Вы находитесь на странице: 1из 418

.

.
.

80
(>

LANGE medical book

1988

HARPER'S BIOCHEMISTRY
Twenty-first Edition
Robert K.Murray, MD, PhD
Professor of Biochemistry
University of Toronto

Daryl K.Granner, MD
Professor and Chairman
Department of Molecular Physiology and Biophysics
Professor of Medicine
Vanderbilt University Nashville,
Tennessee

Peter A.Mayes, PhD, DSc


Reade

in Biochemistry
Royal Veteinary College
University of London

Vlctor W. Rodwell, PhD


Professo of 8iochemistry
Pudue Univesity

West Lafayette,

Indiana

APPLETON & LANGE


Norwalk, Connecticut/San Mateo, California

.
.

2-


. . . . ,
. . . . ,
. . . . ,
. . . .
.. -


- . . .
- . . .

1993

20.070
63

63

577.2

: ., ., ., .
: 2- . . 2. . .:.: , 1993.-415 ., .

ISBN 5-03-001775-5

I' . 21-,

, .

" r .
2- .
: ,
, u (, ,

, OHI:OreHbI l: .).
, ,
.

191()(}()()()()()-218 87-91
041{01~93

20.070

1988 Appleton & Lange, Publjshing Division


ISBN 5-03-001775-5
ISBN 5-03-001773-9
ISBN 0-8385-3648-4

(.)

(.)

of Prentice

. -

1993

IV

34

-2-,
6-,
6-
, 6- .
-

(, ),
(,

(F ,

cGMP),
NAO, NAOP)

(S-);


(U-, U-)

(-).

,
,

(.

34.1).

. ,

(
)

7[-


.
.

37.


, .

-
( );

/N

II

N,
I

~"c'! ,,,

( cGMP).
,

(); (),
(),

I /

'N/"'N

N~lt '

13

5 11

~"/
N

f> 5-,

5' --

34.1.

cor

34

NH 2

NH 2

NH 2

N:1
~NI

:),

O~N

O~N

(2--4-,)

5-

5-
.

34.4.

:I
O~N

5-;
5- (.

34.4).

N6-,

(2,4--5-

(.

(2,4-)

34.2.

HN

~CH'OH
I

N6, N - N 7-Me34.5).
6

,
.

N -

(-,

-)

(.

34.2).

(.

34.3).

(.

35).


(.

34.6).

(1, 3,

7-),

3-

(1,

), -,

(3,

7-).

. , -

35

NH 2

(XN>
N

N:N>

H2N~N

(-)

N
)
HN:X
~N

(2-8--)

N
)
HN:X
O~N

,
(. 34.7),
m
.

(-)

(2,-)

~ .. )l
N

N~N6- 8
.

34.3.

,
..

40.

N~N>

'N/

38

34.5.

N 7 - 8

mu

N9

2' -

N-

. (

(1.3. 7-)

)
,

. m

(.

34.9).

( 1.-)

37.

-.

-.)

(3.7-8)

NH
.

34.6.

HN~

O~N)

NH z

O-l)

3 (8)

3 (8)


.
.

,
, , .
,

(88)

.
.

(8)

NH

HN:X~>

~N

. (.

34.8)

no

, ~-
( D- 2-) N 9 N,-

(8)

()

()

8 ()

. ,

()
D-,
-

-
-

N 9;
N 9 ;
N,;
N ,.

D-

2'-

2'N,

34.7. . .
.

34

HN~

O~_)
N

83

HO~

34.9.

- - .

34.10.

34.8.

() () 2'-

(dAMP)

().

mu

34.11.

(UMP)

() () ().

( )

(). u

(.

34.10).

, (

) , .

2'-

(dAMP
) ,
, 2'- .

2'-.

() ,

2' -

-5
-5'- (. 34.12).

2'-

, , ,

, ,
,

G,

2' -
. (UMP)
, (. 34.11).

,
2'II, 2'- 2'-

dG

2' -.

2'-,

()'),

, ,

,-dG-3'-. , ,

-5

5'

5'5'-

. ,

, ,

2' -

dGMP.

, . . - ,

GMP,

. Il

('1').

, .

UMP

S- (. ).

('VMP)
UMP .

), . ,

, 3-

3'-

. ,

..

34.12. -' - () 2'-5' - ().

10

N
N:Y )

~N~N
2

01

010

11

11

-----
11

0-

34

-5'-8 ()

-5'-08 ()
03-5'- ()
.

34.13.

-
.

DP ()
(). ,

5'-
. ,
-
. 34.13.

, . .
, (
).
1
7 .

34.14.

5'-

cAMP- (. 34.14).

,

(.

42),
(. 34.15).

-3' -5'-.

).

I I

(.

S-

ADP

(.

34.16)

S-

(.

3).

--

(. 11).

- -

()

1 /.

(3', 5'-,
cAMP)-
-

(.

34.14).

(.

43).
1 /) 3

- 8 - - -502.

34.15.

-'--5'--

mu

11

. ,

cGMP
5'-

n
,

_--....----_....

.....

34.16.

---

),-

de novo.

,
.

,
, , ,

. , -

-
GOP

;
,

GTP

cGMP)

(.

GMP (3', 5'-,


34.17)

cGMP .
cGMP GTP
- ,
. ,
,


(. 34.18).

(.

IMP

() -

S-.

GTP. GTP

(lMP

(IOP)

35).

(lTP)

,
;

(.
54).
. ,
(UOPGlc) .
-
(UOPGlcUA)-
,


(.

33).

------------~----~.~MP

I 838I
GMP+

GTP

34.17.

3'5'-

(cGMP).

34.18.

.
I

12

ITP.

(UTP)

UOPGlc UOPGal.

,
.

34


,

.
,

()

()

().

- .

HN~I

)'N)

. ,

, .

(.

5-

5- -2'-

34.1).

34.1.

SH

N:j(N)
H'N~N N

&N~~.H
N~

6-

6-8

RJo-~-1,
[
0- Jn

34.19.

()
().

R"o

HN~

R'

'---V--J

~ 6~

~8

R'

R"

SO~

3'-5'-

NAD
NADP
FAD
CoASH

*
*

PO~

PO~-

1
1
2
2
2
2

1)

:l~N\

.1

R-

PO~-

H2 N

34.20.

8-88

&

6- (1) 8-

().

Jlmu

13

11

11

11

---------

0-

0-

0-

()

()

80

11

11

11

1
0-

1
0-

--

------ 2

1
0-

13, 1"

11

H/ /

' "

11

0-

B-R-O-P-O-P-N-P-O-

11

\~ H~/

0-

0-

13.1"

. 34.22.
,
. : B-80
; R -
. (
) ;
-
JJ..

-13.

-13.

( ).

, - (.

34.19).

6-

6-

. 34.21. 4- (
), l{ ()
.

5-

(.

6-

8-

34.20).

4-

()
l

novo.

de

. ,
,

. ,

(.

.
-.

Ara-C),

34.21).

VIVO

6-

, ,

d . -

5-- -

5-- 5-- -

14

34

.


.
:

. .

34. 22

Henderson J. ., Paterson . R. . Nucleotide Metabolism: An


Introduction, Academic Press, 1973.
Michelson . . Chemistry of Nucleosides and Nucleotides, Academic Press. 1963.
PrusoJJW. ., Ward D. . Nucleoside analogs with antiviral
tivity, Biochem. Pharmacol., 1976, 25, 1233.

35

~
Ix


,
,

, ,

NAD.

f!i.


().

de novo

de novo

in vivo.


, ,
, ,

.
, ,

. ,


, ,

. :
,

; ,

(.

35.1).

,
, ,

).

. ,

.

.

vitro).

de novo.

. ,

in vivo,

in

]-, . .

16

35

27/0"

H~,

'~

-
I

N
HN:Y
)
~~N

HOH2~/

"

H~_tl
I

- ~Pi
8

-1

I.. I ~.-N~
4

H:sN
8

~~I~
N
N

. ..

. 35.1. }'L"I. -
R (, " ).
- .

n1l0 n

-npo-,

"

34.

;
IIII. ,

( ), .

,
.

de novo -

, (.
.

35.2).

35.3

. (

1) -

5--I- ().

.

(. .

NADP -

35.15),

NAD

2 (. 35.3),

5-

5-. ,

.

.

, ~,

, .
(,

17

5- u
( 3); u
- (, ).

(N-9),

5 (-4

-5) .

-.

N7

.
,

-,

NS,

NIO-Me-

-8

. :

. -4
-
-.

3.

( 6).

- (

7).

2 ,

8),

().

cn8

"

1'"

"

N N

10

--

35.1. '
.

10) N

10_

([10_

4)

-;

.
mn.I , -8,

2.
3

11)

I-,
-

(IIIIR; IP).

""", /

'7/

-5-

N....

....

')

. / .

/
N

n-5-

JH
N
I

9 2'
..

NH
I

1
../:...

(IMP)

-S-

n-5-

n -

1
-S-

11

.... ,
,

Mg 2'

n-5-

nrn

-5-

!'N

11

-5-

e n HN.... 'NH

5-

H2C~~":CH

\'@)

.- n .-n

N', N'-n-

",,_ _~:....

NH

HC~"
/
H2N~

n-~

-5-

~,..N

HN""" ' ,

n-5-

nn

..

+ ;

0)

1
11
n , ",

-5-

11
=, ",

N'C,c~'

11

-5-

H2

--20 '

. 35.3. de novo -5- (- ). P-PO~- 02

n-5-

;<

HC-N

n 8

/nl

..

-n

@J)

-n

5n

&

..

\ ) j Pi

CXN~
'1 '\
~.~~>~~--

n n-

H2

N 10_n_

-5-

H2N

n-5-

n8

HN""" '!~ \

11

o-~

~
n n
~

tp\ - 2

t1 I! --- .r,.".,.. ~,\

...

"C,,,,N
HC-N, ,
"11

-I

2'

g ;

-- 2

\)

1nl

H~

~H

-D-- -

-- 2

( ' N

(' NH, +

t...I

v.

;;:

00

n nll

(. 35.3) 8 2
NS, NIO-

NIO-.

NIO-

NS,

,
ND-

NIO-.

NS,

NS, NIO-

NS, NIO -

-'

( ,

NIO-

) .

de novo.

GMP

12

13)

IMP

, .
8


(.

35.3).

14

15)

N-I

(; ).

9).

, ,

IMP

14) NAD 2
IMP

~ ().
( 15).
, -

IMP

- - - - - - - - --

~N

N +

NH

HlN~N> -~: \" " ;~ n~=- -=:~ ~--"'~ :>


I
-5-

--. --

N~N>

NADH
++

n~7.:N~N>
N~-
N

-5-

-5-

()

(GMP)
.

35.4.

IMP

-5-

-5-

(AMPS)

N2

)nua) ~ ~_.~

(IMP)

().

35.4

(lMP).

19

( ).

()

20

35

"ne.

ll

(-

~ 2'.

=7

'\

-L-)

5.

-5-0]-L-)

-,

([62,

...

6-OII
13 14 GMP

14.

(.

35.5).

u -

35.6.

-
~

NAOPH + +

NAOP

2'-

2' -

novo 2'- .

de
2-

de novo.

5-,

novo.

BI2).

de

B12

~...

( ),

l"J ( )

NADPH

().
,'I

NADPH.

(.

\' - - . /~
r.--_ _ _ _
.---.

"--

.
,

de novo.

35.6).

10.

~

- . . . 8

-----------.'

JI "
,

5'-

.
.

35.5.

.
.

J. uUu1lu n u
-

m.1U n)'1l0~

NH 2

u nuuulO ll)'mu

21

.
(. 35.7). -

lll)' - -

IMP

GMP

(.

35.8).

, ,
.

PPj

2.

uuu n)'6 u60)'.lu



(.

35.9).
2' -,

, ,

2-0
3

1/"
I

H~

.'1

1-10

2'-

dAMP

2' -
2' -

2'-
dGMP.

,
.

35.7.

, r

-.

(.

35.10), IMP, GMP

HN"Y'
~NAN/

HN~N>

~N~N
___~~_.L,-_'----.. -o,p-o~/o"I

'\.

.'1

- - 2

1/ "-

H~_c~

GMP
.

35.8.

IMP GMP .
---. .

22

35
NH 2

()
-, -O~70'...!

ADP

~)

I 88 I

H~--c~

.

35.9.

-5'-

(, ,

), .


- -l-

2'-

-l-.

IMP GMP.
, ,

IMP

de novo.

IMP

12

13,

35.4)

.
. -,

-5' -,

IMP

de novo.

ADP

~MP

!81

(
8-8
88

()

>-

-1-

Il

. 35.10. . . IMP . , GMP;


. .
; -

dAMP

dGMP

n nll

23
IMP

.
,

2)

1)

-5-,

-,


,
,

(.

35.11).

/---Er-

I
I

i
I

- - - - -

J
GMP---'

1:

ADP

--~l

!
I

I
11

----

de novo.

I(

I
I
I

l_-0-~j

AjMP

~~--~

{--0--,

/}

GDP

'-----GTP

. 35.12. I
.
.
() ( 6 )
.

,
-5-

,
/'

"

J.... -~, \,

//

5-38

"

I
t

I
I
I

I
I

1\

I I
I I

' I
I I

IMP\

, \

\ \
\

'

'" l

ADP

/
GMP

I ,
I

-, ,
,

de novo.

I
+

de novo, r
(
)
. m

I ,

I
I

--

in vitro

\ \
\ 1

I
t

n-838
~ -,
1
"
n

--

//

/ I
// I

l //
!

GD,//

GTP

. 35.11. de novo.

. (6) .

GMP

(.

IMP
35.12).

GMP

I-.

IMP GTP.
GMP
. ,

IMP.

}.

---

IMP

GMP

,
_


. (.

35.13)

24

..

----.}#,........_--_-+-~ 2'dCDP ----.~ 2'dCTP

.
( )

I
I
I
I

11\
I I
"
I I /~
I I I

2'dUDP - - - -

I
(

I I

---~~i-----=--.~

2'dGDP

2'~

-0\

I ~--------------

()
.


, ,

.
.

I I

J
/-----------./

I I
I I

35.14) -

: i i~ . -.
,~
J
- - . ____________

UDP

GDP

(.

2'

..

/ (

10

,---------------_/

).


()

. 35.13. _'I
'\1u 2'. _l0

() u () ll
.

. SN]-
,

- .

99%

1200

866--1578 ),
541 687

25

ll,

2000

4000

, . .

, .

(. .

35.1)

31 000

HNYy~>=o

o',lN)..N

35.14.

600

24

18-20%

2 -

~8l

Jl .

60.111W n1l0 u n.1l06 ";u6

25

II ' -

llu

ll (

2).

u.

, 2 u

3).

NAD ,
( 4).

. ,
-

,
. .

, u 'u

.J.
(, ). u
r-

-
,
} u.

, ,

6). ,
UMP

400-600

LMP)

(,

. ,

u u.

ll ,

u .


-
,


, .
. ,

, 2

2~ -
( 10) , d

35.13).

.
(.

35.15)

(.

35.6

(;

- UMP

) ( 12) - u
.

;
( 9).

7-12). UTP

de novo,

yr

N5,

2~

N1-

N\

NIO- u

-5

dUMP.

, 2 ,

. ,

, ,

1).

dUMP

NS,

NIO-)

26

-1
CD

35

11

- -

~H2

+ :

,!, ~==:::::;;::=~.~

-?'I- +N' /
+

.........

"\P

11

- -

N '

j:

:~H2

'r\("

/ .....

,_ ~

'-

()

HN

cf

'N......

()

f.i\

NADH+H+

;r6
UMP

R5-

PPj
4

oJ....... N1
R5-

~L

Opotat-

HNJ
N

(i)
@)
80-

dUDP

UTP

dUMP

HN~CH
Ol......N)

I
dR5-

35.15.

\'V

UDP

NAD+

tH

n n m

27

-;===~==~/===::::;-__.

~====:::;;:=~\=====---.

UMP

lol-88

. ,

- ()

~--=----=::;..J
_____.

__

838

~_~

____



, 2'-

(.

35.16).

L=_____. dCMP

__

:J838

. 35.16.

, .

2'-

-,

. -

, ,

, , ,

de novo,

. -

, ,

(4-

N-l

5-

25%

-.

, ri .

,
,
(.

35.17).

, ,
.

- N- ,

. ,
in situ ,

).

2 , (-2)

, .

- - -.

28

35

HNJCH'

O~N

Y202~

~N
NADPH+H+

HN~
O~

NADP+

v-

NADPH+H+

~NADP+

HN~O~
~N

HzN
."..,.

'CH z

O>;'~N,CH2

(3-

(N -n-~na)
2

H2 N

COO-..,

..... '

-4n

~n

'

,C../N....cHz

O" .... ~

N +-z--

~~
-

~
(~n

~ )

Ir-------,I
C02+NH~

N +-r)-

~I
.

35.17.

8.

. ,

. --,

,-

-.

UTP,

, (.

. ,

35.18).

u pey~.

nypuox U nllu\Ull0 )'I

().

- - .......

'\

-- ......

~---.!

.
0

37

':

, u
u
u -

\:::.J

u .
(

ro

I
~

----;-

,
"

.6'

"

.... ---

, .

15

%.

(5,75),

)'

7,

150-200 100 .

UMP

+~;~;~ __i__t~~ __~_~~~


!

%.

/'

2-6

\.1 ,

+ -:
5-

29

UDP

....UTP .--

5,75.

\
\

'

35.18.

UDP

/
..-

, ,

dUDP

.
.
r ()'1 ()
. . 35.15.

. _,
,
, .

- ).

(.

35.1)

( )

(, ,

).

- u,

N-9

5,75,

N-I-IO,3.

, , . .

,
( ).

. ;

5,75

5,75

5,75

, .

, m
u.

. -

(.

35.2).

30

35.1.

35

V max)

"

-5-

1 )

1)

(- -); -

(-);

, ,

2,8-

; -

1)

(. GR)---

-
(

600 24 )
, . .
,

35.2.

(, ).

1.

. ,

. ,
(, )

1)
2)
3)

-
- -

),
- () (

, -).

6- ( ).
,

-6-

. .

J1U n u n u)'.lnm

.
,

31

,
.

, .

(-),

(-).

, -

-.

- .

Jl

(dGTP

dA ),

-
, dCTP.

-5-,

6-

.
12'

(
-6-
,

)
;

-6- ,
,

,

(. 35.3)

,

, , 2 , ,

(3-

. ,

, ,

, .

,
,

,
.

-,

, (3-.

N5,
NIO- .

, .

, h

).

BI2

BI2

(3-

. -

32

3S.3.

ll

35

(?)

, -

11

).
0,0-

. l3 (

, -

()-

(.

35.19).

( ).

. -,

11)
- (. 35.19).

de novo.

, , .

; , ,

(4-) -

.
,

, r .

-,

- n n6 Il.lm

,(
2

, ..
\

~OK'" "

33

, ...... 1 I

01\,

w /o~p
~

~,
~ I

,"

'"

UMP
()
- - - - UTP.---"t ' - (

"

UTP

\.----'-G,

",

dCTP.J

~OK~

t
2

"

--+t-....t...

..............

t
\.

"

---1.~1

;;!

.:

.".,,,

UTP

",

----

~~_

Jf'
YM~ )J

--l \

'-~(~--4---------~y

" V
/'::\ J

....,

."

"

~I l~

......

----j.~ dCP

.J

. 3S.19. . 1,
-- -. .
-, 11.
. 1
. 11 .'I
. . 35. 15.{Redrawn and reproduced, with permission, from Smith L. H.lr. Pyrimidine metabolism in . N. Ellgl. Med. 1973, 288, . 764).

. ,

( )

. ,

6- 6-

2 1594

, .

,
.

34

Ames . N. et /. Uric acid provides antioxidant defense in


humans against oxidant- and radical-caused aging and
cer: hypothesis. Proc. Natl. Acad. Sci. USA, 1981, 78,
6858.
Henderson J. F. Regulation ofPurine Biosynthesis, Monograph,
No. 170, American Chemical Society, 1972.
Henderson J. F., Paterson . R. . Nucleotide Metabolism:
Introduction, Academic Press, 1973.
Jones . Pyrimidine nucleotide biosynthesis in animal celJs,
. Rev. Biochem., 1980, 49. 253.
m . D. et /. StabIe mutants ofmammalian cells that over-

35

produce the first three enzymes of pyrimidine nucleotide


biosynthesis, , 1976, 9, 541.
artin D. W. Jr., Gelfand . W. Biochemistry of diseases of immunodevelopment, . Rev. Biochem., 1981, 50, 845.
Smith L. . Jr. Pyrimidine metabolism in , N. Engl. J.
Med., 1973, 288, 764.
Stanbury J. . et /. (eds.) Metabolic Basis of Inherited Disease, 5th ed., McGraw-ilI, 1983.
The/ander L., Reichard . Reduction of ribonucleotides. .
Rev. Biochem., 1979, 48, 133.
Wyngaarden J. ., Kelley W. N. Gout and Hyperuricemia, Gru and Stratton, 1976.

36


nn

. ,

6.

,
, ,

.
, ,

).

, .

-.

) ( )

1.

-l'

().

3'-

(.

5'-

37.1).

(.

, ,

2.

3' -+ 5'

37.2).

,
.

, ,

, , ,

(n )

. ,

.
.

3.

(, ,

).

4.

mo .

( .).

5.

-.

16

36

() .

()

I )).

(. ),

() ,

u-

5' -

(5'-

. u

).

IlO

3'-

()

, >,

u.

).

3109

(. .).

3000

, .

. ., , ,

,
, ,

10

. ,

1 5

10%

.
u

900/0

(
). .


.
,

1 .

(.

36.1,

. .

41).


.
.


, (

, ,
).

,
(100-500 . .)
(50010000 . .).

).

. ,

, .

) .

,
, (.

36.1).

, -

ull"mllx

37

5'

R8R

8R

30

--

----t'--___

8-

--

8R

30

-;.;n~~.J=~~
5'

8R

...-1- - -

'

'

8R

PPP~

8R

5"-

"-
---

8
0

~AAA---A

88R 8

...:.:-.-- - - -

l ()

_.-- - - - - - -

--------l---T-~;::::,-;H..~- --

~AA---A

_n

. 36.1. u u .
.
5'- 3'-. - ,
, ( ).
5' - , 3' - -

. , , l
. .

39 41.

5'- -

, 3'-.
. .

amilolique.faciens.

().

( 200
) ,

().

, .

(.

- ()

4-7-

EcoRI. EcoRII).

. -

(,

HpaI), ,


, (. 36.1). ,

EcoRI ,

Escherichia coZi, BamHI -

us

BamHI),

. . (

(.

36.2).


(. ). ,

38

36.1.

36

A

amHI

8acillus m/qufins

GGATCC
CCTAGG

f
!

gIII

8acillus g/obigii

AGATCT
TCTAGA

f
!

Escherichia

GAATTC
CTTAAG

EcoRI

13

t
!

EcoRl1

CCTGG
GGACC

Escherichia

245

f
!

Hindlll

"HiJemophilus

AAGCTT
TTCGAA

Rd

influenzae

f
!

Hhal

Haemophilus haemo/yticus

GCGC
CGCG

f
!

Hpal

GTTAAC
CAATTG

Haemophi/us parainfluenzae

f
!

Mstll

CCTNAGG
GGANTCC

f
!

Pstl

CTGCAG
GACGTC

Providencia stuartii 164

f
!

Taql

Microco/eus strain

Thermus aquaticus VTI

TCGA
AGCT

-; -;

G-

I-.

. (

1)

HI)

. .

Taq 1,

5 . . R, 6 . . RI 7 . . Mst 11. ,
-

5' -+ 3', JUl-


3' -+5'. ,

(. . Jl ).
,

N,

(44).

4- (,

G,

, ). ,

256

4096

39

"""" 

--1 J<

1 ham '.-! /G
~ -1 J--~tGGI~
'1tCCTAG G11--

"'""

--I/

c1~Hpa 1.~fG
~fqF
G

ifCAA

C-/J---

G(J--

().

36.2.

() (), () .

(46).

,
,

(.

36.2).


( . ).
,


(
JJ )

36.2. , . (Adapted
Emery . . . Page 41 in: introduction to Recombinant DNA, Wiley, 1984.)

and reproduced, with permission, [

5'-

5'-4

BAL-31

5'-,

3'-

; -

-,

111

3'-

5'-
( -)

--
-

; (

3'-

32

5'-)

Sl

5'-,

3'-)

40

36

. .

. ,

. ,

, .

1)

2)

) . ,

- polyd(C)-

3'- ,
dG. 3'-

r ,

, ['

r ,

- .

SmaI,

- 4

. . .,

fr-l

. ,

, ,

10--20

. . .

, >

- ,
. -

, ,

cos-f,

- .
,

30--50 . . .
. 36.3.
,
,

,
-

,
l, ,

. ,

. ,

36.3.

pBR322

n-
,

PstI- .

, ,

, -

1l0.lOu Ull1lm1l

41

838

8R 8

8R

83

838R

111111111

8.

..

38 R

-838

830

. R 83

8 83"
8

(88R 8 )

. 36.3. .
( ) ,
-. .
.
.

. 'I
, . (dd and reproduced,
with permission, from Cohen SN: manipulation of genes. Sci. . [July] 1975; 233: 34.)

36.3.

, ,

()

0,01-10 . . .
10-20 . . .
35- 50 . . .

pBR322

(.

36.4).

- ,
.
,

( ),

bI -_
, ,
.

. ,
rn , ['eHoRLI

.
.

.

-
(, SauIIIA).
,
,
.
bIX
,

( 20 . . .).
, -

42

36

,..-----

"

----.,

8 8e
8

Pst

830"

..

Pstl

Pstl-

18

8R 83 R22

8R 83 R22

36.4. Pst [-
pBR322. , , -

. , , ,
, . ,
, .

,
(.

36.4). ,
10

,
990/0 .

1500
4500
50000
800 000

coli

1)

(). ,

, .

,-

(. ).

. , ,

J: 99%-
J:

J:

l(1 - )
N=----

In(1 - f) ,

- , f-
J:. ,

3109,

l(1 - 0,99)

N=

2104

J:

2.104J)
I 1- - (
[ 3109

reHbl, J:
re-

, ,

(x J:),

36.4.

CTaBoJ: , ,

, ,

J:

, -

5103

2104.

1)

u um

43

()

(, ).

.gt

, .gt

11.

11,

-,

lU.


-,

. .
NaOH

, ()- ,


.

lU

-.

>,


lU, ,
.


.
32

. ,
,

.

.
l (

lU).
,

r,

, lU

uo

. -

. ,

15--20

) .
,

).

lU .
,

. .

36.5

- (
), - (
) - ( ).


()

, -

(.

36.6). lU -

44

36
-

:-

1
---

1
---

!
---

I11

"1!
-.-

111

.-....

36.5. -.

1"".....

.-.

:::] E::J

c::::Jc::::Jc::::J

C::::J

[:::::::;:]

8088

, ,

_1 "
. , , .
_ ,
. .
, .

. -.
.
.
. . - ( )
(- ). .
Jl .
. . -
.

.
.

.
I - -

1 3

36.6

10

1 8.

, . .

1l0u .wU1lnll

1.

( ...... 1012)

lC

( , .
. .)
,
"*
.

45

4. 4 . lC
,
1 '1 2 .
- lC.
.
.
. .

5'~__~~__~~__~~__~~__~~__~_'
'~--~~--~~~--~~--~~~--~5'

'19

~~

~~

. 2.

5' 3' - .

'

3.

UJ~u
n

PaClIJenJleHU~

sn~u
n

*~~--r------~--~--~--~--~---r--~---r-----'

)
. rCByeT
IC ( )
, .

5.
I . ll1 .
. .
.

G+A

G+A

HCXOllH(;l$1 g~m6m
*-;-G-T-C-T-T-G-G-A-G-C-T-~

l1erpagupOl1oNH",e
OCHOtJOHUf1

Orpe
. . ,
}.

. lC (-:

G--C)
.

36.6.

(~ ' IK)
-

46

1 3

1 9.

36

),

-
. :

. . .

( 4);
( 7);

). ,

in situ -

(.

in situ

16);

36.1),

. ,

.
(

, ,

).

. ,
in situ, . 36.5.
,
: ,

. ,
,

1.

, (-

-).
2. , ,

) .

-
0 .

,
(,
- ); ,


(, ).

).

( , )

3.

36.5.

reHOB

-
-
-

llp15
6p23-q12
17q21-qter
16pl2-pter
llpl2
20q13-qter

124

--

Xq26-q27

ropMOHa

13-,

CerMeHT

G8

,
. () .

6th ed. Johns Hopkins Univ. Press. 1983.

McKusick V. .

"dli

Inheritance i

"

u um

-+fj

fj

5'

'

G'Y

47

[] []

'

10

(jO- R
(jO-

.R

(A'Yhfj)O- R

13-

. 36.7. f3- , .
ll- - -.
- 5'-l;-G--",---'. l;
(a 2l;2). , (HbF, 22).

",13

( 2 2) 2 ( 2 0 2 ).
;
-, , . ( ) -

13-

[130]

(
-). 0- -
( -). ~ (~:rIiP)O ( )
( 111).
. ('li)- ~.
, .

(), ( )
( )
.

,


,

, .

36.1.
-,

(.

36.7, 36.8).

().

1 500
1 7 . ,

(.

36.6).

,-

1 9

: -

48

36

1
5.------------------~/~~

r r

~------------------

. 36.8. -. -. 5' - 3'.


5'- 3' -. 5' - 3' - 1 - 3,
1 2. l\. (8), 5'- .
nnsens- (/:),), , ( )
(). . .

(3-

36.6.

, 16-
, -.

13-

. ,

13- '\i

13-

130_

111

, .

, ,

-.

- 50

36.8

,
).

. .

-.

l~,

.;I

,

.

, :

, ,

GG

CCTGAGG

G G @
G GG

,
,

, .

P-JI
( ) -

Mst II

NAGG: II . .
36.1). Mst - (. 36.9)

.lOu. UllQllmll

" II- l3-n

ne

(5)

5'--------------------, ________1 5 _______


T
~

49

3'
~

POAOCnOBHbIX

AS

AS

SS

1,35

. . .

1-"

1,15

n _ .

AS

AS

f-

. 36.9. Il . ()
- Mst 11 (i) () (S) -.

Mst 11
1,15 0.2 . . .
Mst Il- Mst II-
1,35 . . . - (). (
:I 0,2 . . . .) . -
(), S- )[]) SS- (8).

(").

. -

).

(),
(AS) (SS)
(. 36.9).
,

Jl

' ll .

, ,

()

( -

50

36

). (.

36.9)

, (.

SS

36.1 ),


()

-.

(,

200/0

).

().

, ,

), (

1%

4,

16.

).

.
,

(.

36.5).

(, ,

) ,

350

)-

. ,

. , ,

, , -

5' - - - - - - - - - - - - - - - - - - - - - - i

1-----3'

~---------------~

2------------

3------4-------

5--------------------

*--

36.10.

. d

(*).

( 5'- ). .
. ( .)
.

2.

1.

5.

4.

l/ 6llm

51

. ( ),

. ,

( ).

. ,

(cos-).

.
()

-( )

in vitro

(.

55)

-. ;

, -

, (<<),

Escllerichia

,

.

-.
,

.

. , .
. ,

. -
, .

- .

. ,

, ) - (

).

. ,

-.

(, ).

. .

(, ).

(). ,
,
-. (,
).
,
.
. ,
,


mPHK- (

.
.

. .

.

-r.

.
.
(). .

).

. ,

,
.

52

36

ll. ,

3'-
.

. ,
,

. - .
. - .
. ,

3'-

5'-

. (, , ),
,
;.

. (
),

,

.
. ;
.

. .

3'- 5' - .
. , -

Beaudet . L. Bibliography of cloned human and other selected


DNAs, . J. . Genet., 1985, 37, 386.
DNA in medicine, Lancet, 1984, 2, 853, 908. 966, 1022, 1()86,
1138, 1194, 1257, 1329. 1380, 1440.
Gusella J. . Recombinant DNA techniques in the diagnosis
and treatment of inherited disorders, J. Clin. Invest., 1986.
77, 1723.
. W. ' /. Pages 275- 283. In: Thalasscmia: Recent Advances in Detection and Treatment, ., Carcassi U.,
Rowley . (eds.), AR Liss, 1982.
Lewin . Genes 11, Wiley, 1985.
Maniatis ., Frilsch . F., Sambrook J. Molecular Cloning. 2nd
ed., Cold Spring Harbor Laboratory, 1983.
Martin J. ., Gusella J. F. Huntington's disease: Pathogenesis
and management, N. Engl. J. Med., 1986, 315. 1267.
m . ., Sequencing the DNA ofrecombinant chromosomes, Fed. Proc., 1980, 39, 2830.
Orkin S. . et /. Improved detection of the sickle mutation
DNA analysis: Application to prenatal diagnosis, N. Engl.
J. Med., 1982, 307, 32.
Watson J. D., Tooze J., Kurtz D. . Recombinant DNA: short
Couse, Freeman, 1983.
Weatherall D. J. The New Genetics and Clinical Practice, 2nd
ed., Oxford Univ. Press, 1986.
un R. Structure and mechanism of multifunctional restriction
endonucleases, . Rev. Biochem., 1981, 50, 285.

37

ll


,

,

u -

.
:

HOM~PHX .
.

. ,

IlU,
(, ,
l' ), .

34.
3', 5'-

, u
(.

37. 1).

"J

u, .

..l ,
.

-( ),

5'3'-

-( ).

, ,

(),

()

( ,

).

(), ,

(G)

50-

. - .
37.2. ,

1944

. , ,

G-c

(.

37. 3).

. -

, )

(.

neBMoKoKKOB,

34.9)

. (),

(,

,-

G.

, .

34.3)

(.

37.3).

( = ;

G=

).

, , -

,..

54

37

5'
2

'

. 37.1. . (). (),


() (G) , 2'- .
N- . :
(. . . -

~, . .
3' -+

5' -+ 3',
5'.

5'-3').

( Z-).

( );

37.3,

2)

1)

, ) (. 37. 1).

. --{:
,

. ,

50%.

3) ; 4) (

() G--{:- .

vivo.

in

55

UYK.leUH06blX .m

,4

...
.

37.2.

2,

- . :

(-, -,

G -ry, -, -, S-caxap [). :


(Photograph from J. . Watson. Molecular biology of the Gene 3rd ed. Copyright 1976. 1970, 1965
Inc., Menlo Park, Calif.)

, )

3,4

8.

Z--

(12

w. . Benjamin,

) ,

(. ).

z-

, 1 .

( )

1)

, ,

2)

(. .

Na +

- ;

-.

4)

38); 3) g z-

-5 .

Z-

, .

Z-.

--.

- ,

- , ,

Z- . ,

, , -,

in vivo.

Z-

Z- - ,
,

5-.

(zigzg)-.

56

37
Z-; .

,
Z-.

()

,

.
,
-

.
,

,
.

N)

... m

. ,

G-

- (
), .

37.3.

(nmu

,lUl-t/)
()
().

2-.
D-.

-- ( -

).

16,6 .

,

, m.

--
-

m'

, , ,

(. ).

Z-

Drosophila (

Z- .

, -


, .

37.2,

37.1.

ll-


, ,
,

11

10
12

0,256
0,338
0,371

2,3

1,9

1,8

. .

39 41,

"1l06

, ,
, -
,
. ,

,
3'- 5'- .

.
,

57

(.

37.5).

,
, .

Escherichia


r.

()
( ).
,

( ,

- ), .
, ,

, ()

. ,


,
, .

-,

, -,

. ,
;
-


. ,

(.

37.4).

37.4.

(From J. . Watson. Molecular biology ofthe Gene 3rd ed.


pyright 1976, 1970, 1965 W. . Benjamin, lnc., Menlo Park,
Calif.)

58

37

8R 8R

37.5.

8R 8R

, -

(Redrawn and reproduced. with permission from Lehninger . L. Biochemistry 2nd. ed., Worth. 1975.)

. !; ,

5'- (.

, ,

1000

. ,
- ,

1.

( ).

, . , , ,

,
,

37.6).

2.

2' -

, ,

. .

, ,

. (

. ,

) ,

.
3. - (

, . .

, ),



, , ,

3'-

(.

37.7).

59

5'

/,

/,

/,

37.6.

(),

(),

(U),

() (G)- ,

, N- . :

4.

5'-

' - .

. (

(.

U)
37.8).

5. 2',
3'- ;
2', 3',
5'-,
- 2' ;

. ,
,

( )

().

()

(, ).

()

(. . ) .

, .

()

, IS: ,

()

, -

. -

,-

60

37
,
-.

C-G
C-G
G-C
A-U
A-U
A-U
U G
U G

: ( )
(), ()
().
.

() -

G-C

-
.
,

C-G

l1

37.9).

<),

. .

(.

5'~-C
37.7.

U-A
U-A
U
U-A

5' - 7, 5' 2' --


(. 37.10).
6 2' --
.

, ,

(),

(3' -)

(.

90

300

37.3).

5' -
5' -()

20--250

3'-

poly(A)- .

. ,
poly (). poly ()

, , ,

.,

oligo (),
.

- (
) -.


poly ()-)

- -

oligo

().

8- 5'- G G G G G G G G G G G G - 3'
- 3'- G G G G G G G G G - 5'

5'

pAUUGUGAGCGGAUAACAAUUUCACACAGGAAACAGCUAUGACCAUG

3'

(.

37.8.

-. ,

. -, 5' - 3'. ( 3' ( U) .

5')

ll "l0

61

'

'

5'

5' ______- -____________- - - -________- -__- -______

~'

n u

5'--____~~----~~------~~----~~
nn n,


38

37.9. mPHK-

I
I
-

~\

"'-/

H'HNNy:yN
N)
I
N

/ "'-
3\~ 7/2'

{NH

IlN~O

/ "
\7-7/
I

~/
/.
37.10. . 5 -
7- 5 - . 2'--
.

62

37

, ~ ,

( ,..., 80

25000

,
,

R
R

()

107,

2106.

.
()

75

'" 25000.

(. .

39).

20

. ( )

37.11.

-,

3'-

- ().

20

, .

T'f'C- (-)
(From J. . Wts. Molecular biology of the G 3rd.
ed . Copyright 1976. 1970. 1965 W. . jmi, Inc., 10 Park Calif.)
.

, (.

37.11).

, 'I'-

D- ( ) .

(5' --+ 3').

3'-

, (.

37.7).

(. .

40)

. -

. D-

- ,

T'I'C

mPHK-.

1 (75%

-.

3-5

tPHK-

13-21

37.2

4,2'106

80S

).

1l0

63

37.2. 1)

--------------------------------------------------------------

-35
-50

7105
1106

18S
5S
5,8S
28S

1,4106
2,8106

40S-
60S-

\)

7105
35000
45000
1,6106

1900
120
160
4700

(4OS 60S);

, , - (
).

2,8106 (60S), ,
1,41 06 (40S). 60S-

5S- (), 5,8S-

28S-,

50

. , 40S-

30 .
, 5S-PHK,
-- 45S-PHK,
(. . 40). 5S-PHK

.

.
.
,
,
.

18S-

37.3.

Ul
U2
U3
U4
U5
U6

165
188
216
139
118
106

1106
5105
3105
1105
2105
3105

()

4,5S
7S
7-2
7-3

91-95
280
290
300

3105
5105
1105
2105

90 300 ,
100000-1 000000 .

--

(
surs-- .

nucleic particles),

small nuclear ribo-

U7, -,
3' - .
U4 U6, ,
, Ul--

(. .

39).

37.3.

Darnell J. et /. Molecular ll Biology, Scientific American


Books, 1986.
Bunl . DNA Makes RNA Makes Protein, Elsevier, 1983.
Lewin . Genes, 2nd ed., Wiley, 1985.
Rich . et /. The chemistry and biology ofleft-handed Z-DNA,
Annu. Rev. Biochem., 1984, 53, 847.
, . Controlling roles for snurps, Nature, 1985,316, 105.
Watson J. D. The Double Helix, Atheneum, 1968.
Watson J. D .. Crick ... Molecular structure ofnucleic acids.
Nature, 1953, 171, 737.
Zieve G. W. Two groups of small stable RNAs, , 1981,25,
296.

38


nn

. ,
(, , )

.

-,

.

,
,

, ,
.

,
.
.
-

, . ,

5' -+ 3'.

1).

, - ,
,
.
, .


()
1 ,
(. 38.1).
I
<<
. l

.

.
(

).
. ,

.

: 2, 28, 4.
2 2

3 4
( ).

. -

1

38--41

( ),

,
.

n.'l

65

38.1. , -; 2.5 . (Reproduced with pennission, from . Oudet. . Gross-Bel1ard. . m: Electron microscopic and biochemica1 evidence that
chromatin structure is repeating unit ll 1975, 4: 281.)
, N-

, 3 2 -42 2-2

. -

. ,

, D-
( 2) (
). . ,

in vitro
2, 2, 4 ,

).

. 1

. 3 4

.
9

(3 2 -42 ). 2 2

.
3 2 -42 - 2-2- (.

(2-2),

[H2A-2]n. 3 2 -4:!

38.2).

2-2-

. l yr

3-1594

3 2 -42 -

66

38
.

+-----

-----+

, . ,

,

+ 1

-1

2 ,
166 ,

( ",)

(1,75 )

, .

38.2.

, -,

146

()

(),
,

2, 2, 3 4. l (

, .

ka-

10

2~30 . (.

sion,

(Reproduced, with pcrmisLaskey R. . and Earnshaw W. .: Nucleosome assembly. Nature 1980, 286: 763.)

10

2-2

, 3 2 -42 -.

, 1,75

( ),

146

(.

38.2).
:

(.

38.3).

6--7

30
(. 38.4).
,

. l-, ,

, ,

2-2-4-3-3-4-2-2.

l
2 ,

30

..

166

100

(. ).

, ,
-

, ,

30000--100000

, tt:

, , .

,
.

, ,
,

,

, . -,

.
-

38.3.

, .
l- .

67

YJOl
, .

, -

~c\------I--- Oc~ 80n

(reTepoxpoMaTBH)

. -

() .

(.

) ,

:
r
n

30

38.4.

10

, , .
,
(

) .

,
.

-.

. .

. ,

- , ,

.
, Chirono-

. ,

mus,

reHbI

(-

),

, ,

100000

), (,

1).

5-

(100-300
) ( )
1. ,

- 1 .

, , ,


(.

38.5).

, -,

(. .

39

41).

(.

38.6).

.
, .
-.

. , -

3*

23

1,7'107

3,5'109

68

16

38

38.1.

....
,.
.

38.5.

11

..

,,",

.,. h'I

(25-30

30

8000

()

,

, ,
.

30 ) Chironomus tentans

(10

. - (

~
evj1

'-

-1,0
2,5

1\1

':~\,.. ~

" R
.

....

'" 2

,.

.' .

."

(390 ,

11)

. 5

IV

BR3 -

3,5'109

23

. . .

IV

, 3_ _

;
. (Reproduced, with permission, from

Sass . PNA polymerase in polytene chromosomes. ll


1982: 28: 274. Copyright 1982 the Massachusetts Institute of
Technology.)

-.

,..

. ..

\.

1,5'1 8

..

..

"


8000 !

,.

,. _....

.- -:

25-30 )

.,.

) . .

, .

38.1.

1'.

...

"-

- (.

38.7).

38.6. 12-
27850). (Reproduced, with permission. from
Praw . J. DNA and Chromosomes. Holt, Rinehart and Winston, 1970.)

lC (

1t, t I

.,.

'.

,
" i .~" i\f
I
'"
,~

13

<#

I:!

. '

.. .

14

19

20

'~'I

15

21

t-i-....

12

.. ".

!,
18

17

11

16

"

10

:'

'"

\.:

..

~,

69

22

38.7. ( 46).
. (Courtesy of . Lawce and F. Conte.)

1,5

, R,

m sapiens 100000 .
,
, . .

,
.

.
,

,
.


.
,

tl,

, .
( ,

-,
. -
- 4000 .
( )

10000

15000

. ,
-

ID~ JVO (

).

, .

JVO.

()

1 7

70

38
n",,, cnprIIII ...

,
,

(r) cereHToB

reHoMe

15-7 , ..,'! .... )

r -______________

_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _,

~~----------------------------------~
~~----------------------------------~

'I1''

'''

'----~M_~

(). ,

(). r r

,'"

(300-600

, r

, r. 39.
.

