DIXIE STATE UNIVERSITY

Teacher Work Sample

Mr. Chantz Ramos
DNA The Genetic Code
10-12th Grade Biology
2/27/15 3/6/15

Table of Contents

Contextual Factors

Pg. 2

Unit Plan

Pg. 5

Lesson Plan #1

Pg. 8

Lesson Plan #2

Pg. 13

Lesson Plan #3

Pg. 17

Lesson Plan #4

Pg. 21

Lesson Plan #5

Pg. 24

Lesson Plan #6

Pg. 27

Data Analysis

Pg. 30

Appendix B

Pg. 38

Appendix C

Pg. 39

Reflection and Self-Evaluation

Pg. 42
1

Teacher Candidate:
Eportfolio Website:
Subject: Biology
Grade: 10th-12th

Chantz Ramos
http://cramoseportfolio.weebly.com/

Standard I: Classroom Contextual Factors (DM1)- Narrative-suggested length (2 pagestyped-double-space).

You will need to use differentiation (modification/adaptations) in your lesson plans, instructional
strategies, and assessments that are based on student contextual factors. To help you determine
what types of accommodations are needed, identify the information below.
1. Demographics: Identify the gender, ethnicity, language proficiency, exceptionalities, and
number of students.
a. Students: Total #23

Males: 13

b. Ethnicity: White: 22
Asian: 0

Females: 10

Hispanic/Mexican: 1
Native American: 0

African American: 0
Other: 0

3. Language Proficiency: Identify the number of English Language Learners and languages in
your classroom.
There is one student whose originally language was Spanish before enrolling at the high school
here. However, that student speaks good English and does not have any known problems of
interpreting English.
4. Exceptionalities: Identify the number and type of exceptionalities in the class.
There are 5 students with known exceptionalities:
These 5 students did not score proficient enough on the performance test. There is an aide in the
class to help with those students.
5. Social Economic Status (SES)
There will probably be students who come from low income families or from families that do not
support/care for their childs education. Students from low income families can have difficulty
focusing in class due to several variables, so it is important for the instructor to recognize that
and accommodate each and every student. During Parent Teacher Conferences, the parents who
usually show up are the ones whose children are doing well in the classroom.
2

6. Academic Knowledge (If available): Describe the academic data results of the students thus
far (grades, attendance, discipline factors, core tests. etc.).
These students are on time for the most part and a few have missed a few classes this year due to
sports or other school-related activities.
The class average is around a 79% or C+.
7. English Language Learners: Describe ways you can incorporate tools of language
development and reading content into planning and instruction for these students. Example:
ELED- SIOP/ WIDA; SCED-reading content.
In a science class, the terms used are difficult for those who are not English Language Learners.
Models and pictures are great tools to help ELL students to understand science terms and
develop English within the class setting. Some of the textbooks are written in Spanish and there
are tests in Spanish so if the students first language is Spanish, they would still be able to
progress and learn in class. Flashcards are another great tool that can be used to help identify
words. The flashcards can have a term written in their first language and written in English so
they can start to use them interchangeably.
8. Multicultural Perspectives: Identify ways you can use culturally responsive curricula and
teaching that meets the needs of all students.
In a science classroom, the instructor can show that science is universal. For example, gravity
works on each student the same, regardless of their culture. Examples like that can help the
instructor show that even though there is diversity, students are there to learn. The material
should relate to all cultures and why that material is important to learn. Instructors should look
for similarities between cultures instead of always looking for differences.
9. Prior Knowledge: Elementary-Describe the criteria used to determine the reading and
mathematics prior knowledge and give a percentage of the number of students in these different
levels for reading and mathematics such as Below, Basic, or Advanced. Secondary- Review the
prior knowledge needed of students to be successful in learning the content knowledge for the
TWS unit and how you will implement content reading into your unit (Ex. Common Core
Strategies, etc.).
Literacy in science is important in being able to effectively understand and transfer knowledge.
Instructors could use vocabulary and have the students define the terms and organize it so they
can understand the terms and able to apply the terms on assessments. Free writing could be
another strategy that instructors use to help develop content literacy. Students could write their
thoughts and ideas about the concepts being taught throughout the school year. Instructors can
get their students to use graphic organizers to organize the information in a way that they

comprehend. Instructors will have to use different strategies at different times to help develop
content literacy.
10. Exceptionalities: Describe student exceptionalities that are identified in the class contextual
factors. These exceptionalities can include; (a) development of physical, social, and emotional
needs; (b) special education; (c) ethnicity; (d) gifted/talented; (e) ability differences, etc. Briefly
describe ways to make modification/ differentiation for planning, instruction, and assessments.
The 5 students in this class did not score well enough on the performance test. There is an aide
present in this class. Accommodations and modifications are included in the students IEPs.
Some students are allowed extra time on tests/assignments and are allowed to leave the
classroom during a test.
10. Identify sub-groups of students: Based on your contextual class factors- identify the subgroups you will need to address in differentiation/modifications for your instruction,
assessments, and analysis of student learning (e.g., gender, ELL, special education, ethnicity,
gifted/talented, ability differences, or other contextual factors listed above, etc.) Subgroup data
will be compared to each subgroup and the whole class.
Subgroup #1 Male students
Subgroup #2 Female students
Subgroup #3 Students with IEPs

Standard II: Unit Plan (DM2): Elementary and SET Programs

The unit plan must include Utah Core Standards and objectives (http://www.uen.org)/ Make sure
all instruction, activities, accommodations for diverse learners, assessments, and materials
support your goals and objectives for the unit. You will be required to use multiple assessments
(formation and summative) in each lesson along with a unit pre-test, recommendation use of
quantitative data (e.g., multiple choice, true/false or fill-in, etc.), given before teaching the TWS
unit and using this same pre-test as a posttest after the unit teaching is completed. These
objectives and assessments will be used to determine students' progress toward the unit learning
goals.
DIXIE STATE UNIVERSITY DEPARTMENT OF EDUCATION
UNIT PLAN TEMPLATE

Teacher Candidate:

Grade Level:

10-12

Chantz Ramos

Content Area: Biology

Step 1 DESIRED RESULTS

A. Contextual Factors
There are 23 students in the class. 13 male students and 10 female students. There are no
ELL students in the class, but one students native language is Spanish but is quite fluent
in English. There are 5 students in the class that have IEPs. Their IEPs state the
accommodations the teacher must make for them. There is an aide in the class that helps
with the students with IEPs. The class average is a 79% or a C+.
B. Utah State Core or Common Core Curriculum Standard
Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in
all living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein
synthesis

