Вы находитесь на странице: 1из 383

.

..............................................................................................................3
1- . .................................................................................7
2- ........................................................................................12
3- . ..............................................................................................17
4- . ..................................................................................23
5- . ...................................................................................................27
6- . ......................................................................................................32
7- . .......................................................35
8- . .........................................................................40
9- . .................................................................................45
10- . ....................................................................................49
11- . ......................................................................................................55
12 . .....................................................................................................61
13- . ............................................................................................66
14- . ................................................................................70
15- . ....................................................................................76
16- . ..........................................................................................82
17- . ..................................................................................................................88
18- . .............................................................................94
19- . ........................................................................................100
20- . ....................................................................................106
21- . ......................................................................................111
22- . ...........................................................................117
Corpus Christi ................................................................120
...............................................................................................................121
........................................................................................................................122
...........................................................................................125
..................................................126
................................................................................................128
....................................................................................................134
23- . .....................................................................................135
24 () () ....................140
25- . ...............................................................................146
26- ....................................................................................151
27- . ...................................................................................................157
28- . . .......................................................................161
29- . . ............................................................................168
30- . ..........................................................................174
31- . ...............................................................................182
32 .........................................................................187
33- . ................................................................................194
34- . .......................................................................................199
35 : ....................................................................................204
36- . .................................................................................209
37- . . ......................................................................................213
38- . ....................................................................................................220
39 . . ..........................................................................225
40- . ....................................................................................230
41- . ...................................................................................236
1

42 . ................................................................241
43- . .........................................................................................................245
44- . ............................................................................251
45- .................................................................................256
46- . . ......................................................................................262
47- . ..............................................................................267
48- . ....................................................................................272
49- . ............................................................................278
50- . .................................................................................284
51- . ..............................................................................289
52- . ..................................................................................................295
53- . .............................................................300
54- . .....................................................................................................305
55- . , ..............311
56- . ..............................................................332
57- . ...............................................................................................339
58- . ..............................................................................344
59- . ..............................................................................349
60- . ............................................................................................356
61- . ..........................................................................................362
62- . ....................................................................................................367
63- ....................................................................................373
64- . ..............................................................................................379

.

, ,
,
. , 46 ,
23 . ,
. ( ),
.
,
, .
, ,
( , , ).
, . 64 : 61
, 20 , -
.
, 20 ,
44, , ,
, .
- .
.
, , ,
. ,
-. -
, .
2003
, .

. ,
. , ,
, , ,
, , . ,
, ,
. 33 ,
. ,
, .
, ,
. -,
? : , 50 %
, 40 % ; ,
. , 99,9 %
.
, ,
*,
, , ,
, ,
.
.
, , ,
3

. , ,
, . ,
, , , .

, ,
.
- - .
, .
64 , ,
20 . 44
? ? ,
? , 20 ,
44, ,
, , .
,
.

, .
. , ,
, .
, ,
. ,
.
46 , .
, . ,
80 . , .
64 , , 64 ,
: , ,
.
,
, .
, , , .
. , .
- ,
.
. ,
,
, ,
. ,
.
,
. ,
. , ,
( , ),
, . , 22
, , ,
.
.
4

, ,
, , , ,
.
( , ,
, ),
.
44
. , , ,
, . ,
.
,
, .

44 ,
, ,
, . ,
( *),
, , .
* . : . . .: ACT, 2006.

, , .
.
.
, , ,
.
, ,
, .
, .
, . ,
.
, ,
, .
. ,
, ,
, .
, ,
, .
, , ,
. , , ,
, . !
, ; ;
. , ,
.
,
.
, , , ,
. ,
,
5

. , , VMAT2,
,
. , ,
. ,
, ,
, .

1- .
, ,
: 2- , : (1, 14),
: , : .
1-

- , , ,
.
, ,
, , .
, , ,
,
.
,
, ,
, :
, , ?
,
, .
,
, .
,
. ,
. , ,
, , , .
, ,
.
.

, - .
.
-
.
, , .
6 ,
, 64-
. ,
.
.
, ,
, .
, ,
. ,
, , - , ,
! ,
, .

- , 64
.
1- 2- 63- 64- .
.
.
1-
. :
.
, .
. ,
,
. 1-
. ,
. . ,
,
. .

. ,
,
. . ,
. 1-
. ,
, 64- .
, .
? ,
,
. , , , -,
, ,
. , .

,
.
, ,
. , ,
, .
.
, . ,
.
.
.
1- , ,
. ,
, , .
, ,
, 1-
, .

.
,
. , ,
.
. ,
8

, .
/ ,
, , . . ,
- .
, .
,
, .
( - )
, ? 1- 2-
, ,
, .
, , -
, , .
- 1- , ,
. ,
.
, , .
, ,
,
, .
, ,
.

.

- , .
,
. .
, .
,
. ,
, .

,
. ,
, .
, ,
,
. ,
.
,
.
1-

,
.
!
. ,
, .
.
. ,
9

, , . 2-
, , 1-
, .
,
, , ,
, .
, ,
, . 1-
, ,
, .
, , .
, - .
, 1-
- .
1- .
, ,
.
, ,
!
, , .
, ,
, .
1- ,
. ,
, , ,
, . ,
, ,
, .
, ,
,
.

. , , ,
. , 1-
14- , .
,
, , .
, ,
, , .
.
, , ,
. 1- ,
.

. , ,
. ,
, .
, ,
.
, ,
. -
.
10

,
, .
1-

, 1- .
, , , , ,
. , .
, , -,

.
, .
(1-, 2-, 63- 64-)
,

. Hayoth H Kadosh'
,
.
, ,
. , 64
, ,
.
,
.
1-
. 1- ,
, 2- . .
, ,
.
, .
, , .
, , .
, , ,
. , - -,
, .
, , , .
- . , , .
. ,
, . .
.
, ,
. -,
.
, ,
, .
1- , .
. .
.
.
,
, , .
? , . ,
, , ,
11

,
. , ,
. ,
.
.
,
, .

. , ,
.
, ,
. ,
- -,
. .
, , .
.
, 1- ,
. ,
, .
,
.
, .
(1- 14-
).

, .

2-
:
:
:
: 1- , : (2,
: . :
2-
,
() 64- , 2-
, ,
.
,
. 1-
, 2- .
, , .
, ,
. , ,
,
, .
,
. , , ,
. , ,
12

.
2- , .
, .
, , ,
. ,
.
,
. ,
. .
,
.
. .
, , ,
, ,
, .

, .
, , , ,
. :
,

.
,

, ,
.
,
. , - ,
.
.
.
, ,
,
.
, , 2- . ,
,
. .
. 2- , 1- ,

. ,
, , .
, .
, , 2-
, . ,
,
,
2- .
,
. , ,
. 2-
, .
13

,
.
.
, .
, ,
, .
.
,
. , .
-, ,
.
.
, ,
. , , ,
!
, . , .
,
. , , ,
, . ,
, , .
2- ,
, .
,
.

2-
.
.
,
, .
. ,
,
.
.
.
.

.
, .
,
. ,
. ,
, 2 .
, ,
, .
,
, .
2-

, 2- , 2- .

14

-. , 2- ,

, , ,
. , ,
, .
, - ,
. ,
, .
, ,
.
.
. , ,
, ,
. ,
, . ,
, .


. ,
2- . , , .

, .
,
.
8- .
, , 2-
, .
,
.
,
. .
, ,

, ,
.

, ,
.
.
, .
. ,
, 2-
. , ,
, . , ,
, .
,
. , ,
, ,
.
.
2- , ,
.
15

, .
, ,
,
. 2-
. (
) 2- ,
, , . ,
, .
, .

.
2-

2- .
, .
,
. ,
.
, . .
.
, .
, . ,
, . ,
. ,
.
, ,
, .
, ,
2- ,
. . ,
- , , .
,
,
. ,
. - , ,
, , .
, . ,
, ,
, ,
. . , .
,
, .
. .
, ,
, , .
, , ,
, .
, ,
, ,
. .
, ,
, .
16

, .
.
,
.
, .
.
, .
2- .
, .
;
, . ,
,
. , , , 2012
,
. , 2 , 2012, ,
, , .
, -,
2027 ,
55- ,
. 2012 2027
,
. 2- ,
,
. ,
, ,
. ,

.

3- .
:
:
:
: 50-
: (3, 20, 23, 24, 27, 42)
:
:
3-

3-
. , ,
. ,
, ,
,
.
, - . , ,
. ,
, , ,
17

, , .
,
, , ,
, .
, , 3-
, .
, ,
, , ,
. ,
, , ,
, .
-
. , (. chasm) (. chaos)
, 3- , .
,
. -
, .
3- , ,

.
. , ,
.
, , ,
. ,
,
. ,
, .

.
,
.
.
, , ,
(), . , ,
, ,
, . ,
. , ,
. , ,
, .
, ,
, , .
, ;
,
.
3- - - ,
. ,
.
.
, , ,
3- . ,
. .
, 3-
18

. ,
, . , , , , .
, , ,
.
, ,
, ,
.
, ,
. ,
, ,
.
, ,
. ,
, .
, , , ?
- 50- . ,

, ,
. , , ,
. . 3 , ,
. , ,
. 3- ,
, . ,
,
,
.
()
, ,
.
, ,
.
, , , .
,
.
.
,
. ,
, , .
c
.
, .
, .
, ,
, . -,
. ,
. , ,
, ,
. ,
3- .

19

3-

3- , , , ,
, . ,
, - ,
3- .
,
. , ,
, , - ,
. ,
,
. ,
.
.
,
.
, , , .
,
,
, ,
. ,
3- .
- , ,
( )
.
. , , ,
. , , ,
, . ,
, .
, . ,
.
, , .
. 3- ,
. ,
, , , .
,
. ,
.
.
, .
- . 3-
, - , ,
, .
, .
, - - .
,
. ,
, .
3- , ,
.
, .
3- , ,
20

3- , .
, ,
, ,
. (
!), .
. ,
, .
, ,
. .
,
. , ,
, , .
,
. , ,
, .
, ,
.
,
,
. , , ,
.
, ,
. ,
, ,
. , . ,
. :
,
.
3-
3- , ,
3- . ,
, .
3- .
, , , .
, .
, , , ,
, . ,
, ,
.
.
, , , ,
.
. , ,
! , ?
, , , , ? -
, , ,
. , , ,
. , 3- , ,
!
, .
. , ,
21

, , 3-
, .
3- , .
, ,
3- . , .
, , ,
. ,
, ,
.
.
.
: . ,
, .
, , , .
. 3- , ,
,
( 55- ) .
, .
,
, .
, , , .
, ,
.
, ,
. ,
,
. ,
. ,
.
, , , .
,
. , .
.
, , , .
.
, ,
.
,
. ,
. ,
. ,

. ,
! ,
, . ,
, . ,
,
, ,
.
3- ,
, . :
. .
22

,
,
. ,
. ,
, , . ,
, - ,
.

4- .
:
:
:
: 49- . : (4, 7, 29, 59)
: . :
4-

, 4- -
(),
. 4- , ,
.
49- .
, .
,
.
, .
, 4-
.
, , 4- ,
.
, , ,

. , 4- ,
, -,
. .

, ,
. .
,
, .
,
.
, .
4- , .
, ,
. ,
, . 4-
,
.
,
23

. ,
. ,
.
, ,
. ,
, .
, .
, .
4-
, , -
.
. 4-
, ( )
. , .
, .
, ,
-. ,
,
.
, .
, .
,
.
4- , ,
. .
, .
4- , .
, , - ! ,
4 , - ,
. ,
.
;
, , , ,
. 4 ,
.

4-
, .
-,
, . , ,
, .
, ,
.
. ,
.
. ,
, , .

.
, ,
24

. ,
, !
,
, .
,
.
.
, ,
,
.
4-

4- .

. . ,
.
. , , ,
, ,
. ,
. ,
.
4- ,
,
; .
,
.
. .
, ,
. , ,

.
- ,
, ,
. ,
, ,
.
,
. ,
, .
4- , , ,
,
. ,
, . ,
, .
,
4- .
,
4- .
,

, . 4- 49-
25

, .
,
4- .

,
. ,
.
, 55- 49- , 4-
, .
,
, 4-
. 4-
. , ,
; - . 4-
.
,
. , 4- ,
,
, .
4-

,
. 4- , ,
.
,
. ,
.
, . ,
, .
, .
, ,
, .
4- .
, ,
.
. , ,
. ,
, . 49-
, .
,
. , ,
.

.
,
. ,
. . ,

. . ,
, ,
. , .
26

,
, ,
.
, .
,
. ,
, .
22- , .
4- , , ,
.
.
. ,
, .
, 4- ,
.
, . , ,
. ,
, . .
,
. ,
. ,
4 .
, .
, ,
, , , , ,
, . ,
. 4-
, , , , ,
-. ,
, .
, .

5- .




35- , : sacral plexus, :
. : (5, 9, 11, 26)
5-

64- .
5- , , .
,
. 5- ,
, ,
. , 5-
,
27

.
5- ,
. 5-
. ,
. ,
. ,
. , ,
, , .
, , ,
5- .
, .
, , ,
,
.
.
5- .
. ,
,
. ,
5- .
,
.
, ,
, .
, , ,
.
.
,
. ,
.
, , . ,
. , . ,
.

,
, ,
.
, .
, .
32 . .
5- 35- .
,
, , ,
. ,
, . ,
, . ,
, ,
, .
, , ,
.
5- ,
28

, .
, , ,
. ,
, ,
. ,
.
.
, . ,
, , ,
.
, , ,
. .
,
. , .
.
, , .
5- .
,
, .
, . 5-
,
, .

, .
.
, .
,
. .
,
. , ,
/ .
, ,
. , ,
, .
, ,
.

.
, ,
. .
, ,
. ,
, ,
.
, , -, - ,
. ,
, , ,
.
? ,
, .

29

5-

. ,
. , ,
! .
. , ,
, ,
. , , .
. ,
.
. . ,
, , ,
. ,
,
. .
,
. ,
. ,
,
,
. , ,
, .
, 5-
. , ,
. ,
.
, , ""
. ,
.
. , ,
. . ,
, .
5- , .
, ,
. ,
. ,
,
.
,
, ,
. .
.
. ,
.
, .
, , ,
. ,
, ,
.
30

, , ,
. ,
.
.
. ,
. ,
, .
.
5-

,
,
. , , , ,
, ,
. , , ,
, , . ,
.
,
. ,
.
, , .
, , ,
. ,
, , ,
, , .
. , ,
, . ,
, . ,
.
. , 5- , ,
.
. .
,
.
.
, .
, .
, .
, ,
, .
,
. ,
. ,
. ,
. ,
, , , .
.
5- ,
- !
.
, ,
31

. .
. , ,
, .
.
, .
,
.
. .
, .
, .
. .
. , .
. , .
. .
, .
64- 5- .
, .
. , ,
, , !
, , , ,
, .
,
. ,
, .
5- . ,
.
, .
. ,
, . ,
,
. , 63 ?
, .
, .
: ?
, , ! ,
"" ,
, . ,
.

6- .
:
:
:
: (lumbar ganglia)
:
: 36-
: (6, 40, 47, 64)
6-

6-
32

. , 6-
, .

.

. ,
.
, 6- pH ,
,
. 6-
. ,
.
, , ,
, . pH ,
.
,
, , , .
6-
. ,
. -
, . ,
, .
.
.
, 36- ,
6- , . 36- ,
- .
.
. 36-
, 6- , ,
. ,
.
.
,
. , .

.
, .
6- ,
. .
, ,
.
,
.
6-
. -
,
. 6-
.
. , 6-
, .
, .
33

,
.
, ,
.
6- . , ,
. 6- ,
. , .

7- 14- , .
, ,
. ,
.
, .
.
,
.
6- , .

, . ,
, , ,
.
-
6- ,
, .
,
. - ,
.
. ,
,
. - ,
.
, . ,
,
, ,
.
.
6- .
,
.
,
, .
.
. .
, , , ,
.
- , .
,
, , .
6- .
.
, 6- .
,
34

.
.
, .
pH ,
. , -
,
. \,
.
pH .
, \, ,
. , . 6-
, ,
. , ,

, .
, .
. .
.
, 6-
.
.
, , .
, ,
.
,
.
, .
6- , , .
\ .

7- .
:
:
:
: 13-
: (4, 7, 29, 59)
:
:
7-

.
, .
, .
, ,
. ,
.
, .
. -
. ()
35

,
, .
, , ,
. ,
.
, ,
. , ,
,
.
.
,
, .
,
.
, ,
. ,
.
. ,
. ,
, ,

. , .
1989.
,
.
, , , ,
, , ,
, .
13- , . 13-
.
.
, ,
. , ,
, ,
. , , ,
. ,
, . ,
, ,
, , .
, ,
, . , , ,
.

.
, .
, ,
. ,
, , . ,
,
! ,
. .
, , .
36

,
, , , .
, ,
. .
, . ,
, .
, .
,
. ,
, , , .
. ,
, .
.
, .
, , ,
. , ,
,
, , .
, , .

, . ,
,
. , ,
.
, ,
. , , ,
, . , ,
, . ,
,
.

,
, .
, ,
. ,
, ,
. ,
, .
,
, .
, . ,
, .
7-

, , . ,
,
. .
, ,
. . ,
,
, ,
.
37

, ,
.
.
, , .

, , .
, , 13-
,
. , , . ,
. ,
, .
, . ,
,
, .
.
,
, .
. , , ,
, .
, ,
. ,
. , ,
.
, , .
, . ,
, , ,
.

. , 40-
XX- ,
. , ,
.

.
.
. ,
, ,
, , .

.
,
.
. -
, .
(1- ), (4- )
- (7- ). ,
() . ,
, .
, .
,
. ,
,
38

- , .
,
, .
.
7-

, .
,
.
, . ,
, .
, . .
, ,
.
. , -,
, , .
.
. ,
.
, ,
. ,
, .
,
. ,
.
: .
,
.
, .
. , ,
.
,
. ,
, .
, ,
. , .
. , ,
.
, .
,
. .
, ,
.
tikkun olam,
( ). ,
, , ,
. ,
. ,
, .
, ,
,
.
39


. , ,
.
, . ,
, ,
.
,
. , ,
, .
, 13
. , ,
. , 13-
. .
, 13- ,
.
. , ,
. , ,
, .
, , ,
4-, 29- 59- .
, .
,
.
, ,
.
, .
, ,
. , ,
. , , , ,
- .
144000,
44- . ,
.
,
, .
,
. .
, , ,
, , 13- .
, , .
.
,
. . ,
,
, , .

8- .



40

: 2- : (2, 8 )
: (). :
8-

, , ,
. , ,
, .

. ,
. 8-
.
- , , ,
.
.
, ,
, .
, ,
.
,
.
21
, , ,
. , ,
.
,
? 8-
?
. , ,
, -
.
. ,
.
, 8- ,
, ,
.
8- , .
, 14- .
, , ,
, .
, , , . ,
, 14 . ,
. 8- ,
, ,
, .

, ,
. -, .
, ,
41

, ,
. , .
,
, , .
, .
, .
, 8-
, , .
. .
, , .
8- . ,
.
,
. , .
? , ,
.
. , , , ,
. 8-
, , , .
, ,
. ,

. , ,
. ,
.

, ,
. ,
, .
, . -
. ,
.
, ,
.

.
.
,
. .
,
.

. ,
,
.
8-

- 8-
. 8- ,
- .
. .
42

.
.
, , .
, ,
.
, .

. , ,
,
, .
,
, .
. .
, .
.
, . ,
, ,
,
.
, -
. , ,
. , ,
.
. ,
.

. , ,
.
, ,
.
,
.
, 8-
. , -
, ,
. ,
, ,
-. !
. ,
, .
, 8- ,
. 8- ,
, , .
. ,
,
. , ,
,
, .
8-

8- .
43

, .
, .
,
,
. , .
, ,
.
,
,
,
, .
, , .
, .
, ,
, .
. ,
,
. , ,
. , ,
, .
, . .
: .
8 .
, , ,
.
, , .
, .
,

.
8- . . .
.
.
. , ,
.
. ,
. ,
, , ,
. ,
8- , . ,
.
. .
, ,
2- . ,
.
. ,
.
,
.
.
, 8.
44

.

.
8- .
, . ,
- .
, .
, ,
, , -, . 8
, .
,
. ,
,
.

9- .
:
:
:
: 16-
: (5, 9, 11, 26)
:
:
9-

- ,
. , -, ,
26- . ,
.
, , .
. 9 , ,
. ,
. , ,
. ,
, , (16-
9- ) , ,
(16- ).
,
.
, ,
, . 9-
, , , , .
.
. 9- 9
, . 9-
, , , ,
, , .
.
45

, . ,
, , , .
, . 9-
. ,
, .
, , , . .
, , ,
.
, , . ,
, , .
, ,
, , .
,
, . , 9-
, .
, .
. , , , ,
. , ,
,
. , 9-
.
.
9-
, . -
, .
9- -, ,
.
, 9- , 16
, . .
.
, , ,
. ,
. ,
, . 9-
, .

. ,
,
.
, 9 .
,
,
. ,
, , .
,
. , .
, ,
.

9- .
- , ,
.
46

, ,
. , ,
. ,
.
,
, , .
,
.

9- ,
. ,
. , ,
. ,
,
, .
. .
, .
,
,
.
9-

9- .
. -
, :
.
. , ,
, .
, , ,
. 9- : ,
, ,
. , , ,
.
9- . ,
. ,
, 9- .
,
, . ,
,
. ,
, ,
. ,
.
9- ,
, .
, ,
. .
, , , ,
. .