, r

38.8. .
()

(''').

,
r (

),

MorYT

,
r


r
.

- III
(. r. 39). r
r

,

()

) .

reHoMe Alu,
500000 r re 3-60/0 r reHo-

r r (

. r (

r )
r, ,

()
. 20-30% reHOMa

r ,

5-500

MHoro

4,5S-PHK 7S-PHK. TaKoro

. r
,

Alu,

(LTR). -, ,
,

1 10

yr ().
r

reHoM.

reHoMa

(. ).

, ,

()

r ,

reHoM,

MorYT

1 (j

MorYT

re-

, . r

-- .

() rr

5000-7000
1000-100000

reHoM.

300-

(. 38.8). r

600

II

5'-,

r.

40.

, yr

MorYT

r .


r .

rOMo-

..........J:rr~.........

71

, , ,

38.9.


I .
,

.
,

.

. , .


, ,

(.

38.9).

(Lepore)

-.

(.

38. 1).

--~:::::=:=======


(
)

,
.

38.9.

, -

Gy

Gy
-..:f

Gy

--i

&

1--

Gy

t-

~
-..:f

1&8

. 38.10. . HepaBHoro
: reHbl - - -
. (Reproduced, with pennission, from Clegg J. . Weatherall D. J. J3 O-thalassemia: Time for reap-

praisal? Lancet 1974, 2: 133.)

72
.

38.11.

.
,


. ,

,
,
.

, ,

()


.
-.

,
,

, ,
-.
, ,
-.

, ,

,
. (
) ,
,

.
, AIu-

,

.

, -
.

.
5'- ,
poly - 3'-.


. ,

,
, ,


. II

I
1

nonsense-

()-,

(. .

40).

~A

38.11.

-.

I2

reHOMa (

reHbI . . ) ( re 1 2) reHOB
.

.
.

( ) S-

. (-

73

. n.

. .
.


,
,

cherichia coli

1.

E<t-

. ,

\
.

38.12.

1,

, -

1 . coli,

(Courtesy of

S. Wolff and J. Bodycote.)


(.

(10--200

38.13)

, (

, -

).

.

(.

38.12)

-
.

ll

3'(1-

3'-

, . ,

VL

C L,

(. .

41),

.
()

(.

38.J4).

3'-

. ,

()


, 3' -

1200

(. .

39

41).

. ,

-,

(.

38.15).

. -

74

38.13.

38

-
.

75

"';
.

38.14.

- -

--------------------------------------------------------------------5'
51---."--3'

IO..

IO.

"""1_...-._+1__- - - 100 .---""8ooI1 t--i

~......_-----..v .---------}

38.15.

. -r

. ,

5' -+ 3' (),

llll8

()

150-200 .

5' -+ 3'

JI. ,

3'-+5',

, , ,

, , -

38.16.

76

38

n n

3'

------:""~"""'----5'

5' ---------....

/",:!5'
,,-----------3'

~
~J

n n

38.16. . .

9 -

,
,

ori (

. rigi-).

, (Pol ),
.

()

Pol n
100 ,

,
-.

.

. ,

100.

> (.

38.17).

.
, .

ori

- . Pol n,
- (Pol ),

(. ).
. , - (Pol

.
,

" n n
"n pto"

'

5'

5'

'


n n

38.17.

..

..

ln nl

.
, . .

n
.

77

38.18. , -

'

O~

(Courtesy of

Alberts.)

5'

'

l---tP

= -------0
()

.."", ....

03

'

)0\

5'

3'

3'

lr!'-

,.."", ....

-------@

-.2

11
5'

5'

__ L~

!-

'I

8.8 ... l ....

", ....

. 38.19. , . , ,
-. d- -lI. (Slightly modified and reproduced, with

permission from Lehninger

L.: Biochemistry, 2nd ed. Worth, 1975.)

78

38

,

.

.
,

(.

38.18).

.---- --

(1

),

, ,

400000

/,

. ,
'

.

(-),
.

() ()

38.19

38.20.


,
. -
.

(.

38.21).

(. 38.20).
()

. S-

, .

. -

-, (

),

--,

S-.

, , ,

-,

-,

S-

. ,

s-

.
(
).

S-

- .

. S-

. (

. ~,

(,) (2 )

- , -

S-).

S-

79

ll n

104-105

)--======:::Jf--

: -

108-109
.

38.21. .
(S-) 01 02'

( .)

. .

coli

-. J1'a

3' -+ 5'-

-

.



(. .

38.2).

, .

,
.

(. .
).
,

.

:

.

S-. ,

, , ,

. N-

, .
,

5000--10000

( )

370 .

1.

38.2.

lllill lIm
.

. r

. ,

, ,

. -

11.

37,

111.

(.

34.7).

lI
. -

IV.

.
nll
.
. (.
)

80

38

,
.
,

II
.
, ,

N-

.
-

,
-
u

38.23.

- .

(. 38.22).
ii .
,

(.

38.23).

.

,
,

, .

n-

ATCGGCTCATCCGAT

I I I I I I I I I I I I I I I

TAGCCGAOTAGGCTA

, .

Ten_ ...opr

, ,
,

ATCGGCTUATCCGAT

I I I I I I I I I I I I I I I

. ,

TAGOCGAOTAGGCTA

=jIY_...-lf-rnoo_.....

I I I I I I I

I I I I I I I

, lOlC

!IVK_"I

.
J.1

, ..
lC S-.

ATCGGC

I I I I I I

I I I I I I

TAGCCGAOTAGGCTA

11 -non_.. + :noor...]

--------------------------~--------------------

ATCGGCTCATCCGAT

I I I I I I I I I I I I I I I

PIIC. 38.22. --lC


. lC

8.

(Courtesy of

Alberts.)

(D-)-.

NAD+

D-
.

D-,
np

)n. (D-)-

-(D-)n-

81

(D-)-.

poly

-l' (

-,

- ,

(,

. (

), ,

), ,

, ,

. ,

ll

NAD+.

(),
.
, -,
.
r

.
,
,

n ,

r 19
( ) n


(D-)-

.
n

, -,
,

,
.

w. R. /. Supercoiled DNA, Sci. m. (Ju1y), 1980,243,

118.
Cato, .

R. DNA choreography, , 1981, 25, 293.


Horz W., Zachau H.G. Chromatin, Annu.
Rev. Biochem., 1982, 51, 89.
Jelinek w. R., Schid . W. Repetitive sequences in eukaryotic
DNA and their expression, Annu. Rev. Biochem., 1982,51,
813.
Jongstra J. et /. Induction of a1tered chromatin structures simian virus 40 enhancer and promoter e1ements, Nature,
1984, 307, 708.
Kornberg . DNA Rep1ication, Freeman, 1980.
Lindah/ . DNA repair enzymes, Annu. Rev. Biochem., 1982,
51, 61.
Loeb L. ., Kunke/ . . Fidelity of DNA synthesis, Annu. Rev.
Biochem, 1982, 51, 429.
McGhee J. D., Fe/senfe/d G. Nuc1eosome structure, Annu. Rev.
Biochem., 1980, 49, 1115.
Nossa/ N. G. Prokaryotic DNA rep1ication systems, Annu. Rev.
Biochem., 1983, 52, 581.
/go-Keenes .,

39

-,


, . . .
mPHK-
,

(. .

36).

: , .
.
( ,

),

. ,

(.

37.8).

-,

L.

L .

. mPHK-.

, ,

, -

(.

39.1). ,

3'
5'

I f j~

5'
3'

e

39.1.

. , ,

()

U, L

- - -

L
,

(.

39.2).

ll n.
-S' -

83

,
.

39.3,

- .

-

39.2.

5' - 3'

ll

, .

PHK-.
(From:
J. . Watson, Molecular Biology of the , 3rd. ed.,
right 1976, 1970, 1965, W. . Benjamin Inc. Menlo Park,
Calif.)

- (-)

5'-3',

( ,

).

17

. 5'-

, -

. ,

5'-

. ,

. ,

, (

11,

7-

(.

5' -

37.10)

),
.

). -,

-.

coli

- - .
-

-,

, (J3- J3'-).

(-) -

-,

. .

-,

(-),

-,
,

-.
-

.

. 39.4.

- -.
.

39.1.

-,

500000--600000.

T'laBa 39

84

~ .....- - - - - - - .

,f

"

)5'

/ - - - - - - - 5 ' 111111111111111111111111111111

IR - I

I~I-~

3'~-----.....

-,

()

5,1J11111111111111111111111

::;-,
~

,Q

:r::;;;::u 11111111111111

(
I I
.

39.3.

-
/

':\Dl.
'<1

~ - I

. , -, -

-. ."I, .
-.
. . .

ed . Copyright 1976. 1970. 1965

(From J. . Watson, Molecular Biology of the Gene, 3rd.


W. . Benjamin Inc. Marlo Park, Calif.)

39.1.
-

1 ()

()

()

(10-8_10-9
II)

/)

5S-PHK

39.4.

6000.

, .
.

Jr,


(5' - 3')

(Reprodllced with pcrmission from MilIer . L.


R., Portrait of Gene. J. ll Physiol. 1969. 74
[Suppl. 1]:225.)

85

- -.

.

.
, ,

- (

),

) 6- -

G-.

, -,

39.6,

3'.

- r

coli

-,

Amantia phaloides,

- (- 11).

-

(. .

39.1).

40 ,

-.

-,

III8

39.6.

-,

, -.

-,

, ,

. ,

40

(4

), .. ,
-

. .

, ,

5'-

, .

35

.
,

39.5.

---~.~
..

........-------

........- - - - - -

8 ..

--------------....(11)-----'
.
5'

5'_-_-_-_-__G__G____-_-_-_-_-_-.:_-_-_-_-_-_-_-_-_______-_-_-_-...I-:"~_-_-

.. '

-5

-10

..

..

f-.- - - - -

+1
5'

~ ~,

. 39~. ICl ,
IC 5'- ,

+ 1.

35

86

39

TCGGGCG!
~CGCCCGAI

------------~~:A~G~C~C~C~G~C1:----------~_1.GCGGGCTTTTTTTTT-----------


~---------------------------------------------------

"'" .;:,.vuuuuuuu /
~.,..
"\

<..:1

t5

l'rTI'''\

~<..:1

U<..:1
<..:1U
U<..:1

. 39.6. , yr
- (). -
, .

5'-,

32-16

-61

-47

-105 -80

AAAAG,

- ( ),

10

10-20 .

. - 11, ,
-

32

~ecMa

(.

39.7).

, -.

5' - 3'-

, ,

, ,

, .

(.

39.8).

()

, ,

. -

5'

' -

( (AGGACI

AAAAG

c===____________________________~'(C)

- -1

-20

-10

-1 +1

(TCCTG)-~t=

4 5 6

5'. A(UCCUG)

7 Gppp A(UCCUG)

-ctl=:

-qt=

________________________JI

39.7.

. - -

11

-, ,
-

32

5'-

nll

(+)

"U pstream"

(-)

()

39.8.

..

Ii

+1

.. ..

87

()

..

, ( ).
, . ,
. - , ,

. (upstream) ,
. -,
.
, , ,
( , , ,

). ',
. , (
). . ,

5' - 3'. -
5' - 3', .

, .

(. .

3'-)

m
JI .

( 5'),
( 3')
.

u-

.
,


.
(.

39.2).

39.2.

',

11

(, , ,

TGG(N)6_7GCCAA
GGGCCG

, . .; . .

NF-I ( 1)
SP-I
NF-A (

.
,

44).

Zn +)
2

(Cd2 +

().

,
,


(
,

, ).

,
, , ,

CNNGAANNCNNG

<I>aKTop

GRE)
GGCCACGTGACC

USF (5'-)} MLTF (

88

39

u.

. .

. .
tPHK-
. ,

tPHK-

11,

3'-
. ,

~-
1000-2000

,
.

. ,

, - .

3'-

, ,

, -, '.

-
,

3' -

5SPHK

11

75%

AAUAAA

AAUAAA

15

3'-

50

5'-

, ,

.
,

3'-

(. ).

, .

- - 111,

(, . .

(. .

, ,

37),

(. .

'

, ,

(. 37.11).
in vitro ,

DHU-

38).

.
,

3~0

. , ,

10-

16- .

5S-PHK,
- 111.

-.

u. ,

(. 39.9).

111.

mPHK-

( )
(.

39.1 ).

npolIeccull.>

89

10

~_ _~_ _~I_ _~'_ _~'~~_ _~~~~~~_ _~'_ _~

...

______________~I~__~I~I~I_IL_~I~I~__~__.________
L
12 34
56
7

5'
I

'

5' 'l()
",

.,. . /

.,.'"

""

.,.

./

h" ?, 3 I 4 ,5

""

",

1':"
47

6~
t

232: 412 : 673


283
530

12~3
t

829

~
.

39.9.

"

7 " I Poly(A)
1872

Il

()

. . .

7.

L-

3' -

.'Ia

; :, , ;I -.

. .

Ul)

poly

n (.

. ,

. -
5'- 3' .
U l-
in vitro.

5'-

. .

39.11).
UI-PHK

U l-

, .

. , -

. ,

5'-

2'-5'-

. 28-37
3'-.
JJ

39.12.

AGIGUAAGU

5'

UYUYYYU CAGIG

ll"I...I------------:I.~, '

90
5'-

39

,,

A-G G

'-

. - .......... . ........ .

~.U-G G-A-C-U-Y_ _

\).G~_U-~---U-G--G-G_cr-lJ-"'_lJ
...

/
~

~-G-.<4

,,

..;.

1-

"v

39.11. . 5'-
U 1
3 - . U l-PHK . ,
, , G ( ).

@GU-------------G-G
iI

.
- .
.

GU ---___11--------G-Q

,
- (. .

41).

,
, ,

.
,
f3-, .


-,

'b/

J3-.
AG

v~

. 39.12. -.
5' -

. .
.
-, ,
, .

()
,

5'-


3'-.

polyA

3'-

, .
,

2' -

N6

91

. 5'- , .

10---40

- .

r ,

poly

, ,

, ,

, .

polyA-

3'- .

t'/2'

poly

-, ,

-- .

. .

6 .

polyA-

i.

poly -
( 2-3 ),
.

3'-

()

( )

, ,

5'-,

, 3'-

(.

39.13).

, ,

lll,'

. !
.

18S-. 5,8S- 28S-,


5' -+ 3'.

()
, .

37

40.

45S

. 4SS- .

(<<

28S-,

) .

65
5

. 45S-

-,

. ,

. ,

92

39

___
-

..... - I("

.)

45S,PlW_I(

j
32S'Plw_I(

JL", 1.
-LL
!
185

5.85

39.13.

285

-.

.
.

(Reproduced, with permission from Perry R. .: Processing of RNA


Rev. Biochem. 1976, 45:605.)

. ,

, .

(.

39.13)

, 28S-.
. 5,8S-

3'-- 5'-- ,
,-5'-- 3'--.

60S-

18S-

, -

40S-

. ,

"tI,

, ,

, . '

. ,

; -

(),

, -

u1tm

,
.

.
, .

36.1.

-

(3' -+ 5'

5' -+ 3').

3' -+ 5'-


,
.

93

Beathnach R., Chambon . Organization and expression of


caryotic split genes coding for proteins, . Rev. Biochem., 1981. 50. 349.
Bush . et /. SnRNAs, SnRNPs, ;t:ld RNA processing. .
Rev. Biochem., 1982, 51, 617.
Chambon . Eukaryotic nuclear RNA polymerases. . Rev.
Biochem., 1975, 44, 613.
Cordil1 J. et /. Promoter sequences of eukaryotic proteincoding genes, Science, 1980. 209, 1406.
Nevins J. R. The pathway of eukaryotic mRNA formation,
. Rev. Biochem., 1983, 52. 441.
Ruskill . et /. Excision of intact intron as novel lariat
structure during pre-mRN splicing in vitro. . 1984.
38.317.
Sharp . . the origin of RNA splicing and introns, ll.
1985, 42, 397.

40

: ,

G,

, .
, .

m
. ,

.
: ,

5' -+ 3'.

()

( ),
,
(),

.
, ,

, .
.

,
.

. ,

. ,

.
,

- ,

.
, ,
, -

,
,

.

mPHK-.

KooH

, ()

. ,

. 8 -

I\U

,
(). ,

40.1.

95

)\)

().

,
, ,

- ,

.
20

. ,

Phe
Phe
Leu
Leu

Ser
Ser
Ser
Ser

Tyr
Tyr
Term
Term

Cys
Cys
Termt
Trp

Leu
Leu
Leu
Leu

Pro
Pro
Pro
Pro

His
His
Gln
Gln

Arg
Arg
Arg
Arg

Ile
IIet
Met

Thr
Thr
Thr
Thr

Asn
Asn
Lys
Lys

Ser
Ser
Argt
Argt

Val
Val
Val
Val

Ala
Ala
Ala
Ala

Asp
Asp
Glu
Glu

Gly
Gly
Gly
Gly

"

20 ,

.
,
. ,

, 16
(42) ,
, ,- 64

(43)

, ,

.

.

1)

, ,

: U ; - ;
; G - .
-UG -
; rm- (
. 3).
2)

AUA

Met, UGA - Trp,

G GG

64

,
, .

(nonsense)-

. ,

(.

20

40.1).

UG- U- -

. ,

(.

40.1)

16 .

64

, ,

. ,

U,

G.

CCN,

_ .

16

96

40

R.

. ,

Pf

(3'-)

( )

i{

20

( ).

lf,

.
,


.
-

Jll(

tPHK-,

. ,

r -.

-. ,

- k
20 ,

i{o

20

--.

. ,

- (.

, tPHK-

.
.

40.1,

AUA

Met,

UGA

Trp.
UG

40.1),

3'-

U,

,
. 37 . 37.11.
-- (",)
-
.

--.

tPHK-,
,

UG- U-

. ,

. .

AGA

AGG

22

, 31
tPHK-. ,
, -.

7
(. 40.2).
,

3'-

, ,

(, ,

5'.

5'-,

z), , -

,mm 6_1 11 umuuu

97

- R---..,-------I~

11

11

H N
2

( )

()

------R

>-<

NH

'

'

()

40.1.

-. --

-. -- -.
tPHK-. , .

3'

..... 5', 5' 3',

AGG

, }}

GGC

GGA

5' -
GGU,

}.

() ,

(1) -

AGA

3' -.

(TPHK cvs)'

5--------------------------~ U8 U
8

.u

'

5'

'

40.2.

~Phe

. UUU- . .

(), .
. . , d
: (N)~ ( *); (. .

() (

4 1594

3' -+ 5').

Z):

611

98

4()
<l .,

-~),

:l. bll .ilii,

Il lIJl.JI

II . .,

\11\1

10

<l. r

<l

() ll.

.'l . (l

. <l .1() 3(1-

mPHK-.

<l

. l{.
;

3)

MYT<l-


-.

:II u .,.

. . :

: .

('lIO
II (l II

. ()

:
.

(. .

!\

(.

40.3).

-I

6).

_mllU "6.lm 6 '<'61/0.

. .

. MYT~

1)

. .

. ~-

67

) ;lO

<l ~- .
67 ~-

. -

2)

-,

67

~-

. . -

GAC

..

40.3.

.G

GAU

<l GUU
GUC.
GAA GAG

GUA GUG. (l .
67 ( GCU; GCC; GCA
GCG), J:eo

(GUU; GUC; GUA

GIJG)

(.

40.4).

6eJlKa

()

(3-67

(3-67

(3-67

(3-67

GAU

GUU

GCU

GAC

GUC

GCC

GAG

40.4.

GAA

99

GUA

GCA

GUG

GCG

- 67- ,

, _

, -, OAa-.

GUA

GUG.

67

GUU

GUc.
(.

~-

40.5,

. -.

- ~-

. -

. -

. (3-

{3 -

S. (3 -

. -

(60).

40.5.

-61

AAG

lX!

AAU

-6

GAA

GAG

! ! !

-68

GUA

GUG

CU

! !

UAU

uAe

-, - .

. -

- : ,

. - , , -

111,

100

40

-,

. u

61

- .

AAG

- (.

40.6.

- .
.

lt -II.

r'r

(.

40.5,

).

1).

U .

, ,
,

- J3- l'

u.

Jl

, ;

GAA

GUG).

GAG

GUA

- (

, u (

(1 .

),

-.

MlIccehc- (.

40.5.

(.

40.6,

4).

-.

. .

u. .'III

~,

Fe2 ".

-.

u ,

Fe

(. .

6).

.
,

4,

!\ .

. u

.
lO

u (.

1),

40.6,

u. ,

.LI.

, I'O,

-.

(.

40. 6,

3).

-,

ro

(.

2).

, u,

40. 6,

, ,

. -

i'll

101

I l

UAG

UUUG

AUG

GCC

UCU

UGC

GGC

UAU

AGU

AGU

UAG ...

Met-Ala-Ser-Cys-Lys-Gly-Tyr-Ser-Ser

STOP

AUG

AG ...

~ 1II-1\1

UAG

UUUG

GCC

CUU

GCA

AAG

GCU

AUA

GUA

GUU

Met-Ala-Leu-Ala-Lys-Ala-Thr-Val--Val-Ser-

~~------------------y~----------------

2lI-l!

UAG

~?
UUUG

AUG

GCC

Met -

UCU

GGC

UAU

AGU

AGU

UAG ...

Ser

STOP

UAG

UAG

UUAG ...

AGU

UAG ...

Ala-Ser -Lys-Gly -

Tyr -

Ser -

AGG

CUA

3 ' (+111

UAG

UUUG

AUG

GCC

CUC

UUG

Met-Ala-Leu-leu-Gln--Arg-leu

STOP

'~----------~y~---------~~

UAG

UUUG

AUG

GCC

UCU

UUG

AGG

UAU

AGU

Met-Ala-Ser-Leu-Gln- Arg--Tyr-Ser-Ser

STOP

~--------y~-----~)

40.6. J"I

, . BCTdBOK .

. tPHK-

- .

, . ,
,

,
-.

5' - N-Q
5' --+ 3'

()
. . 39,

5'- .

39.

,
-

, .

102

4()

.l

, :

, .

N- 0-

. Jo
(.

40.7)

mPHK- 5/-
, (.9).

' (.

40JH

r,

40S-

80S- - .

. ,

- !.

AUG.

18S-PHK

() 40S-

, .

40S-

- f

GTP

(-2). """

1 (-l)
40S-

.
(-l, -2 -)

GTP

60S,

GTP.

(-1)

GTP

-1-GD . .

-I-GD

40.8,

-] -GTP

GTP.

- -

-.

. l

(-3).

-,

-,

-.

.'l -

S- .
.'I-

80S- .

~,

. (-)

, -.

,L.l

(-) -,

-.

GTP

(--2) "
[-

- [

GTP. ~
GDP

-, - .

-2.

. .

-. -

, -,

. ,

16S

(18S)- .

. ~ - -

- -

- - -

N--.

GTP

GDP.

GTP GDP

- ,

N-

.
, N-

ADP

poly

t:::=:==tl:t:t11==================~1 ' (Al n


AUG
+

- 3

I
5"@)

I '

+.+

GTP

GTP

-2

Met

Met

-----_/

8-{

- 1

5'

~========:::J '

- 3

Gm

- 1

5'

q:~I=I=====+===================:=:J 3' ()

40.7. , 5'- 3'-poly -. -I, -2


1,2 3 _ Met

-3-

-. - - - .

104

40

GTP_t+
GTP
-1

GDP

GTP

5 =:::====t::::t:t:t:=t:I==*===== '

5'

Pj

=====t==***=#I===t=====::I '

GDP+

6+
-2

40.8. Cxcl\.1a '.' _

d l

n-l. . n

+ 1 . 11- :l

. -I -2-

105

ll111l'1 6.I1 u lll'1nlluu ('

GTP GDP,

. .

ll I" ,
.

:.: .


(.

u ,",

40.9)

. CJfl

, ~:.

. ,

-.

- ,

(R-

). R-

GTP

. l

-.

. .l0

(. .

80S-

40S-

60S-,

. .

51.4

51.5) .

...1

np ..1.

, -

. :1I0

- -.

N-

. -

. .;1

80 .

i: ,

( )

IIOJl.

),

,
( , ).

1I N-u
. ll

:l

100

, ,

(. .

56).

. ,

bJ

KOBaJ'IeH . ,

(). ,

,> . ,

J ~l

, [~I.

..1II (.

170S

37.
80S) ,

~ -

1 ,

42).

. I I ,

II

l ..

(-

),

u
Jl ,

106

40

(-)

Gm -5'

GTP

5'C=======~==~~~~========~

=================:::::::1

-5' '

GDP

Pj

. 40.9. _

- - _ --
2- N N- - _

ClIlIlI/e J
.t

40.2.

u , tI llmll,

\07

1 .1

)
(..1-

I U!lilJ-

IIUU.

lI
.l0

') .1lltll.

+
+
+

')

.llOIII~
.l0

+
.)

.,

+
+

+
+
+

+
+
+
+
+

.)

')

.)

1l0 1

.)

III
\-
J.(1\,

f.1

NH2
~
~N
Nx:

."lt

.l0\tlfJl

' II
lI

Ci ~1

+
+

I'pcll l

+
+
+
+
+

+
+

I )

- 0- - 0- c~z

11

<t;

<

0-

. ["l.

40.2,

,
, r

NHz

BbIe:IeHbI 1 .

= -~H-c. f

. ll ',}:lll

40.10.

;J.JI ().

3' -

-.

rOJlbKo ().
II,

40.1 ,

I1

[ ,

ll.l0

-.

-u

[(

ll u

ll

. UII - l
[ l l' l l.
JI

,
.

' . u

[ l1u

COI"J"llebucte,"ium l/ip/ltaiae.
D- -2
. u -

2 ,

. r .

(, )

10.
rII
J. ,

-2

lt.

ADP-

Bare" . . t!f /. Dit

pattern codon recognition


mammalian mitochondrial tRNAs, . Natl. Acad. Sci.
USA, 1980. 77, 3164.
CaskeJ" . . Pcptide chein termination. Trends Biochem. Sci.,
1980. 5. 234.
[[ J. l /. Molecular ll Biology. Scientitlc American
Books. 1986.
D"ake J. J' Ball= R. . The biochemistry mutagenesis,
. Rev. Biochem, 1975,45, 11.
f(gl . . Molccular genetics of human hemoglobin synthesis, . Intcrn. Med., 1979, 91, 605.

108

Hese/kko", R., Rothman-Denes L. . Protein synthesis, .


Rev. Biochcm .. 1973. 42, 397.
Hunt . DNA Makes RNA Makcs Protcin, Elsevier.
1983.
>}';n . Genes. 2nd ed., Wiley, 1985.
Roth J. R. Framcshift mutations. . Rev. !, 1974. 8,
319.
Schaj"ritz D. . et /. Evidence the l M7GS'-phosphate
group in recognition eukaryotic mRNA inhibition
factor IF-M 1, Nature, 1976, 261. 291.

40
Sch/essinger D. Genetic and antibiotic difiti of protein
synthesis, . Rev. Genet., 1974. 8, 135.
Shatkin . J. mRNA binding proteins: Essential factors
initiating translation. . 1985. 40, 223.
Weatherall D.J., Clegg J. . Thalassemia revisitcd, , 1982.
29,7.
Weissbach G.. Ochoa S. SolubIe factors required [ eukaryotic
protein synthesis, . Rev. Biochem., 1976, 45, 191.
U'ooll. The structure and function eukaryotic ribosomes,
. Rev. Biochcm, 1979, 48, 719.

41

41.1.

\.:

))(II

Il . .
Ll

1IerCl

[CJICl

J I

[ _[

u.

(), (
)

II '10 :\1,

..1.

!Ju .

,
.

rOK ,_1

Escllcricllia co/i.

1000

"] .

. -).
.

. .

~I

HCI-l (.

41.1 ).

"

. t

LI

. u

. IIOI.

'J

:\1ll

roB

'l

: . "(

. , .

r"

l\

. .

u-r .

)'u

..J: rI\I

I"

IIu .

. . t

ll

l.

rora,

. ,

1. u u

. l"

. (

reMa

" J

" 1 . . 10.)
l .

. u

110
s
s

u
u

41

' .
.

)S

::
::

cu

L~

::

ID

cu

8.

>.

'-

s
s

u
u

cu

.
:

"

)S

11

::
::

cu

L-

::

ID

cu

8.
>.

1-

s
s

t----

..j

; ,

cu

)S

cu

::
::

ID

8.
>.

t--i

41.1.

"

(, ).

41.1.

,
..

. ,

cu

20

u
u

. ,

, ,

. .

10,

, (. .

44).

. -

Pt'<'Y./!IU."

111

}1(('I1Cl <~t:I/()

j-

Ij- I

..

'

~'I\'f

OJIIIO '

t).

(AUG)

(UAA)

. 00.lIl OlI .

l.l . ~ ,

:,I 3 _1l ;10 / ,1 ro I f] !\.1 ~-:.

41.2.

'lI.


III~ l.

lO

) _l. }

.'I , ',

-,

. COOTBeTcl u

1,.J.u

l lII I\.

10--100

(. 41.1). ()
II

.
.

I'EHOB

II

-
(,aC-ll

1961 . }
1

I' .

:u ,
l J'l"1'-1

() . li.
, _l ,
.

(.

"lJ. (

41.2).
LacZ)

.
. coli .
,
.

,
u

.
. ,
. L-

. ()

. ii

( )

( ), u

~ !

. } 1
~1I J"
L- (.

41.3), l'

;I

I"

\..

Lac-

"}lllO 10
.

~ 1111111111111111111111111111111t====J

ll

~ , -

41.3.

L-.

112

.l

41

(Z, , )

- -....~

()

CtYi) /

~cbo 1

1701

41.4.

Lac-. () (r

i),

. -

<l

Z.

, . ()

CAP-Jl - l

Z.

, .

'I.10.1 - l. .
.

L-.

Lac-

JI .

, .

. ,

- ;-

(Kd

-
'- - ( .

bolite gene activator

cata-

ti)-1 .

10-12

38000.

/). JlOKYC-

27

21 . .

(.

).

):

Ol L-
(.
OI~

41.4).

L-

5'- TGTG~G~ G ~ATAAcAATT


'- G ~T ~TTOTT

113

17

Lac-

Lac-

).

17

II

()

.
, 52
. . .

, -

, d

- -

17-

L-.

6-7 .
74--75

. - -

53

58)

z-

-.

(.

41.3).

CAP--.

z,

. .

Z, -.
20-40

L-

, .

L-

Lac-

. ,

1-2

Lac-

, )

L-

-.
.

(. ),

L-.

L-.

, .

),

- .

.
,

- ().
.
,

. . l

45000 (. 41.5).

JI

L-

-, -

- -

5'-

lll

114

'L

4/
, (. ).

wlh': JIIf.

(d

100

,
' .


l .

, /~

G;

( ) .

l-lIl

rpUHc-

u .

~
~

6~O)

/ \

'

iUR

41.1.


~ : .

. ~ .'1or
( ) (

) :1r\1

.

\~~~!fIt

-:
~

~-~-18~~-"'<fQj-~

~~
\

~ , .

(:>

lOG )

\~~1

u
,

d (OR) (.

41.6.

).

OIl rop lll }'

41.5.

E.coli

(1).

- ( .luu)

(2, 3).

(4, 5).

, u (<<) ,

. 1
1

(7).

It

I"{BYX

Johnson

(10) d
(Reproduced. with permission. fom Ptashne .,
., . genetic switch in bacterial virus.
Sci. . [Nov.] 1982, 247, 128.)

ero

l'eH ero -

, .
-ll,

,
,

(9).

. . pe~

l,

, l

lO()

(8).

, .

(6)

. . .

u
,

17
41.6, ).
R1, R2 R3

.1 ,J

(.

-
-

ero

.l.'ll :nuu //

115

<<<XXIC~ OOCXD!

_-------3

<I0OI i

-------1-------

-_ .... -_... --->


_...-- -I

... ---: --- --t ~ t t


f
I

41.6.

i
G

t
s

f 6

!s , 2 , !,
I

6 8 f
I
I

t i
s

I
t

n n (OR) (

). -

80

. . .

.iJ - () cro (). .


u

0R 1, 0R 2, 0R 3. -'l 17 .

, . , . .

-. (Jlllum.llIIlU),

. . J1

Johnson

. , . .

gcnetic switch in

0R 1. (Reproduced with permission fom Ptashne


bacterial virus. Sci. . [Nov.] 1982, 247. 128.)

.,

OR2. 0R2

- .

, . .

(.

41.6,

).

236

- ,

N-

OR2.

OR2,

-,

. , -

MOJle-

, ,

, (.

ero,

41.7,

-).

r-,

66

, .

(.

. ,

(. .

r-

, ).

, .

.
. -

0R1,

47.7,

OR3'

1\1

41.8).

OR3.

0R2

0R 1

(.

OR3.

. -, -

ll . ,

,
,

0R 1,

80-

, (.

41.8).

recA- -

116

41

132-236

NH 2

1-92

41.7.

236

, - N- -.
. ().

() (). J1. .
- ( ).

, I OR 1 (8).
(mum ) } N'KoHHeBbIX ,.

(n -

. ; r ' . .

0R 3. (Repoduced with issi from tsh .. Jhs .


terial virus Sci. [Nov.] 1982, 247, 128.)

N-

.. . . gti

switch

i -

, Jl OR2

r-

cro-

OR 1.
OR 1 OR2 . -

r OR3'

- 0R3

OR2. uu

--R2

r- OR 2,

(.

41.8.

OR1.
r- OR3 r

cro, u

41.8).
,

, d-

. (

0R 2.

OR 1.

OR 1
0R 1 0R 2.

() ~ .

- -;!
( ). 1\1 J1

( ), r (

) 1
. ...!,

rec

HapO::lUOTKe -. .
KOI J1\.1 :l)'

. lhl , .J,

l, . u
- 01\l10. .

, -.l.
f-

OR 3,

.'

. , ~

. . IJ. .
.

(Rcproduccd \\'itll pCflission from Ptashne ., .Jtl~I1


tic switch il1 bacteriai virus. Sci. . [Nov.] {982, 247, 12R.)

. .. . .

gel1c-

117

'

ero

ero

. (1)
-

,1_.

121

R ,

~."

?V:;\\

\\\ \\::\\ \\}>:\\':':~


I

I I

.........w.ro...

'~

__ '

ero

'

'~~'
~~

\~~~~~~~~
I

----~~

I I

vv-.
I

ero

118

41

, "II

Trp

-,

. ,

. .

. ro-

_____

, !\1

0R 1

...

l':

r-, -

I ~p_.o""

TrpEDCA

0;:;\

TrpL

~--'-----~I----------~---=-

41.9.

)_li::l !1: CTpYKvpHe rt:HbI

co/i.

Ttp-

Ui::lU i::l ()_l

0'\f-1\1. ~i::l ,IJIIl ()

aTTCHYi::lTOPOM .l 162-ii JI.LI.t:

_'1 Trp

_1 i::l1, OC~

L.

:1. .'1

t')

, ,,1 :\1

u .

. (Rudud \vith pemlission f lOf"sk .

tion in cantl"ul uf expression of bactcrial operons. Ntl 19R 1.

289, 751.)

,
,

, \

II.

<lU

<l () <l.

, u,

u ..].

. u

u .;:II

()

.10 . ll

'\1 .'1ii lI .I

u ,

<l

1 .

,.10 <l

u,

li

l-.

, , , u .

(Trp)

41.9.

(Trp)

) .il [..J

, I1l.

140

<l

Trp-0'\10 -.

u u,

.l <l

: u ).{,l 90-

L-. r-

70-

, ,

5' - <l 27-29


cTapToBoro AUG ,

(.

41.10).

8 10- Trp-MPHK.

llOI I'

. li
, u J
u ,

ll

, -

, TrpL- (.

41.9)

14

. l
,

54.

Tp<lHC-

10-

u .

Il I.,.

l'<'.ll

119

Met Lys Ala Ile


1

Phe Val Leu Lys Gly Trp Trp Arg

49

20.

hr

Ser

69

PPPAAGUUCACGUAAAAAGGGUAUCGACA~AAAGCAAUUUUCGUACUGAAAGGUUGGUGGCGCACUUCC
80
1QO.

~ACGGGCAGUGUAUUCAC~UGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU
140
160
180
UUUUGAACAAAAUUAGAGAAUAACAIAQGlCAAAACAAAAACCGACUCUCGAACUGCU- . - .
t
Met Gln Thr Gln Lys Pro Thr Leu Glu Leu Leu ..

.

41.10.

5'-

Trp-MPHK

140- . 3'- . 3'-


90- , , .

AUG

(AUG)

(UGA)

(Reproduced with permisson

Yanofsky

Attenuation in the control of expression ofbacterial operons. Naturc 1981


289, 751.)

TPHKTrp ,

,
.

140-


Trp--r , r-

. ,

90),

70)
TPHKTrp.

- (

TPHKTrp

(UGA) 2,
1 2.

. ,

-.

140

, ,

2 3 3 4)
, -

(:

U,

1 2, 3 4,
(. 41.11)

: ).

41.12

140-

140

, .

Salmonella typJlimurium.

col,

r ,

2 3

3: 4.

r- (.

41.11,

1
3

),

120

41.11.
E.coli.

rp-

His:

Met-Thr-Arg-Val-Gln-Phe-Lys-H/S-H/S-H/S-H/S-H/SH/S-H/S-Pro-Asp

Leu:

Met-Ser-H is-Ile-Val-Arg-Phe-Thr-Gly-LEU-LEU-LEULEU-Asn-Ala-Phe-Ile-Val-Arg-Gly-Arg-Pro-ValG Iy-G Iy-Ile-G In-H is

Thr:

Met-Ls-rg-lI-Ser- THR- THR-lI- THR- THR- THRlIe-R-lI-R-R-Gl-s-Gl-l-Gl

Ilv:

Met-Thr-Ala-LEU-LEU-Arg-VAL-/LE-Ser-LEU-VALVAL-/LE-Ser-VAL-VAL-VAL-/LE-/LE-/LE-Pro-

_'1

2:3.
3:4. - (



. ."1

2:3,

3:4.

1:2

41_12_ .l
Phe .
His-. Lcu-. Thr- Ilv (, . )-
E.coli S. typblmur;um. ,
, . (Reproduced \vith permission from Yanofsky . ttuti in
ntrol ofexpression ofbacterial operons. Nt-t: 1981.289.751.)

Pro-Cys-Gly-Ala-Ala-Leu-Gly-Arg-Gly-Lys-Ala

1:2

IIv

met-Ls-is-ll-r---.l---
Thr-PHE-Pro

, 

PheA:

Phe, His, Leu, Thr,

41



~l

. ,

3:4. (Reproduced with


permission [ Oxender ., Zurawski ., Yanofsky .
nuration of the Escherichia coli tryptophan : Role of
RNA secondary structure involving trytophan codon region.
. Natl. Acad. Sci. USA 1979. 76, 5524.)

, ,
,

II

l ll8

:l

, ,

, , , CKOP_1YlIa.

. ,

. , ,

5'-

3' -

. , ,

(Dro~'ophila),

. ,

, ,

, ,

:l -

.l'<I JKC1JpeCCII1I

121

ll .

s8

s6

s8

(). , .

55,

(L)

() (.

55.3).

N-

L-,

(V)

() .
.

41.13.

:\1

s36 s38. (Reproduced with issi f


h\ R. Gene l\\ifiti duig dv\t. Trcl1ds
h.

ChisBioc-

Sci. 1982, 7, 16\.)

), -

- -.

. - -

(.

- .

38.16

41.13).

"J

- (V L)'
(J L) (C L).

. , ,

500
V. -. 5-6 Jl- , , 10
20 Cl-.
- VL-
J L - C L -

( ),

-,

ll

in vivo, . .

VL-, J L-

CL-

V-

J -.

V' D ( .

divrsit-),

JH '

, :I

V-, J H V-- -J-

;r

(.

55).

-.

-. -

3, l, 2, u 2,

, ,

-Ig,

Ct;)
IgG,

(CIJ , ,

IgA

..

(. .

2. .

55).

41.14.

-.

39,

, -

V
, -

122

la

41

p-

c~
I

11 \
l VDJ

"

")'2b-

, y2b-

41.14.

. . .

()

50 ,

Jl.

(L). - ., .

J-, V-.
. . J- !! -

8000

-. -

.
. . (, .

J)

, u ~-.

. ~-MPHK.
. . , ,

!!, 3 1. V - - J- J !!- 2-.


2b-.
.

(Reproduced. \vith permission, [rom Molgaard N. . Assembly


1980, 286, 659.)

immunoglobulin heavy chail1 genes. Nature

_ ,

IgA

IgG

IgM,

. .

Jh-bI

- , ,

V,,-D--J-

.
, V- J-

Jl-, -

.
IgM IgA VD-J-
-.

V-D-J

-,

- ,

,
-

- : !!, , 3, 1, 2, 2,

123

i?llI.<1 JII'Cl1pe('('UU ?ll

38,

. -,

. .

-J-

5' -

-.

. ,

. (2

. .

41.14.

v-

-J-.
CII-. l

:l (.

:l .

55).

-, ,
.

39.

"8

, u

-,

. ,

72

SV 40

200

ll

JI

in vivo.
(

to enhance-

u.
-

Ol KO"TPO~1
.

39 ).

-,

. ,
SV40 ,
, 200-

, - u

, KOI'.Ja ( )

.
. 39,

). ,

, (

, ,

>

,
. "1

, ,
(. .

38).

, >

. .

u- (

. , .

), u

- ,

. ,

38.

1-

124

41

. 3

). ,

, (. .

IM

44).

- 51-

- ,

( ,

lIlI

36)

u. -

, ,

. ,

- . ,

5' -

lI.

, . .

. , ,

- .

. ,

K()~

. , ,

- .

ll

.
,

.
,

, , -

.l.<lll.<l ll

125

' .

.'1

-Lys-Val-Lys.

ll

n,

.
,

Jlm-u

Jls-

)'

-. .

Jlm-MPHK
2400

2700

Il. . -

Lys

Jl-MPHK.

Jls-MPHK

Jl-MPHK

ll . .

, lI

IgM.

IgM

Jl,-

mPHK-

."'J: ,

Jl-.

~l

-,

Jlm-MPHK

41.15

u (. .

1.14 -

39):

3'- . .

- Jl-,
. (. . 42).

Jl-Uel1h IgM
Jls' Il- IgM,
,- Jlm' Jls Jlm- -

Jl-MPHK (Jlm- Jls-)


3' -. ,

C~,4 -
(. .

55.3).