C. Enduring Understanding/Big Idea

The structure of DNA affects how it replicates and upon replication, we get identical
DNA templates that code for proteins being produced by transcription and translation.
D. Essential Questions/Guiding Questions
What is the structure of a DNA molecule and how do the nitrogenous bases pair up?
What is the purpose of DNA replication?
What are the steps and enzymes involved in DNA replication?
How is RNA different from DNA?
What is the overall goal of transcription and translation?
What are the steps involved for transcription?
What are the steps involved for translation?
How does a mutation occur and the effects of a mutation?
E. Concepts
Parts of a nucleotide
DNA structure
DNA replication
RNA
Triplet Code
Transcription and Translation
RNA splicing
Ribosomes
Polypeptides
Mutations
F. Skills
Students will be able to construct a DNA molecule and be able to label the parts of a
nucleotide. Students will be able to perform DNA replication by using their models and
briefly describe the steps and enzymes involved. Students will be able to describe the
steps in transcription and translation. Students will be able to use a triplet code to build a
polypeptide. Students will be able to recognize various mutations and the advantages or
disadvantages mutations may have.
Step 2 ASSESSMENT EVIDENCE
6

1. Pre-Assessments
The pre-assessment starts at the beginning of the unit and it is a series of observations.

2. Formative Assessments/Evidence
Studets will complete several worksheets on the concepts throughout the lesson to
understand where they are at throughout the unit.
Students will take a unit test at the end of the unit to test for knowledge of the concepts.

3. Summative Assessments/Evidence

A summative assessment will be given at the end of unit to check understanding of

concepts within the standard.

Step 3 Lesson Objectives with Instructional Strategies

Lesson Plan 1: Introduction to DNA
Students will watch YouTube videos, read sections in the textbook, and have
open discussions on the structure of DNA.
Lesson Plan 2: Building a DNA model
Students will watch YouTube videos, read sections in the textbook, create a
DNA model out of KNex in groups, answer questions pertaining to their
model, and have open discussions on the structure of DNA.
Lesson Plan 3: Perform DNA replication with the DNA model
Students will watch YouTube videos, read sections in the textbook, create a
DNA model out of KNex in groups, answer questions pertaining to their
model, and have open discussions on DNA replication.
Lesson Plan 4: Transcription: The first part of protein synthesis
Students will watch YouTube videos, read sections in the textbook, explore
7

the internet on transcription, answer questions pertaining to transcription,

and have open discussions on transcription.
Lesson Plan 5: Translation: The second part of protein synthesis
Students will watch YouTube videos, read sections in the textbook, explore
the internet on translation, answer questions pertaining to translation, and
have open discussions on translation.
Lesson Plan 6: Transcription and Translation: Bringing them together
Students will watch YouTube videos, read sections in the textbook, get into
groups to make a poster diagramming transcription and translation, answer
questions pertaining to transcription and translation, and have open
discussions on transcription and translation.

Chantz Ramos
2/27/15
Biology Lesson #1
Lesson Title: DNA The Genetic Code
Grade Level: 10th 12th
Core Objective/Indicator: Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all
living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein synthesis.
Concept Statement: DNA is structured the same in all living organisms, but contains genes
unique to one organism that are passed down from the parents and replicated by the process of
DNA replication.
Learning Objective: Students will identify the structure of a DNA molecule by sorting base
pairs in a double helix to understand DNA replication.
Materials: YouTube videos, Textbook, Laptops/iPads.
Mode of Inquiry: Descriptive
Contextual Factors:
8

There are 23 students in the class. 13 male students and 10 female students. There are no ELL
students in the class, but one students native language is Spanish but is quite fluent in English.
There are 5 students in the class that have IEPs. Their IEPs state the accommodations the teacher
must make for them. There is an aide in the class that helps with the students with IEPs. The
class average is a 79% or a C+.
Big Ideas: DNA gives instructions to proteins that perform specialized functions. DNA structure
is the same throughout all living things. DNA replication is the process of creating two identical
strands from the original.
Essential Questions:
What is the genetic information that is passed down from parents to offspring?
Why might cells perform different functions if they have the same DNA?
What would cause the nucleotide pairings? (Adenine with Thymine and Cytosine and
Guanine?
Procedure (5E):
Engage (Reminder--State IQ)
Science Fact of the Day: It is believed that if you put all your DNA molecules end to end,
it would reach from the Earth to the Sun and back over 600 times!
Teacher will introduce DNA by showing a YouTube video
(http://www.youtube.com/watch?v=M4zHVRLXkgw) that will help engage the students.
The video is made like a trailer for DNA. It has no one speaking; it just has music and
words that pop on the screen. After the students watch it, begin the discussion with a few
questions to assess the students on prior knowledge.
Before the students explore cells on their own, briefly describe the base pairs and the
relationships between them. Mention that Adenine and Thymine are like best friends and
stick together while Cytosine and Guanine are like best friends and stick together.
Question:
Half of your genetic information comes from your mother and the other half comes from
your father. What is this genetic information?
(DNA)
Discussion:
When one sperm and one egg unite, it forms one embryonic cell. This cell contains the
complete DNA. This cell then divides and the DNA is duplicated. The cells may contain
the same DNA but are specialized in their function. For example, an eye cell has same
DNA as a stomach cell but they perform different functions. Those functions are related
9

to the proteins they produced. The eye produces proteins that specialize in eye function
and the stomach produces proteins that specialize in stomach function.
Reassess to see if they understand that an eye cell has the same DNA as a stomach cell.
(Students should answer with no and explain that the DNA is the same but produces
specific proteins for specialized functions.
Inquiry Question: How might DNA code for different proteins to perform
specialized functions?
Explore
Students will explore several types of cells on their own and write down the
characteristics of those cells. For example, a stomach cell would secrete hydrochloric
acid while an eye cell produces rods and cones to absorb light.
Inquiry Question: Why would DNA structure be in a double helix and the role it
plays in cells throughout the human body?
Explain
Inform the students that Adenine and Thymine always go together while Cytosine and
Guanine always go together. A-T-C-G is the alphabet for DNA.
Put an example on the board with 10 codons bunch together and show how it looks like a
long alphabet but it is composed of words that are three letters long.
Three letters = Codon
Sentence =Gene
Lego analogy If you give a student 100 Lego pieces of the same color, they can only
make one color combination. However, if you 20 pieces of5 different colors, there are
many color combination possibilities.
DNA issues instructions, but doesnt do much of the work.
Diagram a nucleotide on the whiteboard
Elaborate
The teacher can have students come up to the whiteboard to pair up nucleotides with
nucleotides with magnets. The teacher can also write a long strand of nucleotides and
have the students break it down into codons. Clarify between a DNA strand and RNA
strand by replacing Thymine with Uracil. A fun activity would be to give each student a
specific nucleotide and randomly select students to form a strand. Have the other students
10

work together to form a complementary strand. As the class time comes to an end, gather
the students and ask questions relating to DNA.
Closing questions:
If we take a heart cell and compare the DNA with an ear cell, what would we
discover?
How can a heart cell and an ear cell have the same DNA?
If a heart cell and an ear cell have the same DNA, how do they perform different
functions?