. 9-
47

, . ,
, ,
.
9- . ,
,
. , ,
,
. .
, , ,
, .
, 9-
. , ,
, - .
, ,
. ,
, .

. , ,
, , ,
, , .
. , ,
.
, , ,
. ,
, , .
,
.
9-

, .
,

-, .
9- ,
. , 9- ,
.
.
. ,
.
.
, ,
. , - ,

.
.
, . ,
: 9-
26- . 9- , 26- .
, .
, .
, , .
48

, - , .
, , ,
. ,
, .
, , .
9- ,
, .
, . 9- ,
,
. ,
, . , 9-
, .
, ,
, .
,
. , 5-, 9-, 11-
26- , ,
, - . ,
, .
, , ,
- , .
,
, .
. ,
, , ,
.
9- , ,
. ,
,
. ,
, , .
, , ,
.
, .
, - , ,
, , :
.
, , , ,
.

10- . .
:
:
:
: 15-
: (10, 17, 21, 38, 25, 51)
:
49

: ()
-

10-
: .
, 10- ,
,
.
.
, 64- .
-
.
. 10-
,
. ,
- 10-
, - .
10- - ,
. 10- -
, , .
- .
,
. ,
, , .
-
. , , ,
, .
- 15- , 15-
, . 15-
, , .
15- ,
, 10- -
, .
- , , , . 10-
.
, , .
, ,
. , ,
, .

- .
10- , , - ,
. -
. -
, , .
, , ,
, .
, , ,
.
50

- 10- ,
- . ,
, , ,
- . . -, ,
- " ". ,
,
, .
,
, .
10- - ,
.
- . ,
, , , .
, .
, ,
. -
. -
, . ,
,
, - . ,
.
, .
. , ( 10- - ""),
, , , .
, -
.
, , .
, 10- , ,
10- .
- -
- - .
-
, . ,
. ,
. , ,
, .
,
- -
. - . -

.
-
- ,
, .
,
. ,
.
.
51

. , -
.
, ,
. , - . ,
, , -
.
-

- , .

. -
10- . -
. , - ,
. , , . , , "
?". , ,
,
homosapiens, . - ,
10- ,
.
, , , , .
, .
" ?" , .
10- - , ,
, - ,
- , ! ,
" ?" ,
10- . 10-
, . ,
,
, - . ,
, , , , ,
, .

, .
- .

. ,
.
.
, , ,
. , , "",
" ?". ,
, " ?" " ?",
.

,

.
,
52

-, -.
, ,
,
.
.
, ,
.
,
, . , , ,
.
,
- .

, . ,
- ,
, .
,
. , ,
,
.
.
21 . 10-
, " ",
10-, 17-, 21-, 25-, 38- 51- .
,
. ,
. (25),
(38), (17),
(21) (10), (51).
, ,
. ,
, . ,
, , !
-

,
10- , .
, -.
, "
?". - 10- . 10-
, . 10- ,
,
. , , - , , , , . ,
, 10- - "".
" ", ""
. 10- "" - ,
.
10- ,
53

. - 15- ,
.
, -
,
. ,
""
"" . - , 10- , . ,
, , .
, 15- ,
.
, ,
.
- -
.
, . 10-
.
10- , ,
, . ,
, .
-
, ,
. ! ,
, ,
, , .
- , .
,
.
10- ,
. , .
, 10- ,
, , ,
. 10-
- ,
. 10- - , ,
, .
, ,
, . 10-
, , . .
, 10- ,
. - ,
, .
,
. ,
. , , , ,
10-
. ,
. .
. , ,
, .
54

, , ,
.
, !
, 10- , ,
, , ? -
, . .
, 10-
. , .
, ,
.
,
- ,
.

11- . .
:
:
:
: 12-
: (5, 9, 11, 26)
:
:
11-

11- . ,
, .
, .
,
.
.
, 11- ,
5-, 9- 26- . ,
. , 5-
, , .
,
, . 26-
, 9-
,
, , .

, ,

. 11-
. 11- ,
55

. , 11-
. , ,
.

, , . ,
, - . 11-

,
,
,
.
, . ,

, .
,
11- 12- .
- ,
, . :
, 11- . ,
, ,
. ,
, ,
. , ( 17- ) ,
, .
, ,
.

12- . , ,
11- -
, .
- ,
, ,
. , 11- 12- ,
. ,
. ,
.
.
, , , -
, , ,
.
.
.
, -
, , ,
.
, ,

.
,
, .
56

11- ,
. , ,
, .
, , .
,
. ,
. ,
. ,
, , .
, , .
, . ,
, ,
, .
11- , ,
, .
,
, .
,
, .
, 11- 11- . , ,
, , ,
, .

,
. ,
, .
, .
,
. , ,
, .
, , ,
, , .
, .

, ,
.
, , ,
. ,
, . , ,
. -
, .
, . -
, , .
, .
11-

11- . ,
57

,
. , ,
11- .
.
, . , ,
.
, , ,
11- .
.
, ,
. 60-
, , , -
.
. , ,
11- . ,
, , - ,
.
.
11- ,
.
, , ,
. , :
, ,
. , ,
, ,
,
. , .
,
,
.
, .
, ,
.
.
, .
, , .
, .
,
.
, . ,
, .
11- ,
.
.
11- , , - ,
. ,
. 11-
, . ,
.
.
.
58

, . 11-
,
.
,
.
.
, .
. 11 .
11-

11- ,
, ,
, .
,
, .
.
, ,
.
, ,
, - , , . ,
, .
;
, ,
. .
,
. -
. ,
. .
, .
. 11-
. ,11-
, , ,
, .
, .
.
11- ,
- .
. 11 ,
, .
,
. , ,
. , .
.
, , ,
.
11- . ,
, . ,
, , ,
59

, . , 11-
, , , , ,
, .
.
,
. ,
, .
,
.
,
11- . , , .
,
, .
, 11-
, . ,
, ,
. ,
, .
.
11- .
, .
,
.
, - 11- ,
. ,
. , - .
, .
,
.
.
, ,
.
. ,
. 11-
. . ,
11- .
,
. , .
, , 55-
, 11- ,
. ,
, . ,
.
11- ,
, 2012- . 55- , ,
,
. , 2012-
.
.
64-
, ,
60

. 11-
. 11- .
2012 ,
. ,
.
, .

12 . .
: 11
:
() 12, 33, 56
:
: ( ()
:
: \
:
12- .
12- , ,
. 64-

. ,
,
-.
. 12- , 56- 33-,
, -. -,
,
, . 12-
,
.
12- . 21
.
, 12- .
, (26- ), .
,
. ,
. ,
. , ,
.
, ,
, .
12- . ,
, .
, ,
- , .
12- ,
.
,
61

. , , , .
,
.
, , .
.
, ,
,
. , 12-
, .
.
,
, , .
. , -
, ,
. ,
, . ,
thyroid , .
12- . , ,
, ( )
. ,
, , . 12-
, . ,
, , , ,
. ,
.
, 64- .
- , .
12- , , .
. ,
. , , . ,
,
. , ?
? , - ,
. , ,
! ,
,
, .
, , , ,
.
, , . ,
. ,
, - .
, , , . ,
, 11- , .
, , .
, ,
, .
,
! ,
, . , ,
.
.
62


. 12-
, .
, . ,
, . ,
.
, .
, .
, .

. , , ,
.

.
, , .
, ,
, .
,
, , ,
. 12-
. ,
,
. ,
.
12- . .
, , 12-
, , .
, .
, .
. . 12- , , ,
, , . 12- ( 25-
) . ,
, . -,
- , , .
12- .
, . ,
, .
, ,
, - - .
.
( 18- ) ,
. ,
. , -
,
. , ,
. .
12- .
, .
12- 11- , - ,
63

, ;
. , ,
, .
, - ,
, .
,
. ,
. 12- ,
. , .
, , ,
. , ,
.
, , -
. ,
. ,
,
. 12-
, ,
.
12- . ,
. ,
, ,
,
.
, 12-
. , 12-
, ,
.
, .

, . ,
. ,
. 12-
, , -
- .
12- .

, .
,

.
12- .

. ,
. , .
, .
, , , , ,
, . , - , - ,
.
64

, .
.
, .
.
. ,
. ,
, .
.
,
. , , ,
.
-
,
.
, , , .
. , .
.
, ,
. , ,
. .
, ,
, . ,

. ,
.
12-
.
, , , .
,
, .
. , ,
. , ,
, . , ,
,
.
12- ,
. ,
, .
, . ,
. 12-
, , .
,
.
. .
, . ,
64- ,
. ,
. ,
, .
. ,
. ,
65

, . ,
, , .
.
, ( ,
, ),
(
. 25- ).
.
, . . ,
.
, .
! ,
. , ,
. -
, .
, .
, .

13- .
:
:
:
: 7-
:
: (13, 30)
:
13-

13- .

. 13- ,
.
. ,
. ,
.
.
. -
,
, 13- .
7- 13-
. ,
. ,
, . 7-
13- .
7- , 13-
.
, , , . ,
66

, . 13-
, .
.
,
. 13- 30-
. 30-
. ,
. ,

. ,
, .
30- ,
, .
, 30-
. ,
. ,
.
, , ,
. .
, ,
- .
, ,
.
, - . .
, .
.
13- .
13- - .
,
13- . , ,
,
. , .
. ,
.
.
7- , .
, , .

, . ,
.
. ,
, , ,
. , .
. ,
, , , ,
, .
,
. ,
.

, .
, ,
67

, .
, ,
. , .
,
. ,
, ,
.

/ .
, !
, .
,
.
, .
, ,
.
.
13-

.
,
. 13- .
, ,
.
, . ,
,
. ,
, , ,
. ,
, -, ,
, . .
. ,
. , 13-
. ,
,
. , , , ,
.
,
.
.
,
, .
, ,
.
, , .
,
.
.
,
. . ,
, ,
68


. ,
, , ,
. ,
, ,
, .
.
, ,
. .
, .
.
,
. , , ,
, , .
,
,
.
13-

13- , 7- , .
, ,
, . ,
, . ,
. 13-
. ,
. ,
. 13- , ,
. .
, .
, , ,
.
, ,
. , .
. ,
-. ,
,
.
.
. ,
. ,
.
, .
, 13- . , 13-
, , . ,
, , . ,
,
. .
, .
, 13- ,
.
. , ,
69

. ,
.
13- 7- . 13-,
, , 7- .
,
. ,
. , ,
- , -.
- , .
. , ,
.
, , .
, ,
, ,
. ,
. , ,
.
, ,
.
13- . ,
, .
13- ,
.
, .
, ,
, . ,
.
, , ,
, .

.
, ,
.
. , .
, .
,
.
,
,
. , , ,
, .
, ,
.

14- .



: 8- . : (1, 14)
: . :
70

14- .
- , 14-
,
. , ,
, . 14-
. ,
, , , .
. ,
,
, 14- .
.
. 14- ,
. ,
, , .
, .

, . 14- 8-
, ,
, .
, ,
- ,
.
.
.
,
. ,
. , ,
, .
.

. ,
, , .
,
.
, .
,
, ,
, .
. ,
.
, , , .
, .
. , ,
, ,
. ,
. ,
. ,
,
. ,
. ,
.
71

.
, . ,
, . , -
, . ,
.
, ,
. .
64 .
64-
. ,
,
, . ,
- .
. ,
.

.
, .
, ,
.
14- , ,
, , .
1- .
. ,
,
,
. , ,
.
, ,
, . ,
, .

. , ,
. , , .
,
, ,
.

, , 14-
. ,
.
14- , ,
, .
, 14- .
,
.
, .
. ,
.

.

72

, ,
, , .
,
,
. .
, ,
.
. ,
.
, . , .
14-

, , ,
. ,
, . , ,
, ,
. , ,
.
, ;
;
;
.

.
, . ,
. -
, ,
.
,
.
.
,
14- .
.
. ,
, . ,
.
, .
, ,
, .

.
14- .
, .
, 14
. , .
14- , , ,
.
, .
, .
73


.
14- 8- .
. -
, . 14-
. 14-
.
, , .
,
, . 14-
, , ,
.
, , ,
. , ,
, .
,
.
14- .
, ,
. ,
.
, , .
, ,
. ,
, . ,
. -,
. .
, 14- .
. ,
. , , 14- ,
,
. ,
, .
, 14- ,
,
. , ,
. 14- .
.
-, , , .
, 14-
.
14-


. ,
.
,
. .
- ,
, ,
.
74

, ,
.
,
. ,
, , ,
. ,

, , !
, ,
. , ,
, .
,
, !
64 ,
, .
, .
, ,
, .
, ,
, . , ,

.
. .
.
, - .
, , ,
, , ,
,
. ,
, .
14-

14- .
, .
.
14- , .
. ,
14 , . ,

.
. ,
, ,
, , .
14- ,
. , ,
, .
14- , .
, . ,
. 14-
. 14- ,
.
. , 14- ,
75

. ,
, ,
. . ,

.
14- ,
. .
, 14- , 14-
.
.
.
. , ,
. ,
.
, .
, , , ,
.
, . ,
,
. .

15- . .




10- , (15, 39, 52, 53, 54, 5,
, .
15- .
T.. , ,
- . , ,
, ,
. ,
" ", ,
- . ,
, .
, ,
. 64-
, .
, , .
15-
, .
,
. , ,
, , ,
, .
76

, 15- , ,
. , .
, ,
, .
.
15- .
.
. ,
, .
15- ,
. ,
, ,
. ,

, ,
.
15- . 15-
.
,
, ,
. ,
. , , , ,
.
. , , , - .
.
,
. , . ,
, .
. ,
.
, - , , ,
. , ,
.
, , .
, . , ,
. , , . ,
, , -,
.
15- ,
.
, , . , ,
,
. , ,
. .
, .
.
- , , .
, - ,
. ,
15- .
77

, ,
. ,
, .
- . . .
.
,

. 15- , ,
. ,
.
,
, . ,
. , , .
, , , -
. , ,
, , .
15- 10- , ,
. .

, . ,
, , .

, . .
. - , -
. , . ,
( , () ),
. . ,
. ,
, . .
. , , .
, . ,
.
.
-
,
. ,
(. 35- ).
, , .
.
.
. , ,
- .
, .
, ,
. , -
,
, . -
.

, .
, .
78

, ,
. ,
, , . ,
.
, ,
. , ,
, .
15- .
15- . ,
,
. 1977
.
. 7,8 (1),
.
, . 15-
. -
, , .
, ,

.
, , .
, ,
, .
. .
"". , ,
. , .
,
, .
.
,
.
, ,
. ,
, .
,
.
,
, 15-
. , ,
,
. . , , ,
, .
, .
,
, , , .
,
.
, 15- ,
. .
, ,
79

. , .
, 15- ,
.
,
.
, 15-
. , , 15-
.
.
,
, .
15- , , .
, ,
. ,
. 15-
,
. 15-
.
, .
, ,
, .
, ,
.

. . :
. ,
. 15-
.
,
,
. ,
,
.
15- . .
15- , , ,
.
. , .
, . ,
, . ,
. , - , ,
, . ,
, , .
, ,
, .
, .
, , ,
.
15- 10- .
- ,
80

, ,
. , , , ,
, ,
. , , ,
, .
, ,
, .
, .
, !
,
. , .
, .
. . , ,
,
. , - !
, ,
. , .
, , ,
. . ,
!
15-
.
,
. , 54- ,
, 52-
. 15- ,
. , ,
, ,
. , ,
. ,
.
,
. ,
.
,
. ,
. 64
, ,
. , 15- ,
,
. , . , 15- , ,
.
, , .
. ,
.
, ,
. ,
, .

. ,
81

, , , .
15- , .
,
, , .
, ,
, .
, ,
, .
, .
. , . ,
philos anatropous ,
. ,
.
,
.
,
, , .

, ,
.
. ,
39- .

, 55 .
, , .
, ,
.
, 39-
15-. ,

.
15- ,
. . ,
. .
, ,
"" ,
. , ,
.
,
, .
, .
.
, , ,
.
-
. ,
.

16- .
: 9-
82

: (16, 45)
:
:
16- .
,
, .
. 16- ,
. 16-
, , . , ,
. ,
, .
,
.
.
,
. ,
:
, .
, .
, .
, .
16- .
.
16- ,
. ,
, .

. , ,
-, , , . ,
16- ,
.
, , ,
. .
, ,
.
,
. .
, .
, 16- ,
.
, . , , 5-,
17- 52- , , , .
, ,
, ,
.
16- 9- , ,
. ,
, .
,
83

. 16-
, .
, , .
, ,
. () 16- -.
.
, .
,
.
. ,
, .
, , : .
. , .
. , , .
, ,
. ,
. -, ,
-, .
,
. .
, .
,
, , ,
. , ,
.
. .
(45- ),
. ,
, . ,
, ,
.
16- ,
. ,
, , .
, . 16-
, 16- .
. ,
, ,
. ,
- , ,
, , , , .

.
. , ,
, ?
.
. ,
,
. , ,
. ,
, .

84

, ,
.
, .
, ,
. ,
.
,
. .
,
, , , ,
.
16- .
16-
, .
- .
, ,
.
, , . 16- ,
,
. , ,
,
. ,
.
.
, ,
.
. 16-
. .
, ,
. , ,
.
,
.

.
. , -
,
. , ,
. ,
, , .
. ,
, , .
. ,
. ,
.
16- . ,
.
.
,
, , ,
85

.
. ,
, 64-
, .
16- ,
. .
, ,
. - 16-
, . , ,
,
. , , .
, .
,
.
, .
.
. ,
,
16- .
.
, . ,
, .
, .
,
, . ,
. .
,
, ,
.
,
, ,
. ,
. 16- .
, ,
,
. ,
, , , .
, ,
,
. ,

. , 16- ,
, . ,
, , ,
,
, - .
16- , 45- ,
, ,
. ,
. 16-
,
. ,
86

,
.
,
.
16-

16- , ,
,
. ,
, . ,
( ),
. ,
, ,
.
,
.
, ,
. ,
,
. ,
,
,
. , ,
.
.
.
, ,
, .
, , .
, , .
, . ,
. .
16- ,
, .
16- , ,
.
, 16- . ,
, 16-
.
. .

.
, ,
. , ,
, . 16-
, .
,
.
16- 35- ,
. 35- ,
,
87

. , ,
.
,
. ,
.
,
( 14-, 16-, 35- 60- ).
, ,
.

. , , ,
. . ,
.
, 16- ,
. ,
(),
enthusiasmus. , ,
. , ,
. ,
16- , , ,
? 16-
, .
, ,
, , .
, ,
, .

17- . .


: 18 :
: (10,17, 21, 25, 38, 51) :
17- -

17- 18- ,
- .
.

. ,
.
,
,
.
17- , ,
, 18-
.
, , , ,
88

, .
,
,
.
,
. 17- 18- ,
, . 18-
, ,
, 17 .
, 17-
,
. 18- , 17-
, .
, ,
, , .
,
. ,
,
, 18- .
,
, .
,
. ,
(
), .
, -
- , , ,
" " .
, , ,
.
, . ,
, . ,
.
,
.
, .
,
, ,
.
, , .
, .
, , ,
.
,
.
,
18- .
, ,
, .
, .
89

.
17 , .
.
,
.
, ,
.

, ,
, , ,
.
17- , .
, .
,
. ,
.
,
, ,
.
- 17- .
, ,
. , ,
. , 17-
,
.
, 18- ,
. ,
, , ,
, , .
17-
, ,
.
,
, ,
, .
17- ,
,
.
, ,
- ,
, - ,
.
17-
.
.
,
11 .
[ ] ,
.
, 64 -
90

,
. ,
, .

.
-
17- ,
, .
. ,
, , ,
. , ,
, , .
, , , .
17- , ,
, ,
. , ,
,
.
- Opinionated
, , . 17-
, ,
. ,
.
,
. , , , , ,
. , , ,
. , .
, , .
.
17- -

, - ,
, .
, . .
,
. ,
, , , ,
.
, , , ,
.
. , ,
. ,
, .
17- , ,

- . ,
,
. ,
- , ,
91

/ . ,
.
, , 17- , ,
. 17- , , .
. 17-
18 . ,
17- ,
. ,
, .
63- , ,
, .
, .
, 17-
, 17
. ( . . . .
)
17- , ,
. 17-
, , , , , .
,
,
. ,
. ,
.
,
,
.
17-
. ,
.
,
17- , . ,
.
,
,
17- .
. ,
, , , . 17-
.
, 17- .
,
. , , 17-
. "" .
, 17-
.
,
.
, 17- . 17- . 17-
, , , ,
92

,
.
17- ,
. ,
, - 11- . 17- .
, ,
.
. , , .

, , 17- ,
. ,
, , 17-
, ,
, .
17 -

, 17-
,
. , 17-
,
. , -
. , 17-
, ,
, . ,
. , 17-
.
, 17- ,
. .
, , , ,
. , , .
. ,
, ,
.
, .

6 "", .

. ,

.
,
.
,
.
.17- ,
, .
, -
. ,
.
, . 17-
, 17-
93

. , 17- ,
17- , ,
.
, .
, ,
. , ,
. ,
. 17- ,
. 17- ,
.
,
.
, , , .
, . , ,
.
,
.
, 17- ,
. -
. ,
, . 17- ,
, ! ,
, .
, ,
. (
18- ). , ,
, , ,
. , ,
,
, . ,
17- - "". ,
, , ,
.
17- , .
, , ,
. , ,
, .
, , . ,
.
, .
, , ,
. 17-
. , ,
,
. :
, . ,
, , .

