Вы находитесь на странице: 1из 178

Copyright & A K-C

_____


.. , .. , ..

2012
1

Copyright & A K-C

636.2:636.082(470.47)
60(2.)-369
340
, ..
[] / ..
, .. , .. . : - . -,
2012. 178 .
-


-, - . , , ,
.
,
. .. , -

().
, .-. , , .

,
..

, 2012 .
, 2012 .
2

Copyright & A K-C

................................................................................................................. 5
1. .................................................................... 7
1.1. ........................................................................... 7
1.2. ....................................... 17
1.3. ............. 20
1.3.1. .............................. 20
1.3.2. ............................................................ 21
1.3.3. ..................................... 22
2. ,
...................................................................................................... 31
3.
............................................................................................. 36
3.1. ........................................... 36
4. ...................... 41
4.1. ........................ 44
5. ...................................................................................... 45
5.1. ............................................................ 45
5.1.1. .............................................................. 50
5.2. ................................................................... 51
5.2.1. ................................... 54
5.3. ............................................................................. 54
5.3.1. ....................................... 57
5.4. ............... 62
5.4.1. .............. 64
5.5. ............................................................................... 67
5.5.1. ..................................... 69
5.6. ............................................................ 73
5.6.1. .................. 73
5.7. ................................................................. 76
6. ................................................................................ 80
6.1. .................................................... 82
6.1.1. .............. 88
6.2.
....................................................................................................... 96
6.2.1.
..................................................................................................... 99
3

Copyright & A K-C

6.3. .......................................103
6.3.1. .

...........................................................................................107
6.4. - ..........................125
6.4.1. -
.....................................126
7. .................................................................129
7.1. -
AG-ISSR GA-ISSR- ..................................................................129
7.2.
......................................................................................................134
7.2.1.
...............................................................................................141
7.3. BoLA-DRB3
.............................................................................................................143
7.3.1. BoLA-DRB3 ,
..............................................................................148
7.4. BoLA-DRB3 ,
, ...........150
7.5. .....................................158
7.5.1.
ISSR-........................................160
..................................................................................................165

Copyright & A K-C

. ,
, , ,
, .
.
.
,
, .
, .

.
( ) .
, .
,
.


,
( ).

, , .
, , - .
(
) .

5

Copyright & A K-C

. ,
.
.

Copyright & A K-C

1

1.1.
, .
- , .

400
(.. , 2010; .. ., 1992).
: - .
-
( , , 1929 .) ,
(1155 1162 ) , , ,
. , ,
, (.. , 2010).
,
. (1966) : , (), , , , , ,
,
.
.
. ,
,
(.. , 1967).
, , . .
, , . , , -, -.
20% . 450-480
, 800-950 ; , , 500-600 9001100. 20-25 .
800-1500 (.. , .. ,
1987). ,
7

Copyright & A K-C

, .
, . - .
, . . , . .
: , , - , . , .. .
.. ,
.
. ..
(1877, 1897, 1910, 1949), .. (1914), .. (1949),
.. (1949, 1956, 1961, 1969).
. (1932),
.. (1938), .. (1948), .. (1932, 1934, 1961,
1964), .. (1960, 1961, 1966, 1967, 1968, 1969, 1992), ..
(1970, 1981), .. (1949, 1964), .. (1964), ..
(1975), .. (1971, 1978, 1983, 1989, 1992) .
,
, .. , .. ,
1875 . . , : , , ,
, , , ,
, . ; 8

Copyright & A K-C

, -
(.. , 1969) .
. .. (1910) .
, , , ,
:
.
: . ,
, , , ,
.
. ,
- 1876-1878 . ..
(1879) . 1725
. , , , .. , 70-80
XVIII -
100 . (1969).
, . 1912 . .. (1912): . ,
. ,
,
, . , , , , .
- - , , (.. , 1975).
.
, .. , 1890-1891
, , :
, , ,
, ,
. , .
9

Copyright & A K-C


,
,
-, , , . .
, , , ,
. . , ,
.
. . (1916), , ,
. , .
.. : , XIX XX , .
, .
.
.
.
,
, -
(.. , 1969). - 2007
(.. , 2010).
. , .
, ,

, .
. ,
,
.
10

Copyright & A K-C

, , (..
., 1992).
, ,
, . , , ,
, ,
.
.
, , .
-: 32, 1547 109.

16 . 7273,
7113, 7333, 15, 6367, 3218,
7356 108 (.. , 1981; .. , 1991; .. ,
.. , 1992).
825 12054, 163
.
20% , 1 6,3 . . 15-
393 , 15,6%
(. ., 1982).
,
, . 1205 . - 1279 (.. , 1981; .. , ..
, 1992).

(.. , 2003).
, (), .
( ) , .
.. . ,
11

Copyright & A K-C

. ( )
( ) (.. , 1966).
. (1932) : ,
, -, , .
.. (1963) , .
: , , . , (.. , 1985).

.
. , . ,
, .
.
( ). - ( )
, , ,
. .

( , ) (.. ,1982).
, ,
.


,
.

(.. , 1954, 1958; .. , 1971; .. ,
1972, 1981).
.. (1928, 1933), .. (1932), .. (1964), ..
(1973),
.
12

Copyright & A K-C

.. ,
, , .

.. . ,

, .
.
.. , .. , .. (, ,
, , , ). .. , ..
, ..
(, , -),
.. , (1963) (,
, , ), .. , .. ,
.. , .. , .. .
(. .. , ..
, 2005).
.. (1952, 1961), .. (1968, 1970) : (
) ( ). , , , ,
, , ,
. 700-950 ,
450-550 . .
.
, , ,
.
; , ; ;
.
900 1100 , 460-650 .

.
.. , .. , .. .
(1961, 1969, 1992), .. (1989), .. , .. ,
.. ,
:
13

Copyright & A K-C

, . , , , . , , .
2006 , , , ,
17,3-35,4 ( 5,0-6,6%). ,
,
,

(.. , 2010). -
.
-
.
,
. , .
,
..
(.. , .. , 2005).
- 1932-1935 .. ..
.
.. , . ,
. ..

.
,
. .


.. . 14

Copyright & A K-C

,

,
.

.., .., ..,
.. .

,
, . , , , , .
, ,
15-18- .
.
, , , , , ,
( 1547), ( 1-9),
32. , , .
, , 1205, 1279, 995, 1971,
7933, 25, -62 96. 55, 6226, 2024, 2520, 40193, 1035, 0111 848.
32 , 6 26 .
:
46,4, 31,9, 17,3%. 434,5 . . 60,2, 26,6 . . 85 100 .
2009 8126 , 1136 . . , 2009 2810 .
. ,
15

Copyright & A K-C

. , 3811
, 2016 .
.
-. 2137
. 94-99
100 .
, 1500 . 5 92 100 . , , , 1500, 2188, 2515
2766 , 90% .
,
43016 15.

.
.
. 2007 .
,
.
, 950 . 2007 . 2007.

. 2008 .
. .

. 1635
. , . 2-4 . 1200
. 6004 . . 8335 . , 2008 .
. ,
1 .
, . 16

Copyright & A K-C

. , .
2-

. , .. , . . 2 , 16 1 .
,
, , , , ,
,
.

, .
1.2.

, , , , , , .
(.. , 2010; .. , 1934).

, . , .
( 35-40 , ), ( 45 ) - . ,
, ,
.
, .
. 30
100 ,
.
.
,
. , .
17

Copyright & A K-C

,
, .
.
75% ( , ,
),
.
.
, .
376%,
302% , (.. , 1964).
. , , , ,
, 2 7 . , .
. , , , ,
.
,

.
.

.
.
,
. , ,
-
, -,
.

, -
(.. , 1990).
, - , , , . 18

Copyright & A K-C

, .

, , , , .
.
, , ,
.
, , , ,

8 15
1300 , 1 5,5-6,0 . .
(.. , 1982).
58%,
68% (.. , 1938). 18
200 .
.

, .

, .
. .
15 50 .
, ,
900-1000 .
, , , . .
- .

, , .
19

Copyright & A K-C

.
,
.
(..
., 1999).

, ,
,
-, , , . .
, , , ,
, , .
1.3.
1.3.1.
50
.

.
, . , ,
,
1,1-1,2 (.. , 2000).
40-50%,
85%, 70-75%.
1991 2008 .
19%.
, .

. , 2007 20

Copyright & A K-C

183 ,
178 250-320 , , , ; 755 743
, 1100-1200 (..
, 2010).
1990 4,3 1,9
2002 .
300 . 130-140 , 69-75 .
, , , , , , 500-800
300-400 .
.
.
1995 2000 (15 )
9,7%.
6%.
2001 ,
37,2%.
.. . (2000) , .
520 , 39% , 1998 30,8
, 54% .
1.3.2.

. 5 1,5-1,7 . , .. (1),
57 20 , 22 9 , , .

, . 80
32 .
.
.
, 5 . ,
. , .. , 21

Copyright & A K-C

,
.
1.3.3.
,

, , , , .

. , .
,
.
,
, . , (..
, 2010).
, . ,
, . , , .
, ,

. , , , , , ,
,
50-60%. , , , 9000
, 1:4.
92%, 85%.
, , , , , , ,
, 100 .

, .
, .
.. (2002) , 22

Copyright & A K-C

, ,
, . 1910
17 . .
.
30- .
,
, . ,
, .
, ,
, , .
. -
.
, .
- , .


. 1928-1930 .
,
-, , .
, 1945 1953 ., . , - , -
, 1950 . (.. , 1996).
. ,
, 23

Copyright & A K-C

, , ( 18- , 550-560 , 300-320 , 60%).



- .
50-
- -
I-IV
(.. , 1997).
, -
. ,
- ,
- .
2006 . -
, . , ,
. , 10-12%.
2007
(. , . , . ., 2008). 1 ,

1500 .
. . 520-540 , 200 , 15
430-460 ,
240-250 , 60%.
, 1953 1990 ., . 1953
, , , .
,
.
1000 . .
24

Copyright & A K-C


.
. ,
1957 1962 . 4,5 78,5 . ,
17 . 1960 1965 . 3932 , 1239 .
.
. 1964 927 . , 254 . .
1967 1975 . , , -, - . .
1877 . , .. 2,9 .
, 2 . ,
450 , 4 .
, , , .
5063 - .
1990 , ,
.

2006 . 371,1 . ,
152,9 . (. , . , . , 2006).
,
, , ,
. .
. . (2010) 1 2010
416,2 . ,
171 . . 2006
12,25, 11,8%. 2009
, , , , , .
, ,
, .

( 3%), ,
.
25

Copyright & A K-C

.
2009 304,6 . , 133,6 . ,
13 , 45 .
5 2,1 . ,
, 30 2004 45 2009 .
( , 2010, .
, 2010), (45,51%),
(22,20%) (18,38%) (. 1).
1

,
..:

2007 .
,
.
,%
208895
100
106457
50,96
49941
23,91
34226
16,38


2008 .
,
.
,%
260932
100
121670
46,63
61564
23,59
46714
17,90

2009 .
,
.
,%
304588
100
138607
45,51
67630
22,20
55990
18,38

4739
3459

2,27
1,66

11874
5057

4,55
1,94

18257
6401

5,99
2,10

3363

1,61

5657

2,17

6771

2,22

3085
3032
1700
1268
613
97

1,48
1,45
0,81
0,61
0,29
0,05

2193
2834
2218
1772
1093
987
92

0,84
1,09
0,85
0,45
0,42
0,38
0,04

4113
4645
2555
1577
1207
849
99

1,35
1,53
0,89
0,52
0,40
0,28
0,03

43
183 (. 2).
26

154,02
242,30

183

226

201,59

173

88,22

124,66

135

43

76,91

109,10

69,01

40,09

90,61

56,15

34,46

,
..

..

38

759

747

782

2009

759

748

781

2008

494

488

505

491

485

502

, .

84,1

83,6

84,8

84,1

83,9

85,1

182

182

182

184

180

191

, .

100 ,
.

20453

11319

9134

17084

9360

7454

4934

3199

1735

3890

2116

1774

..

Copyright & A K-C

27

Copyright & A K-C

2009
20453 , 4934 .
2008 19,7%,
26,8%. ,
.
, , .
.
- ,

.
. ,
, , ,
.
, .. ,
, ,
, . , .
, , , , , ,
, .

,
. , .
.
.
. ,
.
, ,
,
, , 28

Copyright & A K-C

, , , , .
, , .
, .
,
. .
,
, ,
, .
,
,
.
,
. , . .

. ,
, , , , , , .
. - , , .
, , .
- ,
(. 3).
- . .. (2010) , .

29

Copyright & A K-C

3




1 2 3 4 5 6 7 8 9 10

+

+ +

+ +

+ + + + + + +

+ + +

+ +

+ +

30

11

12

+0,5
+0,5
+

Copyright & A K-C

2
,


, ,
, : , , .
, , . ,
. .
70
, , 16-17 600700 . 640
800 . 5,9 ( ) 15,2 ,
17, 97,5 , 99 .

.
2010 434451 . , 256,7 . , 2346,1 .
, 22,8 . 685 .
90355 178722 ,
269077 .
165374 . 60,2
. . 26,6 . .
22,4%.
, , ,
.
1979 1993
336,16 363,0 . . 128,0
139,4 . , 59,7 63% . 1993 . 363 . , 128 . , 80,64 . . 221 . , 66,7 . . 81,8%,
24,7%. 31

Copyright & A K-C

,
40%, ,
.
, - .
.
,
- ,
,
, ,
,
- , .

. :
1. -
;
2. , ;
3.
;
4. () ;
5. ;
6. ;
7. .
. , . .
, ,
,
.
1974 349000 . 269077 ( ).
32

Copyright & A K-C

. , , , .. .
, (.. , 2011, 2002).
(. 1).



, .

.









(, )
. 1.

33

Copyright & A K-C


, .
- .
-

.
, ,
. .
,
, , . .


.
, , , , ,
, , ,

.

.

(.2).

,
.
.
, .

,
.

4-5 . :
;
34

Copyright & A K-C


;

;
(5-6%) ;
,
.




,
,

. 2. ex situ
- .
.
- .

35

Copyright & A K-C

3


3.1.

.. , .. , .. .. 20-
, .
.. .
1928 .
, , ..
, . , . ..
.
, .. ,
, , .
,
,
, . , , , ,
, , , (.. , 1979).
1946 , FAO ( ) FAO

(B.G. Beilharz, 1983). 1947 1966 . FAO , 1959 .
, .
13- FAO, 1965 ., 1966 .
, , , . 70-80- FAO . 1974 . ,
36

Copyright & A K-C

, (J.C. Bowman, 1974; K. Malgala, 1974, 1987; R.