Evaluate Please use this simple table.

Phase
Engage

Explore

Explain

Elaborate

Formative
Teacher will assess prior
knowledge by asking
questions (What is the
genetic information called
that we receive from our
parents? How might a
stomach cell perform a
specific function if it has the
same DNA as an eye cell?)
As the students are
exploring different types of
cells and their function, go
around and ask students
what they have found and
why it would be useful.
The teacher should ask
questions that re-visit the
concept the students just
learned. The teacher can
then see if the students
understand the concept, if
they dont care to answer
questions, or if they dont
understand the concept at
all. In that case, re-teach the
concept.
Check for understanding by
asking questions and
weighing the answers. If
students do not answer the

Summative
There will be no pre-test
handed to the students for
this lesson. The information
in this section is to peak
curiosity in the students. The
big picture presented in this
section will be assessed on
the unit exam.
The teacher can check the
work of each group as they
find information on the
function of cells.

There will be no written

assessment in which they
turn in for a grade for this
segment of the lesson. The
students will be assessed on
a unit exam in which the
information from the lesson
will be presented.

There will be no post-test for

this lesson. However, the
information taught
throughout the lesson will be
11

questions, take a moment to

revisit the concept.

assessed on the unit exam.

How did you differentiate instruction?

I placed students that had a hard time seeing up front so they can see the whiteboard and
projector. I would call on some low level achievers to answer some questions so they can
participate and hopefully understand the material better. There was an aide in the classroom that
was taking notes for those students that have a hard time taking notes (mentioned in the IEPs).
Reflection
The formative assessment showed that the students learned some of the concepts taught in the
lesson by participating during the lecture portion of class. I learned a lot during this lesson that I
will transfer over to future teaching. I will incorporate as much activities as I can throughout
lessons, because the students get engaged and get hands on approach to learning. Letting the
students explore during the lesson and then explaining what they found afterwards was effective.
I will continue to do that in future teaching. Time management could have been better since I
didnt spend as much time as I wanted to review the concepts at the end of the lesson. My goal is
to become a better teacher and I will continue to strive for that goal. Finding ways to relate to the
students and keep them engaged throughout the lesson will help. Every opportunity I get to
teach, the better I get as a teacher.
References:
http://www.youtube.com/watch?v=M4zHVRLXkgw
(Introduction to DNA)
http://www.phschool.com/science/biology_place/biocoach/dnarep/structure.html
(Nucleotide model)
http://genetics.thetech.org/ask/ask109
(Double helix explanation)
http://www.pbslearningmedia.org/resource/tdc02.sci.life.repro.lp_dnastructure/modeling-dnastructure/
(Activity DNA Structure)
http://sciencenetlinks.com/lessons/cell-dna/
(Question and Discussion)
http://chemistry.about.com/od/lecturenoteslab1/a/10-Interesting-Dna-Facts.htm
(Science Fact of the Day)

12

Chantz Ramos
3/2/15
Biology Lesson #2
Lesson Title: DNA Model
Grade Level: 10th 12th
Core Objective/Indicator: Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all
living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein synthesis.
Concept Statement: DNA is structured the same in all living organisms, but contains genes
unique to one organism that are passed down from the parents and replicated by the process of
DNA replication.
Learning Objective: Students will understand the structure of DNA by building a model out of
KNex.
Materials: YouTube videos, Textbook, KNex
Mode of Inquiry: Descriptive
Contextual Factors:
There are 23 students in the class. 13 male students and 10 female students. There are no ELL
students in the class, but one students native language is Spanish but is quite fluent in English.
There are 5 students in the class that have IEPs. Their IEPs state the accommodations the teacher
must make for them. There is an aide in the class that helps with the students with IEPs. The
class average is a 79% or a C+.
Big Ideas: DNA gives instructions to proteins that perform specialized functions. DNA structure
is the same throughout all living things. DNA replication is the process of creating two identical
strands from the original.
Essential Questions:
13

What is the genetic information that is passed down from parents to offspring?
Why might cells perform different functions if they have the same DNA?
What would cause the nucleotide pairings? (Adenine with Thymine and Cytosine and Guanine?
Procedure (5E):
Engage (Reminder--State IQ)
Start the class by playing a DNA song for the class to enjoy. (https://www.youtube.com/watch?
v=wdhL-T6tQco)
Show the class a video from Bozeman Biology (https://www.youtube.com/watch?v=q6PPC4udkA) that explains DNA. Stop the video throughout to take notes.
Inquiry Question: Why would DNA strands twist together to form a double helix?
Explore
Place the students into groups with their table partner. Give each group a KNex set and have
them pull out the booklet detailing the instructions on how to build a DNA molecule. Explain to
the students that they need to read and understand the booklet so they can correctly build the
DNA molecule.
Inquiry Question: Why would DNA structure be in a double helix ?
Explain
After the groups have completed their DNA model, ask questions to the group members relating
to the structure. For example, what does this KNex piece represent on a nucleotide?
After asking the groups these simple questions, give them some time to figure out why DNA is in
a double helix. Listen to some of their theories. Then present them with the theory that DNA is in
a double helix because the hydrogen bonds between the nitrogenous bases are weak in water.
(http://genetics.thetech.org/ask/ask109)
Elaborate
After the groups have put away their DNA model, draw two strands of DNA on the board so the
students can label the parts of a nucleotide and see how the bases pair up.
Closing questions:
What are the four nitrogenous bases in DNA?
What holds the nitrogenous bases together?
What are the three parts of a nucleotide?
Why is DNA in a double helix?

14

Evaluate Please use this simple table.

Phase
Engage

Formative
Teacher will assess prior
knowledge by asking
questions (What are the
three parts of a
nucleotide? What are the
four nitrogenous bases in
DNA? What is the
structure of DNA?

Explore

As the students are

working on their DNA
structure, check to see if
they understand the base
pairing and the structure
of DNA.
The teacher should ask
questions that re-visit the
concept the students just
learned. The teacher can
then see if the students
understand the concept, if
they dont care to answer
questions, or if they dont
understand the concept at
all. In that case, re-teach
the concept.
Check for understanding
by asking questions and
weighing the answers. If
students do not answer the
questions, take a moment
to revisit the concept.

Explain

Elaborate

Summative
There will be no pre-test
handed to the students for
this lesson. The
information in this section
is to peak curiosity in the
students. The big picture
presented in this section
will be assessed on the
unit exam.
The teacher can check the
work of each group as
they build their DNA
molecule. Check to see if
the base pairings are
correct.
There will be no written
assessment in which they
turn in for a grade for this
segment of the lesson. The
students will be assessed
on a unit exam in which
the information from the
lesson will be presented.

There will be no post-test

for this lesson. However,
the information taught
throughout the lesson will
be assessed on the unit
exam.

