Вы находитесь на странице: 1из 3

Gene Mutations Answers

Background:
A mutation is a change that occurs in the DNA sequence of a gene. A change in the DNA
sequence may result in a major change in the amino acid sequence of the protein for
which the DNA codes. One type of gene mutation is also known as a point mutation.
This is a change in a single base of the gene sequence. There are three types of point
mutations: substitution, insertion and deletion.
In substitution, one base is changed to another base (ex.: A changed to T) in the
DNA sequence. The resulting change in the amino acid sequence may or may not
have an effect on the protein.
An insertion results in the addition of a base to the DNA sequence and also a major
change in the amino acid sequence of the protein.
A deletion is the loss of a base in the DNA sequence and results in a major change
in the amino acid sequence of the protein.
(Insertion and deletion are also known as Frameshift Mutations.)
Instructions:
This activity is designed to illustrate the effect of these point mutations on a DNA
sequence and the sentence for which it codes. For each of the examples, determine the
sentence of for which this DNA (gene) sequence codes.
1. Transcribe the DNA into mRNA (in RNA, uracil (U) replaces thymine (T)) and then
translate the mRNA into the words of the sentence by breaking the RNA into the
three base codons.
2. Use the Trans Word chart to determine the word for each codon of the sentence.
The starting DNA sequence is:
DNA

TACTGAATAAATGGGTACGTGTTGATT

mRNA

AUGACUUAUUUACCCAUGCACAACUAA

Sentence

The sky is blue and the sun shines.

Substitution: One base has been changed in the DNA sequence


DNA

TACTGAATAAAAGGGTACGTGTTGATT

mRNA

AUGACUUAUUUUCCCUAGCACAACUAA

Sentence

The sky is red and the sun shines.

Insertion: One extra base has been added to the DNA sequence
DNA

TACTGAATAACAAGGGTACGTGTTGATT

mRNA

AUGACUUAUUGUUCCCAUGCACAACUAA

Sentence

The sky is green black sun hot rays fell

Deletion: One base has been removed from the DNA sequence
DNA

TACTGAATAAATGGTACGTGTTGATT

mRNA

AUGACUUAUUUACCAUGCACAACUAA

Sentence

The sky is blue and green sky sky

Answer the following questions:


1. Which type of point mutation has the least effect on the corresponding sentence?
Explain. Substitution. This type of mutation may or may not change the
meaning of the sentence. If it does change the sentence, it is only one word.
2. Determine the sentence of for which this DNA (gene) sequence codes. First transcribe
the DNA into mRNA and then translate the mRNA into the words of the sentence by
breaking the RNA into the three base codons. Use the Trans Word chart to determine
the word for each codon of the sentence.
Mutation:
DNA

TACTGAATAAACGGGTACGTGTTGATT

mRNA

AUGACUUAUUUGCCCAUGCACAACUAA

Sentence

The sky is blue and the sun shines.

Which type of point mutation is this? What was its effect on the corresponding sentence?
Explain. Substitution. It had no effect on the sentence since the new codon
coded for the same word.
3. In these mutation models, what do the Sentences represent? What do the words that
make up the Sentences represent? The sentences represent proteins. The words
represent amino acids.
4. In Sickle Cell, how can substituting one base in the DNA sequence of the hemoglobin
gene that codes for the hemoglobin protein affect the entire body? (Hemoglobin is the
protein in red blood cells that caries oxygen) The defective hemoglobin causes the
red blood cells to take on a sickle shape. The sickle-shaped red blood cells
break apart easily, causing anemia. Sickle red blood cells live only 10-20 days
instead of the normal 120 days. The damaged sickle red blood cells also clump
together and stick to the walls of blood vessels, blocking blood flow. This can
cause severe pain and permanent damage to the brain, heart, lungs, kidneys,
liver, bones, and spleen.

Вам также может понравиться