Nagarcenkan, 1983). 1975-1976 .
FAO/UNEP ( ), , ,
. 80-
(I.L. Masson, 1974; C. Draguneska, 1975).
31- EAAP (
) 1980 . , (C. Cueca, 1983).
1988 . EAAP FAO
. (K. Maijala et al, 1984; H. Epstein, 1974). , ,
.
,
, , (.. ., 1993).
, , , ,
. ,
, . 17%
.
,
, , , , ,
.
, ,
. ,

, , , (.. ., 1979).
37

Copyright & A K-C

,
, ,
, . . ,
.
. , ,
, , , , , (c ). - .

: -.
,
.
, ,
.
.
. ,
,

.
,
.
. ,
18 ,

. 30 .
,
(, , , , , ,
, .) ,
, -
. , ,

.
38

Copyright & A K-C

,
, . : , ,
, ..
.

, (.. ., 1999).
. ,
, . , , , , , .
.
, , , , , ,
, , . ,
,
(.. ., 1979).

, , .
, .
,
. , , , , , , , . (.. ., 1999).
,
-, .
: ..
( )
01.01.1990 . 241693 . , 39

Copyright & A K-C

.. .
1979 , , (01.01.1974) 349000 .
1973 . 0,6%, 1950 . 2,6%.
.. . (1979) -
. ,
.

40

Copyright & A K-C

4

:
;
;
.
, , ,
, 6 ,
.


,
( ).
.
, , .

:
1. ,
.
2.
.

, .
, , - .

( ), .


.
,
.
41

Copyright & A K-C


, , .
, , .
. , . , , , .
, ,
. ,

. ,
: .
.
.

.. .. (1974).
0 1.
, .
-
, ,
.

, .
.
57 10 ,
.
-, , , 42

Copyright & A K-C

,
.
,
, , , .
,
. , ,
,
, 2 2
2 129,3 ,
. 4,4%.
. 157,8 2 2 Z W,
150,8 A2 X2 E3 . .
.
, .
- ,
(BLAD), - (DUMS) , (PrP),
(
) . ,
, , .
, , , , . , ,
.

.
43

Copyright & A K-C

.

, ,
. , .
4.1.

-
2008 .
,
, - .
:
;
() -;
;
;
;

.
- :
,
2 ;
;
,
.
, , - , , ,
.
, , -. ,
.
44

Copyright & A K-C

5.1.
( .., 1997).
( .., 1985). ,
( .. ., 2004; .. ., 2006; .. ., 2006; Bisvas A.K..;2009) (
.. . 2004; Sipko T.P. et. al, 2004).
Bos L.,
.
(B.gaurus) 58. 60. ,
X- . Y- : B.taurus, B.mutus (), B.gaurus ,
(B.indicus) , NFa
58. ( ..,, 1970; .., .., 1983; .., .., 1988).
,
. Bos Capra, Ovis Bison, Bovidae.
B.taurus , Bovinae: , .
, .
. : -, . , B.taurus . ,
.
, , , 15-20 .
, [ .., 1970; ..,
.., 1983; .., 1998].
45

Copyright & A K-C

: 29 ,
, X Y- , 60 (. 3).
. B.taurus L. G-
.

. 3. . (2007)
,
[ .., .., 1987; . ., 1996].
:

, .

. , [Bunch T.D. et al., 1986, .
.. ., 2003], , , Bovidae,
15-20 . , [ .., 1985]. . 46

Copyright & A K-C

, 1
O. aries L. 1 3, 2-2 8 3-5 11 . ,
,
, ,
. , ,

, [s . t l., 1991; diger . t l., 1991; nsari ..
t l., 1992,1993].

. ..
.. [52, 53] 147
,
36 , 10
, .
.. . [39, 42,] A.K. Bisvas t
al. [85] 484 54
, 26 . ,
. , B.taurus O. aries.L.
. , 2
, 2, 8 , 3 O. aries.L. , , 2, 3, 4, 5, 6, 11 17 B.taurus L.
1 .
1 3 , 2 8 . , 9
9 14, 8 9-
, 21-25 29 , , 24 25 29 .
. 4 7982
1/29, 1988-1990 .

(. 4).

.
.
,
13 17 .
47

Copyright & A K-C

15, 16 17 .
, de novo,
.

. 4.
7982 1/29
4


[ .. ., 1997, 2004., 2007]

N /
1
1/21
-

2
1/25
-

3
1/26
-

4
1/27

5
1/29
35
17
6
2/4

7
2/27

8
3/4

9
3/12

10
5/18

11
5/21

12
5/22
-

13
5/25

14
6/16

15
7-11/20-25
,
16
7/21

17
8/9

48

Copyright & A K-C

18
19
20
21
22
23
24

9/12
9/17
11/16
11/15 12/16
12/12
12/27
13/21

25
26
27
28
29
30
31
32
33

14/20
14/21
14/28
15/28
17/27
20/20
21/27
25/27
5/22

,
,

, I, II III (Rt: 5/26; 8/26; 7/25),


.
: 1/29; 2/13 6/14. (Bovidae).
, ..
, [Lgia Souza Lima Silveira da Mota and Rosana Ap. Bicudo da Silv,
1998]. ,
, , , , ,
.
Bovelin A.T. [87]
. Rt 26 .
Rt 26/26 , ,
26. , , . ,
.
, .
, .. .. [8],
1965
49

Copyright & A K-C

. ( ). . 28 ,
Rt13/23, .[
.. ., 2005]
5.1.1.
2006-2007
. . 56 , 27 29 (. 5) 8 56 .
5

.

9675
4
5
60/
60/
91735
3
3
60/
60/
91634
4
4
60/
60/
13827
4
4
60/
60/
12583
3
3
60/
60/
23055
3
4
60/
60/
23050
3
3
60/
60/
23734
3
3
60/
60/

27
29
60/
60/

2n=60 (. 5). ,
, (. 5, 6).
-. ,
.
, .
.
, 29 .
,
,
50

Copyright & A K-C

, .

. 5.

. 6.
5.5.

. , , NF 51

Copyright & A K-C

( ), 2n
.
,
14 22 . .
8- , , 1 . .
.
16
. .
. ,
, , ,
.
-, .
.

[ .. ., 2007].
, NF. , 70- .
,
,
. , , , , . ,
.
, . .
tnt (. 7).
tnt (1;30)
. . ,
[ .., .., 1982; ., 2000].
. 8 ,
.
52

Copyright & A K-C

. 7. Rt tnt
) ) ; ) ,
; )
, ; ) - ; ) -

. 8. -
7982
53

Copyright & A K-C


, , . ,
. NF .
, . .
,
. , , ..
.
5.5.1.
.
3-4 , ,
.
, 80- 90- . , ..
, .. , .. 1989
39 - . .
.. , .. , .. , .. , 1998 . , , , . , ,
, .
5.5.
, , . , , , . , 54

Copyright & A K-C

21 , , .
. ,
(. 6).
6

( .. .. , 2006, .. 2007).

S.scrofa
B.taurus

O.aries
E.caballus

39,XXY
39,XXY/40,XXXY
38,XX/39,XXY
61,XXX
59,X0/60,XX/61/
XXX
60,XX/61,XXY
60,XY/61XYY

55,XXY
63,X0
65,XXX
65,XXY
63,X0/64,XX
64,XX/64,XY/65,
XXY/63,X0
66,XXXY
64,XX/65XXY
64,XX/64XY?/65,
XXY
63,X0/64,XX/65,
XXY
63 X0/65XXY

63,X0/64,XY
C. familaris 79XXY
78XX/79XXY
79XXY
78XX/79XXY
79XXY

, -

,

,

55

Copyright & A K-C

6 ,
. , ,
.
, , ,
.
. .
,
- (. 7).
7


( .. .. , 2006, .. ., 2007).

1. 60,XY,t(1/29)+1
2. 60,XX,t(12/12)+12
61,XX +12
61,XY +12
3. 61+ 17
60/61+17

. .
,
. .

-,
-,

4. 60,XY/60,XY+18
5. 61,XX+20

60,XX,t(20/20)+20
6. 61,XX+21

61,XX+21
61,XX+21

7. 61,XX+22
61,XX+22
61,XX+22

56

, , , . .
. .
.
, .

, . .
, , . .
, , , . .
, ,
.
,
, .
,
, , .

Copyright & A K-C

7
8. 61,XX+24
9. 61,XY+27

, .
, , . .

7 ,
.
.
( ) .
23, 28 30 .
5.5.1.


, .
,
.
.

.
, , .
,
, ,
, .
.
.
,
.
. 8 . 9,6%
(. 8). ,
.
8,2%.
, 1,4%.
57

Copyright & A K-C

8



%

9675
9
450
9,10,14
0,40,07
9,50,16
91735
6
300
7,00,15
1,00,06
8,00,16
91634
8
400
11,00,17 0,30,03
11,30,17
13827
8
400
8,50,15
0,80,04
9,30,15
12583 6
300
7,00,15
1,00,06
8,00,16
23055
7
350
7,00,13
2,0,07
9,00,15
23050
6
300
8,00,16
2,00,08
10,00,18
23734
6
300
7,00,15
2,00,08
9,00,17

56
2800
8,20,04
1,40,02
9,60,06

.
0,1%.
2n = 59, X0.
- , .

( 8), . .

- , . ,
, . , ,
,
,
.
(. 9) ,

, 9%
.
( 9).
(.
10).
58

Copyright & A K-C

%
-

9675
5
250
10,00,20 0,40,04
10,40,21
91735
3
150
8,00,23
2,00,06
100,24
91634
4
200
11,00,23 0,00,00
11,00,24
13827
4
200
9,00,21
0,00,00
9,00,21
12583
3
150
8,00,23
0,00,00
8,0024
23055
4
200
8,00,23
2,00,07
10,00,24
23050
3
150
8,00,24
2,00,10
10,00,24
23734
3
150
8,00,23
2,00,06
10,00,24

29
1450
8,90,08
0,90,03
9,90,08
10


%


9675
4
200
8,50,20
0,50,05 9,00,21
91735
3
150
6,00,23
0,00,0
6,00,20
91634
4
200
11,00,23 0,50,05 11,50,24
13827
4
200
8.00,21
1,50,0,9 9,50,22
12583
3
150
6,00,23
2,00,12 8,00,23
23055
3
150
6,00,23
2.00,14 8,00,26
23050
3
150
8,00,24
2,00,12 10,00,26
23734
3
150
6,00.23
2,00,12 8,00,23

27
1350
7,80.06
1,110,03 8,910,07
. , .
.
-. , . ,
91634, 12583 (p < 0,01).
91634, 91735 (p < 0,001).
, .
, ,
59

Copyright & A K-C

, . .
0,34 (p > 0,05). (r=0,21; p > 0,05),
,
.

1-2 ,
, (. 9).

. 9.
.
, ,
, , (. 10, 11).

60

Copyright & A K-C

. 10. ,
.
0,2%. -

. 11. , .
-

61

Copyright & A K-C

5.5.

. , , .

. . .
.
, , . ,
.
. -,
, . , , ,
,
. , -,
.
,
0,2 , 810%. 0,1 0,3 . ,
.. - . [68] 1 5 .
,
, de novo, , , . ,
, , .
3,8 24,5%.,
1 3 . . , ..
. [5,6], .. [7] .. [65] 5 15% , 0,06-0,50% .

.
62

Copyright & A K-C

,
,
- .

,
,
. .. [25] . .. [48]
.
.. . [23, 24]
.
.. [35].
.
,
[ .. .., 1990]. , .
, , ,
[ .., .., 1989]. .. [26]
,
.

.

, , , . , ,


. ,
.
,
, , .
.
.
[Zinoveva N.A. at. al, 2001; .. ., 2002].

.
63

Copyright & A K-C


. , , [ .., .; 1990.
2006].
, , [ . .., 1983; .. ., 2006].
[ ., 1986]. [ .. ..,
2003]. XY/XX
[ ..
., 2005].
(63,5%) , 36,5% . ,
. , , . ,
,
. .
5.5.1.
,
.
, , , .. , , .
, , ( ) , , , ,
.
, ,
, , , .
,
, : .

( 11).
64

Copyright & A K-C

11

%




9675
9
450
3,10,08 2,20,07 0,90,04
91735 6
300
1,00,25 1,00,26 00,0
91634
8
400
4,50,23 3,00,23 1,50,07
13827
8
400
4,00,14 2,00,10 2,00,10
12583 6
300
00
00
00
23055
7
350
7,60,12 4,80.10 2,80,08
23050
6
300
2,00,08 2,00,08 00
23734
6
300
5,00,13 3,00,10 2,00,08

56
2800
3,5 0,04 2,30,03 1,20,02

3,50,04%,
0 7,6% ( 11). 65%
35% .
,
.
( 12583 11)
, 23055

7,6%. 23734
,
5%.
(. 12).

12583 23050. 23055 6%. 13827.
23734. 4%.
23055 12583 23050 (p < 0,001).
, , .

91735 12583. 23055 10,0%, 9675, 91634 23734, 6% .
65

Copyright & A K-C

12

9675
91735
91634
13827
12583
23055
23050
23734

5
250
0,80,20
0,80,20
00
3
150
2,00,25
2,00,26
00
4
200
3,00,23
2,00,23
1,00,07
4
200
4,00,14
2,00,10
2,00,10
3
150
00
00
00
4
200
6,00,12
4,00.16
2,00,12
3
150
00
00
00
3
150
4,00,14
00
40,14
29
1450
2,5 0,04 1,40,03
1,10,03
13



9675
4
200
6,00,17
4,00,14 2,00,10
91735 3
150
0,00
0,00
00
91634
4
200
6,00,17
4,00,14 2,00,10
13827 4
200
4,00,14
2,00,10 2,00,10
12583 3
150
00,0
00
00
23055 3
150
10,00,26 6,00,20 4,00,16
23050
3
150
4,00,14
4,00,14 0,00
23734 3
150
6,00,20
6,00,20 00

27
1350
4,50,06
3,20,05 1,30,03

(p < 0,01) (p < 0,01).

.
. ,
,
. .
, , , 66

Copyright & A K-C

.
, , , , . .
, , .
5.5.
,
.

, , , .
, .
, .. [7]
- . ,
. , .
.
.