How did you differentiate instruction?

I made some modifications to a few students in terms of how simple I made the concept. I placed
low level achievers with high level achievers to help them learn from one another. When some
students asked for help during the DNA activity, I would repeat the concept over and over again
until they understood. I would ask more questions for those students who struggle so they can
see various angles at a concept.
Reflection
15

Some group members had an easier time understanding the model of the DNA while other group
members relied on others to explain the concepts. I thought placing low level achievers with high
level achievers in this activity allowed the low level achievers to have someone who knows the
concepts well to help them throughout the activity. This also helps the high level achievers learn
by teaching the low level achievers the concepts. Time management could have been better for
an activity that requires time to build and take down.
References:
http://genetics.thetech.org/ask/ask109
(Double helix explanation)
(https://www.youtube.com/watch?v=wdhL-T6tQco)
(DNA song)
(https://www.youtube.com/watch?v=q6PP-C4udkA)
(Bozeman Biology DNA)
KNex Lab
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/D/DNAReplication.html
(DNA Replication steps)
http://www.youtube.com/watch?v=8kK2zwjRV0M
(DNA Replication video)

16

Chantz Ramos
3/3/15
Biology Lesson #3
Lesson Title: DNA Replication
Grade Level: 10th 12th
Core Objective/Indicator: Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all
living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein synthesis.
Concept Statement: DNA is structured the same in all living organisms, but contains genes
unique to one organism that are passed down from the parents and replicated by the process of
DNA replication.
Learning Objective: Students will understand DNA replication by performing it with their
DNA models and taking notes on YouTube videos on DNA replication.
Materials: YouTube videos, Textbook, KNex
Mode of Inquiry: Descriptive
Contextual Factors:
There are 23 students in the class. 13 male students and 10 female students. There are no ELL
students in the class, but one students native language is Spanish but is quite fluent in English.
There are 5 students in the class that have IEPs. Their IEPs state the accommodations the teacher
must make for them. There is an aide in the class that helps with the students with IEPs. The
class average is a 79% or a C+.
Big Ideas:
DNA replication is the process of creating two identical strands from the original.
Essential Questions:
What is the purpose of DNA replication?
What are the steps in DNA replication?
17

What enzymes are involved in DNA replication?

Procedure (5E):
Engage (Reminder--State IQ)
Start the class of again with another rap song. This one will be about DNA replication. It shows
that science can be fun! (https://www.youtube.com/watch?v=1L8Xb6j7A4w)
Ask the students what they think of when they hear the word replicate. (Hopefully the students
will say something along the lines of making a copy.)
Inquiry Question: Why would DNA replication be important for our survival?
Explore
Students will be placed in the groups that they were in yesterday to rebuild their DNA model out
of KNex. Once the students are done rebuilding, they can turn their booklets to the page that
highlights DNA replication. The groups will then figure out how to perform DNA replication
with their models by looking at the details in the booklet.
Inquiry Question: Why would DNA replication be important for our survival?
Explain
Once the groups are done with rebuilding and DNA replication, ask the group members some
questions about DNA replication. Ask them what is happening during DNA replication and what
is the purpose of DNA replication. Re-visit the concepts of the base pairings and the parts of the
nucleotides during this time. After you have finished asking the groups questions, give them
some time to put away the KNex pieces in the correct bags.
Elaborate
After the groups have put away the KNex in the correct bags, they will turn their attention to the
front. I will then show them videos on DNA replication and have them take notes throughout the
videos.
https://www.youtube.com/watch?v=8kK2zwjRV0M
(Crash Course DNA Structure and Replication)
https://www.youtube.com/watch?v=FBmO_rmXxIw
(Bozeman Biology DNA Replication)
https://www.youtube.com/watch?v=5qSrmeiWsuc
(Amoeba Sisters DNA Replication)
Closing Questions:
What is the purpose of DNA Replication?
18

What are the steps of DNA Replication?

What are the enzymes involved in DNA Replication?

Evaluate Please use this simple table.

Phase
Engage

Explore

Explain

Elaborate

Formative
Teacher will assess prior
knowledge by asking
questions (What is the
purpose of DNA
Replication? What are the
steps of DNA Replication?
What are the enzymes
involved in DNA
Replication?)
As the students are
working on DNA
Replication, check to see if
they understand the steps
and enzymes of DNA
Replication.
The teacher should ask
questions that re-visit the
concept the students just
learned. The teacher can
then see if the students
understand the concept, if
they dont care to answer
questions, or if they dont
understand the concept at
all. In that case, re-teach
the concept.
Check for understanding
by asking questions and
weighing the answers. If
students do not answer the
questions, take a moment
to revisit the concept.

Summative
There will be no pre-test
handed to the students for
this lesson. The
information in this section
is to peak curiosity in the
students. The big picture
presented in this section
will be assessed on the
unit exam.
The teacher can check the
work of each group as
they perform DNA
Replication and check to
see if the base pairs are
lined up correctly.
There will be no written
assessment in which they
turn in for a grade for this
segment of the lesson. The
students will be assessed
on a unit exam in which
the information from the
lesson will be presented.

There will be no post-test

for this lesson. However,
the information taught
throughout the lesson will
be assessed on the unit
exam.

How did you differentiate instruction?

I placed low level achievers with high level achievers to allow learning for both parties. The low
level achievers can understand the activity by listening to a high level achiever and a high level
achiever can learn by teaching the concepts to the low level achiever. The aide will take notes for
those who have trouble taking notes, as mentioned in their IEPs.

19

Reflection
Some students had a hard time understand DNA replication when it came to the KNex. I would
ask these students questions that would help them understand the steps better. I thought teaching
the steps and enzymes after exploring with the DNA model is a great way for the students to
understand the content more efficiently.
References:
https://www.youtube.com/watch?v=1L8Xb6j7A4w
(DNA Rap)
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/D/DNAReplication.html
(DNA Replication steps)
https://www.youtube.com/watch?v=8kK2zwjRV0M
(Crash Course DNA Structure and Replication)
https://www.youtube.com/watch?v=FBmO_rmXxIw
(Bozeman Biology DNA Replication)
https://www.youtube.com/watch?v=5qSrmeiWsuc
(Amoeba Sisters DNA Replication)

20

Chantz Ramos
3/4/15
Biology Lesson #4
Lesson Title: Transcription
Grade Level: 10th 12th
Core Objective/Indicator: Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all
living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein synthesis.
Concept Statement: Transcription allows us to have instructions to build a polypeptide to have
specialized functions.
Learning Objective: Students will understand transcription by watching step-by-step videos,
taking notes on each step, and discussing those steps as a class.
Materials: YouTube videos, Textbook, laptops/iPads.
Mode of Inquiry: Descriptive
Contextual Factors:
There are 23 students in the class. 13 male students and 10 female students. There are no ELL
students in the class, but one students native language is Spanish but is quite fluent in English.
There are 5 students in the class that have IEPs. Their IEPs state the accommodations the teacher
must make for them. There is an aide in the class that helps with the students with IEPs. The
class average is a 79% or a C+.
Big Ideas:
Transcription creates instructions for proteins to be made.
Essential Questions:
What is the overall goal of Transcription?
What is the role of RNA in Transcription?
What is the importance of RNA splicing?
Where does Transcription take place?
21

