Вы находитесь на странице: 1из 14

Tema 25: Los cidos nucleicos.

Replicacin y
transcripcin.
Contenidos del tema.
1. Introduccin.
2. Composicin qumica de los cidos nucleicos.
3. ADN.
3.1. Localizacin del ADN.
3.2. Estructura del ADN.
3.2.1. Primaria.
3.2.2. Secundaria.
3.2.3. Terciaria.
3.2.4. Cuaternaria.
3.2.5. Niveles superiores de empaquetamiento.
3.3. Funciones del ADN.
4. ARN
3.1. Localizacin, estructura y funcin.
3.2. Tipos de ARN.
3.2.1. ARNm
3.2.2. ARNt
3.2.3. ARNr
3.2.4. ARNn
3.2.5. ARNv
5. cidos nucleicos de mitocondrias y plastos.
6. La replicacin del ADN.
6.1. Generalidades.
6.2. Importancia biolgica de la replicacin.
6.3. Mecanismo de la replicacin.
6.3.1. Iniciacin.
6.3.2. Elongacin.
6.3.3. Terminacin.
7. Diferencias en la replicacin de procariotas y eucariotas.
8. Transcripcin.
8.1. Importancia biolgica de la transcripcin.
8.2. Mecanismo de la transcripcin.
8.2.1. Iniciacin.
8.2.2. Elongacin.
8.2.3. Terminacin.
9. Diferencias entre la transcripcin de procariotas y eucariotas.

Rubn del Pozo Fernndez

1. Introduccin.
Los cidos nucleicos son molculas extremadamente importantes
para los seres vivos ya que son las portadoras de la herencia. Su
descubrimiento y estudio en profundidad ha permitido ahondar en el
conocimiento del origen, la evolucin y el funcionamiento de los
seres vivos. En el presente tema se abordan las caractersticas ms
importantes de los cidos nucleicos as como los procesos que
permiten duplicarlo antes de l divisin celular y el primer paso en la
expresin de los genes en protenas.
2. Composicin qumica de los cidos nucleicos.
Los cidos nucleicos son en s mismo un tipo de biomolculas
orgnicas. Su estudio qumico nos permite distinguir tres
componentes fundamentales en todos los cidos nucleicos:

Un monosacrido de 5 tomos de carbono: pentosa. Esta


pentosa puede ser la Ribosa o la desoxirribosa.

Una base nitrogenada.La base nitrogenada puede ser prica,


si es derivada de la purina como la Adenina (A) o Guanina (G)
o pirimidnica, si es derivada de la pirimidina como la Citosina
(C), Timina (T) o Uracilo (U).

Un cido ortofosfrico (H3PO4)

La unin de la pentosa (por su carbono 1) a la base nitrogenada (por


su grupo NH) da lugar a un NUCLESIDO.
La unin de un nuclesido (por el carbono 5 de la pentosa) al cido
ortofosfrico (por un grupo OH) forma el NUCLETIDO.
Los nucletidos pueden unirse entre s a travs del carbono 3 de la
pentosa y el grupo fosfato situado en el carbono 5. Dicha unin
formar un dinucletido que al unirse a ms nucletidos formarn
cadenas de nucletidos o POLINUCLETIDO. Dicha unin se realiza
mediante un enlace fosfodister.
El encadenamiento de los nucletidos entre s siempre se hace
mediante el grupo fosfato situado en el carbono 5 de un nucletido
con el carbono 3 de la pentosa de otro nucletido. De esta manera
se establecen dos referencias dentro de la cadena de nucletidos, el
carbono 3del nucletido de un extremo y el carbono 5del
nucletido del otro extremo. Esto se conoce como extremos 3y
extremo 5.
3. ADN.