. , . , () , . . , . . [ ., , 1989; Buckton K.E. et al., 1986; Tozzi C. et al., 1988; Callen D.F. et
al., 1990; Buckton K.E., et al., 1985]. ,
fra,
.
, 67

Copyright & A K-C

,
. 2 ( 30) ( 80).
cauTXq27.3, . (
FRAXA) - http://www.bioinformatix.ru/
- [ .., ..,
interesnoe/patogeneticheskie-mehanizmyi-vozniknoveniya-hromosomnoypatologii.html]. [Mattei1 J. F., Mattei1 M. G.,
Aumeras1 C., Auger1 M., and Giraud F., 2004]
- - , ;

.
.[ . ., . ., . ., 2005, . . 2008].

22 , 19 , 3 (1p1.2; 12q1.1;
18q1.1).[ .. .,2005]

LRec-1, 3, LRec-1k LRec-1sf .
. G- ,
LRec-1, 3, LRec1sf 7 19, .
LRec-1 10 20, LRec-1sf 1, 2, 11, 15, 18 19.
LRec-3, LRec-1k . ,
,
RATMAP. 7 19
,
LRec-1 LRec-1sf ( . .,
. ., . ., 2007).
68

Copyright & A K-C

5.5.1.
, , -,
.
[ .., 1997] . ,
[ ., ., 1981]. .. .. [2005] , [ .. . 2002;
. ., 2007; .. ., 2007; .. . 2008
,].
[ .. ., 2005; .. ., 2005]
, , .
, ,
.
( ).
,
, , , , , , . ,
, ,
, .. , , .
, .
, , ,
.
.
. ,

, , .
: , , .
.
,
.
69

Copyright & A K-C

,
; , .

, .
, , .

, ..


,


.
[ .., 1975; .., 1991; Golubovskaya D.,
1979; Gottschalk W, Klein B.D., 1976; .. . 2002; Zinoveva N. et al,
2001].
(. 12).

5
4,5
4
3,5
3
2,5
2
1,5
1
0,5
0
1

X Y

. 12.

70

Copyright & A K-C

12 , , Y-.
2800 , 10.
,
. [ .., .., 1988]. , , ,
(p>0.05).
RPMI 1640T,
, . RPMI 1640 (. 19),
RPMI 1640T (. 20).
19

RPMI 1640

91634
4
200
3,00,23
2,00,23
1,00,07
13827 4
200
4,00,14
2,00,10
2,00,10
23055 4
150
6,00,12
4,00.16
2,00,12
23050
3
150
00
00
00

15
700
3,2 0,07 2,00,05
1,20,04
20

RPMI 1640

91634
13827
23055
23050

4
4
4
3
15

200
200
150
150
700

4,00,14
4,00,14
6,00,12
2,00.12
4,0 0,08

2,00,23
2,00,10
4,00.16
2,00,12
2,40,06

2,00,23
2,00,10
2,00,12
00
1,60,05

, . 19 20,
71

Copyright & A K-C

RPMI 1640. .
, . , . , .. , . ,
,
in situ, ,
, ..
. , . , , .. . , ,
" " .
. , , .. .
, ,
, .
, .. [22].
,
. :

(,
, HO HO2 ).
,
.
, ,

72

Copyright & A K-C

. [ .., , 1976].
, .. .
. , (
) .
( ) , , .

.
.
, ,

, () . ,
, , ,
, 18S 28S . , , .
.
1/10 , ,
, . , , , , .
5.6.

, . [- ..; 1969]. [ . . ., 1982], [ ..,
.., 2003]. [ .,
1995]. ,
, .
5.6.1.
-
. . 200
.
73

Copyright & A K-C

, 5
/ - (. 11,
12). -
(. 10, 11).

. 13.
23055. .

. 14.
23050. .
74

Copyright & A K-C

13 14
23055 23050.
-
20
( 21).
21
-


5,35+0,07
5,01+0,09
0,34
- 5,35
, 5,01 . 0,34. -, .. ,
.
- , (. 15,
2 3), 1,

. 15. -

- (.
16).
5 -
.. [28]. , 5
-.
- 5BrdU.
, -
, , , 5
, .. [28]. ..
75

Copyright & A K-C

. [8] .

. 16. -
( )
.. . [32] ()
() - ,
. .
-.
, , .
, ,
- , 5BrdU, .
5.5.
, , . .
,
( , , )
(, , 76

Copyright & A K-C

) , ().
[ .., ..,1988; .. ., 1999].
1.
.
, . 50 .. .
( , ).
2. .
RPMI 1640, RPMI 1640 ( ), 8 .
. 10-20 ( ,
). : 100 ./, 100
/.
1000 1:100. 50
8 . 2 .
3. . 71 37,50. 64 5 20 /. 68 -, 15 0,3
4. . . 10
. 100g. ,
(0,56% KCl), 10 , 40 . 37,50.
5. .
. 3 , ( 3:1). 4 45 .,
, .
6. . ,
. 20.
,
, 12-14 .
.
(. 17),
77

Copyright & A K-C

.. . [38, 46]. , Microsoft


Windows.

. 17.

Photoshop.
Photoshop
/ .
( ). , ,
. : , .
.
:
:
, ;
, ;
.
. ,
.
:
;
;
, .
:
;
78

Copyright & A K-C

, ;
.
:
, ;
;
;

, . ,
, .

RPMI1840T, - 6
5 /.

Microsoft\Exel. . .
DN = ln IN
IN = ijYij/ SS 2 SS 2 , y .
x ij

y ij

79

Copyright & A K-C

, .
. 19
() , 1998 .
( 291 402 19.06. 2006).

. , , ,
. ,

.
, -
(-577 30 2002). ,
- ,
(-578 30 2002 .).
, ,
. , () .
, 19 () :
, , .
()
80

Copyright & A K-C

,
.
()
, , , .
,
. . , .
.
,
. .
, . , , .. .
- . ,
, .
, , , , . , ,
, ( .. . 2004).

-.
, , .
, . XIX , . 1900 .
() . ,
.
1924
.
81

Copyright & A K-C

,
. , . , , .
, . A-, B-, C-, S-, F-, M-, Z-.
-. A-, E-, F-, H-, K-, L-, - .
- , 60 .
6.1.
. 1900 , . , , .
.. . , 1898 . .
,
, (. , 1970).
, ,
. .
1990 . ,


(.. , 1972).
E.Dungerh
.
C. Todd, P.G. White (. ..
, 1998). M. Fishbeine
. ,
, .. .

(.
.. , 1995).
E. Dungerh L. Hiszfeld 1910
. . 1924 .
. (.. , 2008).
82

Copyright & A K-C

. ,
, . , .
.


, .
1937
. . , .
,
(.. , 1978).
, , , , , .
(P.H. Maurer, B.T. Gerulat, P. Pinchuk, 1963), (Gill e.a., 1963).

(Jg). , , (.. , 1998; B. Alves e.a. 2005).

, .

(
). ,
.
: ,
, , ..
(.. , 2009).
dd, White
1910 .
.
. 83

Copyright & A K-C

. (Fischbein, 1913; Wescezky,


1920; Kunz, 1928; Kayser, 1929; , 1936; , , 1937;
Mustakallio, Rislakki, 1949). (Todd, White, 1910;
Ottenberg, Friedman, 1911; Karshner, 1928; Little, 1929; Jettmar, 1930;
Hofferber, Winter, 1932; , 1933; , 1933; , 1933, ,
1938; , 1940; , 1949, 1956; , , 1960).
1957 , .
- ,
(Ferguson, 1941; Stormont e.a., 1951),
(Neimann-Sorensen, 1966; Rendel, 1958;
Bouw, 1958; Braend, 1959),
40 . ,
(1957), , ,
(.. , 1988).
-
.
1941 : A, B, C, E, G, H,
I. 1942 . , 23 . . , ( ', B c B', B'' ..).
. . , , 1 2, O, U, E' O1,O2, O3, U1, U2, E'1, E'2, E'3.
D,
(. .. , 1998).
30, (Ferguson .., 1942) ,
. ,
G, G
. G ( BGK). (Stormont e.a.,
1945) , . ,
. (). 12.
100 .
() (.. , .. , 1995).
84

Copyright & A K-C


(Stormont, 1967).
. L, N', T' , B, C, S, A, F-V, J, Z, R'-S' .
-, 50 . , , , .
6-8
30 .
, .
. - (Rasmusen, 1963, 1964)
R-O- (Tucker, 1961).
,
, , , .
: (Fischer, 1930; Race, Sanger, 1962;
., 1964) , (Bernstein, 1924, 1925, 1930;
Wiener, 1945; Stormont, 1945) .
, (Bouw, fiorentini,
1970, 1974; Oosterlee, Bouw, 1974) , . , :
;
;
;

;
, .
( ). .
, ,
(, 1967). , , , . (Irwin,
Cumley, 1947; Cohen, 1956, Miller, 1956).
85

Copyright & A K-C

, , .
(Moustgaard e.a., 1962; Bouw, 1969; Bouw, Buys,
1972). , (1968, 1970) 57 ( 30000 ), (1974) 44 - 21000 .
.

, .
, , .
1 500 (Bouw, Fiorentini, 1970).
(Shaw, Stone, 1962), ,
-. ,
. , , , , , .
,
. . , , , ,
- ( -,
b - ..). -
. ( ), (.
, 1981).
.. , . , .. , .. . (1964-1977 .).
, 11
, 16 , 9
, 14 , 10 (H. Ejuta e.a., 1986; E.M. Tucker, 1994).
,
.
, ,
(O.
Stormont e.a., 1951).
86

Copyright & A K-C

87

Copyright & A K-C

, , .
,

(.. , 1971).
, , , ,
(.. , 1985; .. , 2002).
, .. ,
- . ,
, ,
,
.
6.1.1.

1998
.
19 () .
2003 .

(. 22).
: - 1 2. 1 61%, 1 , 0,78, 0,87,
0,65, 0,71, - 0,63, 0,68, 0,64, 0,63. 50
0,42, 0,48, . 0,42.
2 78%.
0,92, 0,57.
88

Copyright & A K-C


n=113


n=105


n=100


n=150

EAZ

0,42
0,70
0,23
0,35
0,05
0,03
0,69
0,09
0,41
0,48
0,32
0,69
0,16
0,28
0,20
0,19
0,32
0,35
0,45
0,13
0,25
0,40
0,80
0,27
0,59
0,11
0,19
0,31
0,05
0,71


n=105

EAF
EAJ
EAS

0,78
0,84
0,41
0,32
0,36
0,42
0,51
0,28
0,12
0,42
0,54
0,18
0,47
0,61
0,38
0,50
0,18
0,61
0,12
0,01
0,05
0,75
0,28
0,54
0,32
0,29
0,45
0,02
0,92


n=125

EAC

50 n-232

A1
A2
B2
G2
I1
O2
O4
Y2
B
D
E1
E3
F
G
I
O
Q
C1
C2
C2
R2
W
X2
L
V
J
S1
H
U
Z


n=173

EAA

22

0,48
0,57
0,27
0,04
0,11
0,11
0,58
0,22
0,22
0,41
0,43
0,35
0,12
0,36
0,14
0,39
0,14
0,13
0,61
0,05
0,08
0,49
0,70
0,21
0,49
0,008
0,09
0,34

0,68
0,86
0,31
0,50
0,20
0,26
0,32
0,39
0,43
0,70
0,44
0,48
0,10
0,27
0,24
0,58
0,78
0,18
0,61
0,06
0,03
0,70
0,76
0,20
0,53
0,06
0,41
0,49
0,04
0,88

0,87
0,92
0,37
0,11
0,17
0,31
0,57
0,42
0,28
0,50
0,58
0,20
0,22
0,31
0,24
0,45
0,50
0,64
0,14
0,04
0,22
0,19
0,64
0,38
0,37
0,14
0,35
0,008
0,88

0,65
0,78
0,45
0,30
0,41
0,41
0,45
0,10
0,29
0,55
0,44
0,30
0,34
0,35
0,54
0,37
0,53
0,42
0,17
0,19
0,11
0,35
0,68
0,14
0,57
0,17
0,47
0,71
0,02
0,88

0,71
0,88
0,42
0,55
0,13
0,37
0,35
0,49
0,40
0,67
0,57
0,30
0,17
0,48
0,25
0,01
0,87
0,30
0,59
0,05
0,37
0,72
0,79
0,20
0,60
0,12
0,51
0,59
0,09
0,86

0,46
0,69
0,46
0,34
0,37
0,38
0,22
0,30
0,41
0,35
0,49
0,29
0,42
0,41
0,51
0,40
0,43
0,30
0,16
0,15
0,24
0,49
0,66
0,44
0,53
0,13
0,19
0,43
0,10
0,81

0,80

89

Copyright & A K-C

90


n=279

EAZ


n=144

EAS


n=259

EAF
EAJ

.
n=330

EAC


n=167

EAB

A1
A2
B2
G2
I1
O2
O4
Y2
B
D
E1
E3
F
G
I
O
Q
C1
C2
C2
R2
W
X2
L
V
J
S1
H
U
Z


- n=188

EAA

22

0,63
0,78
0,15
0,09
0,11
0,09
0,61
0,07
0,15
0,45
0,49
0,45
0,11
0,41
0,27
0,34
0,46
0,20
0,33
0,10
0,19
0,52
0,70
0,26
0,57
0,13
0,15
0,36
0,05
0,82

0,68
0,71
0,40
0,16
0,20
0,22
0,56
0,23
0,51
0,46
0,46
0,65
0,17
0,21
0,13
0,40
0,35
0,34
0,59
0,17
0,12
0,36
0,42
0,29
0,68
0,12
0,16
0,26
0,11
0,78

0,42
0,73
0,27
0,34
0,29
0,12
0,70
0,11
0,31
0,56
0,56
0,58
0,31
0,59
0,36
0,19
0,34
0,58
0,22
0,11
0,17
0,72
0,81
0,15
0,50
0,11
0,35
0,81
0,11
0,91

0,64
0,82
0,21
0,28
0,12
0,15
0,52
0,18
0,23
0,50
0,32
0,56
0,41
0,38
0,36
0,34
0,38
0,51
0,27
0,04
0,13
0,57
0,42
0,25
0,56
0,03
0,26
0,38
0,02
0,89

0,51
0,78
0,24
0,18
0,13
0,13
0,65
0,21
0,19
0,67
0,51
0,49
0,23
0,69
0,40
0,41
0,54
0,37
0,33
0,08
0,19
0,60
0,83
0,22
0,56
0,06
0.33
0,58
0,10
0,87

0,63
0,84
0,33
0,36
0,19
0,36
0,28
0,34
0,33
0,57
0,41
0,45
0,35
0,67
0,38
0,50
0,53
0,41
0,49
0,22
0,35
0,85
0,57
0,33
0,61
0,20
0,35
0,57
0,23
0,79

Copyright & A K-C

- 5 : 4 50%, 50
0,69, - 0,61, . 0,70
0,65.
0,32, 0,22, 0,28.
D' 52%, 0,70, 0,67, 0,35.