Procedure (5E):
Engage (Reminder--State IQ)
Start the classes off by showing them a video of a goat dressed as Elsa off of Frozen. The reason
for this is 1) it is hilarious and 2) it helps to calm the students down from past classes. It is worth
the watch. (https://www.youtube.com/watch?v=GdJR58uDtXk)
Inquiry Question: Before we make a pizza, what is the first thing we need?
(Recipe/Instructions)
Explore
Students will get on their laptops/iPads and do some research on transcription. They will write
down the basic steps of transcription. They will also need to diagram transcription, which will
help them understand the concept. They will be prepared to give the class some of the
information they discovered.
Inquiry Question: Before we make a pizza, what is the first thing we need?
(Recipe/Instuctions)
Explain
After the students had some time to research transcription on their own, they will then start to
provide their ideas to the class. I will write out Transcription on the board and we will fill in
the steps as a class. I will then explain the steps as we list them. We will then diagram
transcription after we have explained it so they have two ways of understanding the concept of
transcription.
Elaborate
After we have listed the steps and diagrammed transcription, I will ask if any of them have
questions so far. If so, we will re-visit concepts or branch out and talk about new concepts. To
add onto the lesson, I will show the class videos on transcription so they can see it in video form.
https://www.youtube.com/watch?v=itsb2SqR-R0
(Crash Course Biology Transcription and Translation)
https://www.youtube.com/watch?v=h3b9ArupXZg
(Bozeman Biology Transcription and Translation)
Closing Questions:
What is the purpose of transcription?
What are the steps of transcription?
What is the importance of RNA splicing?
Where does transcription take place?

22

Evaluate Please use this simple table.

Phase
Engage

Explore

Explain

Elaborate

Formative
Teacher will assess prior
knowledge by asking
questions (What is the
purpose of transcription?
What are the steps of
transcription? What is the
importance of RNA
splicing? Where does
transcription take place?)
As the students are listing
and diagramming the
steps of transcription, see
if the students understand
a particular step and if
they can tell me what step
comes after or before
another.
The teacher should ask
questions that re-visit the
concept the students just
learned. The teacher can
then see if the students
understand the concept, if
they dont care to answer
questions, or if they dont
understand the concept at
all. In that case, re-teach
the concept.
Check for understanding
by asking questions and
weighing the answers. If
students do not answer the
questions, take a moment
to revisit the concept.

Summative
There will be no pre-test
handed to the students for
this lesson. The
information in this section
is to peak curiosity in the
students. The big picture
presented in this section
will be assessed on the
unit exam.
The teacher can check the
work of each student as
they list and diagram the
steps of transcription.

There will be no written

assessment in which they
turn in for a grade for this
segment of the lesson. The
students will be assessed
on a unit exam in which
the information from the
lesson will be presented.

There will be no post-test

for this lesson. However,
the information taught
throughout the lesson will
be assessed on the unit
exam.

How did you differentiate instruction?

I went around and checked low level achievers more often than high level achievers during their
research. I would ask those questions pertaining to transcription, seeing if they understand the
concept. There was an aide in the class that took notes for those who had a hard time taking
notes, as mentioned in their IEPs.
Reflection
23

When you allow students to research on their own, most do a good job of staying on task while
others not so much. They might not understand what they have written down when they were
researching but explaining it better in more basic steps helped them to understand. Some students
are great visual learners and diagramming transcription allowed them to understand it that way.
Then the videos helped to sum things up and clarify steps throughout transcription.
References:
https://www.youtube.com/watch?v=GdJR58uDtXk
(Goat dressed as Elsa)
https://www.youtube.com/watch?v=itsb2SqR-R0
(Crash Course Biology Transcription and Translation)
https://www.youtube.com/watch?v=h3b9ArupXZg
(Bozeman Biology Transcription and Translation)
Chantz Ramos
3/5/15
Biology Lesson #5
Lesson Title: Translation
Grade Level: 10th 12th
Core Objective/Indicator: Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all
living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein synthesis.
Concept Statement: Translation takes those instructions from transcription and uses them to
build a polypeptide.
Learning Objective: Students will understand translation by watching step-by-step videos,
taking notes on each step, and discussing those steps as a class.
Materials: YouTube videos, Textbook, laptops/iPads.
Mode of Inquiry: Descriptive
Contextual Factors:
There are 23 students in the class. 13 male students and 10 female students. There are no ELL
students in the class, but one students native language is Spanish but is quite fluent in English.
There are 5 students in the class that have IEPs. Their IEPs state the accommodations the teacher
must make for them. There is an aide in the class that helps with the students with IEPs. The
class average is a 79% or a C+.
Big Ideas:
Translation makes proteins from the instructions of transcription.
Essential Questions:
What is the overall goal of Translation?
What is the role of RNA in Translation?
Where does Translation take place?

24

Procedure (5E):
Engage (Reminder--State IQ)
Start the classes off by showing them a video of a scene from Peaceful Warrior. This is to get
the students inspired and to have them focus on one thing.this moment.
(https://www.youtube.com/watch?v=bXAxBnQuHwI)
Inquiry Question: After we get the instructions to make the pizza, what do we do next?
Explore
Students will get on their laptops/iPads and do some research on translation. They will write
down the basic steps of translation. They will also need to diagram translation, which will help
them understand the concept. They will be prepared to give the class some of the information
they discovered.
Inquiry Question: After we get the instructions to make the pizza, what do we do next?
Explain
After the students had some time to research translation on their own, they will then start to
provide their ideas to the class. I will write out Translation on the board and we will fill in the
steps as a class. I will then explain the steps as we list them. We will then diagram translation
after we have explained it so they have two ways of understanding the concept of translation.
Elaborate
After we have listed the steps and diagrammed translation, I will ask if any of them have
questions so far. If so, we will re-visit concepts or branch out and talk about new concepts. To
add onto the lesson, I will show the class videos on translation so they can see it in video form.
https://www.youtube.com/watch?v=itsb2SqR-R0
(Crash Course Biology Transcription and Translation)
https://www.youtube.com/watch?v=h3b9ArupXZg
(Bozeman Biology Transcription and Translation)
Closing Questions:
What is the purpose of translation?
What are the steps of translation?
Where does translation take place?

Evaluate Please use this simple table.