CJ.l4

Jls

20- .
-

Jlm -

38- ,

5'

1 2 CJ.A

~~u~ mPHK-w

~~~_

/ ,

1 2 4

, 2 4

~~"""~ "

() #Js'MPHK

() Jl

m ,

. 41.15. ~s- ~-MPHK. 5'-


CJ.I 4. "). 3' -
. - ) , V - V-'). . .l

RNs poduced f

single

(AAUAA)

. (Repoduced,

iUl10gl0uli ~-gel1e

with issi.
alterl1ative RNA processing path\vays.

Early et al. Two


313.)

ll 1980, 20,

126

41.2.
( ll J. . Variety in the leve1 of ge contro1 in eukariotic cel1s, Nature 1982,297,359 Copyright i
]982 ill Journals Ltd).

41
. . ,

4--6 .

'

nu:

(> 100)

()

'" 1

41.2

in vitro.

-5

-3

,
,

.
,


,
. ,

, .

200

Compere S. J., Palmiter R. D. DNA thlti controls the inducibility the mouse metallothioncin-I gene in Iymphoid
ceIls, . 1981. 25. 233.
Darnell J. . Variety i the level of gene tl i eukaryotic
ceI1s, Nature, 1982. 297. 365.
Jacob F., Monod J. Gti regulatory hisms in ti
synthesis, J. Mol. Biol., 1961, . 318.
McKnight
Tjian R. Transcriptional selectivity viral genes
in li ceIls, , 1986, 46, 795.
PtasJme ., Johnson . D .. . . genetic switch i
bacterial virus. Sci. . (Nov.). 1982, 247, 128.
Sltiizu .. HOlljo . Iglu1il1 class s\vitching, ll,
1984.36,801.
s,({t G. . ! /. Tissue-specific expression () the rat p<increatic
elastase I gene in tf<insgenic i, , 1984, 38. 639.
Wu R .. . R .. Narang S. . Lactose operator-repressor interaction, . . . Regul., 1978, 13, 137.
mmot . Steroid receptor rcgulated transcription of specific gene <ind gene networks. . Rev. Genet., 1985, 19,
209.
Yanofsky . Attenuation in the t1 of expression bacteri<il operons, Nature, ]981. 289. 751.

s..

- Ix
~

42

~: ,

ll

, u,

(),

. -

.l

'1 .

(. .

ul

(!

(!

46.2);

(!

. u u,

. ,

. ,


(!.

1I;

.
u
.

(! ()-

, ,

. , ,

, ,

(!

(!,

(!

. , u

(!

, ,

(! ?

128

56%

, , ,

. :

3)

1) .
2) ;

4)

. ll :
.

42

(,

M g2+,


,
.


, :

2+,

Na +


.
-
,
.

, ), ,

(),

. 2 ,

lI, .

. :

(.

42.1).

, ,

Mg2+,

42.1,

-1).

Na +

2 +,

,
. ? -

1)

.- u. .

, .

,
I,

42.1.

Na+
+

140

2 + ()
Mg 2 +

Cl-

2.5
1,5

0.1

30
4
10
60
0--1

100

")

27

5,5
2 /

10
140

16 /

, ll

(.

42.2).

16.

14

-1, 2---

./..,6: . li

I
I
I

I!I

z:

10

:1

:1

\0.23

0.851

I!I

:1

...

I!I
:

::

I

l
Il
I
l

HeLa

'

5\

. .

r
,

" ,
(. .

2.0

1,1 \

1.0

()

157).

1.3 1

1.1

(.

I!I

129

157).

,
-

3.2 1

C::::J

C:::=J

/ .

. ,

-- .

42.1.

\oI . (

Singer
S. J.: Architecture and topography of biologic membranes.
Chapter 4 In: IJ Membranes: Biochemistry. Il Biology and
Pathology. Weissman .. Claibome R. [editors] HP PubIising
, 1975, .)

(.

.
.

(.

25).

. , . .


, -

- )

, ;

, ,
,

bI

}
..

..

42.2. .
(R. R 2).
. R -
.

5-1594

-,

, .
,

130

42

..----

s
.

42.3.

s s

.
,

. (S)
(U);

1 . 2.

42.4.

( ).

. ,
,

. .

.

(.

, ,

42.3).

, ,

u-,

. ,

.

, .

, ,

,
.

. -,

? , , ;! ,

, ,

,
.
(.

42.4):

60

,
,
(.

42.5).

( ) -

~~}

~~

J~~-

.. }

(). -


. 42.5.
. ( Stryer L.: Biochemistry, 2nd

ed. Freeman, 1981,

.)

l1

ll: , u llUU
+

11

10-14

1
10-10

10-12

10-8

11

J
10-6

Na + jK + -

1981,

. (

-6-

42.6.

5'-

10-2

10-4

, /

42.2. 11

Stryer L.: Bioehemistry, 2nd ed. Freeman,

IJ MHoro ;
.

MorYT, ,
.

.)

(.

42.6);

, .

(. .

u .

. .

42.2

, .

n,

. u

u.

-,

, u.

. ,

20 ,

5,

, .

. ,

. (,

u .

(, ,

. ,

, ,

-.

6--8

100

. ,


( ). ,

r)

132
(

42


, . .
,

(-)
. ,

. --
.

42.7.

:Ia li: .i

12

-
, -. l
.

I\

. ( Mueckler et al.: Squ:


and structure human glucose transporter. Sciel1ce. 1985.
229, 941. .)

. . .
,

d .

.
, , .

11[

. .

);

5-10

,-,

. ,

, .

, d,

, (.

, .

-)

. ,

, .

42.7.


(. 42.8). ,


(. ).

. ,
.

( ) .;I

.
. ,

, ,

, ,

(~,

\16": . "

11
D

133

42.8. n ,

;
, . ,
, .
.
. . , ,

~ ,
. ( Lodish . F., Rothman J. .: assembIy ofcell membranes. Sci. m. [Jan] 1979,240,

43,

.)

1.

4.

KOHKpeTH~

(,

, ,

),

(. ).

2.

.
, (,

2 +

Rpr

. -

(.

42.9).

1972

. ,

3.

(,

). ,


, .



. -

ll

134

42

. 42.9. - . ;
, , d .
.
, , . ,
, . .
. ( Junqueira L. ., Carneiro J . Long J. .: Basic Histology, 5th ed. Appleton and Lange.

1986,

.)

. .

; -

, ,

, . ,

.
,

, r

, ,

, . .

u-

(.

( ,

u-.

), -

42.3).

(.

51).

6ll: ,

"uu

135

. ,
- ,


, ,

-
;
,
-

. ,
,
,


, ,
,

42. 10.

. N-

. N-

, -,

,
.

--.
.

Ladish
The assembIy ofcelI membranes. Sci. .
[Jan.] 1979, 240. 43, .)

. (

F., Rothman J.

.:

, ,

. N-

(.

42.10).

. ,
,

,
.

-
,

. .(
(

15-30

N-

. -

136

42.11);

(.

42

.
m :

.
,

-,

.
,

70

(),

40

30

(. 42.12).
, 7S-PHK,
lu-
(. .

38).

( )
.

-.

.
,


.
, ,
,
.

llO

(
) .

,
,

111


HlA-

ICI48IIrn

.,


HlA-DR
w .Pl~-!an

42. 11.

. ,

N - N 2 -; ' - -. (
F.: Mu]tip]e mechanisms ofprotein insertion into and across membranes. Science. 1985.230.400, -

, -. .

Wickner W. . Lodish

.)

Me~6pa": . "

137

VUli

42. 12.

. .
(

AUG.

5'-3).

UG- ; ,

.
- (). ,
( ). .
( ).
") ,
.
, .
. . . . -

lJ (

Newly made proteins rip through the

Il,

Science, 1980. 207, 154.

.)

. ,

. ,

, ,


, ,
.

42.3.

, -

,
,

bs,

138

42.3.

\)

.
-

- ,

--

- ,

N-

; .
.

42.6)

.
,

.
.
Na +, ,
, + . ,

Na +

, + ,

. , ,

..., 5--8

, u

- - -

, .

- -

- - -

, ,

42

. u

Na+,

Wickner W. The assembIy of proteins into biological


membranes: The membrane trigger hypothesis. u. Rev. Biochem, 1979; 48, 23. .

1J

+ 2+.


, -

42.4.

42.4.

.1J
( )

1.
2.

(. -)
;l ( ')j{

, ,

, )

; )

.
.

42.13.

.'6: ,

139

-....

[ ~~1 ur1 ~~

~~~~

r~~ rl\j Ln~

il

42.13.

~ ~ V~

r~~~~

~~ ~ ~

. .

-.
.

. (

. ! l.:

Alberts

Molecular Biology of the

Garland, 1983.)

. (

, )

, . .

. ,

. , 2 +


Na +.

, ,

1)

. ,

2+ .

2)

, .. .

, ,

4)

;
5) . ,

, ,

3)

, .

(.

, -

42.14)

140

42

811

( )
.


.
+jcaxapa

Na +jcaxapa

(, ,

Na+ j

(,

Na+

, 2 + ).

, .
:

.:l1

42.14.

. .'1

bJ . (

et al.: Molecular Biology of the

]].

Alberts
Garland. 1983.)


. , -,


, .


( ,

l\).

,
.
:

; 2)

1)

, . . .


, , ,
.
,

,

, , ,

, -,
.
-;

,
.

, . .

(.

42.15);


,
(. 42.15); 4) ,

3)

.
:

1)
,
- ; 2)

. .


,
,
.

, -

42.15.

() .

.

mc

V -

. -

.: cmp~Kmypa. ll

(mll

141

""

""

~~
~~
.

, -. - () ,

42.16.

.
l1 (<<

, .

(<<>


:r

42.16).

OI"

), .

(.

, ,

40%

) ).

30--


Na i +

(.

. ,

, ,

1)

;
II)~
;

2)

42.1) -

(.

42.17).

SI

Na +

, -

3)
4)

Na+

, u

(. .

51.13).

Na+

, !\.1
I"Il.

) .

.

r

Na"

(.

42.13).

42.17.

' Na +, + -.
Na + +

l\.fJ1 ,
.
.

( u

R. Post.)

142

42

-6-.

,
+ - .

(. .

+ .

Na +

Vmax
, ,

51.13).

),

(.

42.7).

); .

(.

, , ,

),

Na +

2 +

( + ),

Na+

Na +

(. 42.18). .
Na + , .

. ,

, .

Na + , + -,

Na+

Na -t j

Na + ,

();

, .

()

,
, ,
.
,
,

-,

,
,
. ,

,
.

.i1

. -

,
.

,

42.18.

.
:l

Na t

J10 ' .
Na +, + -

Na +.

. .
.

.'1-

( 1 )

MeMcJpaUbl: .

Na+.

, .

, 2 +
,

. ,

143

. ,

(, , )

(.

42.19).

, ,

. -

~ ,,~~.
~'

08
.

42.19.

. () .

()- . .

() ().
( ), (). (
), .

144

42
,

: 1) ,
; 2) 2 +; 3)

(,

).

u,

. . .

. .

, ,

(.

, .

26).

25%

3%

1 .

30

IIO .

. -

, r

, .

. ,

1/3 ,

. ,

-6-

, -, '

, .

(. .

54).

, ,

) , ,

, (

), (

. ,

T-:I),

:I

. .

.J

. ,

(),

(, ).

, ,

2%

, ,

() (. .

2 +, .

26).

. ,

. r
-

u[.

4.20

: ,

145

42.20.

10.

. ' .

2)

H~

3)

1)

44.

(.

42.21);

. ,

(.

47. 49

51).

, .

, .

,- ,

( ),
,

-4-.

, - .
,

-4,5-.

-.

(.

(.

57).

. ,

44).

, .

.
-4

, -

5-

l'

11

1 2 --- 1

11

2 --- 2

3 2 -=----

0-

42.21.

-4.5-.

U 1,

1,2-

146

42

.
,

2 + .
,

,

",:

:~

. , -

4,

5-

Na+,

..
.. :....

.:

.. : .. " .

1--

',',

.~

.
.

1, 2-.

42.22.

I . J(
. ()

; yr

, ,

, .

, .

,
,

-,

. .

0,6

5
7,5 . ( Unwin . N...
Zampighi G.: Structure the juti betweel1 communicating celIs, Nature. 1980, 283, 545.)
.l

44


OpI

.

.

,
.
,

..
, .

42.22,

. ,
-,


(. ;
.

6.12)

. -,

,
.

/l

G. et /. Translocation proteins across membranes:


The signal hypothesis and beyond, Symp. Soc. . Biol.,
1979,33,9.
Dautry-Varsat ., Lodisll . F. How receptors bring proteins
and particles into cells, Sci. m. (), 1984, 250, 52.
Go/dstein J. et /. Receptor-mediated endocytosis, . Rev.
ll. Biol., 1985, 1. 1.
Hous/ay . D., Stan/ey . . Dynamics Biological Membranes, Wiley. 1982.
Mueck/er . et /. Sequence and structure human glucose
transporter, Science, 1985, 229, 941.
Sabatini D. D. et /. Mechanisms for the incorporation of proteins in membranes and organelles, J. ll. Biol., 1982.92,
1.

Singer S. J .. Nico/son G. L. The uid mosaic model of the structure of ll membranes, Science, 1972, 175, 720.
Stahl .. Sh'rtz . L. Receptor-mediated endocytosis,
J. Clin. Invest., 1986, 77, 657.
Stein W. D. Transport and Diffusion Across ll Membranes,
Academic Press, 1986.
Un'in ., Hendersvn R. The structures ofproteins in biological
membranes, Sci. m. (Feb.), 1984, 250. 78.
Vance D. .. Vance J. . (eds.) Biochemistry of Lipids and
Membranes, BenjaminjCummings, 1985.
Walter .. Gilmore R., // G. Protein translocation across
the dlsmi reticulum, ll, 1984. 38, 5.
Wickner W. .. Lodish . F. Multiple mechanisms of protein
insertion into and across membranes, Science, 1985, 230,
400.

43

,
,

(,

.) ,

, .

, ,

-, ,

, ,

() .

. -

-,

(),

, ,

, -- ()

.
,


, .

c ,

: Il.

; ,

, ,

( ),

, (

).

.
.

43

I1

l\.


)11 J.I .,"1

);
.


. roro
_l

..'1 -ll

. tl
,
-

:

. ,

d (

). ,

PBHOI'O (" ( ).

,.

, ~
'1 .

,' . 1

10

- N -

(~,

'

, ,
.

, lll

. ,

Tro

IIlJ. , . .

r
,

, rKY

()

tl .

l ,

. ,

, ,

- ).

, OI

~ lL\1

, 1 . ().

), . -

JII (),

. ,

.'l ,

Ol'

(; ) l

-,

, 10

ll . :

u . (

. -,

) .

K:Ie J" , ,

()- ,

42.

285

, ;

, -, -
~-MC, ,

. -

, ~ u

"pOl .

II -

..\mm Ol\UllllO

, -

(. .

149

45).

-.

, -

(.

5000

660000)

120

,
, ,

_1

(4 ).

). 'r,

(. .

46).

.
-, 4

T~ ,

. , -

J .
-
.
1 u

, ;

- .

()

1)

, .

4)

2)

3)

5)

- -.

- 0 ( )

25-

()

(.

1.25-
,

47).

r-.

1)

2)

ll .

(, ,

-,

- -, u- .

.
I-

200

.
.

75

, ,

50

u.

, -

- ;

-.

43.1.

, - (

150

01
,,-/

....10,

. ,

"

t<

,,

,
( ),

. II

\
\

......

"

I
I
I
I

"

, , ,

I
,/

. ,
,
u,
.

.,,"

43

, . -
-,
.


,
.

43.1.

.
, , .

, ,
,

-.

(, ),

, .

, .

-.

, .

/.

43.2.

10- IS-IO- 19

(,

, , ) ,

10- s-10- 3

/.

. ,

()

, 10-l0 9 -

, ()

, .

u , ,

, (

, , .

, :

).

J1Im cucme1j,tbl

.
0/

... ... 6.,


..
~

11

r I

151

L.J

I ~-

. 43.2. .
, . ,

, . ,
, .

1.
()

> 1;

, .

1)
2)

( )

, . .

;
;

4)

3)

, ,

u,

(. ).

(): (

) ,

:
,
.
;

,
u -
.

, ,

, ,

, .

().

1,

152

rtIG6U

43

() -

!vflO

, :I

!\l[ "

..

() .

ropbIe

r .

Ht:

( ),
().

ll
~l

).

() r,

43.1.

43.3,

(.

u.

. .

, .

106-107;

rOPMOHi:l

-~

xaraKTep-

).

u;

lll

(.

J .

43.3,.

.
r

2).

u.

, -

43.1. rUP'\.10Hi:l.lbHbIX
.


;
.

lf

. ,

.'1-

J K.'leTKa)

1bI

i:l

(10

(CPO;I-

11_

10

/)

ro ,

1%

(. 1 2, . 43.3. ).

,

1%

; ,

-'1<1

, );

(cAMP- )

( 1O 7_IO- S

. ,

KOl\eH

/)

lf-

( -

/)

153

Jll1 lI.,."

. .. . . . . . ..... .

100

100
10
1-

.'

CD

"

1-

L.

:r

::

10

50

(.)

"'

'*'

- - -
- - - - 1
" . ' 2

-109 []

2)

43.3.

10

10

8
[)

- log

3l\. J () (. '

l, l (.

1 2

. >.
,

r .

(. .

. ,

44).

~-

,
. ,

- u
. - ,

r ,

) ,

(
, ),

, .

, . . . .

. (

()

II

) l'.fJ

. ,

, ). .

( ) rBeT

, ~

'{ .

u .

CIIR

43.4

, 1

5-

()

( r)

, . .

20%

Vmax

(-

,lU

154

43

100

100
10

'"Im

1-

CI.I

ID

1-

1-

L.

L.

:r

:r

.ZJ
::

'"s

50

50

(.)

(.)

'"

?.

?.

10

10

- log []

-Iog

[]


___ 5-
.

43.4.

5- . ()
() .

()

, ;

(. .

1),

()

51.(6).

, ,

, ,

, ,

, -.

, .

Torpedo californica.
2 , ~,


_ u- .

(.

u-,

43.2).
1)

, -

2)
3) N-

).

( 2 ~2)'

. ,

~-

, , ,

v--.

155

J1I1l1l0

100

1-

1-

L.

50

::

*'

[]

-109
.

43.5.

.
uu .

, ,

.
(. .

43.5 . 43.6). 43.5 1, 2


3 ,

(.

48).

100

1, 2, 3

1-

cv

1-

L.

:;
::
s
u
~

"",

::

*'
10

43.6.

......

8
109

,,

50

[]

: (). (). (

(n.

156

1 ,

(. . 4.4).

43
43.2.

(. .

43.6,

).

(-

43.6).

(.

,
.
(.

43.6, N.

(
),

ll-

. ,

, .

in vitro,

48.4

in vitro.

1)

10.

2)

r .

3)

ll.

11

xapH

()]

.

, .

. .

, .

43.2

01

. (

I,'

IgG)

(-

),

11 ,

( ).

( )

, -

mllmlll .JIllIO cucml'.\fh/


, ~

u u .

Gin''Iherg .II. Synthesis and regu1ation rcccptors 1


pcptide hormones. Pages 59- 97. 111: 8io10gica1 Regu1ation
and Deve10pment, Vol. 38, Yamamoto . (ed.). Plenum

157

Prcss. 1985.
D. .. Lee F. The multiple endocrine neoplasia syndromes, Chapter 76. In: Comprehensive Textbook 01' Oncology, Moosa . R .. Robson . ., SchimpfI' S. . (ed.). Wil1iams and Wilkins. 1984.
Misllina . et 0/. Expression functional acetylcholinc
tor cloned cDNAs. Nature, 1984, 307. 604.
ROlh J .. )'/ S./. Receptors pcptide hormones: lt
tions l diseasc humans. . Rev. Physiol .. IQ82. 44.
639.
Rotll J. ' /. The evolutionary origins fhms. neurotransmitters. and other extracel1ular messcngers. N. Eng1. J.
Med .. 1982, 306. 523.
Sihley D. R .. LefkO\~'it= R. J. Molecular mlisms receptor
desensitization using thc j3-adrenergic receptor-couplcd
adenylate cyclasc systcm !> model. Nature, 19~5, 317.
124.

(1nn

44

4 ,


, ~)
.
,

.

, -,

, .


.
, ,

,
,- ,

.
,
,

,
,

-.

( -

);


, ,


.
,

. ,

, II..


( ).
,

II.. .

. ,

: , . H 20 1 , .
, ,

44.1,

44.2.

, -

, .
. -

44.1.

44

159

l13

44.2.

1.

, ." -

[-

(1,25

0)

( 1 4 )

Il

. , ll

. n-

( )

()

. 2+,

()

()
r
()

llI

lllllI 1{)

( )

u,-. -

(d-

, -
,

44.1.

ropMOH ()

1
.

ropMOH ()
-

()

.1- (;

u2 -

()

11

()

. -

.
-

. ,

, u

. .

- (TP~

(; )

,- ,

11

. nUI.:

()

()

1,

u .

()

2)

()
()

; ,

1%

-.
,

- ,


; ,

160

44

A::;::_~

cs

""

'

44.1.

,
. , . -

') , -, .

(n) -

, (

) (. .

11

41).
-

() - ,

-, .

. .

(.

44.2).

. .

-,

44.1),

( ).

(. .

41).

1.

( ),

(.

44.2).

161

ZOp_WVIIOR

-
()

5' _._......
: _ _ _-11

~:~_ _-I7

()

//

;\;

~ ~ ~ ',://1
~/!
..._...

/"1

~--------------------------------~I~I----HL/~--~
/7

44.2.

, .

-
,
.
.
,
. ,

.

(.

44.1

44.2).

1.
( ,

3',

5'-

) -

, lI

-.

(.

-,

44.3),

. -

44.3.

, .

3'.

(. .
).

( )

(x )

' ,

()

( )
( )

(..1-

( )

6-1594

.'.

Q,--

11

5'

11.

(-

11

162

44

yr

(. .

34.14).

, , , ,

, llIe IX

15

(G- )

(. 44.3). ,

.
,

, ,

44.3.

(8)

(i),
m ().
- ~ R j -
- G. G j. . Oj ,
-, ~- -. -,
~ .
-
. (. 45000) Q j (. 41 000).
~

G-,
Mg2+ - GTP -

G-

,
() G j - ()
5
( N 5 - N);
: ,
~ . ,

I , -

GTP

GTP

Q-GP

GTP

~ _---J

I
I

___~______________________~~~------------------------------

_____

44.3. - () (s) (i) ry


(G. G j) , ().
. (Modified with permission from Gilman . G. G-proteins and dual control of adenylate cyclase. Cell,
1984, 36, 577. Copyright the Massachusetts Institute of Technology.)

- -.

GTP

aGTP

163

-
G- (

+ .

, s-),

G ;

a s GTP

GTP

Gs

; ,

D-

us-
G; , a s-

, ,

. ;

G;

GDP

(, . G D ) . ,

GTP

GDP.

- .

j-

();

; ;

D-

.

.
-
, (R)
() .

. : - j-

.
-NF; ,

G s G j

, ,

a s-' j-.
- , , -

()
,

;
5

aj

+ R2C 2 ~

R2C2

J!..2 . (4)

2.

, R-

j- .

- (.

, ,

()
(Mg2+)
.
-Arg-Arg-X-Ser-

-Lys-Arg-X-X-Ser-,

- Gj- a s;
a j , ,

,
,

R ,
44.4).

- .

G-. ,

: cAMP- cAMP-
. , . 44.4,
,

G- (,

, ,

) s-;

, ,

, ,

G o;

44.4

cAMP-

R-.

). -

6*

1-

164

44

GTP

( ()

----

(1

4 ~

..,."...

5'

"~1""'

3ll

44.4.

cAMP- :l.
ri.)

(Courtes) of J

11.

;
,

44.4.

fBeT.
,

/-
cAMP-

/ -

1 11

cGMP-
,

44.5

,
, ,

(. .

51).

11

-- 2
-

1,

1, 11

111

1
11,

,

.

, , ,

165

1l0

>-4.5- 2

'\~--------~::OOO- -

~G
,
) 1(

G
->

.1

. . . . . . . . .~

-----------------

44.5. . (Courtesy of J. . Exton_)

, ,


,
.

cAMP-.

(),

. ,
, ,

:
.,

, ,

, ,

, , .

, .

, ,
,

. -

in vitro)

(_.

166

44

. (


.


-,
.


.
. 1
- ,
11- -.
1
-. 1
cAMP- ; 2,
, -,
,
- -
.
.
; ,
,

50-)

cGMP,

, -, .
, cGMP
. , ,
, , ,

cGMP

cGMP-


. cGMP
cGMP- ,

, ;
, ,

2. ,

, ,


.
,

-.

I .

ll,

cGMP,

cGMP-

GMP

GTP

,
.


, -
.


. , cGMP
.

cGMP

,-,

, , ,

. (
, )
-

-,

,
.
.


, ,

()

47).

5 / (.

-,I-l ./,
,

'l

),

1-20

/. 5000-10000-
OI

, .

. ( 11. )

2 +.
N+/2 +-0,
,
2 +.
2 +/2+-,
2 + +.
IC 2 +,
, -,

. , -

167

OI

44.5.

. -,

2 + -

2+ -

2+/M g 2+-

2+I-

---

-2

(Quin 2)

-2

(Fura 2).

ND-


, ,

1)

-
; .

17000,

2)

, -

2 +.

, ;

A23187; 3)

-.

, ,

19.5 19.7.

.-

3-

0,2

0,6

/).

;
,
. .-

, (
, ) 2+,

, ,

2+ ,
. , ,

44.5.

, , ,

- ,

2 + , ,

-.

~-

, , ,
, .

168

44

( -)

-.

0,1-1

. ,

5-1

/, . . ,

:I

. +
.

. 2 + -

( , ,

; ,

). , -,

---,

. ,

( /

/-

44.5.

).

, -

,
, ,

+ -

2 + , , G-.

, .


- .

3.

. -

4,5-

. ,

-l,4,5-

(.

, ll

(-l -2)

44.5).

, , ,

. -

0,1--0,4

2 +.

( , ,

(
)

(. .

, ,

, .

- ,

, .

-1,2-

2 + --

2 +.

45).

, -I

: ,

cGMP, 20 2' 2+

mrn.

, .

>

, + , , -

; ;

( ),

. -

, ,

. ,

v-sis

c-sis

).
- (,
)
,

' .

,

.

Anderson J. . The effect of steroid hormones gene transcription. In: Biological Regulation and Development, Goldberger R. F., Yamamoto . R. (eds.), Vol. 38, Hormone
Action, Plenum Press, 1985.

lackmore . .,

169

Exton J. . Mechanisms involved in the


tions of calcium dependent hormones. In: Biochemical
tion ofthe Hormones, Vol. 12, Litwack G. (ed.), Academic
Press, 1985.
Catt . J., Dufau . L. Hormone action: Control of targct-cell
futi peptide, thyroid, and steroid hormones. Pages
61-105. In: Endocrinology and Metabolism, Felig . ! al.
(eds.), McGraw-iIl, 1981.
Codina J. ' al. Mechanism in the vectorial receptor-adenylate
cyclase signal transduction, Adv. Cyclic Nucleotide Res.,
1984, 17, 111.
Enhancers and eukaryotic gcne expression. In: ut
munications in Molecular Biology, Gluzman ., Shenk
. (eds.), Cold Spring Harbor Press, 1983.
Gilman . G proteins and dual control of adenylate cyclase.
, 1984, 36, 577.
Means . R., Chafouleas J. G. Calmodulin in endocrine cells,
Annu. Rev. Physiol., 1982, 44, 667.
Niall . D. evolution of peptide hormones, Annu. Rev.
Physiol., 1982, 44, 615.
'll . w. Steroid hormone action in eukaryotic cells, J.
Clin. Invest., 1984, 74, 307.
Rasmussen . calcium messenger system (2 parts), N. Engl.
J. Med . 1986, 314, 1094, 1164.

45

--,

--, -

( )

--,

45.1,

, -

-
.

45.2.

, .

, , . ,

()

( ),

() ()

-,

-.

(.

45.1.

171

).

ropMOH

()
1)

(--, ),

(,

, ( 3)

()

(..);

(. .

()

. ,

()

--

(,

45.5).

()

(-

--

( ),

(.

(-

46.4).

()

.
(

) /

. (.

45.2)

(
1)

- .

) ;
, ,

. 56-
.

43.1).

()

(--,

).

().

, IJ

- (
) m (, GAP). ,

(), ,

()

11.

45.2.

45.1,

{ , ,

- ()

(pyro)Glu-is-r-N2

Ala-Gly-Cys-Lys-Asn-Phe-Phe-Trp-Lys-Thr-Phe-Thr-Ser-Cys-NH2

(pyro)Glu-is-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH 2

-<, j-,,N,;GR-.

(GAP)

Ser-Gln-Glu-Pro-Pro-Ile-Ser-Leu-Asp-Leu-Thr-Phe-His-LeuLeu-Arg-Glu-Val-Leu-Glu-Met-Thr-Lys-Ala-Asp-Gln-Leu-AlaGln-Gln-Ala-His-Ser-Asn-Arg-Lys-Leu-Leu-Asp-lle-Ala-NH2
Tyr-Ala-Asp-Ala-Ile-Phe-Thr-Asn-Ser-.Tyr-Arg-Lys-Val-LeuGly-Gln-Leu-Ser-Ala-Arg-Lys-Leu-Leu-Gln-Asp-Ile-Met-SerArg-Gln-Gln-Gly-Glu-Ser-Asn-Gln-Glu-Arg-Gly-Ala-Arg-AIArg-Leu-NH 2

172

Gly Lys Arg

56

I\

,,

~--------~~---------,~r-L-,

45.1.

-. . .

. .

1) ,

Thr Thr HisGlnProArg Ser Pro Leu Arg Asp Leu


40
50
lys Gly Alaleu Glu Ser Leu " Glu Glu Glu Thr Gly
Gln Lys lys

'

10
Gln His Trp Ser Tyr Gly leuArgPro Gly Gly lys Arg
1
10
Asp Ala Glu Asnleu " Asp Ser Phe Gln Clu " Val
20
lysGlu Val Gly Gln leu AlaGlu Thr Gln Arg Phe Glu


'\.

45

I'OPMOHOB

2)

3)

"

1.

- (). :

( ).

. ,

(). ()

(;

(1-10) (1-56). (Reproduced with permission, from


Nicolics . et. al. prolactin-inhibiting factor with the precursor for gonadotropin-releasing rm. Nature 1986,
316, 511. Copyright 1985 ill Journals Ltd.)

91 )
.


.
.

190--199

85

85%.
--35%.
,

, .

. D-

, -,

-.

. ,

40

(. ).

,
,

, ,

, (. .

44.5).

, -

; -

, ;

6;

17,

--

m .

. nm.
Q

173

~-----~c=J~--~~~--D--iL--~~~~

'

5'
.

45.2. . 45 . . .
4 . 1 5.

, ,

(-N) (-V), ,

.
- - ;

(- -)

(XC-L).

XC-L

-.

5 ,

()

. .

4 (. 45.2).

5' -

-93%- )

-5-15 /-

3'-

MKrjr).

q 22-24
17. . 45.3
5'- 3'-

22000.

45.4

(191

).

5' -.3',

-N -

45 . . .

-N

ll).

. .
(, ), ,

rp-v,

1,

13

. . 1
. -V

, -N (

: , .

(,; );

(, , ,

, - V

),

1 ,

, ,

. ,

-- - -

5'
.

45.3.

XC-L

rp-v

17

'

5'

.1 .

( )

-N

1 .

3'.

,
. , ,
(

)
( ),


. -

174

45.4.

45

. ,
N-.

( )

, , ,

, , ,

, , .

, .

. -

, .

(.

(.

45.5).

45.2).

(.

()

11 500),

, 28- .

---

() -nrn.

2+,

1 (-l,

).

Na +,

,
.

, (-

). lI

-l,

. -l ,

-,

, ,

, . ,

. -

2+ -

175

\'

q/
"

,
/

, -I -2

45.3.

()

"'


----------------------------OTB~

-2

-)

-I -

2, -l

. -I,

-2 (. .
45.3), .

1. .
, ,

. ,
.

45.5.

. . .

, ,

.
.
.

2.

+ ,

2 +.

. ,

. .

,- '

, ,

. ,

-l,

m .
(. . 51

51.8).

2 (-2).

.
.

.
.

3. .
in vitro
()
. in vivo (30--60

( ). -l, -2
,

. -I
, -2-

67.

. -

70

176

(,

. ,

45
(IIP : ,
, Jl )

-I.

4.

. ,

, -I
, Na + ,
+

CI- .

()

23000;
. 45.6.
-

: J1

()

. .

5.

. .

. . ,

, ,

, -,

(),

. , .

(.

45.3).

- . _1

-N,

. (',

-
( ; . 45.2).

-I .

-,

II

, -

~OHa

),

()

_'1.

, )
, .

II

. OI'

TOI ,

_l .

. If

J1l' .

Hd

-.

. -,r,

( )

: .

177

nml

45.6.

XC-L

. . ,
- ,

( )

( ).

2.

) .

: l (

; 1), mo (;
), (

; ) ().


(; )

--

()

. ,

; ,

),

, ~,

, ,

. -

- ( -N

, ,

XC-L),

~-

178

45

. ,

, -.

, , -,

- , r

( );

, .

. ,

. ,

, , ,

. , , -
-

. (, ).

, p-.

, - -

. ,
- -.

)
2- ,

.
,

s- -S-.

5,

- -

. , -

(. .

43.3).

,,,

(, , )

.

. 25000.
. (,

, B

(). ~8

).


. ,

179

ll
,

, .

( ).

, ,

-)

, ,

(, )

. .

a~
. 30000.

. ().
.

1 .

- ,

, .

(. ),

.
. r .

. , m

() (4 ),

( ),

, ,

' ,

20-)

. rII r.

( ),

-- ().

46.4.

r-'-I" (,
). , N-

, m

, ,

(.

(.

45.2).

() -

45.2).

, .

--

-,

2+

- ,

().

-,

180

45

-.

Lys-Arg, Arg-Lys,

Arg-Arg Lys-Lys.

()

(tl/2"" 4

-,

3.

N- ,

()

, - (.

45.7). AKTr l _ 39

3 r,

N- ,

(,

, - ),

. AKTr l _ 39
- ( 1-13)

.
()

(18-39); -
- (42~101)

(42-134)

285

(104--134);

(84 -101)

-.

N-

1-39
.

N-

- ;

- .

, N- ,

-
; -
- 1000
, .

-.

, ,

, - , ,

. -
.

. -

-.

, .

- - (.

. N- . ,

45.7).

-.

(1-39)

(42-134)

~----------~I~!_ _--_---------------~

c=:J!

1'

t-

(1-13)

(18-39)

(42-1011

(104-134)

(, ,

.
:

1)

(-)

2) - (-),
-, -

- . , - -');

3)

N- , Ol" -

ILr===
_______________~I~!________~

L - -_ _ _ _~II

(-

1-

(84-101)

(104-118)
I

(104-117)
. 45.7.
().
--
:
I1 -
: -.

nm.lll

45.4.

181

l1

-.

, , -,
.


1)

1);

45.4.

-'

5%

(. , );

N-

(, )
,
.

11;

.,

11

cAMP- ,

2 +.

.
(m) , (

)
.

, .

20-

. ,

. .

. (

,
.

()

( )
-

().

. n ():

. ..'1.
; -
,

1.

, ;

. -

39

(.

24

45.8)

N-

16

- .

I/lf

182

1 -N

45
.

21 - 27 -

6-

(. .

.'I

, .

48.3),

).

,
,

, ,

), .

, .

3.

mll

, ~-

.

,

1)

. ,

2.

3)

2)

4)
5)

u u

.

.

, ,

.
.

. - (-).

91 - (.
45.7). - ~-MC,
-, - -.
-,
-; - .
,

-. - 7 (

47-53)' 4-10 (.
45.9). -
,
. -,

-.
. . -

45.8.

- - (31
-) (. 45.7).
- - -

Il

-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Lys-Pro 2-12

(),

- (p-).

45.9.

n 45-55

-Tyr- Lys-Met-G lu-His-Phe-Arg- rp-Gly-Ser-Pro-

(3-

183

91

39

, -

-
.

- 15 14
. ,
,
, . (.

. , ,

u ,

- () .

18-30

), .

II

),

-,

1 11
.
19000 21 000.

().

, .

(, )

(2-4

).

, ( )
.

-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly-NH 2

- -. -

1-13' N-
.
,

-Tyr-Phe-Gln-Asn-Cys-Pro-Lys-Gly-NH2

.
.

-Tyr-lle-Gln-Asn-Cys-Pro-Arg-Gly-NH2

.
,

- -, ,

, .

1 6,

184

45

-,

. ,

8 .

1)

4-S

1.

2.
(; )

oil:

, ,

, ,

, ll

--.

1.

,
, .

~
.

11.

. ,
. ;

- IIX -

4 ,

, ,

20 .

1.

, ,

0,5-1

. ()

, ;

N-

, l 0-

ll, ,

. -

(S-S)

rOp.ttOHbI unm.."1.'Cl

in vivo

u,

(
, .


).
,
.

.
,

,
-
. :
.


., Herhert . Polyprotein gene expression:
Generation of diversity of neuroendocrine peptides, .
Rev. Biochem., 1984. 53, 665.
Prantz . G. Prolactin, N. Engl. J. Mcd., 1978. 298, 201.
Krieger D. . multiple faces of pro-opiomelanocortin.
prototype precursor mll, Clin. Res .. 1983, 3, 342.
Kru/ich L. Central ncurotransmitters and thc selection of prolactin. GH. LH, and TSH, . Rev. Physiol., 1979.41,
603.
Niko/ics . et /. prolactin-inhibiting factor with the precursor for m gonadotropin-releasing hormone, Nature,
1986. 316, 511.
Pierce J. G.. Parsons . F. Glycoprotein hormones: Structure
and function, . Rcv. Biochem., 1981. 50. 465.
Seeburg . m growth hormonc genc family: Structure
and evolution of the chromosomal locus. Nuc1eic Acids
Res., 1983, 11, 3939.

Doug/ass J .. Cive//i

, -
,

, - (. .

43.2).

ll

Chorll 1. . posterior pituitary gland, C1in. Endocrinol.,


1975, 4, 89.
RobCl'tson G. L. Regulation of vasopressin function in hea1th
and disease, Resent Prog. Horm. Res .. 1977, 33, 333.

),

,
. ,


,


. et /. Efec! of CNS peptides hypothalamic regulation of pituitary secretion, Adv. Biochem. Psychopharmal, 1981. 28. 557.
Lahrie . et /. h,ism of action of hypothalamic hormones
in the adenohypophysis, u. Rev. Physiol., 1979, 41,
555.
Reichlin S. Systems for the study of regulation of neuropeptide
secretion. In: Neurosecretion and Brain Peptidcs: Implications for Brain Function and Neurological Disease. Martin
J. ., Reicblin S., Bick . L. (eds.), Raven Press, 1981.

Imllra

46

HO-O-~
21 -
_

--,

NH 2

3- ()

-
,

--"
21-
_


-3,5,3'-J ()
3,5,3;5'- (4' ),

,
. (
.

46.1)

1
3.5-
1

1
1

.
.

-{

')-o-Q-CH.TH-COOH
NH 2

3,3',5'- ( 3' 3)

.
,

NH 2

3,5,3'- ( 3)

NH z

-{ }-{ }ch,tH-

3,5,3' ,5' - (, 4)

( ,

---{ }ch,tH-

, .

NH~
()

46.1.

,n
CTBeHH~

187

,
.

( )

80 .

3 4

. ,

. ,

.
,

1.


( )


.
,

.
,

,
. 4

(4) ().
.
660000. 8-10%
, -
--,2-10/0.
. 115

,
. 70%

- ()
(), 300/0 -
, 4 .
, 4/
7: 1. ,
/.
5000


, -, ,



.
,
;

,
4 .
,
,


,
.


. 20
,

, .
, ,

, ,

. 4 /
, , ,


4 .

50
(25-30%
)
150 200 .
,
:
70%
.
,
NAD
- ,
. ,
,
, ] -,
.
, ,

, . 1/3
( 4
), , .1:, 2/3
ll ~
.

2.

, .

46.2.

(1-)


, .

, , ,

1-

.
. -

Na+/K+-.

I-Hacoca

188

46

I1J1J1

~_________ ___'I .

0
. . . . . :~:: KOHeHca~~_~:'<!~T
- - - - - - - - - .. .~I..

. ~.
..