'3, 18% 69%, 50
0,69, 0,65, 0,18
0,20.
G' 21% 69% 0,61, 0,67,
0,69, 50 0,28,
0,27, 0,21.
Q' 14% 87%.
0,87,
0,14 0,18.
- G2,
0,04, - 0,09, I1
50 0,05, Y2
50 0,09, 0,10, 0,07.
- 4 1, 2, W, X2.
1 0,61,
0,64.
W
. 0,72, 0,60, 0,85,
0,75, 0,70, 0,72. 0,19.
2 50 0,80, .
0,81, 0,83,
0,28.
''2
0,01, R2 0,03.
F- V,
53%,
0,68, 0,32.
J- J 0,8% 2,0%.
S- S1, H'', U'',
H'', . 0,81,
0,71.
91

Copyright & A K-C

Z- 84%. 0,92,
50 0,71.
.
I1 50 (0,05),
- (0,09), (0,36), (0,41), (0,37).
2 50 (0,03),
- (0,09), (0,42),
(0,41), (0,37), (0,38).
Y2 50 (0,09),
- (0,07), (0,39),
(0,42), (0,49).
' (0,01), 50 (0,50), 0,58), (0,50). S1
(0,008), (0,41), (0,47),
(0,51).
50
. (. 18).
, . , 50
, A1, B2, I1, O4,
B, E3, F, G, C2, L, H, Z.
. , , I1, E3, G, I, C1, W, V, S1,
H .

. , A1, O4, Y2, B, D, E3, C2, R2, X2, V, H, 0,78, 0,51, 0,28, 0,12, 0,42, 0,18,
0,01, 0,05, 0,28, 0,32, 0,46 . 0,42, 0,70, 0,11, 0,31, 0,56, 0,58, 0,11, 0,17, 0,81, 0,50, 0,81.
, . .
. - , (. 23).
- 1 2 25-76%,
25-88% .
- 4
57%, D' 44%, E'3 59%, 2
92

0,1

0,2

0,3

0,4

0,5

0,6

0,7

0,8

0,9

A1

A2

G2

I1

O4

Y2

B'

E'3

F'

D'

G'

O'

Q'

C1

I'

C2

R2

X2

L'

S1
( . )

. 18.
50

50

B2

H''

Copyright & A K-C

13% 63%, G2 0 63%, G' 10% 63%, O ' 14% 63%.


O2, Y2, B', F', I' 2% 63%.

93

Copyright & A K-C


n=8

.
n=8

n=19
0,47
0,79
0,32
0,42
0,11
0,16
0,53
0,05
0,21
0,21
0,21
0,68
0,42
0,26
0,37
0,32
0,47
0,63
0,16
0,05
0,05
0,26
0,37
0,16
0,63
-

0,25
0,25
0,13
0
0,25
0,25
0,50
0,13
0,13
0,63
0,25
0,50
0
0,25
0,13
0,63
0,50
0,13
0,25
0,13
0,13
0,50
0,88
0,13
0,88
-

0,11
0
0,95

0,13
0
1,00

0,38
0,88
0,63
0,63
0
0,38
0,63
0
0,38
0,75
0,63
0,63
0,13
0,63
0,25
0,38
0,75
0,88
0,63
0,50
0,25
0,63
1,00
0,25
0,75
0,38
0,63
0,63
0,25
0,75

n=50

0,76
0,85
0,19
0,33
0,19
0,37
0,43
0,17
0,09
0,35
0,30
0,19
0,43
0,52
0,41
0,56
0,26
0,24
0,20
0,02
0,02
0,78
0,20
0,67
0,41
0,28
0,48
0
0,96

50

n=14

A1
EAA A2
B2
G2
I1
O2
O4
Y2
B
D
EAB E1
E3
F
G
I
O
Q
EAC C1
C2
C2
R2
W
X2
L
EAF
V
EAJ
J
EAS S1
H
U
EAZ
Z


n=54

23
-

0,71
0,86
0,14
0,36
0
0,07
0,93
0,21
0,43
0,43
0,21
0,93
0,07
0,43
0,07
0,14
0,21
0,50
0,29
0,36
0,21
0,50
0,79
0,21
0,57
0,14
0,36
0,43
0,21
0,86

0,64
0,68
0,34
0,22
0,18
0,14
0,42
0,20
0,56
0,28
0,38
0,62
0,10
0,10
0,02
0,28
0,50
0,28
0,56
0,14
0,08
0,14
0,34
0,16
0,76
0,04
0,16
0,26
0,06
0,64

- 1 44%, W 46%, 2 59%. C''2, R2.


F- V 66%.
94

0,2

0,4

0,6

0,8

1,2

A1

B2

G2

I1

O4

B'

D'

E'3

50

Y2

F'

I'

O'

G'

Q'

C1

R2

X2
.

C2

L'

S1

. 19. -
50

A2

H''

Copyright & A K-C

Z- 86%.

50 (. 19).

95

Copyright & A K-C

-
. , G2
. (0,63), (0,22),
.
2 (0,37),
. (0,38), 50 (0,07). F' (0,43),
(0,42), 50 (0,07).
C2 . (0,50), (0,02), (0,05).
-
50 ,
. . A1, B2, O4, D E3,
I, C1, C2, X2, J, S1, H.
- . , I1, O4, B, E3, F, O, R2, W, X2, L, U,
0, 0,93, 0,43, 0,93, 0,07, 0,14, 0,21, 0,50, 0,79, 0,21, 0,21
50 , 0,19, 0,43, 0,09, 0,19,
0,43, 0,56, 0,02, 0,78, 0,20, 0,07, 0.
. , A1, B2, G2, O4,
B, D, E3, F, I, Q, C1, C2, C2, R2, X2, L, V, S1, U 0,76, 0,19, 0,33, 0,43, 0,09,
0,35, 0,19, 0,43, 0,41, 0,26, 0,24, 0,20, 0,02, 0,02 0,20, 0,67, 0,41, 0,28, 0 , . 0,38, 0,63,0,63, 0,63, 0,38,
0,75, 0,63, 0,13, 0,25, 0,75, 0,88, 0,63, 0,50, 0,25, 1,00, 0,25, 0,75, 0,63, 0,25.
, - . - 50 ,
.
- 50 , . .
6.2.


(.. ., 1982).
, , , .
, . , , , ,
.
96

Copyright & A K-C

:
)

A1A2B2G2O4 C1WX2 F/VZ


a/A2O2E'3I' C2X2 F/VH''Z
F1
A1A2B2O4E'3 C1WX2 F/VH''Z
)

/A2 B2I1Y2Q' X2L' F/F S1H''Z

a/aG2O4E'3 C1W F/F z/z

F1
A1A2O2D'F'G' C2R2 F/VZ
, ,
, . .

. , - -.

, .. .

.

.
. , : 1964 23%; 1968 14,6%; 1970 16,2%.
1985 6%
(.. ., 1969).
19-42%, 3- 9-11% (..
, 2001).
- 52%.
97

Copyright & A K-C

8-11% (..
, 1988).
.. (1995), .. (1999)

27% 1977 4-9% 1990.
,
, . .. (1970).

, ,
23,7%, 4,5%.
.. (1987) 31,4%, 10,2%.
, , . ,
.. (1971), .. (1978) ,
5186% .
,
.
,
,
. , , .
,

, .
() - (.. , .. , 2008).
.. .. (2008),
, ,
, .
, .
W. Kevin (2001), , ,
. ,
,
, 98

Copyright & A K-C

-
.

-.
:
- , . (.. , .. , 1986; .. ., 1989).
, .. , .. (1986) , 78 -,
2 -, ,
,
, .
, ,
, , , ,
.
- .
6.2.1.


2005 2011
, 9813 .
2241
,
, (. 24).
, , 0,3
37%.
.

,
(. 25).
99

Copyright & A K-C

24

2006-2011

,
% , .
.
, .
.
2006
268
259
527
8,5
2007
113
248
361
1,4
2008
76
97
173
2009
46
68
114
35,1
2010
253
204
457
37,0
2011
271
338
609
0,3

1027
1214
2241
11,6
, 20
,
, . , 7
20 , 2 2,2%
90% -.
- 2007
3,7%, 2010 8,9%,
2006 14,7%, .
2010 27,1%, 2010 30%, 45% , , - 2010
90%.
, ,
. ,
. , . ,
, ..
, .
. 13 - , (. 26).
100

17
18

14
15
16

1
2
3
4
5
6
7
8
9
10
11
12
13

2008 .
2005-2011 .
20082011 .

2006 .
120
163

38
577
259
11
20

104
59

109
142

446
200

86
97
206
119
-


. , 2005-2010 .
1077
85
336
204
2005-2010 . 322
57
245
2005-2007 . 552
54
227
85
2005-2007 .
592
100
289
2010-2011 .
174
20
80
2005-2011 .
523
83
214
2005-2008 .
408
54
148
2009-2010 .
287
8
156
2010-2011 .
156
5
100
2010-2011.
248
35
50 2009 .
231
14
130
2010-2011 .
260
6
144
2005-2010 .
463
108
160
-

,
.

17

188
10
107
44
59
51
23
42
36
49
131

..

25

21
27

264
10
100
96
30
70
72
28
52
51
61
64

38
27

452
20
100
203
74
129
123
51
94
87
110
195

2007-3,7
-

2010-27,1
2010-45,0
2006-14,7
2010-8,9
2009-46,0
2007-2,2
2010-30,0

- % ..


2005-2011

Copyright & A K-C

101

102

2005-2007 .
2006-2007 .

2009 .

2009 .
2010 .
2010 .
2010 .
2011 .

30
31

32

33
34
35
36
37

23
24
25
26
27
28
29

2007-2010.
2007-2010 .
- 2009-2010.
200520110.
2010-2011 .
2011 .
2005-2007 .
2011 .
- 2005-2007 .
- 1 2005-2007.
2011 .

19
20
21
22

30
18
60
9
16

50

341
100

172
96
133
120
265
138
100

457
233
188
550

62
198
89
376

156


20
30

19
11
18
14
46
9
2
14

5
94
6
3
93
23
69
10
51
26
161
4
134
15
85

55
286

63
35
9
38

100

110

11

30
27

54

44
80

13

46
56

27

41

67

90
136

2007-3,7

2010-90,0
-

25

Copyright & A K-C

Copyright & A K-C

26

.

/
9675
28/27
0
2
0
91735
14/12
0
2
0
943
3/3
0
0
0
91634
19/18
0
1
0
13827
18/18
0
1
0
12583
16/15
0
1
0
22471
7/7
0
0
0
23055
21/21
0
0
0
23050
11/11
0
0
0
223200
5/5
0
0
0
23621
2/2
0
0
0
23734
15/15
0
0
0
24096
28/11
16
0
1

187/165
16
5
1
, -, 24096, .

57,1%. 60,7%.
943, 22471, 23055,
23050, 223200, 23621, 23734
. 9675,
91735, 91634, 13827 12583
. 11,8%. ,
.
6.3.

, .
. 103

Copyright & A K-C

, 50 , -
50 - ,
- 50
.

(. 27).
,
50 , ,
, , 0,1999, 0,1519, 0,1582,
0,1488, 0,1497 . - 0,0395,
- 0,0228, . 0,0270,
0,0401.
- 0,1252, .
0,1073, 0,1063, 50
0,1293, 0,1145, 0,1034,
0,1213, 0,1160,
0,1264, 0,1205,
0,1229. 0,1129, . 0,1048, 0,1167,
. 0,1222, 0,1114, 0,1046,
0,1108,
0,1027, . 0,1139. ,
50 , ,
. , ,
, . ,
- 0,0944, 0,0903, 0,0987,0,0905,
0,0955, 0,0925, 0,0926, 0,09828 .
-
50 - (. 28).
, -
0,2184, 0,2074. 0,1256, 0,1192,
. 0,1082.
,
- 50
- ,
. . -
.
104


50






-

.


50

0,1999


0,1497
0,0635


0,1519
0,0903
0,0826


0,0831
0,1293
0,1160
0,1129


0,0944
0,1145
0,1264
0,0796
0,0786

0,1582
0,1034
0,1205
0,0424
0,1167
0,0816

0,0781
0,1213
0,1229
0,0863
0,0866
0,0443
0,0857

-
0,1252
0,0465
0,0395
0,0692
0,0785
0,0781
0,0880
0,0928

27

0,1488
0,0526
0,0592
0,0732
0,0925
0,1046
0,1108
0,1027
0,0619

Copyright & A K-C

105

Copyright & A K-C

28
-
50 -



0,2184

0,2074

0,1256

0,1192
.
0,1082
50
,
(. 29).
29
50


0,1999

0,0612

0,1293
.
0,0625

0,1213

0,0635

0,1145

0,0903
-
0,0465

0,0987

0,0526

0,1034

0,0562
, .
50
-,
0,0465, 50
, 0,0526.
,
0,1999, 50 , 0,1293.
,
, 0,0903, 0,0987 0,1034 .
, ,
, , 106

Copyright & A K-C

50 ,
.
50
(. 30).
30
-
50

50 0,0347
0,0784


0,2075

0,0839

0,1839

0,0885

0,1518

0,1293

0,1495

0,1097

0,1431
-
0,0774

0,1510
,
. , , .
0,2075;
0,1839;
0,1518, 0,1510.
0,1495, 0,1431. - 0,0774,
0,0784, 0,0839 09,0885.
-
. , , ,
.
6.3.1. .




.
107

Copyright & A K-C

- (. ,
1984).


(Ferguson, 1941; Jrwin, 1947; Stormont,1951),
40- - .
,
. ,
, ,
,
.
. ,
,
, ,
, ,
(.. , 1978).
, .

,
.
,
(.. , 2004).
, ,
. - .
, , ,
,
.
,
(J. Rendell,1961):
108

Copyright & A K-C

) , , , ;
) , , ,
- ;
) ,
.


