u l a r & t a b u l a r .
,
t a b u l a r , x t a b u l a r \\
...
\\
\ end { x t a b u l a r }
\ end { c e n t e r }
, , xtab.pdf.

11.5.

161

11.5.
,
. \tableofcontents, \listoffigures \listoftables .
\centering
\begin{tabular}{p{0.7\textwidth}@{}r}
1\dotfill & 2 \\
2\dotfill & 10 \\
3\dotfill & 124
\end{tabular}

1 . . . . . . . . . . . . . . . . . . . 2
2 . . . . . . . . . . . . . . . . . . . 10
3 . . . . . . . . . . . . . . . . . . . 124

\dotfill ( ).
listliketab
listliketab
, .
:
\ s t o r e s t y l e o f { enumerate }
\ begin { l i s t l i k e t a b }
\ newcounter {tabenum }\ s e t c o u n t e r {tabenum }{0}
\newcommand{\ nextnum }{\ a d d t o c o u n t e r {tabenum }{1}\ thetabenum . }
\ b e g i n { t a b u l a r }{L>{\ b f }l@{~~~~}>{\ b f }l@{~~~~}>{\ b f } l }
\nextnum &
& & \\
\nextnum & & & \\
\nextnum & &
& \\
\ end { t a b u l a r }
\ end { l i s t l i k e t a b }
\nextnum .
:
1.
2.

3.
listliketab.pdf

162

11.

11.6. ?
tableaux tabvar
.
 .
!

32

()

() +
&

0 +

+
& &

3
2

tabvar tableaux. tabvar.pdf demo.tex.


, -
. pb-diagram ,
:

9.3%

- 0

65 .

6104
420

6.6103

?
/

5
710-

12%

?
+

50

12

.
, ,
,
, .

, , , .
. , .
- . , - , , , , , ,
.
, .
,
.

164

12. -

12.1.
\tableofcontents (toc-) LATEX . \listoffigures
(lof-) \listoftables (lot-).
, 10.5.
- \addtocontents{toc}{}. toc () lof
( ) lot ( ). ,
\protect,
.
shorttoc

. shorttoc :
\ s h o r t t a b l e o f c o n t e n t s { }{1}
, .
(\section), 1.
, tocdepth.
tocloft
. tocloft , ,
. tocloft.pdf. ,
Z, toc or
lof lot, X part, chap, sec, subsec, subsubsec,
fig, tab . , ,
:
\ a d d t o l e n g t h {\ c f t s e c n u m w i d t h }{1 ex }
,
() :
\renewcommand{\ c f t d o t }{\ ensuremath {\ a s t }}
:
\renewcommand{\ c f t c h a p l e a d e r }{\ c f t d o t f i l l {\ c f t c h a p d o t s e p }}
\renewcommand{\ c f t c h a p d o t s e p }{\ c f t d o t s e p }

12.1.

165

tocbibind
1 . \addcontentsline,
, ,
tocbibind. tocbibind
:
notbib
;
notindex ;
nottoc
;
notlot
;
notlof
;
chapter , , ;
section , , ;
numbib
, ;
numindex , ;
none
, .
tocbibind.pdf.
minitoc
, minitoc
6 .
:
\ d o m i n i t o c %
\ d o m i n i l o f %
\ d o m i n i l o t %
\ t a b l e o f c o n t e n t s %
\listoffigures
%
\listoftables
%
\ c h a p t e r { }
\ m i n i t o c %
\ mtcskip
\ m i n i l o f %
\ mtcskip
\ m i n i l o t %
minitoc.pdf.
1 KOMA-Script bibtotoc
idxtotoc .

166

12. -

12.2.

. ,
myheadings :
\ p a g e s t y l e { myheadings }
\ markboth { }{ }
, \markright,
. fancyhdr.
fancyhdr
,
\pagestyle .
..

..

cxii

fancyheadings

. 12.1. fancyhdr
fancyhdr . : , , , \textwidth,
, ,
( , , ). fancyhdr:
\ usepackage { fancyhdr }
...
\ b e g i n { document }
\ p a g e s t y l e {empty} %
\ p a g e s t y l e { f a n c y } %

12.2.

167

\ l h e a d {. . }
%
\ chead{~\a r a b i c { page}~} %
\ rhead {}
%
%
\ c f o o t {~\roman{ page}~}
\ l f o o t {\ h s p a c e { 0 . 7cm} }
\ r f o o t { \ t e x t b f { f a n c y h e a d i n g s }}
. 12.1. page
.
/ , , :
\ rhead [ ] { }
, , .
, ,
fancyhdr.pdf.
nccfancyhdr
nccfancyhdr ncctools
fancyhdr. nccfancyhdr , fancyhdr. nccfancyhdr.pdf , , ,
, , .
technics
fancyhdr technics.
, . 12.2.
. ,
inputenc. fancyhdr, technics.sty .

168

12. -

. . E.M.Baldin@inp.nsk.su

technics

30 2007 .

2007

. 12.2. technics

12.3.
. .
. -, , -, , -,
.
.

\ c i t e [ ] { }
BibTEX, 12.4, thebibliography:
\ c i t e [ ] { rozenko 2005}.
\ b e g i n { t h e b i b l i o g r a p h y }{9}
\ b i b i t e m { rozenko 2005} ..
\LaTeX . \ newblock : . ~,
2 0 0 5 . 398~ .
\ end { t h e b i b l i o g r a p h y }
\newblock . thebibliography , . ,
10 , , , 9, ,
99 .

12.3.

169

[1, ].


[1] .. LATEX. : .
, 2005. 398 .

. 12.3.
thebibliography.
, compactbib.
.
.
,
aux.
LATEX.
\cite ,
, LATEX [8, 9, 10]:
\ c i t e { L v o v s k i j 2003 , K o t e l n i k o v 2004 , Rozhenko 2005}

.
, breakcites
ltxmisc.
\cite \nocite. \nocite ,
.
 , - :
\ c i t e { 2004}
...
\ b i b i t e m { 2004}
citehack:
\ usepackage { c i t e h a c k }
, , .

170

12. -

file.tex file.bib
.bst
LATEX
.aux BibT X
E
LATEX
.aux

.bbl

.blg

LATEX
. 12.4. LATEX+BibTEX: tex LATEX-, bib , bst , blg log- BibTEX, bbl
, aux

12.4. BibTEX
. - ,
, 7.80-002 7.1-843 . . , , , , www-.
,
, ,
-.
BibTEX,
thebibliography, . BibTEX ,
Google Scholar (http://scholar.google.com/), , http://arxiv.org
BibTEX.
 , BibTEX, Emacs RefTeX JabRef .
2 , 2000 .
, - - .
3 7.1-2003. .

12.4. BibTEX

171


[1] . , . , . . LATEX
LATEX 2 : . . . : , 1999. 606 . ISBN: 5-03003325-4.
[2] . . . LATEX. . : , 2003.
448 . ISBN: 5-94057-091-7. 3- ., . .
[3] . . , . . . LATEX -. : , 2004. 496 . ISBN: 5-87550-195-2. 3- ., .
.
[4] . . . LATEX. / . . . .
: . , 2005. 398 . ISBN: 5-901548-25-6.

. 12.5. , gost2008
 , Emacs Java, gBib KBib Gnome KDE .
bibtex2html html-. ,
.
, BibTEX
bib. \bibliography
LATEX-, :
\ b i b l i o g r a p h y s t y l e {}
\ b i b l i o g r a p h y { bib- }
:
> l a t e x mybook . t e x
> b i b t e x mybook
> l a t e x mybook . t e x
, bib- , aux latex.
LATEX .
plain . . , bibtex

172

12. -

bibtex8, --csfile
4 .
unsrt . plain .
alpha . . .
abbrv . ,
. plain.
. BibTEX,
7.0.5-2008 ( . .), 7.1-2003 ( . .
.), 7.80-2000 ( . . .), 7.112004 ( , .
.
) 7.83-2001 ( .
.): gost2003s/gost2008s, plain, gost2003/
gost2008, unsrt.
texmf-dist/doc/bibtex/gost gost.pdf,
gost2003.pdf gost2008.pdf.
, LATEX,
BibTEX-. TEX Live 2012 350
.
:
@book{ Gussens 1999 ,
a u t h o r = {. and . and . } ,
t i t l e = { \LaTeX{ }
\LaTeXe : . . } ,
y e a r = { 1999 } ,
i s b n = {5030033254} ,
p u b l i s h e r = {} ,
a d d r e s s = {. } ,
numpages = { 606 } ,
language = { r u s s i a n } ,
OPTnote = { }
}
4 L
AT X cp866
E
cp866rus.csf. .

12.4. BibTEX

173

at @ .
-. BibTEX ,
5 . , BibTEX .
(BibTEX ).
ritcle . : author, title, journal, year.
: volume, number, pages, month, note, annote.
Book . : author editor, title, publisher, year.
: volume, number, series, address, edition, month, note,
annote.
Booklet . : title. : author,
howpublished, address, month, year, note, annote.
Conference InProceedings , . : author, title. : crossref,
booktitle, pages, year, editor, volume, number, series, address, month, organisation, publisher, note, annote.
Proceedings . : title, year. : booktitle, editor, volume, number, series, address, month,
organisation, publisher, note, annote.
InBook , ,
. : author editor, title,
chapter, publisher year. : volume number, series,
type, address, edition, month, pages, note, annote.
InCollection . : author,
title, booktitle. : crossref, pages, publisher, year, editor,
volume number, series, type, chapter, address, edition, month, note, annote.
Manual . : title. : author, organistaion, address, edition, month, year, note, annote.
PhdThesis . : author, title, school, year.
: address, month, note, annote.
MastersThesis .
PhdThesis.
5 OPT (noteOPTnote),
, .

174

12. -
TechReport . : author, title, institution, year. : type, numer, address, month, note, annote.
Unpublished . :
author, title, note. : month, year, annote.
Misc , .
. : author, title, howpublished, month, year,
note, annote.

. ,
, crossref,
. BibTEX
. ,
author and.
- gost2003/gost2008 gost2003s/gost2008s numpages language
plain. language russian,
ukrainian english .

12.5.
\makeindex. C, , \index:
\ i n d e x { } . . .
\index , ,
, idx.
idx- . idx- ,
. rumakeindex ind.
:
\ i n p u t {ind-}
\printindex makeidx. \printindex LATEX . makeidx
,
.

12.5.

175

file.tex
LATEX

.idx

.tex
LATEX

.ist

MakeIndex
.ind

.ilg

. 12.6. LATEX+MakeIndex : tex LATEX-, idx (), ist , ilg log MakeIndex, ind
rumakeindex , sed
LATEX koi8-r

makeindex.
, , , .
makeindex ( makeindex.dvi)
, ,
. , ,
. xindy (. 12.6).
\index !, ", @ |.
.
\index, " ( ). . 12.7
. .

!:
% 110 111
\ i n d e x { ! rumakeindex }
\index
.

176

12. -


MakeIndex, 110
, 110111
makeindex, . rumakeindex
rumakeindex, 110, 111
xindy, 111
. 12.7.
| . see:
\ i n d e x { ! makeindex | s e e { rumakeindex }}
makeindex see \see, makeidx.
. 12.7
makeindex.
:
% 110
\ i n d e x { | ( }

% 111
\ i n d e x { | ) }
- .
:
% 110
\ i n d e x {MakeIndex@\ t e x t i t { MakeIndex }textbf
@ \index. , .

12.5.

177

splitidx
LATEX
. , . splitidx. mybook.tex
:
%
\ usepackage [ s p l i t ] { s p l i t i d x }
%
\ makeindex
% ( i d x )
\ newindex [ ] { i d x }
% ( aut )
\ newindex [ ] { aut }
...
%
%
\ i n d e x {}
%
\ s i n d e x [ aut ] { }
%
\ p r i n t i n d e x [ aut ]
%
\ printindex [ idx ]
\newindex,
,
. , \sindex
. mybook.idx . . aut
mybook-aut.idx.
:
>
>
>
>

l a t e x mybook . t e x
rumakeindex mybook . i d x
rumakeindex mybookaut . i d x
l a t e x mybook . t e x

178

12. -

,
TEX ,
16. split splitindex.pl,
.
splitidx.pdf.

12.6. xindy
xindy (http://www.xindy.org/) makeindex.
xindy rumakeindex. xindy . xindy makeindex.
xindy ( c see . 176) ,
.
xindy
.
, , . , xindy
6 LATEX. .
, , .
 , xindy,
. .
xindy perl texindy:
> texindy

L r u s s i a n C koi8 r . i d x

idx- . -L
(, belarusian ukrainian), -C
(, utf-8, cp1251 koi8-u).
texindy xindy, .
xdy. , xindy. Lisp.
-M, .
6 xindy GNU/Linux, ,
Debian (Lenny).

12.6. xindy

179

file.tex
LATEX

.glo

xindy

.tex
LATEX

.xdy

.gls

. 12.8. LATEX+xindy : tex LATEX-,


glo (), xdy
, gls
(,
texindy):
:
word-oder . . , -l;
letter-order . -l;
numeric-sort , 7
13. ;
keep-blanks
;
ignore-hyphen ;
ignore-punctuation .
:
page-ranges .
(, 35, 36, 37 38 ), (3538). -r;
book-order . : , ,
.

180

12. -

,
, ,
xindy , ; . ; .

. 12.9.

12.7.
(. 12.9) .
, . , ,
makeidx xindy.
makegloss
\makegloss, ,
\glossary,
\makeglossary. . 12.8 LATEX xindy .
, , makeglos.
makeglos.pdf, makeglos.tex. , .
%
\ u s e p a c k a g e { makeglos }
% g l o
\ makeglossary
...
%
%
\renewcommand{\ g l o s s a r y n a m e }{ }
%
\ a d d c o n t e n t s l i n e { t o c }{ s e c t i o n }{\ g l o s s a r y n a m e }

12.7.

181

% g l s
\ p r i n t g l o s s a r y {}
%
\ g l o s s a r y { : ,

,
}
\ g l o s s a r y { : , }
\ g l o s s a r y { xindy | i s {
, }}
\ g l o s s a r y { xindy | s e e { }}
\ g l o s s a r y { xindy | s e e a l s o { }}
.
, is.
\glossary .
\glossaryname . \glossaryintro,
.
see seealso.
glo- \gsee \galso:
> t e x i n d y . g l o o . g l s M makeglos \
L r u s s i a n C koi8 r

, texindy
-M makeglos.xdy. , makeglos.
.
gloss
gloss BibTEX.
bib-.
:

@gd{gnu ,
word = {} ,
d e f i n i t i o n = { }
}
gnu , \gloss. word . . hyperref ,

182

12. -

. definition.
:
%
\ usepackage { g l o s s }
% g l s . aux
\ makegloss
...
%
%
\ g l o s s {gnu}
%
\renewcommand{\ g l o s s n a m e }{ }
%
\ p r i n t g l o s s {|<< bib | }
:
tex-,
BibTEX gls.aux, :
> b i b t e x 8 bib- . g l s
tex- ,
tex- .
. gloss.dvi
nomencl
nomencl .
, ,
.
%
\ u s e p a c k a g e [ r u s s i a n ] { nomencl }
% nlo
\ makenomenclature
...
%

12.7.

183

\ no me n c l a t u r e [W] { \ Warning }{ }
\ no me n c l a t u r e [ E] { \ E r r o r }{}
%
\ printnomenclature
\nomenclature .
, ,
.
.
makeindex
nomencl.ist:
> makeindex . n l o s nomencl . i s t o . n l s

nomencl.pdf.

13

.
, , ,
amsmath:
\ u s e p a c k a g e {amsmath}
, .

13.1.
, amsmath
amsfonts amssymb.

13.1.1.
LATEX .
. ,
.
:
\mathbin . (+),
(), ( );
\mathrel . (>),
(<), (=);

186

13.

\mathop

.
, \sin (sin), \sum ( ), \lim (lim).

:
\mathord . a (),
\zeta (), \to ().
:
\mathopen ;
\mathclose ;
\mathinner . (. . .);
\mathpuct . .

13.1.2.
, LATEX,
The Comprehensive LATEX Symbol List.

pdf- symbols-a4.pdf.

2
3

$
S
8
F
N
s


\aleph
\Box
\Diamond
\emptyset
\forall
\Im
\infty
\nabla
\ni
\Re
\surd
\wp


\angle

\bot

\diamondsuit

\exists

~
\hbar

\imath

\jmath
0

\natural

\partial

\sharp

\top

\backslash
\clubsuit
\ell
\flat
\heartsuit
\in
\mho
\neg
\prime
\spadesuit
\triangle


\mathdollar
. . . \mathellipsis
\mathparagraph
\mathsterling
\mathsection
\mathunderscore
(amssymb)
\backprime
k
\Bbbk
i \beth
\bigstar
 \blacklozenge
 \blacksquare
\blacktriangle
H \blacktriangledown r \circledR
\circledS
{
\complement
k \daleth
\diagdown
 \diagup
\eth

13.1.
`
}
@
O
2

\Finv
\hslash
\nexists
\triangledown

187
\Game
\lozenge
\sphericalangle
\varnothing

]

M

\gimel
\measuredangle
\square
\vartriangle

(wasysym)
\Box
3 \Diamond
 \varangle
\wasytherefore


(Re) (Im)
(\Re) (\Im) .
:
\renewcommand{\Re}{\ t e x t {Re}}
\renewcommand{\Im}{\ t e x t {Im}}

13.1.3.
, .
,
. fixmath was
.
was upgreek,
.

\beta
\gamma
\varepsilon \zeta
\vartheta
\iota
\mu
\nu
\pi
\varpi
\sigma
\varsigma
\phi
\varphi
\omega
\Gamma
\Lambda
\Xi
\Upsilon
\Phi

\alpha
\epsilon
\theta
\lambda
o
\varrho
\upsilon
\psi
\Theta
\Sigma
\Omega

(amssymb)
\digamma \varkappa

\delta
\eta
\kappa
\xi
\rho
\tau
\chi
\Delta
\Pi
\Psi

188

13.

\upalpha
\upepsilon
\uptheta
\uplambda
\uppi
\upsigma
\upphi
\upomega
\Uplambda
\Upupsilon

(upgreek)
\upbeta
\upgamma
\upvarepsilon \upzeta
\upvartheta
\upiota
\upmu
\upnu
\upvarpi
\uprho
\upvarsigma
\uptau
\upvarphi
\upchi
\Upgamma
\Updelta
\Upxi
\Uppi
\Upphi
\Uppsi

\updelta
\upeta
\upkappa
\upxi
\upvarrho
\upupsilon
\uppsi
\Uptheta
\Upsigma
\Upomega

13.1.4.
, , :

\acute{a}
\dot{a}
\hat{a}

\bar{a}

...