'

"--'~

4.

~~~_.... _._4
1

...

........_..-....;.

NADPH

DP

. ..
"

:. .
..

..- :

.- ...

---

Na+ ,+
BHeKJ1eTO'lHOe

46.2.

. ,

( , ) ( ).
.

, .
. -; -JJ.;
; -; 4 -. .

. .

( ).

1-

(),

(.

46.3).

500

( /) -

. , -

_\fO " .ll

NH 2

/
S=C

C=S

NH 2

/
S=C
\

//

N-CH

\
//

N-- 7

11

N-CH

N-CH

S=C

~ !J0
N-C'I

~ /1
N-C

189

46.3.

25.

.
;

10%),

46.3.

ll

.'

, ,

1-,

1-

1-,

("4).

(Re0 4)

(CI0"4),

. "4

. , .

N -).

(SC-

1-,

. QlI,

1-

1-

- ,

1311), ,
d

()

:110

l0"4

1311,

"

1-

- ,

, , ,

. ,

1-

. ,

60000,
. 20 2

1 -.

, r


ND- ,

--. -

I ;

KI

190

:
- ()

().

,
.

4 ,

50000.

100

20 MKr/lOO

46

()

4 , (. 46.1).

()
.

800/0

10

(<<)

T 1,

.
3

4 3.


. (
)
,

,
4 , 4

, .

4--5


Jl,

,- 4 , ,

4
,
. ,
(
).

(.

46.4). 4

.
,

4 .

. (, , 4 )

4 3'

(,

. "!

4 ,

4 .

), .

-,

46.1.

ropMOH

(%)

,
, .

06-

t'/2

()

0,03
0,3

8
0,15

46.4.

....., 2,24
'" 0,4

3,010-11
....., 0,610 -11

6.5
1.5

191

, '.l1

.
:l ,
.

//0
I
I
I

II

. ,
I ,

.
. 4

".'

1"
/

I
I

,,

\
\

--

02'
.

..

, ,

Na+/K+- .

4

46.4.

. '\1
,

- .
; -;

---
(); - .

.
(-l),

(. .

45.5).
,

45

-,

-l.
,

(. .

44.1).

, ,

,
.

,
.

Ix

4' ,


, ; , -.

, 3' 4'

.

.
J ~'I
.

u .

.

,
, ,
.

,
aTKoB ,

,
(

) -

192

46

. .

, ,

.

,

1)

3)

2)

5)

4)

.
,
, .
.

4
,

.
,

.
, ,

,
,

(IgG),

(. .

43.2).

3 4'

IgG

.
,

,
, , ,
( ), ,
,

, ,
,

(
, 1311) .
.

, , ,

, .

Chopra 1. J. et /. Pathways of metabolism of thyroid hormones, Recent Prog. Horm. Res., 1978, 34, 531.
Jk.rn 1. . D. Thyrotropin-releasing hormone, N. Engl. J.
Med., ] 982, 306, ] 45.
Larsen . R. Thyroid-pituitary interaction: Feedback regulation of thvrotropin secrction thyroid hormones, N.
Engl. J. M'ed., 1982, 396, 23.
Lo G. S. et /. Dependence of renal (Na + and +)-s activity thyroid status. J. Biol. ., 1976, 251, 7826.
Oppenheimer J. . Thyroid hormone action at the nuclear level, . Intern. Med., 1985, 102, 374.
Roblns J. et /. Thyroxine transport proteins of plasma: Molecular properties and osynthesis. Recent Prog. Horm.
Res., 1978, 34, 477.

47

--
- -


I' .

(). ,

1%

,
] %

(),

,
, ,

" ,
,

, ,

() 2 +.

]

Ca 2-t

, ]

;
.

() .

.
2 + PO~ -

.
,

2 +

1)

~'10,

2) , 3)

. ,

6%

. .

() .
( 2 +),

2+

3/

1,1--1,3 /,--

2 + .


990/0

2+

.
-

Ca2 -t

. --

; -

2+ -

7 1594

; ,

194

47

( ,

1.25()2-D.

. .

D.

/ /

. , -.

2 +

2 + ,

0.8

, . .

2 +. ,

( ).

2+

() -

Mg2+,

( )

; ,

Na +

2+.

in vitro,



2+ +

Mg2+.

Na +


.
(lOOO- 2+)

.

Na+

2+ -

1. ()

84

(.

9500)

- (.

N-

I _ 34

25-34

(. . 44).
, 2+ ,

, .

47.1).

115

(.

, 2 +

- ,

, N-

2+ .

- (),
11,25()1-Dl (),

: ,

47.1).

1,1

j)

25

N-

, (

. }-'

195

R ()

-10

-20

/j

\
.

47.1.

. ,

(1- 5)

(4,5).

(Slightly modified and reproduced, with permission. from Habener J. F .. Reccnt advances in
parathyroid hormone research. CIin. Biochem 1981; 14:223.)

)
.

47.1.

47.2.

. .

25

( )

()

1)

3)

2)

196

1: .: <.........:.: .: ...
(31)

47

84

(6) 1

(6) 1

841'

~
....

84

1
,

j----------=-----------"

*
.

+t

..
2+
~Ca

~_ _ _ _ _-,IlL._ _ _ _..;:"'_ _ _ _ _----11 )!


36

37

84

..

, 1

2 +
.

47.2.

'

~ . ( 31) ( 6) .

'

2 +, ,

) IQ .

1)

, ),

,
in vi-

2 + ;

2)

80--90%)

, . . ,

tro.

3)

2 + .
.

. ,

. ,

, .

; ,

. .

2+. -.

, .

2 +;

. ,

. . 2 +
,

,
.

20

(.

197

V.V. .lUu

47.1

47.2),

34-84.

7000.

7_84 ,

10,5 /

. ,

2 t

2 + .

, ,

Ca2t I-

, .
- 1-16
37--84;

(
) .

- .

; I _34

( ).

, , ,

. ,

I _36

1,5

~
. .
,

70 000.

34-84

4000

--------------'7--,

, ,

, -,

,
.
,

N-

- r),

. ,
,

36

37

, .
3000

600

<:

<:

500

:.:

..

2000

400

.
v

...

300

L.

.."
.
.....
:.:

:i

1000

200

700

:i
u

onpeenfleTCfI

fl
,

, N-

\.

3 4 5 6 7 8 9 10 11 12131415 16 17 18
(/100 l

. .

. .

47.3,

10,5

/ ) .

47.3.

()

()
. (Modified d reproduced, with permission,
from Arnaud . ., Litlledike ., Tsao . S. Calcium homeostasis d the siultus sut of lciti and
rathyroid h i pig. Pages 95 - 101. l: lciti: Proc.
of thc 2 d intern. Symp. Taylor S. (ed.). i, 1969.)

)98

47

. .

uI?I .

().

-, ;

900/0

2 +.

98% .
75-900/0

, ,

. .

(. ) .

; ,

, () ,

. .
.

. .

, . -

, ,

u, .

(. ., . )

.
,

, .

. .

. .

, .

, .

, ,

. .

2 +

( ) .

2 +
, .

. . ,
-,

, 2 +.
2 +

+ ,

u (. )

1\1


. .
, -,

. .


, (

. -

.. ei'u Jm60U

199

, .

,-

- .

),

( ).

44.

( )

- , . .

, .

, . ,

, .

, ,

1)

G s-

2)

,
, .

- ,

. .

, , ,

50

. .

(.

, ,

, 2+

47.4),

, (

) .

. ,

1,25-

()

()2-] 25-0-

()

, ,

2.

11,25-()1-])

. . -

. . -

.
,

-,

(.

47.4).

200

47

7- ---~!--. . . .

0 3 - - - - - -..........

_.

(25-0- )

25-..

.......~---- 25-

24,25- () 2-0

1,24,25- () 3-D

24

27

7.

47.4.

:IO

01'

1,25- () 2-D ()

25- .

25, 26-()2-0 1, 25, 26-(k.


01 1.25-()2-0 (). (Reproduced. wiht nissi. from Gg
W. F. Review of Medical Physiology, 13f. ed. lt d Lange. 1987.)
-

7-.

2.

. ,

D- ,

D D

1.

25-

(, ,

),

D,

25-

7-

NADPH,

r.

ND- -450-

-450. ;

7-

, (
) .

25-

-D (

D,

201

D-

, -, .

24,25-()2-D,

. 25-0-] ;

l-

3.

() ll.

, )

, .

C-l.

NADPH, Mg2+,

1) - (
2) (
) 3) -450.

),

1,25-()2-D-

4.

yr

26

20

, 110

-,

1, 23, 24, 25

.
, ,
.

(.47.5). .

, ,

. .
"

(.

. ,

, -

47.4

47.1).

; I-

, ,

, , ,

, ,

l-

, ,

, ,

, , ,

, .

.
l-

.
.

.J.

100000

90000.-

24-, -

, . ,

ll;

47.1.

l-

,
.

(i)

(i)

(1)

(i)

, .

-,

- .

. -1\f .

202

47

It

-----+-
.

47.5.

() . ,

. -- .

, . .

. ,

. , ,

2+,

1-2

. ,

, ,

, ,

- ().

2+ .

. .

. ,

(. . ).

, ,


. D-

. ,

d,

. 3-

1)

, ,

. ,

3)

2)

. ,

, ,

, ,

203

Il.

(. .

).

.

, .
!>I .

il 25-0-) .

11

,
, ,
.

.
,
.
;

, .l
,
.
, ;

.
. ,



(.

43.3)

(, . )
.

9,5

15

%.

u ,

-).

~
.

(1962-1968)

. ,

.
.

-
,


. .

. . -

3.

10

()

() -

(.

32

47.6);

( -

), -

.

.

7-

N- ,
.

I!
\NH

14

32), ,

47.6.

204

47

:I d ,

, ,


, ,

.i10

.
()-.

.

,

,
.
,

Cohll D. J'., E/ting J. Biosynthesis, rrocessing, and secretion of


parathormone and secretory protein-l, Recent Prog.
Horm. Res .. 1983. 39. 181.
. . Parathyroids, calcitonin and control of plasma calcium. Reccnt Prog. m. Res . 1964. 20. 59.
DeLuca . F., Sc/moes . . Vitamin : Recent advances,
. Rev. Biochem., 1983, 52, 411.
Normlln . W., Roth J., ; L. The vitamin D endocrine systcm: Steroid metabolism. hormone rcceptors, and biologil response (calcium binding). Endocr. Rev., 1982,3,331.
Potts J. . Jr., nn . ., Rosenhlall . Parathyroid
hormone: Chemistry, biosynthesis and mode of action,
dv. Protein Chem., 1982, 35. 323. .
Rosenblatt . Pre-proparathyroid hormone, proparathyroid
hormone, and parathyroid hormone. Clin. Orthop. (Oct.),
1982, 170, 260.
Tlllmatlge R. V., J?amlerWiel . J., llh's J. L. Calcitonin
and phosphate. Mol. ll Endocrinol., 1981. 24. 235.

48

,
-

) ,

- -

, .

--

, .
;

; ,

rmo
.

"l :

I. I .


SO .
- ;

Na +

; ,

. ,

Na+

+.

21

-l,

. ,

- .

. ,

( ,

. -

'l 4

206

it

48.1.

21-

,
, .

+ + .

. .

m-

Na +

(,

6. , 6. 4).

18 ).
19

(.

(,

),

. ,

-17 (,

). ,

(
) .

48.1.

-(-) -

17-

- -17.
,
,

48.1)

m . . -

C-19

C-19

u-

- . ('-

'-

1 13)

- =

C-19

C-19

-,
(5) (5~)

(-19 -18

(.

D (. 48.1).
1 13

, ,

. . ,

- -

21

nllu

48.2.

( )

11P,

21--3,20-;-4-

-18-
.

4--, 17-

_l

5- - 3 ~-

11~, 21--4--,20-

1 '~,

F)

17, 21---4-,20-

(
)

(-

450061.)'

6-

)
21- (.

48.2).

-450 00

-4S0
.

3~--5--17-0

2 I -.-4--3,20-

()

11-

17,

21--4--3, 20-

.
,

S)
9--16--1 '~.

17. 21-

-l ,4- -3,20-

1.3.5( 1)-- 3.17~-11.


1.3.5(J0)--3,16, I 7~-
3-- I .3,5( (0)--3-0-

NADPH;

Ll,

17-0

--5~-- I 7-0

9-

9--l '~.

1 '~. 17. 21- - I ,4-

'7.

17.

2 I -

-4--.20-

21 - -l.4-

' -

18-

18--

,-

48.3

-3,ll,20-

5~--. 20-
5~-~-. 17. 20-

~--5--20-0

4--.20-

48.1.

I 7~--4-..::t.--

, .

, .

11.-.20-

17, 21--4--3, 11,20-

()

11-

-450,

: -22, -20;

207

48.2.

--

(3--) 6 5 4 -.

-21 ll- (),

-ll)

Na+).

).

5%

-21

in situ

(,

-,

, -17

, -

208
, /, /, /

'

-450

11

---

()

~
=

17~-
(
.

48.2.

1 )

17a-

, () .
-

17- -

. roro ra

18-

, t:

-18

C-21

11-

. . -l1

, 18-

21 )

01 \: .

19 )

21-

lllJ--

. . ,

(. )

(.

48.4).

, -

, ,

,- : ().

-17, -21 -ll.

r, I -ll

17-

17,20-.

17-

01 ;

C-21,

).

17-

17a-

.,

ll

- (.

, -

, ).

Il llnllu

209

17-

(J- - 5,4 -

C=Q

4 --,17 -

21

11-

11-

11(J-

18-

18-

48.3.

, .

; .

reproduced, with permission from Harding . W_ Page 1135 in Endocrinology v.2,


1979.)

Debroo~

(Slightly modified
L. . [editor). Grune and Sttt.

210

'Jl\'1

"'---

48


( , )
,

.
,

-----1-------1--:=::------

('2')
~

. -

11- f;\::::
~
\::J
17-
.

48.4.

- ).

I-,~_

1-

, (

. .'IlO.

, ,

(),

'.

"l:\.

1)

20- -.

2)

3(3-1 -

L\5.4-. 3) 17-r, 4) 21-

. ,

5) 11 (3-. (Slightly modified and reproduced. with permission from Hardil1d B_W. Page 1135 in
Endocrinology v.2. Dehroot L. [editior]_ Crul1e t Stratton. 1979.)

1,5-2

(. 2

, ,

, tl/2

1 .

. - ,

3--

65.4_

.

17-

C-17 -

()

8%

. .


, .

11- -

(. ).

,
,

ll-

17a-


. Jl.

80%

17-

ll-)

20%

ll-.

211

ll lInllu

-,

ll,

NADPH,

ll.

, I'
-
.
,
,

.
,

, ,

- .

70%

, .

20% -

. LJ.
, , ,

-.

--,

. .

17-,

(), .

17-

48.5.

. 17-.

e

( )

-II-

(;

).

, .

(.

48.5).

, .

J'I. ,

41

[],

. .

(. .

45).

45).

. ll

.-

u -

212

48

48.3. .

ll

, ,

, .

.

ropMoHbl

, .

. -.

48.6).

11

(.

Na +

-1- ,

u 2 -, ;

(,

, )

(.

, -

48.3)

11

Asp-gVl-ll-is--his-Lu-Lu (""" 400 )

k !
j[ !

NaCl,

Asp-Arg-Val Tyr-Ile-H is-Pro-Phe-H is- Leu

Stg-Vl--ll-is--h

j!
I

111

Arg-Val-Tyr-Ile-His-Pro-Phe

j !
I

48.6.

nlIu

213

, ,

~- .
,

18-ll ,

44.

, ,

. 2

1.

F. o

F20 -;

, ,


.
-

-
,

. .
:

0,1

-/ ,

1 - ,

. +

. , ,

Na+

-.

IlI

. +

, ,

, .

, + .

1-

,
.

II

. . ,

(,

. ,

. (, )

.
,

Na +,

+)

11 .
II
111 (. 48.6)
Asp'.

.
4 , HI,

, ,

. I

. .
,

Na+

Na +

Na +

r.

Il

.

.

; .

( )

II

, -,

, , -.

."

214

48

, , . ,

t (C:l. )

r ; .

17.7).

()

(.

( ) 11

.
.LU .

, ,

2.

ll.

~l.

I'

IO

1.

).

'

(<< ), ,

:l l

, .

. IIII

1)

: 2)

() - (

). ,

(,

:\1-

) u

3)

..

'l

.
[

)'

II :

, , -

I',
:I [
1 .

. ,

. ,

. '

ll .

I1 .

, .

ll ll

I;

. OI

~1

, 0-

h .

) .

. )

),

4. .

. ' , [

[, -

ll

II nll

215

. , ,

(,

- ,

). ,

1.

1.

- .

-.

. , ,

. ,

, ,

).

2.

80-m .

, .

. , ,

, -,

. ,

) . . .

, -

2.

3.

, ,

, ,

-,

216

48

ll; ,


( ),

, -, u
(. ).

.

().

x
['

. lO .

49

ll

, ,

, , ,

; ,

, .

).

, ,

.
,

Na +

Na +

. ,

+, +

NH"'4

17a-

),
,
.

: ,

ll- (

) ~ 50 ,

,- ,

Hx

1000 .

. ,
,

Na + +

VI\

Rc, aoRcT,

(.

48.4).

. .
,


(. 48.7). N
, ,

48.4.

217

. .

44

44.1.

,
, . ,

11 (3-
21-

17-

. ,

17(3-

19-

ll-

yr.-

17-

Ila.

. -

. , ,

, ,

,- -.

v-erb-A, -
TFIIIA

. -

Lys-Arg.

Cys-

yr

TFIIIA,

AGA~

CA~.

( );

, ,

, ~,

777

742

t-----v-erb-A-ro -----f

NH z

100

200

300

400

500

600

700

777

. 48.7. .
, 742 777 -.
. u : ,
-. , Y--.

21~

48

; ,

(.

uhI, .

l.

ll . ll

48.R).

_l

I ,

, "

. ,

. ,

. l ull.

), (

K.letok- .

(,

,-

),

ll

(
). ,

( ......

ll

1 /).

( ll

) 80- 100 . :

. 06

vitro,

in

1 11

111 -

1-

1I -

, ,

. 1(1

.
,

, . ,

, ,

XQfl

10

CII

i
~~ )

1
:!t
~

8.

z:

';s

z:

1 ,

. .

tJ

, i

tJ ~
Q.tJ

OI .

z:

8.

ll ,

. .2J.pe
~ - . .
- Na+ -

in vivo

--

1.

. ll .

nWt ..

an.,fl

8p.l

p.l

Na +

48.8.

, .
,

, ll

Na +

48.8.

.'\

()

Na +

Na +,

Na + -. (Modified from dlm S. Candidate mediators


the ti of ldstr Na + -trsrt. I: mr
rsrt Processes, vol. 1. ffm 1.F. [editior). Raven
Press, 1978.)
i

Na t_

Na + / + -:

. ,

Na ~ -

, ,
,

II nUI.:

219

. (l (l

Na +.

/.

Na+ / +-

(l

. (l

. (l ()

(l

NADH:NAD,

. ll

(l ,

ll

(,

, .

), (l

(l

(l

(l.

Na -+.

N(l +-

, ,

R(l .

. .

Na +

, .

-+

I1

~ ll

(l
JJ (J.

).
, .

,
(l I (l

(l ) ,

, , ,

.'IJ,

. (l

(l (l .

(l
(l .
.

N(l+

ll

, + ;

(l

, (l

,-

(l;

, .

810

. (l

ll

, .

, (lll, (l

, -

220

49.

,
,

90%

21-: (
) ( );

J J J3-.

-, 17-,
-,

18-m

18-

1818-

48

Baxter J. D .. Forsham . . Tissue efects of glucocorticoids,


m. J. Med., 1972. 53, 573.
Chandler V. L. al. DNA sequences bound specificaHy glucocorticoid receptor in vitro render heterologous promoter responsive in vitro. . 1983, 33, 489.
Gi/l G. N. Mechanism of action, Metabolism, 1972,21,
571.
Cranner D. . role of glucocorticoid hormones as biological
amplifiers. l: Glucocorticoid rm Action, Baxter
J. . Rousseau G. G. (eds.), Springer-Verlag, 1979.
Morris D. J. metabolism and mechanism of action of aldosterone, Endocr. Rev . 1981, 2, 234.
Samuels . ., Tomkins G. . Rclation of steroid structure to
enzyme induction in hepatoma tissue culture cells, J. Mol.
Biol., 1970, 52. 57.
Weinberger . ' al. Domain structure of human glucocorticoid
receptor and its relationship to the v-erb-A oncogene product, Nature, 1985, 318, 670.
mm . R .. Alberts . . Steroid reccptors; Elements for
modulation of eukaryotic transcription. . Rev. Biochem., J976, 45, 72 J.

49

()


- .

. , ,
,

. ,

,

.
, ,
.

2)

3)


),
,

, ( ,

, ).

49.1.

OpraH


1)

,
-

49.1.

44.

f
f

(
, ,

).

(,

- ).

(, , -
). ,

,
:

t1

222

. t

- -. FlO

3,4-

49

, ',-.

, , .

.

. .

-L--

, . , ,

-0-

"

80%

. ,

,
,

in situ ( ...... 80%

HO~T-T-NH2

1)

, 2), 3)

4)

H0f=\ 7 r=o

11

);

/; - ~-NH2

N-.

49.1

I 1
" j ?-?-NH 2

49.2.

,.----------(3---.

, -

.
,
.

=-
1 I
" /; ?- T-NH2

.
L- L- (L-).

~~

.

:

:-

. -, ,

, -.

.
-,

;/

111

C-C-NH

49.1.

-N-. (Modified and


poduced, with permission. fom Goldfien . adrenal m

dulla. In: Basic and Clinical Endocrinology. 2nd ed. Greenspan


FS, Forsham [editors]. Appleton al1d Lange. 1986.)

rOPAf01lbI 60i' IIlJn'lIIU6

223

100

r ,

N.

, -,

-.
,

L-

3.4- ().
,

L-,

-. :

L-
.
--

, , 3- (
), - .

, -,

(. )

, ,

. - Mg2 f

, + 2 ' .
-

4: 1

(: ).


'. ' ,

--
-- ( ) -
,

,
;
.
, ,

. ,
.

( )
.

-
(.

49.2).

.
, , .

, ,
, , -

N-

(N)

N-

N-

1- - 30

, ,

. N

5%)

. -

224

49

--~--4~

lJ

11

---t~

G-

49.2.

"}- N-; -

-;

--;

-j3-; -.

(), - (), - _
()_

(_

49.3)_

--
_

() -

S-

3--4-rpo (

JJaJI , )

(_

() -

49.3)_

95%

, ,

, -

, , .

: -
, ,

, - ( )

2-

, (

) ,

T(lP

H0=(J1 {

HO-fl-{H

H~CH2

NH 2

NHCH,

:/""

~ I

OH~
f=o
/

'<fH

HO~ ,

NH 2

~ =1l . /;Jl

' 6

CH)O~,{

HO~ 2

tH 2 IKOMT I

NHCH,

t\

CH]o~lHl

225

/l?fl "nn"u

NH2

II!J

'I

--4-

49.3.

-- ()

(). (RepodHced.

with

2nd ed.

issi.

Gs

from Gldfi . Thc d\ medlll1a. I: Basic d 1iil


FS. Forsham . . [editors]. \t <td Langc. 19~6.)

dilg.

,J.Ba

Ct

: ) :!, ~) ~2'

. ( )


. ,

-, ~-,
, ,

. (

) -.

Ct

) ( N)
.

-)l

~-
. -,
, , Ct

, . -,

, ~-

( Ct

)- ,

8 1594

226

49.2.

.
,

.l:

.1

.1

(. .

19.7).

. ,

, . .

.- 2-,

, , 2-

, (. .

) ( )

44.3

G-,

GTP. (G.),
(G;) ,

) .

, G,
G-. GTP (. .

44.3).

44.2).

(l.- ,


, ,

MorYT


( r). ,
' G-

u -

G-

, (l-

GTP.

G-

cGMP.


. ,

GTP.


,
,

: . ,

r ,

. 49.2.

(. .

44.4)

cAMP-

r .
-

Benovic J. L. /. p-Adrenergic receptor kinase: Identification


of novel protein kinase that phosphorylates the agonistoccupied form of the receptor, Proc. Natl. Acad. Sci. USA,
1986, 83, 2797.

-llbl '.fl? lInlIu

. .

Diseases 01' the dl medulla d sympathetic


system, Pagcs 511- 550. I: dlg d
Mctabolism, Felig . ! al. (eds.). Gw-ilI, 1981.
Dixon R. . F. et /. lig of thc g d cDNA for mm
mli f3-dgi receptor d homo)ogy with rhodopsi, Nature, 1986, 321, 75.
Exton J. . hism ivlvd il1 -dgi hm:
Role of calcium i i tis of thlmis il1 livcr
d other tissues, m. J. Physiol., 1980, 238. .
U. . hism of htti i vertebrate visi,
Ids Biochem. Sci .. 1986, 11, 43.
vus

/n

227

F. L .. Chaljie . thli release from the adremedulla, li. dril. Metab .. 1977, 6, 551.
Sibley D. R .. LejkO}~'itz R. J. Molecular mechanisms of receptor
dssitizti usig the f3-dgi receptor-coupled
dlt cyc)ase system as mode), Nature, 1985, 317,
124.
Stiles G. L .. n . G.. Lejko'itz R. . The f3-dgi receptor: Biochemical mhiss of physiological regulati. Physiol. Rev .. 1984, 64. 661.
oung J. .. Landsberg L. thlmis d itrmedi m
tabolism, li. dril. Metab., 1977, 6, 599.
l

50

rOPMOHLI I
u

()-
0prdHbI,

(l

.
,

- .
,

,
.

crporo

,
.
If. reM,
.

1) ,"

, Jl

; 2) .1J
(

JI

),
;

3)

.
,

,
(').
.
.
,

, .

, JI ,
, .

II

'l

l.

(l . , ,

-,

. .

1.

, ,

( )

r~ ( ).

, ,

229

ll I:6 .>/ce_IC]

- (-);

3) 17 -; 4)

17--

1)
2)

~ 5.4_

17_ 20-

(I7--).

17_ z0-.

<

50.1

50.2.

...

CII

, -, 3-0-
. ,
, ,


. u

CJ

()

___

c:t
I

("')

.1

17lj,

17lj--

HO~

~OH

___

---

t1 5 _


.
2. .

o~O

CJ

----

4_ .

L...

tJ
.

CII

c:t

17 .20- 88

s
L.

~O

OH

8.
c:t

17 -

:r

&J-

CII
L.

17 .20-8

.&

-- !i4-

-- .....

Lri'

.il

17-

17 Q-

..,
v'

CII

g:~---

). , -.

L\,4- . , .

L\,5) (.

17-

..,

50.1,

17-

~--.
I

( 4) ,

50.1

5)

----

. .
KdeT

'--

PIIC.

50.1.

TeCTOCTCPOH<l.

I'!~)

I'! 4)

5-. u

50-100


(. ).

2 :
.

17J3--
( 2 )- .

2 -

. , 2

r, .
2 . ,

BO.JpaCTHLIe

ll

('

.
.

230
---

.---

.--

50
.---

111

&~
111

...
S

%
Q)
...

111

111

8.
Q)

:;

...s
~ 8.
1
8.~
v,,'
~ ...
S

Q)

";~

8.

:;

8.111
... 111
u %

Q)

~HPO~

Q)

...

8.

S
...

...

Q)

6.~

....

'

3R

~ )

17-

8.~

~
,~

ts

,Il

...~--- u....

L<1

~ ~

...-

...111

ct~T'
,1

..

. 50.2. .
, , , . (
). -

. -.

(Reproduced. with permission.


and Stratton, 1979.)

DeGroot L. J. Endocrinology, Vol. 3. Grune

. ,

- ()

50.1.

17-f3-



, lI ,

,- .

17--

17-J}--

5 .

, -, ;
, , ,

.
,
, J3-,

(. 50.1).
,

.

, (. 50.2),
u
,

.

.

()
- (),
.

50.2.

, )
;

48)
46).
97-99%

- (. .

- (. .

(
) .
, , , -

CrCr 1 )

KCr 1 )

5
> 10

> 10
> 100

2
1

> 100
> 100

> 100
> 100

1) ~ 109. (Adapted from


Siiteri R. , Febres F. Ovarian hormone synthesis, circulation and m
hanisms ofaction. Page 1401. In: Endocrinology, Vol. 3. DeCroot L.l.
(editor). Grune and Stratton, 1979.)

.'IIl

231

:.

, ,

, ,

,
>.


. .
.

17-
, -

()

3- 1. ,

17-

17-,

, ,

oM -

. ,

. -

- .

17-

, ,

in vivo.

. .
-

400

).

ND-

a-.

,
:

-,



(.

50.3).

(

) ,

, -,

,
.

, .
,
. -

,
. ,

- ,

.

. ( )

. .,

,
--, 17_20- 5-,

m,

- , -, -

u.. .

5-

(t

232

50
.

. -,
-
;

.

.
,

.
;
,

,
,

. rl1

().

, ;

Jl
.

50.3.

(ll).

--

-IlI

J1J.,-
-

--

( ) ,

, ,

(.

50.3).

, ,

( ,

. 2-17J3-.
.

- . (Reproduced. with permission, [ Braunstein G. D. The tests. In: Basic d Clinical drilg,
2nd. ., Gs F. G., Forsham . . [editors]. Appleton
d Lange, 1986.)

(), ii

u . ,
.n

, ,

HopMa.'IbHOe ,

50.3


>,

(.

50.4).

, .

. .

:l

()

Il ( ) -

50.3.

JlII nl6 Jl.'l

233

-
.
-_
(Modified and reproduced. with permission_ f Wilson J. . . al. The endophenotyric de,elopment. Aust. J. Biol. Sci. 1983.36. 101.)

. ,

50.4.

----------'

. - .

crine control of

, 1) ,
,

3)

5)

(.

4)

2)

") ,

u .

50.4).

u, ,

. -
u .

- (

_ :

. ,

) ,

, .

, ~.

. f

") ,
, , , .
,
, _

u.

. ,


. -

YI :

(_ .

44).

, -

234

50

, .

U 2u -

40 ) .

() .

, .

u 2u -,

, ,

. 50.4.

. u2u -
.

. -

u2u -.
-

-,

( ) -

. , ,

5 u-,

Jl -

1 , -.

(.

).

75%

60

, .


.
(-

-) , ,
,

. .

! -

. ,

-, ;

(
) / JI

. .

50.5

, -,

'

( ) .

5-~

ll j.

, .
.

; .
( ).

, .

, -

;:

235
-

-+----_

5-

..

-_.. --..,..-.
.. _. ---.-..----..:

--- ~MPHK

11

-~-

+
-

:~ ::-:

1
2
3

17-

21

5-

19

4 17 -
5 ~4--
.

50.5. .

. -. -. - .

sion,

[ro

Wilson J. . et al.

(Modified and reproduced. with permisendocrine control of male phenotypic development. Aust J. Biol. Sci. 1983, 36. 101.)

. ,


()
,

I\f

,

( J

). ,

.

17-

.

,
. ,
, .

50.6.

J
,

02

NADPH.

-450-0 .

J, (

).

, ;

,- 17- ( 2)

~ (

, , ).

17-

236

---.

50

----. 17-n ---+- n

~ 17-n ~

~'

11

......- - - -

IE I ,

16-

50.6.

(Slightly moditied and reproduced. with permission. [ Gannong W. F. Review of Medical


Physiology, 13th ed. Appleton and Lange. 1987.)

, -, <<

, .

, ,

: 17-

KateXOJl- -

, - .

-2. -

80%

( 2 ).

50%

2 ,

-,

( )

, ,

. -

, -

J 110 '6 ..l

237

, l'llO

. ,

- .

, ;

(.

50.2).

,

, .

..,

, -,

, ,

.
,
,

,
.

. ,
Il

. ,

(. )

, .

:
( ),

-. ,
'

,
.

1
-20-

ll
. .
, <1 .

50.6,

J. ,
,

. 50.7.
. ~ . (Slightly
modified and reproduced. with issi, f Ganong W. F.

Rcview of Medical Physiology. 13th ed. Appleton and Lange,


19~7.)

. .

lI (

) ,

-20- -

.1

(.

C:l

.
.

50.7).

17-

17a-:I

19-,

.
ll
.

238

'lQ

50

2 .,
100000-200000.

400-500

- .
,

(. ) .

1)
; 2) ,
Ix ; 3)
u; 4)

bI,

5)

,
,

u ,
.


, '

u.

. ,

u. ,
.

, , , ,

. u

,
u ,

;
;

();


, ,

u ,

l .

,
.

"J J

J. ,

. ,

),

. r .'I

).

25 35 ( 28

, (.

50.8).

. . -

0,5 , d
.

, 'JaTeM
Ol .

24

() E~ <'l

~7 . -

().

239

opMoll n.16 .ll

36.8

36.6+---~----~~-----+~~--------~----

36.4
2.0

20
17- -../

17a-J

1.0

.-....... -

(/)

.__._

...

-.--.

."
10

,.,.,.'

(/)

200
/

100

OL----+-------------+-------------+---50
40
+-

()

30

20

10

. .~

O~~~. .~~~~~+~~~~~~~

2527 1

7 9 11 13 15 17 19 21 23 25 27 1 3

50.8.

. - , - . (Reproduced. with permission.


from Midgley . R. In: Reproduction, Hafez ESE, Evans TN [editors]. Harper and Row, 1973.)

24- ),

()--

, .

, ,

(. .

, .

45).

. .

( )

-- ,

14 2 .

, . IO

-- ".
,

,
.

(22--

240

50

. r" .,'JO ().

. . I"

, ") I"

JI;

u.

"J () -,

16

1.

lI

. .

50.9.
6-8

(.

50.1 ).

, .

1"

. -

/ .15.4-

30- - 40

3--

, .

. ,

(. ). 1).

. .
()-,

~
...
~

OI"

.. ~:. 3
3 /

:' ' I

::

2"

::

I
I 30 100

24

I
1

I
2

, ,

18

15

. .
50

12

21

I
/

l .

27

50

1:

~:

45.

,
, . ,
.

.
.

. 1

70

140

210

280

50.9.

, -

( ).

with

(Reproduced,
Ganong W. F. Review of Medical Physiology, 13th ed. Appleton and Lange, 1987.)

1issi. f

.

,

100

.
r
,

l (.

45).

.,

241

.~~~--------------~

JA

1-6

+
16

L""--~--....... 16.. - - - - - - '


f

50.10.

-. -".

, ,

. .

, ,

, ,

( )

. ,

(.

50.9).

, .

: .

.
,

aI ,
,

(.

. -

45),

, ,

200

%. -

45.

242

50

53

.
(.

50.6).

,
,

.

17-l

,
.

. ,
, -

1I
.
.
,

(. ).
- ()

, .

LI

. .....

. -

. (

.
-

1.

19-

17

(,

17~

~()II

J
;

-.

243

- -

. -

. ,

, .

).

v-erb-A.

-.

=
--


,
:

1)


. , ,

, ,

2)

--=

4)

3)

, ,

,
~

t1

. ,

, ,

.... , ,
.

. .....

. ,

).

. .....

244

-,

50
,

.
(,
).
.
, .


JI,
.

,
- ( )

I'l' ,

( .

).

....

. ....
( )-
,


I'

.,' ,

.

-.
- :
.

XX-I.

-1. -2. -

.

-),
, ,


' .

35-

50-

.
.....

. 56-

.
, .

, . . l

. '

, '

II.

....

-- (.

50.ll).

'

IIOJlO

90- .

: -+

---+ .

245

1>))\

~.;}-~-----~ . ,

( )

3.

~--------4~

:-.;r--.....;...---~

t. .

50.11. . -, (Modified
and reproduced. with permission, from Fox Sl. Page 631. In: Physiology, William . Brown. 1984.)

,
.

50.11.

, ,

, -

().

17-17,5

3 --/.1 5.4- -

( )

).

, -

(.

50.11).

~1. ,

( ).

. , I,

. ,

70000.

. ,

, , ,

, -

246

. ,
,
.

50
Samue/s L. .. Matsumoto . Localization of enrymes involved
in testosteronc biosynthesis the mousc testis, Endocrinology, 1974, 94, 55.
Wilson J. Metabolism of testicular androgens, Chap. 25, .
491-508. I: Handbook of Endocrinology, Section 7;
docrinology. Vol. 5: Male Reproductive System. ~1ilt
D. W., Grcep R. . (ed.). Americar. Pllysiological Society,
Washington , 1975.

, 5-

. ,


, ,
: .

Two principles in endocrinc therapy of cancer. Hordeprival and hormone interference, Cancer Res.,
1965. 25, 1163.
Ohno S., Geller L. N., Lai . V. . Tfm mutation and masculinization versus feminization thc mouse central nervous
system. , 1974, 3. 235.
'll . W. Steroid hormone action in eukaryotic ceHs. J.
Clin. Invest., 1984. 74. 307.
Huggins

Hall . F. Gonadotropic regulation of testicular function, Pages


1511-1519.ln: The Androgcns ofthe Testis, EikNes . .
(ed.), Dekker, 1970.
ll . F. Testicular hormones: Synthe~is and control. Pages
1511 -1520.1n: Endocrinology, Vol. 3, DeGroot L.J. (ed),
Grune and Stratton, 1979.
Longcope , to .. Horton R. Conversion of blood androgens to estrogen in normal and women, J. Clin. I
vest., 1969, 48, 2191.
Mainwar;ng W. 1. . The Mechanism of Action of Androgens,
Springer, 1977.

Chann;ng .. Coudert S. . Thc role of granulosa ceHs and


follicular f1uid in estrogen secretion the monkey ovary
in vivo, Endocrinology. 1976, 98, 590.
Channing ., Tsafriri . Mcchanism of action of luteinizing
hormone and follicle-stimulating hormone the ovary in
vitro. Metabolism. 1977, 26, 413.
Green S. et /. cstrogen receptor DNA: Sequcnce,
pression and homology ( v-erb-A, Nature, 1986, 320. 134.
Jensen . V., Jacobson . 1. Basic guides ( the mcchanism
estrogen action, Recent Prog. Horm. Res., 1962, 18, 387.
Siiter; . .. Febres F. Ovarian hormone synthesis, circulation
and mechanisms of action, Pages 1401-1417. I: Endocrinology, Vol. 3, DeGroot L. J. (ed.), Grume and Statton,
1979.
Toft D., Gorski J. receptor ll for cstrogens. Proc. Natl.
Acad. Sci. USA, 1966. 55. 1574.

Bullock L. ., Barden . W., Ohllo S. The androgcn inscnsitivc


mouse: Absence of intranuclear androgen retention in the
kidney, Biochem. Biophys. Res. ., 1971,44, 1537.
Jost . et /. Studics in sex diffcl'cntiation in mammals, Recent
Prog. Horm. Res., 1973. 29, 1.
Ohno S. Major regulatory genes for mammalian scxual development, ll, 1976.7,315.
Ohno S. The rol~ of - antigen in primary sex dctermination,
JAMA, 1978, 239. 217.
U''ilson J. D., Wa/ker J. D. The conversion of tcstosteronc to 5androsten-17p-01-3-one (dihydrotestosterone) skin slices , J. Clin. Invest., 1969, 48, 371.
Wilson J. D. et /. The endocrinc control ofmale phenotypic development, Aust. J. Biol. Sci., 1983, 36, 101.

51

, ,

, .
1-2 .

(.

51.1).

1-2%

110 : ,

, .
,

, .

, .

, ,

; , ,

1860

. ,

1889 .,

51.1.

1909 .

1921

1917 .,

, /

( )

..., 25

. , ,

( )

-70
<5

D
F

( )

. ,
.

248

51

.
,

(Abel.

,
(Sanger et al.

1926),

1955),

et al.; Zahn; Katsoyanis, 1964).

(Steiner et al., 1967).

, ,

. ,
,
,

.
.

51.2.

_'1 ,

. }

, ,

7 7 20

819.

6 11

-.

, - -

21

30

24 25 -

Phc

. N-
- - +,
- jHaKOM -. (Redrawn and repoduced, with
mission. [ Tager . S. Abnormal duts of the lm
insulin gene, Diabetes. 1984, 33. 693.)

(.
.

5734)
51.1,

51.2.

2)

1)

3)

- N-ubI -.

8,9 10 -.

(. 51.2). - -
r

51.2, :l -

s- s,

I
1I

Gly-lI - Val-Glu-Gln-Cvs-Cvs-Thr-Ser-Ile -Cvs -Ser -Leu-Tvr-Gln -Leu-Glu-Asn Tvr-Cvs-Asn

10 11

12

13 14

15

16

17

18 19

21

I
S

Phe-Val-Asn-Gln- His-Leu-Cvs-Gly-Ser-His-Leu-Val-Glu -Ala-Leu-Tvr -Leu- va,lvs-G'v-G,u-Arg-G'V-Phe-Phe-Tvr-Thr-Pro-Lvs-Thr


1 2 3 4 ~ 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
.

51.1.

(Reproduced, with permission. fom Ganong W. F. Review of Medical


Physiology, 13th ed., Appleton and Lange, 1987.)

249

. n::.lIl .lhl
.'I

51.2.

()

.'1.

(Modified and
duced. with nissi, fom Banong W. (-<'.: Revicw Medical
Physiology. 13th ed., Appleton and Lang~, 1987.)

.-._ _ _

-----t

~~::~"I

",

...

30

10

, , "I
.J1
, -

()

Thr
Ala
Ser

Scr-
- Ser- lI
- Ser- lIe
Ala- Ser- Val
-

,)..

---' ""/'

/....

~B=-----t-:::::C~A--t--PO\'4'''''

"

.... ...


...

Ala
Ala
Ala

Ala- Gly- Val


Thr- Gly- lle
Ala- Ser-

+
( )

, .

- :

30

8 , 1

..

, ,

L)

""," ~:

(25-30

/ ).

- - - - - _

24 26 ,

,

, ,

51.3.

. ,

- () .

23

, ,

- (nu :lUIlUfl),

lIOII

. .

. lI.
(.

11500).

(Reproduced, with permission, Steiner D. F .. Erros in insulin biosynthesis, N. Engl. J. Med., 1976, 294, 952.)

250

5/
20

. 51.4. . -
, -. (Slightly modified and reproduced, with permission. from
Karam J. ., SabIer . R., Forsham . . Pancrcatic hormones and diabetes mellitus. In: Basic and C1inical Endocrinology, 2nd
ed., Greenspan F. S., Forsham . H.(eds.), Appleton and Lange, 1986.)

51.3.

23

(-)

51.5.

Arg31-Arg32
Lys64-Arg65-Ha

N-

- - 2.

(.

9000),

51.4.

, :

- 1

-.

51.6.

( -8) ,

()

-.

2
1

- . tig-.-u.


N-.- u. .

.. .

_ n.l l

.u.

.u.

Thr \-Arg -rg~Glu - - G l n \Lys-Arg-IG1'V--Asn \

I Phe -

L(S-S)2

,u...u.

I Phe -

IG1v-- Asn \

L(S-S)2.---------......J1

,IJ..u.

~Arg- A,g

Th,

251

IGlu - - G l n \-Lvs-Arg

,...,,....,="",.------'"".'=--=-::---""""'."'"

I Phe - - Thr

IIG1v - L(S-S)2:o=J

Asn

IGlu - - G 1 n l

-.

( ). r

51.6.

-.,

Arg

1 Lvs

51.5.

, .

. ,
. (Redrawn and reproduced, with permission. from Steiner . F., Tager . S. . 927. In:
Endocrjnology. Vol. 2., DeGroot L. J. (ed.). Grune and Stratton. 1979.)

-----. (Redrawn and reproduced, with nissi. from Tager . S.


normal products of the human isuli gene. Diabetes. 1984.33.
693.)

-:

- -

. -.

.
.

78 86 ,

-.

(.

, .

51.7).

(-),

. ,

fVf (.

51.3).

50/0

( )

. ,

,
,

95%

, ,

-,

252

51

,.,._~~~_ _-;-/ (
)

2 +)

~1+4~

~~~r-----;rr-- (
)

51.7.

- ,

. ,
. (Based data presented Orci L. portrait of the pancreatic ll, Diabetologia, 1974, 10. 163.) (Modified and

reproduced, with permission, from Junqueira L. ., Carneiro J., Long J. ., Basic Histology. 5th ed., Appleton and Lange. 1986.)
- C-Q

, ( ) .

, :

- .

.
. ,

. .
(.

51.9)
11.

) (.

51.8).

. ,

, .

. .

- -.

253

Il n.z1l0 .

.

,

1)
2)
, 3)
4)
,

.
. 51..
.
,

.'I

(. . )
.
.

, . - -
. ,

l\1.
,

40-50 . , 1520% .
- ,

(.'I ).

,
. J.

. (Rdt\\<

and reproduccd. with pennission. [ro Tager . S. Ahnormal products ofthe human insulin
gene, Diabetes, 1984, 33, 693.)
'3


- .
. .

-
.

80--100

%,

300--500 /.

('

(.

. ,

51.1 ).

-24

, (-


,
. ,

) -25
.

3' -

- -.

Al"g

Lys-X,

5-10

Lys-

, , -!l.

- -

5'~
n

51.9.

. ,
,

.
,

..

L,

888R

() , - . - -

, -

. (Redrawn and reproduced, with permission. from Tager . S. l products of the human insulin
gene. Diabetes. 1984, 33, 639.)

60

51.10. d

254

51

. -

+ .

01

- .

, .

, .

, , ,

, .

(.

44).

().

, ,

, ,

-,

. ,

2 + ).

Na+

Na+,

. .

. J3-

- .

, ,

(.

).

3-5

, .

, , , ,

- ,

500/0

, ,

. ,

. ,

BOlpacTaeT.

--.

. .

- -

. ;

, .

11

()

, ,

, .

, .

~S2-N--N-(2)-
~_
11

....

n,

1) ,

2)

Il n~1)!(J ..I

3)

255

( )

) .
.
, ,
.IJ,- .....

1l0

? .'I

120

%,

, .

R, ~
.

180

%),

, ,

().
- ,

51.11.

(Courtesy of R. J. Havel.)

(), ,
(
).

(4,1

),

()
.


,
(

). ,

.

,
, ,

.
,
2 ,

-
().

.
(.

51.12),

( md-),
(-).
,

(.

51.13).

.

-,

--.

400

51.11.
. .

200

D-r

600

,- (
,

D-

L-)

800

, -

51.12.

256

51

5%

(!)

, , .

CJ


, ,

--L:"~~@ ~
~

, ,

/:tZ=fA

~~-

6- -

0-

, .

, -6-

---~
"'~

\<~Cn/

1)

NADPH,
2)

~",,"K,".'

CoA-,
- -,

3)

,
,

51.13.

. (Reproduced, with nissi, from Karnieli


. et al. Insulin-stimulated translocation of glucose transport

systcms in the isolated rat adipose , J. Biol, Chem., 1981,


256. 4772, Courtesy of S. Cushman.)

, ,
--. ,

.

) +, 2+,
.

-6-,
-l-

(

).

. .
,
.

fi:JOOfo

()

30 -40%

--.......-----.,;...--....

"'- 70

. cAMP-
,


. ,

, . ,

, ,

. ,

.

. (

). ,

. ,

.:.U'bl

257

:r .

),

).

J}-

11

- (

d) - 2

H10.

- (),

- -

. (. )

J}- .

, -,

. .

, ,

, .

, , ,

, .

51.14,

, , .

. .

. . ,

, m,

, .

-,

),

. -,

- .

, -,

cAMP-

. (

.)
. .

in vivo.

- .
- ,

() , (), -

9 1594

(),

258

51

<--------- -6- "()


i ~~:

_.

()

"
,


(R)

. .~ /

~
I

/Jf.

! ./ /'/

_____

_"'n.......

!'-,-.. .
can
~
"
t
.cn n i'''''

~ .

/'

",,-

.......,

- - - - _
I

I
I

_ _..._~

I
I

I
\

/\,

/'

"')j

, I

',

'.


()

.. ....

,1
-

KeTO~O:~~:

JI

()

51.14.

. - .

(F2 J,

F 2a

() ( , -l

).

G,

, ,

. ,

, , F2 ,

, -, -

.
(-,

G-, , ,

),

( )

lUO S-

33, .

; ,

~PMOH
~

, ,

. .

).

myp 2-2' aJ
(. 51.15).

),

, ,

. - (.

HOB-C-fos c-mS,-

135000)

. ,

. - (.

. ,

(.

44),

. . -

I /i~~H\b\
t

51.15.

95000)-

, ,

, ( )

( , ,

), (

, ,

, ,

51.] 5)
(,

. (.

259

----

ero

(Courtesy of . R. Kahn.)

260

51

NH 2

{3

51.16.

(). ()

. ' , .

. . . . d .

( ..... 25

) '\f , (

), . ,
; , , l0

. . ( II-

) .

(. ).
,

10-20 ,
10--20 .J

51.16.

. . -,
.
, .

7-

1) .u
2) ,
" ' (patches)
, 3) 4)

- .

1382 , .
190000,

- -.

12

19.

, , u

.
,

20000

ll. . .

(. ),

(. .

. -

-u

41).

11

u n1l0

. .

60 ,

261

, .

51.3.

, .

),

cAMP- .
.

cAMP-

(,

(.

44.1).

, ,

),

(, ). 2 2

(.

).

44.4) ( )
.

(. 51.3).

, ,
(

,
, ,

51.3.

. (Modified and
reproduced. with permission. from Denton R. . et al: partial

-, ,

view ofthe mechanism ofinsulin action. Diabetologia 1981,21,

, -

347.)

-.

Vmax

, ,

Mn

2 +, .

), ,

, , -l
.
,

v-sis

erb-B,

v-ros.