- (.. . 2008).
,
, . , , , .
,
.
, G2 C2 R2 W
. 902 ,
750,5 , ..
151,5 .
,
F C1 C2 R2 ,
50,1 .
109

Copyright & A K-C

31

- ,

n -

- 66
A2 C2
700
480.7
219.3

()
X2 W Q' n=7

-
12
A2 X2 W 924.2
773.4
150.8
()
n=6
111
A1 X2 Z 717.2
559.4
157.8
. ()
W
n=21
- 70
A2 X2 Z n=17
- (.)
987.5
812.8
174.7
A2 B2
- 20
()
C1 C2 W n=8

V

-
15
D2 C1 W 825.5
591.4
234.1
()
V
n=6
-
15
844.6
714.5
130.1
A1 B2
()
G2 C1 H'' n=6
U''
-
.
- 19
R2 V' D' 1178.7
1005.3
173.3

n=5

()
-

A2 X2 C2 W Q' 219,3
.
4,4%.
.
( 1000 ), 173,3 ., R2 V' D', 26,3%.
( 600 )
(n=111) . 110

Copyright & A K-C

A2 X2 Z W, 58,8 , .
A2 B2 C1 C2 W V
( 1000 )
174,7 40%.

D2 C1 W
V. 234,1 .
A1 B2 G2 H'' U'', , .

30,1 40% .

, .
,
. , ,
.
.
, ,
.
, .. . (1981),
, , 29245, G1,
( 203-738 ) .
.. (1984)

. , G1QTYEF
BGQ1TAP , .. 640
0,28% .
.. (1991),
, ,
BOGT, GOQJ,
BQTG'P'B'', COTYE'F', JC'C'', QA'EFJ,
GOE, GY, E, G'J', GOTE'F'K'.
.. (1995)
111

Copyright & A K-C


, .
,
G', ; W, Z', X, C.
RX, EWX; , V,H,H''.
. . , 27- (2000, ),
.
, L- . S- , -
. , , , .
, , (.. , 1984).
, , 50%
. , ,
. .
,
, , , ,
.
. - .

.
112

Copyright & A K-C

, , .
.

, (, , ),
.
50 . 8 : , . ,
.
112,6
111,2 , 108,1 107,0 . . . , 20
, , 16 . . , 90 -.
5 2 1 .
(. 32).
32


. -,


2
02169
A1A2O4BE3FI
X2
F/VZ
3
02147
A1A2G2O4BDE3
C1R2WX2
F/VZ
4
02240
A1A2O4BDE3OQ
C2
FFHZ
5
0223
A1A2O4BDE3I
X2
F/FZ
7
12017
A1A2BDE1I
X2
F/VZ
8
11037
A1A2B2O4BE3IQ
X2
F/FHZ
13
02139
a/A2G2I1O4BDFI
C2X2
F/F z/z
14
11202
a/A2G2BDE3
R2
F/FZ
113

Copyright & A K-C

18
20
21
22
24
27
29
30
31
32
33
35

11248
021
0158
11249
0565
0283
11250
11047
10145
0273
11124
11237

1
6
9
10
11
12
15
16
17
19
23
25
26
28
34
36

12127
12031
12130
04145
12135
11242
11109
12062
11245
0298
02149
12006
0282
11252
11032
11238

32
X2
F/FZ
C2R2L
F/VHZ
C2R2X2
F/VZ
C2R2
F/VZ
C2X2L
F/VHZ
C2WX2L
F/VZ
C2R2X2
F/VJZ
C1WX2L
F/FZ
C2R2WX2
F/VS1HZ
C1WX2
F/FHZ
C2WX2
F/FZ
C2WX2
F/VJZ

a/A2B2O4E3I
a/A2B2G2BDE3O
a/A2G2BDE3FGI
a/A2E3G
A1A2G2O4Y2BDE3G
a/A2G2O4E1OQ
A1A2G2O4E3GQ
a/A2B2O4BDE3Q
a/A2G2O4E3
a/aB2I1O4Y2BDE3I
a/aO4DE3Q
a/aG2O4BDE3OQ

a/A2B2O4BIO
WL
a/a BDI
C2X2
a/aO4O
X2
a/aB2G2O4E3Q
C2
a/aO4
c/
a/aO4E3G
C2X2
a/A2I
X2
a/A2O4I
X2
a/A2O4DG
L
a/aDE3FGO
C2X2
a/aB
X2L
a/aE3Q
WX2
A1A2DQ
WX2
a/aO4
C1WX2
a/aO4BI
WX2L
a/A2O2Q
C1WX2

F/VHZ
F/VZ
F/FJZ
F/VZ
F/F z/z
F/F J H z/z
F/VZ
F/F z/z
F/V U z/z
F/V z/z
F/VS1Hz/z
F/FZ
F/VS1HZ
F/F z/z
F/FZ
F/VJS1Hz/z


(. 33, . 20).
,
.
A1/A2 0,40,
0,063,
G2
0,50, 0,063, E3 0,85, 0,13, B D 0,60 0,65 , 0,25,
F/VZ
114

0,1

0,2

0,3

0,4

0,5

0,6

0,7

0,8

0,9

A1A2

G2

B'

D'

E'3

I'

C2

R2

C1

. 20.

O4

X2

F/VZ

Copyright & A K-C

0,55, 0,25.
R2 .

115

Copyright & A K-C

33



1/2
8
0.40
1
0.063

G2
10
0.50
1
0.063
O4
15
0.75
9
0.56
B
12
0.60
4
0.25
D
13
0.65
4
0.25
E3
17
0.85
2
0.13
I
8
0.40
4
0.25
C1
7
0.35
2
0.13
C2
11
0.55
5
0.31

R2
7
0.35
X2
16
0.85
12
0.75
F/EAZ
F/VZ
11
0.55
4
0.25
, R2, E3, G2, B
.

.
8, 15, 18 0,5 ,
5 , , ,
, (. 34).
,

(. 35, . 21).

116

Copyright & A K-C

34

158

111,0

111,6

51,8

02169
30,7 30,9

15

333

121,5

121,5

61,8

34,2

35,8

31,8

169,8

18,4

138,8

41,5

18

408

125,3

127,0

63,0

41,8

172,6

19,8

141,0

44,0

163

112,0

113,7

51,3

43,6 41,7
02147
32,0 31,5

32,0

145,7

15,1

119,0

30,5

15

344

122,3

123,9

65,9

38,1

36,0

32,4

170,9

18,4

142,8

44,1

18

416

125,0

126,4

67,2

42,2

178,4

19,2

143,8

44,8

155

110,8

111,9

53,8

45,5 42,3
0158
30,5 31,7

32,3

147,1

15

117,3

31,1

15

336

120,5

122,0

64,0

34,0

36,5

33,2

169,6

19

137,6

44,8

18

402

124,1

124,9

66,0

43,4

179,5

20

140,5

45,0

170

113,5

114,7

57,6

48,2 43,0
11250
34,1 32,0

31,9

154,8

15,1

121,1

30,8

15

365

124,0

126,4

66,1

38,9

35,8

33,2

174,2

18,1

143,9

44,5

18

423

126,3

129,9

68,0

42,5

175,1

19,3

147,4

44,7

157

110,2

111,3

56,5

47,1 43,8
11237
31,0 31,9

32,1

151,5 15,14 115,1

31,0

15

338

121,7

122,8

65,0

37,3

36,0

32,9

169,7

18,5

141,6

44,2

18

417

124,8

127,3

67,2

48,7

42,8

42,9

177,2

19,1

146,4

45,0

,
.

.
.

31,1

146,8

15,5

117,0

30,1

117

Copyright & A K-C

35

,
.

.
.

28,6

146,0

14,5

117,2

28,8

153

103,9

107,4

53,5

12127
30,8
28,8

15

332

115,9

117,5

58,7

35,0

35,7

43,1

167,5

16,8

139,3

42,8

18

366

120,8

122,7

64,5

36,0

40,5

46,0

169,6

17,9

142,3

44,7

30,0
43,2

147,5
172,8

14,9
18,0

116,5
138,6

30,0
43,0

46,0

176,7

19,0

142,4

45,0

29,9
43,2
44,7

146,5
170,0
172,8

13,8
17,7
19,0

117,8
136,5
141,1

30,0
43,1
45,0

29,6
43,0
45,8

152,6
176,2
177,2

14,7
17,6
18,9

122,3
144,2
145,0

29,8
43,1
45,1

29,5
43,1
45,5

154,8
175,7
178,0

14,8
17,7
18,5

118,8
145,0
146,0

29,7
43,0
44,9

8
15

154
343

107,5
123,2

108,1
125,0

54,6
66,8

04145
31,1
28,6
37,0
39,0

18

405

124,8

127,5

66,7

44,5

48,0

8
15
18

163
334
386

105,7
119,7
123,2

108,7
122,4
125,8

54,1
65,5
65,0

8
15
18

175
351
385

104,2
108,5
118,7

107,2
111,6
120,2

55,2
66,4
66,7

11245
31,4
31,7
34,8
36,0
42,7
45,1
11252
32,0
33,2
39,3
40,8
43,9
44,7

53,8
66,9
68,1

11238
33,4
33,1
38,6
40,2
45,5
47,8

8
15
18

118

174
348
411

108,8
121,3
124,9

109,7
123,3
127,0

8
15
18

,
.

8
15
18

,
.
112,640,38
123,320,56
127,10,42


54,2
64,56
66,28

31,66
36,50
46,62


31,6
36,02
42,72

.
.
31,88
32,7
42,56
149,18
169,78
176,56

15,17
18,48
19,48

- .

.
106,020,26 108,050,16
54,24
31,74
31,08
29,52
149,46 14,54
118,280,48 120,160,51
65,26 37,14
38,34
43,12
172,44 17,56
122,480,60 124,640,58
66,2
42,52
45,22
45,6
174,86 18,66

111,20,31
122,00,50
125,120,12

30,7
43,82
44,7

118,12 29,66
140,12
43,0
143,36 44,94

37

117,90
140,84
144,02

36

Copyright & A K-C

119

Copyright & A K-C

38

, .
, .
8
15
18
8
15
18
,
111,2
122,0 125,1 107,0 118,3 122,5
0,50
*0,12
0,26
0,48
0,60
0,31
,
112,6
123,3 127,1 108,1 120,1 124,6

0,38
0,56
*0,42
1,76
0,51
0,58

117,9
140,8 144,3 118,1 140,1 143,4
,
0,43
0,61
0,59
0,94
0,78
0,41

149,2
169,8 176,6 149,5 172,4 174,9
,
0,51
0,59
0,68
1,12
0,79
0,83
,
160,6
343,8 413,2 163,8 341,6 390,6
1,89
3,05
*3,78
1,72
1,72
4,05
38 , . ,
8 111,2
112,6 , 107 108,1 .
15 122, 123,3 118,3, 120,1 .
18 2,6 , 2,5 , .
.
(. 21).
,
8 104%, 15 103%, 18 102%
, 8 104%, 15
103%, 18 102% ,
8 99,8%, 15 100%, 18 101%
, 8 99,8%, 15 98%, 18 101%
.

(. 39).
I II : 8
, 15 18 I ,
II 3,9%.
8- , 15 18 II 6%
I.
120

97

97,5

98

98,5

99

99,5

100

100,5

101

101,5

102

102,5

103

103,5

104

104,5

105


18

15

. 21. (100% )

Copyright & A K-C

121

Copyright & A K-C

39

, .
, .
8
15
18
8
15
18

47,5
46,5
46,2
47,2
42,6
42,3

113,4 118,5
118,4
114,7
124,0
123,7

58,3
57,3
70,0
58,5
57,7
69,0

101,2 101,2
101,7
100,2
101,6
101,1

124,5 120,5
121,0
126,8
123,6
122,5

14,5
15,6
16,1
14,1
15,4
16,1
-
101,5 100,8
106,5
101,5
98,2
103,3
II , I 8 2,3%, 15
3,1%, 18 1,5%.
- 8
, 15 I 2,6%, II; 18
3,2%.
, , .
, .
18 . 1976-1978 . , 30 , 123-125,4 ( ..), 122,5-125,1
.
, , .
: () ( ).
.. (1972), .. (1961), .. (1968), ..
(1968) , .
.
,
( 1500 ) .
, ,
.
.
, , ,
( .., 2010).
.
122

Copyright & A K-C

: .
(. 40).
40





, .


8
8-15
160,6
870
163,8
844
15
15-18
343,8
778*
341,6
551
18
8-18
413,2*
842*
390,6
782
0,95
8 . I
, .. 180 . 15 .
345 . 18 . (395 ), 20% 425 , .
I
, 40% ,
. 18 22,6 .

.
, 8-15 , 870 844
. 26 .
15-18 .
778 551 , 227
, .. , .
18
842 782 .
60 .
8-15 .
4
5- , 3 851-1000 4 , 701850 3 ( .., 2000).
123

Copyright & A K-C


,
.

.
, (. 41).
41


r
mr
td
8 .
0,011
0,32
0,03
8 .
8 .
0,06
0,31
0,19
8 .
18 .
0,84
0,09
8,85
18 .
18 .
0,80
0,11
6,92
18 .
8 .
0,90
0,06
15,05
18 .
8 .
0,80
0,11
6,94
18 .

0,999

R x/y
0,004
0,002
0,109
0,122
0,169
0,118

8
, , . ,
.
18
. , 0,84, 0,80.
8
18- , , .
(r) 8 . 18
0,9 ( 0,999), 0,8 ( 0,999).
,
. , .
8
0,004 0,002 . .
124

Copyright & A K-C

18
0,109 0,122 .
,
.
(R)
8 18 , 1
169 118 .
, .
,
, ,
: ( ).

. , , , 12
23 , 21
80 . ( .., 2003). ,
,
( 340 336 , 444 ) ( .., 1969).
, .

.
,
, , .
,
18 G2, B, D
R2 .
6.4. -
, , , , () .
. , .
125

Copyright & A K-C

. .

.

, , , , .
- 12-18
. ,
. ,

.
, -
.
- ,
-.
- .
6.4.1. -

, , , - .
, 30 50% ,
. , ,
, , ..
-, ,
.
.
126

Copyright & A K-C

-

.
, , ,
, .
. III ,
20%, I , 167 .
-, , .
-, .
32 --.
42
.

24039
27062
27015
27070


,
1279
740

a/G2C3F/F
12054
742

A/G2G3O2O4BEF/F
2420 775
- A/E1E3X2S1HF/F
12054
780
- a/B2OF/F

, 62
23 9 .
27070, 12 8.
-
(. 43).
6, 12, 15
: , , , . ,
27062 , 27015
.
15 . I .
27070-350 , 5
. 340 ,
4 , ..
. , 127

Copyright & A K-C

27062 27070
.