\ddot{a}
\mathring{a}

\breve{a}
\dddot{a}
\tilde{a}

\check{a}
\grave{a}
\vec{a}

amsxtra
, :

A\spcheck
A\sphat

A\spdot
.. A\spddot
A\sptilde

...

A\spdddot

, , :
, , `

. amsmath

.
amsfonts :
\[\begin{split}
&\widehat{\text{}}\\
&\widetilde{\text{ }}
\end{split}\]

,
.

13.1.

189

\overleftarrow{abc}

\overrightarrow{abc}
\underline{abc}

\overline{abc}
\overbrace{abc}
\underbrace{abc}

cancel \cancel, \bcancel \xcancel,


, . . \cancelto{}{},
, :
(2(
2
=(
5
(
X2 XX
X
2 = 22

\begin{align*}
&\cancel{2\times2=5} &\xcancel{2+2=3}\\
&\bcancel{2^2=22}
&\cancelto{5}{2+3}
\end{align*}

h
h2(
(
h
2+
=(
3
(
h
5
:

2+
3


13.1.5.
:

\cdotp
\ldotp

...

\cdots
\ldots

:
..
.

\colon

..

\ddots

\vdots

[11] ,
, , \ldots.
.
\cdots. .
\[\begin{split}
&a_1+a_2+\ldots+a_n\\
\text{ \ \ } &a_1, a_2,\ldots,a_n,\\
\text{ !\ } &a_1a_2\cdots a_n
\end{split}\]

1 + 2 + . . . +
1 , 2 , . . . , ,
! 1 2

 amsmath \dots
, \ldots \cdots.

190

13.

13.1.6.
, . , ()
(-), , .
textcomp :
(textcomp)
\textdegree
\textdiv
\textfractionsolidus \textlnot
\textminus
\textonehalf
\textonequarter
\textonesuperior
\textpm
\textsurd
\textthreequarters
\textthreesuperior
\texttimes
\texttwosuperior

13.1.7.
(+)
() .


\amlg
* \ast *
\bigtriangledown \bigtriangleup
\cap

\cdot
\cup
\dagger
\diamond
\div
\mp
\odot
\oplus
\oslash
\pm
 \rhd
\sqcap
\sqcup
\times
\triangleleft
\unlhd
 \unrhd
\vee
\wedge

\bigcirc
\bullet
\circ
\ddagger
\lhd
\ominus
\otimes
\setminus
\star
\triangleright
\uplus
\wr

(amssymb)
Z \barwedge
\boxdot
\boxminus
 \boxplus
 \boxtimes
e \Cap

\centerdot
~ \circledast
} \circledcirc
 \circleddash
d \Cup
g \curlyvee
f \curlywedge
> \divideontimes
u \dotplus
[ \doublebarwedge | \intercal
h \leftthreetimes
n \ltimes
i \rightthreetimes o \rtimes

13.1.
r

\smallsetminus

191
Y

\veebar

(wasysym)
 \lhd
 \LHD
# \ocircle
 \rhd
 \RHD
 \unlhd
 \unrhd

13.1.8.

\approx
\cong
\equiv
\mid
\perp
\sim
\succ

\geq
\ll

\sqsubseteq
\supset

/
u
w
m
2
P
t


\asymp

\dashv
\frown
|= \models
\prec
\simeq
\succeq

.
=


\gg

= \neq

\sqsupseteq
\supseteq


\ne
< \not<
>

\not\approx
\not\asymp

=
\not\equiv
\not\ge

\not\ne
\not\preceq

\not\prec
\not\propto

\not\simeq
\not\sqsubseteq
\not\succ
\not\succeq

\not\supset
\not\supseteq

\notin

\bowtie
\doteq
\preceq
\parallel
\propto
\smile
\vdash
\leq

\subset
\subseteq
\not>
\not\cong
\not\le
\not\perp
\not\sim
\not\sqsupseteq
\not\subset
\not\subseteq

(amssymb)
\approxeq

\backepsilon
v \backsim
\backsimeq

\because
G
\between
\Bumpeq
l \bumpeq
$ \circeq
\curlyeqprec
3 \curlyeqsucc
+ \doteqdot
\eqcirc
; \fallingdotseq
( \multimap
\pitchfork
w \precapprox
4 \preccurlyeq

192

13.
q
v

\precsim
\shortparallel
\succapprox
\therefore
\varpropto
\Vvdash

:
a
<

1
>

'

(amssymb)
\eqslantgtr
0 \eqslantless
= \geqq
\geqslant
\ggg
 \gnapprox
\gneq
\gneqq
 \gnsim
\gtrapprox
m \gtrdot
R \gtreqless

T

/

\gtreqqless
\gvertneqq
\lessapprox

5
l

\gtrless
\leqq
\lessdot

&
6
Q

\gtrsim
\leqslant
\lesseqgtr




\lesseqqgtr
\lll
\lneqq
\ngeq





\lessgtr
\lnapprox
\lnsim
\ngeqq

\lesssim
\lneq
\lvertneqq
\ngeqslant

\ngtr
\nleqslant

\nleq
\nless

\nleqq

*
<
j
c
%
!

(amssymb)
\nsubseteq
+ \nsupseteq
# \nsupseteqq
\sqsubset
= \sqsupset
b \Subset
\subseteqq
( \subsetneq
$ \subsetneqq
\Supset
k \supseteqq
) \supsetneq
\supsetneqq
\varsubsetneq
& \varsubsetneqq
\varsupsetneq
' \varsupsetneqq

/

3


(amssymb)
\ncong
\nmid

\nparallel
\nprec
 \npreceq
.
\nshortmid
\nshortparallel  \nsim
 \nsucc
\nsucceq
2
\nvDash
0 \nvdash
\nVDash
 \precnapprox
 \precnsim
\succnapprox
 \succnsim

J
6
7

(amssymb)
\blacktriangleleft
I \blacktriangleright
\ntriangleleft
5 \ntrianglelefteq
\ntriangleright
4 \ntrianglerighteq

\risingdotseq
\smallfrown
\succcurlyeq
\thickapprox
\Vdash

p
`
%

\shortmid
\smallsmile
\succsim
\thicksim
\vDash

13.1.

193

E
D
B

\trianglelefteq
\trianglerighteq
\vartriangleright

,
C

?
1
<

(wasysym)
\apprge
> \apprle
 \invneg
\Join
; \leadsto
 \logof
\sqsubset
= \sqsupset
 \wasypropto

\triangleq
\vartriangleleft

13.1.9.


x
L99




W
#


\Downarrow
\hookleftarrow
\leadsto
\Leftarrow
\leftharpoonup
\leftrightarrow
\Longleftarrow
\Longleftrightarrow
\Longrightarrow
\mapsto
\nwarrow
\rightarrow
\rightharpoonup
\searrow
\uparrow
\updownarrow

\downarrow
\hookrightarrow
\leftarrow
\leftharpoondown
\Leftrightarrow
\longleftarrow
\longleftrightarrow
\longmapsto
\longrightarrow
\nearrow
\Rightarrow
\rightharpoondown
\rightleftharpoons
\swarrow
\Uparrow
\Updownarrow

(amssymb)
\circlearrowleft

\circlearrowright
\curvearrowleft
y
\curvearrowright
\dashleftarrow
99K \dashrightarrow
\downdownarrows

\downharpoonleft
\downharpoonright

\leftarrowtail
\leftleftarrows

\leftrightarrows
\leftrightharpoons
! \leftrightsquigarrow
\Lleftarrow
"
\looparrowleft
\looparrowright

\Lsh
\rightarrowtail

\rightleftarrows
\rightleftharpoons

\rightrightarrows
\rightsquigarrow

\Rsh

194

13.



:
<
;




\twoheadleftarrow
\upharpoonleft
\upuparrows


\nLeftarrow
8
\nLeftrightarrow
=
\nRightarrow
9

\twoheadrightarrow
\upharpoonright
(amssymb)
\nleftarrow
\nleftrightarrow
\nrightarrow

- (amssymb)
\overleftrightarrow{abc}
\underrightarrow{abc}

\underleftarrow{abc}
\underleftrightarrow{abc}

\xrightarrow{abc}

(amssymb)
\xleftarrow{abc}

13.1.10.
4.3.9 . 54 . LATEX -.

(
]

(
]


)
[
(
)
)
[
{
}
]
{
\{
}

\backslash

\Downarrow

\langle

\lfloor

\rangle

\rfloor
\uparrow

\updownarrow \Updownarrow

[
\}
\downarrow
\lceil
\rceil
\Uparrow

(amssymb)

\lvert
\lVert
|
\rvert
\rVert

\llcorner

\ulcorner

\urcorner

\lrcorner

13.2.

195

13.1.11.
T\

JK

NO
U]

V^
R

QY


S[
\bigcap
\bigcup
LM
\bigodot
\bigoplus
FG
\bigotimes
\bigsqcup
W_
\biguplus
\bigvee
`a
\bigwedge
\coprod
I
H
\int
\oint
X
P
\prod
\sum

(amsmath)
ZZ
ZZZ
RR
RRR
\iint
\iiint
ZZZZ
Z
Z
RRRR
R
R
\iiiint

\idotsint

13.2.
, ,
4.3.7 . 52, . 13.1.11 ,
.
commath
commath ( commath.pdf.) , .
\[\begin{split}
&\dif{x}\quad \Dif{X}\\
&\od{f}{x}\quad \od[2]{f}{x}\\
&\pd{f}{x}\quad \pd[2]{f}{x}\quad
\md{f}{5}{x}{2}{y}{3}\\
&\eval[0]{f(x)}_{x=0}\quad
\eval[2]{f(x)}_{x=0}\quad
\eval{f(x)}_{x=0}\\
&\fullfunction{f}
{\mathbb R}{\mathbb R}{x}{\sqrt{x}}
\end{split}\]

dx

DX

df
dx

d2 f
dx2

f
x

2f
x2

5f
x2 y 3

f (x)|x=0
f



f (x)

x=0

R
x




f (x)

x=0

196

13.

esdiff
\frac{\partial^3 f}{\partial x\,\ partial y^2}? , , , esdiff :
\[\begin{split}
&\diff{f}{x}\quad\diff[n]{f}{x}\quad
\diff*{f}{x}{x_0}\quad\diff*[n]{f}{x}{x_0}\\
&\diffp{f}{x}\quad\diffp[3]{f}{x}\quad
\diffp{f}{{x^3}{y^2}}\quad\diffp*{P}{V}{T}
\end{split}\]

df
dx

dn f
dxn

f
x

3f
x3

df
dx

x0

5f
x3 y 2


dn f
dxn x0


P
V T

esdiff.dtx.
esdiff :
text
\textstyle
. \displaystyle;
italic d (). roman;
thin, med big d .
;
thinp, medp bigp , , ;
thinc, medc bigc
\ diffp {f}{{x}{y}}. .
esdiff thinc:
\ usepackage [ thinc ] { e s d i f f }


.
.
wasysym, integrals. euler,
Concrete ( concrete,
10.3 . 126).
\[%
\int\quad\iint\quad\iiint\quad\oint dx
\]

ZZ

ZZZ

dx

13.3. ,

197
w

\[%\usepackage[integrals]{wasysym}
\int\quad\iint\quad\iiint\quad\oint dx
\]

x
Z

\[%\usepackage{concrete}
\int\quad\iint\quad\iiint\quad\oint dx
\]

ZZ

z
ZZZ

dx

dx

13.3. ,

array (. 11.3 . 151).
\[\left(\begin{array}{@{}ccc@{}}
a_{11}&a_{12}&a_{13}\\
a_{21}&a_{22}&a_{23}\\
a_{31}&a_{32}&a_{33} \end{array}\right)
\begin{pmatrix}x_1\\x_2\\x_3\end{pmatrix}=
\begin{pmatrix}b_1\\b_2\\b_3\end{pmatrix}\]

11
21
31

12
22
32


13
1
1
23 2 = 2
33
3
3

array @{} . array matrix


. , .
\begin{gather*}
\begin{matrix}1&2\\3&4\end{matrix}\quad
\begin{pmatrix}5&6\\7&8\end{pmatrix}\quad
\begin{bmatrix}9&A\\B&C\end{bmatrix}\\
\begin{vmatrix}D&E\\F&10\end{vmatrix}\quad
\begin{Vmatrix}11&12\\13&14\end{Vmatrix}
\end{gather*}

1
3

2
4

5
7


10

6
8

11

13

12

14

, ,
\hdotsfor[ ]{ }:
\[\left(\begin{array}{@{}llll@{}}
a_{11}&a_{12}&\ldots &a_{1n}\\
a_{21}&a_{22}&\ldots &a_{2n}\\
\hdotsfor[2.5]{4}\\
a_{n1}&a_{n2}&\ldots &a_{nn}
\end{array}\right)\]

a11 a12
a21 a22

. . . . . .
an1 an2

. . . a1n
. . . a2n

. . . . . .
. . . ann

198

13.

tensor
tensor:
\[\begin{split}
&M\indices{^a_b^{cd}_e}\quad
\tensor[^a_b^c_d]{M}{^a_b^c_d}\\
&\tensor*[^*_*]{\prod\nolimits}{^*_*}\quad
\tensor*{M}{*^{i_1}_{m_1}^{i_2}_{m_2}
^{i_3}_{m_3}^{i_4}_{m_4}}\\
&\tensor*[^{14}_6]{\mathrm{C}}{}\quad
\nuclide[14][6]{C}
\end{split}\]

M ab cde
Y

a c
a c
b dM b d
i1 i2 i3 i4
Mm
1 m2 m3 m4

14
14
C
6
6C

\indeces,
\tensor, . ,
* , .
. \nulide.
tensor.pdf.
amscd
array, CD, amscd1 , .
\[\begin{CD}
F(X)
@V{\eta_X}VV
G(X)
\end{CD}\]

F (f )

@>{F(f)}>>

F(Y) \\
@VV{\eta_Y}V \\
@<<{G(f)}< G(Y) \\

F (X)
F (Y )

X y
y Y
G(X)
G(Y )
G(f )

@>>>, @<<<, @VVV, @AAA , ,


. .
, , , .
, : ,
.
1 amscd -T X, amsmath
E
.

13.4.

199

 amscd ,
, , xypic.

amsmath \binom,
:
( )


( + ) =

\[(x+y)^n=\sum_{k=0}^n\binom{n}{k}x^ky^{n-k}\]

=0

13.4.
LATEX ,
. , ,
(\ partial x\,\ partial y).
.

A B

\(AB\)

A B

\(A B\)

A B

\(A\, B\)

A B

\(A\! B\)

A B

\(A\: B\)

A B

\(A\negmedspace B\)

A B

\(A\; B\)

A B

\(A\negthickspace B\)

\(A\ B\)

A
B

\(A\hspace{5mm}B\)

B
B

\(A\quad B\)

\(A\qquad B\)

\(A\hspace{5mm}B\)

\(A\hphantom{xyz}B\)

A B

\(AxyzB\)

A B
\fbox.

200

13.

\hphantom.
, , . \hphantom
\vphantom \phantom.
\phantom{} ,
, \vhantom ,
.

13.5.
4, , .

, .

, amsmath. , . \allowdisplaybreaks ,
LATEX . \displaybreak,
\\.
 ,
equation equation*:
\begin{equation}\label{eq:ex1}
\fbox{\text{ }}
\end{equation}
\begin{equation*}%
\fbox{\text{ }}
\end{equation*}

(13.1)

align/align*:
\begin{align}
&\fbox{\text{ }}\\
&\fbox{\text{ }}\\
&\fbox{\text{ }}
\end{align}

(13.2)

(13.3)

(13.4)

align \\. &.


- . .

13.5.

201

\begin{align}
x&=\gamma(x-\beta ct) &y&=y\\
ct&=\gamma(ct-\beta x) &z&=z
\end{align}

= ( )

= ( )

(13.5)
(13.6)

align: flalign alignat. alignat , . ,


, 2, 2 2 = 4. , align/align*,
flalign/flalign* , alignat/alignat :
\begin{align*}
x&=\gamma(x-\beta ct) &\quad
ct&=\gamma(ct-\beta x)&\quad
\end{align*}
\begin{flalign*}
x&=\gamma(x-\beta ct) &\quad
ct&=\gamma(ct-\beta x)&\quad
\end{flalign*}
\begin{alignat*}{2}
x&=\gamma(x-\beta ct) &\quad
ct&=\gamma(ct-\beta x)&\quad
\end{alignat*}

= ( )

y&=y\\
z&=z
y&=y\\
z&=z

= ( )

= ( )

= ( )

y&=y\\
z&=z

= ( )

= ( )

=
=

, gather/gather*:
\begin{gather}
\fbox{\text{ }}\\
\fbox{\text{}}\\
\fbox{\text{}}
\end{gather}

(13.7)
(13.8)
(13.9)

multline:
\begin{multline}
\fbox{\text{}}\\
\fbox{\text{}}\\
\shoveleft{\fbox{\text{}}}\\
\fbox{\text{}}
\end{multline}

(13.10)

202

13.

multline, , . , . \shoveleft
, \shoveright, , .
split :
\begin{equation}
\begin{split}
&\fbox{\text{ }}\\
&\fbox{\text{ }}
\end{split}
\end{equation}



(13.11)

split
& align.
 , ,
.
split , . split , .
( centertags amsmath),
amsmath tbtags, , , ,
, ( leqno amsmath).
aligned, gathered alignedat, split, :
\begin{equation}
\begin{aligned}[b]
x&=\gamma(x-\beta ct) \\
ct&=\gamma(ct-\beta x)
\end{aligned}\quad
\begin{gathered}[t]
y=y\\
z=z
\end{gathered}
\end{equation}

= ( )

= ( )

(13.12)

, ,
. :
[c] ( ),
[b] ,
[t] .

13.5.

203


\intertext.
\begin{align}
\begin{cases}
\dot{x}=-R\omega\sin\omega t\\
\dot{y}=\hphantom{-}R\omega\cos\omega t
\end{cases}\\
\intertext{,}
a_{\tau}=0
\end{align}

{
= sin
= cos

(13.13)

,
= 0

(13.14)

\intertext . nccmath \intertext, ,


: \intertext[]{}.
 cases
.
cases
cases
cases ltxmisc numcases :
\begin{numcases}{|x|=}
x, & $x \geq 0$\\
-x, & $x < 0$
\end{numcases}

|| =

> 0 (13.15)

< 0 (13.16)

empheq
mh amsmath. empheq,
, :
\begin{empheq}[box=\shadowbox*]{align}
E&=mc^2 \tag{*}\\
Y&= \sum_{n=1}^\infty \frac{1}{n^2}\notag
\end{empheq}

E = mc2
Y =

n=1

(*)
1
n2

empheq.pdf .

204

13.

13.6.
, * , .
, , .
 ,
. \ref ,
\eqref:

~\ref{eq:num1} ~\eqref{eq:num1}.


13.17 (13.17).


. , ,
leqno, amsmath. .
,
\tag \tag* .
\notag.