Phase
Engage

Formative
Teacher will assess prior

Summative
There will be no pre-test
25

knowledge by asking
questions (What is the
purpose of translation?
What are the steps of
translation? Where does
translation take place?)
Explore

Explain

Elaborate

As the students are listing

and diagramming the
steps of translation, see if
the students understand a
particular step and if they
can tell me what step
comes after or before
another.
The teacher should ask
questions that re-visit the
concept the students just
learned. The teacher can
then see if the students
understand the concept, if
they dont care to answer
questions, or if they dont
understand the concept at
all. In that case, re-teach
the concept.
Check for understanding
by asking questions and
weighing the answers. If
students do not answer the
questions, take a moment
to revisit the concept.

handed to the students for

this lesson. The
information in this section
is to peak curiosity in the
students. The big picture
presented in this section
will be assessed on the
unit exam.
The teacher can check the
work of each student as
they list and diagram the
steps of translation.

There will be no written

assessment in which they
turn in for a grade for this
segment of the lesson. The
students will be assessed
on a unit exam in which
the information from the
lesson will be presented.

There will be no post-test

for this lesson. However,
the information taught
throughout the lesson will
be assessed on the unit
exam.

How did you differentiate instruction?

I went around and checked low level achievers more often than high level achievers during their
research. I would ask those questions pertaining to translation, seeing if they understand the
concept. There was an aide in the class that took notes for those who had a hard time taking
notes, as mentioned in their IEPs.
Reflection
When you allow students to research on their own, most do a good job of staying on task while
others not so much. They might not understand what they have written down when they were
researching but explaining it better in more basic steps helped them to understand. Some students
26

are great visual learners and diagramming translation allowed them to understand it that way.
Then the videos helped to sum things up and clarify steps throughout translation.
References:
https://www.youtube.com/watch?v=bXAxBnQuHwI
(Peaceful Warrior Scene Taking Out The Trash)
https://www.youtube.com/watch?v=itsb2SqR-R0
(Crash Course Biology Transcription and Translation)
https://www.youtube.com/watch?v=h3b9ArupXZg
(Bozeman Biology Transcription and Translation)

Chantz Ramos
3/6/15
Biology Lesson #6
Lesson Title: Transcription and Translation
Grade Level: 10th 12th
Core Objective/Indicator: Standard 4
Students will understand that genetic information coded in DNA is passed from parents to
offspring by sexual and asexual reproduction. The basic structure of DNA is the same in all
living things. Changes in DNA may alter genetic expression.
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein synthesis.
Concept Statement: Transcriptions creates the instructions for translation to make the proteins.
Both processes work together for protein synthesis.
Learning Objective: Students will bring transcription and translation together to understand
protein synthesis by adding more details to their notes by looking into the textbook.
Materials: YouTube videos, Textbook.
Mode of Inquiry: Descriptive
Contextual Factors:
There are 23 students in the class. 13 male students and 10 female students. There are no ELL
students in the class, but one students native language is Spanish but is quite fluent in English.
There are 5 students in the class that have IEPs. Their IEPs state the accommodations the teacher
must make for them. There is an aide in the class that helps with the students with IEPs. The
class average is a 79% or a C+.
Big Ideas:
Transcription and translation work together to make proteins that perform specialized functions.
Essential Questions:
What is the overall goal of transcription and translation?
Where does transcription take place?
Where does translation take place?
How does transcription relate to translation?
27

Procedure (5E):
Engage (Reminder--State IQ)
Show the class a video of a speech by Steve Jobs. This is meant to inspire the students to follow
their dreams and ask themselves What if today were my last day, what would I do? Would I be
happy with my life? Am I living my dream today?. (https://www.youtube.com/watch?
v=a5SMyfbWYyE).
Inquiry Question: How does transcription and translation work together to make proteins?
Explore
Students will get into groups of 3-4 and create a poster diagramming the steps of transcription
and translation together. Not only do they diagram the steps but also have illustrations for each
step. When the groups are done with their poster, they will then present it to the rest of the class.
This will serve as a way to understand the process of protein synthesis.
Inquiry Question: How does transcription and translation work together to make proteins?
Explain
The students will explain the steps of transcription and translation to the class. I will intervene at
points to ask questions to make sure they really understand the concepts.
Elaborate
After all the groups have presented their posters, I will then review the steps of transcription and
translation on the board. This is the time to review past concepts such as DNA structure and
DNA replication. The students may have questions during this time and I will make sure to
clarify concepts as best as I can.
These videos can be served as a review:
https://www.youtube.com/watch?v=itsb2SqR-R0
(Crash Course Biology Transcription and Translation)
https://www.youtube.com/watch?v=h3b9ArupXZg
(Bozeman Biology Transcription and Translation)
Closing Questions:
What is the overall goal of transcription and translation?
Where does transcription take place?
Where does translation take place?
How does transcription relate to translation?

Evaluate Please use this simple table.

28

Phase
Engage

Explore

Explain

Elaborate

Formative
Teacher will assess prior
knowledge by asking
questions (What is the
overall goal of
transcription and
translation? Where does
transcription take place?
Where does translation
take place? How does
transcription relate to
translation?)
As the groups are listing
and diagramming the
steps of transcription and
translation, see if the
students understand a
particular step and if they
can tell me what step
comes after or before
another.
The teacher should ask
questions that re-visit the
concept the students just
learned. The teacher can
then see if the students
understand the concept, if
they dont care to answer
questions, or if they dont
understand the concept at
all. In that case, re-teach
the concept.
Check for understanding
by asking questions and
weighing the answers. If
students do not answer the
questions, take a moment
to revisit the concept.

Summative
There will be no pre-test
handed to the students for
this lesson. The
information in this section
is to peak curiosity in the
students. The big picture
presented in this section
will be assessed on the
unit exam.
The teacher can check the
work of each group to
make sure they diagram
the correct steps of both
transcription and
translation.

There will be no written

assessment in which they
turn in for a grade for this
segment of the lesson. The
students will be assessed
on a unit exam in which
the information from the
lesson will be presented.

There will be no post-test

for this lesson. However,
the information taught
throughout the lesson will
be assessed on the unit
exam.

How did you differentiate instruction?

I put low level achievers with high level achievers so the low level achievers can get some extra
help from the high level achievers. The high level achievers can benefit by teaching the concepts
to the low level achievers. There was an aide in the class to make sure the students with IEPs
were accommodated as mentioned in their IEPs.
29

Reflection
When you allow groups to work on a project or presentation and present information to the class,
they must know the material to do so. It also helps build social skills and public speaking, which
are helpful in todays world. There are some students that rely too much on their peers. Perhaps
an individual project can be beneficial as well on this concept.
References:
https://www.youtube.com/watch?v=a5SMyfbWYyE
(Steve Jobs Inspirational Speech)
https://www.youtube.com/watch?v=itsb2SqR-R0
(Crash Course Biology Transcription and Translation)
https://www.youtube.com/watch?v=h3b9ArupXZg
(Bozeman Biology Transcription and Translation)
DNA The Genetic Code Unit Data Analysis
I.