- ,

. - .
,

, ,



. , -

R-

6--2-

-2,6-

(cAMP-)

, ,

-
,

0,03%


- -

--

--)

262

. Jlll CJIII . ,

50


.

S6- -
4OS. Mor

-,


,
. ,

.
(. 51.4),

, (

).

(-,

, .


, .

. .

, -

, ,

lI ()

, ,

,
(. 51.4).

,
,

. ,

reHa (.

51.17).

ro ,

, ,

(10-12-10-9

reHOB, , ero

/),

51.4.

- 1)
-lC 1)

--- 1)
-I- 1)

l'
1)

2-
1)
, mlllUl

1)

1)
...

. 51.17.
. )(
4II
,

lCp .


-

(3 . .)

-.

(Reproduced,
with permission, from Sasaki . ! l. Multihormonal regulation phosphoenolpyruvate carboxykinase gene transcription,
J. Biol. Chem., 1984, 259, 15242.)

1)

(".

ll nu

51.5.

263

900/0

-l
(-

11 ().

-2
(,
u
,

1,

100/0

. .

().

I.

(. .

43.2).

67

70

51

0,3-2

r/

r/

. (,

, -l -2)

, ,


, .
-I, l,

(-l

2-J2
. -2

-2) ,

260000

, , ,

-I -2. ,


.
(. .

51.8). .
51.5. -I -2
, 70 67

50%

62%,

(.

51.5).

00-

,
,
.

. -

29
. 51.18.
. (Reproduced, with permission, from Katzung . G. (ed.),
Basic and Clinical Pharmacology, d ed., Appleton and Lange.

1987.)

264
I.

51.6.

, -] -2

-2

-]

-2


(.

51.6).

-{ -2.

, .

N-u

, ,

-l, ,

:

.

Ser-2 01-3,

. -

).

, ,

-I

, (

51

-,


.
, ,

, ,

, ,

(.

, ,

3485), 29
(. 51.18).

.,J, ,

:l


. ,

(.

14 27

; ,
.

- .

52.5).


(. .

44).

, .

Il

9000).

I<,

[L1

- (.

40%

30--

- ,

51.7.

265

.\fOll'" nll 'l

14
. 51.19. . (Reproduced, with permission. from
. R., Forsham . . Pancreatic hormones and diabetes mellitus. I: Basic and Clinical Endocrinology, 2nd

Forsham

Jl

51.7.

. .

Karam J. ., Salber
ed. Gs F. S.,

(editors). Appleton and Lange. 1986.)

(Slightly m
dified and reproduced, with pennission from J. ., SabIer . R., Forsham . . Pancreatic honnones and diabetes
mel1itus. ln: Basic and C1inical Endocrinology. 2nd ed . Grcenspan F. S. Forsham . . (eds.), AppJeton . Lange, 1986.)

1640,
51.19).

14

(.

, ,

( ).

--

--

. , -,

6--I-
6--2- (-2.6-)
,


, .

- ,

-6-

2)

1)

, ) (

, ,

-l,6-

- ()

- .

4)

5)

.
.

-) .


(),

P-ll ).
,

F -
. u
, ,

36

(.

4200),-

u.

~u .
,

- u.

,
.
-

(.

11 500) D-

.
28-

Chance R. .. Ellis R. . m JV. W. Porcine proinsulin:


Characterization and amino scquence. Science, ]968,
161, 165.
Cohen . The role of protein phosphorylation in l and
hormonal control of cellular activity, Nature. 1982, 296,
613.

266

Docherty ., Steiner D. . Post-translatiooal proteolysis in polypeptide hormone biosynthesis, . Rev. Physiol., 1982,
44, 625.
Granner D. ., Andreone 1. Iosulin modulation gene expression, [: Diabetes and Metabolism Reviews, Vo). 1,
Fronzo R. (ed.), Wiley, 1985.
Kahn . R. molecular mechaoism insulin action, .
Rev. Med., 1985, 36, 429.
n . Action insulin glucose transport and
phosphodiesterase io fat cells: Involvement of two distinct

51

molecular mechanisms, Recent Prog. Horm. Res., 1983,


30, 519.
Straus D. S. Growth-stimulatory action of insulin in vitro and
in vivo, Endocr. Rev., 1984, 5, 356.
Tager . S. Abnormal products ofthe m insu)in gene, Diabetes, 1984, 33, 693.
Ullrich . ' /. insulin receptor and its relationship to
the tyrosine kinase family of oncogenes, Nature, 1985,313,
756.
Unger R. ., ; L. Glucagon and the ll (2 parts). N. Engl.
J. Med., ]981, 304, 1518, 1575.

52

.
,

, , , -

1902 .,
60 ,

(, , . .)

(, ; . .

60- , .

47).

- .

- .

, ,
,

12

(.


- .

1902

52.1).

- ,

.
.

. .

<< (. .

. }

, ,

,
.

() , , (),

(.

, , RM

(. .

( -

43).

, ()

52.1).

43)

268

52.1. - . (Slightly
dified and reproduced, with permission. from Deveney . W.,
Way L. W. Regulatory peptides of { gut. I: Basic Clinical
Endocrinology, 2nd ed. Greenspan F. S. For5ham . . (EdiLor5). Appleton and Lange, 1986.)

52
.

(), ,

, ,
(. 52.1). ,
-, in vivo
.

1)

+ (+) -

- .

(+ +) -

()

. ,

. -

- + (-)

( +) - -

+ (+)

( + ) - (+)

()

+ (+)

+ (+)

+ (+)

52.3).

. .
-

-.

. ,

()

- + (+)

- .

( + + +)

.
-

(.
1)

( )-

(.

(.

52.4).

, ,

()

52.2,

()

-.);

-;

, ;

+ ; -

-,

52.5).


. (
) (,
, ,

). ,

).
- ,

, -

, -

- ,

- .

, -

rOP_WOHbl 1l0-u1l0

52.2. -
(Slightly modified and reproduced, with permission, from
Deveney W .. Way L. W. Regulatory peptides of the gut. I:
Basic and Clinical Endocrinology, 2nd ed. Greenspan F. S.,
Forsham . . (editors). Appleton and Lange, 1986.)

269

.jIll

ll

."1 .

()

, ;

(Slightly modified and reproduced, with


permission. from Deveney . W., Way L. W. Regulatory peptides of the guL. ln: Basic and Clinical Endocrinology, 2nd ed.
Greenspan F. S., Forsham . . (editors). Appleton and Lange,
1986.)

(?)

52.3.

()

--

('

N
D

(?)

. -

(.

52.1).

1)

, -

52.4.

'

'\i

()

27

34 (34)
17 ( 17)
14 (l4)

()

27

'If

(27)

34

rl7
l4

39

(39)
..

1.

33

, . - .

(33)

12

. . ,

I2

(I2)

:, .

8 (8)
4

(4)

11

:I

43

n.

. l\t . !\1

(43)

28
14

. -

11500

43

270

52

52.5. - 1). (Slightly modified and re-

produced, with permission, from Grossman . 1.: gastrointestinial hormones:


mes ... (editor) Excerpta Medica 1977.)

Tyr

IIe
Gln
Gln
Ala
_Arg
Lys
Ala

Ser
Gly
Arg
Va\
Ser
et
lI

Lys
Asn
Leu
Gln
Ser
Leu

Ser
His
_Arg

IIe
Ser

_Arg
Asp
Tys
et

_Gly

Tyr
Ala
Glu
Gly

His
Ser
Gln

Phe
VaI
Pro

Asp

hr

(pyro)Glu Phe
Leu
lI
Gly
Ser
Asp
Gln
Tyr
Ser
His
lI
Ala
Pro
Met
Asp
Leu
Lys
Val
Ala
lI
Arg
Asp
Pro
Gln
Gln
Ser
Asp
Lys
Phe
_Lys
Va\
Gln
Asn
Gly

_Pro

Leu
Leu
Glu
Ala
Gln
Glu
Glu
Gln
Glu
Lys
Gly
Glu
Lys
Ala
Lys
Tys
Ser
Asp

lI

Ala
Val

Phe
hr

hr

Tyr
Gly
Glu
Leu
Gln

Asn
Tyr

Glu
Leu

hr

Lys
Tyr
Leu

Arg
Leu
Arg

Ser
Arg

Ala

Ala

Leu
Arg
Leu
Leu

Gln

overview.

Endocrinology. Ja-

10

(pyro)Glu
Gln
Arg
Leu
Gly
Asn
Gln

Arg
Pro
Lys
Pro
Gln
Gln
Phe
Phe
Gly

Ala
Gly

CYSj
Lys
Asn
Phe
Phe

Met-NH2

Gln
Glu
Lys
Glu
Arg
Asn

Lys
Gln
Met
Ala
Va\
Lys
Lys
Tyr

Ala
Va\
Gly
His
Leu
Met-NH2

Lys
hr

Phe
hr

Ser
Cys

-.J

Gly
Gln

Asn
Ser

Gly

lI

Met
Asp

Val-NH 2

Leu
Asn-NH 2

hr

Asp
Phe-NH2

Lys
His
Asn
lI
hr

Gln
1) s-, -- , ,

--.

2)

, -

-; )

; 4) - ;
;

5)
6)

2+.
: , .

52.1

.
-

: ,

.
, 2+ -

-u1l0

271

...~

. .

...-

"'"

_
.

---.
~


0000

.
.

..-

......

51.1. .
4 , , 2

, .
.

27- .

2 + , ,

r ()

4- ,

, .

cAMP-

2 +, ,

- ,

. , ,

-,

44.


m m ()

- 27
S-

28- ,

. 14 27
.
, (. 52.5). -

. ,
(),
, .

272

52
8.

. -
ll.
.

I-

G-,

.
- .
.

- l1

(8

).

, -
-

(.

52.4).

,
(

; .

52.5). - 14
34, J7 14

34
, 17. . ')
, (15
) 5 -7 l 17.
.

, (
,
,

).

, -.

, ,

-- (")

17,
1/10

11-

- .

5-14
18-27 --,

C-OI :

5
52.5).

. (

(.

22-

~ 10

) -
7 ,

, ,

IlO.

()

) , ,

. mo

. -

(l')

: ()

.
()

(.

52.4).

100

L-

opMoII II-ull

( 13-

),

,
.

40

,
- .

s. R .. Polak J. . Gut Hormones. 2nd ed .. Churchill Livingstone, 1981.

loo

273

Boden G. Gastrointestinal hormones. Pages 1175 -1190. In:

Endocrinology and Metabolism, (-'elig . ! al. (eds.).


gGw-iII. 1981.
Buchanan . D. Gastrointestinal hormones: General concepts,
Clin. Endocrinol. Metab., 1979. 8, 249.
Chen W. .. Gutierrez J. G. The endocrine control of gastrointestinal function, Adv. Intern. Med., 1978. 23, 61.
Gardner J. D .. Jensen R. . Gastrointestinal peptides: Thc basis
of action ! the ccllular 1evel. Recent Prog. m. Res .
1983. 39. 211.
Walsh J. . Gastrointestinal hormones and peptides. l: Physiology of the Gastrointestinal Tract. Johnson L. R. (ed.).
Ra ven Press, 1981.

VI

53

, Ie

. ,

.

( ).

812

.,

; ,

.
,

Jl .

(
,

, ), ,

53.1

(),

( ), 1VI

( )

(2),

) ().

(. .

hbHbIX

( ,

16.1).

, ,

: ,

, ,

, .

53.2.

275

53.1.

2 ).

( 3,
( 3.

, - .

, ,

1),

3,

Q-

4)

(),

5),

, ,

, ,

(B I2),

(6),

(2 ), (.)

D 6), . K S)

-
();

, ,

, , , ,

, , , ,

, , ,

11 , , .

4)

S)

IC,

21 .

Q- .

]1 ,


~I

53.2. ,
. (Adapted [ Dvids S.
et al. Nutrition and Dietetics, 7th ed. Churchill Livingst, 1979.)

,
;

. .

53.3

, / (/)
-

l )

5,4
9,3
4,1
7,1

(22,6)
(38,9)
(17,2)
(29,7)

4.1
9,3
4,1
7,1

(17,2)2)
(38,9)
(17,2)
(29,7)

4
9
4
7

(17)
(38)
(17)
(29)


(
)
.

.
1)

21

.
.

1 02
4,83 (20 ) .

, :

276

53.3.

(Data from Recommended Dietary ll


wances, 9th ed. Food and Nutrion Board, National Research
Council-National Academy of Sciences, 1980.)

53
. I

.
, , ,

()

()

()

(- ()

70
55


. ,

,
.

+ 300

+ 500

53.1).

154 2700 2300--3100 11,3


120 2000 J600--2400 8,4

(.

23-50
23-50

, ,

20

9 ,

,
.

1) ,

u (

, ,
,

12

).

. .
,
f'

, , .

, .

53.4.

5-

, , ,

) .

10%

r . 30)

2)

(.

3)

-,

10-

. ,

, :

,
.

4)

.
ll ,
120/0
.

.



. ,

,
.

. . ( )

. ,
.

.
,

,
,

{, ),

277

. ll

53.4. .
(Data from Recommended Dietary Allowances, 9th ed. Food and Nutrition Board, National Research
Council - National Academy of Sciences, 1980.)

( / )

( )

(4-6

12

(1 -

(70

2000

1400

800

56

101
71
30

33

83

135
99
49
141

?
28
42
44
22
22

10
12
16
12
10
16

0,70
0,84
1,12
0.84
0,70
1,12

?
5,3
8,2
6,7
2,1
4,7

68
21
92

28
4
25

8
3
14

0,56
0,21
0,98

4,1
1,2
5,7

( )

( )

() ( ).


; ,

.

. ,


,
,
.

. .

, .

()

-
-

,
,
. ,
.

5- ) ,
.
-


, ,
, ,

, , ,

,
,

. .

(, , ).

(,

),

278

53

0-

()

. ,

(. .

50-100

14.

6, 20:4).

15.2).

24.

. ,
, .

.
, u-

()-

, ,

. ,

, ( )

(.

24.6),

2%

1-

, , -

, ,

, ,

(. .

27).

, ,

, ,

, .


, ,

( ),

, .

. ,

, ,

) .

).

53.5 (
53.6 (

( ).

()

. (
) () 6,

. ,

18:2), u- () 3, 18:3)

279

mll.

53.5. .

11

( .

2)

3)

(),

---

(NADP)

3)

(NAD);

( )

- (
);

(- (l-

- (

.)

-)

).

(l-

2-

(FAD);

--

2)

()

(,

(FMN)

N-

2 ,

-)

;I;

(-

5' -
cl -

' 2

).

, )

280

53

( .

1)

II 2)

))

';

(?)

(-

1)

. ,
, ~ .

BI2 ,

.,'l

( );

. ( re ) .
2)

. : ( )
( ); , IIO,
;

, -

(5

; . KJleToK
.

) , II
: , . . ).

, .

B,~ (

).

, .

BI2

D .

, ,

. ,

B12,

5
. BI2

).


( , , )

(),

, ,

. ,

. .

BI2

. ,

,
B12

,
,

(, , ) -

, .

53.7.

,
2 : 1)
, , -

53.6.

21

11

ll--

?)

1,25-

;I

(.

7-

),

25- -

()

D --

).

: ~-Ka

281

1,25-

(
)
) (

It

(<<

).

.'IO

1
(
), 2

BbI

),

..'l:

11, VII, IX

Jl0:

1\10-

282
j

2)

1 )

53

: -

J II-

31

bl

1)

. .

2)

. .
JI . IIll
. -

, .
.
3)

J( , ,
, , .

53.7. .

,
. (From: n R. ., Stifel F. .,
Green . L. Vitamin-deficient states and other related diseases.
In: Disorders of the Gastrointestinal Tract; Disorders of the Liver; Nutritional Disorders. Dietschy J. . (editor). Crune and
Stratton, 1976.)

CoA-

100

2)

100 .
. 53.1.
. 53.8
, . 53.9-0
.

B I2

.

. ,

- .

. ,
, ,

(1)

.
,

6)

1)

53.8.

283

bl.

1)

2)

3)

paropMo

, ,

2+:

, ,

1).

P"eoP1 .

~o

Na +/ +-

Na +/ +-

284

1)

53

.:l -

rOMbl,

1 2)

3)

'

(d

.)

1)

-. ,
, (, Jl , ).

. lI (
), , .
2)

. , ,
I .

31

,
, , .

; 2)
; 3)

4)

yr

5)

- ,

6)


, .

52.


, ,

.
.

99,5%

. ,

,
, -

u,

53.9.

( ).

21

11

285

.!-

..lbT

BI2

BI2

BI2

- -

(.

);

.)

(,

-'1

(-

:1

53

286

21

11

.l

~1

, -

3)

1)

; -

(?)

.
, .

2)


, , , .

3)

. . d
.

. , ,

(, ),

, , +, 2 +, - 3'

- ,

(SCN-) ,

0,2--{),5% HCl 1,0.


97-99% ,

(IgA).

6,8,

( ) .

. . HCl
.

'

53.1.

, .

+ ,

4,0

( ),

+ ~.
2 2

..

(<< )

).

. +

287

Na+JK+- . -

+-,

Cl-,

,
,

+ .

, -, .

. .

().

- .

. ,

. .

, .

+,

ll ,

, ,

2-4

30%
.

().

N-

1.

sn-3,

sn-3.

(, )

(, ).

. (, ).

. -

, ,

.

~

_ _ H+
+

....-+-------

it .

. :-
, ,
. 53.1.
"', +-.

288

53
. -

3.

r Jlli

, , , .

4.

;
.

. .

. , ,

, .

, . 53.1~,
.

. , ,
,

. .

1.

~ .

, , .

.
(.

53.2),

.
2. .

. ,

, ,

7,

. .

53.10.

,
-

,
()

, ,

97,00
2,52
1,93
0,53
0.06
0,14

.

, , .

,

36,9
21,3

2.4
5,6

85,92
14,08
9,14
2,98
0,26
0,32

,
,

0,84

33,3

0,65

1,01

1,04

7,1-7,3

6.9-7,7

mQl,.

289

,
.

. TpnCR, R .

~
~ ,
, .

. n n
(nn",

, ,

xonecTepona

n"'" .)

(, ),


,
,

100
100

80

60

20

40

\.....
~------ n'l ne'------"l\

53.2.

, , , .
.
n

, ,

( ,

) . Q

( )

. .

lC

(5%

15%

80%

. ,
,

. Cllllel.
. n.

( -).

. -
, .

(Reproduced. with permission, from Redinger R. N. Small . . Bile composition,


l salt metabolism. and gallstones. Arch. Intern. Med., 1912,
130. 620. Copyright 1912. Medical Association.)

. . -lUI

-.

. [
, a(I-+4)-].

(1-+ 6)

()-- .

(-),

ecr.

.eJI1III lIIII.
:x r

s.

33.

. ,

Zn

+, ()2"4

10-1594

), 1
( ).

2
-,

, 2 +,

2
2+.

s<Y....

Na +,


- -7.5--8,

+,

CI-)- ,

.--

(,

, ,

. .

2
2 (. . 25.5) .-

290

53

/,
.

2-

(.

'53.3).

. (

). ,


, . .

, .

. ()

()

(. .

38

39).

. 1 2

JI Il ,

(. .

15.34).

2-

, ,

IIII

2-

,
,

, :

1
2

(",,)

Ei

"

..,

~=... D~'~::~-

8", ..
---~~-----------------------~~

..,
.

",

E :~:

2-

I~;:
====~----~======~I

\_~=====---,__
r

(!)

f~

;::::===.~

_ _ _ _ _...

- 22"10

'-~-~~------------------------------------------------------~

53.3. . - . (Modified from


Mattson F. ., Volpenheim R. . The digestion and absoption of triglycerides. J. Biol. Chem., 1964, 239, 2772.)

1)

N-

291

; ,

2)

, , - (),

(l-+4)-

90%

, (-),

(1-+6)-

(),

-;

; , ,

, ,

. ;

, ,

, ,

3)

,
.

4)

5)

(),

6)

, -,

,
, ,
, , .

(,

(,

3-10



,
.

( ),
,
,

.
.


.

, , -,

,
,

,
. ,
,
.
.

53.11.

: 2-

, ;
; 5-

. ,
. , -,

.

\0*

292

53.11.

53

: -

6.6--6,8

1:6
(

2,~7,5;

ll

4,0--4.5

1,2-

sn-

HCL,

1,0--2.0

1) ,

J"'l

5.2-6,0.

;
,

7,9

4,0

2)

8,0

293

, nu

l1 : 1

Jl

I-IOM

7,1

1:6
(

,
,

, .

3l1 .

8,0

'

) ,

Toii w:

N-

294

53

nI

5,0-7,0

~, ~

5,8--{),2

5,4.~.0

8,6

1:6

1:6

,

,

Na+

Na +

+ (. 53.4).
( ),
, ,

. m
Na + .

Na +

. ,

Na+

Na +

; ,

. ,

, -

.
-

(
)

295

,
,
.

2.
.
.

,
, .

.

3.

. ,

, ,

.


--

.
,

. m
,

, .

. .

53.4.

Na + , + (1) Na + (2). 3.

. .

,
3()()
.
. .

(, )

()


,
.

( -).


2-,

l-m

, ,

(.

53.2).

. ,

, .

, )

, -

2 -

1.

296

53

,
.

98%

. ,

l-

12 ),

, ,

2-

1J

(.

53.3).

, ,

. ,

(, )

,
, ,

. ,


R .

(L-) ( D-)

-3- .

6 ().

L-

R~

lO

2,4-~.

M ,

, ,

(.

, ,

()

53.4).

Na + -

Na +

, , ,

(. .

26.3).

Na +

10 (
, )

(,
) (.

).

10---12

. ,

() .

lII

), (

), .

, ,

JJy- ,

, -

297

53.12.

53.13.

tX,i

JI. -

B12,

, ,

, ~,

, , ,

BI2

, , -,

,
(
),

.1

, -, ( )

. ,

( )

, ,

6 7 ,

53.12

53.13 ,

, .

, , ,

18:)

-N-= 2

.

.
,
, 2 , , . ,

u

(
).

R-C-NH 2

R
l(

'\

2 NH 2

298

53
,

, ,

().

CtJ

lIl

(

25%)

. .



, , - ,

H 2S.
S

. ,

.
.
.
.
,
,
.

[2]

S --.,;\---.... 4

+ H2 S

.
,
.
,

. ,

. -

American Cancer Society. Nutrition and cancer: Cause and prevention. (Special report.) . 1984. 34. 121.
Borgstro . The micellar hypothesis offat absorption: Must it
revesited? Scand. J. Gastroenterol . 1985. 20. 389.
. . Simple versus complex carbohydrate use ( diabetic diet, . Rev. Nutr., 195, 5, 95.
Nestle . Nutrition Clinical Practice. Jones Medical PubIications, 1985.
Passore R., st!d . . Davidson and Passmore m
Nutrition and Dietetics, 8th ed . Churchill Livingstonc,
1986.
Steven . R., Kaunitz J. D., Wright . . Intestinal transport of
amino acids and sugars, . Rev. Physiol., 1984, 46.
417.
Tso . Gastrointestinal digestion and absorption of lipid. Adv.
Lipid. Res., 1985, 21, 143.
Woo R., Daniels-Kush R., Horton . S., Regulation of energy
balance, . Rev. Nutr., 1985, 5, 411.

54

I I

Jlll- ,
() ,
.

81 ,
,

) (

()

,
;
,

).
.

;

Jl.

- ,
, (

), .

, .

, .

-
(. 54.1);

(. .

42).

1 85%

( ).

. (,
)
.

(.

.57).
, ,-,

54.2.

,
x

, ),

. ,

(, )

1000 .

. ,

, ,

300

54.1. , m

54
, . ,

,
, -

OJl

I'

(,

(()

'll

G M1 ;

-6-

. .

15).

(.

).

Mory ..
(, )
(. .2)
,

, .

-

..,'ll

- -

-
--

54.2.

(Adapted from Schachter . Biosynthetic


ntrols that determine the branching and heterogeneity ro
tein--bound oligosaccharides. Biochem. . Biol., 1986.64.
163.)



( rx )

,
, .

- , ,

, ,

(. ).

, ,

,
,

--1' (-).

- -

(
)
.

unmu,.,

nm.'l,.,

,)~

, .

200

yr 12 (. 54.3).
. 14.
N (NeuAc),

(Gal) N- (GalNAc).

.

(GDP)

54.3; ,
UDP.

. ,

(. ).



')

. ,

,

.


(UDPG1c).

Jl 54.3. . .
. 14

IJ

Gil

NeuAc

N- .

Glc

N-

N-

N-

NeuAc

N- -
. yr .

NeuAc -

(9

Fuc

N- -
GIc NAc,

reK-

N--

If-

GalNAc

GIcNAc

N-,

Asn

N- -

N--

N-

Asn;

302

(UDPGal)

:
UDPG\c--

+ -l-------UDGl +
+

, . .
54.4 F .

F ,

, r

UDPGlc-

UDPGlc

54.4.

UTP

54

UDPGal.

l-ro


. ,

Gal, GDP-Man

UDP-

CMP-Nu

. ;

(,

UMP, GMP

), .

UMP

UDPGal

(..

NeuAc)

.
,

I'

UDPGal


-Gl

+ UDP

UMP + P j

UDP

,
. ,

(.

54.5).

40

(. 54.4).
(JI),

, :

()

, (),

1)

ConA -

NeuAc
Gal .
F

, ,

I ;

2)

(. . ),

Ix .

GlcNAc,

(. .

57).

, 70- .,

, Gal

.

3) ,

runmu u nmu,.,

54.5.

303

.

( ;

ConA

WGA

Man Glc
Gal GalNAc
GlcNAc NeuAc

H/~-O
I

"1+1

, { _ ~/

OI

(, ) ,

11

I
I

Asn

N-C-CH2 - C

H-~

-=

CH3I

, -,

,
.

54.1.

N-

N-


- JIII

4 : 1)
Ser ( Thr)-GlN (. 54.1); 2)
,

Ser-Xyl; 3) ,
(Hyl)-Gal; 4)
,

s-GlcN

(.

-
- Ser Thr

Asn-~r(hr), - ,
.

,

Ser Thr
,
.

54.1).

1, 2 3

. x

-8 .

(. . ,

).

N- (. . ,

N- m

). 2
3 , 0-

1.

N- .

, ,

Ser Thr,
GalNac (. 54.1). Gal NeuAc
GalNAc.
~ ~
. 54.2.
.

yr

. - .

, l ,

1 30 ,
2 3


- .

N-,

l (. . 40).
-

'

304

54
,

NeuAc

02.6

GalNAc ---.~ Ser(Thr)

(. .

). ,
(,

NeuAc),

N-

Gal

--_1 Ser(Thr)

fj1.3. GalNAc

102.

,
,

t02.6

NeuAc

Asn-G1N (.

54.l).

NeuAc

- r,

(,
).

()

54.1.

() ,
'VJ . (Modified and reproduced,

.
,

with permission, from Lennarz W. J. Biochemistry of Glycoproteins and Proteoglycans. Plenum Pn:...s, 1980.)

Asn
.
.

J J8, ,

NAc, UDPGal

UDPGal-

CMP-Nu. ,

N-

N-

(.

54.3).
([n]) [G1cNAC])2'
. 54.3 . 54.4,

Ser),

..-JlI-JI.

,

.

). ,

l2."" 6

G.f'
131.4+

NeuAc
G1cNAc; -

2.nl

~1,41

Gal

Gal

~~1.4

Gal

131,4~

GlcNAc
GlcNAc
GlcNAc
131.~ _ _ _ jp, 21,2

01,~

GlcNAc --....:....---...~~

~,6

01,2~

L _

Ma~

01,~

.!1~.#"'A1~1a _

01,~

~0~.6
...

'

~,~ 01,6

01~

GlcNAc

01,2~

~6

~ 131.4

~131.4

~131.4

GlcNAc
I 131.4
01,61
,
Fuc -------I~~ GlcNAc

GlcNAc
~ 131,4

GlcNAc
~ 131.4

GlcNAc

GlcNAc

Asn

Asn

Asn

1
I

I
I

L ___ ~ ___ - __ ~ ______ ~--_-J

54.3.

- 8. , ,

, N- .

feld S. Assembly of asparagine-linked oligosaccharides.

(Reproduced, with permission, from Kornfeld R.,


. Rev. Biochem., 1985, 54, 631.)

TluKonpomewI nmu

~6

(14

(34

(}1

(GlcNAc, Gal. NeuAc).

54.4.

Man-GICNACTGICNA~ Asn
~
:
I

(GlcNAC)2 (. 54.4.).

305

. N- .

Glc
Man . ,

N-

. -

lf

. ,

N- -

. t

[Galp 1 1-3]

4GlcNAc

-fl,

--,

2 : 1)

--

I/i.)
2 (. 54.2), 3 4 ,
. 5 .

.
-, -, -

,
.

N-

, , .

54.3,

Gal

Fuc.

2--6

1(

2)
1.

-.

. ,
,

17-20

. Rx N-ll
.

54.5).

--

--(
---Dl), ,
,

N- .
(Glc)

(Man)9 (GlcNAC)2-R,

R = P-P-Dol.

(.



(Dol-P) .

.
GlcNAc--
(GlcNAc--

Dol)

--.

s-


Dol-P UDPGlcAc :

Dol-P + UDPGlcNAc-~ G1cNAc- --l

Glc 6 -

--.

HO-----

CHa-=-

+ UMP.

CHa-=-,

54.5.

. IC 8
. -

(n-17-20

).

306

54

UDPGlcNAc
DOI-P*

- - - -

UMP
-

GlcNAc--- l

UDPGlcNAc

':J

UDP'

,/

G-G-G ---

M-(GlN)2-- -Dl

/'

I'--I

G-P-Dol

()- (GlcNAc)2 - - - l

- GlcNAc-GlN -

~P-OOI

- - l

7""

(GDP-M).
.

~P-OOI

- l

GDP-M~

GlcNAc -GlN- -

GDP"-

(GDP).

--

"

"'--I
-(GlN)2 ---l

54.6. ---. 54.7.

, GD-, ,

. -- --.

; Dl-; -; UMP-; GD-;

UDP-

-;

G-.

, .

Cyrb

54.6.

-
:

GlcNAc

UDPGlcNAc;

GDP-

N-

Asn .

-.


(GlcNAC)2- -

R-

P-Dol.
Asn
Asn-X-Ser/Thr, - ,

, , .

P-Man,

-,

Dol-

Dol-P + GDP-Man

-+

Dol-P-Man

+ GDP,

) ,
,

Dol-P-Glc,

,
-.

Asn,

.
, .

, ,

N- ,

Dol-P

UDPGlc.

(2

GlcNAc

Man)
7 (4

54.8.
-

--,

Man 3 Glc)-.

, . 54.7

. -

(Glc)

--.

(Man)g

(GlcNAc)2-- P-Dol.

2.

"nm

1,2

307

nmu"

~6

~6

(31,314). GlcNAc_GlcNAc---

Gfc~ Glc~Glc~ ~~~3


.

54.7.

---.

(Reproduced. with permission. from Lennarz W. J. The Biochemistry


Glycoproteins and Proteoglycans. Plenum Press, 1980.)

) . ,

, .

54.8.

).

1 (.

11

I- (. )
GlcNAc.

) .

.
7,

. ,

.
( 4-).

5
6

GIcNAc

G1cNAc-

7,

1.

).

(.

54.4).

54.8

11).

54.8,

9, 10

11

11.

Fuc, Gal

NeuAc

-. -

-.
. .

54.8,

G1cNAc;

-GlN-

(-

11

, .

. 1

.
1 G1cNAc-l- 6-

-, n-;


. ,

, -,

G1cNAc-,

UDPG1cNAc

UMP:

GlcNAc-

UDPGlcNAc + -

GlcNAc-l--6--

11 GlcNAc

+ UMP.

6- :

-6--

. ,
,

,
. . 54.8, -

-+

GlcNAc-I--6--

+ GlcNAc.

-6-.

5)

u-, -,
- - (
9, 10 l1)- n-

, -6-

,
.

7 GlcNAc-,

308

54

,---0

p-tfp ~-iY-~ uz ~
~
--l UDP-l

54.8.

.'I.

2-u-

1,2-u,

7 -

ur;

3--

11;

5--

10 -

11

4-

.1;

1-

N- -l-
6-N-VJ

8- N-.l~t 11; 9 -
- N-!I; 0 -
-.'lU1: 6 -: - : - .'I. (Rcproduced. v,;ith issiu. [ Komfeld R.,
Kornfeld S. Assembly of asparagil1e-linked oligosaccharides. . Rev. Biochcm . 1985,54,631.)
1;

a-'

N-,

--N,ll;

1;

.'I10;

:I;

11-

rJ.

} (

, ).
(. .

) N-

1)

2) Dol-P

3)

1)

unmUll

(.

). ,

u npomeol.IUKQlIbl
54.6. ,
.

2)

. ,
Q- 11
GlcNAc-

1 (. 54.8);
3)

GlcNAc

-,


----

1 11
11

, ,

. ,

. ,

N- .

4)

[,

()--]

, -,

. ,

--

, .

5)

. ,

I-

, Man6- - C:t
.
.
I- (
mo-inlusin ll). I-

- ,

,
.
, -,

,
, ;

6)

, ;

Sindbis

. , ,

.
I-

, ,

~ (

).

7)

(.

. , 1
,

57).

('

Man-6-P.

,
.
-,

GlcNAc -.

Man-6-P. ,

54.6.

310

54


, .

- -, -

Fuc-al ,2-Gal-p- R

;
,

hh

, i:1 - -

.

1900 . .
20
, 160
.
() (Le).

- ;

,
, 3- : 1)

GalNAc.

-,

2)

(.

54.7);

(Se)

, .

, ,

Sese

SeSe

- -
- -
(

) (. 54.8). sese
- ,
-
, r.

3)

Fu- , ,


2
,
I GalK
Fuc-a 1,2-Gal-p - R,
,
Se. -

-
,
-l, 2- Gal,

1,4- 1,3-.

UDP--GlN

+ Fuc-al,2-Gal-p-R

GalNAc-l,3-(Fu-l,2)Gl--R

+ UDP.

UDP-a-Gal + Fuc-al,2-Gal-p-R-Gal-al,3-(Fuc-al,2) Gal-p-R + UDP.

GDP-p-Fuc + Gal-p-R -+ Fuc-al,2-Gal-p-R + GDP.

54.8.

54.7. ,
()
(Le)

H,h

Se,se

,,

Le,le

00

()

SeSe

()

()

()

Sese
sese

()

()

unmu1t

-,

GalNAc

1,2-

Fu-, , -,

311

nmu1t

UDP-

l- l

Ser

l-

: GalNAc, - Gal . ,
-. - ( 00),

0GalNAc Ser ( Thr),


, UDPGalNAc. N- GlcNAc
Asn

- ,

--,

-- -, ,

,
, GalNAc
. --
,

Gal.

GaINAc,

Gal.

- (

-
.
.

Gal.

, ,

. ,

Fuc

Gl--R-,

hh,

GalNAc.

Sr--

Gal)

,
.

4- ;

-
,

- -.

( )
-

L-r

(GkUA) 5-. L-
(IdUA). ,

-. N- (
).

1)


; 2) ,

1) - Xyl Ser,
; 2) -
GalNAc Ser(Thr),
11; 3) N-
GlcNAc Asn.

3)

.
.

GalNAc-

GlcUA
.

IdUA

,
.

. 14.

.
,


. , ,

. ,


N-
.

(-

312
111.4

111.3

111.4

111.3

GlcUA - - GlcNAc -GlU -

..,

111.4

111.3

54

111.4

111.4

GlcNAc--

111.3

/J

111,4

tjl.3

-GlU--GIN--GlU-Gl-Gl--l--

er

4-

11

~.~.~..-GlN- Asn (

111.4

111.3

111.4

\G\C~ ... , ...


... ...

111.3

- - GlcNAc - - Gal -GlN -

Gal......

'tI

......:... ...

- -

"GaINAc~ Thr (5er) ( 11)

I
Gal-Nu

01.4

01.4

01.4

- IdUA - - GlcN -

I
81.4

50] - or

GlcUA -

111.3

111.4

Gal- Gal- l -

11

5er

111.4

01.3

iJl.3

IdUA - - GalNAc -

GlcUA -

111.4

111.3

GalNAc -

111.4

81.3

GlcUA - - Gal- Gal- Xyl- 5er

2-
.

111.3

01,4

GlcNAc -

2-

111.4

GlcUA -

4-

(GIcUA-D-;no ;

54.9.

L-

D-;

GlcN -

GalN -

D-;

- ;

Gal- D-;

IdUAXyl-

D-; S-L-; h-L-: s-L-; -D-; Nu-N-


). , . ,
, , L-, D- .l10. ,
~: .

2- ,

<Slightly rnodified and reproduced, with perrnission. from Lcnnarz W. J. The


cans, Plenurn Press. 1980.)

Biochernisty

of Glycoproteins and Protcogly-

),

) , ,

. , ,

llLI

GlcUA

GlcNAc.

, ,

.11

- .

)'

KdHOB .

54.9.

Xyl-Ser.

. ,

54.9.

GalNAc,

GlcNAc.

GlcUA,

GalNAc

ll -

unrneu

nmuu

____

7 O I t - - - -

7 i : ; ' . . " . - - - -

_-_

. 54.11.
. (Repoduced, with permission, fom Len-

narz W.J. The Biochemistry of Glycopoteins and Proteoglycans. Plcnum Press, 1980.)

.

54.10. -

, d

80 ;

. (Repo

. ,

duccd, with permission. fom Rosenberg L.. llm W .


Kleinschmidt . . Electon microscopic studies of poteogly
aggregates {' bovine articular cartilage. J. Biol. Chem.,
1975, 250, 1877.)

II

6.

110

4-

- .


. -
3'-- 5' - ( ).

,
,

.J

54.9,

11

Gal-GlN 6-

40

, 20000.

ll .

GlcNAc - Gal.
1

GlcNAc-sD.
II- ,

2,5 106.

ll.

v' I

N-hr(Ser).

(.

54.1 );

Gal-

54.11

.


, .


. -

314

I ~H.oso;>-

COi

CtyISOJ

IdUA

'C0i

NSO;

OSO;

GlcN

54.12.

OSO
CIIz '

;;

hQlLQ- ~LQ- l~
CH.OSO;

HNSO;

54

GlcN

HNSOi

IdUA

GlcN

NAc

GlcUA

GlcNAc

x ;~
, ~~ ~--~ 3-0- . (Modified
redrawn, and reproduced wlth

nISSlO,

from

u. ! l. Structure and biosynthesis of heparin-iike poiysaccharides. f'ed.


Proc., 1977, 36, 19.)

Ldhl

.
,

, .

,
.

54.12.

JO

(GlcN)

GlcN

N-

,
.
6- .

10%

90%

GlcUA.

GlcN

II

IdUA

GlcUA,

90%

5GlcUA

.

;

5000-15000,

100000.

N-

(GlcUA-GlN);

2)

50%

N-;

GlcN

3)

GlcNAc

. fI

,

GlcNAc

N-

. 5- (
)
N-
,

GlcUA.

IdUA

GlcUA,

-IdU.

1)

IdUA,

2- .

GlcNAc;

4)

N-

90%

5-

GlcUA IdUA; 5)
IdUA -
-2; 6) 0

GlcN

G6-.

l.

, .
, GlcUA.
GalNAc ~-l.-,

IdUA,

IdUA,

GalNAc

a-l,-.

, 5-

GlcUA.

.
,

GalNAc

2
IdUA-

GlcUA-GlN.

(~l1)
,

Jl

54.9.

s-

- L-

, ,

()

11

, ,
,

IIIA

-N- (

, ,

IIIB

, ,

-N-

IIIC
IV

N-

6-
-

VI

13-

N--

, ,

4- (

13-

VII

. ,

6-

()

VIII

N- -

6-

I
(-

I-lC

11

UD-N-- . ,
:

N-

111

, ,

. -

, ,
.

, ,

316

54

~-

. ,
~-

(,

Il ~-

J). .

54.9

, .

Gl-

(. .

25).

-L-
,

.
,

.
Il ,

ldUA

, ,
.

(GlcUA-~1,3-GlcN-~1,4>:"!.

, : ,

, .

. Gl--
. 4-
.

Il-

( -)

~-

N-.

GlcUA

ldUA

4-

6-

GalNAc6-.

~-.

. , ,

Q,

Gl-6-

NAc-6-,

, ,

. Il

- -6-.

~-

,
Il,

Cal-

N--6--


GlcNAc- Glc-6-.
-
, -2- IdUA

. , ,

~-D-r


Il

~-

GlcNAc

GaINAc.

~-D-

.
, ,
.
.

- N-

11.

13-

GlcNAc,

D-.

JIn .

~ (ap>n;
(3-, <P~)n.
Il -

, .

II,

(-N-)

GlcN-

. l3

~-,

(GlcN)

, -

:nmrUl

N-, .
-:
N-

GlcN

-.
, u-N-
. no

317

nm.lu"Il

, , ,
.
Oll .
, , -,l,

, ,

.


,
,


. ,

IdUA,

, ,

GlcUA

.
"

.

.

. :I

IdUA

IX

XI.

.il

2-

111.

(1: 1)

111

Lys 111, -,

.
.

54.13.

II

.,l

()

111.
1

(),

, .

, ,

IdUA

1, 11

111)

2 5

l'

N-

IdUA-

,
,

111,

8,

. I.

100

N-

318

[]+
+

. ,

54

--..

in vitro.

, .

----.

.
,
.

54.13.

(,

, ,
,

), . ,

, ,

. (

.)

(------)
. (Repoduced, with permission, [ Lennarz

W.J.

Biochemistry of Glycopoteins and Proteoglycans.


Plenum Press, 1980.)

il

,

, .

.

,
. ,
, -,
,

, ,

, .

,
.

,
, -

Buckwalter J. ., Rosenberg L. . Electron microscopic studies


of cartilage proteoglycans, J. Biol. Chem., 1982. 257, 9830.
DiNatale ., Neufeld . F. biochemical diagnosis of
polysaccharidoses, mucolipidosis and related disordes. In:
Perspectives in Inherited Metabolic Diseases, Vol. 2,
. et al. (eds.), Editiones Ermes (Milan), 1979.
Hook . et al. Cell-surface glycosaminoglycans, . Rev.
Biochem., 1984, 53, 847.
Hubbard S. ., l\'att R. J. Synthesis and processing of asparagine-linked oligosaccharides, . Rev. Biochem., 1981,
50, 555.
Jagues L. . Heparin: old drug with new paradigm. Scien, 1979, 206, 528.
Korfeld R., Korfeld S. Assembly of asparagine-linked oligosaccharides, . Rev. Biochem., 1985. 54, 631.
Korfeld S., Sly W. S. Lysosomal storage defects. Hosp. Pract.
(Aug), 1985, 20, 71.
Lennarz w. J. Biochemistry of Glycoproteins and Proteoglycans, Plenum Press, 1980.
Poole . R. ! al. Proteaglycans [ro bovine nasal cartilage: Immunochemical studies oflink protein, J. Biol. Chem., 1980,
255,9295.
Reitman . L. ! al. Fibroblasts [ro patients with I-cell disease
and pseudo-Hurler polydystrophy are deficient in uridine
5'-diphosphate-N-acetylglucosamine: glycoprotein Nacetylg1ucosaminylphosphotranspherase activity. J. Clin.
Invest., 1981, 67, 1574.
Schachter . Biosynthetic contols that dctermine the branching and heterogeneity of potein-bound oligosaccharides, Biochem. ll Biol., 1986, 64, 163.
Snider . D., Rogers . . Transmembrane movement of oligosaccharide-lipids during glycoprotein synthesis, , 1984,
36, 753.

55

- ,

. -

() ()
, ,
.
( ),

();
.
,


, .

1) -

2
;

2)

3)

, , ,

5)

4)

~KPOB
); 6)
;

7)

(
);
;

8)
9)

, ,
, , .

, .


,
,
-

.
- , ,
,
.
;
.

(. )
.

, ;

-7-7

5 /

(%). , ~
. ,

,
,

() ;

.
,

: ,

, ,

.
-

. -

320

55

. ,

. .

20--25


- ,

.
.

5,

- ,

,
,

(.

55.1).

- .
,

61

-ll.