\newcommand{\mft}[1]{\fbox{\text{#1}}}
\begin{gather}
\mft{{ \No 1}}\label{eq:num1}\\
\mft{{ \No 2}}\notag\\
\mft{{ \No 3}}\tag{$*$}\label{eq:num2}\\
\mft{{ \No 4}}\tag*{$*$}\\
\mft{{ \No 5}}\tag{\ref{eq:num1}$$}\\
\mft{{ \No 6}}\tag{\ref{eq:num2}$$}
\end{gather}

(13.17)

2
3
4
5
6

(*)
*

(13.17 )
(* )

\tag \ref .


.
- , , , .
, , , deleq. deleq.dvi.
amsmath subequations, .

13.7.
\begin{equation}
\fbox{\text{ \No 1}}
\end{equation}
\begin{subequations}
\label{eq:num3}
\begin{equation}
\label{eq:num3-1}
\fbox{\text{ \No 2}}
\end{equation}
\begin{equation}
\fbox{\text{ \No 3}}
\end{equation}
\end{subequations}\par
~\eqref{eq:num3},

~\eqref{eq:num3-1}.

205

(13.18)

(13.19a)

(13.19b)

(13.19), (13.19a).

, \theequation, :
\renewcommand{\ t h e e q u a t i o n }
{\ t h e p a r e n t e q u a t i o n \ asbuk { e q u a t i o n }}
.
 LATEX
, TEX- LATEX TEX.

13.7.
9.3 . 111,
beamer, \newtheorem:
\newtheorem{Thexmpl}{}
\begin{Thexmpl}[ ]
\label{th:Pythagor}
.
\end{Thexmpl}
\begin{Thexmpl}
\label{th:WisdomLaw}
,
.
\end{Thexmpl}
:
~\ref{th:Pythagor},
: ~\ref{th:WisdomLaw}.

1 ( ).

.
2. ,
.
:
1, : 2.

206

13.

\newtheorem :
\ newtheorem {}{}
\ newtheorem { } [ ] { }
\ newtheorem {}{ } [ ]
.
, .
(, section). .
\newtheorem ,
:
\ b e g i n { } [ ]

\ end {}
 nccthm ncctools , . nccthm.pdf [10].

14


+++ .
+++

-

, . . TEX .
. LATEX
.

14.1.
LATEX . , ,
.
, .
-
.
,
. , -
LATEX .

208

14.

verbatim

verbatim,
.
\verb!!.
\verb ( !),
.
, *.
verbatim tools ,
.
\verbatiminput,
.
, , \verb*/\verbatiminput*
verbatim*. *- ,
(\textvisiblespace).
\begin{verbatim*}
\textbf{verbatim}
\end{verbatim*}

\LaTeX{}

\textbf{verbatim}\LaTeX{}

altt
altt , verbatim,
LATEX , ,
, .
\begin{alltt}
\textbf{altt}
\end{alltt}

\LaTeX{}

altt

LATEX

fancyvrb.
fancyvrb.pdf.
listings
listings .
1 , ,
.
, , , , .
1

listings.pdf.

14.1.

209

listings :
Listing 14.1. listings
\ usepackage { l i s t i n g s }
% listings
\ l s t l o a d l a n g u a g e s { [ LaTeX ] TeX , bash , MetaPost , P e r l , C++,make}
%
\ l s t s e t { l a n g u a g e =[LaTeX ] TeX , %
e x t e n d e d c h a r s=t r u e , %
e s c a p e c h a r =| ,
% | LATEX|
frame=tb ,
%
commentstyle=\i t s h a p e , %
s t r i n g s t y l e =\ b f s e r i e s } %
2 \lstloadlanguages. .
\lstset , . .
, , extendedchars=true3 .
escapechar LATEX
. , , LATEX. , (
|) , . escapechar,
escapechar
.
2 listings 1.3c ( ): ABAP, ACSL, Ada (83, 95), Algol (60, 68), Ant, Assembler (x86masm), Awk (gnu, POSIX),
bash, Basic (Visual), C (ANSI, Handel, Objective, Sharp), C++ (ANSI, GNU, ISO, Visual), Caml
(light, Objective), Clean, Cobol (1974, 1985, ibm), Comal 80, csh, Delphi, Eiffel, Elan, erlang,
Euphoria, Fortran (77, 90, 95), GCL, Gnuplot, Haskell, HTML, IDL (empty, CORBA), inform,
Java (empty, AspectJ), JVMIS, ksh, Lisp (empty, Auto), Logo, make (empty, gnu), Mathematica
(1.0, 3.0), Matlab, Mercury, MetaPost, Miranda, Mizar, ML, Modula-2, MuPAD, NASTRAN,
Oberon-2, OCL (decorative, OMG), Octave, Oz, Pascal (Borland6, Standard, XSC), Perl, PHP,
PL/I, Plasm, POV, Prolog, Promela, Python, R, Reduce, Rexx, RSL, Ruby, S (empty, PLUS),
SAS, Scilab, sh, SHELXL, Simula (67, CII, DEC, IBM), SQL, tcl (empty, tk), TeX (AlLaTeX,
common, LaTeX, plain, primitive), VBScript, Verilog, VHDL (empty, AMS), VRML (97), XML,
XSLT.
3 ,
LATEX .

210

14.
frame=<POSITION>
. t , b , l
r . frame=trbl
. frame= . frame=TRBL,
. .

, listings, lst. \lstinline!! \verb!!.


lstlisting:
\begin{lstlisting}[language=Perl,
frame=tlBR,
caption={ }]
#
if (open(CHECK,"<$file")) {
$cmd=$term->readline
("Overwrite (yes/NO): ");
if (lc($cmd) ne "yes") {die;}
close(CHECK);}

Listing 14.2.
#
i f ( open (CHECK, "< $ f i l e " ) ) {
$cmd=$term>r e a d l i n e
( " O v e r w r i t e ( y e s /NO) : " ) ;
i f ( l c ( $cmd ) ne " y e s " ) { d i e ; }
c l o s e (CHECK) ; }

\end{lstlisting}

, . , language
, , frame
, caption .
\lstinputlisting:
%
\ l s t s e t { numbers=l e f t , l a n g u a g e=MetaPost ,
%
%
b a c k g r o u n d c o l o r=\ c o l o r { y e l l o w } ,
frame=shadowbox , r u l e s e p c o l o r =\ c o l o r { b l a c k }}
%
\ l s t i n p u t l i s t i n g [ f i r s t l i n e =16 , l a s t l i n e =24 ,
emph={ f o r s u f f i x e s , t e x t , bpath } ,
emphstyle ={\ b f s e r i e s \ s c s h a p e } ,
emph = { [ 2 ] f i l l , u n f i l l } ,
emphstyle = { [ 2 ] \ b f s e r i e s \ underbar } ] { i n t r o .mp}
1
2
3

v a r d e f drawshadowed ( expr dx , dy ) ( text t ) =


fixsize (t );
forsuffixes s=t :

14.2. LCD-

211

4
f i l l bpath. s s h i f t e d ( dx , dy ) ;
5
u n f i l l bpath. s ;
6
drawboxed ( s ) ;
7 %
draw p i c ( s ) w i t h c o l o r r e d ; %
8
endfor ;
9 enddef ;
firstline secondline ,
.
. numbers=left .
\color,
. -
, backgroundcolor. emph=< >.
,
. emphstyle
.
, , .
float,
.
. , , \lstdefinelanguage. ,
.

14.2. LCD-
LCD- . , - .
LATEX lcd.
\definecolor{darkgreen}{rgb}{0.22,0.26,0.19}
\definecolor{lightgreen}{rgb}{0.05,0.97,0.55}
\LCDcolors{darkgreen}{lightgreen}
\centering
\LARGE\textLCD{12}|Linux Format|\\[2mm]
\LCDcolors{white}{darkgreen}
\small\textLCD{12}|Linux Format|

\definecolor color. \LCDcolors , \textLCD


LCD- . \textLCD -

212

14.

,
.
, .
\DefineLCDchar. ,
5 7 . ,
, , . ,
.
\DefineLCDchar{yo}{01010000001111110001111001000111111}

. 14.1. LCD
\LCD,
,
, - .
,
.
\DefineLCDchar{yo}{01010000001111110001111001000111111}
\definecolor{lightblue}{rgb}{0.9,0.91,0.99}
\definecolor{darkblue}{rgb}{0.14,0.2,0.66}
\LCDcolors{darkblue}{lightblue}
\LCDframe
\setlength{\LCDunitlength}{1.1mm}
\LCD{2}{4}|LF {yo} |
|zone |

14.3.
,
,
. bytefield.
bytefield:
\ b e g i n { b y t e f i e l d }{ }

\ end { b y t e f i e l d }

14.3.

213

15 16

31

hhhh
h
h
hhhh hhhh
hhhh hhhh
h hh
hhh
hhhh
hh h
hhhh
h
hhhh
hhhhhhhh
hhhhh
h
65.527
14.1. UDP
bytefield \wordbox \bitbox, , :
\ wordbox [ ] { }{}
\ b i t b o x [ ] { }{}
. [lrtb] , : l , r , t b .
\\.
UDP4 :
\ b e g i n { b y t e f i e l d }{32}
\ bitheader {0 ,15 ,16 ,31}\\
\ b e g i n { r i g h t w o r d g r o u p }{ }
\ b i t b o x {16}{ }\ b i t b o x {16}{ }\\
\ b i t b o x {16}{ }\ b i t b o x {16}{ }
\ end { r i g h t w o r d g r o u p }\\
\ wordbox [ l r t ] { 1 } { }\\
\ s k i p p e d w o r d s \\
\ wordbox [ l r b ] { 1 } { 6 5 { . } 5 2 7 }
\ end { b y t e f i e l d }
UDP
\bitheader, \wordgroupr \skippedwords .
\bitheader , , , {0-31}.
rightwordgroup
4 User

Datagram Protocol IP.

214

14.

leftwordgroup ,
, .
.

14.4.
, , . . TEX .
LATEX . , , .
.
algorithms
algorithms , .
. algorithmic. .
\begin{algorithmic}[1]
\IF{\(i\leqslant0\)} \STATE \(i\gets1\) \ELSE
\IF{\(i\geqslant0\)} \STATE \(i\gets0\)
\COMMENT{ ~ }
\ENDIF
\ENDIF
\ENSURE \(i\geqslant0\)
\FORALL{\(\xi \in \mathcal{A}\)}
\STATE \(\mathcal{B}\gets\xi^2\)
\ENDFOR
\RETURN \(\mathcal{B}\)
\end{algorithmic}

1: if 6 0 then
2:
1
3: else
4:
if > 0 then
5:
0 {


}
6:
end if
7: end if
Ensure: > 0
8: for all do
9:
2
10: end for
11: return

, .
1, , 2 ,
.
\STATE . \IF{<>}, \ELSIF{<>}, \ELSE \ENDIF.
\FOR \FORALL,
\ENDFOR. \WHILE{<>}
\ENDWHILE, \REPEAT \UNTILL{<>} \LOOP
\ENDLOOP. \REQUIRE, ,

14.4.

215

, \ENSURE, \RETURN,
\PRINT \COMMENT.
, .
. , . : algorithms.pdf.
algorithmic ,
algorithm,
. algorithm \caption
\label.
algorithms
algorithms algorithmicx.
.
,
. , Pascal, , .
algorithms. algorithm2e. C-.
.
. algorithms.
clrscode
clrscode ,
5 : . , . , . .
.
\begin{codebox}
\Procname{
$\proc{ }$}
\li \For $j \gets 2$ \To $\id{length}[A]$
\li \Do $\id{key} \gets A[j]$
\li $i \gets j-1$
\li \While $i > 0$ and $A[i] > \id{key}$
\li \Do $A[i+1] \gets A[i]$
\li $i \gets i-1$ \End
\li $A[i+1] \gets \id{key}$ \End
\end{codebox}


1
2
3
4
5
6
7

for j 2 to length[A]
do key A[j]
ij1
while i > 0 and A[i] > key
do A[i + 1] A[i]
i i1
A[i + 1] key

5 Introduction to algorithms, Second Edition Thomas H. Cormen, Charles E. Leiserson, Ronald


L. Rivest, Clifford Stein.

216

14.

pseudocode
. (Donald L. Kreher) . (Douglas R. Stinson) Combinatorial Algorithms: Generation,
Enumeration and Search. , : pseudocode. .
,
2005 . .
\begin{pseudocode}{C2F\_}
{\text{}, \text{}}
\PROCEDURE{C2F}{c}
\COMMENT{
$^\circ$$\to$$^\circ$F}\\
f \GETS {9c/5} + 32\\
\RETURN{f}
\ENDPROCEDURE
\MAIN
x \GETS \text{} \\
\WHILE x \leqslant \text{} \DO
\BEGIN
\OUTPUT{x, \CALL{C2F}{x}}\\
x \GETS x+1
\END
\ENDMAIN
\end{pseudocode}

Algorithm 0.1.1: C2F_(, )


procedure C2F(c)
comment: F
f 9c/5 + 32
return (f )
main
x
whilex 6
output (x, C2F(x))
do
x x+1

14.5.
, .
, ,
, .
change log.
:
;
;
;
.

14.5.

217


vhistory
.

Jochen Wertenauer

1.2 29/09/07

()

1.0
1.1
1.2

22/01/04
21/07/07
29/09/07

JW
JW
JW, EMB

owncaptions

. 14.2. vhistory
versionhistory.
\vhEntry:
\ vhEntry {}{}{()}{}
() , . |. :
\ vhEntry { 1 . 1 } { 1 3 . 0 5 . 0 4 } {JW|AK|KL}{ Typos c o r r e c t e d . }
vhistory,
. 14.2.
%
% o w n c a p t i o n s
\ usepackage [ owncaptions ] { v h i s t o r y }
|\ ldots |
%
%
\newcommand{\JW}{ Jochen Wertenauer }
\newcommand{\EMB}{ . }

218

14.

{\renewcommand{\ s e t s e p a r a t o r }{ \and }
\ t i t l e { \ t e x t b f { v h i s t o r y }}
\ a u t h o r {\ v h L i s t A l l A u t h o r s L o n g }
\ d a t e { \ v h C u r r e n t V e r s i o n {} \ vhCurrentDate }
\ maketitle
}
% .
\renewcommand{\ vhhistoryname }{ }
\renewcommand{\ vhversionname }{ }
\renewcommand{\ vhdatename }{}
\renewcommand{\ vhauthorname }{ () }
\renewcommand{\ vhchangename }{ }
%
\ begin { v e r s i o n h i s t o r y }
\ vhEntry { 1 . 0 } { 2 2 / 0 1 / 0 4 } {JW}{ }
\ vhEntry { 1 . 1 } { 2 1 / 0 7 / 0 7 } {JW}{ o w n c a p t i o n s }
\ vhEntry { 1 . 2 } { 2 9 / 0 9 / 0 7 } {JW|EMB}{ }
\ end { v e r s i o n h i s t o r y }
\vhCurrentVersion \vhCurrentDate.
. (. 12.2).
\vhListAllAuthorsLong ,
\newcommand.
 , TEX Live 2007, -
owncaptions, .
21/07/2007 1.3
CTAN ({CTAN}/macros/latex/contrib/vhistory.zip).
vhistory vh_sets_en.pdf.

14.6. LATEX
LATEX- .
.
. Subversion svn,
svn6 .
6 cvs (Concurrent Versions System), rcs rcsinfo.

14.6. LATEX

219

\ u s e p a c k a g e { svn }
\SVN $ Date $
\SVN $Rev$
, \SVN.
Subversion :
> svn p r o p s e t svn : keywords " Date Rev"
> svn commit m " "

svn , commit. Date Rev


.

> svn h e l p p r o p s e t
\SVN $Date$ \SVNDate \SVNTime, .
\SVN $Keyword$, Keyword svn, : \SVNKeyword.
:
\SVN $Date: 2006-11-25 21:02:20 +0600 $
\SVN $Rev: 265 $
\SVNDate\ \SVNTime

25 2006 .
21:02:20
265

\SVNRev

svninfo.
 , LATEX ,
. . ,
. LATEX , , , .

15


,
:
-
, .

LATEX ,
.

15.1.
.
, , , - 1 :
\[\mathbf{p}\psi(\mathbf{x})
\stackrel{\mathrm{def}}{=}
\bra{\mathbf{x}} \mathbf{p} \ket{\psi} =
-i \hbar \nabla \psi(x)\]

def

p(x) = hx| p |i = i~(x)

, , , ,
.
, .
1 \bra \ket braket ltxmisc.
braket.sty.

222

15.

15.1.1.
8.417-2002.
,
, . , , , .
, . \text (. 4.2).
,
. , . :
\(25\,\text{}/\text{}\) (25 /), \(36{,}6^{\circ}\) (36,6 ).
, , : \((1/60)\,\text{}^{1}\), (1/60) 1 .
(\((100.0\pm 0.1)\,\text{}\), (100.0 0.1) )

: \(50\,\text{}\pm1\,\text{}\) (50 1 ).
, , : \(\text{}\cdot\text{}\) ( ).
( ). ,
, .
: /( ), : //, / .
, ( ):
2 1 , 2 . ( ).
, : / ( ).
. : /, : /.

15.1.

223

SIstyle
,
. SIstyle, sistyle.sty.
: \SI , \num ( ) \ang
.
\SI{}{m.kg/(\text{}^3.A)}\quad
\SI{}{(MPa)^{0\pnt 5}}\quad
\SI{}{(MPa)^{\num{0.5}}}\par
$v=\SI{10}{m.s^{-1}}$\quad
$v=\SI{10}{m/s}$\quad
$v=\SI{10}{\tfrac{m}{s}}$\par
\ang{45}\quad \ang{10; 12; 4}

mkg/(3 A) (MPa)0.5 (MPa)0.5


v = 10 ms1 v = 10 m/s v = 10 ms
45 1012 4

\text, .
SIstyle-2.3.pdf ( 2.3 ) ,
.
 SIunits (SIunits.pdf).
unitsdef (unitsdef.pdf) .
units (units.pdf).

15.1.2.

LATEX. ,
, http://arxiv.org2 .
hepparticles
, , (, ) ,
, , , .
2 ,
02/02/2008 461,639 , , ,
.
LATEX-. . , - pdf- PostScript-.

224

15.

hepparticles , :
\begin{itemize}
\item :
\HepParticle{B}{d}{0},
\HepAntiParticle{B}{d}{0}
\item :
\HepGenParticle{q}{d}{},
\HepGenAntiParticle{\ell}{\mu}{}
\item SUSY"=:
\HepSusyParticle{\chi}{1}{},
\HepGenSusyParticle{q}{2}{}
\item :
\HepParticleResonance{J\!/\psi}{1S}{}{\star}
\item :
\HepProcess{\HepParticle{B}{d}{0} \HepTo
\HepParticle{K}{}{-}\HepParticle{\pi}{}{+}}.
\end{itemize}

:
B0d , B 0d
: qd,
SUSY-:
e 1, qe2

: J/(1S)

: B0d K +.