18- .
94




: 17- . : (18, 46, 48,
57)
: . : .
18- . .

, . 18-
,
, .
.
18- .
, .
,
.
14 21 . ,
, ,
,
. , .
,
, . ,
,
.
, ,
.
18- ,
. , .
, , , ,
, . ,

.
.
, .
, ,
, . ,
. ,
,
, . , ,
.
, .
, .
, .
,
.
, ,
, , .
18- 17- .
. ,
,
95

18- .
.
, :
?
18- , .
, ,
-. ,
.
, ,
, , .
,
. 17- 18-
.
.
, ,
.
18- ,
, . ,
, .
. ,
, ,
. 18-
,
.
, 18- .
, 18-
, .
.

.
. 18-
.
, .
,
. , 18- ,
, , ,
. ,
, ,
, .

18- .

.
, .
, .
, , .
,
, , , - .
.

18- ,
.
96

, .
,
. , , ,
.
,
, .
, , .
,
.
18- . .
18- .
,
. ,
. ,
, .
, ,
21 .
, : , .
, ,
,
.
, ,
, .
. ,
, ,
.

.
,
. ,
46-, 48 18- , 57-
.
,
, .

.
18-
14 21 , ,
, .
, . , ,
,
, , .
,
,
.
, 18- ,
,
.
,
97

. , 18- ,
,
.
, 18-
. ,
. ,
,
.
,
.
,
.
.
, .
, ,
, .
, , .
,
, .
64 , .
,
, , .
18- ,
, , .
, ,
. , ,
,
. ,
. , ,
. ,
, .
, . ,
,
.

, .
, .
, , , .
18-
, . ,

.
18- . .
18- , 18- ,

.
.
,
! ,
, .
98

. .
, . ,
.
, .
, ,
, ,
. .
18- .
, , .
, . 18-
. ,
, .
.
, ,
.
, 18- ,
.
? ,
. ,
. ,
, ,
, ,
. , , .

,
. 18-
. , ,
. ,
,
. ,
, 18- .
,
, .

, , ,
.
.18- ,
. , ,
, .
, ,
.
18- .
. .
, , ,
, . ,
, ,
. , ,
. ,
. 18-
,
. .
18- ,
99

, .
.
. 18- ,
, .
, ,
, .
, . ,
. ,
18- , .
.
,
. 18-
, . ,
, .
,
.
, , .
. ,
.
,
.
, , .
. ,
.

19- .
:
:
: -
: 33-
: (19, 60, 61)
:
:
19- Co-.
49- 55- , 19- , .
.
, .
, ,
, . ,
, . , ,
.
,

. ,
. ,
. ,
. ,
,
100

. 19- ,
. ,
. ,
. ,
,
.
19- Co- , .
, co- .
, -
. , ,
, , .
, , . 19-
. , . 19-

. , 19 . ,
, .
, .
19- 33- . ,
.
.
, .
,
. , , ,
.
. ,
, .
, ,
, , co- .
, , ,
. ,
, .
19- ,
.
, .
, -,
.
, . , ,
, . ,
, ,
, ,
co-. ,
, .

.
, , 19-
. - .
, , ,
. ,
. ,
101

. - , ,
, -.
, , .
, 19-
.
19-
. , 60-
61- , . 60-
61- .
, , ,
. -,
.
, , ,
. ,
, , 19- .
, ,
, .

19-
. .
,
. ,
, ,
, . ,
, , ,
.
, , .
. , .

.
, , .
, .
, , ,
. ,
, , ,
, . ,
, ,
. ,

, co-.
19- . .
.
, ,
, 19- . ,
, . 19-
. ,
. ,
, , .
,
102

, ,
. 19-
.
, .
. ,
. 19-
.
. 19-
, ,
, , ,
.
, , ,
.
,
, ,
. 19-
.
, 19-
. 19- .
, ,
.
, .
, , ,
. .
,
19- ,
co- . .

, co. , , ,
, ,
.
,
,
co-. 19- ,
. , , ,
, , .
,
. ,
,
.
, ,
, .
, 19-
, .
19- ( 62- 12-
),
. , ,
, ,
.
, ,
103

,
. (, ,
)
. , 19- . , 19-
,
, . ,
,
. ,
,
.
19- .
, , ,
, , .
,
,
, .

.
.
, ,
.

, ,
.

, , .
-
. 19- .
.
,
, ,
.
19- , ,
.
.
, ,
, ,
.
. , , ,
, , ,
.
19- . .
19- co- ,
, .
, .
, 19- Co- 19- . ,
, .
,
104

,
.
, .
. ,
. ,
.
19- ,
. co- , , ,
. , ,
,
, .
.
, ,
, . 19- 49-
. , , ,
, .
, ,
, .
,
.
, 19- .
. , ,
, Homo sapiens. 19-
, , ,
. ,
, . ,
. ,
,
. ,
, , .
, , ,
, , ,
, , .
.
,
.
,
, - .
. ,
. 19-
, .
, ,
,
.
19- ,
. , , ,
. ,
.
, . ,
, ,
.
,
105

- .
, ,
.
19- .
,
. 22- .

1.
2.
3.
4.
5.
6.
7.
8.
9.
.
19- , .
. , 19-
.
, ,
, ,
, , .
,
. ,
.
, .
, .
,
, . 19-
.
,
. ,
.
, ,
, . ,
. 19- ,
, , ,
. , ,
. ,
, , ,
. ,

.

20- .
:
:
:
: 34-
106

: (3, 20, 23, 24, 27, 42)


: ()
20-

20- .
, ,
. 20- ,
.
, .
, ,
. 20-
,
. 20-
- , .
.
, 20-
, , -, ,
. , ,
. . 20
,
. ,

. , ,
. ,
, , ,
.
, ,
, , .
,
.
,
.
, , ,
. , ,
.
,
, . ,
, . 20-
.
.
,
, ,
, , . , ,
, .
, .
, ,
. ,
100 ,
, .
, ,
,
, - .
107

, ,
. ,
,
, , ,
. 55 .
, ,
. ,
, , . .
, ,
, ,
. ,
, -.
.
,
. -
. ,
. ,
.
, .
, ,
.
. ,
. ,
, . 20-
34- , .
,
. , .
,
.
. ,
,
.
, ,
, ,
.

, 20- ,
. ,
. 20- ,
.
, . ,
. , . ,
.

.
, , .
, ,
. ,
- 20- ,
. .
,
108

.
20-

,
.
. ,
, .
- , ,
. .
, ,
. ,
. ,
, , ,
.
20- ,
. ,
, ,
. , - ,
(27), (42),
(24) (3), , , (23).
,
.
, 34- .
, ,
.
. , ,
, ,
.
.
, ,
.
, ,
. , .

,
, . ,
. ,
. ,
, , ,
.
.
.
( 55-
),
. 20- ,
20- .
. ,
,
. , ,
.
,
.
109

. , .

. ,
, . ,
, ,
.
. ,
. ,
, . ,
, ,
. 20- ,
, . ,
, , ,
. 20-
.
20- .
20- , .
.
. ,
.
, ,
. .
, .
, .
.
, , ,
.
, .
. ,
, .
. ,
, ,
. ,
. , ,
, .
.
.
.
.
,
, .
.
, ,
, .
.
. 20- ,
, , 23- ,
. (24),
(27), (3) (42).
20- ,
110

, . ,
, , , ,
. , , ,
, .
20- ,
, .
, (. 22-
), ,
, , .
, ,
.
1.
2.
3.
4.
5.
6.
7.
8.
-, ,
.
. .
, , ,
.
, , , .
.
. ,
, , .
,
.
20- . ,
, .
, 20- , ,
. ,
. 20- , ,
,
.

21- .



: 48- . : (10, 17,
21, 25, 38, 51)
: . :
21-

,
. , ,
. ,
111

.
, ,
. ,
. ,
. ,
. , .
,
, .
,
, . 21-
, .
,
. ,
,
, , . .
,
.
21- , - ,
.
,
. , ,
. , 21-
. , , ,
. ,
. ,
.
, .

. ,
.
,
.
.

.
.
, .
. -,
.
. .
.
.
, , ,
, - .
,
, . 21- ,
, ,
, .
.
21- , ,
, , ,
112

.
. , ,
.
. ,
,
, ,
, , .
, .
, ,
. .
, ,
. , .
,
, .
44- .

. .
. 21-
48- , .
, . ,
,
. , ,
. ,
. ,
, ,
, .

. 21-
. ,
. ,
, , .
, ,
. , , ,
. 21-
, ,
, ,
. . .
.

21- .
-. ,
- . ,
. , ,
. ,
, , .

. ,
, .
,
, ,
113

.
21-

. 21 ,
, .
21- ,
, ,
. .
21- , ,
. ,

. ,
.
. .
.
,
. , .
, .
,
, .
,
.
.
.
,
. ,
. ,
,
. ,
. ,
, .
, .
, 21- .
.
21- . ,

, , .
21- ,
. ,
. ,
. ,
. , ,
,
, , , ,
. 7- 31-
,
. 21-
.
. 31
, 7- , 21-
. ,
114

, .
.
, ,
.
. (kinship),
(kingship). ,
, .
, ,
.
21-
. ,
.
, .
,
. ,
.
, , .
, . , .
21-

21- , , ,
. ,
.
, .
,
,
. 21- .
,
.
.
.
,
,
. ,
,
, , .
,
. ,
.
. , , , , ,
, .
, .
, ,
.
.
.
. 45- 21-
.
, .
, , .
,
115

.
, ,
. ,
, .
, .
.

. .
(. 22- ),

.
. ,
, .
, , ,
. ,
, , ,
. . ,
, , ,
. 21-
, , ,
.
, , ,
.
.
.
, , ,
. ,
,
. , ,
, .
-, .

.
, 21- ,
. 21-
,
. ,
, . , ,
.
, - . ,
, 21-
. 55-
, 21- .
,
. 21- 48- ,
.
( )
( ).
,
.
, . ,
. ,
116

.
, ,
. , ,
, .

22- .



: 47- . : (36, 37, 22,63)
: ( ). : .
22-

64 , .
, , ,
.
.
. ,
, . ,
,
,
.
, ,
. :
,
,
22- 64- ,
. ,
. 22-
55- , .
55-
, , 22-
, . ,
, , .
22- , ,
.
22-
, . .
, ,
.
22- .
, , ,
.
. !
22-

, 22- .
117

. , ,
.
, 22-. ,
.
. , ,
, . ,
, ,
. ,
,
. 22- .
,
.
,
. .
,
.
. , ,
. ,
, ,
.
, , , , .
,
, - .
.
22- .
, , , ,
. , ,
. 22- ,
, . .
, ,
. , ,
,
.
22- .
,
, .
22-
.
, ,
,
.
, , . ,
.
,
,
, .


. .
,
. 22- , ,
, , .
118

, , .
, . 22-
, ,
. ,
,
.
22-
.
, ,
. .
.
.
22- ,
,
. ,
. ,
,
. ,
( )
.
, . , ,
.
. ,
. ,
,
.
64 22 ,
.
, .
.
,
. ,
,
. 22 .
. . ,
. ,
,
, , ,
.
,
. , 22-

.
, . ,
,
,
. , ,
. 22-
, .
, , ,
, , .
119

,
, .
, ,
.
, ,
.

Corpus Christi .
,
, .
,
. XIX-
, .
, ,
, , ,
, , . ,
.
.
, , 6 10
, . ,
Corpus Christi .
7
.

1. .
.
, ,
. 9- ,
,
. , ,
.
.
2. , ,
.
,
. ,
. ,
,
.
,
.
3. ,
.
.
.
,
.
,
.
4. .
120

, .
, .
,
, .
,
. ,
,
. ,
.
.
5. .
,
. ,
, .

, .
.
6. .
.
,
,
,
.
.
.
7. .
.
, ,
.
, .
,
. ,
, .
, ,
,
, ,
.

.
22- 47- ,
. 47-
. ,
, . ,
, ,
,
. ,


. 47- . , 22-
, .
121

, ,
, .
,
. , .
. ,
.

, .
, , ,

.

.
, ,
.
. ,
. .
, , , ,
,
. ,
.
, ,
-, .
,
, .
,
,
. .

.
, .

. ,
.
, ,
, , , .
22- , ,
,
, .

. . .
, ,
. ,
, ,
,
. ,
, ,
, , .

122

22-

.
,
.
, ,
, , . ,
.
,
. ,
, ,
, ,
.
,
.
,
.
, ,
. -
. , ,
, . ,
, ,
.
, , .
, .
, . ,
.
, .
,
.
. 22-
, - .
.
.
. ,
. ,
. ,
, ,
. ,
. ,
, .
, 22-
.

22-
. ,
. .
.
.
.
,
, .
123

. 22- .
, . .
,
,
. ,
.

22- .
.
. ,
. 22-
,
,

. , , . ,
.
22-

22- . ,
, . , ,
, .
, ,
.
,
, . 22-
, .
, .
, 22- .

,
. ,
, .
, , , ,
, .
,
, , . , ,
. ,
, ,
, . ,
.
,
, .
, ,
.
, . , ,
, ,
. 22-
, ,
- .
, .
, .
124

.
, , ,
. 22- ,
, , ,
.
.

2004 , ,
.
, 64
, ,
.
,
. ,
. ,
,
,
.
,
,
. ,
.
.


1.
2.
3.
4.
5.
6.
.
, ,
,
. ,
.
, ,
, ,
.
( 55- ),
.
,
, .
22-
, 55- .
22-


, , ,
125

.
, ,
- .
.
.
, .
, ,

, .
,
. 64- 6
, ,
22- :


40- ;
17- ;
25- ;
43- ;
4- ;
63- ;
22- .
22-
. , ,
.
,
. , ,
.

,
. ,
. ,
.
, , .
40- . 40-
, ,
.
, ,
, , . ,
, .
,
.
, ,
.

17- , .
.
,
126

. - ,
. ,
. , ,
, , ,
.
,
, .
, .

.
, , .

25- .
. ,
,
. .
.
. ,
,
. , ,
, . ,
, , ,
. , , ,
, , ,
.
.

43- ,
. , ,
. ,
(
) .
, ,
, ,
.
, ,
.
,
, .
.
.

4- .
, ,
, ,
.
, . ,
, .
, ,
. , ,
, .
, ,
127

.
, .
.

(
), coupe de grace ( ),
.
.
. ,
. ,
,
. 63- .
, , , , .

. ,
,
. , ,
. , 63- ,
,
.


. , ,
.
, .
,
. ( 22- ),
. ,
, (47- ).

, .

, .
, ,
. ,
, , ,
, .
.
,
, .
.

.
.


22-
.
,
. ,
128


, .
, ,
. , ,
, .

.
.
-.
, , ,
. , ,
, ,
, , .
/ ,
.
, ,
. ,
.
, ,

.
22-


. .
1.
2.
3.
4.
5.
6.
7.
8.
9.


.
. ,
, .
.
,
.
. ,
.
. ,
. ,

.
129


. ,
. ,
, ,
.
.
.
,
. ,
, , ,
. .
, ,
.
, , , ,
- ,
.

. ,
,
.

.
, , - .
, , .
,
,
.
.

, .
.
.

. ,
. ,
, , .
, , ,
.

,
. ,
, .
, .
, .
,

. ,
,
.

,
.
130

, .
, .

. , .
()
.
,
.
.
, ,
, .
, .
.
, ,
. .
.
,
,
.
. ,
.
, , , ,
.
.
,
, .
4
.
. ,
.
.

, .
,
.
.
,
. ,
,
. ,
,
(), .
,
, , . ,
, .

.
. ,
,
, .
, ,
.
131

. ,
.
.
. , ,
. ,
, .
, ,
.
.
, , .
,
,
.
.

, . ,
.
,
.

,

, .
.
. ,
, ,
.
.
.
.
,
.
, .
, ,
, .
,
.
.
,
, , .
,
.
.
, .
, .
, . ,
,
.
, .
,
. ,
,
132

. ,
, ,
, .

, .
.
. ,
, .
.
,
. ,
.
, .

.
, 45- ,
.
. ,
.
, .
,
, , ,
, .

.
,
, ,
. ,
, .
, . -
,
.
.
, , ,
. ,
, .
, .
, ,
,
.
.
, .
,

.
.

.
.
.
, .
, , .
133

.

,
.
( ),
, .
.
.
.
.
.
,
. ,
. ,
, , , .
.
.


, 22- .
, , , . ,
,
. . ,
. 22-
,
, . 22- ,
, ,
, .
, , ,
.
, ,
, , , , ,
. ,
.
. .
,
. ,
. ,
.
, , .
,
. .
-, ,
, . ,
, .
. , ,
. , , .
,
. ,
.
134

22- , , .
. .
. . . ,
. ,
. ,
, ,
. .
, . ,
, . , ,
, . ,
, ,
.
, , 22- ,
.
, .
, ,
, , .

23- .



: 43- . : (3,
20, 23, 24, 27, 42)
: ( ). :
23- -

: -,
. , , .
23- ,
. , , , 64
.
, ,
.
, .

, .
23- ,
. .
.
,
.
,
- . ,
, ,
.
- , .
, , ,
.
135

.
, .
23- 43- . 23-
.
, .
.
, . ,
, , ,
, .
. ,
23- , ,
,
. 23-
. , ,
.
23- , ,
, .
. ,
,
. .
, !
, , -
, , . -
, , ,
.
.
, .
23- . 23- ,
,
.
, .
.
,
. , .
, ,
. ,
.
,
. ,
, . ,
,
. ,
.
, .
, , ,
, . , -,
, , - .
, 23- , ,
, , .
. , ,
. ,
,
136

, . ,
, ,
, - ,
, . - ,
, .
, 23- ,
. ,
,
. , 23-
, . ,
, ,


, 23- .
, , ,
. ,
, .
. ,
dumb (),
. , ,
, , ,
, .
.

,
. ,
, . ,
, , .
, ,
. ,
, .
,

23-

,
. . ,
, .
. ,
. -, . ,
23- , .
23- . , .
, . ,
.
, .
. ,
.
. , , .
, .

. 23- ,
137

. ,
,
.
.
, ,

. .
, .
.
, .
, , .
.
.
, . 23-
43- ,
. .
. 43-
, , .
, ,
. 23- ,
.
, , 23
,
.
,
. 3- ,
. 20- ,
. 24-
. 27-
, , 42-
. ,
, 23-
, .
.
-, 23- . ,
, ,
, .
, ,
.
, . ,
, , , .
, .
,
, .
23- ,
, . - , ,
. . , 23 , . ,
. , ,
. ,
, .
.
138

, 23- , .
, , ,
.
. , ,
.
. , .
.
, , 23- ,
.
. .
23- .
23- .
, , ,
. ,
, , . 64-
, .
,
23- .
23- .
.
, .
.
, .
, ,
23- .
, .
.
, .
. ,
,
.

.
.
.
, .
,
, , .
, , ,
. ,
.
, ,
.
- ,
, ,
, , .
, 23- ,
.
,
, .
139

, . 23-
.
. ,
, .
, ,
, .
.
, , ,
.
, , .
, .
,
, ,
. .
. ,
. , - ,
, , ,
. ,
,
. .
, ?
(), , .
23- , . ,
, .
23- ,
. , ,
.
,
- , .
, ,
. ,
,
.
23- :
.
,
. , , ,
, .
, , .
, ,
. , .
, ,
, . ,
,
.
- .

24 ()
()

140

()
-
-
: 44
: (3, 20, 23, 24, 27, 42)
: . : .
24
.
24 , , ,
, .
, ,
. ,
. ,
,
, . . ,
; , .
- .
, ,
, (). 88
, ,
. ,
, , .
, ()
. ,
, - .

, 24 , .

, . - ,
. 24
,
, .
, .
, .
, . ,
. ,
.
, . ,
(), . ,
24
.
(gap),
(awareness). ,
.
, .
.
, . ,
, , ,
. ,

. ,
141

, , , . ,
,
. ,
, .
-,
, , .
,
. -
, 22 . 7 ,
. , 3
, .
, .
, , ,
, .
, , ,
, , , .
,
, , .

. , ,
, .
,
. .
, .
.
. ,
,
, .
, ,
. ,
.
,
.
,
.
, , , .
24 - 44
, , , , .

, 24 . , ,
, ,
. ,
, , .
, ,
? 24 , , ,
, , 24
. ,
, . ,
, ,
, .
,
.
142


,
. -, , ,
. ,
. ,
, , .
, .
, .
,
.

, , .
. ,
, . ,
, .
, ,
, . ,
, ( ) ,
( ).
, , , .
, , ,
,
.
24
24 , ,
, .
, , ,
.
, , , .
,
, .
, ,
. 24 ,
.
, ,
, . ,
, , ,
.
, ? : .
24 .
, , - .
,
24 . ,
.
. , . 24
, , .
,
, . 24
143

, ,
, .
,
. - ,
, . ,
, , , ,
.
.
, ,
, .
, , ,
. , ,
, !
. ,

. ,
.
23 , , 24 ,
.
,
. . ,

. - ,
, . .
.
24 . 24
. , , ,
. ,
,
. ,
. , ,
.
. ,
. ,
, 24 . ,
. ,
, .
, ,
. ,
, , , ,
.
24 ()

24 , , ? , .
, .
,
. , ,
, .
, , , .
- ,
, .
144

, . , ,
, ,
, 24 . 24 ,
, .
. , ,
, .
, , ,
, . ,
. ,
.
, .
, (thought by life). ,
. , .
, , , ,
, . , ,
.
, .
, , , .
. -
.
, .
(awareness) ,
,
(consciousness). , .

. , ,
.
24 . 24
- , .
, , .
,
, .
, , .
, , ,
, .