, ,

.
r-

. (
),

-, ~- - (
);

(. 55.2).
.
Oll

(. . 54).
,- 2-.

,
.

Oll ,
(. .

26).

r
- -_

, .

. .
.

, (
- ), ,

'

..

Na+

10

69,000

64,450

().

~
-y.f"

I-

156,000

90,000

--..
Ql

), (. .
Pi

1,300,000

_~

. '

340.000

).
,

55.1.

e opMo.

200,000

1,25-

~_

(Oncley).

26.

321

I~ I~ I~

55.2.

. .

. . . .
. .

. u,-, u 2-. (3- -.

(Reproduced.
with permission. from Stites D.P. Stobo J. . WeJJs J. V. (eds). Basic and Clinical lmmunology. 6th ed. Appleton and Lange,
1987.)

(Fab)

. ,
-

. l

, .

r'


() (),

(L)

(.

23000)

() (.

53000-75000),

(.

(L2HJ

55.3).


oMe .
.
, ,

(C L ),

N-

(V[).

.
N-,
(V ), 3/4 -
( ), 2, ).
, r
. N-
, . . V11 VL.
,

(Fc).

l-

2-

C L (. 55.1).
-,
.

-,

-.
-.

()
(. 55.1). -.
, , Jl,
; . 50000 75000
(. 55.1). Jl- -
,
.
, ,
. OI
: IgG, IgA, IgM, IgD IgE. .
55.1, -

-.
,
VL - V-, .
. (

),

.
. 55.3,

. ,

11 1594

, .

322
Fab

55.3.

V-

; -

IgG

55
Fc

; -

- L-; - .

from Stites

. .,

Stobo J. .. Wells J. .

(Modified and reproduced. with permission,


(eds.). Basic and Clinical Immunology, 6th ed. Appleton and Lange, 1987.)

55.1. . (Reproduced, with pemission,


Wells J. . (editors). Basic and Clinical Immunology, 6th ed., Appleton and Lange, 1987.)

()

from Stites D. ., Stobo J. .,

(L)

J-

, -

J.1

IgG

IgA

IgM

IgO

IgE

IgA

IgA,IgM

70000

15000
8

1, 2, 3, 4
G m(1)-(25)

1, 2

500002)

55000

70000

62000

70000

VHI-VHIV
10

15

18

18

16

V-

1, 2, 3, 4
m(I)-{3)1)

(2)


()

1, 2

2(I),

23000

23000

VKI-VKIV V>..I-V).. '

1)
2)

Inv (1)-(3).
3-60 000.

323

//.l( KP(ltJU m6!l

:
-,

V..V

-. )

. ,

R
-

. ll
.

(
) 1

(.

55.4).

, l


IgM IgE),
I-~-. '}

, 2 3 ( 4

.
(.

55.2).

. IgG,
. (lgA

IgM)

(.

(lgM)

(IgA)

55.5).

55.2. - . (Reproduced, with permission, from Stites


(editors): Basic and Clinical lmmunology, 6th, ed. Appleton and Lange, ]987.)

IgG

], 2

. .,

Stobo J.

.,

WeIls J. V.

IgA

IgM

IgD

IgE

J!
J!l, J!2

1;

IgG,

. (Modified and reproduced, with issi, [rom Stites . ., Stobo J. 0'0 Wells J. V.
(eds.). Basic d Clinical Immunology. 6th ed. Appleton d
Lg. 1987.)

55.4.

al,

3, 4

a~ L~+

L2
( ~

(S)

(-

6-7
150000

ll -

()

%)

11

( 2 L 2 )sJ +

2 L2

]9
900000

7 8
]80000

8
]90000

0,05

,
1;2

L2

a-J3
++++

1000

200

]20

+
+

+
+++

+++
+

?
?

++++

J3

()

+
+
+

L 2)2 J
7
160000 +
400000 **
-

+
+

19A


ceKpeTopHoro IgA

?
?

324

()

~J.l =<:

JgA

55.5.

; - .

tes

. .

Stobo J. ., Wells J. . (eds.). Basic and Clinical

, -

, ( ) OII
(. 55.1).
-

lmmulg,

(Reproduced, with permission, f Sti6th ed. Appleton and Langc. 1987.)

V VL -.

. -

(J) ( J IgA IgM) (CL ).

(V 1 ),

- J.1-

:
( ), (D),
(J) ( ).

- ,

IgM.

r-

V-,
IgG
r ,

Ig.

-,

, .

38

41.

(IgM. IgG

IgA,

V.

IgG.
IgA),

( L)

(V )

m.

325

(n).

. "

41

V-.

,,-.

, ml

II

l\ . ,

). ,
-
(,

IgA IgG),

(lgA. IgD.IgE, IgG. IgM).




, . I
.

55.3)

1,

. .

55.1

- ,

;
.

340000.

46

( -, 2~-

). ~ Aa2B~2Y2' B~-

. :
- .

Asn.

, -, B~

-, ; -

I. 55.3.
.

. -

rr

11
IV
V
VH

.
( ).
-

, , -

, c

VII)

(-

XI

( ). -

().

- -

.
,

vivo

- B~ (. 55.6). ' f
B~
--. ll-

in

. ,

) (. 55.3).

326

55

_ _ _ _ _

Gly

-rgJS,6N

-+

-------

Gly- ArN 5
_

+--

NNArv

Gly

55.6.

, (3)2' ,
() Arg-Gly.



,
, .



XIII (XlII a). XIlla
(Cf")

'-

ArgGly (. 55.6).
, -

B~ .

34000,

- (.

55.7).

. .

nell,

XIII,

(a~'Y)2.

;

: .

).

111

(. ).

--. ,

(Gla).

2 N - - 2 - 2 -

-1

NH.

()

XIII.

()

11
- 2 - 2 - 2 - 2 -NH-C-CH 2 - 2 -

55.7.

'

11

- 2 - 2 - 2 - 2 -N

11,

()

XIII

327

.J.\ m

, 1-

( - - - SS - - - ,

~IGJ~~an~I===::::::::::::=:==~w:a:/.~A~~"~~~~~~~~~~~"~"~~B~g~/~"~"~~~?2~/~"~ ~~~~~~~:;;:=~~~:~~~~~:~~~~
t

2 + (-

. N- , -

''------..y"..----~/ ''------...,------/ Gla). , ( )

F,2

( )
(

55.8.

1 Gla

N-

(. 55.9). Va
'

F-l'2 (. 55.8).

, .

. - -u
(muu) .

N- .

55.8.

, .

72000;

55.8

. N-

Gla.

(l-Ha

14

2 +
Gla

Il u
Tax~

, 2 +.

Va

'

50--100

(.

55.9).

350

V'

.

.

Gla


(.

Gla

55.1 ).

o~ o~o

Gla.

55000

Gla

2 + -

(XJ

~.n----

.
,

Arg-

II .

55.9.

, , 2 +

Arg-Ile.

VH a

328

55

, .

55.10.

VII

' (Gl- ). IX..


2+

, .'1 IlO IlO


.

VHa -

Gl-

(')

(')

VH -

VHa

Arg--Ile,

. ,

'
500 VIH ( VIIIJ.

V II

VI, -,

, ,

; ,

VllI

'
Arg - 'l . ll

1 3
0.01 . ,

. ,

l\m.

(.

yr ,
-

() (.

55.11).
55.4

55.10).

in vivo ,

in vitro

"

'-

,
~

'

'

. ,

XI a XI a

Xl a
' Vllla

II'

""

Xll
a
.....

Jl

).

, I

55.11).

VHI,

( lO-

(.

55.11.

mu

55.4.

329

ll

J-

II

VH

VH

VIII

VIII

IX

Xl

Xl

II

XIII

-
VIII
.

VHI,
.
( Jl.'l)

(-

200000.

, .

VIII ,
2300 ;

V.

);

, ,

VIII. -.

,
VHI. ,
,
VIII.


.

,

u,-.

u 2 - 25%
.

VIII.
VIII;

330

55

u2 -

u2 -

,
.

III.

111

; '

,
,

r,

111,

VIII,

(r).

111

III
IXa, ' Xl a

ll

.
,

. ,

. ,

(l

(),

. , .

. ,

111.

).

III

--

Glu.
Gla N-
11. VH, IX . '
. Gla

' ;

(,

. u

, (
).
, .

, ,

u ,

,
u1-
u 2- ,

.
, ,

Gl-
. KYMapIJl;la

12-24

.
. .

.

.

. mll-

Deykin D. Thrombogenesis, N. Engl. J. Med., 1967, 276, 622.


Genton . ' /. Platelet-inhibiting drugs in the prevention of clinical thrombotic disease. (2 parts), N. Engl. J. Mcd., 1975,
293. 1236. 1296.
George J. N.. Nurden . ., P/li//ips D. R. ll defects in
interactions of platelets with the vessel wall, N. Engl. J.
Med., 1984, 311, 1084.
Gitschier J. , /. Characterization of the human factor III ge, Nature, 1984, 312, 326.
Heimark R. L. , /. Surface activation of bIood coagulation. fibrinolysis and kinin formation, Nature. 1980. 286. 456.
Jackson . ., Nemerson . Blood coagulation, . Rev.

331

Biochem .. 1980, 49, 767.


W. . , /. Factor V,,-dependent binding of factor " to
human platelets, J. Biol. Chem., 1980.255. 1170.
. . Hemostasis and disorders of bIood coagulation.
In: The Metabolic Basis of Inherited Disease, 5th ed .. Stanbury J. . et l. (eds.), Gw-iII, 1983.
Stenj10 J., Suttie J. W. Vitamin K-dependent formation of gamma-carboxyglutamic acid. . Rev. Biochem., 1977,46,
157.
Stites D. .. Stobo J. D., We//s J. V. Basic and Clinical Immuno10gy, 6th ed., Appleton and Lange, 1987.
Weiss . J. Platelet physiology and abnormalities of platelet
function (2 parts). N. Engl. J. Med., 1975,293.531.580.

56

. ,

()

().

, .

250/0,

u-

1986 .,

40%,

MUCCbI .

30%

I'

-,

1)

lJ .

, -,

, . .

3)

2)

u,

. , ,

. ,

4)

, ,

u.

: , . -f

( ).

. ,

JI.

mmle

333

mm"

S6.I.

. (Drawing Sylvia Colard . Reproduced.


Bloom W., Fawcett . W. Textbook of Histology, 10th cd. Saunders, 1975.)

with permission. from

-,

16

( ),

(.

-- .

I-, ,

56.2).

(<< )

- (.

II, .

, .

56.2).

()

; f

, .
, (
) .

-- II
.

. e

(.

56.1).

1500 -- 2300
II

1).

,
(.

56.2).


. .

56.2,

14

( ) ,

. Ol

z.

56.2.

( )

150

,--

11

u,

I- , ,

, -

(. 56.1).
x

. ,

, lO

, ,

. 08)

80-

().

(<<

lll

334

56

~
Z-

I-

/z

zz<27222z

/?

/????????,

)22222222721

22222222?22;;/2222)

, //{, ,,<' ( ; <

222/22;

('???????????????,'???'

L - -_ _ _ _ _ _

<1.

?????]

(?222?/2/

--------'

."

2300

;;

,\

t::-

--~

;::::::=:-
1

1.
....
........
...
... -.

~:~:~:~

:.::_

/???????????????????)

/?????;?????????????

P2222ZZtZZZZ2Z222ZZZZZJ

zzzzzz2

zz/2221

2/z/z

2222222222

/???????????????????)

2// ?222

-----

L....-_ _ _

56.2.

1500

16

----..

_ _ . _ .

, .

F-

. .

20%

75%

- .

G-.

(r)

(-

(.

F -
56.3).

)- .
43000, 25%

G-

. _ pon ()

. .

(.

F - (.
56.3). F- 6--7
35,5 -

56.3)_

(})

F -

()-

335

'lU

000 08

G~

OOuCO

~--------------------------------------~y~------------------------------------~

1
.~'f."o-,'r"';.",...

.. "

~.

"'~"""

35.5
.

56.3.

ll8

.
: , .

- ,

(.

, ,

(.

. ,

17000.

F-,
:

TnI

TnT

(.

56.3).

TnC,

38,5 .
55%

().
.

460000.

, ,


<< (.

56.4).

200000)
15000-27000).

ATP-R
( -)
-

F -.


- .
()
- (. 56.5).

F-.
()
.

340000,

(.

56.5).

F-. -

336

56
. S-l S-2. S-2
,
F-.

8-1

115000,

, (.

56.6).

S-I,

, F-

100--200

. ,

F-

. , F-

-r- Z-
.

F- (.

56.2).
.rJ


IL.1\f :
.

56.4.

- ( ).

(G)

? ,

(.

F-.

I I
134

85

56.5.

l-

1;

S-2-

2.

s-

ule "

337

. .

) F-,

3)

900.

450,
900 450, ( 10-15

) .

4)
-F-.

5)

() F-.
.

56.6.
S-I- . (Courtesy of Professor James Spudich, Stfrd University.)

,

--LI .

F-.


(.

1)

56.7).

. ,
, .

2) .
,

50%;

200/0.

ll
lu


, l .


. ,

2+.

: .

. ,
,


.
.
"
,

D+

56.7.

56.3).

ADPP j

Pj

F- (.

; j- .

(Modified from Stryer


L. Biochemistry, 2nd ed. Freeman, 1981.)

(
) .
, F-.
d - ,

TnI

138
F--.

TnI

F -,

56
2 + ;

F -; 2)

F- (

F- ,

),

(<<) ,

F-.

. , l

F-.

2 ,

56.7.

2 +.

10-7-10-8

/.

,
.
,

.
, ,

, 2 +

,

10-5

/. 2+-

Ca 2t

4 2 +

TnI

F-

ADP

F-

+
2

10

1)
7

~
2

+;

3)

2)

4 +
2

, ,


F-

4)

F-,

. , 2+

, ,

Tnl,

F -.

2 +
. 2+
,
;
.


: 1) 2 + -

,
, , R

. ,

.

.
,

,
; ,

.
,

, .

F-

d ,

, ,
.
,

F-

(-

),

F-.

F-

.
--


h: , .

4 2 +

56.8).

4 2 +

105000,

(.

COKpamume.1bllhle u " fj.lI

339

8
()

10-5 / 2 +

..

...-.-_-_~-_-_~-_-_-t..~ 2 +.
10-7 / 2 +

2 +. -
()

pL-

ADP

4" pL-
(
)

56.8.

ll.

netics of actin- myosin

(Adapted from AJelstein R. S .. F:iscnherg R. Regulation and kiRev. iochem., 1980.49,921.)

iti. .

F-. , (_ 56.8).
,
1) 2 + 10 7 /; 2) :! I -

(u ).

2+
.
-

3)

2 + .

, ;

, ,

- .

4}

)<
F-II ;

5)

F -.

- .
.
, ,

. F-

, ,

.
. 56.1

( )

2 +

() ,

(_ .

, _'I .

44)

340

56.1.

56

( )

()

()

1)

(I,,)
F-

F-)
F-

F--

(TnI)

2 +

2 +

4 +
' 4 2 +

4 2 +

TnI

, ':I

- .

F-

:I -

. 42+ -

'

F-

F-

u F-)

1)

~ ~J

--,

. , JI

. x ,

, ,

02

l( -

I). ,

. e m

, ,
,

--),

() ,

,

(. ).
Tnl 2 + -


II,.
.
()-
,
r

, ,

l-.

cAMP-

.
.

TnI

13-

(. .

-,

19).

34)

JI

-- (. .

19).

--,

3-eJ1IC11IIII.

, .

3-

, 2 +

JI

-.

( -),

. ,

(, JI ),

or (. .

6).

, ,

. .

2 ,

56.2

d, ,

( ) (

) .


. , .

3-

56.9,

. , ,

, '


( ),

- ,

in vivo
, ,

, -

56.2.

III-

ll3

,
. .

, , , d

,
. ,

342

56

~---~

L...----_

---....

1!8'_~

56.9.

F-

. .

IMP

IMP

(. .

35).

: - -.
, .
.

, ,

7-9,5

, ,

56.1 ).

. .

: ()
),

(25

(7-9,5

S-1

(.

,

.


.
(.

56.11).

).

, ,

(10--12

. ,

- .


ll

G-,
, .

20--30

, ,
. 56.12. ,

43 000

(-).

N-

S-I,
56.12).

(.

343

COKpmll11111CJlh1lble II mn" .l1\ll

, ,

.... J,

"\

"

.J

...

11

.: .. .....~

"

.,
,4f~

'11

-"

'

\~
.

56.10.

.-

'\

I (S-I).

.'Ia :
( l\). .

'\ ".
, ,.

"

'"

.J

CI

-,

"

'J

' ..

,J

,
,.

'"

'

.,

"

..

. ."

"

,.
"

.~

.
~~

-'

',..'

,"

..

" ..

(); -

70000;
200 000. (Rcproduced. with permission. [ Heuscr J. .
Kirschner . W. Filt gizti re"elatcd in platinum
rcplicas of frce7e-dried cytoskclctons. J. ll Bial. 1980. 86.
212.)

. u

-
. ,

...

, ,
, . . ,

,,

. ,

-
.

56.11.

..

6 (). . . .
'

(I )
. :I ( )

,
. ;I

. .

140000; , 115000. (Reproduced, with permission. [


Heuser J. ., Kirschner . W. Filament organization revcaled
in platinum replicas freeze-dried tsklts. J. Biol ..
1980. 86. 212.)

.... .,

344

56

56.12.

- ,

. IC ,
. ,
; .

( ); .
, .

duced, with

rmis~i,

from Lazarides

Revel J.P.:

molecular bases of ll movement. Sci.

m. []

(Repro1979; 240, 100.)

1 -.

, .
,

. u-I

(.

56.13).

, . ,
,
.

, ,

, .

. JI

, , ,

, ,

r .

G-

(),

. -

, .

13

..
"\

"...
~

..

...

345

-.

..

...

.'

...

~-

--.

56.14.


.
,

55

56.13.

- .
.
, ,
.

(Reproduced, with permission, from Lazarides ., Revel J.P.:


molecular basis of movement. Sci. . [] 1979; 240,

40

. , ,

(Reproduced, with permission,


from Heuser J. ., Kirschner . w. Filament organization revealed in platinum replicas of frasc-dried cytoskeletons. J. ll
Biol. 1980, 86, 212.)

100.)
.

(.

56.14).

- (.

l3- (.

55000)

IJ-

53000)

8RM ; nl

, , ,

, .

()
;

. .

. .

> ()
, ,
JI .

.

GTP

56.15.

,
, JI
.

.
(

). (

Vinca.

) (

).


IC ()
. (. .

37)

, . .

8 1

) (

23

).

. -

, -

346

56

56.15.

in vitro

.1

- 11 -l. (

, , .) , .
, ( .

). .
. , KO.'IblJ,a , (
) . 1 >, ();
. F: , , , . ().

t: . ().

from Dustin

Microtubules. Sci.

'i.

1 11

56.3.

10--20

, ,

.
.

()

, ,

Jl

56.3.

(Rcproduced. with permission.

[Aug] 1980. 243. 67.)

40- 65

()

(10 - 20

(OI

11

50- 55
52

10
10

, .
, -

Z)

.)

- ,

200

150

10

10

70

51

COKpllmume.lbIlhle mmll(' {j('.IKU

347

67

Ii~j

"

."

",,., 300 .... ,

"

,/

"

"

.
, -,
,

.
.

1,4

300

-Gly-


(.

1/4

.

,

- Y-Gly-

- -Gly-X-

56.16).

56.16.

Jl. iI.

(Slightly
modified and reproduced, \\-'ith permission. [ . R:
ColIagen. Molecular divcrsity in the body'protein scaffold.
Science 1980. 207. 1315.)

10 100 ,

ll

, ,

r .

0-

.
(Gl--), -
, .

4-.

100
100

56.4.

).

-
,
.

- -

3-

5-

Il

, N- ,

100 .

ll

, -

348

56

56.4. .
, -

[ 1(I)2

;
;

11

- ,

[ I (11)]

nucleus pulposus,

;
,

111

[ 1(111)])

- , ,

- ;

IV

[I(IV)]

-;

r:

()2

() ()

(?)

. ;

in vitro

(?)

-,
4- -.

N-

, N-

20000

. N-

npo~~ .
-3-

- -

(Gly-X- )

30000-35000,

, -

le u CnlpYKnlJ'p"bIe .'lU

349

56.5.
(
[Gly-X- ) n

lI.W.J.

'r (l )

1)
2)

3)

3- -, -
4-

4)
5)
6)

5- y-

7)

4- -


S-S-

1) N 2 - (.

1000

2)

,
,

3)
4)

5)

, ,
-

. IC

(.

,
.

20000)

-
30000-35000)

. ,

. ,

II

(. .

() .

54).

- .

56.5.

f:

Pro 2 Pro 2
VII -

Proa2 L

Proa2cx

. 56.17. 1. - -; -
. - . (Reproduced. with permission. from Prockop D.J., Kivirikko . 1. HeritabIe diseases of

coll<1gen. N. Engl. J. Med. 1984. 311, 376.)

350

56

56.6. , . (Reproduced, with


pennission, from Prockop D.J., Kivirikko K.I. Heritable diseases of collagen. N. Engl. J. Med., 1984, 311, 376.)

1)

Proal (1)0

Proa2(1)S

( )

11

Proa 1 (I)~

Proa2 (l)s proa2 (1)0

proaI (III)
()

Proa2 (l)CX

111

ProaI (l)

proa2(I)cx

proa [(1)

()
lI

Proa2(1)s

-N-

pN-

2)

Proa2(1)L

()

Jl --

Proa 1 (111) +

Proa 1 (III)sM
Proa I (111)>-

111

IV

111

()

VI

()

-N-

N-

Proa2(J)J.

-N-

VII

2)

pN-

2)

1)

ro\

(1)0. proa2(1)0 ro \ (111) + -: proa \ {l)S

ro2 (I)S - -u; proa2 (I)L - proa - ; proa I (I)CX proa2 (I)cx_ ,
C-1I0ll -; ro I (lII)SM- \ (III)-, ; proa I (I)"

proa2(1)"
2)

, -.

. N-, -.

, ;

, \10.

: l

, , -

( ).

).

56.6

. 110

, .

56.17

, d

1.

Adels1ein R. S., Eisenberg R. Regulation and kinetics of actin myosin interaction. . Re\'. Biochem., 1980.49.
921.
Adels1ein R. S. 1 al. Phosphorylation of muscle contractile proteins, Fed. Proc., 1980. 39, 1544.
n .. n)' . Phosphorylation of the myofibrillar proteins. . Rev. Physiol .. 1980 42. 275.
Borns1ein ., Sage . Structurally distinct collagen types, .
Rev. Biochem., 1980. 49. 957.
Caplan . Cartilage, Sci. m. (Oct.), 1984. 250, 84.
Clark ., Spudich J. . Nonmuscle contractile proteins: The rol of actin and myosin in motility and shape deterrnination. . Rev. Biochem . 1977, 46, 797.
DeCrombrugghe ., Pastan 1. Structure and regulation of
I1agen gene. Trends Biochem. Sci.. 1982. 7. 11.
Dustin . Microtubules, Sci. m. (Aug.), 1980, 243. 67.
D. R. 1 al. Cross-linking in collagen and elastin. .
Rev. Biochem., 1984. 53, 717.

m/'n) .,I\U

351

Puchs ., Hanukog/ll 1. Unraveling the structure of intermediatc


filaments. . 1983. 34. 332.
us J. ., Kirs('hner . W. Filmt organization revealed in
platinum rcplicas of freeze-dried cytoskelctons. J.
Biol., 1980, 86, 212.
Kleinman . ., Klebe R. J .. Martin . R. Role of colIagenous
matrices in the adhesion and gro\\th of cells, J. ll Biol.,
1981, 88. 473.
[zids . Intermediate filmts: chemically heterogeneous. developmentalIy rcgulated class proteins. .
Rev. Biochem .. 1982. 51, 219.
La=arilles ., Rel'el J. . The molecular basis of ll movement,
Sci. m. (). 1979, 240. 100.
J. ., Weber . The cooperative ti of m uscle
teins. Sci. . (Fcb.), 1974. 230. 59.
Prockop D. J., Kblrik/...o KI. HeritabIe diseases of collagen, N.
Engl. J. Med .. 19R4. 311. 376.
Sandbng L. ., Soskel N. ., Leslie J. . Elastin structure. biosthsis. and relation to diseasc states, N. Engl. J. Mcd ..
1981, 304, 566.

57

, ,

1)

2)

.
, -
.

(
),

3)


().

. ,

, ,

, .

(.

57.1).

57.2

(, )

1)

2)

-,

,
, .

57.1. ,
. (Adapted, with pennission, from Mclntire . R.
Tumor markers: How usuful are they? Hosp. Pract. (.), 1984,

19, 55.)

, ,

()

- ()

()

()

()

, , ('ln

57.2. . (Adapted.
with permission, [ Mcll1tire . R. markers: How
useful they? Hosp. Pract. (.). 1984. 19. 55.)

ll

N-

2-,

-4-

()

;J.

(-

, ),

<r

II

57.3.

353

Il ,

8,

r,

, ,

3)

l ,

(.

57.3);

.
, .

57.1.

. ,

( ). ,

57.3,

80%

"(-

r (., ),

(, ,

. ,
.

srgus

flavus,

().

),

( }N=N{ }NHCH'

12 1594

57.1.

2-

N--4-

, . .

354

57

R-

+ 02 + ND + +
R - + 2 + NADP+.
--t>

, - ,

(.

57.3).

. ,

. ,

(, f3-)

. ,

. .

-.

()

-448

ot

Q;

(, ),

KOHe~ . Il

(,

--t>

--t>

-.

. , , ).

(),

, (

, ,

).

2- (2-)
N-- ( )

(-, -, -,

),

(..

).

UD-,
3'-5' - ()
.
.

(..

. .

. ,

, ,

. ,

,
:

1)

; 2)

.
, ,
.

, -, ;

3)

NADPH- :

4)

. -

, , n

355

. ,

-448

5) ,

, .

Salmonella typhimurium,
His-.

KOBa~...eHTHoe

,

. .

. .

(, ).

His-,

. ,
is- --t> is+,

.
,

. ,
. ,

9000 g.

S-9).

. ,

N-7. 0-6

N-2, N-3.

0-8 -

90%

(. .

38).

,
,

. ,

,
.

(, )

. ,

u .

. .

.
,

(.

57.2).

)
. ,
,
: 1) ,

u. (.

38

40).

(. ).

12

, ;

. , -,
,

356

..

,
,- .

t t t t

57

])

, ,
,

, ;

t t i i

2)

3)

57.2.

. .
(, ). .


( ). .

4)

(.

) ,

. ()

100 ;

()

,
-

. -

(.

,
.

' : 2)
, . (
) (

,
();

3)


, .

,
,

.
- ,

SV40.

5 . . .),
5-6 .

. ,


. SV 40
( ,

-12-0--13-

57.4.

t.

(), .
,

57.4).

SV40.

12, 18. 3 1

-,

(. ).

, R

' ;

, .

1 11

, llll,

T,mid-T t.
tumor (),

,
;
,

357

gag. /. env, src.

gag

, ,

ellv

Src

,
.

gag

, /-

-,

, nv-

, ,

( ),

2),

src,

, ,
.

. ,

, -

(,

).

, ,

yr

(.

, ,

. -,

.
,

57.5.

57.5).

src,

. ,

. src

OJl,

- .

-4,5-
(.

. ,

2 +

(,

).

in vivo.

;
, ,

44).

, .
(),

Na+ / t- -ll,
42). , src

(. .

, ,
.

( ).

358

57.5. ,
(,

).
-

,
(

):

57
,

(1 %
). (,
, ,
)

(. ).
,

,
.

,
,

20

(
).

(,

),

57.6.

erb-B

sis

. !s ,

,
. ,

, ,

- ,

ras

. ,

G . ,
,

, ,

(.

GTP,

44).

57.6. . (dd and reproduced, with permission, from Franks L. ., Teich N. .


(editors). Introduction to the Cellular and Molecular Biology Cancer, Oxford Univ. Press, 1986.)
re

(-

)
-

fes

fos

29

sis

sre

(-)

(?)

359

. .

,
,

, ,

-n (

(. .

lar oncogene;

36)

cellu-

, c-ras). ,

, ( , )

. ,

(, -r-).

,-

-n (,

. ,

oncogene),

-,

v-n-

, , ,

,
; ,

. ,

-n-

v-ras; viral

(,

v-rs-

).

,

,

. ,

(
), .

.
. .
(, )
, .

( , ,

, ,

, ).

<< .

(),

, ,

-.

. ,

( ),

- (

NIHj3T3).

1-2

, ,

(. .

39).

, . ,

, ,

- (.

(. .

- ,

36.

20

57.3).

.
,

ra.5

(. ).

. R.
,
, (.

360

57

I
I

LA

---_.......... -----

LA

---~

.......... _--

+
~
~
.

57.3.

. .

. .

, .

(LTR). ,

. . -.
.

57.4).

,
,

5'

3').

22.

, -,

(.

(. .

39

57.5).

41).

14.

8.

14. .
57.6, (

. e .

. -,

. .

- ,

, .

8J1 .

( ) )

. ,

( )

------ .......... --------

t
I

LTR

--_ ...........

LTR

~---

~
~

~--MPHK

57.4. . .
. .
. . . ,
(.

57.6).

:).

. .

361

, u,

_
:

I I

p - - -....~

Q - - -.....~

14

14

14

. .

... :.

p----t.~:
:

Q----t~~:

;4-.

'..-

57.5.

, l .

8 14. q- 8- 14- ,
14 8- . 8, 14;
, , .

. .
38)

(. .

(. c-ras)

. ,

(.

).

- .

. . v-ras

, ). -

, .

400

. ,

1000 . . .

rOMor'elIHo

-, .

21 000

(21) -

-,

c-ras
c-ras

.
, ,

12 p21).

-.

, , ,

: ,

c-ras .

. , ,

-------- .......... -------

------_ ...........

-rs--

~
~MPHK

57.6. m-

. 14- . ,
.

. , . }' . .

362

. 21


G .

( .
,

,
GDP (. . 44).

57

. .

,
.

.

,
.

( )
C:i ,

sis

mb~I---_:

A~

11L _____

2 +

57.7.

, Ccl-

. , cAMP- .
(1 -.

2 +, . . -; G-G-_l:

: -; - : - ; ; -; - .

, ,

. ,

363

ras,

) ,

. ,


).

-
, .

15%

- .

2.

, ,

c-ras,
G-+A.

3.

(
),

(.

57.7).

57.7). 1.

(.

, ,

, .

sre,

57.7. . (Modified and reproduced, with permission, from Franks L. .,


Teich N. . (editors). Introduction to the Cellular and Molecular Biology of Cancer. Oxford Univ. Press, 1986.)

()

1
2(-I, -2,

( -1 )

(-2)

-2

()

(-)

(-

364

57

- ; ,

. ,

, .

. (,

, -,

(,

r ;

. .

II

(.

27);

1) ,

. .

LDL,

v-sre).

.

.

, 4,5-
(. .

v-sre, . 44.5).

2 +, -

-;

2)

; )

, ,

( )

ra,

LI;

(. .

3)

24).

( ). ,

, .

1-2 ) (
, - c-fos). ,

Il

,
(. 57.6).

109

. , -

(. .

. ,

44),

v-sis

100

). ropa

. .

, ,

109

-;

v-sis. .

() ;

, ,

v-erb-B


;
,

365

57.8.

v-erb-B,

, ,

(-J3)

' (.
)

(,

>,
.

()


. ,

-J3
(

).

,
. -J3

sis.

. ,
,
; , ,

. ,
-

: , ,

(.

57.8).

,
.

, (

);
(, )

.
,

. ,

.
,

,
(

; . .

II

,

57.1); ,

.
. ,

.
,

;
, .

1 ,

, ,

. ,
.

, ,

, , (

. ,

) (.

. ,

Ix

57.5).

366

57.9.

(Adapted from Robbins J. ., Nicolson G. L. Surfaces of normal and transformed


ceIls. In: Cancer: Comprehensive Treatise, Vol. 4, Beckerr
F. F. (editor). Plenum Press, 1975.)
.

(, )

57.9),

,
.


(,

IV

),


.
,

(.

57

,
(

).
, -

Barbacid . Oncogenes and human cancer: Cause of


nsequence? Carcinogenesis, 1986, 7, 1037.
ishop J. . The molecular genetics of cancer, Science, 1987,
235,305.
. ., Klein G. Chromosome translocations and human
cancer, Sci. . (March). 1985. 252. 54.
Darnell J., Lodish ., Baltimore . Molecular Biology,
Scientific American Books, 1986.
Farmer . .. Walker J. . (eds.) Molecular Basis ofCancer, Croom. l. Ltd., 1985.
Franks L. ., Teich N. Introduction to ( lll al1d l
cular Biology of Cancer, Oxford Univ. Press, 1986.
Hute . Oncogenes and growth control, Trends Biochem.
Sci., 1985, ., 275.
Hunter ., J. . Protein-tyrosine kinases. Annu. Rev.
Biochem., 1985, 54, 897.
Massague J. transforming growth factors, Trends Biochem.
Sci., 1985, 10, 237.
Mcltire . R. Tumor markers: How useful are they? Hosp.
Pract. (). 1984, 19, 55.
Nicolson G. L. surface molecules and ( tstsis: Regu]ation ofmetastatic phenotypic diversity, . ll Res.,
1984, 150, 3.
Pitot . . Fundamentals ofOl1cology, 3rd ed .. l Dekker,
1986.
Sporn . .. Roberts . . Autocrine growth factors and cancer, Nature, 1985. 313, 745.
Tannock 1. F., R. (eds.) Basic Science of Oncology,
Pergamon Press, 1987.
Weinberg R. . action of oncogcnes in fh~ cytoplasm and
nucleus, Science, 1985. 230, 770.

- ,

5,3-5,7.

- 5,3, 5,7
/;
.


ld a~x

5,5

, ,

,
.

(
,

).

() .

95%

:
,

( ),

, , , , ,

, ,
.

5 r%. ,
95%- 2

%. ,

, ,

10

(20 %). ,
200 / ,
~ 190 210 %.
0,1
/ (lSD)
0,2 .

.
,
- . ,


,
.

ullu

368

, .

.
u.u. .JI
,
, ,

, .

, ,

(%)

u . ,
:


(1000/0 ).

:

72 %

.'1

. .

8-12

3-4

~(.

3-4 ,

10--14- .
. . ,

, ,

1--

, ,

. ,

, ,
, .

: .
,, , , ,
, , , ,

: ,
,
.

(3-4%).

).

3-

:
- +5%, - +6,7%, -- +5%,
-- +9,30/0, - +8,4%;
-

2,3%.

6%

--

20% (80%-


, ,

, .

(%)
.
:

.
:


----------------------------

%, -,4-0,6 /;

9% (

3% --

). ,
; ,

-,4 %; -10--25 %,
0,8-1,8 %, 4-

.JI

0,5

(97%- );

99.9%

(+ 11 %)

. ,

, .
,

(%)

15%

, .

20%

100%;

_l

100%;


----------------------------

100%.

uu

369

cek- 1;

-- , -- I
2

: / = cmcek- 1; / 2 = ,- 2 .

, ,

, ,

( ).

(Systeme International d'Unites)


-

: ();

()

: ();

(mole);

( ):

: ();

: ();
: ();
:


{. )

()-6-25

U; ()--26

/ .

(cd);

(kat).

. . ,
.

. .

(),

() -

: / (/);

: / (/);
: / (/);
: ( 3 );

();

: / (/);

: / (/);
: /;
: ()-/ 2

, , .


. .

1.
( );
(
, ); (
, );

10 12

109
106

103

102
101

10-1

10-2
10-3

10-6

2.
( 6),
;

, .

10-9

10-12
10-15
10-18

( ): 1(}-11 %

(: fr-65 /).
. .

, .

>, ,

ci .

u.lOu

370

,
.
.

1)

2)

.

.

( ):

40-250

/.
. .
,

1 ,

. (.
.

2, 6

24

.li.

. .

,

.


( ):

80-180

24-28

/ (:

24-28

/).

100 (
,

. .

7,2); 0,8-3,2

/.

. .

() (.

50000)

. . I
,
.
-

- .
8.l1.

1.

) (

),

.li.

1.

, ,

) (

(,

) 2

, ~,

( 02)

), .

, ,

, .

, ,

(),

2.

) (

) ,

2.

, , ,

, .

I!U.IO.:u

371

) .,'l.'1 (

I 1

2 )

.
.

1.

,
%

0,2 -1,2

/). ()
()

-0.2- 0,7

(:
3.5 -19
- 0,1 - -0,4 %.
% (:

7 /, 12 /).
. .
.

D.

- ,

, ,

, .

, .

. .1lO .

2.
, D (, ),

. ,

.
,

(,
),

'\10

,
(,

( )

.l.).

. .

1.

Il

50-150 24
(: 1,2-3,7 /24).

. .

),

, . -

2.

(3,1

).

12

24-48

). :I

~8,5

/~

/)

24

125 50

200 /24
).


: -25--43 % (: 1,7)~~ -lO-200 % (: 16 -31
/).
. . .

-10.3 % 4,2-5,2
- 4.2-5,2 % 2,1-2.6

. .

50/0
95% -

/ (: -2,1-2, ~,;

-1,05-1,3

2,9

/).

. .

24

(5

3.

. .

.
(,

150

, .l ,

u2 - .

. OJJO .

1.

I' -

, . ,

1 , , ,

, , ,

, .

372

uu

2.

), , ,
, .

.l. .

(Reproduced. with nissi. from Krupp


cian's Handbook, 21st ed. Lange, 1985.)

: 96-106 / (: 96-106 /).


. .

;
.

. . -

() (),
(-)
(-).

. .

et al. Physi-

(Mr%)

(Mr%)

(Mr%)

(Mr%)

120-240
140-270
150-310
160-330

<29
30-39
40-49
>49

10-140
10-150
10-160
10-190

170
190
190
210

45 12

55 12

,
. l
NH 4Cl ;

-. ( )

(,

. .

r , ,

).

.lI

.ll

1.

1.

(KO~

(), ,

), (),

, (),

, ,

(
), ( ),

2.

(,
), (,
).

2.

(,
, - ),

( ),

, . ,

(), ,

,
( NaCI), (
+), (
N , +).

()
:

10-50

/ 30 .
0

. . ,

, - ,

, .

. .

.
,

( )
.
, .

.lI

1.

:

150-280

r% (:

3,9-7,2

), , ,

/).

(), ,

.
( 3-5 ) 2-3

(. . .l.)
. .
.

Dle

( ,

(. . , ).

uu

2.

(. .

. . .

,
.

, -

.. .
(24 )

".2)

(. ).
.

373

, -

1-7
2-3
4--4.5
9-9,5
11-14

4,5 /
8,1 /
7,9 /
4,5 /"!"
2,5 /
2.7 /
0-50
0-100

10 /
12,8 /
12,1 /
14.6..!

18.1 /
20,1 MrjKr

25 MrjKr
21

.2.

(%

1,

ro)

.
.

1.

2,
3,

0-3
97- 100

), ( ,
. .

).
, .

2.

, ,
.

. . - Dl-
,

. ; (
, , , );

0,7-1,5

% (:

60-132

/).

.
. -

. . .
. .

2--4 )

72

20%.

, .

, ,

. ,

(24

20%

: . . ..

. .

. .

24

10 10

5%-

.
. . -

, , ;

( ),

ullu

374

, ~-, -, ,

. .

, , ,

, ,

0,7 %


: . . .

3.


, -

.J

, .

: -65-11
% (:

/).

3,5-6,1

. .

(3

/ ).

24

50-175

% (:

9-31,3

/).

. .

. .

. .

, .

. .

, , ,

, ,

, .

1.

, ),

, (

, ,

1.

), ,

. Il

2.

, ,

(),

2.

, , .

2-3

; .

-,

,
: -25
/

30 / 300 ,
30':) , -50

30" .

. . .

-250--410

(:

. . -

/), -20-55%.

() -

. . .

45-76

. ,

. .

. r

30-40%-

, , ,

.
.

().

L-;

1.

, -

U_10u

, , ,

375

.4. :

2.

(
)

(, . ),
, l\t (

: , ).
.

1.

( ,

, , ,
, . ).

2.

1 (u t )
( 2 )
3 ()
4 (YI)
\II 5 ()

28 (15 - 30)
36 (22 -50)
23 (15-30)
6 (0-15)
6(0--15)

. k, ,
.

. u
.

, ,
.



(ll'

2' , t

1 (
2, 3,4 5 (
1
2'

() ,
,

),

( ),

).

( ):
-55-140 /,

300 .

. .

15-75 ( ): 6,3-30
8300 /8 ( ).

/.

. .
,

100

, .

.
10 .
. ll .

NADH.

5- u ( )
.

. .
1;

-,

1).

1/ 2

, , .

. .

0,2-0.5

, . .

. .

B I2

, .

..J.

5-7

3- 4

(, ,

, , 1 1l

. .

).


.J

: . . .4.
. r. (. ).

. .

: 1.8-3 % 1,5-2,5 / (: 0,75/ ).


. . .
. .

1.25

, -

- -

uu

376

, , ,

, .

1.

;
,

2.

, ,

, ,

, ,

1.

(),

) ( );

.
, ,

) ,

, , (

, (
), ;

,- ,
, ), ,

0,1-0.63

( ):

) (-
) , , ;

. .

) ,

24
.
m ,
. .

, ,

3-4 .
. . ,
4,9,

) .

2.

r
: -4-7 % (:

, ,

1,3-2,3 /);
1-1,5 /).

, ,

-3-4.5 % (:

, .
,

. . ,

.
. .

, ,

d.

I .

. .

, ,

, , ,

, ,

1.

2.


( ):
: 2,8-6,7 ; -

- -

0,8-2,3 ; - 5-13 . 24-71 / 300 .

, D (, ),
(),
, ,

( ),
, ,
( ),

( 1~%). -

. .

48

uu
, -

, (i (,
)


( , )

377

: .
. .
.

: 3,5-5 / (: 3,5-5 /).


. . ,

+ ;

, , (

), .


.
. l
1. . : 6-8 %. (:
60-80 /). .
. .5.

.
. .

.5. ,

.
, (

), ,
,
.

. (. ).

<l.-
<l2-

1.
(,

~-
-.fl

52-68
2,4-4,4
6,1-10,1
8,5-14,5
10-21

),
(

2.

),

% (:

. :

33-55

3,5-5,5

/):

, ,

, , ,

),

2.

) ();

) ,
,

, ,

(, ,

, , .

),

3.

. : 2-3,6
% (: 20-36 /) (. . .6 .7):
) ue

(
) ;

. ,

;
) -

;
, .

, (

, , ,

, ,
, ,
; -

--)
; ,
(, );

, ;
,
;

.6. .

IgA
IgG
IgM
IgD
IgE

90-450 %
700-1500 %
40-250 %
0,3-40 %
0,006-0,16 %

U,IO.u

378
.7. n.1

r .'1OI Il

~I.

...

8.
1.

( ). <i
, .J:

2.
U1

IIl

1J. .

( );

.
ll

ll

, .
ll (

OJ' . )

. ,

, , , ;

- . :

) (' (

. :

0,2-0,6 %

(:

:
. ,

4.

2- -6

/):

; ,
, '

) t::

, (). ;
)

( ,

100

1,6

% ( 1J.,

200

%) -

t: .

, ),

ll

. ,

( 4)' 4
: -

5
136-145 /

(:

12

% (:

11

136--145

/).

65-156

.'10

% (:

51-142

/);

- -'}-4-

/).

. . .

. .

. .

. .

140

155

(-

).

, .

-,

, .

ullu

( ) (.

). 4
.

1.

( 3) ,
()
-
( -)

)
.

2.
( )
- .

379

: ,

1251_

, 25-36%; -
( -)
12SI-

0,85-1,15.

. . .
. .
,


( ):

0,01-0,03

4 ,

0,8-2,4

% (:

/).

. ,

12 s 1

( ,

. . .

. .

4 4 .4 ,

).

, , 3 (

-,

). 4
.

, .

2.

. .),

, . . ,
4 , , .
.

1.

1.

,
, ,
, ,

- ()

2-4,8

):

- ,
,
, , ,

2.

, .

%.

. . .
. . -

4 . u

4 , . .

.,

, .

,
, -.

. .l).

. .

1.