, , \HepProcess \HepTo.
hepparticles.pdf.

, , , ,
.
feyn. ,
feyn.pdf .
feyn:
:
\(\Feyn{fs f gl f glu f fs}\)
:
\[\Diagram{\vertexlabel^a \\
fd \\
& g\vertexlabel_{\mu,c} \\
\vertexlabel_b fu\\
} = ig\gamma_\mu (T^c)_{ab}\]

: kf y
fz
f k
:
a

d g
e

= ig (T c )ab

,c


feynmp feynmf . 1995 .
(Torsten Ohl), , () . LATEX -

15.1.

225

, MetaPost3 .
, + Br(/ + )
:

e+
e + e
e

e+

J/

Bre+ e
e

. 15.1. ( feynmp)
, , . eepsiee.tex:
% e e p s i e e . t e x
\ u s e p a c k a g e { feynmp } %
...
\ b e g i n { f m f f i l e }{ eep s i e e } % mp
\ b e g i n { fmfgraph } ( 1 1 0 , 6 2 ) %
\ f m f l e f t { e i , p i } % ( )
\ f m f r i g h t { eo , po} % ( )
\ f m f l a b e l {$ e^$}{ e i } %
\ f m f l a b e l {$ e^+$}{ p i } % +
\ f m f l a b e l {$ e^+$}{po} %
\ f m f l a b e l {$ e^$}{ eo } %
% ,
\ fmf { f e r m i o n }{ e i , J i , p i }
% ,
\ fmf { f e r m i o n }{ po , Jo , eo }
%
\ f m f l a b e l {$\Gamma_{\ e e }$}{ J i }
%
\ f m f l a b e l {$ Br_{\ e e }$}{ Jo }
%
\ fmf { heavy , l a b e l =$J /\ p s i $}{ J i , Jo }
3 Linux Format , MetaPost . CC-BY-SA 3.0
http://www.inp.nsk.su/~baldin/mpost/.

226

15.

\ end { fmfgraph }
\ end { f m f f i l e }
ei Jo
. .
fmffile mp-, META. ee-psi-ee.mp. ,
eepsiee.tex, :
#
>
#
>
#
>

eep s i e e .mp
l a t e x e e p s i e e . tex
eps eep s i e e .mp
mpost eep s i e e .mp

l a t e x e e p s i e e . tex

mpost MetaPost. mpost LATEX.


xdvi dvi- PostScript pdf.
,
feynmf manual.ps.gz.
isotope
, , , . isotope (
isotope.dtx) \isotope,
:
\isotope{Ra}\quad \isotope[228]{Ra}\quad
\isotope[228][88]{Ra}
\[\isotope[A][Z]{X}\to
\isotope[A-4][Z-2]{Y}+\isotope[4][2]{\alpha}\]

Ra

228

Ra

228
88 Ra

4
4
2 Y + 2

15.1.3.
- ,
, LATEX .
circ ,
, ,
. LATEX
circ . , . circ.

15.1.

227

\ u s e p a c k a g e [ b a s i c , box , gate , o l d g a t e , i c , o p t i c s , p h y s i c s ] { c i r c }
:
basic
: , , , , ;
box
, , ;
gate
;
oldgate , ;
ic
( );
optics ;
physics - .
circuit. \begin{circuit} 0 4.
0. .
\begin{circuit}0
\npn1 {?} B l % .
\frompin npn1C %
\- 1 u
% .
\nl\A1 {$I_C$} u % , A1.
\atpin npn1B
%
\- 1 l
% .
\R1 {510 } l % R1.
\- 1 l
% .
\centerto A1
% A1.
\nl\A2 {$I_B$} u % A2.
\frompin A2b % A2 ()
IB A
IC
\vtopin R1l % R1 ().
\frompin A1t % A2 ()
R1
\- 1 u
% .
\.1
% ( ).
510
\frompin A2t % A2
\vtopin .1
% .
\htopin .1
%
\- 1 u
%
\cc\connection1 {$U_b$} c u % .
\frompin npn1E %
\- 1 d
%
\GND1
% .
\end{circuit}

Ub

circ.dvi.
.

228

15.

timeDiv :
5ms/div

Channel A :
1 V/div

Channel B :
1 V/div

XY
ON

F1

F2

OffsetA
0

. 15.2. ( pst-optic)

OffsetB
0

OffsetC
0

. 15.3.
( pst-osci)

-, pst-circ.
pst-circ-doc.pdf
.
MetaPost makecirc.
MakeCirc-en.pdf

15.1.4.
,
.
circ, PSTricks, pst-optic ( pst-optic.pdf,
pst-optic-examples.pdf). , . 15.2 :
\ t e l e s c o p e [ m i r r o r F o c u s =6, posMirrorTwo =5,yBottom=5]
pst-osci. . 15.3
:
\ O s c i l l o [ a m p l i t u d e 1=3.5 , phase 1=90 , a m p l i t u d e 2=3.5 ,
p e r i o d 1=25 , p e r i o d 2=5 , phase 2=60 , L i s s a j o u s=t r u e ]
, , . ,
, pst-osci.pdf

15.2.

229

15.2.
. . : , ,
. , , ,
, .

15.2.1.
, -
, . .
PSTricks, pst-labo, 15.1.4,
.
\psset{glassType=ballon,
unit=0.5cm,
becBunsen,
pince=true}
\pstChauffageTube[becBunsen,
barbotage]

, , , , ,
pst-labo-docEN.pdf.

15.2.2.
, ,
.
.
LATEX.
:
\(\frac{1}{2}\mathrm{H}_2\mathrm{O}\)
\(3\,\mathrm{Cr}_2\mathrm{O}_7^{2-}\)

1
H O
2 2

3 Cr2 O2
7

, .

230

15.

mhchem
mhchem : mhchem.sty rsphrase.sty.
mhchem \ce \bond, . :
\ u s e p a c k a g e [ v e r s i o n =3]{mhchem}
. ,
, .
\ce -
:

H2 O
H+
AgCl2
Y99+
H2(aq)
(NH4 )2 S
KCr(SO4 )2 12 H2 O
KCr(SO4 )2 12 H2 O
RNO
2
-Cl


\ce{H2O}
Sb2 O3
\ce{H+}
CrO2
4

\ce{AgCl2}
[AgCl2 ]
\ce{Y^{99}+}
Y99+
\ce{H2_{(aq)}}
NO3
\ce{(NH4)2S}

\ce{Sb2O3}
\ce{CrO4^2}
\ce{[AgCl2]}
\ce{Y^{99+}}
\ce{NO3}

\ce{KCr(SO4)212H2O}
\ce{KCr(SO4)2.12H2O}
\ce{RNO2^{.}}
\ce{$\mu\hyphen$Cl}

2 H2 O

\ce{2H2O}

1
2

H2 O

\ce{1/2H2O}

+
227
90Th

C6 H5 CHO

\ce{^{227}_{90}Th+}

\ce{C6H5CHO}

XY
Z

\ce{X=Y#Z}

\bond:
\ce{A\sbond B\dbond C\tbond D}\\
\ce{A\bond{-}B\bond{=}C\bond{#}D}\\
\ce{A\bond{~}B\bond{~-}C}\\
\ce{A\bond{~=}B\bond{~--}C\bond{-~-}D}\\
\ce{A\bond{...}B\bond{....}C}\\
\ce{A\bond{->}B\bond{<-}C}

ABC
D
ABC
D
C
A B
B
C
D
A

ABC
ABC

15.2.

231

 dvi-.
\ce ,
\ce. , .
\centering
\ce{CO2 + C -> 2CO}\\
\ce{CO2 + C <- 2CO}\\
\ce{CO2 + C <=> 2CO}\\
\ce{H+ + OH- <=>> H2O}\\
\ce{$A$ <-> $A$}\\
\ce{CO2 + C ->[\alpha] 2CO}\\
\ce{CO2 + C ->[\alpha][\beta] 2CO}\\
\ce{$A$ ->[\ce{+H2O}] $B$}

CO2 + C 2 CO
CO2 + C 2 CO

CO2 + C

2 CO

H2 O
H+ + OH

CO2 + C
2 CO

CO2 + C
2 CO

+H2 O

rsphrase (Risk and Safety Phrases)


. , . mhchem.pdf.

15.2.3.
TEX . chemtex.
xymtex.
xymtex LATEX
. . ,
. , GUI-, ,
. , xymtex TEX Live
http://homepage3.nifty.com/xymtex/fujitas3/xymtex/indexe.html.
xymtex403b.lzh. ( ) lha.
xymtex texmf :
#
>
#
>
#
>


l h a x xymtex403b . l z h
xymtex
cp r xymtex texmf-local

texhash

232

15.

.
xymtx402403.pdf doc402403. , :
%\ u s e p a c k a g e { xymtexps } %
%\ u s e p a c k a g e { chmstps }
%
%
\ b e g i n {XyMcompd} ( 2 1 0 0 , 1 8 0 0 ) ( 2 0 0 , 0 ) { } { }
\ p y r a n o s e {1 Sa==H; 2 Sb==H; 2 Sa==OH; 3 Sb==H; 3 Sa==OH;
4Sb==HO; 4 Sa==H; 5 Sb==H; 5 Sa==CH$_{3}$;%
1Sb==%
\ r y l ( 8 ==O) { 3 ==%
\ s t e r o i d {3== ( y l ) ; 5A==H; 8B==H; 9A==H;%
{{10}B}==\ l m o i e t y {OHC} ; { { 1 4 }A}==OH;%
{{13}B}==\ l m o i e t y {H$_{3}$C} ; { { 1 6 }B}==OH;%
{{17}B}==\ f i v e h e t e r o v [ e ] { 3 ==O}{4D==O; 1 == ( y l ) }
}
}
}
\ end {XyMcompd}
, , :
O

H3 C
OHC
H
HO
H

H
H

O O
CH3
H

OH

OH

OH

OH

. 15.4.
 GUI- .

15.3.

233

15.3.
,
. , LATEX
. , , texshade, .
AF414973_Fusarium_sporotrichioi
DQ026008_Fusarium_equiseti
AF111054_Fusarium_tricinctum
AF009185_Gibberella_avenacea
044-its1_2006-03-10
121-its1_2006-03-10
027_its1_2006-03-06
090_its1_2006-03-01
025-its1_2006-03-17
026_its1_2006-03-06
consensus

340
.

350
.

360
.

370
.

380
.

390
.

400
.

ACCCTCAAG..CCC.AGCTTGGTGTTGG.GATCTG.TGTGCAA.AC...ACAGT..C...CCC.AAATTGATTGGC
ACCCTCAAG..CTC.AGCTTGGTGTTGGGACTC.GCGGTA.AC..C..CGC.GT...T.CCCC.AAATCGATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTG.CCTTCT.GGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAG..CTC.AGCTTGGTGTTGG.GACTCG.CGGTAAC.CC...GCGTT..C...CCC.AAATCGATTGGC
ACCCTCAAG..CTC.AGCTTGGTGTTGG.GACTCG.CGGTAAC.CC...GCGTT..C...CCC.AAATCGATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAG..CCC.AGCTTTTTGTGGGTGATCTG.TGTGCAA.AC...ACAGT..C...CCC.AAATTGATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTG.CCTTCT.GGCGGTGCCGCCCCCGAAATACATTGGC
ACCCTCAAGccCcCg.G.TTggTGTtGGggatcgGct.tgc.cttCt.ggCggTgccgccCCCgAAATa.ATTGGC

. 15.5. (alignment) Fusarium/Gibberella texshade


texshade . . WWW http://herba.msu.ru/shipunov/software/tex/tex-ru.htm
TEX .

16


;
, .

. , , .

16.1.
, , . ,
, .

verse:
\begin{verse}
\\*
.
\emph{ }
\end{verse}

, \\. (\\),
.

236

16.

verse
verse .
verse.pdf .
\renewcommand{\poemtoc}{subsection}
\poemtitle{}
\settowidth{\versewidth}{ "-- .}
\begin{verse}[\versewidth]
,\\
, ,\\
, ,\\
"--- .
\vin
\vin
\vin
\vin

\\
\\
,\\
.

,\\
,\\
\\
, .\\
\ldots

,
, ,
, ,
.


,
.
,
,

, .
...
. .

\emph{.\,. }
\end{verse}

\poemtoc , . \poemtitle .
\versewidth ,
. verse .
, . \vin .

, .
stage
, , , stage.
stage.sty -

16.1.

237

Act I
(Pause.)
Scene 1
( . , , .
. .)

. , ?

.
( ). .
?.. ?

( .)
The End

. 16.1. stage
( ),
.
stage:
% s t a g e
\ documentclass { stage }
\ u s e p a c k a g e [ T2A] { f o n t e n c }
\ u s e p a c k a g e [ k o i 8r ] { i n p u t e n c }
\ usepackage [ english , r u s s i a n ] { babel }
\ u s e p a c k a g e { i n d e n t f i r s t }%f i r s t paragraph i n d e n t
\ a u t h o r { . }
\ t i t l e { }
\ b e g i n { document }

238

16.

%
\ a d d c h a r a c t e r { }{ }
\ a d d c h a r a c t e r {}{ }
%
\ act
%
\ pause
%
\ scene
%
\ opensd { . , ,

.
.
. }
%
\ d i a l o g {}{ . , ?}
\ d i a l o g { }{ . }
\ d i a l o g { } { ( ) . . }
\ d i a l o g { }{ ? . . ?}
\ s t a g e { . }
\ end { document }
stage-documentation.pdf.

16.2.
-
. , LATEX
, .
guitar
.
guitar .

16.2.

239

guitar:
\begin{guitar}
[Gm] [Eb], [Gm]
[Eb][D7] , [Gm]
, [A7] [D7]
[Eb] [D7], [Gm]
\end{guitar}

Gm E

Gm

,
E

D7

Gm

,
A7

D7

,
E

D7

Gm

guitar .
guitar.dvi
.
MusiXTEX
musixtex musictex. , .
musixdoc.pdf , , LATEX, musixtex. LATEX , . ,
, , ,
, . MusiXTEX LATEX [6].
, -, , ,
music:
\begin{music}
\startextract
\notes\qu{abcdefghi}\ql{jk}\enotes
\endextract
\end{music}

G2

(
). \startextract/\endextract. TEX . \notes \enotes .
, ,
\startpiece/\endpiece. LATEX . ,
.

240

@ ) @ )
G2 34 @

>
@
3

) @ )
G2 @

>

16.

2
@ ) @ )

>
4
@ ) @ )

>

. 16.2. . . , musixtex
. 16.2 . . . :
\ b e g i n { music } % . .
\ p a r i n d e n t=0pt%
\ g e n e r a l m e t e r {\ m e t e r f r a c 34}% 3/4
\ g e n e r a l s i g n a t u r e {1}%
%
\newcommand{\ l i f t } [ 2 ] { \ r a i s e #1\ I n t e r l i g n e #2}
\ s t a r t p i e c e%
\ n o t e s%
\ z q l {d}\ l i f t {1}{\ qs }%
\ ibbu 0 s 5\ qb 0{km}\ tbu 0\ qb 0{ o }%
\ ibbu 0 s 0\ zqb 0{m}%
\ l i f t {3}{\qp}%
\qb 0{km}\ tbu 0\ qb 0{ k}%
\ i b l 0 j {6}\ zqb 0{h}%
\ l i f t {3}{\ qs }\ ccu {k}%
\ t b l 0\ zqb 0{ f } \ l i f t {2}{\ qs } \ ccu {k} %
\ e n o t e s%
\ bar%
.
\ e n d p i e c e%
\ end { music }

16.2.

241

musixtex ,
.
MusiXTEX -
.
musixlyr
musixlyr MusiXTEX,
. . 16.3
- . . .
, :
%
% m u s i x l y r
\ u s e p a c k a g e { musixtex }
% m u s i x l y r LATEX
\ input { musixlyr }
%
\ b e g i n { music }
\ p a r i n d e n t=0pt%
\ g e n e r a l m e t e r {\ m e t e r f r a c 44}% 4/4
\ g e n e r a l s i g n a t u r e {1}%
\ nobarnumbers %
%
\ s e t l y r i c s { Egorov }{% Egorov
,
{ } , { } .
{ } ,
_

}
\ a s s i g n l y r i c s 1{ Egorov } %
\ s t a r t p i e c e%
% ,
\ l y r r a i s e {1}{b1.5mm}
\ Notes \qp\ ds \ ca { a c f }\ en \ bar
\ Notesp \ ca {hg }\ qp\ ca { f e }\ ds \ c c a { de }\ en \ a l a l i g n e
%
\ l y r r a i s e {1}{ b0mm}
\ Notesp \ha{ f }\ ds \ ca { d e f }\ en \ bar
\ Notesp \ ca { j i }\ qp\ ca { h g f e }\ en \ a l a l i g n e

242

16.

G2 44 > ?
(
( (
G2

G2 -

( ( (

( >

G2 : ( >
- ,

- -

G2 ( ( >
,

( ( >

>

>

- -

( ( ?

) )

- -

( ( ( (

- ,

- - - - -

>

( ( ( (

- - -

( ( ( (

- - -

. 16.3. ,
mysixtex mysixlyr
\ Notesp \ ca { e f }\ qp\ ds \ ca { h i j }\ en \ bar
\ Notesp \ qa {kk }\ ca { j e j k }\ en \ a l a l i g n e
\ Notesp \ ca { j g }\ qp\qp\ ds \ ca { j }\ en \ bar
\ Notesp \ ca { j i }\ ds \ c c a { i i }\ ca { h g f e }\ en \ a l a l i g n e
\NOtes\ i s l u r d 0 f \ha{ f }\ t s l u r 0 f \ ca { f }\ qp\ ca { f }\ en \ bar
\ Notesp \ ca { i j }\ qp\ c c a { h i }\ ca { h g f e }\ en \ bar
\ n o t e s p \wh{d}\ en
\ setdoublebar
\ e n d p i e c e%
\ end { music }
, \setlyrics. (-) .
({}) .
(_) .
mxlyrdoc.dvi .

16.3.

243

16.3.
: , .
LATEX
. The Comprehensive
LATEX Symbol List (symbols-a4.pdf).
tipa

(International Phonetic Alphabet IPA).
tipa IPA . :
\textipa{},
\tipaencoding,
IPA.
, ,
:
:
[\textepsilon kspl\textschwa%
\textprimstress ne%
\textsci\textesh\textschwa n]
:
\textipa{[Ekspl@"neIS@n]}

: [Ekspl@"neIS@n]
: [Ekspl@"neIS@n]

, .

tipaman.pdf.
HieroTEX
HieroTEX TEX Live.
http://www.iut.univ-paris8.fr/~rosmord/archives/ . HieroTeX-3.5.tgz Type1 HieroType1-3.1.4.tgz. . HieroTEX .