Rubn del Pozo Fernndez

El ADN son las siglas del cido Desoxirribonucleico. Dicha molcula


presenta siempre Desoxirribosa como pentosa y Adenina, Guanina,
Citosina y Timina como bases nitrogenadas.
3.1. Localizacin del ADN.
El ADN puede presentar diversas localizaciones en los seres vivos.
Algunos virus lo presentan como material gentico en el interior de
su cpside. Los procariotas lo presentan libre en el citoplasma y el
eucariotas tienen abundante ADN en el interior del ncleo as como
en las mitocondrias y plastos en pequeas cantidades.
3.2. Estructura del ADN.
Como ocurre con otras biomolculas como las protenas, el ADN es
una molcula polimrica que generalmente presenta distintos
niveles de complejidad en su estructura y que se explican a
continuacin. No obstante hay que resaltar que en algunas
estructuras biolgicas el ADN puede presentarse formando una sola
cadena o dos y tambin puede encontrarse en forma lineal o
circular.
3.2.1. Primaria.
La estructura primaria del ADN es la ms sencilla y est compuesta
por la secuencia lineal y ordenada de los nucletidos que lo forman.
3.2.2. Secundaria.
La estructura secundaria representa la disposicin espacial de las
dos cadenas de nucletidos complementarias que forman la
molcula de ADN.
En 1953 James Watson y Francis Crick propusieron el "modelo de la
doble hlice" basado en las evidencias qumicas acumuladas hasta
entonces y en el anlisis de los diagramas de difraccin de rayos X
efectuados por Rosalind Franklin. Este modelo cientfico les supuso
el Premio Nobel en Medicina y fisiologa en 1962.
Dicha configuracin conocida actualmente tambin como "Modelo
B" presenta los siguientes postulados:
1. El ADN es una doble hlice, formada por dos cadenas de
polinucletidos enrolladas alrededor de un eje imaginario
con 2,37 nm de dimetro.
2. Ambas cadenas seran antiparalelas, una ira en sentido
3'-5' y la otra en sentido inverso, 5' -3'.

Rubn del Pozo Fernndez

3. Cada pareja de nucletidos est separada de la


siguiente por una distancia de 3,4 A (Amstrongs). (10 A
= 1 nm)
4. Cada vuelta de la doble hlice implica a 10 nucletidos
(por tanto una vuelta supone 34 A (3,4 nm de longitud).
5. Los grupos fosfato estaran hacia el exterior y de este
modo sus cargas negativas interaccionaran con los cationes
presentes en el nucleoplasma dando ms estabilidad a la
molcula.
6. Las bases nitrogenadas estaran hacia el interior de la
hlice con sus planos paralelos entre s y las bases de cada
una de las hlices estaran apareadas con las de la otra
asocindose mediante puentes de hidrgeno.
7. El apareamiento se realizara nicamente entre la adenina y la
timina, por una parte, y la guanina Y la citosina, por otra. Por
lo tanto, la estructura primaria de una cadena estara
determinada por la de la otra. Ambas cadenas seran
complementarias.
3.2.3. Terciaria.
Las grandes molculas de ADN del ncleo de las clulas eucariotas
estn muy empaquetadas ocupando as menos espacio.

Collar de perlas:

El ADN se encuentra en el ncleo de clulas eucariticas somticas


en reposo, asociado a ciertas protenas: nucleoprotenas,
formando la cromatina. En la cromatina, la doble hlice de ADN se
enrolla alrededor de unas molculas proteicas globulares, las
histonas, formando los nucleosomas.
Cada nucleosoma contiene 8 histonas (octmero) y la doble hlice
de ADN da dos vueltas a su alrededor (implicando 200 pares de
bases). Esta cantidad de bases tendra, sin nucleosoma, unos 68
nm de longitud pero al formarse esta estructura se reduce esta
distancia hasta 10 nm. Por tanto consigue disminuir la longitud del
ADN ms de seis veces. El conjunto forma una estructura llamada
collar de perlas.

La estructura cristalina:

Se da en los ncleos de las clulas eucariotas reproductoras, el ADN


se asocia a protaminas, unas protenas ms pequeas y bsicas
que las histonas que llegan a constituir el 50% de la estructura.

Rubn del Pozo Fernndez

3.2.4. Cuaternaria.
Es la que adopta el ADN con estructura terciara al replegarse sobre
s mismo, lo que origina la fibra de 30 nm (300 A) al ser observada
con el microscopio electrnico.
Para explicar la estructura interna de esta fibra se recurre al
modelo del Solenoide segn el cual las fibras se forman al
enrollarse seis nucleosomas por vuelta alrededor de un eje formado
por las histonas.
3.2.5. Niveles superiores de empaquetamiento.
Los siguientes niveles de empaquetamiento no estn an aclarados
del todo pero, parece ser, que cada fibra de 30nm se volvera a
enrollar formando un bucle (cada bucle tendra 50 millones de
pares de bases), seis bucles se empaquetaran producindose un
rosetn, 30 rosetones formaran una espiral y 10 espirales
formaran una cromtida. La unin de 2 cromtidas daran lugar a
un cromosoma.
3.3. Funciones del ADN.