, .
: .
.
, , ,
, .
,
, -
. ,
, , ,
. 24 , ,
.
-.
. 22
. , 24 ,
, , ,
.
145

, , ,
, - .
, .
24 , , ,
. 44 ,
24 .
, ,
. ,
, .
, , , .
.
(awareness) , (consciousness)
. , . ,
, ,
. ,
, . -
, (awareness).
,
. ,
. ,
.
22 ,
, ,
.
, ,
.
, , .
,
. , ,
,
. , ,
. ,
. ,
,
, , .
24 .
,
,
, ,
.
, .
, - ,
, , .

25- .
:
:
:
: 46-
: (10, 17, 21, 25, 38, 51)
146

:
:
25- .
64 ,
, 25- . ,
. - 25- .
,
. , , ,
.
.
.
. .
, .
,
, ,
. 25-
,
, .
25- .
. , ,
. ,
,
. , .
,
. : - ,
- , . ,
, ,
, . [1]
, ,
, . ,
, .
.
25- .
, ,
.
, 25- , 25-
. 25- - 46- - ,
-, , ,
. 25- 25- ,
.
, .

. , ,
25- . ,
, ,
. - .
25- ,
.
, .

147

- . -
.
, ,
.
, ,
, , , .
. ,
, , ,
. ,
, .

. .
, . -
, , .
25- , , ,
, , , , .

25- . , 25-
, 25- .
- . ,
, ,
. , ,
. 25 .

25- .
. ,
.
.
, .
. , , -
.
-
.
, ,
. , -
, , .
.
-
,
, .
. .
, ,
. , .
64- , ,
,
. , .
,
. , ,
.
25- .
148

25-
. 25- ,
, .
. ,
25- , 46- . ,
, . -,
, . ,
.
25- ,
, .
, .
,
.
. ,
.
, , ,
, .
, ,
,
-.
.
, 25- ,
. ,
, .
,
. ,
25- . ,
, , ,
.
, .
, , ,
.
, . ,
- ,
.
. , .
,
, , , . ,
, . ,
. , ,
. ,
,
. 25- .
,
. , .
25- .
. ,
. , . ,
, , ,
. , ,
149

. ,
, .
, .
.
25-
[2]
25- , ,
. ,
25- . 25-
, , 25- ,
. 25-
22- , .
25-
.
64- , ,
.
46- , 29-, 56-
36- . 25- - ,
. ,
,
. . ,
,
. ,
, .
, , .
. , ,

, ,
, .
.
, ,
, .

, .
, , ,
, .
.
.
, ,
, , .
,
, , .

. 25- ,
.
.
, , .
.
150

, .
, , , ,
, . 25- . ,
, ,
.
. ,
.
,
. .
, 25- ,
. ,
.
. ,
, .
. ,
, , , .
, 25- ,
. .
, , ,
. , , ,
.
, . , -
25- , . ,
, ,
. ,
.
[1] . wound , wound (
wind ; ; ; ; ;
; ;)
[2] , ( . )
. ,
,
.
- ,
, , , .

26- .
:
:
:
: 45-
: ()
: (5, 9, 11, 26)
:
26-

151

,
, ,
. ( 5-, 9-, 11- 26- )
.
, ,
, \
. ,
D,
. ,
, ,
.
, , ,
, ,
.
, , ,
.
. 26-
, ,
. ,
.
.
, , ,
. ,
, . ,
, 26 .
,
, .
. ,
. 26- ,
.
. , ,
, , 26-
.
,
.
,
. .
26- , , ,
. , , ,
.
26- . ,
,
26- , , .
,
. ,
. ,
, 26-
, .
, ,
. ,
152

. ,
. 26-
,
. , , .
, 26- ,
,
,
. ,
, ?
, .
26- ,
. , ,
,
,
.
. , 26-
,
.
, 5-
,
26- .

, . ,

, . 26-
.
45- ,
26- .
, 26- .
. ,
.

,
. .
,
, .
,
. ,
26- ,
,
.

26- .
, ,
. . ,
.
, ,
, . 26-
,
, . ,
153

. .

. ,
. .
- , . -
, ,
. ,
. ,
. 26-
, 26- , ,
, . , ,
,
.
26-
.
26- ,
. . , 26-
,
. ,
, .
.
. ,
, .
, -,
, -, .
,
.
, , ,
. ,
. ,
, . ,
.
- . ,
.
26- ,
. ,
.
, ,
.
,
, .
. , -,
. ,
, .
, , ,
, . ,
. ,
. 26- -
. , ,
. ,
154

, .
, - . 26-
. , . ,
- - , . 26-
- , .
, .
,
.
26- .
, .
, . ,
,
, . ,
. ,
. ,
.
,
, .
,
. , , 26-
. .
. ,
, .
, , , .
, , 26-
. , ,
,
. 26- .
, - .
, , 26- ,

, . 26-
, , .
26- .

, : ,
( ) , ,
.
26- . 26-
, .
, ,
. , , ,
. ,
, ,
, 26- .
, ()
,
.
, ,
. ,

155

.
26- .
.
26-
. , ,
. 26- . ,
, ,
.
, . 26- .

, .
.
,
. ,
. ,
. ,
,
. , ,
, .
26- . 64
, ,
.
, . 26-
-: ,
.
. ,
26- .
. ,
.
.
26- , , .
,
. , , ,
.

, . ,
, ,
,
. . -
- , .
; ,
. , , .
26- .
, . ,
, .
-; .
.
.
, . ,
, ,
156

. ,
.
, ,
. 26- .
.

27- .
:
:
:
: 28-
: (3, 20, 23, 24, 27, 42)
:
:
27-

27- .
, ,
,
. ,
. 27 - . , ,
.
, 27-
. ,
. ,
, .
, , , .
, , ,
, . ,
,
.
, - .
27- .
, ,
. , ,
, .
, 27-
.
.
. , ,
.
,
.
, 27-
. ,
. ,
Homo Sapiens .
157

. , ,
.
, , , , ,
, . ,
. .
. .
, ,
. -
. , ,
.
, ,
- , . ,
,
. .
-,
.
, . ,
, ,
.
, , ,
27- . ,
.
, , 27- .
- 27- , 28 . .
, . ,
, . .
,
, .
27-
. ,
. , , .
, ,
, . 27-
,
. 24- , , 3-
, , 20-
. 23- , ,
, 42- , ,
.

, ,
, , .
, ,
, . ,
.
,
. .
,
, . ,
, ,
.
158


, - ,
. ,
- .
. -
, ,
. ,
27- ,
. , .
27-

27- .
, . 27- .
. ,
, 27- ,
.
. ,
. ,
, , ,
.
, .
, ,
.
. , ,
, .
, . , , ,
.
, .

, .
. ,
27- 42- .
27- 27- , ,
, - . 27-
, ,
, .
, ,
, . . ,
.
27- ,
, .
, .
, 27-
. , ,
. .
,
.
. ,
.
, , ,
, ,
159

.
. ,
.
, .
. ,
, .
, - ,
, .
.
, , , .
, ,
. .
, , .
.
.
. .
27- , , ,
.
,
. .
, , ,
. 27-
.
, .
27-
.
.
27-

27- , .
. , 64 ,
.
, - . ,
, , .
64- 64- .
64- , ,
, .
, . , ,
, , Homo Sapiens.
, .
,
. 27- .
, .
.
. ,
.
,
, .
, , .
27- .
, 64-
160

.
, .
. ,
, ,
, .
, 28- ,
27- . ,
, .
, ,
. ,
, ,
, .
. , ,
. ,
.
64- ,
. .
, -, .
, 27-
. ,
. ,
, , .
.
.
. .
, ,
.
, , ,
. 27-
.
, ,
. , . 27-
.
27- . -
, , 27- ,
.
, ,
, .
- .
, . 27-
, ,
. , ,
.
, ,
, .
, , , .
27- . .

28- . .
( Ryaba & Harhor)
161

:
:
:
: 27
: (28,32)
:
:
28-

64- .
, .
, ,
, . 28-
, .. ,
.
.
. ()
. , . , ,
28- . ,
, ,
.

. ,
.
,
.
- . 28-
- , .
,
.
,
, , - .
.
,
, , . ,
.
, .
, . ,
.

162


. , ,
,
. , ,
. , ,
, , -
.
, .
.

,
. , ,
, .
!
. ,
, ,
, .
, ,
. ,
, .

, .
. ,
, .
.
. , , .
.
, , , ,
.
, , , .
27- ,
28- . ,
, - , .
28- .
.
, .
,
, .
, ,
.
. , ,
.
. ,
.
. ,
,
.

163

. - ,
. 28- - ,
, .
,
. 28- .

,
. ,
.
, .
, , ,
, , .
, . ,
, ,
. ,
,
, , .

28- . ,
. ,
.
,
, .
, , .
.
28-
.
, ,
.
, .
28- ,
, , .
.
, , .
, , ,
, .
.
, ,
,
".
.

28- , -,
, .

164

, , ,
. , ,
.
,
.
, ,
.
, ,
, , .
, .
,
. , ,
. ,
, , .
,
.
, .
, , ,
.
, .
, 28- .
,
.
, , , ,
, 27-
. ,
.
,
- , . , ,
.
, , ,
, .

.
28- 32- ,
. ,
. , 28- , 32-
.

. , .
, , ,
:
, - .
, ,
, .
, , ,
165

,
, ,
.
28-

.
, .
, , ,
.
,
. ,
. , ,
.
, 28- ,
.
28- ,
. ,
,
.
, ,
. 28-
,
.
,
, . ,
,
.
, ,
. , ,
.
,
. -
, ,
.
, .
.
,
.
.
,
.
,
, .
, , .
, .
,
166

. , .
.
.
.
.
.
, .
, .
, 28- .
, , , , ,
.
,
.
!
.
,
.

, .
28- ,
. , ,
. ,
, ,
, .
, -
, .
,
,
28- .
, 28- . ,
.
, 60-
, .
,
, . 28-
, ,
.

. ,

.
, ,
.
.

167

29- . .
:
: (VALINE)
: 30-
: (4, 7, 29, 59)


-
29-

, 29-
30- ,
.
. - .
, 30- ,
, . ,
, . ,
. 29-
. , , ,
.
, . ,
, , , ,
. , ,
. , ,
, , , .
,
. ,
, ,
. , ,
.
. ,
.
.
.
.
, .
64 .



29- , 30-
168

, , , .
.
. , 30-
, ,
.
. , .
29- . ,
.
, .
, , ,
. .
, , - ,
.
, , .
, ,
, . ,
.
, . ,
.
.
.
.
, . ,
.
, ,
. , ,
. - , .
,
, .
29- . ,
, .
,
. .
, .
.
,
. ,
. ,
- . ,
.
, ,

.
29- ,
.
. ,
,
, . , 29- ,
. - ,
, ,
, . ,
169

, , , .
.
, , ,
, .
29-
.
, . ,
29- ,
.
, .
"". ,
.
. ,
. ,
, .
29- , .
- . .
, ,
, . 30-
, .
.
, , .
, .
, . ,
. ( ), -
. - ,
,
,
, . 29-
, ,
.
. 29-

.
: , ,
. 29- ,
, .
,
. ,
. ,
, .
- 29- ,
. , ,
, , .
,
, .
-
,
. ,
. ,
170

,
.
. -
, ,
, .

29- , ,
, . , -
,
.
. ,
, , . ,
, - ,
, ,
.


,
. 29-
,
.
. 29-
,
. 29-
,
.
, ,
, .
, .
, . ,
. , 29-
.
.
5 , .
, .

, , !
, , 29-
4-, 7-, 59- . ,

. ,
,
.
59- 55- .
,
, . 29-
,
, .
-
171

(7- ).
,
. ,
. ,
.
. , ,
. , ,
, .
. , .
, ,
. , ,
. , ,
, , .
, . .
29- ,

.
29-
. , .
, , ,
. .
. 29-
,
. , ,
. ,
.
, . ,
, . ,
,
.
29- ,
, ,
. . ,
. , ,
.
. ,
. ,
, ,
, .
. ,
, , , .
29- .


,
. ,
.
. - ,
. ,
172

, , .
. - .
,
.
,
. , 29-
,
. ,
.
,
, .
, , ,
. ,
, . ,
, .
, ,
. , ,
. , - ,
, .
29- 29- ,
. ,
, , .
, , , ,
. ,
. , , ,
.
. - 30- ,
. .
, .
, .
, , .

. 29-
.
, , , ,
.
5- , .
, , .

, .
,
. -
. 29-
.
,
.
, ,
, .
, ,
, . ,
,
173

. ,
' '. , ,
.
- ,
.
, - .
, .
, .
. ,
.
, .
. -
, - ,
. - , . 29-
, ,
. - ,
?
29- - . ,
. ,
, . ,
. - . ,
29- .
, ,
. ,
, ,
, '' .
- , '' - ,
. 29- -
.
.

30- .
: /
: (GLUTAMINE)
: 29-
: (13, 30)



30-

, , ,
. 30- .
174

, , ,
, , .
30- , ,
. ,
. ,
, ,
. , ,
. ,
.
,
. .
, - . ,
30- .
, ,
, . ,

, ,
. ,
, . 30-
,
. - , -
- 30- ,
.
, .

,
( ), .
,
, , , , ,
.
, , ,
.
,
, .
,
. ,
, ,
.

30- -
.
30- .
, , ,
. ,
. , , ,
.
, . , (-)
, .
, , , ,
175

. ,
,
. ,

. .
30- , 29- ,
. -
,
. ,
.
, .
, , , , ,
, . ,
. , , .
,
,
.

, ,
, , .
. , ,
. , .
,
.
,
.
, ,
.
. 30- ,
, .
,
30- .

, ,
.
.
, .
, ,
( ).
, ,
, .
, , . , ,
, . ,
, . , ,
176

. , , ,
, , .
64 .
:
30-



: 29- . : (13, 30)
: / . : .
30-

,
. 30- . ,
, ,
, .
30- , ,
. , .
,
.
. , ,
, . ,
, , .
, .
. ,
- . 30- .
, , ,
, . ,
, ,
.
, , . 30-
,
- . ,
, - ,
30- ,
.
, , .

, , ,
. ,
, , ,
, .
,
.
, , ,
, .
,
. ,
177

.
, ,
. ,
, 30 13-
,
. ,
.
, .

, .
,
.
, 13- . ,
,
. ,

, ,
.
, , ,

. ,
, !
.
, , , .
-.
,
, . ,
. -. ,
. 30-
, , - .
. ,
, .
30- - (, ), ,
. 30-
. , ,
, .
, , ,
. ,
, .
. ,
, .
, , ,
. , ,
. , ,
.
.
, 29- ,
.
.
.
. ,
,
178

, , , ,
. , .
, , .
, ,
,
. ?
, , -
? ,
.

, ,
, , .
. , ,
. ,
. , ,
. ,
, .
,
. . 30-
, ,
. 30- , ,
, .

, ,
.
.
.
, ,
. ,
, , ,
. ,
. , .
, .
, , .
30-

, . ,
, ,
. . ,
, , ,
. ,
.
.
, .
30- ,
, , .
30- ,
. , , ,
. ,
179

: , , !. ,
, , .
, ,
. ,
. .
, , .
,
.
, ,
.
.
.
. ,
. ,
,
. , ,
, ,
. , ,
. .
,
, ,
, .
,
.
,
.
, .
. ,
, .

, , .
, ,
. .
, , . ,
. , ,
, ,
. ,
.
. ,
, , ,
. , ,
, .
, , .
,
. .
, , -
, ,
. , 30- , ,
-, ,
.
30- , ,
. ,
180

, ,
.
.

. , .
, .
, , ,
.
, ,
, . , ,
,
. 30-
, ,
.
30-

30- ,
. 30- , 29- ,
, . , ,
,
. ,
, .
, .
, ,
. ,
, , ,
-
30- .
30- 29- ,
.
,
. 30-
, .
, 30- - ,
. 30- .
.
.
, .
,
. ,
.
, . (
belonging - , , ; be our longing , ).
,
. , ,
,
. , 30- ,
.
, 30- 29-
.
.
181

. ,
. ,
. 30-
.
. ,
. , , ,
. ,
,
. 29-
,
.
, 30-
, 55- . 30-
, . ,
, ,
.
.
, !
22- .
30-
( ).
30- , ,
.
, . ,
, ,
. ,
, .
30- . , , ,
, , ,
.
30-
. , .
.

. , 29- 30- ,
.
, 30- ,
. ,
,
.
, , ,
.

31- .
:
:
:
: 41-
: (31, 62)
: /
182

:
31-

31- (31- ?!)
. ,
,
. , ,
, .
, ,
. , 31-
, .
31- 62-
, .
. 62-
, .
,
, . - 62-
, , .
31-
,
. .
,
, .
, .
, -,
. - ,
. .
, . ,
, .

, , , ,
.
, ,
, , .
. , 21- ,
. ,
. 31-
, , . ,
,
. . ,
, ,
,
. 31- .
31- , ,
, ? ,
, .
, !
, , , ,
.
, ,
183

, . .
, ,
,
.
- ,
. , ,
. ,
,
. , ,
, . ,
, ,
, .
, ,
!
,
. ,
, . , ,
. , ,
, , .
.
, ,
. , ,
, .
, , ,
.
. , ,
. ,
,
. 31-
, , .

. ,
, .
, , ,
? ,
, , ?
, , ,
, 31- .
. ,
. 31- 41- ,
. , , ,
.


. , ,
. ,
. ,
, , .
, .
,
.

184

, ,
.
, , , .
,
, . ,
, , ,
, , , .
.
31-

,
. 64-
7- . 31- .
, ,
.
. , ,
, , . ,
, . 31-
,
.
.
31- 31- ,
. ,
, .
.
, , .
/
.
- .
,
, .
, 31- .
,
. , . , 31-
,
-
. , ,

. 31- .
62- , ,

.
31- ,
. ,
, ,
. ,
,
.
, 31- .
185

, 31- , .
,
, .
, 41- , 31-
.
31- . , ,
, , ,
, ,
. ,
, . ,
, . ,
. 31-
, ,
. ,
. ,
. .
, .
.
31- , , ,
,
. ,
,
, . , ,
. ,
, , ,
, .
31-

, 31- , ,
31- ! , .
,
. ,
- . .
,
.
, ,
. ,
.
, , ,
, ,
. ,
. ,
, .

. 31- ,
, , .
.
, , , .
.
31- - ;
186

, .
, 31- .
,
.
,
. , ,
.
. , ,
, !
. 31-
. ,
. 31- ,
, .
- - . ,
- .
, , ,
, , .
, 31- , .
, . ,
,
.
31- , .
, ,
. , .
, . ,
. , - ,
.
, .
. 31- ,
, , .
,
.
31- .
. , ,
. , , , .
-.
, , ,
(. 22- ).
,
. , , , .
, .
, .
, , , .
. ,
. .

32
,
, .
187

,
: 42
:
: (28, 32)
:
32-

, , 32-
- , .
, .
() , , ,
, -.
, .
: -,
, , . , ,
, ,
. ,
,
.
, ,
-
, , , .
,
.
. ,
. , ,

.
,
.
, .
,
.
, . 32-

. ,
,
. , :

,
. ,
. , .
, , , , ,
, 32- .
.
, , , ,
.
. ? , .
, ,
. , !
. , 32-
188

, ,
, , . ,
, , ,
,
, .
.. ,
.
, ,
. ,
, ,
, ! 32- - ,
. , , .

, ,
. , , ,
, 32-
.
, ,
.
, .
. ,
. , , ,
,
. .
. 42-
32-
, . 42-

. -
28- .
( , ). ,
,
,

.
, .
,
, .
, .
, ,
. ,
, ,
. , ,
.
( )
. , ,
, - , ,
. , .

32- . 32-
, ,
, .
189

, .
.
, ,
. ,
, ,
, .
, .
32- .
, ,
. ,
, , , .
,
. , (,
) , ,
. , ,
, . ,
- , ,
, .
32- .

32- . ,
,
. 32- , .
, - , , .
,
, ,
. , , ,
, , ,
.
. 32-
,
.
. (
) , ,
. (
), ,
.
( ) ( ).
, , ,

, .
32- .
: : 10 ,
- 5 - 1 ( )
- , . ( 10
) 20- . ( 5 )
10-. ( 1 ) 1 ,
, . ,
.
- . 32-
, . , ,
190

. 32- , ,
.
. , - ,
- ()
,. .. 42- ( ) ,
,
32- .
32- , .
, , ,
. , .
, .
, .. ( )
.
, .
, .
, .
, .
,
. 32- .
: . 32-
, .
, . - , , ,
- ,
. , ,
.
,
.
, ,
. .
.
, , .
,
. ,
.
. -
, . ,
64- 2 ,
, ;
, , .
.
, , .
, ,
,
.
32-

, .
. 32- ,
, ,
.
32-
191

. 64- ,
,
. , ,
.
.
, , .
( ),
, .
. , ,
, .
,
: , ,
. ,
(), - :
, ,
, ,
, .
.
, . ,
- .
.
, -


. , , ,
, .
.
, ( ) ,

.
.
32- . , , .
, ,
.
, . ,
.
, , , .
, ,
, .
, .
,
(28- ), ..
. , - ,
.
, .
,
.
, ,
.
, , , .
. 22-
192

.
,
.
.
, - ,
.
, ,
.
(). ,
.
. ,
.
:
, . -
- ,
( ) ,
.
,
, .
, . ,
, , , ,
. ,
. , ,
. ,
.
. ,
, . ,
. , 32-
, .
32- .
32-
. , ,
. ,
. ..
,
. , .
,
, , ,
. , , ,
,
.
.
. 32- ,
.
, ,
. ,
, , , ()
,
.