165

% (:

1,65

/) (.

, ,

2.

16

).

. . ,

(), ,

, ,

, ,

, .

pullu

380

( );

. .

1. :
) -
, ,
x ;

,
,

-,

,- ( ),

.
. . ,

, (

);

, )

) -

1.

) -

II

),

2.

, (
), .

, 6

111 , IV (
V

( );


: -3-9 %

(:

/); -2,5-7,5 % (:

0,18-0,53
0,15-0,45

/).
. .

) -

, ,

, .

2.

) -

:
,

(-

),


;
.

, ;

. .... . ,

) -

() .

. ,
,
,

:  -8-25 % (:

2,9-8,9 /);
3,5-9 /).

-21-53

(:

, );

. .

. ....

1.

, , , ,

, .


.

,
, .
-

, (

1),

- (-
- -

),

.
.

2.

Uu

381

(), ,

.lf.

1.

25-30%

350-600 /24
2,1-3,6 /24 ).

. -

. (:

0,21--0,59;

0,75 ,

- -

. . ,

2.

( 1) .~

24

mo

. .... .

2-3

u.lO::Jlu

382

- : -

410
-

. 250/).

(44.7-73.4

20 -5~%.
3.5- -5

: -

(3.5 -5 ,'.'1).
(2.1 -2.6 /).

(), (), (),


()

.'1: -8.5-10. %

: -

, (

/ ( 550 /).
-: ()- 3-5,5 %

100

8.9

/).

-8-25

(2,2-

(2.9-

lI

100 .

): - 3-26 /

30" .

() (

): -

6- -25

30' .
110

% (

65

/)

( ).

C-I-5

2.1-

(0.9-5.5~

. (-).

80---100

..

(10.67-

) ( ).

13.33

180 %
- 0.4-1.5

(23-85

/).

94-

: -15-23

%.

.l: - (PIC)' 90-250 %. 4 (PIF)'


10-60 M%~ ( 50)' 75-160 %
:

/);

8
8

5-25

/.
(): -

l-: -
:

M%~

( -).

:!. (P"n 2 ):

100%

() (

: -

4.25-5.25

j).

. -50-300

():

[J-:

(1.05-1.3

: -I6--24 %.

: -80-180 .

0,1 - ..63

3.9

2.6

!).

: ( )-

/).
:

10

(138-690
(275

10- 50

30"'. .

(): . . .2.

: -0.3-2 %

(3-20

/).

: -3,5-5.5 %

(35 -55 /).


(20-36 /).
(60-80 /).

: -2-3.6 %

-0,7-1,5

(62-132

/).
: - ( ):
%

(0.44 -1.8

- 4- -16

/).

: -6--8 %
: . . .5.

(): -

: -

IJa: -

0.2-0.6 % (2-6 /).


- 24- -28 / (24-28

:
: .

-0.2-1.2

/).
% (3.5-20.5

/).
()-.l---,4 % (

/).

-0.2---,7 % (

12 /).
: -I5-60 % (0,53-2,1 /).
Blz : - 200 % ( 148 /).
D: - (D ): 25-, 8-55 / (19.4137 /); 1.25-.
26-65 / (62-155 /); 24,25. 1-5 / (2,412 /).
.... :
C-40-170
.

); -55-140 /.;] 30~C.

150

, .

. : -450-1000 % (4.5-10 /).


: -l,8 -3 % (0.75-1,25 /).
: : 100-200 % (16 -31 /).
: , - 3-9 %
/); -2,5/).

-136-145 /

(0,18---0,54
(0,15---0,45
:

-7.5

(136 -145

/).
:

(3

500

/).

( ):
-

2990- -6980

: - 280-296 MOCM/I

296

(280-

/ )

: -145-160 /

(145-

: -65-110 %

/).
: -.6-1 % (7-114 /).

: -50-175 %

160

(3,6-6,1 /).
(9-31,3 /).

uu

: (): -8-10 -

: -5,0-20 %
1 :

383

/).
: - ,

(0,2-1,14 j).
24-29 / (24-29

100

/).

(0,4-10

: : -0.4-2 /.

0,5-1,5

(156-468

(): -

/).
: -200--400 %

(23-45 j).
165 % (1,9 /) (.

: -

/ (22 /).
: C-I-25 j

).

/.

():

-2-12 j;
-I-I5 /;
-I-30 /;

: -l,056 (

). -1,0254-1,0288 (

- 30--200

).

).
: : -

30-300

20-120
15

/,

/;

7-140 /.

:
-2-20
/
(4,5-45
/).
: -5-12 % (1,45-2 /).

: -

: , - 3-4,5 %
(1-1,5 /).
: - :
-- 40 %;
-
180
r%;

- 40 %. (
/ 0,026.)
: -96-106 / (96-106 /).

: -

:

-150-280 %
(3,9-7,2
/ (. 8).
.

-25-43

(1,7-2,9

():

').

-35-45 .

(4,7-6

-7,35-7,45

(+44,7-45,5 /).

rOPMOmI

(56-250

/);

/).
: -

0,5

(3

/). .

:
: ( ):

: ():

/).

(0,2 /).
: - 135 //.
: - 8 - 5-20 % (0,14-0,55
/), 8 - 10 % (0,28
7

-65-75%

0.55

-2-9 %

/).
: -200 % (148 /).
: -50-150 % (7,65--22.95 /).
: , -5-13 (), 0,8-2,3 . (-)
.

0,1

: ( ), -

100

/). ,

1:

(47 /
200 /.

-25-100 /.

20--100

/.

: -4-25 /; (29-181 j).


-: -0,9-4,2 /.

:

.lJ.
.

.iI:

(, ):
285 /0-2 /; 290

:
- -:
- 9/;
( ) -

/- 2-12 /.
(): , -l-10 /

(): ,

465

10
(46-

/ ( ).

():

0,2

l\/)

).

2-12 /;

-I-15 /;
-

/.

30 /;
- 30 /.

:
:

-0,2-1,5

384

/; - 6-32 /;
24 /; -

1 r/ (1

r/ = 3,2 /).
,

100 %,

-300-1000

r%; -20-80 r%;


120 r%.
: , - ]0-30 %;
-0,3-2 r% (1 % = 0,035 /
-

/).

(Ez): ( ), - 12-34
/; - (1-1
) 24-68 /; 11-20 - 50-300
/; 21-30 -'-73-149 / (
) (l/ = 3,6 /).

, :

M-20-100 /24 (0,5511,17-:


, 4-12 /24 ; , 4-8 /24 .

2,76

17-: -

8 , 0-2 /24 ;
2-20 /24 ; , 10-20 /24 ;
, 5-15 /24 .
. (1 = 3,5 )
: - 1,3 /24 ( 6,6
,

).
.

: -

24

80

30%
/24 ( 0,4 /

l\-8R : -l,5-7,5 /24

(11,4-57,2

: ( ). : -

1-3

//; -

3-6 //.

: -

2--6 //;

-3-20 //.

: -

345

230

/24 (

: -

50

/24 (

60

: -

2 /24

8,8

)
:

-0-2,5

/24

4,23

: -
/).

100

29,2

:
)

40-280

/24

(68-474

( ) -25--36%;

0,85-1,15.

, (4):

-5-12 %

(65--156

/) ( ).
, (4 ): -,8-2,4 % (10-30

/).
- : 12-28 4 (150-360 T4 /lOO ).

I
:
: -2-26 /24 (5,5-72 ).

.

: , - 100 /24 .
- 10 /24 ( 55 );
-

100 /24 ( 591


).
.

Friedman R. . , /. Efects of diseases clinical laboratory


tests. Clin. m., 1980. 26 (Suppl. 4). ID.
Hansten . D .. Lybecker L. . Drug efects laboratory tests.
In: Basic and Clinical Phannacol0gy. 2nd ed., Katzung
. . (ed.), Lange. 1984.
Lippert .. Lehmann . . Sl Units in Medicine: lntroduction to the Il1temational System of Units With Conversion
Tables and Nonnal Ranges. Urban and Schwarzenberg.
1978.
Lundberg . D., Iverson ., Radu/escu . (.). Now read this:
SI units are here. (Editorial.), JAMA. 1986,255,2329.
Powsner . . Sl quantities and units for American medicine,
JAMA, 1984, 252. 1737.
Scully R. . et /. Normal reference laboratory values: Case records of the Massachusetts General Hospital. N. Engl. J.
Med., 1986, 314, 39.
Snnnlilh . ., Jarett L. GradwohI's Laboratory Methods
and Diagnosis, 8th ed . Vols 1 and 2, Mosby, 1980.

----

---

-------

--

--

()

--

----

--


--

--

13 1594

-- (

--

-- ()

-- -
--
--
--
--
--
--
--
-- -

()

--

-----

--

--

()

()

--

-- 3' --5' -
-- -
--
--
-- m

1: 262, 285
1: 160
1: 113
11: 302
1: 143, 144
11: 298
11: 155-156, 216, 217
11: 342
1: 116, 218
- 1: 136
1: 192, 194, 238, 254,

8- 11: 12. 13
11: 13
11: 20
6- 11: 33
6- 11: 12, 33
, 1:
1: 307
1: 306--307; 11:
1: 174, 175

270, 271; 11: 10, 11,

162, 163, 167, 177, 178, 197


11: 162-163, 226
- - G- 11: 163
3' ,5' - .
.
11: 18, 19
11: 19
11: 6. 7, 9, 21, 35, 73
, 1: 115-116
- 11: 21
S- 11: 335, 336, 345, 353, 354
S- 1: 114, 267, 303, 335, 336, 346, 348,

306--316
276--277

1: 175

u- 1: 174, 175
1: 174
11: 176
11: 344

11: 333, 335, 337, 340, 342, 343


- (G-) 11: 334. 335,

349,

353. 354; 11: 10, I1


S-- 1: 348. 349
11: 7. 8, 9, 10-11, 15, 16
- - - 11: 7. 8
, 11: 30, 31
() 1: 113, 114, 115, 116, 117,

130,215,
217, 218; 11: 10, 340, 341
11: 21, 22
() 1: 114, 115,215,216,218; 11: 5,
8, 9, 19, 20, 22, 23, 342
-3' -, 11: 9
-5' -, 11: 9
( ) 1: 113, 114, 115, 116, 117, 130,
181,182,184,188,192,196,215,235,247,248.249,267,
275, 309, 335, 336; 11: 9, 10, 18, 20, 332, 333, 337, 340,
341
- 1: 114
- 1: 114
-5'-, 11: 10
1: 192, 194,215,219-220,223,269,270,271,353;
11: 221, 222, 223, 225, 226
- , 11: 383
- 1: 288
- 11: 226
- 11: 226
- ,

11: 339
11: 225-226
11: 219
(, ) 1:

270, 271; 11: 148, 159, 171, 181-182, 211, 213, 219

342

11: 334
11: 342-344
F- 11: 334, 335, 337, 338
G- 11: 334, 335, 342
- 11: 342
- 11: 342
- [[: 342
- 11: 334, 336, 344

- 11: 339, 340


- 11: 337
11: 337-338
1I: 342, 344
- 11: 334, 337
- 1: 344, 345
1: 25, 28, 179, 215, 296, 299, 301, 308, 311, 312,

323, 344; 11: 341


- 1: 344
- 1: 28, 344, 345
-- 1: 308
- 1: 308, 323
1: 328, 329-330
- 1: 358
1: 267, 286
- 1: 242
1: 64, 121, 267, 268
- 1: 358, 360, 361, 363, 364, 365
1: 120, 11: 24, 25
11: 13, 32
1: 104-108

1: 214

1: 104, 107; 11: 28


1: 104, 106
, 1: 107-108
1: 353
- - 1: 352, 353
1: 353
() 1: 42; 11: 319, 320
- 1: 247, 256, 259

313,


1: 121, 268,
1: 155
1: 208
1: 140, 145
-- 1: 142
1: 64, 182, 183, 203, 207,
11: 148, 206, 207, 208,

326

1: 131
11: 120-121

208
209, 210, 211, 212, 216,

1: 299, 304
1: 165
()

--

1: 192, 193, 194,244,270,295; 11:

5, 10

11: 218-219
11: 219
11: 177
11: 289, 370, 382
- 11: 286, 292
-[1 -+ 6]- 1: 191
1: 148, 149
1: 148, 149
-[1 -+ 4] -+ [1 -+ 6]-
- 11: 97, 102, 103, 106
-- 11: 96

1: 198
1: 168
1: 22--24
1: 306--316
- 1: 317-342
1: 167-168, 171
11: 276
1: 311-313
- 1: 327-335
- - 1: 319-322
- 1: 319
- 1: 322-327
- - 1: 335-341

1: 270

121

11 11: 159, 161, 171, 212, 213


111 11: 212, 213
11: 212

- 11: 213
1: 220
- ( ) 11: 232
11: 156, 169, 211, 228, 233, 234, 236
- 11: 208, 230
-- 11: 233, 234
11: 206, 207, 210
11: 231
11: 274, 297
-- 11: 81
11: 132

- -

1: 343--

355

- ()

1: 190

1: 21-32
1: 299-305
1: 33-41
-- -- 1: 36--37
11: 296--297

-- 1: 24
-- 1: 28--29
- ,
- 1: 24
- 1: 24, 28
-- 1: 24,28
-- pl 1: 22--23

1: 112
- 1: 99, 165
1: 238, 245
1: 9,
1: 181
I 11: 212, 213

-, 1: 354-355
-- 1: 354
- 1: 28, 340; 11: 27, 28, 31
--- 1: 343, 344, 358

1. 325. 326

1: 358, 360, 363, 364,

365
1: 151

1: 317, 318. 322, 333. 337,

341

217, 218

---

387

1: 355

- (-, )

345, 346, 354, 355


2--6-0 11: 6
() 1: 67; 11: 291, 293
1: 124, 207
6- 11: 6
1: 146
-- 1: 210, 211
1: 307
- , 11: 369, 382
11: 298
-- , 11: 369
- 1: 306, 307, 309-311, 315
- 1: 309-310
-- 1: 310-311
1: 309. 310
1: 307

1: 28,

1: 142

11: 155-156. 216, 217


: 105, 107
() 11: 252
-- 11: 244, 245
11: 321
11: 121, 244, 310-311
-- 11: 310-311
-- -- - 11: 31
- -- - - 11: 310-311
- - -- - 11: 310
- 11: 357
11: 329--330
11: 96
- 11: 97
, 1: 132
1: 126, 161
11: 121, 296--297, 321, 324
,- , 11: 382
11: 317, 318

-- 111 11: 326, 330


1: 258, 259, 261, 262, 279
1: 261, 262, 264, 266, 267, 284. 285
- 8-100 (-8-1), 1: 280
- 1: 260, 261, 262. 266, 285
- -II 1: 263
- D 1: 264, 281
- (-) 1: 259, 260, 261, 262, 265, 266, 286
-- - 1: 261, 262, 264, 265, 286
() 1: 258-259, 260, 262
1: 65, 121
11: 13
1: 153,238,239,240,241,243,244; 11:
275, 278
1: 102, 103, 314, 315, 316
1: 26, 296, 299, 304, 320-321, 347; 11: 298
- 1: 304
- 1: 347
- 1: 347
1: 314, 316, 317
1: 313, 314, 315
1: 315-316, 317

388
- 1: 314, 315
, 1: 347
() 1: 254, 255; 11: 315, 316
{: 184, 185
- J'1 1: 175
11: 29
( ) 1: 205, 207;

, 1: 64
-- 1: 123, 227, 228, 229. 230, 231
-- () 1: 116, 198, 225. 226, 228.

249, 268, 269


1: 136
-- 1: 337,

11: 275, 278,

280, 382
1: 25, 299, 301, 318, 319
1: 310, 319
1: 301
1: 25, 178, 179. 296, 299, 301, 318, 319
- () 1: 103, 106, 108~:
25, 26, 28
1: 204, 238, 242, 243, 244
- 11: 81
1: 285
1: 283, 284
1: 132
1: 50; 11: 335, 337, 338, 340
K+- 11: 287
Na+/K+- 1: 144; 11: 141
Na+/K+- 11: 191
- 1: 133. 135. 136, 272
- 1: 180,215,217,235,236,271
1: 268, 326
2- 11: 353
1: 235, 236, 328
N- (GaINAc) 1: 150; 11: 301, 303, 310
J3-D- 11: 316
1: 150
N--- 1: 304
N- (GlcNAc) 1: 150,210; 11: 301,302,304,
306. 307, 308
-N- 11: 315, 316, 317
N--
(GlcNAc) 11: 305, 306
N--6-, 11:
315, 316
N-- (GlcNAc-
) 11: 307. 308, 309
N- (NeuAc) 1: 150, 210, 211,

253; 11: 30]. 302, 303, 304


N- 1: 351
11: 156, 159, 338
lI 11:
- 1: 172, 178. 179. 180.

338
186,215,233, 235,

~28.

335,

340
1: 172-180
1\1 1: 274
1: 327-335
1: 175
-- 1:227
-- 1: 215, 235, 270; 11:

1: 231, 232
1: 288
1: 289, 290, 291, 292, 296, 328.
- 1: 290, 292
- 1: 233, 234
- 1: 290, 291, 292, 297, 318
-- 1:291
1: 289, 292: 11: 382
1: 289
1: 229

261

339

1: 151
1: 247-251
1: 247-251

l--3-- 1: 248,
l-- 1: 248
()-- 1: 233, 234

1: 250

249

341

--- ( )
1: 119, 120-121
- . 1:
1: 181

1: 280

173

11: 297, 298


() 11: 113-118
- -

11:

114, 116-117
,

1: 131
11: 184, 212
1: 42--51. 109.232;11: 152. 154, 163, 164, 167,232,276-277, 284, 287, 291, 292
- 11: 319
- 1: 52. 53, 54, 55, 58
- 1: 43
- 1: 48
- 1: 44
- 11: 64
- 1: 42-43
- 1: 109
- 11: 131-132
- - 11: 132
- 11: 334-336, 340
- () 1: 47
- 1: 306
- 1: 50-51
- 11: 319-325
- 11: 46-47
- 11: 105
.
- 1: 42
- G- 11: 162-163
- 11: 332-350
- - 1: 45-46
- 1: 47, 48, 49-50
- - 1: 47,48-49
- - 1: 47, 48, 49-50
- - 1: 47, 50-51
- 1: 47
- . 11: 377, 382
- 11: 152
- 11: 64
- 11: 277
- (-) 11: 112
- 11: 178
- () 1: 231-232. 234
- - (FeS) 1: 128, 129
- () 11: 163
- - 11: 210
- 1: 281
- 11: 276-277
- D- : 200
- 1: 100; 11: 94-107
- - 11: 94-107
- - 11: 105. 107
- - 11: 102, 103
- - 11: 105, 106
- - 11: 102, 104
- - 1: 275
- - 11: 261
- cro (ro-) 11: 115, 116, 118
- 11: 115. 116, 118
Z- 1: 225. 260
11: 353, 355, 356
1: 267, 289. 294; 11: 239-240


, -

11: 370, 382


I- 1: 366, 367
1: 367
, 1: 367
-- 1: 368-369
- .

1: 369
1: 367
1: 367-368
, 11: 37], 382
1: 367, 368, 369
- [: 371
1: 196, 198. 199, 231; 11: 275, 279, 282
1: 198, 199
1: 111-117
1,3- 1: 114, 115, 116, 183, 184. 185, 186,
2,3- () 1: 59-60, 185, 186
1: 185
2,3- 1: 185
11: 43
11: 183, 219
- 1: 195
- 11: 329
-- 1: 345, 347; 11: 285
- 1: 285
- 1: 370
- 1: 194-195; 11: 30, 31
-- 1: 247, 254
-- 1I: 156, 192
-- 1: 340, 341
1: 255
- 1I: 316
-- I- 11: 309
- 1: 195
-- 1: 254
- 1: 242
- - 1: 254
- 1: 195
- 1: 229. 231
- [: 283, 284; 11: 27, 282
- , 1: 285
- 1: 195
- ~ 1: 247, 254; 11: 316
- 1: 254
-- 1: 254
- 1: 195
- 1: 335, 346; 11: 274, 282, 297
- 1: 229
11: 270, 272
[: 35; 11: 213
, 1: 181
- 11: 297-298
- 1: 235

---

8 ()

197

11: 170. 171,


174, 268, 269, 270. 271
[: 220, 249, 269, 270; 11: 159, 162, 183, 184. 257
[: 25. 28, 33, 296, 299, 311, 335, 338, 340, 341; 11: 277
- 1: 305
- 1: 335, 338 -339
1: 139
() 11: 224
11: 42-43
- 11: 43, 44, 51
11: 346
11: 357
11: 356
- , 11: 357, 358
- - 11: 357
- SV 4011: 356

389

- 11: 123
11: 356-358
11: 280, 281
- 2 11: 275, 279
- 6 1: 334; 11: 275, 279, 282

- '2 1: 198. 339, 341, 342; 11: 275, 279. 280. 282
- -- 11: 280
- D 11: 194, 199, 200, 201. 203, 280. 281
- 2 11: 281
- D 11: 281
- 1: 126, 161, 267; 11: 281
- 11: 280, 281
- , 11: 281
-- 2 11: 281
1: 267; 11: 275, 278 - 280, 281
- 11: 275. 278. 279-280
- 1: 66; 11: 278. 279
- 11: 275. 278. 280, 281
- 11: 282
1I: 128
- 11: J 28
1: 44
() 11: 278, 291
- -- -- [1: 278
1: 151
1: 210
1: 142, 150,205,209,210,211,259;
- 1: 205, 209-211, 221
- 1: 209
1: 146
1: 210-211
() 1: 144
() 11: 302

-()
-:113

---

11: 291. 294, 301

1: 100: 11: 315. 316

11: 111
1: 254

11: 302
1: 157-158, 252, 253, 254
-I-- [: 209
1: 209
11: 177
1: 254
1: 158, 253; 11: 129, 316
11: 267, 268, 269, 270, 272, 293
11: 272
-- () 11: 272
11: 295
1: 153
1: 254
1: 199--204, 233
1: 140, 150, 205
1: 64, 69, 115, 182, 183, 185, 189, 197,

207, 209,
215, 222
1: 52, 53, 54, 55. 58, 356, 366
- , 1: 360, 361
- - [: 360, 363, 364
- [: 366-368
- 1: 343, 360. 361
1: 361, 362
1: 366
1: 123, 124
() [: 52, 55-62. 185,356,366; 11: 71,98.99, 100
- 1: 60
-- 1: 57
- 1: 60
-- S 1: 60-- 61
- 1: 366
[: 123
11: 329

390
Il: 325
11: 328, 329
1: 285
(). 11: 361, 362
- - 11: 120-121
- ( L V ) 11: 324
- - 11: 47, 48
- , 11: 98, 99
- 11: 100. 1 1

1: 124
1: 39
1: 302,
- 1: 304

303, 304

3--3-- (-)

1: 274, 275,

276, 290, 291, 292, 338, 339


3--3--- (--)

1: 290, 292
--
( --.) 1: 103, 108, 275, 278, 283; 11: 261, 309
-- (--)

11: 121
11: 111
1: 275, 290, 291
11: 252, 253
5- 11: 6
(C L ) 11: 324
1: 245
11: 111
4- 11: 13
11: 36
1: 25, 296, 299, 301-303, 308, 327
11: 72
- 1: 303
() 11: 324
- 1: 327
, 11: 114, 115
1: 327
(J) 11: 324
15-- 1: 245
11: 36, 160
3-- (3--) 11: 209, 229
11: 40
17-- (I7P-OH-Cr) 11: 229
- - 11: 40
5- 1: 350, 351
11: 124
5- 1: 349, 350
, 11: 46
5-- 1: 350
11: 310
n- 1: 328, 329
- 11: 262
n- 1: 328
- 11: 111
7- 1: 282
- 11: 109-126
, 1: 64
, 11: 37
, 11: 114, 115, 116
1: 21
- gag, 11: 357
- 1: 102
- , 11: 359, 360, 361
1: 120, 123-124
- src, 11: 357, 358, 362, 363, 364 1: 44
11: 73
11: 282
11: 94-107
1: 286
1: 315, 333
11: 46
: 35
1: 316, 321
- 11: 72-73
1: 369-372
11: 67, 68-69, 70
1: 212, 223, 224; 11: 254
- , 11: 68-70
1: 289
11: 41-43
1: 333
11: 311, 312, 314, 316, 317
1: 285-286
1: 150, 263; 11: 311, 312, 313-314, 316, 317
, 1: 322- 111 11: 330
323
- 11: 317
11: 197, 199
11: 316
11: 219-220
1: 140
1: 319
1: 140-141
11: 156, 192
1: 113
- 11: 276
11: 67
1: 286
- 11: 67
11: 29-31
- 11: 67
1: 330
11: 311, 316
1: 283, 285
1: 146, 149, 150,210; 11: 311, 312, 316 - 1: 285
11: 36, 43, 51
1: 285
11: 176
11: 325
1: 232, 233, 236
1: 194, 207, 212, 223, 224, 294
3- 1: 334, 335
11: 243, 244
3- - 1: 124
11: 6, 11, 15, 16, 21, 22, 24, 80
3- 1: 334
- - 11: 21,
11: 193, 347
22, 30
3--- 1: 227, 228
1: 185
( - )-3- 1: 289, 290, 291, 292, 293
1: 353
D( - )-3- 1: 289, 290, 291
11: 198-199
- 1: 338, 339, 340
1: 284, 285; 11: 191
3- 1: 334, 335
- 11: 276
18- 11: 208, 220
11: 29, 30, 31
21- 11: 208, 220
1: 270; 11: 170, 172-185, 383
7- 1: 281, 282, 283
, 1: 343, 344
17- 11: 229
1: 346
llP- 11: 208, 220
1: 103, 321

1: 26, 81, 296, 299, 305,


1: 305
1: 321-322
1: 346

321-322, 346; 11: 277. 298

- 1: 270
-3- 1: 248, 249
-3- 1: 123, 136, 197,

1: 321

. 11: 309

11: 307--309
11: 308, 311
1: 224
1: 150
11: 299
1: 114, 130, 166, 181--188, 200, 202, 203, 214. 215.
216, 217, 219; 11: 340. 341
-- 1: 181
- 1: 181
-- 1: 182-185
- u 1: 214-219
1: 151, 157--158, 209, 252-255
1: 200, 201

11: 304
1: 150, 209. 210, 211; 11: 299-310, 314, 315.

320
, 11: 307-309
11: 314. 316
11: 366
11: 303
, 11: 300
, 11: 300
11: 305
N- 11: 304-307
- 11: 303-304
11: 299, 300
1: 151, 157-158,211,247,252-255;

---

11:

129

11: 366
1: 150

1: 282
11: 272-273
D- 1: 142. 145, 207

-3-

199, 248.

249

183, 192, 196, 197, 208, 210, 215,


287, 294, 296, 318; 11: 292, 293, 340
- , 1: 190--191
- 1: 189-195
- - 1: 219-220
1: 168, 189-191. 190, 192, 215, 220
1: 194-195
1: 168, 190. 191. 192. 193, 219-220
1: 189, 190. 191. 192-194, 198, 214, 215.
216, 219; 11: 261
1: 192
- 11: 340-341
1: 149, 211; 11: 299. 311. 312, 317. 318
- 11: 312
- , 11: 317-318
11: 302
1: 143-144
- 1: 144

11:

290, 296

() 1: 42; 11: 36
- 11: 64--65
- 11: 65-66
- 11: 65-66
- 11: 65-66
11: 78
1: 148, 149, 181,

-- -

269, 295, 297, 298; 11: 290, 293, 296


1: 197, 198, 247, 248, 268
-3- 1: 114, 197, 198,249.269,295,296.297;

391

1: 282

1: 182, 183, 184. 197, 199,201,202,

203
- 1: 137
-3- 1: 183,184.207,235
1: 151, 196. 197, 198-199. 247, 248, 261, 262, 263.

1: 251
1: 136. 137
1: 151, 250
- 1: 251
I:25,296,299,301,302,311,322-323.326,343--344,

354
1: 301, 302
1: 343-346
1: 322, 323, 326
11: 17
-

--

()

11: 17

11: 17

, 1:
1: 322, 323
1: 322
1: 366
() 1: 42, 43; 11: 319, 320
1: 178. 179. 296. 299. 300. 301,

343

304, 308, 309, 310.


311. 318, 319
L- 1: 300. 303. 307, 308, 319. 321. 332. 333. 354. 355
1: 300, 309, 315
L- 1: 308 .. 309
L- 1: 354, 355
- 1: 308
- 1: 321
1: 26, 299, 300, 31(). ~H 1, 319; 11: 25. 26. 341
1: 310, 319
1: 26
1: 65, 300, 310. 311
1: 35, 352
-- 11: 254
1: 124, 162, 204
1: 204
1: 192, 193,217,223,270,271; 11: 148, 159, 162,247,
250, 263, 264-265, 272
- 11: 263
-- 11: 264
-- 1: 192-193
- 1: 223
- 1: 288
-- 1: 102
-- 11: 264-265
1: 190, 191
1: 140, 181, 182, 184, 186, 187, 188, 189, 190, 196, 197,
198, 199, 205, 210, 211, 259, 268-269. 290, 292. 294,
296, 297, 298; 11: 291, 294. 295, 297
- 11: 294--295
- . 11: 374,
382
- 1: 189--190
- 1: 287
- 1: 205, 207, 221, 268-269
- 1: 142, 143
-- 1: 223
- 1: 222
- 1: 179, 180
- 1: 141
- 1: 224, 286
-- 11: 142-143, 295
1: 146, 210, 211
1: 146
1: 144; 11: 294
1: 189

392

1: 157, 252, 253, 254


- 1: 221, 222. 312; 11: 341
-l,6- 1: 115, 189
- 1: 297
1: 121
-l- 1: 114, 189. 191, 192, 206
-6- 1: 114, 115, 182, 183. 189, 197, 200,

178. 232, 238, 239

203.
206, 208, 210. 215, 222, 235, 269. 295, 297
-6- 1: 71, 190, 191, 197, 198,209,214,215.
216. 217, 218, 219, 220, 221; 11: 30, 31
-6- 1: 103, 200, 201, 202, 203,
204, 215, 271
1: 223-224, 255
1: 182. 183, 185. 189. 197, 208, 215. 222
11: 214-218
- - 11: 216-218
- -- - 11: 215
- -- )) 11: 216, 221
- - 11: 217-218
11: 216-217
1: 215. 223. 270, 271; 11: 124, 181, 205
- : 208
- 1: 102
1: 168. 175, 178, 179, 182, 196-199,215,216.
294. 296, 298, 312; 11: 214. 256-257
- , 1: 219
- 1: 298
- 1: 214, 215. 216, 217
1: 200, 201
. 11: 315
- 1: 368; 11: 316
1: 205; 11: 311
1: 222,229,237,240,242.260,267,278,289,297-298; 11: 275, 277, 341
1: 76. 98--99, 212; 11: 194-196, 199
11: 196
1: 327. 328
1: 124
1: 328
1: 346
, 11: 71
1: 140
1: 27, 303, 304. 335, 336
1: 27, 303, 304, 325, 335. 336
1: 325. 326; 11: 282
- ( ) 11: 170,
171, 172
-- (, ) 11:
170, 171, 179, 232, 238. 239
() 11: 149, 159,
170, 177, 178, 239, 240
11: 178--179
m .

--


()

11: 159. 170, 171, 183, 184-185


171.

--

11:
.
(, ) 11: 149, 159, 170,

--

11: 176--177. .
- () 1: 36, 270; 11: 148,

() 11: 148, 156, 159, 193, 194-199


() 11: 194, J95
- () 11: 171, 172. .
-- 11: 171. .
, 11: 173
(, ) 11: 179-180
() 11: 149, 159, 170, 177,

177,

178, 231, 232, 233. 238, 239


159, 162, 170, 180, 183

--

- , 11: 159
- () 11: 160
u2 - 11: 161
-- - 11: 161
- 11: 158, 161
- 11: 148-149
-- 11: 170- -172
- 11: 172-183
- 11: 177-180
- 1, 11: 159- 166
- - 11 (), 11: 161-169
-- : 158-169
- - 11: 267-273
- - - 11: 269-271
- 11: 158-159
- 11: 205-220
- 11: 221-227
- 11: 247-266
- 11: 228-246
- 11: 193-204
- - 11: 149-150
- 11: 149. 150-157
- () 1: 270, 271; 11: 172, 173-176
- - 11:

174, 175
- 11: 228-235
- - 11: 228-230
- 11: 205-220
- 11: 160
-- 1: 223, 270, 271; 11: 186-192
- - - 11: 190- -191
- 11: 147
- - 11: 147
- 11: 235-244
- - 11: 243-244
- - ll: 238-243
S 1: 35
11: 16, 24
11: 11. 166
11: 6, 7, 15. 16. 21. 22, 35; 11: 73
11: 7, 8, 9, 11, 16. 21
(GDP) 11: 301
(GMP) 11: 19, 20, 21, 22, 23
- IC ( GMP) 11: 5, 11, 166
(GTP) 1: 117, 178, 196; 11: 345
- - -2 11: 102. 103
G, 11: 163
- 1: 191, 195
L- 1:

120

1: 68
18-,

ND- 1: 123,
1:

11: 220
128
121, 123

1: 119, 120-121

ND- 1:

1: 121

1: 128
121, 127, 130
1: 121

ND-
7-, 11: 281
() 11: 205, 207, 208.
1: 178
- 1: 308-309
11: 53
2'- (dAMP) 11: 8
5'- 1: 341, 342
11: 53
2' - (dAMP) 11: 8, 9
S 1: 60-61
11: 53

209, 229


II: 53
ll- (
l1- ()
1: 144

S) 11: 207, 209, 210


11: 207

() 11: 92, 290, 293



1: 144
1: 282, 283
11: 53
11: 27
11: 27
11: 53
11: 187
11: 297
- Q- 1: 341
1:
- - 1: 186
11: 207
1: 140, 149
1: 48

11: 73, 74

177

11: 56
Il: 344
1: 100-101
11: 311, 312, 314, 316
~ 1: 250
~ - 1: 239, 240
~- 1: 240. 241
1: 240
11: 153, 198
11: 346
1: 275, 277
1: 324

11: 156,
185
- - - 11: 185
- ': 166,212,224,229,256,260,265,272,284,285.
286, 294: 11: 254, 263, 278
- - 1 11: 263
- - - - 11 () 1: 286; 11: 156, 263
- - 1: 207
- - - 1: 207, 208
1: 207
11: 20
() 1: 155, 250, 271; 11: 168
1,2- 1: 249, 266; 11: 290, 293
- 1: 248, 249
1: 271
1,2- () 1: 248, 249
1: 140, 145
- 1: 201
I: 182, 183, 197, 199,207,248,249,
250
- 1: 248
5,6- 1: 352
3,4- () 1: 27, 352, 353; 11: 222,
223
1,25- 11: 149
1: 123, 186
!1 1: 186
() 1: 103; 11: 25, 26, 32
11: 25
() : 26
() 11: 229, 231, 232, 233, 234, 235,
245
() 11: 28, 62
1: 136
~ 1: 153
~ -ll-~4_u--- 1: 230, 231
() 11: 186, 187, 189
1: 132
: 6

393

3,3- 1: 275, 276


11: 345
1: 132
1: 132
1: 124
l1 1: 156
: 291, 294
1: 140, 146, 147
- 1: 147
11: 295
1: 285
11: 244
1: 285- 286
1: 44
1: 156, 249
11: 107
1: 348
11: 139, 140-141
- 11: 138
, 11: 80
- 11: 80
- 11: 57
- 11: 113. 114
- 11: 56
- 11: 56
- u : 79 - 81
- , 11: 48
- 11: 56
- 11: 70
- - - 11: 70

II: 79, 80

11: 40--41
() 11: 54, 82
11: 37, 38, 39, 40, 51
11: 73, 75
11: 50
11: 55
1: 100
11: 69
1: 64-81
11: 35-36
II: 355

() 1: 74; 11: 50
11: 79. 81
() 11: 69, 70
- IJ: 69
- 11: 85, 86
)

11: 72

11: 35-52

11: 57
11: 64, 73-81

I1: 57-58
11: 75. 76
11: 39
' 11: 356
11: 43- 44. 45
- - 11: 44, 45
- - 11: 44
, 11: 73, 74
- 11: 75
- 11: 78-79
- 11: 76
- S- 11: 78, 79
11: 54. 56
11: 57, 78
: 57, 77, 78
11: 72
11: 37, 38, 39, 40. 52

.,

11: 113

394

- - 11: 114
- - 11: 114
- - (OR) 11: 114, 115
- - () 11: 115, 116, 117
5'- 11: 36
- 11: 55
- 11: 53, 55, 57
Z-ll: 54, 55, 56
11: 73, 75
11: 57-58
11: 39--40, 41, 52
11: 53-54
11: 80
11: 36, 359, 360
11: 64, 69
1 11: 67
- 1: 74
- () 11: 359
- , 11: 70, 359,
360
- 11: 75, 77, 80
- - 11: 60, 78
- 1 11: 73
- (POL ) 11: 76
- 11: 77, 78
1: 155, 160, 276, 278; 11: 305, 306
- 1: 276
11: 305
---, 11: 311
(Oo1-) 11: 305, 306
- () 1: 353; 11: 223
1: 353; 11: 171, 174, 181, 221, 222, 223, 225
-- () 11: 223, 224, 225
-- 1: 353
, 1: 181
1: 119, 121, 123, 127-132, 133, 134, 135,
139, 174, 186, 187, 188, 227, 228
1: 112, 131, 132, 136, 221, 272
--- 1: 227. 228
1: 232,
1: 183, 185

233

1: 121, 123, 128


, 11: 374, 382
1: 128
11: 285
) 1: 356
) 11: 292
) 1: 369
- 1: 369, 372
- 1: 371-372
- 1: 372
- 1: 370, 371
- 1: 370
) 11: 286, 292, 383
- 11: 292
)- , 11: 267-273
- - 11: 274-298
) ()) 11:

267. 268, 269, 271


) , 11: 288
1: 280, 281-283; 11: 288
- 1: 281-283
- - 1: 283
- - 1: 281, 283
1: 366--372
- 1: 366--368
1: 281, 284, 285: 11: 288, 293
) , 11: 293
1: 281, 283, 286, 367, 368, 371; 11: 287-289

)() 1: 151, 256, 266, 267, 287, 288, 294, 295, 297, 318
1: 268, 270
1: 294-296
) 1: 151-155, 215, 225-237, 252, 260, 262,

263, 265, 267, 294, 295, 296


1: 225-226

() 1:

225, 226, 229, 256, 257, 258,259260,265,266,267,268,269,287,288,289,291,292,293,


294, 297, 298
- - - - 1: 292, 293
- - - 1: 292, 293
- - 1: 231-234
- - 1: 179, 180, 231-236, 265
- - - 1: 287-289
) 1: 271.292,293,295,297,298; 11: 149,162, 175,
220
- - , 1: 272
- - 1: 268-270, 294. 295
1: 93; 11: 289
1: 275, 277
11:

254,

1: 233, 235

1: 294
1: 152, 153
1: 152
- 1: 239-240
1: 152
1: 152
- 1: 231--237
() 1: 238,241-242, 244-245
1: 152-154, 230, 231, 238-242
- 1: 238-240
- 1: 230, 231
- u-- 1: 154, 242
1: 151-152
1:218, 225-231
- 1: 225-237
- 1: 289-294
- (- 1: 229
- 1: 226--229, 230, 231, 269
1: 152
1: 152
- 1: 231
- 1: 240
- 1: 284
- () 11: 278
1: 232, 233, 234
1: 152

43

11: 325
: 315, 316
-L- : 315, 316
1: 341
-- 1:341
1: 25, 296, 299, 305, 311, 335,
- 1: 305
- 1: 335, 337, 339-341
- 11: 277
11: 291, 294
1: 142
() 1: 64; : 290
u-- 1: 64

~S.4-

337, 339, 340

11: 209, 229

1: 154
- 1: 141-142
1: 276
() 1: 71-72
1: 174, 175, 235
1: 174, 175, 177, 233,
- ND- 1: 221

235, 236

4--5- 1: 321
1: 321
1: 321. 322
1: 26
:

324
11: 324
(IgG) -
11: 121-123. 320. 321-325
- 11: 321
- 11: 322. 323
- () 11: 321. 322, 323
- - 11: 323
- - () 11: 321, 322
- 11: 122-123
- 11: 322, 323
- ( 11: 121, 321, 322. 323, 324
- - () 11: 121-122. 321, 322, 324
11: 29, 30. 31
1: 258
I- 11: 17
1: 100
,
- 1: 107
1: 105
1: 105

11: 192

1: 107-108

1: 104-106. 107, 108. 11


1: 105
() 1: 105
-I 1: 192, 193. 194
11: 105, 107
11: 298
-3- 1: 350
-5.6- 1: 352
11: 113
1: 100
11: 355-356
11: 15. 16. 22
(IMP) 11: 17, 19. 21, 22, 23, 342
(l) 1: 196
11: 145
1: 49, 193, 194,215.222-223,269.270,271,272; 11:
148, 156, 247-263
- 11: 249-253
- 11: 262
- 1: 294
- 11: 256--257
- 11: 249
- 11: 256
- 11: 254
- - 11: 257
- 11: 259-262
- 11: 251
- u 11: 253-254
- 11: 249, 250, 25 J
- 1: 288
- 11: 248-249
- - 11: 250
- 11: 262
- 11: 256
- - 11: 261
- 11: 248-249
- , 11: 252, 253
11: 255, 257, 258
11: 259, 263. 264
() 11: 154. 159. 168.
170, 174
- - - 1 (-l) 11: 174, 175, 263, 264
- - - 2 (-2) 11: 175, 263, 264
- 11: 254
() 1: 38; 11: 36. 37, 51, 52, 69-70, 88, 94
-

395

1: 149
. 11: 285
, 11: 187-189
1: 139; 11: 139
1: 348; 11: 298
11: 283, 377, 382
11: 328
1: 192, 193, 220; 11: 165, 167, 335, 338, 339,345
11: 338
11: 166--168, 193-204. 283, 289, 293, 371. 382
- 11: 194-196, 199
- 11: 166, 167
- 11: 167-168
- 11: 166--167
- 11: 193-204
- () 11: 193, 202
() 11: 159, 161, 193. 197, 203-204
- 11: 352
- II: 203-204
- 11: 203
11: 193, 194, 195. 199-202
- 11: 200-201
- 11: 201-203
- 11: 201
11: 193

11: 353, 355-356


11: 353, 354. 355

11: 26
1: 114. 313. 314. 315; II: 25, 26
1: 313, 314, 315; 11: 25, 26, 28
1: 57, 59; 11: 286
1: 132
1: 67; 11: 289, 293
1: 146
1: 156, 248, 249
- 1: 136
11: 69
11: 175, 176
1: 226, 227, 229
- 1: 226
-- 1: 226
- 1: 226. 229, 293
1: 345-346
, 1: 346
- 11: 281
- , 11: 382
1: 350
1: 214
11: 112
1: 112
- 1: 99, 165
1: 120. 124, 308. 309. 357
, 1: 95-97, 104
- 1: 95
- -) 1: 94-95
- 1: 95
1: 63
- 1: 77
1: 104, 107
- - - 1: 79-80
- - - - -) 1: 79
11: 197
- D 11: 197
1: 145, 219-220, 271; 11: 147, 148
- 11: 222-223
- 11: 225-227
- 11: 223-224
-- () 11: 224. 225
1: 120
- 11: 236

396
1: 300
1: 300, 307; 11: 274, 277,
() 11: 312, 313. 316,
11: 346
1: 289
1: 232, 233
3- 1: 232, 233, 234
3-II- 1: 233, 234
3--- 1: 236
3--- 1: 236

295
317

- 1:
1: 171,

335, 336
274. 289-294. 298
- 1: 292-294
- 1: 174, 175, 178, 179, 235. 296, 300, 311, 318,
319. 332, 333, 355
- 1: 174, 175
() 1: 140. 145, 194, 229. 267, 289. 290. 292, 293, 294
1: 203
1: 289, 292
1: 151,171,215.289,290,291,293,294,297,
298
1: 289, 341
- 1: 341
3- 1: 252
3-- 1: 252
3- 1: 227. 228
1: 156. 157, 249
() 1: 192, 193, 194
- 1: 278
- 1: 192, 193. 194; 11: 261
- - + / 1: 193
, 1: 91-92
11: 345
11: 328, 329
J: 334
1: 334
- 1: 333
- 1: 334
, 11: 275
11: 144
(), 11: 127-128
- 11: 128
- 11: 228, 232
- 11: 178, 228, 232
11: 342-347
1: 2-29, 285, 337
1: 339; 11: 275, 279
. 11: 285
1: 214, 217-218
, 1: 65, 78
- - 1: 78-79
() 11: 94 -96, 97, 98, 118, 119
- II: 102
- 11: 96, 97
11: 289
1: 302, 303, 304; 11: 105
- :I 11: 317
- 11: 347-349
- 11: 347, 349
, IV, 11: 366
11:347, 349
11: 350
1: 275, 284
, 1:
103
, 1: 232,
233, 234
,
1: 103-104
- -- 1: 9~97

( ) 1: 150;
11: 146
1: 83--84
1l- 1: 242

11: 302, 303

': 1: 238
() 1: 359, 360. 361, 362
- 1: 359, 360, 363,
1: 357, 362
: 1: 364. 365
() 1: 160. 28 J
1: 270; 11: 205

365

11: 205-220
1I: 207-210
11: 205
1: 101
11: 171, 205, 207
- , 11: 383
- : 211
( ) 11: 207
- ()

11: 210, 230,

237
11: 205, 207, 208
-- (, )

11: 159, 161, 170, 171, 181


, 11: 40,
, : 193
1: 124
1: 270, 271; : 6, 7
() 1: 177, 215, 233
- - 1: 178

41

Q 1: 127, 128, 130

J: 65-66, 104
- 1: 65-66
- 1: 121-123
1: 146. 148, 149; 11: 289. 292, 293
1: 115, 116, 354
- 1: 344, 354
- , 1I: 373
1: 354
- .