244

$
$1
)
$
+
< N $
I
; $ ; ; <)
2 4

16.

!I
M)
=
((
6

6 0 0

>B

2P

0 0

"

. 16.4. (HieroTEX)
- sesh, texmf-
texhash. EGypto.pdf. ( hierotex.htx)
:
% h i e r o t e x . htx
% EGypto . t e x h i e r o t e x
\ documentclass { a r t i c l e }
\ u s e p a c k a g e { egypto }
\ usepackage { h i e r o }
\ b e g i n { document }
\ EnColonne [ 1 . 2 \ Htm] {
\ begin { hieroglyph }
G5 <S E1 D40 xa m R1 9 ( t \ s 1 : niwt \ s 1 ) >!
nbty wAH sw \ ! t \ s 1 \ ! i i ( r a : Z1 ) mi m ( p t : pt ) !
sxmG8 F9F9 DsrxaZ2!
( sw : t ) ( b i t : t ) <ramnxpr >! zA \ ! \ ! \ ! ( r a : . )
<G26ms n f r xpr>! O10 nbt Mf (kA : t ) (N3 3 :N3 3 :N3 3 )
mr i i
\ end { h i e r o g l y p h }}
\ end { document }

16.3.

245

sesh LATEX- (
hierotex.tex):
> s e s h < h i e r o t e x . htx > h i e r o t e x . t e x
hieroglyph. pdflatex latex ,
. 16.4. , , , . .

arcs
- ,
arcs:
\underarc{}
\overarc{} .

 LATEX-: http://www.essex.ac.uk/linguistics/external/clmt/latex4ling/, The LaTeX for Linguists.

17

TEX Live
.

.
.
TEX Live CTAN1 .
LATEX,
TEX Live .
,
X .

17.1.
, .
.

17.1.1.
X fontenc LATEX.
X inputenc , .
1 CTAN
(Graham Williams) TeX Catalogue,
http://texcatalogue.sarovar.org html-.

248

17. TEX Live

X babel .
.
10.1 . 121.
, babel, LATEX ( ) (arabtex),
(armtex), (arosgn, bangtex), (burmese),
(vntex), (gurmukhi), (devanagari), (malayalam), (itrans), (oinuit), (ocherokee), (cjk), (cjk), (manjutex),
(montex), (sanskrit), (sinhala), (adami), (ctib4tex, pecha), (enthiop), (osmanian), (telugu) (cjk) .
ucs Unicode.
braille ( ).

17.1.2.
X anttor Antykwa Tor
unska. .
X concrete concrete ( ) euler ( ). . .
. .
cyrillic LATEX. inputenc.
X lh Computer Modern. Type1 cm-super.
X indentfirst .
X t2 . misccorr (
), mathtext (
) citehack ( BibTEX).
X eskdx .
X gost780u gost71u gost 7.80-00 7.1-84
BibTEX.

17.1.3.
extdash ncctools ,
.

17.1.

249

X ncccomma nctools .
icomma was.
X underscore (_) .

17.1.4.
contour .
.
nccstretch ncctools .
X soul , , .
truncate .
ulem .
umoline .

17.1.5.
dashrule .
X mboxfill ncctools .
X nccrules ncctools .

17.1.6.
X lineno .
X ragged2e .
hanging .
X comment , .
shapepar . ,
- .

17.1.7.
X desclist ncctools description.
engrec
.
enumerate enumerate
.
enumitem .

250

17. TEX Live

X eqlist , description, .
etaremune .
expdlist description.
multenum .
X paralist .

17.1.8.
X alltt
LATEX .
fancyvrb .
moreverb verbatim.
X verbatim .

17.1.9.
balancedquotes "" ,
, .
csquotes . . .
X epigraph .
quotchap .

17.1.10.
alnumsec .
chappg
.
fncychap .
Lenny.
nccsect ncctools .
sectionbox . , .
titlesec ,
.
titletoc.
appendix .

17.1.

251

17.1.11.
authblk preprint \author, , ,
.
coverpage CoverPage, .
titling \maketitle.
abstract , .

17.1.12.
crossreference .
lastpage , .
X prettyref .
refcheck , ,
.
X showkeys . .
typedref \ref \figureref, \sectionref \eqref.
\label .
varioref tools .
X xr .

17.1.13.
fixfoot .
X footmisc
.
footnpag .
X ftnright tools .
manyfoot ncctools .
X nccfoots ncctools .
X savefnmark .
.
yafoot pfnote ( ), fnpos (
) dblfnote ( ).

252

17. TEX Live

17.1.14.
endheads .
X endnotes .
X pagenote
.

17.1.15.
X marginnote .
X mparhack LATEX .
X changebar . .

17.1.16. WWW-
X breakurl .
X hyperref .
typehtml carlisle HTML LATEX.
HTML2 HTML3.
X url .
cooltooltips . Adobe Reader 7 .

17.1.17. PDF
cmap pdf-.
pdfcrypt oberdiek pdf-
.

17.1.18.
boites , , .
boxedminipage , - .
boxhandler .
dashbox .
eqparbox ,
.

17.1.

253

fancybox .
nccboxes ncctools . . .
pst-fr3d 3D-.
X shadow \shabox, .

17.1.19.
X draftwatermark DRAFT
- .
draftcopy.
X fixme
.
prelim2e
, .
progress HTML-, .
.
pdfsync pdf-. pdf- . iTeXMac, iTeXMac2, TeXShop emacs (AucTeX) pdf iTeXMac, iTeXMac2, TeXShop, TeXniscope PDFView.
srcltx dvi-. DVI xdvi yap.
snapshot , , ,
. .
X svn svninfo LATEX
svn.
cvs, rcs rcsinfo.
svnkw svn-multi svn.
X vhistory .
vpe srcltx PDF. vpe .

17.1.20.

combine pdfpages.
X askinclude \include.

254

17. TEX Live

X excludeonly , , \include.
chapterfolder , ,
.
import \input,
.
volumes , \includeonly.

17.1.21.
crop (cropmark)
. ncccropmark
ncctools.
fixltx2e LATEX 2 .
mylatex carlisle mylatex.ltx, , . ,
.
morse ( ).
pagesel oberdiek ,
. , / .
totpages , .
wordlike , , . . , , .

17.2.
LATEX ,
, LATEX.

17.2.1.
X amsmath -LATEX. .
amsbsy ( ), amsopn ( ) amstext ( \text,

17.2.

255

). , .
X amssymb . amsfonts (
). .
X amscd . .
amsthm . proof. .
X mh amsmath. mathtools , ntheorem
theorem empheq
.
mhequ .
bezos accents ( ), tensind ( ),
dotlessi ( \dotlessi \dotlessj), esindex, checkend ( ) arabicfront
( ).
breqn .

. .
X cancel \cancel, \bcancel \xcancel, ,
.
X cases numcases subnumcases .
X commath , ,
.
complexity .
dcpic LATEX.
deleq .
easy .
easy ( easy-), easyeqn ( ), easymat ( ), easybmat ( ), easytabl ( ), easyvector (C-
), easybib ( ).
egameps pstricks
(extensive games).
eqname \eqname
.
X esdiff .
esvect , , .

256

17. TEX Live

eulervm Euler.
extarrows extpfeil .
faktor \faktor,
 . amsmath.
flagderiv - (flag
notation).
gauss .
hhtensor , .
karnaugh Karnaugh Maps, Veitch diagram.
maybemath \maybebm \maybeit. .
nath natural math notation. .
,
.
nccthm ncctools ().
onlyamsmath , LATEX TEX-. .
X pb-diagram .
pst-3dplot . .
pst-bar .
pst-eucl .
pst-func . , , ,
.
qobitree .
sobolev .
sseq ,
spectral sequence charts.
subeqn subequations
.
t-angles (Hopf algebra).
X tableaux, tabvar variations
. .
X tensor .
vector .

17.2.

257

venn (MetaPost).
X was fixmath ( ), gensymb ( , , ),
icomma ( ), upgreek (
up ).
X wasysym . integrals .

17.2.2.
ascii IBM ASCII.
X algorithms, algorithmic, algorithmicx, algorithm2e,
clrscode pseudocode .
basix BASIC, TEX. : {CTAN}/macros/generic/basix/. TEX Live .
X bytefield .
cursor L- .
examplep LATEX MetaPost.
codep ( code, ,
) examplep (
).
, , .
keystroke . PostScript- pdf .
X lcd LCD-.
X listings .
method .
pst-dbicons ER-.
pst-uml UML-.
semantic , T-.

17.2.3.
astro cmastro
, .
braket - .
X circ LATEX
METAFONT.
X feyn .

258

17. TEX Live

X feynmf
LATEX METAFONT/MetaPost.
X hepparticles .
X isotope .
pst-circ .
X pst-optic .
X pst-osci .
X SIstyle . SIunits.
slashed carlisle - . \slashed,
/ def
, :
= .
timing LATEX METAFONT.
units . , .
unitsdef .

17.2.4.
bpchem , , .
chemarr oberdiek .
chemarrow .
chemcompounds . .
chemcono .
cryst .
X mhchem ,
(
).
X pst-labo
pstricks.
r-und-s ( ).
X xymtex LATEX
. chemtex .
http://homepage3.nifty.com/xymtex/fujitas3/xymtex/indexe.html.
TEX Live-2007 .

17.3.

259

17.2.5.
biocon .
dichokey
.
dnaseq -.
pst-pdgr .
X texshade (nucleotide and peptide alignments).
textopo ,
(membrane protein topology plots).
labbook .

17.3.
answers
.
assignment .
courseoutline coursepaper
.
eCards - . pdf Adobe Reader.
X exam , .
examdesign .
exercise .
flashcards .
interactiveworkbook pdf-. pdf Adobe Reader.
probsoln
- , .
qcm .

17.4.
. LATEX.

260

17. TEX Live

17.4.1. ,
dramatist .
ednotes .
ledmac . TEX- edmac. ledpar .
play .
parrun , .
poemscol , .
sides . plari.
X stage .
verse .

17.4.2.
pst-tree
pstricks.
arcs (\underarc) (\overarc) .
cbcoptic .
covington , , --, ,
,
.
engpron , ,
(Daniel Jones English Pronouncing Dictionary)
lexikon .
linguex .
phonetic .
rst .
synttree .
X tipa (International Phonetic Alphabet).
teubner babel, greek .
xytree .

17.4.3.
abc LATEX ABC- ( ASCII-). abcm2ps.

17.5.

261

ConcProg . concprog.
cd cd-cover CD-.
X guitar .
musictex MusicTEX ,
LATEX.
X musixtex MusiXTEX MusicTEX .
X musixlyr musixtex .
songbook
.

17.5.
- , - .

17.5.1.
TEX-
. .
, ,
.
cooking .
.
cuisine cooking.

17.5.2.
cchess .
chess .
skak PGN (Portable Game Notation) .
skaknew , skak.
texmate .

17.5.3. ,
backgammon .
crosswrd . cwpuzzle.
dice , .
, epsdice.

262

17. TEX Live

othello .
psgo .
sudoku sudoku.

17.5.4.
advdate ltxmisc , , , , \today.
calendar .
calxxxx . .
china2e .
clock .
datetime . isodate.
weekday .

17.5.5.
bizcard .
labels - .
ticket , , .

17.6.
, , ,
. .

17.6.1.
float . floatraw.
rotfloat float, .

17.6.2.
boxhandler figure table.
dpfloat ,
. .
X floatflt , .
nccfloats ncctools
.

17.6.

263

sidecap , .
X wrapfig , .
X miniplot , subfig, .
photo .
picinpar . wrapfig . , .
plates ,
, (). , .
X subfig . .

17.6.3.
capt-of
.
captcont .
X caption , . ccaption.
X mcaption .
subfloat , .
X topcapt \topcaption, \caption,
.

17.6.4.
X endfloat .
figcaps preprint , . ,
.
hvfloat
.
X placeins ,
.

264

17. TEX Live

17.7.
. , ,
.

17.7.1.
bmpsize oberdiek . .
figsize
.
X graphicx .
epstopdf oberdiek eps- pdflatex, epstopdf .
nccpic ncctools graphicx .
hilowres
, , .
, .
rotating .
watermark ncctools , ,
. bophook, eso-pic wallpaper.

17.7.2.
aurora dvips .
.
X color .
colorinfo .
xcolor .

17.7.3. LaTeX
bardiag PSTricks.
bez123 .
coordsys ,
. picture.
curve2e pict2e.
curves .
picture.

17.7.

265

ebezier . picture.
ecltree . picture.
epic picture.
epic eepic.
histogr . picture.
pdftricks pstricks pdflatex.
pict2e picture, .
pgf A Portable Graphic Format for TEX.
LATEX, tex.
pstricks Postcript LATEX.
pst-node ( ), pst-plot
( ), pst-tree ( ).
pst-3d -3D, , .
pst-barcode .
pst-blur .
pst-coil .
pst-eps eps-.
pst-fill .
pst-geo .
pst-gr3d 3D-.
pst-grad RGB- HSB-.
pst-infixplot .
pst-lens .
pst-light3d 3D- , .
pst-math ,
PostScript.
pst-pdf pdf-.
pst-poly .
pst-text .
pst-slpe .
pst-vue3d 3D- .
pst-xkey xkey - pstricks.
scalebar .
xypic TEX.

266

17. TEX Live

17.8.
, .
,
.
X booktabs .
.

17.8.1.
X arydshln .
delarray ( ) array.
X hhline .

17.8.2.
X cellspace ,
.
X colortbl , .
X makecell .
, , \makecell.
X multirow , . bigdelim ( ) bigstrut ( ).
X slashbox , .

17.8.3.
X dcolumn tools
. rccol warpcol.
X numprint
, .

17.8.4. tabular
array tabular array .
.
blkarray carlisle blockarray, array, tabular.
tabularht oberdiek tabular , .

17.9.

267

X tabularx tools tabular


.
X tabulary tabular .
X ctable .

17.8.5.
X longtable . .
ltxtable carlisle longtable tabularx.
X supertabular
longtable, .
X xtab supertabular longtable.

17.8.6.
X listliketab .

17.8.7.
X csvtools CSV-.

17.9.
() , ,
, , . LATEX , ,
.
X afterpage
.
everypage .
microtype pdftext. .
( T2A). .

17.9.1.
X lscape landscape,
.
X portland .

268

17. TEX Live

X pdflscape oberdiek lscape. pdf- , landscape,


.
X rotpages
, , . , ,
.

17.9.2.
chngpage .
X geometry .
X layout .
pdfscreen pdf- .
X pgfpages pgf ,
.
pdfpages pdf- pdf-.
X twoup .
booklet.
rmpage .
typearea KOMA-Script .
fullpage preprint 1.5 .
savetrees . , ?
stdpage , ,
.
X typogrid . .
X vmargin .

17.9.3.
X setspace .
nccparskip ncctools .

17.9.4.
X balance preprint
.

17.10. LATEX

269

dblfloatfix ( midfloat sttools) (


fixltx2e).
X multicol tools .
X parallel .
.
parcolumns sauerj .
X sttools , ,
. stfloats (
), floatpag ( ,
), flushend ( ), cuted ( / ), marginal ( ) midfloat (
).

17.10. LATEX
article (), book (), report (), proc (), letter () slides ( ) , .
. .
X KOMA-Script . scrartcl (), scrreprt (), scrbook () scrlttr2 ().
X ncclatex, , ncc. , , , , . [10]
.
hc KOMA-Script hcart
(), hcreport (), hcletter ().
hcslides.
ntgclass (artikel1, artikel2 artikel3), (boek
boek3), (brief ) (rapport1 rapport3).
.

270

17. TEX Live

extsizes , 10pt, 11pt 12pt 8pt, 9pt, 14pt, 17pt


20pt. extarticle, extbook, extletter, extproc, extreport.
X minimal , , .

17.10.1.
X eskdx . : eskdtext ( ), eskdbtab
( ) eskdgraph ( , ).
isostds ISO
(iso) ISO 10303 (iso10303).

17.10.2.
letter scrlttr2
KOMA-Script .
adrconv directory ,
BibTEX .
adrlist .
X akletter letter.
beletter .
X cdpbundl .
envlab US Postal Service.
dinbrief g-brief . dinbrief
dinbrief-gui Tcl/Tk.
facsimile fax .
formlett mailing .
lettre .
X newlfm ,
. fancyhdr geometry.

17.10.3.
book , , scrbook KOMA-Script.
X memoir ,
.
X octavo : , .
X sffms .

17.10. LATEX

271

17.10.4.
report, ,
, , scrreprt KOMA-Script.
X hitec HiTech.
refman refart refrep, , Adobe.

17.10.5.
X slides
.
a0poster .
X beamer .
powerdot .
prosper seminar slides. ppr-prv , prosper.
sciposter .
X seminar slides .
talk beamer . .
texpower , . powersem.
seminar ifmslide pdflatex. pdfslide.

ppower4,
PDF-.

17.10.6.
.
, .
X disser , , .
. ,

272

17. TEX Live

TEX Live-2007, CTAN-


{CTAN}/macros/latex/contrib/disser.
ebsthesis European
Business School.
hepthesis . PhD
(HEP).
pittetd University of Pittsburgh.
gatech-thesis Georgia Institute of Technology.
muthesis University of Man.
uaclasses University of Arizona.
ucthesis UC Berkeley.
uiucthesis University of Illinois.
umich-thesis University of Michigan.
uwthesis University of Washington.
york-thesis York University ().

17.10.7.
X curve CurVe .
europecv , .
moderncv .
vita,
currvita cv.

17.10.8.
,
.
aaai AAAI (American Association for Artificial Intelligence).
aastex AASTeX American Astronomical Society.
abstbook .
acmconf ACM (Association for Computing Machinery). acm.
active-conf ACTIVE ().
aguplus AGUTeX AGU (American Geophysical Union).
aiaa-tc , AIAA (American Institute of
Aeronautics and Astronautics). aaainamed.

17.10. LATEX

273

X - amsart (), amsbook () amsproc


().
apa American Psychological Association.
apacite apa apalike.
asaetr American Society for Agricultural Engineers (ASAE).
ascelike American Society of Civil Engineers. .
cc computational-complexity Computational
Complexity.
X combine . .
X elsart , Elsevier.
jpsj2 Journal of the Physical Society of Japan.
iagproc IAG (International Association of Geodesy).
IEEEconf IEEEtran IEEE (Institute of Electrical and Electronics Engineers).
mtn Maple Technical Newsletter.
nature , pdf-
Nature. .
X nccproc , .
nrc1 nrc2 nrc National Research Council ().
X revtex4 . ,
/ (http://www.maik.ru/pub/tex/).
ptptex PTPTeX (Progress of Theoretical Physics), .
X sibjnm .
siggraph Siggraph.
smfart smfbook .
spie SPIE.