Contextual Factors
Total Number of Students Male Students Female Students -

23
13
10

Ethnicities
White Hispanic -

22
1

Subgroup #1 - Male Students

Subgroup #2 - Female Students
Subgroup #3 Students with IEPs
II.

Lesson Objectives
Objective 3
Explain how the structure and replication of DNA are essential to heredity and protein
synthesis.
Concept Statement
DNA is genetic material that replicates itself in order for all cells to contain DNA,
which create instructions through transcription and makes proteins through
translation.
30

Learning Objective
Students will learn about the structure of DNA, DNA replication, transcription and
translation by building models of DNA, watching YouTube videos and taking notes,
pulling information out of the textbook, research information and creating posters,
and open discussions.

III.

Data

Correlation between Overall Class Grades and Test Scores

Class Grade
Ch. 11-12 Test Score

Percentages

Student Number

31

Learning Plan
1.

2.
3.
4.
5.
6.
7.

Test questions (28):

Fredrick Griffith concluded that there was a transforming factor when he mixed the
heat-treated deadly strain and the harmless strain together and the mouse died. Oswald
Avery followed up this experiment to search for this transforming factor. What did
Avery conclude from his experiment with regards to the transforming factor?
Youre walking in the hallways and you overhear some people talk about DNA. So you
walk over to them and you sound cool by saying the scientific name of DNA. How would
you say it?
What are the three parts of a nucleotide?
What are the four bases for DNA and how do they pair up?
What bases are classified as Pyrimidines? What bases are classified as Purines? What is
the difference between Pyrimidines and Purines?
What is the structure of DNA?
What comprises the backbone of the DNA and what bonds the base pairings together?
(Think back to the KNex lab).
32

8. If one strand of DNA reads: ATTCGCATCAGT

What would the other strand
read?
9. What is the purpose of DNA replication?
10. What enzymes are involved in DNA replication? What roles do they play?
11. When does DNA replication occur? What is the end result of DNA replication?
12. Briefly describe the steps in DNA Replication. (Use the enzymes involved to describe the
steps)
13. List two ways RNA is different from DNA?
14. Using the triplet code (see table), translate the following codons:
GCC
AGA
CUU
UAC
UGA
GUG
CCA
AUG
GAU
UAG
15. Who is most notable for the discovery of the DNA strucutre? Who was the scientist who
discovered DNA structure first by using X-Ray crystallography but did not get awarded
the nobel prize?
16. Which molecule completes the flow of information from DNA to protein?
17. What is overall goal of transcription and translation?
18. What are the three types of RNA and their role?
19. Transcribe this DNA strand:
TACGCTAACTGA (DNA Strand)
20. After we transcribe the message from the DNA template, what is the final step before we
can begin translation? Why would this be important?
21. What is the difference between exons and introns?
22. What are we achieving by translation? In other words, what is the goal of translation
compared to transcription?
23. Draw a ribsome and label the following parts: small subunit, large subunit, P-site, ASite, mRNA, tRNA.
24. Diagram translation by building a polypeptide. Make sure you show the anticodon for
each codon. Refer to your triplet code. You dont need to draw a ribosome to illustrate
this.
(mRNA) AUGCGAGGCUCAGUUCUGCUUUGA
25. What is a polypeptide? What is another name for a polypeptide?
26. Define mutation? Give an example as well.
27. What type of mutation would be more harmful: a base substitution or an
insertion/deletion? EXPLAIN WHY. Feel free to diagram this if youre not sure.
28. What is another name for Trisomy 21? What is the cause of Trisomy 21?
Lesson #1
33

Students will be introduced to DNA. They will understand what DNA stands for, who discovered
DNA, the parts of a nucleotide, the nitrogenous bases for DNA and how they pair up, and the
classification of Pyrimidines and Purines.
The teacher will show videos that introduce DNA and talk about the structure of DNA, using the
textbook as a reference. The teacher will then explain DNA in more depth after the students
explore DNA on their own. At the end of class, the teacher will then go over all the concepts
covered in todays lesson.
The students will explore cells and DNA on their own. They will see why cells specialize in
function. They will then take notes over videos and information from the textbook.
Lesson #2
Students will understand the structure of DNA. They will understand what comprises the
backbone of DNA, what holds the bases together, and why DNA is in a double helix.
The teacher will briefly review concepts in the last lesson before letting the students build their
own DNA models. While the students are building their models, the teacher will go around and
make sure each group member is participating and that they understand the concepts of DNA.
After the groups have finished building their model, the teacher will ask questions relating to the
DNA structure. After the students put away their DNA models, the teacher will review the
concepts from this lesson and the previous lesson.
The students will build their own DNA model out of KNex. They will work together to put the
base pairs in the correct spot and be able to answer questions regarding DNA structure. After the
students finish their model and answer the questions, they will put the KNex in the correct bags.
Lesson #3
Students will understand how DNA replicates. Students will understand the process of DNA
replication, how the base pairs line up, the steps and enzymes involved in DNA replication, and
the purpose of DNA replication.
The teacher will briefly review concepts in the last session before letting the students re-build
their DNA model so they can illustrate DNA replication. The teacher will go around the room as
the students are working to make sure the base pairs are lining up throughout DNA replication.
After the group has finished DNA replication, the teacher will re-visit concepts from previous
lessons. The teacher will then show videos on DNA replication and have students take notes on
the major concepts.
The students will re-build their DNA model so they can illustrate DNA replication. They will
work as a group and be able to answer questions pertaining to DNA replication. After they have
34

done this, they will put away the KNex pieces in the correct bags. They will then take notes on
DNA replication by watching videos.
Lesson #4
Students will understand the process of transcription. Students will understand the steps of
transcription, the difference between RNA and DNA, how the base pairs line up, the process of
RNA splicing, and where transcription occurs.
The teacher will briefly review concepts from previous lessons. The teacher will then let the
students explore on the internet to find information about transcription. After some time
exploring, the teacher will then show the class some videos and have the students take notes on
those videos. At the end of class, the teacher will summarize all the concepts in the lesson.
The students will go on the internet and find information pertaining to transcription. They should
list the basic steps of transcription. After they list the basic steps, they will take notes on videos
of transcription.
Lesson Plan #5
The students will understand the process of translation. They will understand the steps of
translation, the different types of RNA involved in translation, the role ribosomes play in
translation, how mRNA is coded, and the final product of translation.
The teacher will briefly review concepts from previous lessons. The teacher will then let the
students explore on the internet to find information about translation. After some time exploring,
the teacher will then show the class some videos and have the students take notes on those
videos. At the end of class, the teacher will summarize all the concepts in the lesson.
The students will go on the internet and find information pertaining to translation. They should
list the basic steps of translation. After they list the basic steps, they will take notes on videos of
translation.
Lesson Plan #6
The students will understand the process of transcription and translation. They will understand
the steps of both processes, how they relate to each other, and be able to diagram both processes.
The teacher will briefly review concepts from previous lessons. The teacher will then put
students into groups to create a poster diagramming transcription and translation. The teacher
will go around to make sure the students are working and that they understand both processes.
After the students complete their poster, they will present it to the class. The teacher will ask