El ADN acta como portador de la informacin gentica


hereditaria, tanto en eucariotas como en procariotas, siendo
una de las pocas molculas con la misma funcin e especies
diferentes.

El ADN es capaz de codificar una gran cantidad de informacin


biolgica y el grado de compactacin de dicha informacin es
asombroso.

El ADN es la molcula que en ltimo trmino controla, a travs


de la sntesis proteica, cada aspecto de la funcin celular.

Adems de regular la funcin celular el ADN puede controlar


su autorreplicacin, lo que permite hacer copias de si mismo y
que se tratar en el punto 6 de este tema.

4. ARN
El ARN o cido ribonucleico es el cido nucleico formado por Ribosa
como pentosa y Adenina, Guanina, Citosina y Uracilo como bases
nitrogenadas.
4.1. Localizacin, estructura y funcin.

Rubn del Pozo Fernndez

El ARN se localiza en todos los virus de las plantas, en las clulas


eucariotas y procariotas.
El ARN es casi siempre monocatenario, esto es, formado por una
sola cadena, a excepcin de algunos virus (reovirus ) que son de
dble hlice. El ARN puede ser portador de informacin gentica en
su secuencia de bases, sirviendo de genoma en virus y reovirus.
4.2. Tipos de ARN.
Segn la estructura, el lugar donde se encuentra y la funcin que
realiza distinguimos los siguientes tipos:
4.2.1. ARN mensajero ARNm
Solo presenta estructura primaria. Presenta una vida muy corta (no
ms de 40 minutos). Representa un 10% del total. Su funcin es
transportar la informacin contenida en un gen hasta el ribosoma
donde se fabricar la protena o protenas
que codifica. En
Eucariotas presenta modificaciones que consisten en un extremo 5
cap que evita la degradacin y favorece la traduccin y un extremo
3poli A, que lo protege de la degradacin y favorece el transporte y
la traduccin.
4.2.2. ARN transferente ARNt
Presenta una estructura secundaria con forma de hoja de trbol
gracias a la existencia de regiones complementarias dentro de la
misma cadena que favorece la formacin de tres bucles por
autohibridacin.
En uno de los tres brazos presenta una secuencia de tres
nucletidos denominada anticodn que es complementaria al codn
presente en el ARNm y especfica para el aminocido que
transporta.
Es el encargado de transportar los aminocidos desde el citoplasma
hasta el ribosoma donde se encuentra el ARNm. All se formar la
cadena polipeptdica.
4.2.3. ARN ribosmico ARNr
Son los componentes principales de los ribosomas y constituyen
hasta el 65% de su peso. Presentan una estructura secundaria y se
encuentran unidas a protenas ribosmicas.
4.2.4. ARN nucleolar ARNn