17.10.9.
LATEX,
.
X papertex LATEX.
leaflet - .

274

17. TEX Live

17.11. -
. . -
.

17.11.1.
X minitoc .
multitoc .
X shorttoc .
X tocbibind , , .
X tocloft , , , .
tocvsec2 .

17.11.2.
X fancyhdr .
X nccfancyhdr ncctools fancyhdr.
X technics , fancyhdr
.
.

17.11.3.
amsrefs BibTEX .
authorindex .
backref hyperref , .
babelbib
babel. .
bibcheck ltxmisc ,
thebibliography .
bibtopic
.
bibunits
, , \part.
X breakcites ltxmisc \cite
. .
camel BibTEX .

17.11. -

275

cite , cite ( ), overcite (


), drftcite ( ) chapterbib (
).
X citehack t2 \cite.
citeref .
X compactbib thebibliography
.
custom-bib .
doipubmed (\doi, \pubmed \citeurl)
.
footbib
.
harvard Harvard.
multibbl .
multibib .
natbib . .
notoccite
, / BibTEX- unsrt.

17.11.4.
X gloss BibTEX.
index .
X makeidx LATEX .
X makeglos .
X nomencl . .
robustindex . ,
, .
X splitindex
.
X varindex . , , , .

276

17. TEX Live

17.12. LATEX
,
- .
, .
perltex PerlTEX. perl LATEX.

17.12.1.
arrayjob LATEX .
binhex , .
X chngcntr
.
clefval /
. - .
engord oberdiek
.
dcounter ncctools ,
.
fmtcount (, , ) .
sublabel preprint
, 4a, 4b, 4c .
zahl2string sauerj .

17.12.2. LATEX
X calc .
fltpoint .
refcount oberdiek ,
.
fp , , .

17.12.3.
ifdraft oberdiek
draft/final.
ifmtarg ltxmisc . ,
.

17.12. LATEX

277

ifpdf oberdiek \ifpdf latex pdflatex.


X ifthen , \ifthenelse ( ) \whiledo ().
xifthen.
labelcas .
multido \multido.
stdclsdv .

17.12.4.
acronym .
makecmds \makecommand, \makeenvironment
\provideenvironment, , , , .
optparams sauerj
. .
robustcommand .
toolbox ,
.
twoopt oberdiek
, .

17.12.5.
coolstr . ASCII-,
. \substr, ,
.
keyval =.
processkv sauerj =.

.
X tokenizer .
xkeyval keyval.
=.

17.12.6.
attachfile2 oberdiek PDF.
fink ,
\finkfile.
embedfile oberdiek PDF.

278

17. TEX Live

extract , .
filecontents LATEX-
\include.
newfile / .
X optional , , .
versions ,
.

17.12.7. LATEX
afterpackage ncctools ,
.
X doc .
.
X docstrip , doc.
blindtext .
lipsum.
diagnose .
dialogl LATEX-.
export / LATEX .
makedtx dtx-.
msg . , .
xdoc , , doc.

TEX Live

279

TEX Live
CD TEX Live-2007. LATEX http://www.tug.org/texlive/.

CD, TEX Live :
i386-linux
GNU/Linux x86;
powerpc-darwin MacOSX PowerPC1 ;
win32
32- Windows, 9x .
texmf-doc/doc/russian/texlive-ru/
html- pdf-: live.html live.pdf .
,
.

GNU/Linux
GNU/Linux, , Debian (Lenny), TEX Live LATEX .
, TEX Live.
GNU/Linux Mac OS X
CD :
> sh . / i n s t a l l t l . sh
. , . .
1 . ,
.
, PATH, , :
#
>
>
>

bash . b a s h _ p r o f i l e
TEXLIVE=/u s r / l o c a l / t e x l i v e /2007/
PATH=$TEXLIVE/ b i n / i 3 8 6 l i n u x :$PATH
e x p o r t PATH
1 , T X Live Mac OS X, E
MacTEX (http://www.tug.org/mactex/). TEX Live .

280

TEX Live

tex-
. - LATEX. ,
: emacs2 vim.
, , . , Kile (KDE Integrated
LATEX Environment) LyX (WYSIWYM ).

Windows3
Windows MiKTEX
(http://www.miktex.org/). LATEX
CTAN, TEX Live
MiKTEX.
TEX Live Windows
tlpmgui.exe, setup-win32
. CD, .
. tlpmgui.exe (scheme-full) , , Language
Collection. Install, perl , .
( ). , GhostScript
PostScript dvi- dviout. , .
.
, .
LATEX Windows
.
gsview (http://www.ghostgum.com.au/).
PostScript. , 2 L
AT X AucT X RefT X. E
E
E
preview-latex.
3 L
AT X, , ,
E
GNU/Linux . ,.

TEX Live

281


.
Adobe Reader (http://www.adobe.com/products/reader/) pdf-.
tex-. :
TeXnicCenter (http://www.toolscenter.org/)
. dvi-;
WinEdt (http://www.winedt.com/) ShareWare . 5.5,
TEX Live-2007;
Notepad++ (http://notepad-plus.sourceforge.net/ru/site.htm)
, ;
emacs vim, GNU/Linux.
TEX Live-2007 . http://tug.org/texlive/bugs.html.
 , . mktexmf TEX-.

lh.

texmf.cnf. :
MKTEXPK = 1
MKTEXMF = 1
MKTEXTFM = 1
MKTEXFMT = 1

/TeXLive2007/texmf-var/web2c/.
> kpsewhich texmf . c n f
. latex, . 4 , dvi-
. , ,
.
4 ,
Q (to run quietly).
, .


A
\AA, 125
\aa, 125
abstract, 41, 98
\act, 237
\acute, 188
\addcharacter, 237
\addcontentsline, 135, 165
\addtocontents, 164
\addtocounter, 72, 75
\addtoendnotes, 140
\addtolength, 70, 75
\AE, 125
\ae, 125
\afterpage, 63
\againframe, 119
\aleph, 186
\alert, 113, 116
algorithm, 215
algorithmic, 214, 215
align, 200202
align*, 200, 201
alignat, 201
aligned, 202
alignedat, 202
\allowdisplaybreaks, 200
\alph, 72
\alpha, 50, 187
\alt, 116
\amlg, 190
\AND, 77
\and, 41
\ang, 223
\angle, 51, 186
\appendix, 135

\apprge, 193
\apprle, 193
\approx, 51, 191
\approxeq, 191
\arabic, 72
\arccos, 54
\arcctg, 54
\arcsin, 54
\arctg, 54
\areaset, 85
array, 151, 197, 266
\Asbuk, 72
\asbuk, 72
\AskOption, 147
\ast, 190
\asymp, 191
\ataribox, 124
\author, 41, 251
B
\backepsilon, 191
\backmatter, 136
\backprime, 186
\backsim, 191
\backsimeq, 191
\backslash, 186, 194
\backslashbox, 156
\balance, 92
\bar, 51, 188, 240, 241
\barwedge, 190
\baselineskip, 90, 91
\Bbbk, 186
\bcancel, 189, 255
\beamerbutton, 113, 115, 116
\because, 191
\begin, 31


\bell, 124
\beta, 50, 187
\beth, 186
\between, 191
\bfseries, 36
\bibitem, 168
\bibliography, 171
\Big, 54
\big, 54
\bigcap, 195
\bigcirc, 190
\bigcup, 195
\Bigg, 54
\bigg, 54
\bigodot, 195
\bigoplus, 195
\bigotimes, 195
\bigskip, 91
\bigsqcup, 195
\bigstar, 186
\bigtriangledown, 190
\bigtriangleup, 190
\biguplus, 195
\bigvee, 195
\bigwedge, 195
\binom, 199
\bitbox, 213
\bitheader, 213
\blacklozenge, 186
\blacksmiley, 124
\blacksquare, 186
\blacktriangle, 186
\blacktriangledown, 186
\blacktriangleleft, 192
\blacktriangleright, 192
block, 107, 115, 116
blockarray, 266
bmatrix, 197
\bond, 230
\boolean, 76
\bot, 186
\Bowtie, 124
\bowtie, 191

283
\Box, 186, 187
\boxdot, 190
\boxminus, 190
\boxplus, 190
\boxtimes, 190
\bra, 221
\breve, 188
\brokenvert, 124
\bullet, 190
\Bumpeq, 191
\bumpeq, 191
\burl, 142, 143
bytefield, 212, 213
C
\cancel, 189, 255
\cancelto, 189
\Cap, 190
\cap, 190
\caption, 43, 66, 137, 154, 215, 263
cases, 203
\cbend, 141
\cbstart, 141
CD, 198
\cdot, 51, 190
\cdotp, 189
\cdots, 189
\ce, 230, 231
\cent, 125
center, 89
\centerdot, 190
\centering, 90
\ceqn, 47
\cftchapdotsep, 164
\cftchapleader, 164
\cftdot, 164
\cftdotfill, 164
\cftdotsep, 164
\cftsecnumwidth, 164
\ch, 54
\chapter, 30, 41, 98, 130, 135
\check, 188
\checked, 124

284
\CheckedBox, 124
\checkmark, 125
\chi, 50, 187
\circ, 190
\circeq, 191
\circlearrowleft, 193
\circlearrowright, 193
\circledast, 190
\circledcirc, 190
\circleddash, 190
\circledR, 125, 186
\circledS, 186
circuit, 227
\cite, 168, 169, 274, 275
\citeurl, 275
\clearpage, 63, 145
\clock, 124
\clubsuit, 186
\cnttest, 76, 77
code, 257
\colon, 189
\color, 114, 115, 211
\columnbreak, 94
\columncolor, 156
\columnwidth, 81
\COMMENT, 215
comment, 35
\complement, 186
\cong, 191
\coprod, 195
\cos, 54
\counterwithin, 72
\counterwithout, 72
\ctable, 159
\ctg, 54
\cth, 54
\Cup, 190
\cup, 190
\curlyeqprec, 191
\curlyeqsucc, 191
\curlyvee, 190
\curlywedge, 190
\currency, 125


\curvearrowleft, 193
\curvearrowright, 193
D
\dag, 125
\dagger, 190
\daleth, 186
\dashleftarrow, 193
\dashrightarrow, 193
\dashv, 191
\date, 41
\ddag, 125
\ddagger, 190
\dddot, 53, 188
\ddot, 53, 188
\ddots, 189
\DeclareMathOperator, 54
\definecolor, 211
\DefineLCDchar, 212
\Delta, 50, 187
\delta, 50, 187
\depth, 129
\depthof, 75
desclist, 132
description, 131, 132, 249, 250
\diagdown, 186
\Diagram, 224
\diagup, 186
\dialog, 237
\diameter, 124
\Diamond, 186, 187
\diamond, 190
\diamondsuit, 186
\Dif, 195
\dif, 195
\diff, 196
\diffp, 196
\digamma, 187
\dimtest, 77
\displaybreak, 200
\displaystyle, 47, 196
\div, 51, 190
\divideontimes, 190


\DJ, 125
\dj, 125
document, 35
\documentclass, 26, 32, 33, 97
\doi, 275
\dominilof, 165
\dominilot, 165
\dominitoc, 165
\dot, 51, 53, 188
\doteq, 191
\doteqdot, 191
\dotfill, 89, 161
\dotlessi, 255
\dotlessj, 255
\dotplus, 190
\dots, 125, 189
\doublebarwedge, 190
\doublespacing, 91
\DOWNarrow, 124
\Downarrow, 193, 194
\downarrow, 193, 194
\downdownarrows, 193
\downharpoonleft, 193
\downharpoonright, 193
\dropchapter, 131
E
\ell, 51, 186
\ELSE, 214
\ELSIF, 214
\emph, 36, 113
empheq, 203
\emptyset, 186
\EnColonne, 244
\end, 31, 35
\endextract, 239
\ENDFOR, 214
\ENDIF, 214
\endinput, 145
\ENDLOOP, 214
\endnote, 140
\endnotemark, 140
\endnotetext, 140

285
\endpiece, 239
\endrotboxpages, 83
\endspace, 89
\ENDWHILE, 214
\enotes, 239241
\ENSURE, 215
\ensuremath, 73
enumerate, 37, 115, 131, 132, 249
\epigraph, 130
\epigraphhead, 130
\epigraphwidth, 130
\epsilon, 187
\eqcirc, 191
eqlist, 132
eqlist*, 132
\eqname, 255
\eqref, 46, 137, 204, 251
\eqslantgtr, 192
\eqslantless, 192
\equal, 76
equation, 46, 47, 137, 200
equation*, 47, 48, 200
\equiv, 51, 191
\eta, 50, 187
\eth, 186
\eval, 195
\evensidemargin, 81
example, 107
\excludeonly, 146
\exists, 51, 186
\exp, 54
F
\faktor, 256
\fallingdotseq, 191
\fbox, 129, 199
\Feyn, 224
\feyn, 224
figure, 62, 63, 137, 262
\figureref, 251
\finkfile, 277
\Finv, 187
\fixme, 143

286
flalign, 201
flalign*, 201
\flat, 186
\fleqn, 47
\FloatBarrier, 64
floatingfigure, 65, 66
\flushend, 92
flushleft, 89
\flushleft, 89, 90
flushright, 89
\flushright, 89
\fmf, 225
fmffile, 226
fmfgraph, 225
\fmflabel, 225
\fmfleft, 225
\fmfright, 225
\footnote, 138, 139
\footnotemark, 138
\footnotesize, 37
\footnotetext, 138
\footskip, 81
\FOR, 214
\FORALL, 214
\forall, 51, 186
\foreignlanguage, 122
\frac, 52, 53, 196
frame, 111, 112, 116
\framebox, 129
\framesubtitle, 112, 114
\frametitle, 107, 112, 114
\frontmatter, 136
\frown, 191
\frownie, 124
\fullfunction, 195
\fxerror, 143
\fxnote, 143
\fxwarning, 143
G
\galso, 181
\Game, 187
\Gamma, 50, 187


\gamma, 50, 187
gather, 201
gather*, 201
gathered, 202
\ge, 51, 191
\generalmeter, 240, 241
\generalsignature, 240, 241
\geneuro, 125
\geneuronarrow, 125
\geneurowide, 125
\geq, 191
\geqq, 192
\geqslant, 51, 192
\GetTokens, 77
\gg, 51, 191
\ggg, 192
\gimel, 187
\gloss, 181
\glossary, 180, 181
\glossaryintro, 181
\glossaryname, 180, 181
\gnapprox, 192
\gneq, 192
\gneqq, 192
\gnsim, 192
\grave, 188
\gsee, 181
\gtrapprox, 192
\gtrdot, 192
\gtreqless, 192
\gtreqqless, 192
\gtrless, 192
\gtrsim, 192
guitar, 239
\gvertneqq, 192
H
\hat, 51, 188
\hbar, 186
\hdotsfor, 197
\headheight, 81
\headsep, 81
\heartsuit, 186

287

\height, 129
\heightof, 75
\HepAntiParticle, 224
\HepGenAntiParticle, 224
\HepGenParticle, 224
\HepGenSusyParticle, 224
\HepParticle, 224
\HepParticleResonance, 224
\HepProcess, 224
\HepSusyParticle, 224
\HepTo, 224
\hexstar, 124
\hfil, 89
\hfill, 89
\hhline, 155
hieroglyph, 244, 245
\hline, 153
\hm, 55
\hoffset, 81
\hookleftarrow, 193
\hookrightarrow, 193
\hphantom, 199, 200
\hrule, 128
\hrulefill, 89, 128
\hslash, 187
\hspace, 89, 91, 199
\hspace*, 89
\Huge, 37
\huge, 37
\hyperlink, 116
\hyphenation, 39, 40

\in, 51, 186


\include, 145, 146, 253, 254, 278
\includegraphics, 6062, 115
\includeonly, 119, 145, 146, 254
\indeces, 198
\indent, 89
\index, 174176
\infty, 51, 186
inparaenum, 133
inparaitem, 37, 133
\input, 145, 174, 254
\int, 53, 195, 196
\intercal, 190
\intertext, 203
\invdiameter, 124
\invisible, 116
\invneg, 193
\iota, 50, 187
IPA, 243
\isempty, 77
\isequivalentto, 77
\isnamedefined, 77
\isodd, 76
\isotope, 226
\isundefinedcommand, 76
\item, 37, 43, 115, 131, 132
itemize, 37, 115, 131
\itshape, 36

I
\idotsint, 195
\IF, 214
\iflanguage, 123
\ifpdf, 277
\ifthenelse, 76, 277
\iiiint, 195
\iiint, 195, 196
\iint, 195, 196
\Im, 186, 187
\imath, 186

K
\kappa, 187
\ket, 221
\kill, 151
\kreuz, 124

J
\jmath, 186
\Join, 193

L
\L, 125
\l, 125
\label, 42, 43, 46, 116, 137, 215, 251
\Lambda, 50, 187

288
\lambda, 50, 187
\land, 51
landscape, 82, 267, 268
\landscape, 82
\langle, 194
\LARGE, 37
\Large, 37
\large, 37
\LaTeX, 30
\layout, 79, 80
\LCD, 212
\LCDcolors, 211
\lceil, 194
\ldotp, 189
\ldots, 40, 189
\le, 51, 191
\leadsto, 193
\left, 54, 55
\LEFTarrow, 124
\Leftarrow, 193
\leftarrow, 193
\leftarrowtail, 193
\leftharpoondown, 193
\leftharpoonup, 193
\leftleftarrows, 193
\Leftrightarrow, 193
\leftrightarrow, 193
\leftrightarrows, 193
\leftrightharpoons, 193
\leftrightsquigarrow, 193
\leftthreetimes, 190
leftwordgroup, 214
\lengthtest, 76
\leq, 191
\leqq, 192
\leqslant, 51, 192
\lessapprox, 192
\lessdot, 192
\lesseqgtr, 192
\lesseqqgtr, 192
\lessgtr, 192
\lesssim, 192
\lfloor, 194


\LHD, 191
\lhd, 190, 191
\lightning, 124
\lim, 54, 186
\limits, 53
\linebreak, 88
\linelabel, 144
linenumbers, 143
\linenumbers, 144
\linewidth, 81
\listfiles, 146
listliketab, 161
\listoffigures, 135, 161, 164
\listoffixmes, 143
\listoftables, 135, 161, 164
\ll, 51, 191
\llcorner, 194
\Lleftarrow, 193
\lll, 192
\ln, 54
\lnapprox, 192
\lneq, 192
\lneqq, 192
\lnsim, 192
\log, 54
\logof, 193
\longitem, 132
\Longleftarrow, 193
\longleftarrow, 193
\Longleftrightarrow, 193
\longleftrightarrow, 193
\longmapsto, 193
\longpage, 90
\Longrightarrow, 193
\longrightarrow, 193
longtable, 159
\LOOP, 214
\looparrowleft, 193
\looparrowright, 193
\lor, 51
\lozenge, 187
\lrcorner, 194
\Lsh, 193