193

33- .
:
:
:
: 19-
: (12, 33,56)
: , .
: (-).
33- .

, ,
. , .
. ,
,
.
,
. , , ,
. ,
, .
,
,
.
,
, ,
. .
. ,
. ,
, ,
.
, . ,

, , - ,
.
33- . 12- 56- ,
.
33-, 12- 56- - .
,
, , , .
,
? ,
. 33- .
, , , ,
.
.
, .
33- 19- Co-. ,
. ( wound , ,
; wound . . .). ,
-, .
194

. Co-
,
.
, .
, , ,
. ,
, . -
,
. .
,
.
. , 33- ,
.
,
.
,
. , 22-
. ,
, .
, , ,
-.
, .
. -. ,
, .
co-
, .
.
33- . ,
.
, --. --
, .
,
, . ,
, ,
, . 33-
, .
,
. 33-
, .

.
. , .
, , , - .
, , ,
,
, - .
, .
, ,
, ().

33- ,
,
195

. .
.
, , .
. ,
,
. , , ,
.
, , , .
33- .
.
33- ,
, .
, .
, -.
33-
, . , ,
. , , ,
. ,
, . ,
, ,
, .
, ,
.
, ,
.
.
, , , , (12- )
, , . ,
- , 56- ,
. ,
, ,
.
. .
,
.
, ,
.
. -
, .
64- ,
.
,
64- .
, .
. ,
, , . .
, , .
.
,
. ,
196

.
, , ,
. ,
, . , ,
, , .
,
.
, ,
. ,
, .
.
, , , .
, .
. ,
, ,
. ,
. .
, .
! ,
. ,
,
. ,
, .
33-

-.
33- , , ,
. , 56-
, . , ,
12- , .
,
, ,
. ,
, .
33- , .
, .
. ,
.
, .
.
, .
,
.
, , .
. ,
.
, .
. ,
,
. , , ,
197

. .
,
. ,
. .
. .
, , . ,
, .
. , ,
, , , ! (
). , .
,
, , . ( remember ,
; member , , . . . ).
,
.
, ,
33- .
.
.
.
.
. -
, ,
. -
. , ,
, . 33-
, ,
.
, , , .
, .

,
. , , ,
,
. ,
, , , . 64-
.
33- .
. ,
,
. ,
, 33- . ,
,
, , !
, ,
. ,
, .
, ,
, .
. ,
.
-, , -,
198

.
, ,
, . - ,
, .
.
, , , ,
, !

34- .
:
:
:
: 20-
: (34, 43)
:
:
34-

34- .
, ,
.
, .
.
34- .
, ,
.
, -
.
, 34- ,
,
. 34- ,
. ,
. ,
.
, . 34-

. ,
, ,
.
, , , 34- -
, , ,
.
.

, . 34
, 20 ( 20- , . .),
, . 34-
. , .
, ,
199

.
34-
. ,
, .
, , .
,
. , 34- 43 .
, , .
34- . ,
, .
34- ,
.
, , .

. ,
.
,
. 34- ,
.
.
34- , ,
-
. , ,
34- . 34-
,
, .

. ,
, .
. ,
,
,
.
34- ,
. , .
,
,
.
. , ,
, . 34-

. , .
, ,
.
, .
. ,
.

34- .
, , .
.
200

- .
, .
,
34- ,
. ,
, .

,
. .
.
, , .
, ,
. ,
. ,
. ,
, .
34-

34- 34- ,
.
, .
, . 34-
, , , ,
.
,
.
. , ,
, , .
, .
, 34- ,
. ,
. ,
, .
34- .
34- . ,
,
. ,
. , ,
. , 34-
, .
, 34- . ,
,
. 34-
.
34- . ,
. .

. . , ,
. , ,
. (
21- , ).
, ,
201

. ,
. .
, 34- ,
, , .
, .

. , , ,
.
, (20-
, 34- ). 34-
, , , -
.
, , , , .
, . ,
,
.
43- 34-
, .
, . ,
. .
. ?
.
? .
. . ,
.
34-
,
, 34- ,
.
, .
. ,
, , , .
.
. ,
.
. 34- ,
, , ,
, .
34- .
, ,
,
. ,
, , !
34- :
, . .
, ,
, ,
, , 34- .
, . ,
, ,
. .
.
202

, .
,
. , ,
.
.
. , .
, 34-
, . , ,
,
. -
-.
, .
, , , .
, 34- ,
. ,
.
, ,
, ,
.
34- .
, 20- ,
,
. ,
. ,
, ,
! ,
.
, ,
. ,
.
34- .

. ,
. ,
. ,
, ,
. , 34-
. :
,
.

, .
,
.
.
.
:
,
.
.
203

35 :



: 5- . : (35)
: / . :
35-

, .
, 35-,
. 35-
, 35- .
, ,
, .
,
. , 35- , ,
, .
, - , .
35-
. ,
. 35- ,
,
. ,
, -, , ,
. , ,
( ) , ,
.
, . 35- ,

.
5- 35- , ,
.
,
, , .
, ,
35- . , ,
. ,
.
, , ,
. . ,
.
35- ,
. ,
, , .

, (
) , - - . 204

, ,
. , ,
,
. , ,
. -
-, , , .
,
-
! - .
,
. 35-
, .
35- ,
. , ,
,
, .
, .
35-
, . ,
, .
, , , .
, .
.
, , , ,
.
, . ,
. ,
, .
.
35-
.

35- .
. , ,
,
. ,
.
, .
,
. , , .

35- , . ,
, .
, , , ,
.
,
. ,
. ,
.
, ,
, .
205


35 -

. ,
. ,
35- .
. , 35- ,
, . , ,
,
. ,
.
, ,
.
, .
, ,
.
(, 55 ),
. ,
, 35-
. ,
. 35- ,
.
, .
, , .
35- , ,
. 35- 41-
, ,
. 35-
41- . , . 35-
.
41 , , ,
. , 41- ,
. 35-
, ,
. ,
!
, ,
, .
. ,
,
. 35- ,
, .
, .
, ,
. ,
. ,
.
, , .
,
.
206

,
.
( ), .
-
.
,
. , ,
35-
. ,
.
.
.
, , ,
, .
. 35- ,
. ,
,
.
35- , .
.
, ,
.
, , ,
, .
,
.
. 35- 64- ,
- ,

. 35- , ,
.
, 35- ,
, . ,
, . ,
35-
.
, ,
. ,
. ,
, , ,
.
35-

64- ,
, ,
, , .
, , ,
, , . ,
, 35- ,
, , ,
207

. 35-
,
. 35- .
, 35- .

. , 35- , 35- .
,
. , 35- ,
. 35- ,
: . . 35-
. , , 35- . 35-
.
,
.
,
.
. , ,
. , 5- , 35-
. ,
. , 64 ,
, ,
.
, .
35- , , ,
, , ,
.

. ,
, ,
. 35- ?
. ,
, .
, ,
, .
, ,
.
,
.
, 35- .
,
. .
, ,
, , . 35-
, .
, ,
. 35- . 64- ,
60-, 35-
,
.
- 35-
. ,
208

. , .
35- ,
, .
.
.
35- 22- ,
, , , . 35 - .
, 35-
.

36- .
:
:
:
: 6-
: (36, 37, 22, 63)
:
:
36-

64 .
, . 36- ,
. ,
,
. , , ,
. 36-
,
.
,
.
- 64 , -
. -
. ,
. 36-
, .
, , 36-
.
, 36- ,
.
, , .
.
,
, . .
.
,
.
209

, ,
.
36- . ,
, 6- ,
.
. ,
36- . , ,
.
36-
().
. , . ,
.
, .
, !
36- , ,
.
, , , .
, .
36- , , , ,
/ . ,
- .
, . ,
, , .
, .
.
, . ,
,
, .
36- .
.
.
.
, ,
, .
, ,
. .
.
22- , 4
.
, (63- ). ,
, - .
,
. ,
. ,
, ,
, .

, ,
. ,
. -
. ,
210

,
, .
- .
. ,
,
- .

,
.
. ,
. , ,
,
. ,

, .
36-


, , ,
! 36- , , .
.
.
.
, , -
. , , 6-
, 36- .
, , , .
, , . ,
.
.
. ,
, , , .
, . ,
.
36- , 36-
, . ,
36-
, ,
. , 36- , ,
.
, ,
, .
.
, 36- .
, , .
. ,
.
,
. ,
, .
. 36-
211

, . ,
. ,
-.
.
36- , ,
. 36-
,
. ,
.
,
,
, . 36- -
. , ,
, . 36- , , ,
, .
, ,
.
36-

, 36- 36-
. 64 , ,

. ,
,
. 36-
. , ,
, , " ".
, ,
.
, , ,
, .
.
. 36-
.
, ,
.
: ?
, 36- . 25-
. 25-
, 36- .
() , . 36- ,
, , ,
. 36- . ,
, "". ,
, , , 36- ,
.
, , ,
, - . , ,
-
, . .
212

, .
"" . ,

, , .
, - 6- ,
.

, ,
. "
" , ,
,
.
.
,
,
.
, .
, , .
, .
36- - ,

. , 36- , -
, . ,
. ,
, .
- . ,
, , ,
, .
36- .
, ,
, ,
:
, .
, .
, .
, .
, .
, .
, .
, .
( 5, 3-11)

37- . .
( Harhor)
:
:
:

213

: 40-
: (36, 37, 22, 63)
:



, ,
. 37-
, .
37 , , -
. ,
, ,
. ,
, . ,
,
.
.
37- . ,
, , ,
. , , ,
. ,
, ,
. , ,
,
. 37-
, ,
.
37- .
. ,
, .
, ,
. ,
.
, . ,
, , ,
, -,
. , .
37- ,
. .
.
, ,
.
,
.
.
,
. ,
. 37- ,
.
214

,
, .
37- ,
, 40-
37- . , ,
,
, . ,
, . , ,
, .
,
, - .
,
. 37-
, , ,
,
.
,
.
. ,
.
,
. 37- ,
.
,
. ,
.
, 37- ,
, .
,
. ,
, ,
, .
,
.
. ,
, .
, .
37- . ,
37- .
, , - .
, .
. , ,
- . , ,
. , ,
,
. ,
,
.
.
215

-
37- . ,
, ,
. ,
,
, . , ,
. ,
.
, .
,
. ,
,
.

,
. ,
, .
, -
.
. ,
\,
. , ,
, . -
, , .


37- ,
. . ,
,
, . ,
. 37- ,
, .
, , .
37- ,
.
.
, ,
.
. , 55-
,
. ,
. ,
37- . ,
. ,
, ,
.
37- .
, .
.
216

.
, . ,
, .
,
.
,
. 37- , ,
. ,
, ,
.
55-
, .
,
.
.
.
,
. ,
, .
,
.
.
, .
.
, .
. ,
.
, . 37-
,
. ,
. .
. , ,
.
!
, , .

. ,
, ,
; .
. ,
: ,
,
. ,
, ,
. ,
, ,
.
.
37- , , .
, .
, 37-
217

. ,
, , .

, , .

. 37- ,
, ,
, .


37- ,
.
, , ,
, ,
,
. , ,
.
,
, .
, ( )
( ). ,
.
.
, 37- ,
, , .
,
. ,
, .
.
,
. , ,
,
. ,
,
.
37- ,
.
.
, 37- .
,
.
,
. , , ,
.
, , .
,
, ,
, .
37- .

218

.
. ,
.
,
. ,

.
, , .
, 37- :
, .
, .
.
,
. ,
-
, .
37- ,
. , ,
,
,
.
,
. , ,
, , .
, . ,
, ,
. ,
.
, ,
, . , .
, . ,
.
37- ,
. ,
. -
, ,
.
37- 22-
, 36- 63- .
.
,
, . 37-
, , 55-
. ,
, 40-
, . ,
.

219

38- .



: 39- . : (10, 17,
21, 25, 38, 51)
: . : .
38-

38- 39- .
.
. ,
38- , :
, , . ,
, ,
.
, . ,
. 38-
.
, ,
38- . 38-
,
, .
, .
, . - .
, , , .
, 38- .
, ,
, .
, 39- , 38-
- - , - - .
.
,
. 38-
, 28- .
,
.
, ,
. ,
,
. 38- .
, , ,
, .
,
38-
.
, ,
. ,
, ( ) .
, , ,
220

. , ,
. ,
, .
28-, 38- 39- ,
, .
.
38- . 38-
39-, .
, . ,
, ,
, .
38- . ,
, , , . -
38- , ,
. ,
.
. ,
. ,
.
,
. . 38-
.
, ,
,
. ,
,
. ,
( ), , ,
. 38- ,
.
, ( ),
, .

.
. ,
.
, . ,
.
.
, ,
. ,
.
. ,
, .

,
,
, .
. ,
. .
, ,
.
221

. , .
. ,
- ,
.
38-

38- 38- .
, .
, ,
.
. , ,
.
.
, .
. 38- .
38- ,

.
38- . - ,
. ,
, . .
,
. 38- , .
. , ,
, . ,
. ,
, . ,
, , ,
.
39- , 38- .
, . ,
. ,
, .
, , 38-
. , 38- , , 38-
. 38-
, . 38- ,
. ,
. ,
, . ,
, ,
.
38- , .
.
38-
. ,
.
, .
,
. .
, , , ,
222

.
38- . ,
, ,
, , . 38-
. .
,
. ,
38- . ,
, , . 38-
. -, 38- ,
, . , 38-
,
.
, 38- ,
, .
,
.
.
, .
, , . ,
, ,
. , ,
, .
, ,
38- .
38-

, . ,
.
, .
- . ,
, .
.
. . .
, .
, .
,
.
? , ,
, .
, . , ,
. ,
. .
.
, .
. , -,
, ,
. ,
, . ,
.
.
223

, , .
,
. , 38-
,
. , ,
. , ,
, . , 38-
. , ,
. ,
, .
, .
, ,
. ,
, . ,
.
38- . .
. : "
, ".
.
, , 38-
.
, .
, , ,
. .
, .
, 38- ,
, .
.
. ,
. , .

.
. .
,
. , ,
.
.
, .
, 38- , 39- .
,
, .
, 38- 28- .
(28 ).
.
,
,
. ,
. ,
, ,
, ,
.

224

39 . .
:
:
: .
: 38 .
: () 15, 39, 52, 53, 54, 58.
: .
: .
39 .
(?).

,
. 21
.
, ,
, .
39 38
. ,
().
.
,
.
39 .
, 39 ,
.
39-
().
(), 39
, . ,
().
, , .
,
. ,
. ,
, , .
, ,
.
39 . ,
, .
225

. , ,
. , ,
, , ?
, . , ,
, . , .
, .
, , ,
. , ,
- , .
.
, ,
. , . ,
. ,
. . .
.
, ? ,
? ,
,
.
39 .
, .
, .
-.
. 39 38 .
, (
), .
. ,
, -.
39
. , ,
,
. , -
, , .
, , -
.
, .
, ,
,
. ,
, .
, ,
.
. ,
-
, .
,
226

.
39 , . ,
. 39
. , ,
. , ,
, . ,
.
, .
39 , .
, .
, ,
, . , ,
, , ,
. , ,
. 39 . ,
, .
39 , .
.
.
.
64
. ,
. . , ,
. .
.
64 . ,
. , 39 , ,
. ,
, .
, ,
.
.
!
. ,
.
. , .

. , , .
.
, ,
. 39
, ,
.
39 .
.

227

,
, . ,
, .
. 39
.
, ,
,
. 7
.
7 ,
. , , ,
7 , .
. . ,
, , 7 ,
.
, .

. , ,
. , ,
. ,
. ,
. 7 .
. , . ,
,
. ,
, .
, ,
.
, . , ,
, , .
.
, 39
.
.
, ,
, , .
. , 39, !
-, , .

. ,
. .
, , . 39
, , , , ,
. , 39
.
39 . .
, .
228

, , .
, , .
, .
, .
, ,
, .
,
.
39 ,
. .
39 ,
.
39 .
.
39
.
.
39 , .
39 , .
, .
, .
,
. ,
. .
.
,
, .
. .
.
, .
, , .
. ,
, .
, ,
.
. .
. 39
, , .
. , , ,
. , .
. .
.
. ,
, .
229

. . ,
, . .
. , , .
.
.
, , . .
, . (38
). , ,
. , , . ,
. , ,
, , .
, -,
. , ,
, .
, .
, .
, .
55 . 55 39 .
, .
, , . ,
,
, . ,
. ,
. ,
.
, 39
, .
- , .
39 55 ,
.
,
. ,
, 39
.
55 , ,
.
.

40- .



: 37- . : (6, 40, 47,
64).
: . : .

230

40-

40-
.
.
, . ,
,
. ,
, .
40-
.
.
, : ,
, ,
, , .

, .
40- -
, .
, 37 ,
.
32- , .
40-
,
, . 40
, ,
. ,
.
-,
. , -
, , .
40- .
, , ,
,
. -
, ,
.
, ,
,
.
,
.
, .
. ,
, .
, 40-
, ,

. , ,

. , ,
, ,
231

,
, , .
40- . ,
,
. ,
.
. ,
,
. ,
. , 40-
. ,
.
40-
. ,
,
. ,
.
,
, ,
, ,
.
, ,
,
. 40- .
, ,

. 40- ,
. 40- ,
, , , .
, ,
. , ,
.
, , . 40-
.
, -
.
.
,
, , .

. ,
, .
,
, .
, ,
. 40- ,
.
, .

. ,
232

.
. .
. ,
.
, ,
, . ,
, ,
.
40-

40- ,
. , ,
. ,
, . 40- ,
.
. ,
, .
, , .

.
40- . ,
.
. ,
.
. , ,
, . ,
.
,
. 40-
. ,
. ,
, . 40-
.
.
,
. , ,
, . , ,
, . ,
, , ,
. ,
, ,
. ,
40- .
, , ,
, ,
. .
.
40- ,
, .
, , ,
. 40-
233

- , -
, , - .
, , ,
, .

.
, :
. 40- .
. ,
. ,
, .
, ,
. 40-
, 37- . 37- ,
40- ,
, .
, , .
, .
: , , ,
, .
, , , ,
, , .
40-

.

, .
, .

, ,
. , 40-
.
37- 40-
. 37- ,
, , ,
, ,
. ,
. , ,
. 40- ,
, ,
. , 40- ,
. , 40- -
, 40 .
, , ,
!
, , ,
.
. ,
, ,
, . , 40-

234

. , 40-

. , 40- , ,
. .
, ,
. , ,
.
40- , , ,
. ,
.
.
. -
, , , ,
, . 40-

. , ,
.
,
. , ,
, .
.
, . ,
,
, , ,
. , 40- ,
.
,
,
. ,
, .
,
.
, , ,
. , 40- , ,
40- . 40- ,
, , 37- ,
.
, , ,
.
, 40-
. , ( 22
), ,
. 40-
,
.
, .
,
. 22- , ,
.
; .
.

235

41- .
: ()
:
:
: 31-
: (41)
:
: ()
41-

41- -
. ,
, .
. , ,
.
, .
A, T, C G.
(), (), () (G),
.
, .
, , , ,
, . ,
, ATG,
. ,
.
CAATTGTCATACGACTTGCAGTGAGCGTCAGGAGCACGTCCAGGAACTCC
TCAGCAGCGCCTCCTTCAGCTCCACAGCCAGACGCCCTCAGACAGCAAAG
CCTACCCCCGCGCCGCGCCCTGCCCGCCGCTGCGATGCTCGCCCGCGCCC
TGCTGCTGTGCGCGGTCCTGGCGCTCAGCCATACAGGTGAGTACCTGGCG
CCGCGCACCGGGGACTCCGGTTCCACGCACCCGGGCAGAGTTTCCGCTCT
, , 41-
. ,
, .
41-
. 41- ,
, . 41-
, , , ,
, ,
. - 41- ,
, , ,
.
41-
. ,
, .
, - ,
.
41- ,
. , .
, (30- ) . ,
.
236

,
? - ? ,
.
, ,
. , , .
, ,
, Homo Sapiens.

. . ,
, , .
, ,

.
-
. 41-
. ,
. 41-
.
, ,
.
. , ,
. ,
, ,
. , ,
,
.
,
, .
, , ,
. ,
, .
, ,
,

.
41- . ,
, . 41 31- . 31-
, , ,
. ,
41- , ,
. , ,
.
, 41- - ,
. ,
,
. , ,
, .
,
. ,
, ,
. ,
237

, . , ,
.

41- ,
. , ,
, . ,
. , ,
, , .
,
. ,
,
.
.

.
, .
, ,
, .
,
. , ,
.
,
, .
41-

41- ,
.
41- . ,
, :
.
, .
,
. ,
,
.
,
.
41- .
,
. 64-
. , , 31- ,
,
.
, ,
, . , , ,
. (41) (31) ,
. ,
. ,
.
41- ,
,
238

. ,
, .
, ,
. ,
-
.
, 41- .
, ,
.
,
, ,
.
41- ,
.
.
41- .
,
, , .
,
. ,
, .
.
41- 41- : ,
.
,
, - 41-, ,
. 21
, .
, , ,
, ,
. 20
, ,
, .
41-
.

,
.
.