Rubn del Pozo Fernndez

El ARNn se origina a partir de diversas secuencias del ADN (regin


organizadora nucleolar) . Dicho ARNn forma el nucleolo celular y es
el lugar donde se forma un ARNr que se escinde en tres y junto con
las proteinas ribosmicas (que llegan del citoplasma) forman los
ribosomas celulares.
4.2.5. ARNv
5. cidos nucleicos de mitocondrias y plastos.
Las mitocondrias contienen ADN en la matriz. En el caso del ADN
humano se sabe que es una molcula circular de unos 16.569 pares
de bases con informacin para sintetizar 13 protenas y ARN
mitocondriales.
En los plastos tambin existe ADN en el estroma pero se conoce
peor, aunque se sabe que es mucho mayor que el mitocondrial,
unos 100.000 pb y que existen varias copias en cada orgnulo.
Que ambos orgnulos tengan ADN de aspecto procariota apoya la
teora de Margulis sobre el origen endosimbitico de los eucariontes.
6. La replicacin del ADN.
La replicacion o duplicacin del ADN es un proceso clave en el ciclo
celular, imprescindible para que se realice la divisin celular, este
proceso ocurre en la fase S de la Interfase.
6.1. Generalidades.
El ADN es una molcula formada por dos cadenas complementarias
y antiparalelas. Una de las primeras dudas que se plantearon fue la
de cmo se replicaba el ADN. A este respecto haba tres hiptesis:
1 hiptesis: El ADN se replica de manera conservativa. Cada
doble cadena de ADN forma una copia completa y una clula hija
recibe la molcula original y la otra la copia.
2 hiptesis: El ADN se replica de manera semiconservativa.
Cada hebra de ADN forma una hebra complementaria y cada clula
hija recibe, por lo tanto, una molcula de ADN que consta de una
cadena original y de su complementaria sintetizada de nuevo.
3 hiptesis: El ADN se replica de manera dispersiva. Cada una
de las cadenas hijas contiene fragmentos de la cadena original y
fragmentos de nueva sntesis.

Rubn del Pozo Fernndez

Esta controversia fue resuelta por MESELSON y STAHL en 1957


con una serie de experiencias y que proponan un modelo de
acuerdo con la hiptesis de sntesis semiconservativa.
6.2. Importancia biolgica de la replicacin.
Cuando una clula se divide, da lugar a dos nuevas clulas que
deben contener la informacin gentica que les permita sintetizar
todas las enzimas y el resto de las protenas necesarias para realizar
sus funciones vitales. sta es la principal razn por la que el ADN
debe replicarse o duplicarse previamente, para que no se pierda
informacin y es lo que le da sentido biolgico de este proceso.
6.3. Mecanismo de la replicacin.
Hoy en da, basndose sobre todo en las experiencias realizadas en
procariotas, se ha desentraado, en gran parte, la secuencia de
reacciones que conducen a la replicacin del ADN. El proceso que se
describe a continuacin es el de los procariotas (Bacteria E. coli).
El proceso de replicacin del ADN se divide en tres etapas:
1. Iniciacin.
2. Elongacin.
3. Terminacin.
6.3.1. Iniciacin.
Consiste bsicamente, en el desenrollamiento y apertura de la doble
hlice.
Se inicia en una regin del ADN llamada OriC o punto de iniciacin.
Es una zona formada por unos 245 pares de bases donde abundan
las secuencias de bases GATC.
Durante la fase de iniciacin se producen varios acontecimientos:

El punto de iniciacin es reconocido por unas protenas


especficas que se unen a l. Las enzimas HELICASAS rompen
los enlaces de hidrgeno entre las bases nitrogenadas y la
doble hlice se abre como si se tratase de una cremallera.

Cuando la doble hlice se


abre se produce el
desenrollamiento de esa zona, lo que crea en las zonas
prximas unas tensiones que podran provocar un mayor
enrollamiento. La accin de otras enzimas, las GIRASAS y las
TOPOISOMERASAS, evita esas tensiones rompiendo y
soldando de nuevo la hlice del ADN en esos puntos.

Las protenas SSB (Single Strand Binding-DNA: protenas de


unin a la cadena sencilla) se unen a las hebras moldes e

Rubn del Pozo Fernndez

impiden que se vuelva a enrollar. Dejan libre la parte interna


de la hebra que lleva las bases, de modo que estas sean
accesibles para otras molculas.
En esta etapa, en el lugar de origen de la replicacin (alrededor del
OriC) se ha formado una burbuja de replicacin en la que hay dos
zonas, con forma de Y, denominadas
HORQUILLAS O DE
REPLICACIN, donde se van a sintetizar las nuevas hebras de ADN.
La burbuja de replicacin se va extendiendo a lo largo del
cromosoma en los dos sentidos, de ah que se diga que la
replicacin es bidireccional.
6.3.2. Elongacin.
Es la fase en la que se sintetiza una nueva hebra de ADN sobre cada
hebra de la doble hlice original.
En la elongacin de los procariotas intervienen tres tipos de enzimas
llamadas ADN polimerasas (tipos I, II y III).
Las ADN polimerasas I (primera en ser descubierta) y III participan
en la replicacin del ADN, mientras que la II tiene un papel poco
conocido todava.
Todas las ADN polimerasas presentan una funcin doble:
1. Actividad polimerasa.
Unen entre s los nucletidos que forman el ADN.
2. Actividad exonucleasa.
Eliminan nucletidos, cuyas bases nitrogenadas estn mal
apareadas, as como los fragmentos de ARN necesarios para
comenzar a duplicar el ADN (cebadores).
Con las hebras de ADN separadas, las ADN polimerasas no pueden
iniciar de cero la sntesis de una nueva cadena de ADN
(actividad polimerasa).
Para comenzar su actividad las polimerasas cecesitan un fragmento
de unos diez nucletidos de ARN, denominado CEBADOR o
PRIMER.
Este fragmento de ARN aportar un extremo 3 donde queda libre
un grupo hidroxilo (OH) a partir del cual las polimerasas van a
aadir los nuevos nucletidos de ADN.
El cebador es sintetizado por una ARN POLIMERASA llamada
PRIMASA.