35

questions to each group pertaining to their poster. At the end of class, the teacher will review all
the steps of transcription and translation in detail.
The students will get into groups and create a poster diagramming transcription and translation.
The students will work together and be able to answer questions regarding both processes. They
will present their information to the class. After the groups have presented, they will take notes
on how transcription and translation go hand in hand.
IV.
Analysis
The purpose of this analysis is to see if there is a correlation between a
students grade in the class and their test score. Assumptions can be made that
those students with high grade percentages in class will have high test scores.
Several factors can play into this, such as internal and external motivation,
study time, note taking, test-taking skills.
Looking at the data, 7 students (about 1/3 of the class) had higher test scores
than their class grade. 15 students (about 2/3 of the class) had lower test
scores than their class grade. 1 student had the same percentage on their test as
their class grade.
There are 9 students that have an 80% or better in the class. 3 of these students
scored higher on their test than their class grade. 6 of these students scored
lower on their test than their class grade.
Student numbers 1, 4, 5, 6, 8, 11, 13, 14, 16, 19, 21, 22, 23 are males.
Student numbers 2, 3, 7, 9, 10, 12, 15, 17, 18, 20 are females.
Student numbers 1, 6, 14, 16, 22 have IEPs.
Out of the 13 male students, 5 males scored higher on their test than their class
grade. 7 males scored lower on their test than their class grade. 1 male student
scored the same percentage on their test as their class grade.
Out of the 10 females students, 2 females scored higher on their test than their
class grade. 8 females scored lower on their test than their class grade.
Out of the 5 IEP students, 1 scored higher on their test than their class grade. 3
students scored lower on their test than their class grade. 1 student scored the
same percentage on their test as their class grade.
3 out of 23 students scored 90% or better on the test. (About 1/7 of the class)
6 out of 23 students scored 80% or better on the test. (About of the class)
14 out of 23 students scored 70% or better on the test. (About 3/5 of the class)
The average class grade is a 79% or C+. The average class test score is a 72%
or C-.
Male students are averaging a 76% in the class.
Female students are averaging a 82.5% in the class.
Students with IEPs are averaging a 75% in the class.
Male students averaged a 72% on the test.
Female students averaged a 71% on the test.
Students with IEPs averaged a 72% on the test.
The highest score was a 100% on the test (male student) and the lowest score
was a 31% on the test (male student).
36

 Looking at the data, only 7 students (30% of the class) scored better on their
test score than their class grade.
Overall, male and female students averaged very closely the same on the test.
It is hard to say if the male students did better on the test than the females.
There were 3 more male students in the class than females. I could have made
the average of the male students go up or it could have made it go down.
Students with IEPs averaged the same as the male students and very closely to
the female students.
Even though the majority of the class scored lower on their test than their
class grade, they still averaged a 72% as a class on the test. That is a good
percentage to have for a class full of sophomores.
The class overall learned concepts throughout the unit and it shows by the
average test score as a class (72%). It shows that they meet the core standards
and the learning objectives throughout the unit.
A pre-assessment will more likely show progress due to students first being
exposed to some of the concepts in the unit.

37

38

Lowest score

39

Middle Range Score

40

Highest Score

41

Chantz Ramos
DM1 DM6 Reflection and Self-Evaluation
4/12/14
DM1
There was one student that could be classified as an ELL student, but that student speaks English
fluently so there was no need to make accommodations for that student. If I did have to make
accommodations, I would make a test that had their native language on it so they could answer it
in their own language or at least understand what the question was saying. I used several
examples that were relevant to some cultures to help support diversity and show the diversity
within the classroom.
DM2
I used technology within the unit to complement the learning process. I used YouTube videos to
help the students understand all the major concepts in the unit: DNA structure, DNA replication,
transcription, and translation. I also used YouTube videos to inspire students. Students these days
are up to date with technology and they appreciate it when you use it in a lesson.
DM3
As the year progressed, I became more confident being in front of the classroom and teaching the
content to the students. This confidence improved my subject matter knowledge that increased
the effectiveness of the lessons. There is always the challenge of finding ways to relate the
material to the students so they can understand it. I start to find new and efficient ways to do this
with more experience. I have confidence in myself as a person and educator to find ways to
relate material to the students and be an effective teacher and learner.
DM4
I created a physically and emotionally safe classroom environment by showing professionalism
and respecting the students. I like to ask them how their day is going and what dreams they have.
It shows that I care about them and they appreciate that. I also like to smile and laugh in the
classroom because it allows the students to feel welcomed and comfortable. Classroom
management strategies I found useful were close proximity, changing the tone of your voice
throughout the lesson, using different teaching strategies throughout a lesson, gain respect from
the students, and having a confident presence. Don't allow the students to sit in the desks the
entire time. Students lose focus if they sit for too long and it disrupts the lesson. Find creative
ways to get the students up and moving around. As a teacher, activities and experiments help
improve classroom management.
DM5
I found that the students learned the core standards and learning objectives by analyzing the unit
assessment compared to their class grades. A pre-unit assessment would most likely show little
knowledge for the concepts within the unit. I was looking for the correlation between overall
42

class grades and the chapter 11 and 12 test scores. It lets me see which students do well in the
class overall and which students struggle or do well on tests. The average class grade and the
average of the test scores were similar, where some students had higher test scores than their
class grades, some students had lower test scores than their class grades, and one student scored
the same on the test as the class grade. I could use this data to improve lesson plans and my
approach at teaching the concepts. It makes me a more effective teacher and learner.
DM6
I have gained valuable knowledge and experience from my student teaching experience. The best
way to learn to become a teacher is to be a teacher. I had the opportunity to take over a few
biology classes and it taught me how to be an effective teacher and learner. I improved greatly
from my first day of student teaching to the end of my student teaching. I look at myself and see
great confidence in my ability to relate the material to the students and be a great and effective
teacher and learner. The most important part of teaching is to have a caring and professional
relationship with the students, parents, and other teachers. Students learn better if they feel
comfortable around the teacher. Students also show greater appreciation to the material and focus
better if they have respect for the teacher. Parents are important to stay in touch with because
they can spend time with the students outside of class and make sure they are getting their work
done outside of class. Other teachers can help with ideas with lesson plans or work to collaborate
on projects that pique student interest. I learned the value of having caring and professional
relationships with the students, parents, and other teachers throughout my student teaching
experience.

43