. , ,
. , ,
,
. , ,
. , ,
,
, ,
. 41- .
41-

41- ,
239

,
. ,
- , .
: ,
? , 41-
.
-, , .
, , ,
, .
, ,
. 10
, ,
, . , ,
, , .
,
, , , -
. ,
.
41- - , ,
41- , .
, . ,
, . .
, ,
, . 41- ,
. ,
, , , 41- ,
, . , ,
, .
, 41- .
- , ,
.
,
. - ,
, .
() -.
, , ,
, , , .
, .
, , ,
. , ,
, - . ,
.
.
, , . 63
, .. .
41- ,
. ,
, .
. , ,
, , , , ,
.
, 41- , . ,
240

, . ,
. , .
, -,
- . , ,
. ,
. ! , -
. -
. .
.
41- , ,

.

42 .



: 32
: (3, 20, 23, 24. 27, 42)
: ()
:
42-

.
. , , . -
, , - -
, , , , , .
, , ,
, ,
. : ,
. , , ,
, . , ,
-. .
, ,
.
42- , ,
. , . 30-
, , ,
, , .
,
.
42- ,
, 42- .
, ,
.
, - - - ,
.
42- ,
.
241

.
,
. , ,
, ..
. , ,
- , . , ,
42- 42- .
42- ,
, .
, 6
. 3 42-. 3-

. -,
. 42-
. ,
, , , .
, ,
, .
, ,
.
.
, . , ,
- , ,
. ,
. , ,
42- .
, , ,
,
. ,
, , ,
. ,
, , .
42- 32- . ,
, ,
. ,
, , .

. , ,
.
, - , , ,

. , , - ,
, -, , .
,
.
, ,
.

, . -, ,
-, .
. , ,
242

- . ,
, ,
, .
.
,
, .
,
- .
, .
, - .
,
. , .
, ,
. , ,
, .
. ,
().
,
.
42-

, . ,
,
. , , ,
. ,
, . ,
, ,
, ( )
, .
, .
,
. .
, -
. .
.
, , ,
. , , ,
: , ,
, .
.
, .
, . 42-
,
.
, . ,
, ,
.
, , ,
, , , ,
.
243

42- ,
, .
, ,
. , ,

, .
,
, .
, . ,
, .
,
. .

. ,
. 42-
, ,
. ,
. ,
, , , ,
.
42-

42- . ,
. , .
.
, .
. 42-
.
, .
42- .
, , ,
- - .
, .. . 42-
, .
, ,
,
, .
.
.
,
, ,
.
, .
, ,
. ,
,
. , ,
.
, , , .
, - . -
, .
244

, , .
,
, . ,
,
, .
. , .
, ,
.
, , :
. , ,
. ! , .
,
.
. . !
42- -
( ) . ,
.
, , , ,
.
. ,
. ,
. .
. , -
, , -
! , , , .
, , , ,
. , ,
, -.
, .
, , , ,
. - ,
, . , ,
?
, , ,
.

43- .

()

: 23- . : (34, 43)
: . :
43-

, ,
, .
, ,
64 .
, .
245

, ,
.
,
,
. ,
. .
, , ,
, , ,
.
;
.
.
, , .
, . 43- ,
.
. ,
, - ,
. 43- .
,
, , .
,
. 43-
, .
43- ,
. ,
. ,
. ,
, , .
, ,
!
. , ,
. ,
.
, .
,
. ,
, .
, , , .
43- ,
. , ,
,
. , ,
, .
, ,
.
.
, ,
. ,
. ,
. , .
, ,
.
246

. ,
, . 43-
,
,
! , ,
. , .
43-
. ,
, ,
. ,
.
. ,
. , ,
, , . ,
, , .
, , ,
( 23- ).
!
, ,
. , ,
, .
43- , ,
. ,
,
. , , ,
. , ,
.
, ,
, .
,
.
, , , ,
, , ,
.

43- .
. ,
.
, , .
,
, .
. 43-
. , ,
, ,
.
, , ,
.


. , , , , - .
,
247

, . ,
, , ,
. , , ,
.

, .
, ,
,
.
43-

43- . ,
,
. , ,
. , ,
, , ,
. .
, .
. , 43- ,
. ,
, .
, , , .
, , .
, , , ,
, .
, , ,
.
. , ,
, ,
. ,
.
. ,
. , , ,
, ,
.
,
. , .
. ().
. ,
, , ,
. , 43- ,
, , .
.
(23- ),
.
43- .
, . ,
, - .
, ,
. 43- ,
248

, , ,
. ,
. .
, .

, .
. ,
,
.

, .
, ,
. ,
, ,
. , ,
, , , , .
.
, , ,
.
, ,
. , ,
,
.
43- 34- ,
().
, 34-
, 43-
. ,
,
, ,
. ,
. , ,
,
- . , ,
, ,
. .
.
43-

,
. ,
.
, , ,
,
. ,
. ,
,
. 64
, ,
. , - .
. , , ,
249

. ,
.
,
,
, . 43- .
, .
, Epiphany ,
.
,
.
, . ,

. ,
.
, ,
, .
43- ,
, .
, , ,
. ,
, , .
,
, . ,
, , .
. ,
- ,
. ,
, !
, , ,
.

.
, ,
, .
, ,
.
,
. , ,
,
, .
, .
,
.
43- , ,
. 22-

,
, . 43-
,
.

, . ,
250

,
, .
43-
, .
. ,
, , , .
,
, ,
, . 43-
,
. , , ,
, ,
, .
, .
. 43-
, . ,
. !

44- .
:
:
:
: 24- . : (44, 50)
: . : .
44-

44- ,
, . ,
,
. , ,
.
,
.
,
.
. , ,
, .
, , ,
,
, , ,
. ,
.
, ,
. ,
, .
, ,
. , , ,
.
251

,

. ,
,
. .
. ,
, . 44-
, ,
.
44-
( ), 44-
, ,
. , -,
, , . ,
. , ,

. , ,
, ,
.
44- , ,
. ,
. , ,
, , .
. .

. , ,
.
.
,
.
. ,
.
, , ,
.
, .
.
, ,
,
.
, 24- , 44-
,
. 44- .
,
, . , ,
. ,
. ,
, .
,
. , ,
, . ,
,
252

. , , , ,

, .

44- .
, . ,
, .
, .
,
. , ,
. ,
, .

44- .
, , .
44- ,
, . - ,
, , ,
. ,
,
. ,
.
44-

44- , .
,
.
,
, . ,
.
. , , , 57- ,
.
. -
, .
44- ,
. , ,
; ,
.
.
, 44-
.
,
. 44- .
, ,
, .
-
. 44-
, .
,
.
, ,
253

.
, 44- .
. ,
, ,
, , , .
.
22- ,
, Corpus Christy .
, ,
, , ,
. , ,

.
. , ,
, .
, , , ,
, ,
.
, ,
, ,
.
.
. ,
,
.
, 44- ,
.

, ,
.
,
. , , ,
.
. ,
, .
, .
44- . ,
,
. 44- , .
44-

44- .
. 24-
, , . ,
. ,
.
. ,
, , , .

.
, . 44- 50-
, , ,
254

, 50- , ,
.
.
, ,
,
, .
,
, , ,
, .
, , ,
44- .
, .
, , ,
. ,
. , , .
,
,
. .
, . ,
,
. ,
, .
44-
. , .
.
, , ,
. .
, . 44-
,
. , 44- ,
.

, , .
, .
, ,
. ,
, . , ,
, ,
, .
, ,
. ,
, .
.
, ,
. ,
. , 44 . ,
, ,
, . ,
. ,
, ,
. ,
255

.
, ,
. ,
.
. ,
. ,
, .

.
, 44- , ,
, , . ,
, .
.
, ,
, .
. ,
, .
, 144000,
,
.
,
. ,
. ,
. ,
, .
. ,
,
, .
,
, , , !

45-
:
:
:
: 26-
: (16, 45)
: .
:
45-

, ,
.
, .
. .
, .
. ,
,
256

, . 45-
- , ,
. , ,
. , ,
. ,
.
-.
, ,
, .
, , , ,
, .
, ,
,
.
. ,
. .
,
, .
, .
45-
. , ,
. ,
. .
, , ,
. ,
, .
, , . 7-
, ,

. - .
,
, .
, ,

. ,
.
, 45- .
. .
, ,
,
. , ,
.
,
.

. , , - .
.
, ,
, . 45- 26-
, ,
.
257

, , .
, ! ,
, , ,
. ,
. , ,
.
. ,
-.
, ?
, . ,
, ,
. ,

. .
, , ,
. ,
. ,
. , ,
. . ,
, , .
, .

45- , .
.
.
, , ,
, . ,
, .
, ,
.

, ,
, ,
, . ,
, .
45- , ,
. , ,
, ,
. ,
, , ,
. ,
.
45-

, .
,
.
, .
- .
, .
, , , .
258

.
45- .
, , ,
, .
,
.
-,

. 45-
.
, .
,
,
, ,
. , ,
,
, . , , ,
, .
, ,
. 45- .
, .
, , ,
, ,
, . ,
,
. 45- ,
,
.

.
. 45- ,
, ,
.
45-
, .
,
, .
45- , , . 45 16-
,
.
, .
,
,
, , . ,
,
.
.
45- . ,
, . ,
. ,
.
, 16 ,
259

,
, .
, .
. 45-
,
.
, 45- . ,
.
, .
, .
. ,
,
, .
. , 45- ,
,
, . ,
.
,
,
. , ,
,
. , , ,
, .
,
45- .
, ,
.
45-

45- , ,
.
, .
. ,
45- .
,
.
.
.
.
, ,
. ,
, .
.
,
.
.
,
. 45- . ,
. , ,

. , ,
. , , ,
260

. ,

. .
45- , , .
. ,
.
. ,

, . ,
-. ,
, , , , 44 45-
. ,
-. 44-
, 45- . , 46 ,
, .
45- , ,
, , .
44- ,
, .
,

, .
. ,
, . ,
,
,
,
. , ,
.
, .
. ,
,
.
, , ,
. , ,
, , ,
, , .
, ,
. ,
.
, ,
. -
.
, 45- .
. ,
, . ,
, 45- .
, , .
, , . ,
, .
, .
22- ,
261

, .
, .
,
, .
. 22- :
, 45- ,
.
. ,
.
, .
,
, , ,
, .

.
, , ,
45- . , ,
, .
,
. 6- 47
.
, , ,
.

46- . .
:
:
: 25-
: (18, 46, 48, 57)
( )

/
46-

- .
, , .
, ,
. ,
, ,
, - .
, ,
, . ,
. .
, , .
. ,
,
262

, ,
, .
, ,
, , .
. , ,
, , . ,
, , . ,
, . ,
, ,
. , ,
. ,
, .
, 46-
.
, , , ,
.
46- .
,
. ,
, .
, , .
,
. , , ,
.
.
46- .
, , ,
21 . 46- ,
, ,
,
, .
7 ,
.
. ,
.
,
, ,
. ,
, .
, , ,
, .
, ,
. ,
, .

. , ,
263

-
- , .
46- .
,
.
46- , 46-
. ,
, .
,
. , ,
, ,
.
, 46- ,
.
, , , .
,
, . , , ,
. ,
.
, ,
, . , , .

. , . , ,
, ,
. - 46- 25-
. ,
. ,
.
, . ,
, 46 , , , .
()
.
,
, .
- . ,
. .
, ,
.
, , , ,
.
()
. ,
,
. , ,
264

, ,
.
,
, . , , ,
, - , , , ,
. , ,
, ,
, .
64 .
:
46-

-
. 25- 46- .
. - ,
, , , , .
, . ,
.
.
, , (a matter),
: (it matters) (it doesn't matter),

, , . ,
,
!
. , ,
. ,
, .
64- .
,
.
, ,
.
64 . 46-
. ,
,
. , .
, ,
. ,
. 46- , ,
,
.
, ,
. 46-
.
, .
, -
. , .
265

, .
, ,
, . ,
.
46- .
. ,
, .
. , ,
, .
, .
. , ,
. , ,
,
. ,
. , , , ,
.
.
, , 46-
.
. , ,
,
. .
. ,
.
, .
, !
46-

46- .
, , .
, .
.
, . .
,
.
. ,
.
46- , . ,
. ,
,
, ,
. , ,
. .
, . ,
, ,
. ,
. ,
.
, , .
, 46- .
, , ,
266

. ,
. , -
, , ,
. 46-
, , , ,

.
, .
. ,
, .
, ,
.
, ,
, . , ,
.
.
, . -
, .
46- , , .
, ,
.
, 46- ,
,
. , ,
, .
,
. 46- , ,
.
, , ,
. , ,
,
, . ,
, , . ,
,
.

. ,
.
, .
, .
, , . ,
. .

47- .
:
:
:

267

: 22-
: (6, 40, 47, 64)
: ( )
:


47- .
. 47-
. , , ,
. 47- ,
.
. 47- ,
. ,
, .
98% ,
. ,
.
47- .
, 47- ,
, .
,
. ,
. ,
.
,
.
. , ,
, , ,
. , 64 , ,
, ,
, .
,
.

. , - ,
. , .
.
, ,
, . ,
, ,
, . 47-
.
,
, .
.
47- , , ,
. , ,
268

, , .

. , , ,
.
,
, .
, .
.
. ,
, .
.
47- 22- .
, . ,
. ,
, , .
.
,
.
. .
, ,
. ,
. ,
, .
, ,
, .
.
47- , ,
, .
, ,
, .
.
, ,
.
,
. , ,
. . ,
. ,
. , , .
, , ,
.

47- .
,
. ,
. ,
. ,
. ,
.

, .
269

,
.
, . ,

.
, . ,
.


47-
, . ,
, .

, .
,
.
,
. ,
.
,
.
. ,
, .

.
.

. , ,
. , ,
. , .
,
- . , ,
.
, 47- .
, , ,
.
, -
, , .
,
. .
,
. ,
. .
.
.
.
,
. ,
.
, .
270

,
.
. ,
, ,
. ,
. ,
, , ,
.
,
.
, .

, . , 47-
, ,
. , ,
, .
. .


47- 47- .
. , 47-
.
. ,
.
, . ,
, , ,
, .
,
.
.
, .
, . 47-
, - ,
.
, , , .
,
, . , ,
, -.
, unio mystica ,
,
.
, . ,
. ,
, ,
. - , ,
.
, . , , ,
.
.
, . ,
271

, .
.
, .
. ,
, , .
,
, ,
. , ,
, , ,
.
, ,
.
22- , 47-
. , , ,
, .
, , ,
, .
, 47- ,
.
, .
,
.
, . ,
, ,
.
Urukhai

48- .
:
:
:
: 21- . : (18, 46, 48,
57)
: (). :
48-
EQ IQ
, , 48- .
. , ,
.
, . ,
.
,
,
.
48- .
, .
,
, ,
272

, .
48- , ,
.
, , 48
.
48- , .
48- ,
. ,
.
, .
() ,
, ,
, , . 48- ,
.
, ,
,
. ,
,
.
.
, , ,
. ,
EQ . , EQ
IQ .
.
. 48-
.
, ,
, - .
, 48- ,
.
, 21- ,
.
, , ,
. ,
.
. ,
,
. . , ,
. (
),
.
, ,
. , ,
, , .
. ,
, ,
.
,
, .
48- .
273

,
! .
, , . 48-
.
,
. 48- ,
, , . ,
- , . ,
,
, .
.
, ,
. - ,
. 48-
. .
, ,
, .
,
.
, ,
. ,
.
, .
, , .

48-
( ), ( ).
48- . ,
.
. , ,
. ,
, .
,
, .

, ,
48- . ,
- . ,
. ,
, .
. -
. , ,
, .
.
48-

, 48- ,
. ,
.
, ,
7 14 .
274

:
() .
,
. ,
.
, ,
. 14-, ,
, ,
, .
, . ,
,
, .
.
.
, .
, ,
.
, .
- 48- .
, .
, .
, 48-
. , ,
. , ,
.
. , ,
, , , .
. . ,
.
.
, ,
.
, . ,
, , .
.
. ,
, ,
,
. , ,
, . - ,
, ,
, .
.
,
. , , ,
.
, ,
. , ,
.
,
. ,
,
275

. , ,
.
, .
, .
, , .
,
, .
, .
. ,
,
, . ,
, .
, , .
, ,
, ,
. , ,
, , ,
.
, .

. .
. , ,
, .
,
. , .
.
. ,
.
. ,
, ,
, .
48- , .
. , ,
, .
, ,
.
48-
. , 48-
, , , . ,
, ,
-. ,
. 48-
, .
,
,
.
48-

48- .
. ,
,
, . 64-
276

64- .
.
, ,
. 48- ,
, , . ,
.
, , .
.
, . ,
, .
.
,
, . ,
, .
, .
.
, .
. ,
. ?
.
. .
. ,
.
? : ? ? ?
, , . ,
.
.
, .
, , ,
, .
. .
.
.
. . ,
, , . , , ,
, , . -
, ,
. , , ,
, , . , ,
, , ,
, ,
.
.
, .
, .
, , !
, .
. (
) ,
, . ,
. ,
. !
277

. ,
.
. , ,
, .
, .
- .
, , .
, .
, , ,
.
, ,
.
48- ,
, ,
. ,
. ,
. ,
, , , , . .
,
, , . ,
, , ,
,
.
. ,
. ,
, . , 48-
.

49- .
:
:
:
: 4- . : .
: (49, 55). :
49-

49-
. ,
,
!
49- . ,
. 49- ,
, ,
.
49- .

.
.
278

, , , ,
. ,
, ,
. , , .
,
.
, .
,
.
.
, 49- .
.
.
, .
.
49- , , .

. , ,
.
, .
,
49-
. ,
. ,

.
, , 49- ,
. ,
. -
. ,
,
. . .
,
, . ,
. ,
, .
,
. ,
, 49- .
49- 55- .

, . ,
, .
, 55- , ,
, 49- ,
.
, 49- , 55-. ,
, , ,
, .
49- .
.
, ,
279

. 49- ,
. , . 49-
. , .
, .
49- ,
, .
, ,
. .
.
, ,
.
, .
, ,
, .
,
. .
, ,
. ,
, 4- , 49 . ,
, . 49
, , . ,
, .
,
. ,
, .
, ,
.
, 49- ,
. , ,
, .
, .
, .
, ,

. .
, , , .
49 ,
,
.

. ,
, , - ,
,
.
,
, , , .
, ;
. .
, ,
, ,
.
280

, .

, , . 49-
, .
.
, . ,
. ,
, ,
.
-,
. , , -.
49-

49- ,
. . 49-
.
,
.
. .
,
, ,
.
, .
. 49 , , . ,
, ,
.
, 49- .
, ,
. , , ,
. 4- ,
. , , 49- ,
. , ,
.
, . .

. ,
, , . 49-
, (
55- ), .
.
49-
. 49- ,
, , , .
.
49-
,
.
, . ,
, ,
. 49- ,
.
281

. ,
49-
. ,
,
.
.
, 49- , ,
. , 49- ,
,
, . ,
, , ,
49- ,
. , ,
.
.
,
, ,
.
49-

49- ,
. 49- 49- ,
49- 49- .
, , , ,
. 55- 49-
, .
, . 49- ,
, 49- . ,
, , . 49-
.
, . ,
.
, .
. , ,
.
.
.
, . ,
.
. ()
49- 55- , .

, , ,
.
,
. , , .
, 40 ,
.
Homo Sapiens,
, 350
. , . 49-
, , .
282

, , .
.
, , , ,
.
. 49-
. ,
, , .
.
, 49- -
. 49- . ,
, , ,
.
, , .
.
, . 49- ,
,
. , ,
.
, .
, .
, .
, , , , ?

, ,
?
, ?
, . , .

, .
, ,
, .
. ,
, , .
, ,
. ,
, . .
, , ,
, .
49- , 4-
. , , ,
. .
. ,
. , -
, . ,
. , ,
.
, ,
, .
,
. . , ,
283

. ?

50- .
:
:
:
: 3- . : (44, 50)
: . : .
50-

,
, .
: , .
,
. , 64 , ,
, .
,
. , 50-
, .
50- .

. 50- ,
. ,
.
, 50- ,
, .
. , ,
. , ,
.
, .
,
, , ,
.
,
, , ,
.
,
. , , ,
, , . 50-
,
.
.
, , .
, 50- ,
. , ,

. , ,
. , ,
284

.
, , , ,
. , 3-
50- .
50- -
, . , ,
50- .
, , .
,
. ,
, , .
, . ,
.
.
, ,
. , ,
, .
,
. 50- ,
,
, .
44- , 44- 50-
, . 44
, .
, 50- .
,
.
, ,
, .
,
.
, , -
50- . -
.
,
. 50- ,
. , , ,
, .
, , .
, ,
, .

50- ,
,
. .
.
.
, ,
- .
,
. ,
.
285


, ,
, .
, , ,
. , ,
. , ,
.
, .
, ,
.
50-

50-
. 50- ,
, . ,
, 50- , :
?. ,
, , .
50- .
.
,
.
64 , ,
.
50- 59- .
, 50- , 59- .
, ,
59- 50- .
.
.
, .
.
: ,
, , .
50- , ,
. ,
, ,
. ,
, , ,
, . ,
. , ,
,
, .
,
.
,
. 50-
, .
50- ,
, , . , 50-
, . 50-
286

,
50- , ,
. ,
, .
,
, .
.
, 50-
. .
, , .
, 50- , ,
, 45 . ,
, , ,
. ,
. , ,
.
,
.
50-
. 3-
, . ,
, . 3-
.
,
. 44-
, 50
. , ,
,
.