27062-346 27070-340 .
43


-

, .
, .
n
n
6
12
15
6
12
15
24039
22
168
283
344
16 168
285
345
27062
10
166
282
344
6
167
288
348
27015
17
166
281
345
12 167
281
340
27070
12
168
284
350
4
166
279
340
:
61
167
282
345
38 167
284
344

- (. 44).
44
-
,%

24039
99,7
100,3
27062
99,7
101,2
27015
100
98,8
27070
101,4
98,8
24039
27062, 27070. .
24039, 27062, 27015 . 15 .
- 27070
(. 44).
, -
. ,

.

128

Copyright & A K-C

7

7.1.
-

.
. -
, , , . .
XX 30 .
66 , 80-90 XX ,
2001 33 . 50% 90- . 33- 16
(). 50% ( FAO) ( ., 2004).
- .

. -, - . , ,
100 .. : , STMS (Sequence Tagged Microsattelite Site), STR (short tandem
repeat), SSR (simple sequence repeat) (Litt et al., 1989; Tautz, 1989; Weber et al.,
1989). STR , ,
. STR , .
(
, ). (
75%).
.
12-20 ,
. , , . 129

Copyright & A K-C

.
(Baker et al.,
1980). , 5 -

(3,2% -) ( ., 2005).
. -,
, .
: RAPD (Randomly
amplified polymorphic DNA) , AFLP (Amplified fragment length
polymorphism), ISSR (Inter-simple-sequence-repeats).
RAPD-. ,
, .
.

GC- ( 60%) .

RAPD (Random Amplified Polymophic DNA) AP-PCR (Arbitrarily Primed
PCR) (Welsh et al., 1990; Williams et al., 1990). .
.

, 100 5000 .. (). , ,
, . -
- (
- ) / ( - ) (. :
, 2004). RAPD- (/ -) (Williams et al., 1990).
RAPD- -
, . RAPD- , , (Caetano-Anolles et al., 1991; Waugh et al., 1992; Welsh et
al., 1990; Williams et al., 1990). RAPD-PCR
130

Copyright & A K-C

, c , - ( ., 1999; ., 2001; Naqvi et al., 1996). RAPD-


(Naqvi et al., 1996).
, : , /, . , RAPD-
- - .
(AFLP-).
AFLP. , .
, ,
. , , (~ 15 ), ( 3) (2-4 )
(Mueller et al., 1999; Vos et al., 1995).
, , , ,
.
75-100 (AFLP-), .
, ,
, ,
. 40 .
(. : , 2004). AFLP-
(Menz et al., 2002;
Thomas et al., 1995), .
.
(ISSR-).
ISSR- ,
(4-12 ) - (
). , 131

Copyright & A K-C

( , ).
,
(ISSR-). - (Gupta et al., 1994;
Zietkievicz et al., 1994). ISSR-
, / . RAPD AFLP ISSR .
AFLP , ,
, ,
(Gupta et al., 1994; Neve et al., 2000; Zietkievicz et al., 1994). ISSR-

- (Fang et al., 1998; Irzikovska et al., 2001).

- ( ., 2001, ., 2002).

. ,

( ., 1999; ., 2003). ,
ISSR- , . : , ( 15 30 ), (1-2 )
( ). , ,
.

().
. ,
, , , , ,
.
, 132

Copyright & A K-C

,
-.
, , , . ,
XX 30 . 66 ,
80-90 XX , 2001 33 . 33-
16 ( ., 2004).
,
. .

.
. , , ,
- (, Roslin Institute
(Edinburg) "Genetic Diversity in Cattle").
(MacHugh
et al., 1998), (Troy et al., 2001; Hanotte et al., 2002);
Bos
taurus (http://www.ri.bbsrc.ac.uk/bovmap/bovmap.htm). ,
.
, , .
-

-. -
,
- . (CSN3),
(Schaar et al., 1984,
1985; Robitaille 1995), (Zadworny &
Kuchnlein, 1990). ,
.
-.
133

Copyright & A K-C

, , -
12-20
: , , , (Applied
Biosystems). ,

, ,
(, ). , , .
-, RAPD (Randomly amplified polymorphic
DNA), AFLP (Amplified fragment length polymorphism) ISSR (Inter-simplesequence-repeats). , ,
,
.
-
ISSR- , ,
ISSR-.
. ( 30 ).
,
.
- , ,
.
, - - .
7.1.1. -
AG-ISSR GA-ISSR-
Bos taurus turano-mongolicus , ,
, , , ,
(, 1949). . , . ,
1000
.
. .
,
134

Copyright & A K-C

, . .. (1949),
3-4 . . .. (1962) ,
1857 . 171666 .
(, 1949) Bos taurus turano-mongolicus.
.
, , (, 1976).
XVII .
, .
, , (, 1931). , .
(, 1931), (, 1924).
,
(,1936; , 1949).
, , (, 1981), .
Bos taurus turano-mongolicus.
,
.
.

, , , , . .
. - AG-ISSR GA-ISSR . 45.
, .
,
( Stephens) (. 45).

135

Copyright & A K-C

45
-
AG-ISSR GA-ISSR-

AG
GA
AG
14.120.34 8.620.18 GA
0.82
0.45
1(89)
2(88)
16.500.29 9.940.26 0.20
0.21
(30)
(32)
14.560.34 8.230.11 0.53
0.47
(27)
(31)


(
Stephens)
AG
GA
AG
GA
0.82
0.87 0.28
0.19
0.91

0.88

0.10 . .12

0.91

0.95

0.14

0.10

1 (AG)9C;
2 (GA)9C.
1. ( ), AG-ISSR-,
(. . 9),
(P< 0.001 P< 0.002 ), . 1.
2-3 ,
, (P< 0.001).
GA-ISSR- ,
. , AG-ISSR-, ,
( Stephens) .
3.

(P< 0.001), (0.19) (P<0.001) ( 2).
(. 22).
1 2
. , 77.03%, ,
(. 22). (. 22b),
,
.

136

Copyright & A K-C

1. (a)
(b) - ,
AG-ISSR-

137

Copyright & A K-C

2. (a)
(b) - ,
GA-ISSR-

138

Copyright & A K-C

UPGMA

b
0,135

0,140

0,145

0,150

0,155

0,160

0,165

0,170

. 22.
, AG-ISSR-
(); ,
UPGMA
, AG-ISSR- (b)
GAISSR- (. 23).
139

Copyright & A K-C

0,10

0,15

0,20

0,25

0,30

0,35

. 23.
, GA-ISSR-
(); ,
UPGMA
, GA-ISSR- (b).

, ISSR- (AG- GA-),

Bos taurus turano-mongolicus (, 1949),
140

Copyright & A K-C

.
(, 1976) .
, , -, , - .
, , , .
7.2.

.
, .
, , , (, ) , . , , , . .
, .

,
.

.
, , .
, , (.. , 1976).
(13-15),
. . , ,
. 141

Copyright & A K-C

( 3,4%)
2% , .
- , . -
.
.
,
,
().

. ,
,
.

.

. , (..
., 1999). ,
(.. , 1968). , , , ,
,
.

(.. , 1968; .. , 1960;
.. , 1968; .. ; .. ., 1967).
, .. .
, . .. , .., .
. ,
, , .
,

142

Copyright & A K-C

, 24.

. 24.

, ,
, ; , , .
7.2.1.

.
, , ,
( , , ,
).
,
.
143

Copyright & A K-C

, -
Retroviridae, Deltaretrovirus, -
.

(, , , , ..) ,
.

.
, , , , ( , , , , , , , , ,
), ,
. (, )
.
, , ,
II .
-,
() -, .
, ,
BoLA-DRB3.
(Bovine Leukocyte Antigenes (BoLA)),
23 . BoLA-DRB3 6
. . b1 II , .
- 54
, 90. ,
.
(BoLA-DRB3.2*11, *23, *28 (
)), (BoLA-DRB3.2*8, *16, *22, *24) .
2 - ( 70-71) ,
ER (Glu-Arg),
144

Copyright & A K-C

VDTY (Val-Asp-Thr-Tyr), VDTV (Val-Asp-Thr-Val), VDRV (Val-Asp-Arg-Val)


75-78.
, -
c .
-
.
. 60-70-
-
- . .
, 2000-2003 . . ,
. , - , 60-80%, , 10-20 . ,
-
. , , ( ), (, , ),
, 3 9 . 14,6% 1990 0,6% 2010 .
( ) . ,
.
, . , .
, , BoLA-DRB3 .
BoLA-DRB3
.
BoLA-DRB3 46. 33
54.
.
145

Copyright & A K-C

46
BoLA-DRB3

( ( (
)
)
)
BoLA BoLA27
0.009
DRB3, DRB3, 34
0.009

36
0.026

1
0.034
37
0.017
11
0.034
2
0.009
38
0.026
23
0.017
5
0.017
41
0.009
28
0.120
6
0.017
43
0.026

0.171
10
0.060
45
0.009
BoLA12
0.069
46
0.017
DRB3, 13
0.009
47
0.017
15
0.060
50
0.017

17
0.017
51
0.026
8
0.078
18
0.043
52
0.017
16
0.043
19
0.009
54
0.026
24
0.078
21
0.026

0.630

0.199
26
0.009
.
0,171. .
, .
, .

*8, *16, *24. 0,199. ,
.

. , . , , ,
.
:
1. / (/).
2. / (/).
3. / (/).
4. / (/).
5. / (/).
6. / (/).
146

Copyright & A K-C

47.
47
BoLA-DRB3


/
0,0525
/
0,0525
/
0,1905

0,2760
/
0,0865
/
0,1545

0,2410
/
0,4635
, , , .
.
BoLA-DRB3
. ,
. (0,7069), (2=0,5124, p<0,05)
(0,9109). ,

BoLA-DRB3. .
, :
1. (0.171).
2. ,
(0.2760), ,
(0.2410).
3. .

48.
, , , , .
,
.

147

Copyright & A K-C

48

,
- *
*
BoLA-DRB3,
11
0,034
0,220
0,090
23
0,017
0,030
28
0,120
0,070
0,015

0,171
0,290
0,135
BoLA-DRB3,
3
0,145
0,077
8
0,078
0,090
16
0,043
0,076
22
0,070
0,015
24
0,078
0,135

0,199
0,215
0,559
* .. (, 2006).
7.3. BoLA-DRB3

BoLA-DRB3 ()
, ,
( )
. (_) 54
, 90
[http://www.ri.bbsrc.ac.uk/bola/drb3pcr.htm].
BoLA-DRB3
- . BoLA-DRB3 .
,
[13], , Staphylococcus sp. [46], [5], [5] [7, 8].
BoLADRB3 [9], , , BoLA-
[8]. BoLA-DRB3 : ( [10], [5, 11],
[12], [13]), ( [14], [5], [12]), - [2, 15] [3, 15]
148

Copyright & A K-C

, (
[16]), [17], (, , [12]), ( [12], [18], [19]) . -
( Bos taurus turano-mongolicus), , , , . , ,
, , , ,
[20]. .
, .
, ,
63, 8-8.5 . . : . , 3-4 .
. X-XV
., ,
. 1857 . 17.5
, , (. [21]). - 30- 40- .
1000 . , ,
, , , ( 4.75%
6-7%) [21].
,
, .
, ,
[22].
- . .
, 149

Copyright & A K-C

(. [23]).
- (),
. -
XVII ., . .
: , , .
2007 . 1.5% [24]. , - . .
.
, .
, , . , - .
.
, . ,
. ,
- ,
[23]. - BoLA-DRB3, , , .
7.3.1. BLA-DRB3 ,

BoLA-DRB3 , ,
,
.

. . (n = 62),
- (n = 71).
150

Copyright & A K-C

(n = 42) ... .. . Nucleos (


DiatomTM DNA Prep 200 Isogene Lab. Ltd, )
. (NestedPCR)
[1, 2]
GenePakTMPCR Core (Isogene Lab. Ltd, ).

HLO-30
(5'tcctctctctgcagcacatttcc3') HLO-32 (5'tcgccgctgcacagtgaaactctc3').
:

HLO-30

HLO-31
(5'attcgcgctcacctcgccgct3'), HLO-30 HLO-32. (Isogene Lab.
Ltd, ) :
95 5 .; 35 , 94 1 ., HLO-30 HLO-32 68 45 , 72 45 ;
72 7 . 10
(HLO-30 HLO-31) 62.5,
. 2%- (Agarose LE, Analytical Grade,
Promega, ). - 284 (281 ,
).
RsaI, HaeIII BstYI (XhoII). 4%- (TopVisionTM LE GQ agarose, Fermentas, ) (5 /) -. B GeneRulerTM DNA Ladder, Ultra Low Range
(Fermentas, ). .
, [25]. . POPGENE 3.1 STATISTICA 6.0. [26]: Ho , He .
BoLA-DRB3 , BoLADRB3 . 49.
, ,
( ). , 151

Copyright & A K-C

,
BoLA-DRB3.2*8, *16, *22 *24 [1] *3, [3].
35 BoLA-DRB3 54, -, 34,
5 (. 49). BoLADRB3 (35 ) [16],
(32 ) [19]
(29 ) [16]. .
[10,11], [5, 14], [3, 15], [17] 1118 . (27 ) [5, 6] (26 ) [13].
: BoLADRB3.2*18 (8.45%), *20 (7.75%) *28 (7.75%),
23.95% (. 49).
49
BoLA-DRB3 ,

RsaI,


XhoII (BstYI), HaeIII

P,%
,
0
3.22
2.11
*11
gea
0
1.61
0
*7
nba
0
*28
7.7
14.52
ecc
63 4
4, 84
1,2
*23
obb
24.19
0
15.49
,
0
0
*3
2.82
bbb
0
0.7
3.22
*8
faa
4.0
0
0.7
jb
*16
0
0
mba
*24
0.7
0
7.26
*22
1.42
nbb
0
6.34
14.5

152

Copyright & A K-C

aaa
bba
caa
rcc
daa
fda
fba
haa
hba
hbb
iba
kbb
lbf
sbb
lbb
lbe
oaa
oab
obf
pcc
ibf
lab
lba
oba
bda
tba
aba
nb
kbf
kbi
sdb
vba
waa
wb
xba
gaa
jdb
sda

49
,
*1
2.82
3.22
13.1
*2
2.82
0
0
*4
0
2.42
0
*5
0
1.61
0
*6
0
1.61
0
*9
0.7
0
0
*10
0.7
5.65
0
*12
0.7
6.45
0
*13
0.7
0.81
0
*14
1.42
0
0
*15
0
5,65
0
*17
0
1,61
0
*18
8.45
4.84
0
*19
0
0.81
0
*20
7.75
0
0
*21
1.42
2.42
0
*25
2.82
0
0
*26
5.63
0.81
0
*27
3.52
0.81
0
*29
5.63
0
77.3
*31
0.7
0
3.6
*34
4.23
0.81
0
*36
4.93
2.42
0
*37
2,82
1.61
0
*38
2.11
2.42
0
*39
1.42
0
0
*41
0
0.81
0
*42
0.7
0
0
*43
2.82
2.42
0
*44
0.7
0
0
*45
0
0.81
0
*46
5.63
1.61
0
*47
0
1.61
0
*49
5.63
0
0
*50
0.7
1.61
0
*51
0
2.42
0
*52
0.7
1.61
0
*54
0
2.42
4.8

78,17
61,3
98,8

. 510%.