11: 373,

382
1: 136
1: 113, 114, 354;
() 11:

11; 332. 340


340
11: 372-373, 382

11: 191
, 11: 319-325
- 11: 325-330
- -
- - 11: 328

JI: 327

11: 325.

328
11: 319
11:
- 11: 71
1: 338
11: 6. 15, 16, 21. 23. 24
1: 120
: 30, 31
() 1;

71

103, 120; 11: 16,

24.30
11: 30. 31
11: 30, 31
() : 19
1: 286
1: 334, 335
, 11: 354
11: 81
11: 274
1: 205, 206, 207
-5- 1: 200, 201, 203,

205, 206

11: 330

u- 1: 86--87, 89
11: 291. 294. 295
- 11: 295
1: 178, 181, 185. 196, 197, 198, 296
- . 11: 382
1: 186; 11: 282
() 1: 183, 185, 196, 324,
- , 11: 375.
- 1: 71-72
11: 172, 177
1: 140, 147, 209, 210; 11: 291, 294, 295
- (J- 11: 111
- 1: 209
1: 209, 210
11: 343, 344

1: 275. 277
1: 254
() 1: 153, 154, 238, 241, 242,
1: 25. 299, 305. 311, 327, 337, 338
- 1: 337. 338

1: 251, 264,

280, 281, 286


1:
() 1: 64; 11: 229
- 1: 64
I7_ 20- 11: 229, 231
1: 65; 11: 75
11: 39-40, 51
1: 152,
1: 304

286

11: 277

293

- 11: 360. 361


1: 230, 231,238.239,240,241.242;

11: 275.

278

- 1: 238, 239. 240, 241; 11:


1: 214
- ",- 1: 268, 269, 270
- 11: 289, 293
- - 1: 263
- 11: 286. 287. 292
11: 130-131
1: 151-164; 11: 382
- 11: 295-296

278

1: 167, 171, 263. 264, 287-297

1: 162-164
1: 151
1: 160-161
1: 267
11: 278
1: 256--259
1: 169
- 1: 256--272
1: 155
1: 168,170,215,231,235,236.268,269,271,287-

1: 287- 289

11: 291. 294


1: 195
1: 140. 147; 11: 294
11: 176
11: 142, 144, 145. 150. 259
11: 277
1: 185; 11: 285
- 11: 300
1: 274, 275. 276. 277
1: 276
1: 275, 284
1: 119. 120
- - , 11: 371. 382
- 11: 285
1: 351-353
- 1: 351-352
11: 183
1: 351
1: 351
1: 351, 353
, 1: 350. 351
(), 11: 139, 141- 142
- 11: 129-130
- 11: 131-132
- . II: 136, 137, 138
- - - 11: 136--137, 138
- - 11: 133-135
- 11: 133
- ,
11: 131
- - 1: 163, 164
- 11: 128-130
-

", 1: 172
11: 357

289

1: 257, 258,
259. 262. 264, 279- 280. 281, 284. 285, 286
- - - 1: 265, 279-280
- () 1: 171, 257, 258, 259.
260,261,262,263,264.265.266.267.269.279,280.281,
284. 285, 286
- () 1: 257. 259. 262,264. 280. 284
1: 163, 164; 11: 132, 133. 290
() 11: 159, 161, 170. 180
(J- (J-) 1: 35, 36; 11: 182
1: 267
1: 282, 283

1: 231, 232
(-)

1: 251

(, (J-)

1: 157, 251; 11: 290, 296


, [: 80-81

257,
281,

1: 182, 200; 11: 284


, 11: 375-376. 382
11: 280. 282. 283-284
1: 177
1: 175, 176, 197, 198, 235, 236
1: 71. 137, 175, 176, 177,235,236
1: 137
, u 1: 175
- 1: 231, 232, 233, 234, 235, 236, 237, 240. 241,

252

1: 26, 299. 305. 308, 327. 332-333;


1: 305
1: 332
1: 157, 251, 252, 264
11: 143

(. -) 1:
258, 259, 260. 261, 262, 263. 264 ~ 265, 266, 279,

284. 286

285, 295

243, 245-246

11: 277
- 11: 273
1: 150; 11: 302-303
1: 156. 249, 251
: ()

-- 1: 288
1: 288-289
1: 242, 243, 245
1: 161, 245
1: 170, 268, 269. 270
- 1: 271
- 1: 258
(J- 1: 258, 280. 285. 286
1: 170.259.261.262,263,270,285; 11: 317
- 1: 285
1: 151. 170, 244. 256, 260, 262, 263. 264, 266,

354, 355
382

397

398
-


11: 130-131
1: 132
- 1: 138-139
: 135-137
, : 127-146
: 134, 135
II: 139-140
- - II: 140

II: 140
11: 140
11: 140
11: 131

, 11: 281
: 242
: 238-239
11: 298
3- 1: 325
3--
6- 11: 12, 13, 20
() 11: 335, 336
- () 11: 335, 336

171
- -

11: 280, 282, 283-284.

285-286
11: 341
() 1: 52-55, 56, 356; II: 341
11: 334, 335, 338, 339, 340, 344
11: 334, 337
1: 156, 157; 11: 168
II: 20
11: 333
1: 195
- 11: 99-100
11: 344
1: 132-133,

1: 326

11: 335

1: 237, 239, 240


, -450 1: 124
11: 342, 344-345, 346
II: 342
11: 282, 285-286
11: 193
11: 205
- 11: 207-208

135, 136--139,

174, 241

1:

1: 168-171

1: 99

1: 165, 166, 212-214


- - 1: 168-171
- 1: 338, 340
II: 124
1: 96
1: 120, 128
: 298
II: 224
11: 365-366
1: 60
NS,N1- : 17, 19
- 11: 37
N--4- : 353
2--3- 1: 28
a-- 1: 340
a---- 1: 340
3- : 341
- 1: 275, 276
P-- 1: 338, 339
N 7 - 11: 6
NS,N1- 1: 322; 11: 19, 25
P-- 1: 337, 338, 339
1: 270, 271
1: 339, 341
- 1: 198, 335, 339, 340, 341, 342
-- 1: 198
-- 1: 339
-- 1: 198
1: 198, 342; : 282
1: 150
1: 349
5- : 6
- 11: 102, 103
1: 25, 267, 296, 299, 303, 305, 335, 336, 346, 349; 11:
10
- 1: 305
- 1: 335-336
- - 1: 335, 336
3--4- : 224
5--3- 1: 350, 351
5- 1: 350, 351
- 11: 273
: 325
11: 342, 343, 344

- 1:
1:
1: 121, 127, 131

136--139
174

, 1: 127-130
1: 138

uxu 1: 85-87
uu- 1:
- - - 1: 87-88
1: 163, 164; 11: 130, 133,
- 11: 290
, 1: 311-312
1: 121; : 285

85-88
288

II: 241
() 1: 119, 120,

136,350,351; 11: 224,

225

1: 155, 248; : 290, 291, 293, 295-296


- 1: 248, 249
- 1: 136
1: 152, 153
() 1: 27; 11: 186, 187, 189

1: 47

1: 124; 11: 354, 355


1: 140, 143; 11: 291, 295, 297
1: 152
11: 268, 269, 270, 272
1: 120; 11: 6, 15, 16, 24-25,

380-381

1: 307
11: 24

16

1: 306, 307, 309, 313-316; 11: 380


11: 311, 315, 316
11: 299, 311, 315, 316
1: 149; II: 299
1: 150
,

11: 355
11: 355
1: 142, 143
11: 70, 98-100
- :

11: 100

11: 361, 362


11: 98
II: 98

98-99

11: 98

II: 332-342
1: 311
11: 332, 337, 338, 339, 340
1: 189

399

11: 336--337

11: 332, 333, 334, 337,


- II: 333-334
11: 332, 337, 338
1: 181; 11: 332, 337, 340, 341
1: 181
1: 168
1: 181; 11: 333, 337, 338,

338, 339, 340

339

, 11: 221
11: 294
11: 283, 378, 382
11: 302
1: 150
11: 297
11: 147
11: 268, 269, 273
: 183
11: 346
11: 345
1: 285; 11: 298
11: 221
- - 1: 270--271; 11: 221
, 11: 142
1: 252
1: 284
1: 121, 177; 11: 275, 279, 282
1: 139
1: 66, 121; 11: 279
(NAD) 1:

121, 122, 123,


125, 177, 181, 215, 227, 228
- (NADH) 1: 124, 125, 176, 181,215
(NADP) 1: 121,
122, 125, 202, 233, 234, 235, 236, 249
- (NADPH) 1: 124, 125, 204, 231, 234, 236,
237, 239, 249
, -

1: 121, 123
1: 121, 271, 335; 11: 279
- 11: 51
1: 24, 28
n- 1: 91-92
- 11: 43, 51
Hohcehc-() 11: 95, 96, 98
1: 192,269,270,271,272,353; ll:

221, 222, 223,

225, 227, 382


11: 92-93

,
11: 291, 294
1: 117; 11:
1: 117;
11: 7, 8, 9, 13, 15, 16, 22
11: 66

: 66
11: 64, 65, 66
11: 15
11: 301-302

.JI

11: 53-63

20
11: 20

11: 63

11: 68

11: 276

1: 165-171
1: 284, 286; 11: 156, 274,
1: 118
- 1: 118-126

292

, 1: 293, 294
- 1: 118-119
1: 308-309
1: 172, 173, 175, 176, 178, 179, 196, 197, 235,

236, 293, 295, 296, 301, 318

1: 275, 277

1: 140

1: 153, 238, 239, 240


1: 47
1: 132
11: 291
-- 11: 305, 306, 307
- : 306, 307
1: 140; 11: 291, 294, 304, 308, 309, 310
- 11: 306-307
(v-onc) 11: 357, 359
- (-n) 11: 359
11: 357-363
- , 11: 359
- : 362, 363
- 11: 357-358
11: 112, 113, 114
11: 112, 113
1: 100
- (TRP), : 118
- - 11: 118-119
L- 11: 111-113
- 11: 111
11: 159, 161
1: 142
, (' 11: 365
- - - II: 365-366
- , 11: 352
, II: 365
11: 189
1: 27, 35, 296, 313, 320, 347, 349; 11: 298
-, 1: 347,349
- 1: 314, 315; 11: 32
- 11: 25, 27, 32, 33
(, ) 11: 25, 26, 27
(-), 11: 32, 33
11: 32, 33
11: 25, 26, 27, 32, 33
II: 184
11: 199, 203, 280
11: 216, 242, 274, 297
1: 238, 239
11: 247, 250, 265, 267, 268
1: 66, 177, 178, 232; 11: 275, 279
11: 267
(), 11: 196-197.
.
- - 11: 198

11: 5-14, 15, 17-22, 26-28

1: 174, 175
1: 185
1: 120, 124
() 1: 120, 124; 11: 354
- 1: 308-309
- 1: 227
1: 64, 67, 119
: -
1: 220

11: 197

11:
11: 272
1: 153
1: 132
1: 140

196, 197

1: 167, 199-204,205,206,214,215,
217, 235, 269, 270, 288
1: 205, 207
1: 140, 143, 150, 205
1: 64; 11: 287, 292
11: 287, 292
- 11: 250, 251, 252

400 .

[1: 102
n- 11: 102, 103, 104, 106
1: 43- -44
1: 33--41
- 1: 40-41
- 1: 34
- 1: 35-36
- 1: 34
- , 11: 181
1: 178, 307-308, 337
() 1: 120, 123-124. 242, 244
1: 124
1: 309
1: 219--220,260.261,262,264,265,289.290,295,297,

311; 11: 293


1: 189, 219

- 1: 266-267
-- . 1: 311
- 1: 262, 264
- 1: 289-290
- 1: 261, 262, 264, 265
- - 1: 207
- 1: 168
- 1: 294
- 1: 260
- 11: 293
1: 131
1: 260; 11: 144, 187
, 11: 279
1: 192. 252. 307, 333, 334
, 11: 279
, ll: 275, 279, 282
() 11: 5, 6, 15, 25-29, 31-33
- 11: 25--27
- - 11: 28
- 11: 27
- 11: 31-33
, 11: 15, 25-29,
31-33
1: 35
1: 35
1: 116-117, 189
1: 276
GIcNAc- 11: 305, 306
I: 116,178,179,180,181,183,185,186,187,196,197,
208,210,235,236,293,301.318,322,323,324,325,326,
327
- 1: 181-188
1: 179, 180, 187, 214, 215, 216, 217,
218, 219, 235, 270. 295, 326; 11: 261
- 1: 288
1: 186, 322
1: 178, 196, 197, 215, 218, 293
1: 183, 185, 197, 215, 216; 11: 261
11: 274-284
11: 15, 284-291, 292-294
- 11: 286-287
, 11: 275
, 11: 319-325
1: 157, 250
11: 40, 41, 51
11: 330
11: 330
, , 11: 383
() 11: 240
, [1: 247-266
- - 11: 247
- - : 289. 292
11: 244
- 11: 245-246
- 11: 244

1: 349

1: 347, 348, 349


- 1: 349, 350

11: 255

1: 152, 238, 241


(1 ) 11: 76
(1 ) 11: 76
() 11: 15, 291, 294
1: 208
() 1: 33, 34, 37-38; 11: 248, 263, 267, 269, 271
- 11: 254, 267, 268, 269, 271
- 1: 38
- 1: 38--39

1: 160
95, 105
149-150; 11: 311, 314

() 11:
1: 140, 146, 148,
11: 255
1: 120
1: 60

1: 152

11: 244-246
, 11: 228-246
- 11: 244
1: 362-365
- , 1: 363
1: 361
1: 356 -365; 11: 384
- 1: 357-360

1: 361


- 1: 365
- () 1: 363

1: 365
()

1: 365

1: 358. 359, 360, 363, 365


11:

11:
, 1: 311
11: 207
11: 207
11: 207

1: 364

277

11: 275

30

11: 207
11: 328, 329
u- 1: 276
-. 11: 90
11: 105
11: 359, 360
11: 207, 217, 229, 230, 235, 237, 239
- 11: 237
11: 235, 236, 237, 238
- 11: 237
1: 49; 11: 148
() 11: 354
11: 289, 293
11: 105, 348, 349
() : 159, 170, 171, 172, 176-177
11: 171, 172
1: 42
1: 303
1: 26, 296, 299, 301, 308, 319-320, 347
1: 320
11: 82, 83, 111, 112, 113, 123, 356, 359, 360
- 11: 359. 360
11: 355, 356
() 11: 160
() 11: 148. 170, 180, 18]
11: 189
- 1: 198,227,235, 296. 335, 336, 337. 340, 341
-- 1: 50, 198, 342
1: 342; 11: 282

401


()

1: 153,238,241,242,243,244,245,270;

11: 258, 278


--
1: 153, 242
1: 153

()

1: 242

, 11: 317, 318


cGMP- : 166
() 1: 194; 11: 163-164, 261
- cAMP- 1: 192, 193, 194,214,218,219,270,271;
: 163-164, 166, 261. 362

cAMP- 11: 163

11: 357, 358, 362, 363. 364

,- 1: 194, 214, 289; 11: 197


11: 339
-l 1: 192, 193, 194, 219, 220
1: 149. 209; II: 299, 311. 314. 316, 317, 318
- 11: 317
- - 11: 311
- N- 11: 311
- 11: 314
- 11: 311
- 11: 312
1: 102
1: 123
1: 47, 48. 72
- -
1: 134
, 1:

133-135

() 11: 259, 359, 360


111 1: 358
I 1: 359, 360
1: 360,
1: 365
11: 344
: 326
- 11: 327
1: 93-94. 102
11: 344
11: 105
- 11: 125
11: 289
( )

365

11: 145

-5- 1: 200. 201, 203; : 18


-5- 1: 200, 201.
() () 1: 47, 49, 81; 11:

203
93, 290, 293

1: 81

: 20, 26
11: 102, 103, 105
1: 66. 120, 123, 177; 11: 275, 279
1: 120
-5- 1: 200. 201. 203
-5--3- 1: 200, 201. 203
( ) 11: 58--63, 82-93
- I1: 59--60

11: 29
11: 9
11: 297

11: 16, 22, 30

11: 31

,
11: 6--7
- , 11: 15-25. 29-31
() 11: 5, 15, 17-24, 29-31, 35
- , 11: 22-24
- 11: 24
- 11: 29-31
- 1: 343; 11: 17-23
1: 266, 267; 11: 107
1: 347, 348. 349, 354; 11: 298

359. 360
- 11: 152
11: 225 -226
- 11: 149, 150-157
- - 11: 153-154
- - - Il: 153
- - - I1: 153. 198
- - 11: 152
- - 11: 151
- - 11: 154-157
- - : 151-152
- 11: 259, 260, 263, 264
- 11: 263

11: 243
11: ] 44

11: 156, 199

n 1: 105, 108, 110


1: 102
1: 250
: 70-71
: 212
11: 287, 292
,
1: 49
1: 101; 11: 112
- 1: 101
- 1: 101
- 1: 100 -101; 11: 28
L- : 112. 113
11: 36--39
, 11: 281
. , 11: 70.

11: 11, 72

1: 43

1: 102-

1: 39; : 366

~~

104

1: 112-113, 301
1: 112-113

11: 46, 51. 300


11: 352
: 156, 199, 203, 280
1: 142
- 1: 119-126
- 1: 212-213
- 1: 112-113
- - 1: 115
- , 1: 213-214

11: 64
N- 11: 59
11: 88-90, 120, 124, 125
- 11: 125
11: 82 - 93
- - 11: 82-85
- 11: 85-88
11: 36. 52
I1: 6(} -63
I1: 58-59
() 11: 62. 69, 89, 94
- - 11: 89, 90
() 11: 60-62. .

1'vf () :

36,37,41,43,59,61,90-91,94,97,

101. 103, 105


--

11:
11: 111, 112
11: 120, 125-126
1: 100
() 11: 59, 62, 91
- 11: 91
- 11: 96--98

126

402
-

1I: 100-101
' () 11: 59, 62--63, 91-92, 120
11: 78
- 11: 73, 74, 75
- - 11: 82, 83, 84, 85
- - : 112, 113, 115, 116
- 11 - : 68, 85, 86
- 111 - 11: 88
- - ,
11: 84
11: 240-241
1: 131

11: 333
11: 333, 338
11: 333
11: 338, 340
- 11: 43, 44, 45
1: 146
11: 302
11: 291, 294, 295
- 11: 295
.
1: 140, 147, 265; 11: 291, 294
1: 332, 333
, 11: 384
1: 177, 184, 187, 190
-7- 1: 201, 203
11: 267, 268, 269, 270, 293
-- () 11:

230, 231,
232, 237
1: 124; 11: 285
1: 25, 248, 249, 252, 296, 299, 301, 311, 323, 326, 346
- 1: 301, 303, 322
1: 103, 322, 323, 326
1: 349-350; 11: 273, 382
1: 60-62, 74; 11: 47,48,49,50
1: 69
11: 311
1: 150, 210, 211, 253, 259
1: 242
- - 1: 371-372
- 1: 156
- 11: 263
- 11: 219
- - I 11 1: 370
- 11: 182, 219
- - 11: 30, 31
- - 1: 195
- - II: 315, 316
- 11: 349, 350
- 11: 350
- 11: 315, 316
- 11: 274
- 1: 242; 11: 33
- - 1: 329
- 1: 244
- 11: 156, 235
- 11: 315, 316
- 11: 299, 315, 316
- 1: 231
- - 1: 242
- - 11: 179, 244
- - 11: 349, 350
()

11: 148
11: 315, 316-317

1: 231, 232, 234
, 11: 105, 107

11: 148

II: 102, 103


11: 105, 106
11: 102. 104


1: 160, 284
1: 274, 275, 277

11: 179

1: 276

1: 276
1. 275, 277
- 1: 46-47
1: 255
1: 42
, 11:
11: 284, 292
11: 171, 172, 174, 175

284, 286

()

11: 172, 177


11: 240
11: 171, 174
11: 159, 161,171,174,175,190,247,250,265
268
'
11: 173
, 1: 207-208
1: 208
1: 132
, 11: 232
- 11: 233
11: 228
11: 228
1: 346, 347, 348, 349
1: 346, 347, 348, 349
- 1: 45-46; 11: 336
1: 154-155
- 1: 140
n 11: 52, 70
- 11: 125
11: 206
1: 141, 159
-

()

11: 210-211
- 11:
- 11:

211-213
210

11: 231-232
1: 151, 158-160

11: 217
11: 216, 217
1: 281

11: 206- 207

1: 159
11: 129
11: 330
1: 144, 146
, 1: 84-85
1: 88, 89, 175, 343, 344, 355
- 1: 343, 344
1: 123, 136, 175,
1: 174, 175
- 1: 115, 175, 176, 178, 179,

176, 221
180, 197, 198, 291,

296, 318, 335


---- 1:
-- 1: 174
1: 204
(), 1: 255; : 316
() 1: 253
1: 158, 253
1: 326
1: 253, 254
1: 151
11: 254
1: 326
yn 1: 125, 126
- 1: 125

176, 291


[: 250
[: 252
1: 157, 252, 253
1: 254, 255
1: 237, 252, 254
- 1: 247, 252
1: 254
1: 157, 252, 257;
1: 151

11: 129

149, 170, 171,

179, ]86, 187, 190, 192,3/8-379,

1: 62, 74
- - 11: 48
1: 28, 282
1: 282
1: 282
11: 6
11: 6, 7
1: 270; 11: 6, 7
1: 272
1: 272
11: 276
11: 149, 178, 207, 210, 230, 231, 232, 236, 245
- 11: 228-229, 245-246
- 11: 231
- 11: 148, 178
j- 11: 234
-- 11: 230
1: 304, 353
1: 153
(, 4) 11: 186, 187, 190, 191
1: 140, 143
( .) 1: 66, 177, 186,200,204; 11: 275, 279, 282
1: 186, 200
- 1: 338, 340
() 11: 25, 26, 53
11: 25, 26
() 11: 9
11: 15, 27, 53
11: 27
() 11: 25, 26
11: 5, 6, 7, 27, 28, 35, 55, 56, 73
- 11: 80
6-1I 11: 12, 13
1: 228, 275, 277, 291
11: 189
11: 20
11: 20
11: 189
1: 176
1: 232, 233, 234
11: 149
- 11: 187
, 11: 187
- - 11: 191-192
- () 11: 149, 156, 159,

162
(lgO) 11: 192
11:
11: 189

1: 353
1: 328-329
-, 11: 107
--- 1: 328
11: 261
1: 328-329
1: 328
; (, TJ 1: 27, 223; 11:

204

11: 192
11: 187, 189
-- (, )

1: 35;
11: 159, 170, 171, 179-180
1: 25, 26, 296, 299, 327, 328, 352, 353-354; 11: 222,
298
- 1: 303, 304
- 11: 189
- 1: 327-328
- 1: 328
1: 120, 328, 352
- 11: 222

- () 11: ]90, 379


() 11: 190
1: 161-]62; 11: 281
11: 57, 77, 78
1: 201, 202, 203
() 1: 307, 308, 3]9, 321, 323, 324, 325; 11: 32
1: 232, 233, 234
1: 132
1: 200, 20], 203, 204
1: ] 77
11: 210
11: 83
11: 60, 78
- - 11: 357, 359
11: 52, 113, 114, 115, 118-120, 123
- 11: ] ]8-]20
- 11: 159-]60
- 11: 85, 95
- 11: 83
11: 360, 361
11: 52. 94. 95, 96. 101, 102, 119
- , 11: 126
11: 364
11: 143-145
- - 11: 138-139
11: 138
, 1: 267
( ) 11: 359
11: 139, 141-142
( ) 11: 359
() 1: 64; 11: 52, 354
- - 11: 310
- - 11: 31

11: 382
:
11: 357
11: 291, 294
1: 147; 11: 291, 294
1: 25, 296, 299, 305, 308,
1: 325, 326
1: 100

356, 357, 358

()

325, 326, 346; 11: 277

1: 155,244,248.249.256.260.261,262,
265, 266, 267, 268, 270, 271, 285, 291, 292, 293,295; 11:
290, 291, 296
- 1: 263, 285; 11: 290
- , 1: 248
- 1: 247
- 1: 270, 271, 292
- 1: 265-267, 293
- 1: 270, 271
1: 155, 379
1: 153
(]) 1: 27; 11: 149, 170, 171, 179, 186, 187, 189,
190, 191, ]91, 379
- - 11: 179, 190
- - 11: 191
1: 182
1: 140. 143
[: 207, 208
() 1: 33
1: 39, 82; 11: 289, 292, 335, 336
. 11: 289, 292

404

1: 26, 296, 299, 327, 333-335, 349-350; 11: 298


- 1: 349-351
L- m 1: 124
1: 102, 333
(L-) 1: 100,
102, 124, 333, 334, 357
1: 351, 352
1: 82; 11: 326-327
() 1: 153, 154, 238, 242, 243, 244
- () 1: 250
11: 326, 327
11: 333, 334, 337, 338, 344
II: 333, 334, 335, 337
- 1: 193
11: 335, 337
- 11: 345, 346
- 11: 345, 346
11: 309
1: 142, 144, 146; 11: 294
1: 127, 133, 160, 276,
- 1: 276

278

-I- 1: 359, 363


1: 358, 359, 360, 362
1: 357, 362

11: 187
11: 187
11: 144

( )

264

11: 80
,

1: 50
- 1: 256

11: 25, 29, 30


11: 5, 7, 9, 11, 27, 28, 32
-- 11: 80
- 11: 28
1: 307; 11: 17
(, UMP) 11: 25
11: 7, 8, 32
(UDP) 1: 189, 209
UD-N- 1: 210, 211
UD-N- 1: 210, 211
(UDPGal) 1: 189,209,210-211,

11: 364--365
11: 363-365
11: 364
11: 325, 329
- - ' XI 11: 317
11: 102, 104
1: 275, 276, 278
1: 26, 296, 299, 303, 304,327,329,

330-332; 11:

277
- 1: 330, 350
1: 303, 304
1: 331
1: 331
( ) 1: 39, 40
1: 74, 330, 350-351
1: 331
1: 331
-N- 11: 223
1: 120
1: 351, 352
11: 222, 227
1: 190, 191, 195
- 1: 234
- 1: 215, 233, 236
,

253; 11: 301, 302, 304

1:

213-214

1: 253
UD--4- 1: 209; 11: 302
(UD-, UDPGlc)

189, 190, 205, 206, ~09, 253; 11: 11, 301


UD- 1: 205, 206
)

11: 329

11: 280
11: 245
(-) 11: 363, 364, 365
- () 11: 257, 258, 358, 363, 364
- () 11: 257, 258
- () 11: 257, 358, 363, 364, 365
(R-) 11: 105
- 11: 102
- , , 11: 364
- - - 11: 364, 365
- - - - 11: 364
- - - - 11: 364
- - () 11: 170, 174, 175,258,263-

1: 140-150

11: 291, 294, 295


, 1: 169
1: 150
1: 166-167, 171
- 1: 212-224
11: 277-278
11: 299
1: 186-188
, 1: 57, 59
, -

UD-

11: 40, 41

1: 114.

(UDPGlc--

1: 189, 190, 205, 206, 209; 11: 302


UD- 1: 367, 368, 370
11: II
11: 1I
(UMP, ) 11: 9, 25,
26,33
(UTP) 1: 117, 189, 190, 205; 11: 12
- 11: 27
1: 119, 120; 11: 24
1: 307; 11: 17
() 1: 368, 369, 371, 372; 11: 384
1: 321; 11: 330
1: 205; 11: 311, 312, 314
- - 1: 205-207
- 1: 359, 363, 365
-III- 1: 359, 360, 363

- 1: 213
11: 131
- 1: 84, 96
- - 1: 87
, 1: 289
- 1: 215
- , 11: 265
- - - 11: 261, 265
- 1: 107, 214
- - 1: 107-108
- - 1: 108
- 1: 198, 199
- 1: 72-74
- 1: 71
- 1: 69-71
- 11: 357
- 1: 67--68
- - 1: 119-126
- 1: 88-90
- - 1: 88-89
- - 1: 89-90

405

: 355
1: 100
1: 95-97, 104
1:

63

6-

1: 94-95
1: 79--81
1: 76-90
1: 63-65
1: 108-110, 214, 217-218
1: 68-69
1: 103
1: 100
1: 84
1: 100
- 1: 10 I
1: 91-97
() 1: 105
1: 288
1: 90
1: 101-102
1: 109
1: 63-75
- 1: 136
1: 67
1: 100
11: 76-78
1: 78-79
1: 104, 214, 215
- .l 1: 106--107
[: 98 -110,
- 1: 104-108
- 1: 99-}02
- 1: 99

11: 36--39

1: 100-102

102-104

1: 242, 251
11: 357, 364
1:

1: 94

252
1: 308
1:

123, 129, 227

1: 28
, 11: 280
11: 275, 280, 282, 383
-
-5- 11: 17, 18
N- 1: 333, 334
N-- 11: 102
N- 1: 321

210

-- () 1:
197. 215; : 214, 262. 264, 265
, 11: 166, 168
() 1: 136, 251; 11: 289, 290, 291, 293.

178, 196.
295

1: 214, 217
1: 67 - 68
1: 66---67
1: 136
1: 50
1: 360, 364, 365
11: 342
11: 325, 326
11: 326
11: 320, 325-326
11: 330
1: 242
11: 349
, 11: 343
- 11: 342. 345-346
1I: 344
, : 281
1: 229
11: 296
(FAD) 1: 120, 121, 125, 177. 227
- 1: 123
(FMN) 1: 120, 123
() 1: 118, 123, 125, 128, 176, 186,227,228.229,

, : 258
1: 114, 115; 11: 340
(Pi) 1: 113, 184, 215
() 1I: 15, 166, 291, 294, 339, 376, 3~3
1: 248, 249, 293
1: 156
1: 156, 248, 249; 11: 357
1: 157, 248, 249
1: 156, 248, 249
1: 156, 157. 248, 249
1: 156
1: 116-117
1: 113, 114, 115, 173. 176. 184
3--5- () 1: 253
1: 182. 183, 203
1: 250
2- 1: 183. 185, 197, 208
3- 1: 116, 183, 185, 197
1: 183, 184
1: 183. 185
() 11: 128
1: 249
1: 189, 190, 191, 206, 209, 210
6- 1: 200, 201, 203
6- 1: 200, 201, 202, 203, 215
6- 1: 200, 201
() 1: 193. 194.270,271; 11: 10. 165,261,307
1: 114. 115, 178, 179. 183, 185, 196, 197,

11: 17

151. 156--157. 238. 241. 244. 248, 251, 252,


254. 256. 263. 265; 11: 128-129. 289. 293, 295
1: 276
4' - 1: 232, 234
11: 166
11: 164-165
1: 267; 11: 283, 376, 383
5'- 11: 17, 18
5--l- () : 17, 18,20,21.22,
23, 28, 30
.l-- : 17
() 1: 191, 192, 193, 209. 214, 216; 11: 261, 341
- 1: 192-193
- 1: 207, 214, 219
-- 1: 109-110
11: 340
- 1: 184
- 1: 114, 127-136, 166, 172, 173, 175, 186: 11:
340, 341
- -- 1: l1
- - 1: 131
- - 1: 132
- - 1: 132- 136
- - 1: 132
1: 184
- 1: 346
1: 247, 252
GtcNAc- 11: 307, 308. 309
1: 183, 184, 178
1: 182, 183, 185, 197.207, 215, 216, 218,
219
1: 248, 249
-- 1: 248, 250
- 1: 248
11: 15
1: 248. 249
11: 80. 81

406

1: 140, 142, 144,205.207,208,215,221,265; 11: 291,

294
1: 207, 208
1: 149
-l,6- 1:

182, 183, 197, 208, 215


203, 208, 215

-l,6- 1: 197, 198, 202,


-2,6- 1: 218-219
-6- 1: 114, 182, 183
1: 205. 207
1: 207, 208
D- 1: 142
D- 1: 142
1: 174, 175
, 11: 286
5- : 12
1: 174
1: 144, 150, 259
-, 1: 254
1: 254
11: 310
1: 175, 176
1: 88, 175, 197, 296, 314, 318,
1: 176
1: 328

328; 11: 19

1: 132-136, 272
1: 170, 171, 256, 257, 258, 259,

260-264. 281,

285, 286, 295; 11: 280, 290, 296


- 1: 262-264
- 1: 261
- 1: 260, 261
: 296
11: 296
1: 260
, 1: 77-79
- 1: 77
11: 287
1: 64, 67, 92; 11: 289, 292
- 1: 82
- 1: 82
- 1: 93
- 1: 93
11: 289, 292
11: 287, 288, 292
1: 149
() 11: 284, 372, 383
- () 1: 132
1: 356, 357
1: 281, 282
11: 281
1: 286
1: 151, 159-160, 238. 242, 244, 251, 256, 258,

, 11: 285
11: 67, 68, 73
11: 64, 66, 67
- 11: 67, 173
- - 11: 67
- D- 11: 80
- 11: 66
, 11: 66, 68
1: 29-31
- 1: 70
- 1: 162-163; 11: 300
- - 1: 35-36
- 1: 31
- 1: 29-30
- 1: 30-31, 163-164
11: 223
-, -t 11: 50
11: 71-72
11: 360, 362
11: 70, 71
- , 11:
- 11: 345
- 11: 67, 68
- 11: 67
- 11: 70-71

1: 23
1: 149

1:
11: 67
1: 157, 252, 253, 254. 255
, 1: 254
1: 209, 253; 11: 129
1: 252
,

260,
262,263,264,265,274--286;11: 129, 132, 134,207,208,
229, 278, 288, 290
- 1: 274--279
- - 1: 278-279
- , 11: 372.
383
- 1: 281
- 11: 288
- 1: 279-281
- 1: 151, 251, 252, 255, 262, 263, 264, 284; 11: 383
-, 11: 220
11: 290
() 11: 267, 268, 269, 270, 272, 293
1: 156, 157, 251, 252, 267, 301, 302; 11: 297
- 1: 267
1: 150; 11: 311, 312-313, 314. 317
1: 21
11: 50
ll: 244

66

50

11:

371, 383
1: 155
1: 120, 132
(CNBr)

1: 38

/ 1: 114, 115
- ,
- 1: 221

1: 172

11: 78, 79

1: 114, 130, 166, 172-180, 187, 197,


227, 228, 235, 269, 290, 291, 293, 295, 296, 297, 318
- - - 1: 177-180
- - - 1: 176
- - - 1: 178, 179
- - - 1: 172-174
- - - 1: 178, 179
- - - 1: 174--176
- - - 1: 221
- - - 1: 177
- - - 1: 179, 180
- - - 1: 176
- 1: 221
- 1: 306, 313-315
- - 1: 315-316
- 11: 11
- 1: 172
11: 107
-3' ,5' - 1: 270
1: 242, 245
1: 242, 243
: 206
1: 220
- 1: 116-117
1: 121; 11: 383
- 11: 286
- 1: 281.
283


1: 242, 266, 267, 306, 309
1: 304, 335, 336
1: 326; 11: 282
1: 25, 296, 303, 324-325, 346; 11: 298
-- 1: 303, 304
-- 1: 324-325
-- : 277
- 1: 346
1: 324
5-S-- 1: 352
1: 27
1: 323
- 1: 325
1: 325, 326
1: 323, 324
1: 325
: 110
11: 13
: 7, 8, 12
() 11: 12
(D-) 1: 248, 249
() 1: 106, 117, 249; 11: 12
11: 5, 6, 7, 27, 28, 35, 73
1: 171
11: 342-346
11: 344
() 1: 120, 123, 124, 128, 129, 133, 134,229,240,357,
1: 123, 130
-450 1: 361, 363; 11: 207
-- 1: 124
1: 120, 123, 129
1: 172, 179, 180, 215, 296, 318
1: 174, 175, 221
1: 27, 313, 315
- 1: 314
1: 315

.
: 146
,
: 376, 383
1: 223; 11: 186, 187, 189, 192

11: 186-192
192

1: 238
1: 152-153, 238, 242, 243
5, 8, 11, 14, 17- 1: 243
() 1: 239, 242
5, 8, 11, 14- 1: 243
(-'-) 1: 240
8, 11, 14- 1: 243
1: 112-113, 177

11: 302, 316

() 11: 36, 37, 52, 70, 88, 94


() 11: 36, 52, 93
11: 287
11: 144-145
11: 344
, 11: 109
- -- 11: 111
- -- 11: 113
- -
- - 11: 113
- - - 11: 113
- -- 11: 109--126
- -- - 11: 109
- - - 11: 109
-- - - 11: 120-126

11: 289, 292


11: 317
,

1: 51

1: 44

(, )

11: 321
1: 258

1: 237, 240
1: 240
-- 11: 102, 104
, 1: 163, 164
1: 111-113
11: 302, 305, 316
,

11:

147
-

--

11: 147-157

, 11: 148
11: 36, 52, 92
1: 73-74; 11: 413
-- --
() 1: 74; 11: 50
() 11: 287, 289

1: 76-77
1: 113, 114

11: 268, 269, 273


1: 111
11: 268, 269
11: 289
1: 111
() 11: 36, 87

11: 359-360

11: 123-124
11: 160
() 11: 154
1: 209, 210
1: 142
, 11: 281
1: 160

11: 281

1: 345, 347
1: 140, 145
1: 356
[: 146
, 1:

185, 200
1: 268
11: 148. 149. 207
17- ( 2) 11: 229, 235. 236
11: 235-237, 238
- 11: 235-236
- 11: 237
- 11: 243
, 1: 267
1: 248, 249
() 1: 161
11: 207, 231

11: 109-110

1:

36, 51, 70-71


- - - 11: 300
1: 32

1: 171,260, 275; 11: 95,


- 11: 180, 182
11: 182--183
11: 143--144, 364
11: 344
11: 274-276
. 1: 77
11: 275
, 11: 353
- 1: 111-116

358

407

187

408
1: 43
,
1: 351, 352
11: 67
1: 59. 60
- 1: 218
1: 104, 107

11: 120

1: 215, 233, 235, 236


11: 62, 64
, 11: 235-244
11: 235
1: 229
- 11: 300

34.

IV.

.
. .
..
.
.
. . . . ..
..

-


..
..
.
.

35.

DpIIIIIUIOBX .

.

.
hl

..
.
...

,
.

36.

JlII . ..

.
.
.
. .

I-

-
. . . .

. . . . . . .

15
IS
15
15
17

25
29

31
34

303

309
310
310
310
310

.
.

311
lC

. . ..
. . . . . .

14

3S

.
.
.
.....
.
..
..
.

-
.

37.

7
10
12

35
35

35

5
5
5
5

314
317
318

36
44
47

51
52
53
53
53
53

410

38.

39.

58
63

64

.
.



.

64
64
64
64

82
82
82
88


.
.
.
.

40.

41.

42.

93
94

.
.
.
.

.

. . . . . .
.
.

94
94
94
94
96

98
101

107

109

.
.
.

.

109
109

v.

111

120
126

: , .

. . . . . .
- .
. . . . . . . . .
. .



....
.
.

43.

92

.
.


. . . . . .

...

68
70
73
81

127
127
127
127

128
128
130
131
132
133
135
137
138
)43

145
146
146

IIJI .

)47

147
147
147
147
149
149
150

.
.

-
. . . . . . . . .


.

157

44.

411
.

..
.
.
.
.
1 .
......
Il ( )
1. "
.
..
2. ,
3.
.

45.

.
.
.

. .

1. --
2. .
..
.
3. ()

1. . . . . . . . . . .
..
2. (; )
.

46.

.
.

1.
2. .

. . .

.
.
.

47.

, llll.
. .
.
.
.

..
.
.
,
1. ()
2. (I,25-()2-D]
3. ()
.

48.

.

.
..
.
. . . .

. . . . . . . ..
,

.. .



.

49.

.
. . .
....
.

. . . .

.

158
158
158
158
159
161
161
166
168
169
170
170
170
170
172
172
177
180
183
184
184
185
186
186
186
187
187
187
190
190
191
192
192
193
193
193
193
194
194
194
199
203
204

205
205
205
205
205
206
207
21
211
213
216
219
220
221
221
221
222
223
223

412

50.

224
225
227
227

228

228
228
228
228
231
233
234
234
235
235
238
243
244
244
244
244
245
246

..

. ..

..

..

.





.

.

r.1J8Ba

51.

52.

53.

247
247
247
247
263
264
265
265
265

- .

267

.

. . . . . . . . . . . .
-

-
.
-
.

267
267
267
267
271

. . . . . . .
.
. .
..... .

.
..

.

VI.

272
272
273

, .

.
.


.
.

...


.
.

.


.

274
274
274
274
275
275
276
277
278
278
278
280
282
284
284

413


.
-

.

.
.


.

54.

286
287
291
291
294
295
296
297
298

.
.
.
.
. . .

. . . . .

299
299
299
299
299
299
300
301
301
302
302
303
309
310
310
310
310
311

. . .

, .
. .
.
.
.
....
.
.

1-

-
.

. . . . . . . .
.
.

.

55.

56.

57.

...

314
317
318

II.

319

.


.

.

319
319
319
319
325
330

332

.
.

..

.
.

332
332
332
342
347
351

, , .

352

.
.
. . . . .


.

352
352
352
353
353
353
356
357
357

.
.

..
..

, .

...

......

363
364

..

364
365

414

JJ

365
366
366



, ,
.

.
.

367
367
369
382
382
383
384
384
385
386

, , ,


2- .

.. . . . . .

. . .
. . .
. . .:

. .
ll . .
Xl . . ., . . .

. . .
];2

010174 20.05.97
02.12.98. 84 108/16.
N! 2. .
. 13,00 . . .-. . 43,68.
.-. . 51,55. . N2 4/7134.
1 000 . 1594. 026

129820,

. , l- .,

2.

143200,

. , . ,

93

., . .
. . - .: , 1997

368 ., .
- ,

, .

, ,
,
;

, ,

, ;
, ;

( ,
, );
,
, ;

, ( );
, , (,
);

(, , .),
(-, , , ,
.), , (, ,
JI~, , );

.

, , ,
.

.
.


, ,

: 129820, , 1-u :u ., 2
..' ': (095) 286-89-88, 286-84-55;

286-82-99; 286-17-72
(095) 288-9522, e-mail: victor@mir.msk.su

"
- , , " , ,

K ct-tiX:

.
. ,

4 (,

... "

.. .

"8

>< " "

w1

...

>to.8

21

,
ei:1 i:t .

lia 1

(, , no ,

, .)
,
t

,
.

" " " ", "


" .

lO'4 D R

, . , R

, .
,

. ,
, , ,

700 ... "

. ,

Оценить