\lstdefinelanguage, 211
\lstinline, 210
\lstinputlisting, 210
lstlisting, 210
\lstloadlanguages, 209
\lstset, 209
\ltimes, 190
\lVert, 194
\lvert, 194
\lvertneqq, 192
\lyrraise, 241
M
\mainmatter, 136
\makeatletter, 71
\makeatother, 71
\makebox, 129
\makecell, 157, 266
\makecommand, 277
\makeenvironment, 277
\makegloss, 180
\makeglossary, 180
\makeindex, 174
\makenomenclature, 182
\makepagenote, 140
\maketitle, 41, 251
\maltese, 125
\mapsto, 193
margincap, 67
\marginnote, 141
\marginpar, 141
\marginparpush, 81
\marginparsep, 81
\marginparwidth, 81
\markright, 166
\mathbb, 50
\mathbcal, 50
\mathbf, 50
\mathbin, 185
\mathclose, 186
\mathdollar, 186
\mathellipsis, 186
\mathfrak, 50

289
\mathindent, 47
\mathinner, 186
\mathop, 186
\mathopen, 186
\mathord, 186
\mathparagraph, 186
\mathpuct, 186
\mathrel, 185
\mathring, 188
\mathsection, 186
\mathsterling, 186
\mathstrut, 52
\mathunderscore, 186
matrix, 197
\max, 54
\maxwidth, 71
\maybebm, 256
\maybeit, 256
\mbox, 40, 129
\mboxfill, 128
\md, 195
\measuredangle, 187
\medskip, 91
\medspace, 199
\meterfrac, 240, 241
\mho, 186
\mid, 191
\min, 54
\minilof, 165
\minilot, 165
minipage, 64, 65, 130, 138, 159, 160
\minitoc, 165
\models, 191
\movie, 119
\mp, 51, 190
mpsupertabular, 159
mpxtabular, 159
\mtcskip, 165
\mu, 50, 187
multicols, 93, 94
\multicolumn, 155, 156
\multido, 277
\multimap, 191

290
\multirow, 155, 156
multline, 201, 202
music, 239241
N
\nabla, 186
\natural, 186
\ncong, 192
\ne, 191
\nearrow, 193
\neg, 51, 186
\negmedspace, 199
\negthickspace, 199
\neq, 51, 191
\newblock, 168
\newcommand, 74, 75, 218
\newcounter, 71
\newenvironment, 74
\newindex, 177
\newlength, 69
\newpage, 90
\newtheorem, 114, 205, 206
\newtie, 126
\nexists, 187
\nextnum, 161
\ngeq, 192
\ngeqq, 192
\ngeqslant, 192
\ngtr, 192
\ni, 186
\nLeftarrow, 194
\nleftarrow, 194
\nLeftrightarrow, 194
\nleftrightarrow, 194
\nleq, 192
\nleqq, 192
\nleqslant, 192
\nless, 192
\nmid, 192
\No, 32
\nocite, 169
\noindent, 89
\nolimits, 53


\nolinenumbers, 144
\nomenclature, 183
\normalmarginpar, 141
\normalsize, 36, 37
\NOT, 77
\not, 191
\notag, 204
\notes, 239241
\notesname, 140
\notin, 191
\nparallel, 192
\nprec, 192
\npreceq, 192
\nRightarrow, 194
\nrightarrow, 194
\nshortmid, 192
\nshortparallel, 192
\nsim, 192
\nsubseteq, 192
\nsucc, 192
\nsucceq, 192
\nsupseteq, 192
\nsupseteqq, 192
\ntriangleleft, 192
\ntrianglelefteq, 192
\ntriangleright, 192
\ntrianglerighteq, 192
\nu, 50, 187
\nulide, 198
\num, 223
numcases, 203, 255
\numprint, 157
\nVDash, 192
\nvDash, 192
\nvdash, 192
\nwarrow, 193
O
\O, 125
\o, 125
\ocircle, 191
\od, 195
\oddsidemargin, 81


\odot, 190
\OE, 125
\oe, 125
\officialeuro, 125
\oint, 195
\Omega, 50, 187
\omega, 50, 187
\ominus, 190
\onecolumn, 92
onehalfspacing, 91
\onehalfspacing, 91
\only, 116
\opensd, 237
\oplus, 190
\opt, 146
\OR, 77
\oslash, 190
otherlanguage, 122
otherlanguage*, 122
\otimes, 190
\overarc, 245, 260
\overbrace, 189
\overleftarrow, 189
\overleftrightarrow, 194
\overline, 189
\overrightarrow, 189
P
\P, 125
\pagebreak, 90
\pagenote, 140
\pageref, 43, 137
\pagestyle, 166
\paperheight, 81, 85
\paperwidth, 81, 85
\par, 36, 74
\paragraph, 133
Parallel, 94
\parallel, 51, 191
\ParallelLText, 95
\ParallelRText, 95
parbox, 130
\parbox, 64, 65

291
\part, 41, 135, 274
\partial, 53, 186
\pause, 113, 237
\pd, 195
\permil, 124
\perp, 51, 191
\pgfpagesuselayout, 87
\phantom, 200
\Phi, 50, 187
\phi, 187
\phone, 124
\Pi, 50, 187
\pi, 50, 187
picture, 264, 265
\pitchfork, 191
\pm, 51, 190
pmatrix, 197
\poemtitle, 236
\poemtoc, 236
\pointer, 124
\poptabs, 151
portrait, 82
\portrait, 82
\pounds, 125
\prec, 191
\precapprox, 191
\preccurlyeq, 191
\preceq, 191
\precnapprox, 192
\precnsim, 192
\precsim, 192
\prettyref, 138
\prime, 186
\PRINT, 215
\printglossary, 180
\printindex, 174
\printnomenclature, 182
\printnotes, 140
\printnotes*, 140
Problem, 73
\prod, 51, 195
proof, 107, 115, 255
\propto, 51, 191

292
\protect, 30, 46, 66, 135, 138, 164
\providecommand, 74
\provideenvironment, 277
pseudocode, 216
\Psi, 50, 187
\psi, 50, 187
\pubmed, 275
\pushtabs, 151
Q
\qedhere, 115
\qquad, 89, 199
\quad, 70, 89, 199
quatation, 130
quote, 130
R
\raggedend, 92
\raggedleft, 90
\RaggedRight, 90, 94
\raggedright, 90
\rangle, 194
\rceil, 194
\Re, 186, 187
\real, 76
\recorder, 124
\ref, 43, 73, 137, 144, 204, 251
\refstepcounter, 73
\renewcommand, 74
\renewenvironment, 75
\REPEAT, 214
\REQUIRE, 214
\RETURN, 215
\reversemarginpar, 141
\rfloor, 194
\RHD, 191
\rhd, 190, 191
\rho, 50, 187
\right, 54, 55
\RIGHTarrow, 124
\Rightarrow, 193
\rightarrow, 193
\rightarrowtail, 193


\rightharpoondown, 193
\rightharpoonup, 193
\rightleftarrows, 193
\rightleftharpoons, 193
\rightrightarrows, 193
\rightsquigarrow, 193
\rightthreetimes, 190
rightwordgroup, 213
\risingdotseq, 192
\Roman, 72
\roman, 72
\rotboxpages, 83
\rowcolor, 156
\Rsh, 193
\rtimes, 190
\rule, 128
\rVert, 194
\rvert, 194
S
\S, 32, 125
\saveFN, 139
\scene, 237
\scriptscriptstyle, 47
\scriptsize, 37
\scriptstyle, 47
\scshape, 36
\searrow, 193
section, 112
\section, 30, 98, 133, 135, 164
\section*, 42
\sectionref, 251
\see, 176
\selectlanguage, 122
semiverbatim, 116
\setcounter, 75, 135
\setlength, 69, 70, 75, 130
\setlyrics, 241, 242
\setmarginsrb, 84
\setmargnohfrb, 84
\setmargrb, 84
\setminus, 190
\setnewcounter, 72


\setpagewiselinenumbers, 144
\settodepth, 71, 129
\settoheight, 71, 129
\settowidth, 70, 129
\SetWatermarkAngle, 145
\SetWatermarkFontSize, 145
\SetWatermarkLightness, 144
\SetWatermarkScale, 144
\SetWatermarkText, 144
\sh, 54
\shabox, 129, 253
\sharp, 186
\shortmid, 192
\shortpage, 90
\shortparallel, 192
\shorttableofcontents, 164
\shoveleft, 202
\shoveright, 202
\SI, 223
\sidefig, 66
\Sigma, 50, 187
\sigma, 50, 187
\sim, 51, 191
\simeq, 51, 191
\sin, 54, 186
\sindex, 177
singlespacing, 91
\singlespacing, 91
\skippedwords, 213
\slashed, 258
slide, 108
\slshape, 36
\small, 37
\smallfrown, 192
\smallsetminus, 191
\smallskip, 91
\smallsmile, 192
\smile, 191
\smiley, 124
\so, 127, 128
\sound, 119
spacing, 91
\spadesuit, 186

293
\spcheck, 188
\spdddot, 188
\spddot, 188
\spdot, 188
\sphat, 188
\sphericalangle, 51, 187
split, 202
\sptilde, 188
\sqcap, 190
\sqcup, 190
\sqrt, 51, 52
\sqsubset, 192, 193
\sqsubseteq, 191
\sqsupset, 192, 193
\sqsupseteq, 191
\Square, 124
\square, 187
\SS, 125
\ss, 125
\st, 127
\stage, 237
\star, 190
\startextract, 239
\startpiece, 239241
\STATE, 214
\stepcounter, 72, 73
\stretchwith, 128
strip, 92, 93
subequations, 204, 256
subnumcases, 255
\subparagraph, 133
\subsection, 30, 133, 135
\Subset, 192
\subset, 191
\subseteq, 191
\subseteqq, 192
\subsetneq, 192
\subsetneqq, 192
\substr, 277
\subsubsection, 133
\succ, 191
\succapprox, 192
\succcurlyeq, 192

294
\succeq, 191
\succnapprox, 192
\succnsim, 192
\succsim, 192
\sum, 51, 53, 186, 195
\sun, 124
supertabular, 159
\suppressfloats, 63
\Supset, 192
\supset, 191
\supseteq, 191
\supseteqq, 192
\supsetneq, 192
\supsetneqq, 192
\surd, 186
\SVN, 219
\SVNDate, 219
\SVNKeyword, 219
\SVNTime, 219
\swarrow, 193
\switchlinenumbers, 144
T
tabbing, 150, 151
table, 152, 262
\tableofcontents, 41, 112, 133, 161, 164
tabular, 137, 151153, 158, 266, 267
tabularx, 158
\tag, 204
\tag*, 204
\tau, 50, 187
\tensor, 198
\text, 48, 222, 223, 254
\textasciicircum, 123
\textasciitilde, 123
\textasteriskcentered, 123, 124
\textbackslash, 123
\textbaht, 125
\textbar, 123
\textbardbl, 124
\textbf, 30, 36
\textbigcircle, 124
\textblank, 124


\textbraceleft, 123
\textbraceright, 123
\textbrokenbar, 124
\textbullet, 123, 124
\textcent, 125
\textcentoldstyle, 125
\textcircled, 126
\textcircledP, 125
\textcolonmonetary, 125
\textcopyleft, 125
\textcopyright, 125
\textcurrency, 125
\textdagger, 123, 124
\textdaggerdbl, 123, 124
\textdblhyphen, 124
\textdblhyphenchar, 124
\textdegree, 190
\textdiscount, 124
\textdiv, 190
\textdollar, 123, 125
\textdollaroldstyle, 125
\textdong, 125
\textdownarrow, 124
\textellipsis, 123
\textemdash, 123
\textendash, 123
\textepsilon, 243
\textesh, 243
\textestimated, 124
\texteuro, 125
\textexclamdown, 123
\textflorin, 125
\textfractionsolidus, 190
\textgreater, 123
\textguarani, 125
\texthight, 81
\textinterrobang, 124
\textinterrobangdown, 124
\textipa, 243
\textit, 36
\textLCD, 211
\textleftarrow, 124
\textless, 123


\textlira, 125
\textlnot, 190
\textmd, 36
\textminus, 190
\textmusicalnote, 124
\textnaira, 125
\textnumero, 124
\textonehalf, 190
\textonequarter, 190
\textonesuperior, 190
\textopenbullet, 124
\textordfeminine, 123, 124
\textordmasculine, 123, 124
\textparagraph, 123, 124
\textperiodcentered, 123, 124
\textpertenthousand, 124
\textperthousand, 124
\textpeso, 125
\textpilcrow, 124
\textpm, 190
\textprimstress, 243
\textquestiondown, 123
\textquotedblleft, 123
\textquotedblright, 123
\textquoteleft, 123
\textquoteright, 123
\textquotesingle, 124
\textquotestraightbase, 124
\textquotestraightdblbase, 124
\textrecipe, 124
\textreferencemark, 124
\textregistered, 123, 125
\textrightarrow, 124
\textsc, 36
\textschwa, 243
\textsci, 243
\textsection, 123, 124
\textservicemark, 125
\textsf, 36
\textsl, 36
\textsterling, 123, 125
\textstyle, 47, 196
\textsurd, 190

295
\textthreequarters, 190
\textthreequartersemdash, 124
\textthreesuperior, 190
\texttildelow, 124
\texttimes, 190
\texttrademark, 123, 125
\texttt, 36
\texttwelveudash, 124
\texttwosuperior, 190
\textunderscore, 123
\textuparrow, 124
\textvisiblespace, 123, 208
\textwidth, 60, 69, 81, 166
\textwon, 125
\textyen, 125
\tg, 54
\th, 54
\thanks, 41
\the, 70, 72, 73
thebibliography, 168170, 274, 275
\theendnotes, 140
\theequation, 205
theorem, 107, 115, 116, 137, 255
\therefore, 192
\Theta, 50, 187
\theta, 50, 187
\thickapprox, 192
\thicksim, 192
\thickspace, 199
\thispagestyle, 86
\tilde, 51, 188
\times, 51, 190
\tiny, 37
\tipaencoding, 243
\title, 41
titlepage, 40, 41, 136
\to, 186
\today, 262
\top, 186
\topcaption, 154, 263
\topmargin, 81
\totalheight, 129
\triangle, 51, 186

296
\triangledown, 187
\triangleleft, 190
\trianglelefteq, 193
\triangleq, 193
\triangleright, 190
\trianglerighteq, 193
\twocolumn, 92
\twoheadleftarrow, 194
\twoheadrightarrow, 194
U
\ul, 127
\ulcorner, 194
\uncover, 115, 116
\underarc, 245, 260
\underbrace, 189
\underleftarrow, 194
\underleftrightarrow, 194
\underline, 189
\underrightarrow, 194
\unitlength, 131
\unlhd, 190, 191
\unrhd, 190, 191
\UNTILL, 214
\upalpha, 188
\UParrow, 124
\Uparrow, 193, 194
\uparrow, 193, 194
\upbeta, 188
\upchi, 188
\Updelta, 188
\updelta, 188
\Updownarrow, 193, 194
\updownarrow, 193, 194
\upepsilon, 188
\upeta, 188
\Upgamma, 188
\upgamma, 188
\upharpoonleft, 194
\upharpoonright, 194
\upiota, 188
\upkappa, 188
\Uplambda, 188


\uplambda, 188
\uplus, 190
\upmu, 188
\upnu, 188
\Upomega, 188
\upomega, 188
\Upphi, 188
\upphi, 188
\Uppi, 188
\uppi, 188
\Uppsi, 188
\uppsi, 188
\uprho, 188
\Upsigma, 188
\upsigma, 188
\Upsilon, 50, 187
\upsilon, 50, 187
\uptau, 188
\Uptheta, 188
\uptheta, 188
\upuparrows, 194
\Upupsilon, 188
\upupsilon, 188
\upvarepsilon, 188
\upvarphi, 188
\upvarpi, 188
\upvarrho, 188
\upvarsigma, 188
\upvartheta, 188
\Upxi, 188
\upxi, 188
\upzeta, 188
\urcorner, 194
\url, 141143
\usecolortheme, 118
\useFN, 139
\usefonttheme, 118
\useinnertheme, 118
\useoutertheme, 118
\usepackage, 26, 32, 34
\usetheme, 118


V
\value, 76
\varangle, 187
\varepsilon, 50, 187
\varhexstar, 124
\varkappa, 50, 187
\varnothing, 51, 187
\varphi, 50, 187
\varpi, 187
\varpropto, 192
\varrho, 187
\varsigma, 187
\varsubsetneq, 192
\varsubsetneqq, 192
\varsupsetneq, 192
\varsupsetneqq, 192
\vartheta, 187
\vartriangle, 187
\vartriangleleft, 193
\vartriangleright, 193
\Vdash, 192
\vDash, 192
\vdash, 191
\vdots, 189
\vec, 51, 188
\vee, 190
\veebar, 191
\verb, 142, 208, 210
\verb*, 208
verbatim, 208
verbatim*, 208
\verbatiminput, 208
\verbatiminput*, 208
verse, 235, 236
\versewidth, 236
versionhistory, 217
\vfil, 91
\vfill, 91
\vhantom, 200
\vhCurrentDate, 218
\vhCurrentVersion, 218
\vhEntry, 217
\vhListAllAuthorsLong, 218

297
\vin, 236
\visible, 116
Vmatrix, 197
vmatrix, 197
\voffset, 81
\vphantom, 200
\vspace, 91
\vspace*, 91
\Vvdash, 192
W
\wasylozenge, 124
\wasypropto, 193
\wasytherefore, 187
\wedge, 190
\WHILE, 214
\whiledo, 77, 277
\widehat, 188
\widetilde, 188
\width, 128, 129
\widthof, 75
\wordbox, 213
\wordgroupr, 213
\wp, 186
\wr, 190
wrapfigure, 65, 66
X
\XBox, 124
\xcancel, 189, 255
\Xi, 50, 187
\xi, 50, 187
\xleftarrow, 194
\xrightarrow, 194
\xspace, 73
xtab, 160
xtabular, 159
Z
\zeta, 50, 186, 187