153

Copyright & A K-C

5% (27 )
47.9%. : 521*28
(14.52%), *24 (7.26%) *12 (6.45%); (29 )
5% 60.47%.
BoLA-DRB3 *28. . , - (35-43%) (68-74%). ,
(*16,
*20, *2, *29, 51.7%) [18], (*8,
*10, *20, *34, 48.4%) [19], (*8, *24,
*11, *16, 67%) [13].
(*8, *10, *15, *21, *36, *ibe,
74%) [14], (*34, *15, *6,*20, *37,
*20, 71%) [27],
(*8, *11, *16, *22,*23, *24, 69, 7%) [28],
(*8, *9, *21, *27, *7, *24, 70%) [17].

BoLA-DRB3.2 - [15] [16] .
BoLA-DRB3 ,
- 9%, 12.9%.
. - *16
(8.86%), *24 (8.86%), *11 (6.63%), *12 (6.33%),*13 (7.59%), *51 (6.33%) [15].
*3 (12.9%), *16 (7.36%), *24 (7.4%),*11
(8.3%) [16]. 55.65 50.28%
- . , , ( ),
. .
( ).
BoLA-DRB3.2*29(77.3%), *1 (13.1%). ,
9.6%. BoLA-DRB3
. BoLADRB3.2
11 [10, 29]. , 154

Copyright & A K-C

BoLA-DRB3 , , . BoLA-DRB3 - .
BoLA-DRB3
. 56
, - ,
(n = 71).
5.63% ( *7/*7).
,
*7/*7 *18/*18 (5.63 4.23% ), . 51 ,
BoLA-DRB3.2 . 5% ( *15/*28,
4.85%), - .
(*29) BoLA-DRB3
, *29/*29 (71.4%). *18/*18 (9.5%) *18/*29
(7.1%). .

(. 50). ,
, ;
[30]. . 23
DRB, .
50
() ()
,

2
D

0.775
0.953
3.32
187

0.708
0.946
5.99
0.252

0.12
0.38
17.79
0.684
. D .

(.
50), , , ( , , ).
155

Copyright & A K-C

7.4. BoLA-DRB3 ,
,

BoLA-DRB3 (), .
[13] BoLA-DRB3.2*11, *23, *28.
, , , BoLA DRB3.2*7 [15].
1524%.
, *7, (1.2%).
. *23, *7, *11 *28
5.63%, 2.11% 7.55%. *28 (7.55 14.52% ). , *28, [14]
[15]. .
, ( *7), ( < 0.05) . BoLA-DRB3.2*8, *16, *22, *24 [13],
*3 [15]. 6.34%,
2 14.51% ( < 0.01).
.
, ,
. *8, *16
*24 3.22%, 4.03% 7.26% .

*24. . ,
( < 0.01). , BoLA-DRB3.2 . ,
*16 *24 ,
Staphylococcus sp. [46], *16 [5]. , *16 *24 , .. ,
.
156

Copyright & A K-C

*16 *24,
BoLA DRB3.2 , ,
[46, 29], .
*2, *7 *11,
*7, *11 *23.
, ,
. (1.2%)
*7. , ,
.
, .
, .
,
(. 47): / (/), /
(/), / (/), /
(/), / (/), /
(/). , , . 22.52%, 38.95%, 2.4%.
( < 0.001). , ( / /),
12.68%, 15.3%.
. .
, , .
, [24].
- [13]. (n
= 17) (n = 33) . 70.5%,
,
.
,
, 35.29%, , , 61.77%, .. 2 . , .
157

Copyright & A K-C

. -
, [12].
, ,
.
BoLADRB3 , . , BoLA-DRB3 , , Bos taurus
turano-mongolicus.
, . .
. , , , (), , , , .
7.5.
. . ( ) , , , .. .
,
. ,
, ,
.

() .. - .. [105] ,
.
, , , , , .. , , [106], , 158

Copyright & A K-C

, .
.
,
, . 13 ,
- 1000 , 17 23 . 40 , , , , , , , , , .

, , ,
, , , . , - [113].
, : .

,
(. 51).
.
51

(. : , 1989)
-

30-40

: - G


,
159

Copyright & A K-C

: ,
,
. " "
[143] ,

.

.
-, ,
, , ,
, ., .

(). , , , [114], , , .
( ). (
) .
, ( ),
. ,
,
..
.
7.5.1.
ISSR-
. , , . : , , , , . ; 160

Copyright & A K-C


.
: -, ; -,
; , , .
, , . , , . ,
, 20- . ..
1927 .: , , ,
, , , , , , .
, ,
, , . , , .
, , .
. . , - ,
.

.
. :
, , , .

. ,
161

Copyright & A K-C

, ,
- .

, (ISSR,
Inter- Simple-Seguence Repeats).
(,
, -) DIAtom DNA Prep (IsoGene, ).
GenePakTM
PCR Core - (IsoGene, ) (AG)9C (GA)9C : 2
. 94-95, 94-95 30 c., 55 30 ,
72 2 . (35-37 ). 72
10 . 2%-
.

ISSR-
(GA)9C (GA-ISSR), (AG)9C (AG-ISSR-). ,
, (. 25). (AG)9C (GA)9C.
,
,
.
, ,
,
. ISSR- ( ISSR-) , , .
, , ,
(). (GA)9C (AG)9C 24 ( 210
2430 ..) 31 ( 190 2450 ..) .

162

Copyright & A K-C

)
. 25. , ISSR-PCR
(AG)9C (A) (GA)9C ()
1,5%- : 1-6,
8-13 ; 7
(GeneRulerTM 100 bp DNA Ladder Plus)
/ , . , AG-ISSR, , GA-ISSR (. 52). (
) , GA-ISSR.

163

Copyright & A K-C

52

GA-ISSR- AG-ISSR-

(AG)9C
N
43 12.050.39 0.58 0.82
57 14.700.38 0.66 0.85
89 14.120.34 0.82 0.82
30 13.270.44 0.90 0.71
33 11.240.62 0.88 0.73

S
0.25
0.24
0.28
0.27
0.39

(GA)9C
N

42 8.290.30 0.66 0.84
62 5.790.13 0.59 0.88
88 8.610.18 0.45 0.87
31 8.230.11 0.46 0.95
35 7.170.31 0.32 0.78

S
0.24
0.16
0.19
0.10
0.21

: N , ;
, , S
Stephens.


, (AG)9C-, , ,
AG-ISSR. , GA-ISSR,
, . , ,
, ,
.

. , ,

.
, ISSR-

55 ,
, .

164

Copyright & A K-C

1. , ..
/ .. . // .
1989. 2. . 36-41.
2. , .. / .. // . 2001. 256(2627).
3. , .. /
.. // . . , 2002.
4. , .. - / ..
// . 2002. 5(2655).
5. , .. / .. . ., 1949.
6. , .. -
/ .. . -, 1964.
7. , .. / .. // . 1962. 6.
8. , .. -
. /
.. . ., 1968.
9. , .. / ..
. , 1968.
10. , .. .
/ .. . , 1990.
11. , ..
, / .. // . . . 1991. .
80-86.
12. , .. . , : / ..
. , 1992. 25 .
13. , .. . / .. . , 2001. . 1-55.
14. , .. / ..
// . 2007. . 3-4.
15. , .. / .. . ., 2010.
16. , ..
/ .. , .. , .. // .
11. 2000. . 2-3.
17. , .. / .. . :
. -, 1971. 248 .
165

Copyright & A K-C

18. , .. / .. , .. , .. . , 1987.
19. , .. / .. //
. : , 1976. . 16-27.
20. , .. / .. // . 1991. 1. . 11-13.
21. , .. / .. ,
. // . 1992. 1. . 9-12.
22. , .. / .. , .. . : , 1992. 113 .
23. , ..
: . .
- .-. / .. . ., 1997. 34 .
24. , .. / .. , .. // .
. 1972. . 38.
25. , ..
/ .. , .. , .. // . (. .), 1978. . 54. . 43-47.
26. , ..
: . - . / .. . , 1995.
27. , ..
/ .. , .. //
. . . . 5. , 1978.
28. , .. . . , 1983. . 7/13.
29. , .. / .. . , 1992.
30. , .. , / .. , .. , ..
// . . 1989. . 2. . 11.
31. , .. / .. , .. //
. : . -, 1988. 102 .
32. , .. / ..
, .. // . 1984. 11. . 32-34.
33. , .. / .. , .. , .. //
. .-. . -: - , 2002. . 74-78.
34. , .. / .. .
-: - , 2007. 118 .
166

Copyright & A K-C

35. , .. / .. , .. , ..
, .. // . 2009. 7. . 11-13.
36. , .. / .. ,
.. , .. // -
: . .-. .,
. 400-
. , 2008. . 187-191.
37. , .. -
- / .. , .. , .
//
: . .-. . , 2008. . 96-98.
38. , .. / .. , .. , .. //
. 2008. 8. . 9-11.
39. , .. BoLA-DRB3
- / .. , .. ,
.. , . //
: IV . .
. . 2009. . 75-77.
40. , ..
ISSR- / .. , .. // . 2009. 3. . 4-5.
41. , ..
/ .. , .. , .. //
. 2009. . 62 (1). . 68-73.
42. , .. -
/ .. , ..
, .. // :
VI . .-. . . 2009. . 117-119.
43. , .. BoLA-DRB3
, / .. , .. , .. , .. , . , .. //
. . 46. 4. ., 2010. 9 .
44. , .. BOLA-DRB3
- / .. ,
.. , .. , .. , . , .. // , 200-
. V . ., 2010. . 2.
45. , .. BoLA-DRB3
, / .. , .. 167

Copyright & A K-C

, .. , .. , . , .. //
. .-. . , 2008. . 5.
46. , .. -
/ .. , .. ,
.. // . .-. . ,
2010. . 4.
47. , .. - (csn3)
/ .. , ..
// , : . .- . . . 2011. . 6.
48. , .. / ..
, .. . . 2003. . 5.
49. , .. ISSR- / .. , ..
// . .-. . -. 2006. . 4.
50. , .. IISR- / .. , .. , ..
// - : . .-. . . 2007. . 165169.
51. , .. -
/ .. , .. ,
.. // . .-. . .
2008. . 5.
52. , .. -
/ .. , .. , .. //
- : . . .
75- .-. . , 2011. . 185-189.
53. , .. / .. . .: , 1932.
54. , .. / ..
. : , 1969.
55. , ..
/ .. . ,
1992.
56. , ..
/ . // . . , . 14. 1970.
57. , .. / .. , .. // . .-. . 1974. 9. . 75-80.
58. , ..
: . -. . / .. . ., 2001. 35 .
168

Copyright & A K-C

59. , .. - - / .. , .. , .. , ..
// . 2009. 7. . 13-15.
60. , ..
/ .. // .
1970. 9. . 37-39.
61. , .. / - - / .. , .. // . . , 1970. . 14. . 84-93.
62. , .. / .. // . . 1968. . 13.
63. , .. / .. //
.-. . 1970. 2. . 146-148.
64. , .. : . . . - .-. /
.. . , 1972. 45 .
65. , .. / ..
, .. // . 1974. 10. .
34-35.
66. , .. / ..
// . ., 1982. . 35-42.
67. , .. / .. // / . . 1985. . 122-126.
68. , .. . / .. // . 1990. 3. . 54-57.
69. , .. / .. //
. , 1996.
70. , .. / ..
// .: , 1981. 444 .
71. , .. 9- / .. , .. , .. , .. // .
. . 32. 1970.
72. , .. /
.. , .. // ., 2005. 381 .
73. , .. / .. , .. // .
1987. 4. . 18-19.
74. , ..
/ .. , .. , .. //
. 1989. 10. . 17-20.
75. .. (, ) / ..
. , 1982.
169

Copyright & A K-C

76. , .. / .. , .. , .. // .-. . 1976. 6.