Rubn del Pozo Fernndez

Una vez comenzada la sntesis, la propia cadena de ADN que se est


sintetizando acta como cebador para las polimerasas ya que van
aadiendo nucletidos que dejan un extremo 3 libre.
Como las dos cadenas del ADN son antiparalelas, cuando se
forma la horquilla de replicacin la ADN polimerasa solo
puede sintetizar nucletidos en uno de los sentidos (solo
puede aadir nucletidos complementarios en la cadena 53).

La sntesis de la nueva hebra sobre la cadena molde 3- 5se


realiza sin interrupciones. A la hebra que se forma sobre ella
se
le
denomina
CADENA
ADELANTADA,
HEBRA
CONDUCTORA o LDER.

El mecanismo de sntesis de la hebra sobre la cadena molde 5


- 3 (la nueva hebra es la HEBRA RETARDADA) fue
descubierto en 1973 por R. Okazaki. Dicho mecanismo
consiste en una sntesis discontinua de pequeos fragmentos
de ADN de unos mil nucletidos (fragmentos de Okazaki).

Cada uno de los fragmentos requiere un cebador de ARN sintetizado


por la PRIMASA cada ciertos intervalos. La ADN polimerasa III se
encarga de ir elongando la cadena de ADN (en sentido polimerasa 5
- 3)
La ADN polimerasa I es la que se encarga de ir eliminando el
cebador y sustituyndolo por ADN.
Finalmente la LIGASA une todos los fragmentos obtenidos en la
hebra retardada.
6.3.3. Terminacin.

Rubn del Pozo Fernndez

Como el ADN de las bacterias es circular, el final de la


replicacin se produce cuando la ADN polimerasa III se encuentra
con el cebador inicial situado cerca del origen de replicacin.
7. Diferencias en la replicacin de procariotas y eucariotas.
La replicacin del material gentico en procariontes es muy
parecida a la que se produce en eucariontes.
Las principales diferencias son:
1. Los cromosomas de los eucariontes contienen molculas de
ADN muy largas, por lo que para abreviar el proceso, la
replicacin se inicia de manera simultnea en varios puntos
de cada cromosoma denominados REPLICONES. Los
eucariotas tienen miles de puntos de origen de replicacin
mientras que los procariotas tienen uno solo.
2. En eucariotas existen cinco tipos de DNA polimerasa en
procariotas tres.
3. Los cromosomas de eucariontes poseen histonas asociadas al
ADN (esto no ocurre en procariontes), estas protenas se
sintetizan durante la replicacin y se van uniendo a la doble
hlice que se va formando junto a la hebra retardada.
4. En eucariotas el proceso de elongacin se completa
normalmente hasta llegar al extremo del cromosoma, EL
TELMERO. Cuando se elimina el ltimo cebador la hebra
queda incompleta ya que la ADN polimerasa no puede rellenar
el hueco (es incapaz de incorporar nucletidos en el sentido 3
- 5). Esto es un problema para la clula ya que el extremo 3
protuberante de cada cadena no puede ser replicado por las
DNA polimerasas celulares. Un enzima denominado
Telomerasa aade secuencias repetidas a los extremos
cromosmicos. La adicin de estas secuencias cortas que
lleva a cabo la Telomerasa contrarresta la tendencia
al acortamiento de los telmeros durante la replicacin
normal.
8.2. Mecanismo de la transcripcin.
En 1955, el mdico y bioqumico espaol Severo Ochoa de Albornoz
descubri y aisl una enzima de la bacteria Escherichia coli que
llam polinucletido-fosforilasa
y que posteriormente fue
identificada como la enzima responsable de la sntesis de ARN: la
ARN polimeras.
Elementos necesarios