, .
50-

50- , 50- .
,
,
. ,
. ,
. .
, .
,
.
. , ,
.
50- ,
. ,
.
. , 50- ,
.
, .
,
287

. ,
.
, .
, ,
.
50- , ,
, , . 50-
. ,
,
.
, ,
.
44- . ,
,
.
.
.
.
, . ,
.
, .
.
,
.
.
.
,
,
. , ,
.
50- ,
. ,
. ,
,
. 50-
,
, , ,
. .
50- ,
. 50-
.
. ,

. , ,
. - 3-
, , 50-
.
,
.
, 50- . , 50-
- , 50 .
50- . 6- ,
288

, .
,
. 50- .
, 50- , ,
, . ,
, , .
,
. ,
. 50-
-. ,
, , .

51- .
:
:
:
: 57- . : (10,17,
21, 25, 38, 51)
: :
51-

51- ,
, ,
. ,
.
51- , . ,
, ,
. , 57 , 51-
.
, , ,
.
, 51- ,
, .
.
, ,
, .
,
, . , ,
.
,
, .
. ,
,
.
, , ,
.
. , ,
. .
, ,
289

. , ,
, . ,
,
. ,
, .
.
,
.
51- , ,
. ,
. , , . ,
. , 51-
, ,
. 51-
,
.
,
.
,
.
. , ,
, .
, 51- . ,
. , , ,
. 51-
.
. ,
, -
. - , ,
. ,
. 51- ,
. ,
. , ,
. ,
, , .
51-
. 51- ,
.
,
, . ,
, .
, - ,
, .
, , ,
. , 51- ,
.

, 51-
. , ,
, .
290

- , .
.
, ,
.
. , ,
, .
,
. ,
.

.
.
.
. ,
, .
.
, .
, 51- .
. ,
.
, - ,
, , .
51-

51- , 51-
. 51- ,
.
, , 51
. 51- ,
.

.
, .
. ,
. ,
. ,
.
51-
. ,
, - . ,
, .
, , , . 38 39- , 51- .
. ,
. , ,
, , .
51- .
.
51- .
291

, . ,
, ,
, , . ,
, 51- ,
. 51- ,
- . - ,
, .
.
. , .
,
. ,
51- .
51- ,
. . ,
,
. .
, . ,
, ,
.
. , ,
. 51-
. !
. ,
, , ,
-. , ,
, . 51-
, 51- .

. , .
, 51- , .
, , .
51- ,
. 64
. 51-
, .
, . ,
,
, ,
. 64- ,
, . 51-

.
, ,
.
51-

. ,
, , , ,
, , . ,
, .
, .
292

, ,
. 64
,
. ,
, , ,
. ,
.

, .
51- . .
. ,
,
. - ,
, - , - .
, , . ,
, . ,
, . . 51-
- . ,
. , , , .
. 51-
, , !
, ?
. , ,
, , ,
, ,
.
, , .
, - ,
. .
,
. ,
. ,
. , ,
,
. ,
.
. ,
51- , , . ,
, , , ,
, . .
, ! ,
, .
. , , ,
, .
.
, .
.
, ,
.
,
.

293

. , . ,
. , ,
,
. 51- ,
, .
,
. ,
, ,
. ,
. .
. -.
, , , .
, , . ,
, . . ,
.
, !
, , .
, - .
, .
51- , .
.
, ,
.
. , ,
. ,
. ,
. ,
.
, .
, .
, .
, , .
,
. 51- (),
. .
, . ,
. , .
, ,
. , .
, .
, 51-
. 51-
, .
, . ,
.
, , , , ,
. ,
, .
, , ,
. , ,
.
. , ,
294

52- .



: 58- . : (15, 39, 52, 53,
54, 58)
: . :
52-

52- .
,
, . 52 , 58-
,
. .
- . ,
. , , ,
. ,
.
.
,
, , , -
, . ,
. , ,
, .
, ,
, . , - ,
,
. , ,
, . ,
. ,
.
. , ,
, .
,
. , ,
, . ,
, , , ,
, .
. , ,
, . 52-
,
, .
,
,
. , , ,
.
. ,
295

, . -
. ,
, ,
. , , , ,
. ,
, .
, .
.
, .
, ,
.
, . 52-
. [
,
, , 52- ,
, ,
.]
52- 52-
. 52-
. , ,
, . ,

. - ,
. 52-
, .
, ,
, .
; ,
, , . 52-
, , .
.
, ,
,
, .
,
,
, .
,

.

,
, 52- .
.
, .
, .
,
, .
.
.
52- ,
.
296


, . ,
. , ,
.
, , .
, .
, .
.
,
.
52-

52- - .
- . , ,
. , ,
,
. ,
. , .
-, ,
. ,
, ,
, , .
52- .
, , .
, , .
,
. , ,

, . 52-
, . ,
. , ,
, . ,
.
, 52- .
,
. ,
. , .
, . ,
, ,
. , ,
. ,
. ,
, .
.
, ,
. 10 ,
, 5000 .
.
.
, :
? . ,
, ,
297

, .
.
52- , ,
, .
, .
, ,
. , , .
,
, ,
. , ,
, , .
.
, .
.
, , ,
, , ,
. . .
,
,
, , .

, .
.
52- , .
, ,
. .
,
.
, (15), (39),
(52), (53), (54) (5. 52-
, .

.
, .
52-

,
, . ,
,
, .
, .
, , ,
. .
, , , :
52- .

.
. .

298

. . 52-
. 52- -,
(), ,
, ,
.
52- ,
. ,
.
, .
, ,
, .
, .
58- ,
52- .
, 52- 58-,
. ,
.
, .
, , ,
. ,
, , ,
-. ,
,
. ,
, ( )
( ).

.
,
. 52 ,
, . ,
, ,
. , ( )
, .
, 52- ,
, .

, .
,
. .
, , ,
,
, .
,
, . 52
, ,
.
55- , ,
, .
, , ,
2027 . ,
64-
299

.
,
. ,
, 52- . , 52- ,
.
, 52- ,

.
52-
. , ,
, . 52-
. ,
, .
, 52- ,
. ,
.
, ,
,
.
.

53- .
:
:
:
: 54-
: (15, 39, 52, 53, 54, 58)
:
:
53-

: ,
. ,
53- , . , ,
. ,
. ,
.
, , ,
, , .
, , .

. ,
.
53- , 54- ,
, . ,
,
, . ,
, ,
300

. ,
, , ,

. 53- .
.
, .
, , , .
, ,
, . ,
, , ,
.
,
, 53- ,
. , ,
.
, -
. ,
. ,
, ,
. .
. ,
. ,
, , .
, , .

. ,
.
, ,
.
, .
, . , ,
,
. , ,
, .
,
, , ,
. , , .
, .

,
.
. ,
- .
, , ,
. , ,
.
?
. . .
, , ,
, (. 22-
). , ,

301

. , 53-
. , .
, ,
.
, .
, ,
. , , ,
. 53-
(). , ,
,
. , , ,
, ,
. ,
, , ,
.
, ,
. ,
.
53- , ? ,
.
,
. .
, ,
. 53- ,
, ,
, . ,
, , , , ,
, .

,
. .
,
- . ,
.
. ,
. , ,
, , , .
.

53- , -
, .
, .
. , ,
, . ,
, .
, .
.
, ,
, .
53-
302


53- , , ,
.
, .
.
. 53-
. , ,
, . ,
,
.
53- .
. ,
53- , .
, .
, .
.
,
, .
.
.
, , .
, .
, -, ,
.
, ,
, , . ,
, .
, , .
, ,
, .
,
. ,
. -
, ,
, , .
, ,
. ,
.
, ,
, ,
. .
, ,
, .
, , . ,
. ,
, ,
. , ,
, .
, . 53
. ,
. .
303

, .
.
, , , ,
. .
.
, , . ,
. ,
, .
, 53-
. ,
. ,
, . , 53- ,
,
. ,
, , , -, .
, , .
,
, , , .
, ,
, .
53-

53-
.
, ,
. , ,
, ,
, ,
. .
:
, ;
.
; .
, ,

,
. ,
, . , . ,
, .
, ,
, .
24- . 53- ,
, .
. ,
.
, .
,
.
, , ,
. ,
,
304

. ,
, .
, 53-
. ,
,
. ,
. , ,
. , ,
.
, 53- , ,
. ,
. ,
, . ,
, , ,
.
, ,
, . .
, , .
.
,
. ,
, .
, . ,
. ;
, ,
, . 53-
. ,
, ! , ,
, .
, 53- , , .
, .
, ,
. 53-
, . ,
,
. 53- , ,
- ,
. ,
, . ,
,
. , , ,
,
.

54- .
:
:
:
: 53-
: (15, 39, 52, 53, 54, 58)
305

:
:
54-

54- , .
, .
,
. .
, .
,
. ,
, . 54-
,
,
. , ,
,
. , ,
, .
, .
,
- .
,
. , .
,
. ,
.
, 53- 54- . ,
,
. , - ,
. , ,
, , , ,
, .
54- , 53- , ,
. 53-
,
. ,
. . 54-
,
. , 54-
.

, .
, ,
.
54-
,
. .
,
, , .

, , 54- ,
306

. ,
, ,
.
, 54- . ,
. , , , ,
.
54- , ,
, , . ,
, ,
. , ,
, , .
, ,
. , ,
.
, ,
.
,
. ,
.

.
. ,
. ,
.
, , ,
.
54- , ,
.
. ,
. ,
54-
.
. ,
, ,
, . ,
, ,
- , ,
, ,
, .

.
,
. ,
, .
, ,
.
. , ,
, .
, ,
, .

307


. , .
, ,
.
,
.
, . ,
. , ,
.
,
.
54-

, 64- , ,
. 54- .
-, ,
.
.
54- .
. ( 54-
) ,
.
54- , 54- .
- .
.
. .
,
. ,
, .
. , ,
. 54- , ,
, ,
.
54- . -
, ,
(53- )
. ,
. , ,
.
,
.
.
, 54- ,
, .
. ,
, , ,
.

. , ,
. ,
.
308

, , ,
.
, ,
, .

, .
,

.
,
. , 54-
, .
. 54-
,
. , ,
. -
, . ,
, ,
. 54- ,
.
, . , 54-
, , .
54- ,
, . ,
, ,
. 54-
. ,

.
, . ,
, .
. ,
, ,
. ,
-, 54- ,
.
, ,
. 54-
,
.
54-

54- ,
64-. ,
. .
,
54- , . ,
, XX-
, . 54-
. ,
, ,
309

. , ,
, ,
, .
54-
,
.
, , ,
, .

. ,
, ,
.
, ,
. 54-
, , .

, .
, ,
.
, ,
. ,
, .
, , .
, . .
, ,
.
54- - .
.
.
, .
. ,
. .
,
. . ,
.
, .
, .
. ,
. ,
.
. , ,
, , , ,
. ,
, ,
. ,
.
.
,
. , ,
. ,
,
. ,
310


. , , . ,
, . ,
, .

55- . ,
.
:
:
:
: 59-
: (49, 55)
:
: ( )
1
2
3

. 64
, . ,
, .
.
, ,
.
,
64-
. , , ,
,
, . ,
, , .
, .
,
, ,
. , .

, 55- .
.
, ,
. ,
.
, ,


311

1
55-
, ,
? , ,
, .
,
. , ,

.

.
,
.
. , ,
.
,
. , .
,
.
, .
. ,
. ,
,
,
.
, ,
, .
, ,
. ,
, . 55- , ,
. 55-
, 22- ,
. 55- , , 22-
, .
.
,
. ,
.
, , .
,
.
. , ,
,
...
!
55-

55-
312

.
,
. ,
. 55-
. ,
.
.
55- , 59- ,
,
. ,
, , 55- .
, .
,
. ,
. ,
.
, ,
.
- ,

, . ,
. 59-
, , , .
, 55- .
, . .

, ,
. ,
. 55- ,
, , . 55-

.
. .
,
, .
,
, , , , .
. ,
, ,
.

. ,
.
. ,
. .
, , ,
. , , ,
, . ,
, , . :
, ,
313

, .
.
,
. ,
, .
, ,
. ,
.
: , ,
.

, 55- . ,
, . ,
. 55-
, .
,
, -
.
.
,
. ,
, .
.
, .
, . ,
.
. ,
.
,
, .
, .
, , - -.
, .
,
, .
, 55-
.
, , . ,
,
, , ,

. ,
, .
. ,
, ,
. . ,
, ,
, .

314

.
,
. ,
. , -
,
,
. ,
,
. 55- . ,
.
, ,
.
.
; , , , , , ,
.
. ,
, . , 55- ,
,
, . ,
, .
, ,
. , . ,
; , , ,
. ,
.
55- , ,
. 55-
,
.
, ,
.
. 55- , ,
. , ,
,
. ,
.

55-
. .
,
. ,
,
, .
,
. , ,
, , ,
.

55-
, .
315

.
, , ,
,
. ,
, -
, .
,
.
? 55-
.

,
.

, .

.
, .
, ,
.


. , ,
(
).

,
. ,
, , , ,
. ,
.
,
, ,
, . ( ) ,

. ,
, , , ,
.
,
, .
.
, ,
.
, .
, ,
, , , , .
, ,
, ,
( ).
,
316

( ).
, ,
, , ( ).


, ,
. (
, 22-
).
1. - ;
2. , ;
3. , ;
4. , ;
5. , ;
6. ,
7. ,

, ,
, ,
. (
), ,
, .
, , .
.
,
.
.
.

, , ,
. ,
.
, ,
.
, .
.
.
, ,
.
, .
,
, , .
, ,
.
, ,
. ,
317


, .
,
.
, ,
, , .
, -, .
,
. , ,
, ,
. . ,
. , , ,
.

.
, , .
.
,
. ,
.
.
55- ,
.
,
. ,
,
, .
,
.
. ,
, .
.



.
. ,
.
, . , , ,
.
- . ,
, . ,

. ,
. ,
,
.

318

55- .
. ,
. ,
.
, ,
.
, .
. ,
,
. ,
.

55- .
, - - .
.
,
. ,
.
, ,
. -, .
, ,
. .
,
.
2
55-

55-
. ,
. ,
64- , .
.
,
. ,
.
.
,
. ,
. , .
, ,
. .
,
, , .
.

, .

. , , 21- ,
319

,
.
( ) . ,
.
: ?

. ?. , 55-
. -,
. .
, ,
, ,
. .
55- .
,
.
. 55-
.
.
, ,
, ,

, , 55-
. .
. 55- ,

. .
, , ,
. .
,
. ,
. ,
, .
55- . ,
.
.
, , .
.
,
.
.
, , . ,
, , .

,
.
. ,
, , .
, ,
. ,
, .
320

, ,
. . ,
, ,
.
.
,
. - ,
, , .
,
. , .
, ,
, .
, .
,
. . ,
. .
55-
. , ,
, , .
, , ,
, .
, . 55- ,
, , .


. ,
. ,
. ,
,
. , 55- ,
,
. ,
, .
( 2012) .
.
55- , 59- 39 . . 39-
39- .
. 39-
. ,
. 59- ,
55-.
, . 59-
.
.
, 55- , 55-
.
. .
,
. , ,
321

. . ,
, .
. , .
, . ,
.
.

, 55- , ,
. 55- ,
-, .
, ,
. ,
. ,
, .
. ,
,
.
.
.
. , .
, .
( ), , ,
(). .
, . ,
, .
, .
, .
.
,
.
.

, 55- .
. ,
, .
,
. , .
.
. , ,
, -, ,
. 100000, ,
. , , ,
,
.
, .
.
50- 6- .
, ,
.
322

. , ,
, , 28- .
- . , . 55- ,
. ,
. ,
.
, ,
.

, ,

, 333,
. 20
.
, 333, ,
. ,
. 1987
, 2012 2027 .
,
.
1987
. ,
.
1987 , .
,
, , .
, ,
. ,
,
. ,
, , .
, , ,
.
2012
2012 ,
.
. , 1987
, 2012 , 2027 .
. ,
. 2012

.
, ,
,
/ .
2012 .
,
. .
323

,
. , ,
. , -
,
, .
2027

,
. , ,
, 64 -
.
, 2027
. 2027 .

. , .
2027 .
2012 2027 ,
, .
. ,
.
. ,
, . , 2027
, , .
, .
3

, ,
.

. ,
, .
.
, , ,
.
,
, . conjunctio,
.
,
. , , , ,
.
-
. ,
.
, ,
, ,
.
, .
, ,
.
324

,
. ,
.
55- , .
,
, , . -
, , .
,
. .
, .

. ,
, ,
.

.
.
,
.
. . ,
, ,
. ,

. ,
, , .
55- , .

. ,
. ,
.
.
.
,
. 55-
. , ,
, , .
,
. ,
.
, , .

. .
. ,
,
. ,
.
.

.
325

, .
, . ,
. ,
.
. , ,
. ,
. .
,
(), , .
, .
. ,
?.
. .
.
. , .
.
,
, , , . ,
, ,
. , ,
, .

, 2027 ,
. ,
.
, .

55-
. ,
. ,
- . ,
55- , .
32- , .
,
/ . ,
.
.
, .
, ,
. .
, .
59- , ,
-
. ,
, .
, .

,
. .
326

, .
, , , ,
,
. , ,
.
.
, .

. , , .
, ,
. , -
. ,
. , ,
, .
, ,
. ,
. , ,
, 6-
,


. .
, ,
. , ,
, . ,
. , ,
.
, ,
.
.
, ,
. ,

.
.
. ,
.
, .
, , . ,
,
, .
. ,
, , .
.

,
. ,
, , ,
.
327

. , , ,
, . ,
.
. .
. , ,
,
. ,
. .
.
,
. .
.

.
,
. ,
,
. 55- , , ,
. ,
, . ,
,
. ,
55- . , ,
. ,
.
,
.
, .
. ,
. .
, ,
. ,
, . ,
.
, ,
. . ,
,
, ,
. ,
. .
, , ,
, .
, .

.
55- , .

, ,
,
. ,
328

,
. .
, , ,
,
. .
, , , ,
.
,
, . ,

. , ,
64- ,
-, .
, ,
.
.
.
, ,
. , , ,
.
, , , ,
. ,
. ,
.
. ,
. ,
,
.
, .
, ,

. , , , ,
, . ,
. ,

.
,
,
. ( 44-, 45- 49-
. ,
). , ,
, , ,
.
, .
, ,
.
,
50- .
. 50- ,
.
329

.
. ,
,
.
,
45- . ,
. .
. ,
. , , .
, , .
,
, .
45- .
, .
, .
45- ,
. , , ,
,
, . , 55-
. 49- ,
. ,
, .
, ,
, ,
.
,
. ,
, .
, 55- .
, 55- ,
, . 28-
, 55- . 55- ,
28- , , .
28- ,
. -
, .
,
.
.
, .
, ,
- . , ,
. ,
.
. , , ,
. , ,
.

330

, ,
.
.
,
, . (
44- .)
,
,
,
.

, , , .
. , ,
. , 2027
. ,
.
,
.
, . , ,
, .
, ,
.
,
- , .
, .
,
. ,
.

.
.
,
. .
, , .
,
. , .
. , .
, .
. ,
.
.
.
, ,
,
, . 55-
. .
. , , ,
, .
, .
.
331

, , ,
.
, . ,
, . ,
.
. ,
. ,
.

64-
55- .
. ,
. ,
. , .
. , ,
. ,
.
.
,
.
,
.
, , , .
, ,
,
.
,
: Urukhai

56- .



: 60- . : (12, 33,
56)
: / . , -.
56-

, ,
. ,
, 64
. 21 ,
,
332

. , 64 , 21 , 20
, 21- ( ) .
, , ,
. , 12-,
33- 56- , .
,
-.
,
, ,
- . 41- (
-) . ,
, .
, , .

,
. 35- .
( 35- ),
, ,
. , , , 35-
.
, ,
, , .
, , ,
, .
, .
33-
.
,
. , 56- ,
, . ,
, ,
, - .
, 12- .
.
,
.
, 56- ,
,
. .
.
.
, , ?
.
, , , , ,
, . ,
.
, .
, ,
.
, 56- ,

. , .
333

,
. , ,
. ,
56- ,
- , , .
, ,
, , , ,
. ,
, .
.
.
.
, ,
.
,
.
. ,
, , .
, ,
, ,
, .
, .
,
,
.
, . ,
, . , 60-
56-. 60-
,
. 60- , ,
, , .
, ,
.
, 60-
. ,
. ,
,
, ,
. ,
, , .
, , ,
, , .

56- .
. .
, . ,
, ,
. ,
,
. , 56- ,
,
334

. ,
.

56- . ,
.

, .
. ,
. , ,
, . 56-
,
. ,
, . , .
56-

64 ,
. . ,
, . , 56- ,
, , .
, . , ,
, . -,
? , ,
. , 56- ,
,
.
.
. , , ,
, , .
, . ,
. 56- ,
. ,
. , , , .
56- , .
. 56-
. , ,
, . 56- ,
, .
. 56-
, ,
. 56-
, ,
.
.
56-
, . ,
. ,
, ,
. . 56 . ,
,
. ,
335

,
. ,
.
,
.