77. , .. / .. // . 1978. 5.
. 66-70.
78. , .. , / .. , .. , ..
// : . . , 1980. .25. .58-68.
79. , ..
/ .. // . .
, 1985. . 28-31.
80. , ..
: .
. - .-. / .. . , 1993. 51 .
81. , ..
/ .. // .
, 1961. . 82-98.
82. , .. , / .. // . .-.
- - /. 1952. . 9. . 192202.
83. , .. / .. //
. , 1961. . 24-27.
84. , .., ..
( )
/ .. , .. // XXXIII . . .
. . .,1982. . 5.
85. , .. / .. // . 1983.
11. . 47-57.
86. .. ()
, / .. //
. . V. 3. 1964.
87. , .. / .. . , 1979. . 3-12; 17.
88. .., .. / .. , .. // XXXIII
. . . . . ., 1982. . 9.
89. , . / . , . // . 2006. 5. . 34-35.
170

Copyright & A K-C

90. , ..
/ .. , .. // . 1974. 6. . 39-40.
91. , .. / .. // . 1981. 7. . 51-53.
92. , .. / .. // . 1984. 4. . 32-33.
93. , .. / ..
// . 1991. 5. . 11-16.
94. , ..
/ .. , ..
, .. , .. //
: - , 70- . , 2000.
95. , .. / .. , .. //
. , 1988. . 18-21.
96. , ..
/ .. , .. // . 2001. 383 .
97. , .. /
.. , .. // . : , 1972. 118 .
98. , .. / .. , .. , .. , .. // . 2006. 2. . 9-11.
99. , ..
/ .. // . ., 1949. . 29-38.
100. , .. / .. . .: , 1947. 223 .
101. , .. / .. , .. ,
.. // . , 1989. . 73-78.
102. , ..
XIX XX / .. . , 1999.
103. , ..
.-. / .. . ,
1960.
104. , .. / ..
// . . . . , 1969.
105. ..
XIX / .. // , 1925. 2. . 112; . 2001. 251(2622).
106. , ..
. 171

Copyright & A K-C

.-. // .. ,
.. . ., 1968.
107. , .. . / .. . // . 5.
1979.
108. , .. / .. . : , 1961.
109. , ..
/ .. // . . . 2. 1967.
110. , .. / .. // : . , 1968.
111. , .. / .. . , 1992.
112. , . // . .: , 1981.
113. , .. -
/ .. , .. , .. , .. // . 1986. 10. . 29-30.
114. . ., 1987. . 4-5.
115. , ..
/ .. , .. , .. , ..
// . 2000. 8. . 25-27.
116. , ..
// . - . 1940. 13. . 121-153.
117. , .. - : . . .-. : 06.02.01 / H.A. . (. .), 1998. 35 .
118. , .. / .. , ..
// . (. .): , 1999. 70 .
119. , .. / .. , .. //
. . 1997. 2. . 62-64.
120. , .. / .. // . 1966. 5. . 37-46.
121. , .. / .. // .
. ., 1971. . 35-48.
122. , ..
: . .
. .-. / .. // , 1970. 25 .
123. , .. /
.. // .-. . 1970. 1. . 127-129.
172

Copyright & A K-C

124. , .. .-.
/ .. // . 1958. 7. . 6-12.
125. , .. / ..
// . ,
1995. . 32-36.
126. , .. : . - .-. / .. . , 1973. . 1.
127. , .. / .. ,
.. , .. // . .: ,
1997. 828 .
128. , .. BoLA-DRB3
- / .. , ..
, .. , . , . , .. //
. .-. . . 2008. 3 .
129. , .. - .
- / .. . ., 1968.
130. , .. -
(Bovinae) (TTAGGG)4 /
.. , .. , .. // . 1999. . 34. . 1-3.
131. , ..
/ .. , .. , .. // : . . . . ., 2001. . 184-189.
132. , .. / .. , .. //
. 2008. 8. . 8-11.
133. , .. / .. . .:
, 1970.
134. , .. , / .. , .. , . // . 1982. . 18,
2. . 306-312.
135. , .. -
/ .. // : . .: , 2006. . 138-166.
136. , .. - BoLA-DRB3 / ..
, .. , .. , .. // . 1995. . 31.
9. C. 1294-1299.
137. , .. :
/ .. . .:
, 1993.
138. , .. - 173

Copyright & A K-C

, BoLA-DRB3 / ..
, .. , .. . // . 2003. . 39. 3. C.
383-396.
139. , ..
: . . . . .; , 1982. 153 .
140. , .. - / .. , .. , .. , .. // . 2007. 6. . 5-6.
141. , .. : , , / .. . ., 2010. 220 .
142. , .. -
: . . . . .; , 1984, 1984.
145 .
143. , ..
: . . - .-.
. (. .), 1992. 50 .
144. , ..
/ .. , .. , .. . , 2008.
145. , .. / .. . , , 1985.
146. Ajmone-Marsan P., Negrini R., Milanesi E., et al. Genetic distances
within and across cattle breeds as indicated by biallelic AFLP markers // Anim.
Genet. 2002. Vol. 33. P. 280-286.
147. Alves B.C., Unanian M.M., Silva E. et al. Use of RAPD markers for identifying Nelore bulls with early reproductive maturation onset // Anim. Reprod. Sci.
2005. Vol. 85. P. 183-191.
148. Antoniou E., Skidmore C.J. A bovine Y-specific marker amplified by
RAPD // Anim. Genet. 1995. Vol. 26. P. 444-445.
149. Alizadeh Z., Karrow N., Mallard B. N. Biological effect of varying peptide binding affinity to the BoLA-DRB3*2703 allele // Genet. Sel. Evol. 2003. V.
150. Avon L. Methodes de guestion des petites populations: Le cas des rases
bovines a tres petits effectitifs // Ethnozootechnie. 1983. N 33. P. 63-69.
151. Beilharz R.G. Conservation of animal genetic resources // Domestication,
conservation and use of animal resources. Amsterdam etc.: FAO, 1983. P. 93-105.
152. Bodo I. Principles in use of live animals // Animal genetic resources:
Strategies for improved use and conservation. Rome: FAO / UNEP, 1987. P.191198/
153. Bodo I., Methods and experiences with in situ preservation of farm animals: Manuscript of the Department of Animal Husbandry University of Veterinary Science. Budapest. 1989. 29p.
154. Bodo I., vacs C., Seregi J. Die Anwendung einiger spezieller Methoden der Genkonservierung in Ungrand // Wien. tierarztl. Wochenschr. 1989. Bd.
76, N 9. S.23-29.
174

Copyright & A K-C

155. Bowman J.C. Conservation of rare livestock breeds in United Kingdom //


I
World congr. On genetics applied to livestock production. Madrid, 1974. P.
23-29.
156. Brem G., Graf F., Krausslich H. Genetic and economic differences
among
methods of gene conservation in farm animals // Livestock Prod. Sci.
1984. Vol. 11, N 1. P. 65-68.
157. Chevalet C., De Rochambeau H. Predicting the genetic drift in small
populations // Livestock Prod. Sci. 1985.Vol. 13, N 3. P. 207-208.
158. Brem G., Graf F., Krausslich H. Genetic and economic differences among
methods of gene conservation in farm animals // Livestock Prod. Sci. 1984. Vol.
11, N 1. P. 65-68.
159. Chrenek P., Vasicek D., Bauerovf M., Bulla J. Simultaneous analysis of
bovine growth hormone and prolactin alleles by multiplex PCR and RFLP //
Czech J. Anim. Sci. 1998. Vol. 43. P. 53-55.
160. Crittenden L.B., Bitgood J.J., Burt D.W., et al. Nomenclature for naming
loci, alleles, linkage groups, and chromosomes to be used in poultry genome publications and databases // Genet. Select. Evol. 1996. N 28. P. 289-297.
161. Cuenca C. Luisde Herencia patologia en la conservation del patrimonio
genetiko // Zootechnia. 1983. Vol. 32, N 1/3, P. 11-18.
162. Cunningham E.P. Present and future perspectives in animal breeding research // XV Intern. cong. genet., New Delhi, Dec. 12-21. New Delhi; Oxford,
1983. P. 112-114.
163. De Rochambeau H. Methodes de guestion des petites populations // Ethnozootechnie. 1983. N 33. P. 55-61.
164. Dragunesku C. Ratiun si procedure penru conservarea materialului de
genetic la animalele domestic // Rev. cresteria anim. 1975. N 3. P. 25-30.
165. Freeman A.R., Meghen C.M., Machugh D.E. et al. Admixture and diversity in West African cattle populations // Mol. Ecol. 2004. Vol. 13. P. 3477-3487.
166. FAO. Animal genetics resources conservation and management. Rome:
FAO, 1981. 388p. (Anim. Prod. and Health Pap. N 24).
167. FAO/UNEP. Animal genetic resources conservation by management data
banks and training. Rome: FAO/UNEP, 1984. 185p.
168. FAO/UNEP. Joint expert panel on animal genetics resources conservation
and management // Animal genetic resources: Strategies for improved use and
conservation. Rome: FAO/UNEP, 1987. P. 301-303.
169. Gwakisa P.S., Kemp S.J., Teale A.J. Characterization of Zebu cattle
breeds in Tanzania using random amplified polymorphic DNA markers. // Anim.
Genet. 1994. Vol. 25. P. 89-94.
170. Hodjes J. Conservation of animal genetic resources in developing countries // Genetic conservation of domestic livestock / Ed. L.: CAB, 1990. P. 128145.
171. Henderson D., Milt ., Yang Da. Conference review: Bovine genomics
from academia to industry // Comp. Funct. Genom. 2005. Vol. 6. 174-180.
175

Copyright & A K-C

172. Kantanen J., Vikki J., Elo K., Maki-Tanila A. Random amplified polymorphic DNA in cattle and sheep: Application for detecting genetic variation //
Anim. Genet. 1995. Vol. 26. P. 315-320.
173. Kulberg S., Heringstad B., Guttersrud O.A., Olsaker I. Study on the association of BoLA-DRB3.2 alleles with clinical mastiitis in Norvegian Red cows //
J. Anim. Breed. Genet. 2007. V. 124. P. 201207. 7.
174. Maillard J.C., Martinez D., Bensaid A. An amino acid sequence coded by
exon 2 of the BoLA-DRB3 gene associated with a BoLA class I specificity constitutes a likely genetic marker of resistance to dermatophiloses in Brahman zebu
cattle of Martinique (FWI) // Ann. N.Y. Acad. Sci. 1996. V. 791. P. 185197.
175. Lagziel A., De Nise S., Hanotte O. et al. Geographic and breed distribution of an Mspl PCR-RFLP in the bovine growth hormone (bGH) gene // Anim.
Genet. 2000. Vol. 31. P. 210-213.
176. Lagziel A., Lipkin E., Seller M. Association between SSCP haplotypes at
the bovine growth hormone gene and milk protein percentage // Genetics. 1996.
Vol. 142. P. 945-951.
177. Li G.H., Liu W.S., Takasuga A. et al. Characterization and RH mapping
of bovine microsatellites generated from a microdissected BTA20-specific DNA
library // Anim. Genet. 2005. Vol. 36. P. 146-151.
178. Mohammad Abadi M.R., Kovalenko T.A., Nassiri M.R., Sulimova G.E.
Inter-simple-sequence repeat (ISSR)-PCR for the identification of polymorphism
in some native cattle breeds // Proc. of the 3rd Moscow Intern. Congr.: Biotehnology: state of the art and prospects of development. Moscow, 2005. Vol. 1. P. 282.
179. Lamb M.A., Tess M.W. Evaluation of crossbreeding systems for small
beef herds: Twosire systems // J. Anim. Sci. 1989. Vol. 67. P. 40-47.
180. Laurans R. La probleme de la conservation du material genetique en
France // I World congr. on genetics applied to livestock production. Madrid,
1974. P. 75-84.
181. Maijala K. Conservation of animals in general // I World congr. on genetics. applied to livestock production. Madrid, 1974. P. 37-46.
182. Maijala K. Possible role of animal gene resource in production, natural
environment, conservation // Animal genetic resources: Strategies for improved
use and conservation. Rome: FAO/UNEP, 1987. P. 205-216.
183. Maijala K., Cherekaev A.V., Devillard J.-M. et al. Conservation of animal
genetic resources in Europe // Final Rep. EAAP. 1984. Vol. 11. P. 3-22.
184. Mason I.L. Introduction to round table A: the conservation of animal genetic resources // I World congr. on genetics applied to livestock production.
Madrid, 1974. P. 13-21.
185. Mohammad Abadi M.R., Sulimova G.E. Diversity and gene frequencies
of bovine lymphocyte antigene DRB3. 2 lokus in Mongolian cattle // Cell. And
Mol. Biol. Lett. 2004. Vol. 9, supple. 2. P. 42.
186. Nei M. Genetic distances between populations // Amer. Natur. 1972. Vol.
106. P. 283-292.
187. Nei M. Estimation of average heterozygosity and genetic distance from a
small number of individuals // Genetics. 1978. Vol. 89. P. 583-590.
176

Copyright & A K-C

188. Nijman I.J., Otsen M., Verkaar E.L. et.al. Hybridization of banteng (Bos
javanicus) and zebu (Bos indicus) revealed by mitochondrial DNA, satellite DNA,
AFLP and microsatellites // Heredity. 2003. Vol. 90. P. 10-16.
189. Nagarcenkar R. Model progeny testing program for draught in the Hariane breed // Animal genetic resources information. Rome: FAO/UNEP, 1983. N.
1. P. 29-30.
190. Ouyeo J., Lee J.Y., Kim J.W. DNA marker mining of ILSTS035 microsatellite locus on chromosome 6 of Hanwoo cattle // J. Genet. 2005. Vol. 83. P. 245250.
191. Polge C. New biological techniques for conservation of animal resources
in animal genetic resources conservation and management // FAO Anim. Prod.
And Health Pap. 1981. Vol. 24. P. 289-293.
192. Robertson A. A theory of limits in artificial selection // Proc. Roy. Soc.
London. B. 1960.Vol. 153. P. 234.
193. Senner G. Inbreeding depression and the survival of zoo populations //
Conservation biology / Ed. V. Soule, B. Wilcox. Massachusetts, 1980. P. 151-169.
194. Sivarjasingam S. Improvement and conservation of buffalo genetic resources in Asia // Animal genetic resources: Strategies for improved use and conservation. Rome: FAO, 1987, P. 55-74.
195. Smith C. Economic benefits of conserving animal genetic resources //
FAO Anim. Prod. and Health Pap. 1984. Vol. 44(1), N 3. P. 21-30.
196. Takeshima S., Ikegami M., Morita M. et.al. Identification of new cattle
BoLA-DRB3 alleles by sequence-based typing // Immunogenetics. 2001. Vol. 53.
P. 74-81.
197. Tsuji S., Itoh K., Sasazaki S. et.al. An association study using AFLP
markers and application to a beef cattle breeding population // Anim. Genet. 2004/
Vol. 35. P. 40-43.
198. Verkaar E.L., Nijman I.J., Beeke M. Metrnal and paternal lineages in
cross-breeding bovine species. Has wisent s hybrid origin // Mol. Biol. Evol. 2004.
Vol. 21. P. 1165-1170.
199. Wright S. Mendelian analysis of the pure breeds of livestock. 1. The
measurement of inbreeding and relationship. // J. Heredity. 1923. Vol. 14. P. 339348.
200. Wilkie B.N. et al. Associations of the bovine major histocompatibility
complex DRB3 (BoLA_DRB3) alleles with occurrence of disease and milk somatic cell score in Canadian dairy cattle // Anim. Genet. 1998. V. 29. P. 185193.
201. Xu A., van Eijk M.J.T., Park C., Lewin H.A. Polymorphism in BoLADRB3 exon 2 correlates with resistance to persistent lymphocytosis caused by Bovine Leukemia virus // J. Immunol. 1993. V. 151. 12. P. 69776985.
202. Yamada Y., Kimura K. Survival probability in small livestock populations // Animal genetic resources conservation and management by data banks and
training. Rome: FAO, 1984. P. 105-110.

177

Copyright & A K-C

24.10.12. 6084/16.
. . 1. . . . 10,46.
100 . 1873.
.
358000 , . , 11

178