A
a0poster, 104, 271
aaai, 272
aaai-named, 272
aastex, 272
abc, 260
abstbook, 272
abstract, 251
accents, 255
acm, 272
acmconf, 272
acronym, 277
active-conf, 272
adami, 248
adrconv, 270
adrlist, 270
advdate, 262
afterpackage, 278
afterpage, 63, 267
aguplus, 272
aiaa-tc, 272
akletter, 101, 270
algorithm2e, 215, 257
algorithmic, 214, 257
algorithmicx, 215, 257
algorithms, 214, 215, 257
alltt, 250
alnumsec, 250
altt, 208
amsart, 100, 273
amsbook, 100, 273
amsbsy, 254
amscd, 198, 199, 255
amsfonts, 50, 185, 188, 255

amsmath, 45, 47, 48, 137, 185, 188, 189,


195, 198200, 202204, 254
256
amsopn, 254
amsproc, 100, 273
amsrefs, 274
amssymb, 50, 51, 125, 185187, 190
194, 255
amstext, 48, 254
amsthm, 255
amsxtra, 188
answers, 259
anttor, 126, 248
apa, 273
apacite, 273
apalike, 273
appendix, 250
arabicfront, 255
arabtex, 248
arcs, 245, 260
armtex, 248
arosgn, 248
array, 153, 159, 198, 266
arrayjob, 276
article, 33, 41, 42, 81, 83, 98, 141, 269
artikel1, 100, 269
artikel2, 100, 269
artikel3, 100, 269
arydshln, 155, 266
asaetr, 104, 273
ascelike, 273
ascii, 257
askinclude, 146, 253
assignment, 106, 259
astro, 257
attachfile2, 277


aurora, 264
authblk, 251
authorindex, 274
B
babel, 32, 33, 39, 40, 48, 54, 121123,
132, 248, 260, 274
babelbib, 274
backgammon, 261
backref, 274
balance, 92, 268
balanced, 93
balancedquotes, 250
bangtex, 248
bardiag, 264
basix, 257
beamer, 104, 111116, 118, 119, 205,
271
beletter, 270
bez123, 264
bezos, 255
bibcheck, 274
bibtopic, 274
bibunits, 274
bigdelim, 266
bigstrut, 266
binhex, 276
biocon, 259
bizcard, 262
blindtext, 278
blkarray, 266
bmpsize, 264
boek, 100, 269
boek3, 100, 269
boites, 252
book, 33, 41, 42, 81, 83, 98, 102, 135,
269, 270
booklet, 87, 268
booktabs, 153, 266
bophook, 145, 264
boxedminipage, 252
boxhandler, 252, 262
bpchem, 258

299
braille, 248
braket, 221, 257
breakcites, 169, 274
breakurl, 142, 252
breqn, 255
brief, 100, 101, 269
burmese, 248
bytefield, 212, 257
C
calc, 7577, 83, 276
calendar, 262
calxxxx, 262
camel, 274
cancel, 189, 255
capt-of, 263
captcont, 263
caption, 66, 263
carlisle, 252, 254, 258, 266, 267
cases, 203, 255
cbcoptic, 260
ccaption, 66, 263
cchess, 261
cd, 106, 261
cd-cover, 261
cdpbundl, 101, 270
cellspace, 155, 266
changebar, 141, 252
chappg, 250
chapterbib, 275
chapterfolder, 254
checkend, 255
chemarr, 258
chemarrow, 258
chemcompounds, 258
chemcono, 258
chemtex, 231, 258
chess, 261
china2e, 262
chngcntr, 72, 276
chngpage, 268
circ, 226, 228, 257
cite, 275

300
citehack, 169, 248, 275
citeref, 275
cjk, 248
clefval, 276
clock, 262
clrscode, 215, 257
cm-super, 110, 126, 248
cmap, 252
cmastro, 257
codep, 257
color, 211, 264
colorinfo, 264
colortbl, 156, 266
combine, 104, 253, 273
commath, 195, 255
comment, 249
compactbib, 169, 275
complexity, 255
computational-complexity, 273
ConcProg, 106, 261
concrete, 126, 196, 248
contour, 249
cooking, 261
coolstr, 277
cooltooltips, 252
coordsys, 264
courseoutline, 106, 259
coursepaper, 106, 259
CoverPage, 251
covington, 260
crop, 254
crossreference, 251
crosswrd, 261
cryst, 258
csquotes, 250
csvtools, 158, 267
ctable, 159, 267
ctib4tex, 248
cuisine, 261
currvita, 105, 272
cursor, 257
curve, 105, 272
curve2e, 264


curves, 264
custom-bib, 275
cuted, 92, 93, 269
cv, 272
cwpuzzle, 261
cyrillic, 248
D
dashbox, 252
dashrule, 128, 249
datetime, 262
dblfloatfix, 269
dblfnote, 251
dcolumn, 157, 158, 266
dcounter, 276
dcpic, 255
delarray, 266
deleq, 204, 255
desclist, 132, 249
devanagari, 248
diagnose, 278
dialogl, 278
dice, 261
dichokey, 259
dinbrief, 270
directory, 270
disser, 105, 271
dnaseq, 259
doc, 278
docstrip, 278
doipubmed, 275
dotlessi, 255
dpfloat, 65, 262
draftcopy, 144, 253
draftwatermark, 144, 145, 253
dramatist, 260
drftcite, 275
E
easy, 255
easybib, 255
easybmat, 255
easyeqn, 255


easymat, 255
easytabl, 255
easyvector, 255
ebezier, 265
ebsthesis, 272
eCards, 259
ecltree, 265
edmac, 260
ednotes, 260
eepic, 265
egameps, 255
elsart, 104, 273
embedfile, 277
empheq, 203, 255
endfloat, 64, 263
endheads, 252
endnotes, 140, 252
engord, 276
engpron, 260
engrec, 249
enthiop, 248
enumerate, 249
enumitem, 249
envlab, 270
epic, 265
epigraph, 130, 250
epsdice, 261
epstopdf, 264
eqlist, 132, 250
eqname, 255
eqparbox, 252
esdiff, 196, 255
esindex, 255
eskd, 101
eskdbtab, 101, 270
eskdgraph, 101, 270
eskdtext, 101, 270
eskdx, 33, 101, 248, 270
eso-pic, 145, 264
esvect, 255
etaremune, 250
euler, 126, 196, 248
eulervm, 256

301
europecv, 105, 272
eurosym, 125
everypage, 267
exam, 259
examdesign, 259
examplep, 257
excludeonly, 146, 254
exercise, 259
expdlist, 250
export, 278
extarrows, 256
extarticle, 99, 270
extbook, 99, 270
extdash, 248
extletter, 99, 270
extpfeil, 256
extproc, 99, 270
extract, 278
extreport, 99, 270
extsizes, 99, 270
F
facsimile, 270
faktor, 256
fancybox, 253
fancyhdr, 86, 166, 167, 270, 274
fancyvrb, 208, 250
fax, 270
feyn, 224, 257
feynmf, 224, 226, 258
feynmp, 224, 225
figcaps, 263
figsize, 65, 264
filecontents, 278
fink, 277
fixfoot, 251
fixltx2e, 92, 254, 269
fixmath, 187, 257
fixme, 143, 253
flagderiv, 256
flashcards, 106, 259
float, 62, 262
floatflt, 65, 262

302
floatpag, 269
floatraw, 62, 262
fltpoint, 276
flushend, 92, 93, 269
fmtcount, 276
fncychap, 250
fnpos, 251
fontenc, 48, 247
footbib, 275
footmisc, 139, 251
footnpag, 251
formlett, 270
fp, 276
ftnright, 92, 93, 251
fullpage, 268
G
g-brief, 270
gatech-thesis, 272
gauss, 256
gensymb, 257
geometry, 83, 85, 268, 270
gloss, 181, 275
gost, 172, 248
gost2003, 174
gost2003s, 174
gost2008, 171, 174
gost2008s, 174
gost71u, 248
gost780u, 248
graphics, 60
graphicx, 60, 61, 264
guitar, 238, 239, 261
gurmukhi, 248
H
hanging, 249
harvard, 275
hc, 269
hcart, 269
hcletter, 269
hcreport, 269
hcslides, 269


hepparticles, 224, 258
hepthesis, 272
hhline, 155, 266
hhline.pdf, 155
hhtensor, 256
hierotex, 243
hilowres, 264
histogr, 265
hitec, 103, 271
hvfloat, 263
hyperref, 110, 111, 142, 144, 181, 252,
274
I
iagproc, 273
icomma, 249, 257
IEEEtran, 273
ifdraft, 276
ifmslide, 271
ifmtarg, 276
ifpdf, 277
ifthen, 76, 77, 277
import, 254
indentfirst, 32, 123, 248
index, 275
inputenc, 32, 34, 167, 247, 248
interactiveworkbook, 259
iso, 102, 270
iso10303, 102, 270
isodate, 262
isostds, 270
isotope, 226, 258
itrans, 248
J
jpsj2, 104, 273
K
karnaugh, 256
keystroke, 257
keyval, 60, 83, 277
KOMA-Script, 33, 8385, 100102, 165,
268271


L
labbook, 106, 259
labelcas, 277
labels, 262
lastpage, 251
layout, 80, 268
lcd, 211, 257
leaflet, 273
ledmac, 260
ledpar, 260
letter, 81, 83, 98, 100, 269, 270
lettre, 270
lexikon, 260
lh, 34, 126, 157, 248, 281
lineno, 143, 249
linguex, 260
lipsum, 278
listings, 208210, 257
listliketab, 161, 267
longtable, 159, 267
lscape, 82, 267, 268
lstlistings, 116
ltxmisc, 72, 140, 146, 169, 203, 221,
262, 274, 276
ltxtable, 267
M
mailing, 270
makecell, 157, 266
makecirc, 228
makecmds, 277
makedtx, 278
makeglos, 180, 181, 275
makeidx, 174, 176, 275
malayalam, 248
manjutex, 248
manual, 103
manyfoot, 251
marginal, 269
marginnote, 141, 252
mathtext, 48, 248
mathtools, 255
maybemath, 256

303
mboxfill, 128, 249
mcaption, 67, 263
memoir, 102, 270
method, 257
mh, 203, 255
mhchem, 230, 258
mhequ, 255
microtype, 89, 267
midfloat, 269
minimal, 98, 270
miniplot, 65, 263
minitoc, 165, 274
misccorr, 32, 123, 248
moderncv, 105, 272
montex, 248
morderncv, 105
moreverb, 250
morse, 254
movie15, 110
mparhack, 141, 252
msg, 278
mtn, 104, 273
multenum, 250
multibbl, 275
multibib, 275
multicol, 9294, 269
multido, 277
multimedia, 119
multirow, 155, 156, 266
multitoc, 274
musictex, 239, 261
musixlyr, 241, 261
musixtex, 239241, 261
muthesis, 272
mylatex, 254
mysixlyr, 242
mysixtex, 242
N
nassflow, 103
natbib, 275
nath, 256
nature, 104, 273

304
ncc, 34, 83, 100, 269
nccboxes, 253
ncccomma, 49, 249
ncccropmark, 254
nccfancyhdr, 167, 274
nccfloats, 66, 262
nccfoots, 139, 251
ncclatex, 83, 269
nccmath, 47, 203
nccparskip, 268
nccpic, 264
nccproc, 273
nccrules, 128, 249
nccsect, 250
nccstretch, 128, 249
nccthm, 206, 256
ncctools, 66, 128, 132, 139, 145, 167,
206, 248251, 253, 254, 256,
262, 264, 268, 274, 276, 278
nctools, 49, 249
newfile, 278
newlfm, 101, 270
nomencl, 182, 275
notoccite, 275
nrc, 273
nrc1, 273
nrc2, 273
ntgclass, 100, 101, 269
ntheorem, 255
numprint, 157, 158, 266
O
oberdiek, 252, 254, 258, 264, 266, 268,
276, 277
ocherokee, 248
octavo, 102, 270
oinuit, 248
onlyamsmath, 256
optional, 146, 147, 278
optparams, 277
osmanian, 248
othello, 262
overcite, 275


P
pagenote, 140, 252
pagesel, 254
papertex, 98, 273
paralist, 37, 133, 250
parallel, 94, 269
parcolumns, 269
parrun, 260
pb-diagram, 162, 256
pdfcrypt, 252
pdflatex, 264
pdflscape, 82, 268
pdfpages, 86, 253, 268
pdfscreen, 268
pdfslide, 271
pdfsync, 253
pdftricks, 265
pecha, 106, 248
perltex, 276
pfnote, 251
pgf, 87, 118, 265, 268
pgfpages, 87, 118, 268
phonetic, 260
photo, 263
picinpar, 263
pict2e, 264, 265
pittetd, 272
placeins, 64, 263
plain, 174
plari, 260
plates, 263
play, 260
poemscol, 260
portland, 82, 267
powerdot, 104, 271
powersem, 103, 271
ppower4, 271
ppr-prv, 103, 271
prelim2e, 253
preprint, 92, 251, 263, 268, 276
prettyref, 138, 251
probsoln, 259
proc, 98, 269


processkv, 277
progress, 253
prosper, 103, 271
pscyr, 102
pseudocode, 216, 257
psgo, 262
pst-3d, 265
pst-3dplot, 256
pst-bar, 256
pst-barcode, 265
pst-blur, 265
pst-circ, 228, 258
pst-coil, 265
pst-dbicons, 257
pst-eps, 265
pst-eucl, 256
pst-fill, 265
pst-fr3d, 253
pst-func, 256
pst-geo, 265
pst-gr3d, 265
pst-grad, 265
pst-infixplot, 265
pst-labo, 229, 258
pst-lens, 265
pst-light3d, 265
pst-math, 265
pst-node, 265
pst-optic, 228, 258
pst-osci, 228, 258
pst-pdf, 265
pst-pdgr, 259
pst-plot, 265
pst-poly, 265
pst-slpe, 265
pst-text, 265
pst-tree, 260, 265
pst-uml, 257
pst-vue3d, 265
pst-xkey, 265
PSTricks, 228, 229
pstricks, 255, 258, 260, 265
ptptex, 273

305
Q
qcm, 106, 259
qobitree, 256
quotchap, 250
R
r-und-s, 258
ragged2e, 90, 249
rapport1, 100, 269
rapport3, 100, 269
rccol, 158, 266
rcs, 218, 253
rcsinfo, 218, 253
refart, 271
refcheck, 251
refcount, 276
refman, 271
refrep, 271
report, 33, 42, 81, 83, 98, 102, 269, 271
revtex4, 33, 104, 273
rmpage, 268
robustcommand, 277
robustindex, 275
rotating, 264
rotfloat, 262
rotpages, 82, 268
rsphrase, 231
rst, 260
S
sanskrit, 248
sauerj, 269, 276, 277
savefnmark, 139, 251
savetrees, 268
scalebar, 265
sciposter, 104, 271
scrartcl, 33, 42, 83, 84, 100, 269
scrbook, 33, 42, 83, 84, 100, 102, 135,
269, 270
scrlettr, 83
scrlttr2, 100, 101, 269, 270
scrreprt, 33, 83, 100, 102, 269, 271
sectionbox, 250

306
semantic, 257
seminar, 103, 108, 271
setspace, 91, 268
sffms, 102, 103, 270
shadow, 129, 253
shapepar, 249
shorttoc, 164, 274
showkeys, 138, 251
sibjnm, 104, 273
sidecap, 263
sides, 103, 260
siggraph, 273
sinhala, 248
SIstyle, 223, 258
SIunits, 223, 258
skak, 261
skaknew, 261
slashbox, 156, 266
slashed, 258
slides, 82, 98, 103, 108, 111, 269, 271
smfart, 273
smfbook, 273
snapshot, 253
sobolev, 256
songbook, 261
soul, 127, 249
spie, 273
splitidx, 177
splitindex, 275
srcltx, 253
sseq, 256
stage, 106, 236, 237, 260
stdclsdv, 277
stdpage, 268
stfloats, 269
sttools, 92, 269
subeqn, 256
subfig, 65, 263
subfloat, 263
sublabel, 276
sudoku, 262
supertabular, 159, 267
svn, 218, 253


svn-multi, 253
svninfo, 219, 253
svnkw, 253
synttree, 260
T
t-angles, 256
t2, 48, 123, 248, 275
table, 159
tableaux, 162, 256
tabular, 153, 159, 266
tabularht, 266
tabularx, 158, 267
tabulary, 159, 267
tabvar, 162, 256
talk, 104, 271
technics, 167, 168, 274
telugu, 248
tensind, 255
tensor, 198, 256
teubner, 260
texmate, 261
texpower, 103, 271
texshade, 233, 259
textcomp, 124126, 190
textopo, 259
ticket, 262
timing, 258
tipa, 243, 260
titlesec, 250
titletoc, 250
titling, 251
tocbibind, 165, 274
tocloft, 164, 274
tocvsec2, 274
tokenizer, 77, 277
toolbox, 277
tools, 75, 92, 153, 155, 157159, 208,
251, 266, 267, 269
topcapt, 154, 263
totpages, 254
truncate, 249
twoopt, 277


twoup, 87, 268
typearea, 8385, 268
typedref, 251
typehtml, 252
typogrid, 85, 268
U
uaclasses, 272
ucs, 248
ucthesis, 105, 272
uiucthesis, 272
ulem, 249
umich-thesis, 272
umoline, 249
underscore, 249
units, 223, 258
unitsdef, 223, 258
unsrt, 275
upgreek, 187, 188, 257
url, 142, 252
uwthesis, 272
V
variations, 256
varindex, 275
varioref, 251
vector, 256
venn, 257
verbatim, 35, 116, 208, 250
verse, 236, 260
versions, 278
vhistory, 217, 218, 253
vita, 105, 272
vmargin, 83, 84, 268
vntex, 248
volumes, 254
vpe, 253
W
wallpaper, 145, 264
warpcol, 158, 266
was, 187, 249, 257
wasysym, 53, 124, 125, 187, 191, 193,
196, 257

307
watermark, 145, 264
weekday, 262
wordlike, 254
wrapfig, 65, 263
X
xcolor, 264
xdoc, 278
xifthen, 76, 77, 277
xkey, 265
xkeyval, 277
xr, 137, 251
xspace, 73
xtab, 159, 160, 267
xymtex, 231, 258
xypic, 199, 265
xytree, 260
Y
yafoot, 251
york-thesis, 272
Z
zahl2string, 276


[1] . . . TEX. . : , 2003. 560 . ISBN: 5-8459-03823.
[2] . . . METAFONT. . : , 2003. 384 . ISBN: 58459-0442-0.
[3] . . . . . : , 2003. 686 . ISBN: 503-3361-0.
[4] . . LATEX. . : , 2000. 172 . ISBN: 5-030033661-0.
[5] . , . , . . LATEX
LATEX 2 . . : , 1999. 606 . ISBN: 5-03-003325-4.
[6] . , . , . . LATEX
. . : , 2002. 621 . ISBN: 5-03-0033882.
[7] . , . . LATEX Web-. . : , 2001. 604 . ISBN: 5-03-003387-4.
[8] . . . LATEX. . : , 2003.
448 . ISBN: 5-94057-091-7.
[9] . . , . . . LATEX -. : , 2004. 496 . ISBN: 5-87550-195-2.
[10] . . . LATEX / . . . .
: . , 2005. 398 . ISBN: 5-901548-25-6.
[11] . . . -. . : -,
2003. 500 . ISBN: 5-224-04560-6.