. , ,
.
.
56- . ,
. ,
, , . -
. , . ,
,
, .
,
.
. 56- ,
. , ,
, .
, . ,
56- .
.
, ,
, .
,
, .
56- , ,
, .
56-

56- .
. , ,
, ,
. (Intoxication).
toxicon, , .
,
. , ,
. ,
, !
.
.
, !
56- .
64 . 56-
, . 56-
, .
, ! 56- , ,
,
. 56-
,
336

. 56-
! 56-
. , ,
,
. , ,
.
56- . ,
, ,

56- . .
,
, 56-
.
. , ,

. 56- ,
.
, . ,
.
, ,
. ,
, .
64 ,
. 56-
. ,
, ,
. , ,
. , , ,
. ,
, .
, .
56- .
. 56-
, . ,
, . ,
, .
, ,
, . ,
, .
.
. ,
, , .
, . ,
, ,
.
55- -, 56-
, 55-
. , .
, ,
. , , ,
, . , 60-
, , 56-.
337

, , .
, ,
, ,
. ,
( )
.
, ,
:


,


.
. , ,
, .
.
. ,
, .
,
.
, . ,
. 56- .
, .
-, 56- ,
, . ,
, , .
, , ,
. ,
, .
, , , , ,
. .
, .
, , .
.
.
, . .
'As it draws you to itself
What pleasure your suffering becomes.
Its fires are like water
Do not tense your face.
To be present in the soul is its work,
And to break your vows.
By its complex art
These atoms are trembling in their hearts.'
Rumi

338

57- . .
:
:
:
: 51-
: (18, 46,48, 57)
:
:


57- .
. , ,
.
. , , ,
, . , ,
, , , . 64-
,
, . ,
.
64 , . ,
,
.
, ,
. . ,
. .
,
. .
, ,
.
. , , 57-
.
57- - . ,
. ,
, . ,
, .
. 57-
, .
57 .
, .
- ,
, .
.
, , ,
. 57- .
, ,
339

. .
. ,
, .
, .
. ,
, .
,
. , ,
, .
.
, - .
. , ,
.
, , .
. ,
.
, , .
- .
, .
, - .
,
,
. ,
, , , .
, .
, , ,
.
, . ,
, .
,
, . ,
, .
57- , , 51-
, .
.
. , ,
, .
, 57-
. .

. ,
21- .
, ,
, 18-, 46-, 48- 57- . ,
57-
.
, ,
. 51- 57- ,
, ,
. , .
340

, .
. ,
, , . ,
, .

, . ,
, , ,
, , .
, , .
,
.
.
.
, ,
.

.
, .
, ,
. , .
, ,
.
, ,
. , .
.
, ,
, .
.

Synfield ( )
64-
57- . ,
, .
.
. ,
,
. co ,
, , . ,
,

.
.
, , , , .
, , .
.

, . ,
21- . ,
.
341

, . , ,
, . ,

.
57- ,
. ,
, . ,
, .
.
,
. 57-
.

,
.
. ,
,
.
,
- .
, .
.
, ,
. , .
.
, . ,
, .
,
.
, ,
, . ,
, , ,
.
.
. ,
,
. ,
, .
. , ,
, . ,
.
, ,
, . .
,
. ,
. , .
, ,
,
. , ,
.
342

, . ,
. ,
. 57- ,
. , ,
.
,
.
,
, .
, , .
, ,
. ,
,
.
. ,
,
. ,
. , 57-

.


57- ,
. ,
, ,
- . , ,
.
, . ,
, , .
,
.
,
, , 57 .
,
, . ,
,
. ,
, . ,
57- , , ,
. .
, .
57- . , 51- 57-
. , ,
.
, , .
,
, , .
, ,
.
, .
343

, , .
. 57-
. , .
.
- 57- .
. ,
. ,
, .
.
. ,
, . ,
, ,
,
. , .
, .
. , ,
, .
. 57- , 64-,
, .
, .

. .
.
. ,
. , .
, 57- ,
.
.

.
. ,
! . 57-

. , .
, ,
, , , , .
- .

58- .
:
:
:
: 52-
: (15, 39, 52, 53, 54, 58)
:
:

344

58-

-,
, ,
, , , , ,
.. 58- .
,
. ,
. ,
52- , 58-.
. , 58-
. , 52- ,
58- . ,
, , , , ,
, .
...
, 52-
, . 58- : ?
?
. ,
, , , 10- 20-, ,
.
.
? , , ,
. , 58-
.
, , ,
.
, , , , .
, , ,
.
,
. ,
58- . , , ,
. , ,
, , , !
58- , , -
- . ,
.
. 58- .
, ,
, . 58-
. , ,
, .
, .
52- 58- , ,
. ,
.
, . ,
.
,
. ,
345

, .
, ,
.
58- .
, . , ,
, , ,
.
.
. ,
. , .
, 58- ,
. -, . ,
, ,
. .
,
.
, -
. , ,
. !
, . , ,
, ,
.
, , , ,
.

58- ,
. , .
, , ,
. , , .
,
.

, ,
. , ,
.
. ,
, . ,
, . ,
,
, , , ,
.
58-

, ,
.
. -,
. , ,
. ,
, . ,
, .
,
. ,
346

.
, , ,
. ,
.
.
.
. , ,
. ,
. .
, , ,
, . ,
,
.
,
, .
- . ,
, .
. ,
. 58- ,
, , , ,
. , ,
.
,
. ,
.

.
58- , ,
.
. ,
. ,
, , .
,
. , , ,
. ,
. , ,
, ,
.
.
, , 58- ,
, . 58- ,
,
, . ,
,
.
. , -
, .
,
. .
-, , ,
, .
, , 58-
347

.
58-

,
.
. ,
, . ,
,
, . , ,
, .
, , , , ,
.
, ,
. , ,
, ,
" " . ,
,
. ,
, -
. ,
, .
.
.
58- ,
. ,
, ,
.
, .
. ,
, ,
, .
.

. ,
. , ,
,
. 58-
, XX- .
, .
- ,
. ,
.
,
. ,
.

. ,

.
, .
. ,
348

,
. , 64-
,
.
, ,
.
. ,
, . ,
, ! , , ,
, .
.
. ,
. , , ,
, .

59- .
:
:
:
: 55-
: (4, 7, 29, 59)
: ( )
:


59- ,
.
. 59- , , 49-
, . (
- 55- .)

, . ,
,
. 55-
, 59- ( ) . 55-
, 59-
.
59- ,
. , ,
. , , ,
, .
.
,
, . , ,
,
,
349

.
59- .
, ,
, - . 59 , .
59- , . .
, , - , 59-
, .
, .
, , -,
. ,
. , 59-
. - , .
. .
, 59- , ,
. ,
.
. ,
,
.
59- ,
. ,

. ,
, . ,
, , . ,
, , ,
. , ,
. .
. ,

. . 55- , 59-
. ,
, , .
, 59- . 59-
, .
. .
, ,
.
.
.
, , 59- .
.
. .
,
.
55- ,
. ,
.
, . 59-
350

.
. , ,
,
.
. ,
. . ,
, .
,
. ,
. , ,
,
.
. ,
.
.
,
.
. ,
.
.
, . .
,
-
.
, : ,
? ,
? .

?
,
. , .
. , ,
, ,
. ?
59- .
,
, .
,
.
.

. .
,
. 59-
.
, ,
.
, .

6- .
351

, ,
. -
. ,
.
-. , ,
, .
.
, .
, .

6- .
, , .
,
. , . ,
,
. ,
, .
,
.
, , ,
-, , .


59-
. 59- ,
,
. .
. ,
, - ,
, .
59-
. -
59- , .
,
.
59-
. , -
.
( 55-
). ,
.
.
,
. .
, 59-
.

, 59- .
, .
352


, .
,
, .
,
. ,
, , .
.
55- ,
.
, . ,
,
.
, 59- .
. , ,
. ,
,
. .
, , ,
.
59- ;
. , ,
. ,
. , 59-
. ,
59- . ,
, , .
, ,
. ,
,
.
.
, ,
. ,
.

,
.
.
, .

.
.
.
. ,

. ,
, .

( ,
. .).
353

,
.


, 59-
. ,
, ,
- .

, !
,
.
59- , .
,
. , ,
.
.
, 59- 55-
. 59- , 55- .
,
, .
59- . ,
.
, . , 59-
,
. .
. 59-
, , .
, .
59-
. 4-, 7-, 29- 59-
( ) .
.
, , ,
4- . ,
, (7-
).
, ,
. (29- ) .
,
, .
, \ .
.
, 59-
, .
, ,
, .
59-
. , , .
354

,
. , ,
- .
- ,
, .
, .
, , 59- .
, .
59- ,
. ,
. ,
- .
, , ,
.
, . ,
,
, . 59- . ,
.
,
, .
2012 , , ,
. ,
, .
59-
. ,
() ().
.
,
, ,
.
. , ,
, . , ,
.
.

, , ,
.
, , ,
. ,
,
.
- Harhor

60- .
:
:
355

:
: 56-
:
: (19, 60, 61)
:
60-

60- , .
. ,
60- , . 60-
,
. 60-
, , , ,
.
, 60- .
, ,
, . ,
, , ,
. 60-
. , .
. -.
64
. 60-
.
. , ,
.
60- 60- . ,
.
. 60-
-
. , ,
. , ,
. ,
. 60- .
, -
. 60-
. , ,
.

. ,
.

.
.
, , .
60- 56- , ,
, ,
. ,
.
. ,
,
356

. ,
. ,
.
, , .
,
. , .
. . ,
. ,
, . ,
. 60- ,
, .
60- , 60- , ,
,
,
.
. ,
- , 60- .
, .
.
.
, .

, ,
. , , ,
.
.
60- . .
- .
,
, , .
60- .
. , 60-
.
.
, , . ,
. ,
, ,
, .
, .
60- .
,
. 60- 61- .
61- ,
. , ;
,
. ,

, .
.

60- .
357

,
.
, .
, , .
, .
.
, ,
.

, 60- .
.
, -
.
. ,
. ,
.
, .
60-

60-
.
60- , ,
. , ,
, 60- , , , . , .
, ,
.
.
60- .
60- , - ,
.
. .
, . 60- ,
. 60-
, ,
.
, . 60-
, ,
, .
60- ,
.
, , , . 60-
, , , ,

. , .
, ,
.
,
, .
, ,
. ,
358

, ,
.
, ,
. ,
, .
, .
. ,
- . ,
!
, . ,
60- , , ,
,
, . ,
, , , .
. 60-
, . ,
.
. , , ,
, . ,
. . ,
, , ,
. 60-
, .
.
, .
, . 60-
.
, , ,
. .
. 60-
, ,
. ,
, .
60- ( 19- 61-),
. ,
.
. 19-
,
.
, , .
, 60- 61- ,
. 60-
, 61-
, . 61- -
, , ,
,
.

. . . , ,
, ,
. .
, .
359

,
, .
. ,
, ,
.
60-

60- . -
. ,
. ,
60- .
, ,
( ) ,
, .
, , , , ,
.
.
, . ,
, -,
, ,
, .
, , , . , , 25-
, ,
, ,
. .
60- , ,
( ). ,
, ,
.
. ,
, .
, , 60-
. .
,
60- . ,
, ,
. ,
, 60- ,
.
,
, , .
.
- .
.
(). ,
, .
, ,
. , ,
. ; , ,
.
360

? .
60- .
, , .
, .
, 60- . ,
, , ,
. 60-
. ,
, . ,
.
,
. 60- .
, , ,
, .
, ,
, .
.
, , , , ,
, , .
, ,
. 60- . ,
. , .
60- , ,
.
60- ,
.
. . ,
, . 60-
.
, . ,
, , ,
. ,
, .
, ,
, 60- .
, 60- , .
, .

.
, .
, , . ,
. , ,
, . ,
. ,
,
.
. .
, .

.
.
.
361

61- .

-
-
: 62-
: (19, 60, 61)
:
:
61- -

'' :
.
, ,
-. , ,
, , . :
. , ,
,
. , 61- , ,
, ,
, , .
, ,
, .
61- . , 61- (),
, ,
( ). , -
- , , .
61-
?. ? ,
.
(),
. ,
, .
, , ,
, .
, - .
61- - 62- . ,
61-
, , .
'' - , .
61- 62- - .

, 55- .

.
, ,
, . , -
.
362

, .
,
() .
, .
, .
,
64- . ,
, ,
, :
, .
, 61-
62- . ,
, - . ,
, 61- ,
. ,
, .
, - , , , .
. ,
,
. 61- - .
, .
,
. .
,
. , 61-
,
. 61-
,
. 61-
, ,
/
(). ,
, ,

, . 61-
.
61- . ,
, ,
'? ' .
( 63- ).
,
. '?' , '?'
'?'
,
, ,
. ,
, .
, , ,
, , , , .

363

, 61- .
- ,
. - ,
.
(), . ,
, , ,
. ,
-. , ,
. 61- ,
, .
, ,
-. , , ,
,
.

, 61-
. , 61- ,
.
, ,
, . ,
, .
,
.
,
, .
,
.
.
61-

- , ,
. 61-
, . ,
.

spiritus, .
.
,
, .
,
, . 61-
, ,
, . ,
, .
, , ,
.
.
.
, , .
.
, .
61- , ..
364

, ,
.
.
.
, .
. ,
, , .

. , ,

. , .
,
,
. 61- 62-
, . 62-
, .
61-
.
- : ,
, .
, . ,
,
() . ,
. ,
- . ,
,
.
, -
, .
, .
!
, . ,
, 61- ,
. ,
, .
, .
, -
-
. , ,
, ,
.
61- ,

61- .
, 61-
, - ,
. , ,
.
,
. , , . ,
, .
61- , ,
365

. .
: ,
, .
: , , -
.
61- , .
. . ,

,
( ).
, ? ,
, , ? ? . ,
- .
.
, ,
.
.
, ,
. , ,

.
61- . , 61- ,
, .
, ,
, .
, , (
) .
, .
,
. , , ,
. ,
,
.
, ,
, . 61-
.
,
.
. , ,
61- , -,
. , - ,
, ,
. ,
, . , , ,
, , .
61- , . . , , , .
, , 61- .
. . . ,
, , .
, , ..
.
366

, ,
.
61- .
, 61- ,
, , , .
, ,
. , ,
, .
,
, . 61- .
, , , ,
, !
, , . 61-
,
. , ,
. ,
.
. , ,
. .

62- . .


-
: 61- : /
: (31, 62) :
62-
,
64 -,
, . , ,
, 1- 2- 63- 64-,
(1)
. ,
, .
, 3-
() 61-
, -
. 61- ( 62- ),
, . , 62-
. , 62-
,
.
62-
. , 62- ,
. ,
. 64- ,
.
. 62-
. ,
367

, .
, , , 6
64 (2).
, 64
. ,
.
, .
, , ,
, ,
! , .
.
,

.
,
.
, . ,
.
, . ,
, ( ), .
, , .
, , ,
.
, , .
, .
, . , .
, ,
. .
.
, . ,
, ,
. , !
,
, , .
, ,
.
, 62- .
, ,
. ,
, , ,
. ,
. . 62- ,
. .
, .
. , ,
. 62- , 61-
. , ,
.
62- 61-
. 62- , . , 61-
- . ,
368

,
, , .
, 61- 62- ,
. ,
, . 62-
, ,
61- , .
,
, .
62- . ,
, . .
, .
,
, . ,
, , ,
.
, ,
. ,
, .
, ,
, . ,
. , ,
. , ,
.
, , , .
, ,
:
. , , .
-
62- , . 62-
. ,
, .
,
. ,
, ,
. , .
, ,
, ,
.
-
,
. ,
. ,
, .
, ,
. ,
. , .
, ,
- - , .
62- -

62- , , , , ,
369

.
, (
), ( ).
.
,
62- , ,
- .
,
, , . 62- ,
,
, ,
, .
,
,
.
. ,
,
, .
, ,
, , .
, ,
. , , ,
, . ,
62- , , .
, , - , ,
.., . ,
, . ,
.
, , .
, .
, .
(61- ),
. , ,
, . ,
, , ,
, . ,
, , . .
, , ,
.
62- , 31- ,
(3).
, , .
.
,
. 62-
.
, , ,
. : -, ,

370

, -,
.
, . ""
, .
- ,
. ,
. . 62- ,
, . 31-
. ,
. ,
. - .
,
. , , .
.

.
62- .
,
.
, .
, ,
. ,
, ,
. , ,
, , ,
. , ,
, . 64 ,
, .
,
.
62- -
-
62- .
62- , .

. ,
.
( , ),
, . ,
, .
,
. "".
"" ,
. , , ,
, "" .
,
! -
62- , , .
" ", ,
.
: , , .
. , ,
371

, , .
( ), .
, , , ,
, , .
! .
62- ,
, . 62- ,
.
,
. , .
, .
, .
, ,
. , ,
,
, .
. , , . , -
62-, .
, .
, .
, , , ,
.
62- ,
, ,
. , ,
,
.
. ,
, ,
. , 62- ,
.
. ,
, .
, , . ,
, ,
. ""
, . ,
.
, . ,
, , , .
.
- .
. ,
.
,
. .
, . ,
. .
.
- , , ,
- .
372

(1) , , . (. Vorsatz) (. ). ,
,
( ,
).
(2) 6 , . It is
precise and infinitely complex, and yet it is elegantly simple to learn, formed as it is from only 6
possible permutations of each of the 64 Gene Keys.
(3) 64- (
) , ()
, .
,
.
.
. 64, 20.
, ( 2 6).
.

63-
:
:
:
: 64-
: (36, 37, 22, 63)
: .
:
63-

63- , 64-
. 63- 64-
, .
, . - ,
. -
, 1
64. ,
.
, , - -
. ,

.
1- 2-
, 63- 64- , .
. ,
373

, .
XVII -

. , 64-
,
64- . , 63 64- , ,
, .
63- 64- ,
, . ,
. : , ,
. ,
. ,
, . ,
63- 64- , .
, , ,
. ,
, ,
.
63- ,
. ,
,
. ,
.
,
.
. ,
!
, .
, , ,
. - ,
, . , ,
-
.
,
.
. ,
,
. 63- ,
. .
(64- ), .
,
. ,
, .

. .
, , , ,
. , ,
, .
, - , .
.
374

. ,
,
. ,
. , ,
. .
.
, ,
, . 63-
,
, .
, .
, ,
. ,
, . ,
.
- ! - ,
, .
,
, .
, !
, ,
.
. - -, ,
, .
. .
,
, .

, .
,
.
, .
, ,
, . , ,
!
, .
.
. ,
.
.
, .
,
, , , .

63- ,
. , ,
, .
. 63-
, ,
. , ,
, .
,
375

. , , ,
, .
, . ,

.
63-

, .
.
.
, .
. -
,
,
. 63- .
, .
, , , .
-, .
, ,
. .
,
. , .
-, , -,
. 63- :
- , ,
.
, .
,
, , .
.
.
63- (36, 37, 22 63),
, . -
22 ,
. 63-
, ,
.
,
. ,
.
(37- ). (36- )
(22- ) ,
.

, ,
.
,
. ,
.
. ,
, .
,
376

. ,
.
, ,
, .
, .
.
, . ,
, ,
. , ,
63- , ,
- -. , ,
. ,
, , ,
, .
, .
63- 64- , .
, , , ,
, .
. ,

. .
, ,
.
,

63- .
63-

, ,
. - , 63- 64 , . 63- , 64- - . ,
- , , 63- ,
64-. , , , -, ,
. .
,
, , ,
.
, .
, , ,
.
63- , .
. . ,
.
. ,
. , ,
. , ,
, , , .
, ,
, . ,
, .
, .
377

, , . ,
. ,
,
, .
. 64-
,
. , ,
. ,
, . ,
, ,
, .
64- . 63-
. , ,
, , ,
, , , .
. , . ,
,
, . , .
, . . 64-
,
, . ,
.
.
, , . .
. , 64
, . ,
.
, .
.
, , 63- .
. , .
, .
,
, , .
, .
. , , , ,
. , , ,
.

- . ,
, .
, , , ,
.
.
, , .
, , .
, , .
,
. , .
, ,
, . ,
378

64- .



: 63- .
: (6,40,47,64)
: . :
64

64-
. , 64
. .
, ,
. 64- ,
64- .
. , , ,
. ,
, .
,
. ,
,
.
.
.
massa confusa, , ,
. ,
, .
, .
, ,
64- .
64-
, .
. 64- ,
, 63- . :
,
. ,
, .
, ,
, .
,
, .
,
. ,
.
. , .
, ,
, ,
379

. , , ,
. ,
,
. .
,
. ,
. ,
, , .

. , .
. , . ,
, , .
, ,
.
. 64
. ,
. ,
. .
64- ,
6- , , 47-
,
, 40- , .
, . , 64- ,
, .
, .
, ,
. , ,
.
,
.


. ,
, .
- , ,
, .
, , ,
. .
, , .
, . -
!

, .
,
, ,
. ,
, .
. ,
. -,
-.
. -,
.
380

, ,
.
64-

, ,
64- ,
63- . , ,
, . . ,
, ,
, .
, ,
.
,
. ,
,
, .
, .
, , , ,
. .
, ,
.
. , /
, .
. - .
, , ,
.
, , .

. . ,
, . , ,
.
.
, . 64- .
, , .
.
, ,
. , . ,
. ,
.
,
, .
. ,
, , .
,
. , .
.
, , .
,
. , , !
, .
, ,
, ,
381

. , .
, ,
. ,
. .
, , .
, ,
. , , ,
. .
.
64-

64- . ,
. ,
,
. .
. ,
.
. , ,
. 64- . ,
- , ,
, . 1 64- ,
, .
, , ,
, . ,
, , , .
. ,
. , .
, , ,
. .
, .
, , ,
.

. , ,
, .
, , , ,
. , .
64- ,
. ,
, .
, . ,
. . ,
.
64- 63-
.
. ,
,
, , . ,
64- , . , ,
,
. , .
382


. ,
, , .
, .
, , ,
.
, .
, .
.
(. 22 ), ,
. ,
.
( )
. , ,
.
, , .
,
. ,
. (40-
), , .
.
(47- ) .
. 64-
, . ,
,
, .
.
.
.
,
, .
.
. , ,
, . ,
.
, . 64-
,
.

383