Rubn del Pozo Fernndez

La sntesis del ARN o transcripcin ocurre en el interior del ncleo,


para ello se requiere:

Una cadena de ADN que acte como molde. De las dos


cadenas de nucletidos que forman el gen, solo una, la
denominada cadena molde, se transcribe realmente, mientras
que la otra, llamada informativa, no lo hace.

Enzimas. EL proceso est catalizado por la ARN polimerasa.


En los procariontes solo existe una (constituida por cinco
subunidades), mientras que en los eucariontes existen tres,
llamadas ARN polimerasas I, II y III. La I intervendra en la
sntesis de ARNr, la II intervendra en la sntesis de ARNm, y la
III intervendra en la sntesis de ARNt principalmente (tambin
el ARNr de pequeo tamao).

Ribonucletidos trifosfato de A, G, C y U. Estos se unen


mediante enlace ster entre el cido fosfrico situado en
posicin 5 de un ribonucletido y el grupo OH situado en
posicin 3del ltimo ribonucletido de la cadena de ARN en
formacin. Estn libres en el nucleoplasma y citoplasma
celular.

La transcripcin consta de tres etapas:


Iniciacin.
elongacin.
Terminacin.
8.2.1. Iniciacin.

Comienza cuando la ARN polimerasa se une inespecficamente


al ADN y lo recorre hasta que reconoce en el ADN las
secuencias consenso de los promotores (en ellos
encontramos las secuencias consenso: para procariotas:
TTGACA y TATAAT).
Las secuencias consenso se encuentran en los promotores a
35 y 10 pares de bases (pb) de la primera base en ser
transcrita
(respectivamente)
TTGACATTTATATATATAAATAAAATATAATTAAATAAAATT
La ARN polimerasa se une al promotor especficamente y se
forma el complejo enzima-promotor cerrado.
A continuacin hace que la doble hlice de ADN se abra y se
forma el complejo promotor-enzima abierto.
Esto va a permitir que quede expuesta la secuencia de bases
del ADN y se puedan incorporar los ribonucletidos que se van
a unir.

Rubn del Pozo Fernndez

8.2.2. Elongacin.

Es
la
adicin
de
los
sucesivos
ribonucletidos
correspondientes para formar el ARN complementario al gen
que se quiere transcribir.
La ARN polimerasa avanza a lo largo de la cadena de ADN
leyndola en sentido 3- 5, mientras que el sentido de la
sntesis del ARN es 5- 3.
La enzima selecciona los nucletidos del nucleoplasma cuyas
bases son complementarias con las de la cadena de ADN que
acta como molde y los une (ATP, GTP, CTP o UTP). La energa
para el proceso se desprende de la formacin de un enlace
fosfodister con el siguiente nucletido, adems se libera un
grupo pirofosfato (PPi).
Al avanzar la ARNpol desenrrolla el ADN que tiene delante y
vuelve a enrollar el que acaba de transcribir.
El resultado es un ARN complementario a la cadena molde e
idntico a la otra hebra de ADN, salvo por el cambio de T por
U.

8.2.3. Terminacin.

Ocurre cuando la ARN polimerasa reconoce en el ADN unas


seales de terminacin que indican el final de la
transcripcin.
Esto implica el cierre de la burbuja formada en el ADN y la
separacin de la ARN polimerasa del ARN transcrito y del ADN.
La secuencia de terminacin en los procariotas suele ser una
secuencia palindrmica, igual en ambas hebras y simtrica.
por ejemplo CGGCCG y seguidas de varios AAAA. (Ejemplo:
CGGCCGAAAAAAA)

9. Diferencias entre la transcripcin de procariotas y eucariotas.


El ARNm de los procariontes puede ser directamente traducido y a
partir de l se forma una proteina funcional. No se puede hablar, por
tanto, de una maduracin de los ARN mensajeros en estos
organismos.
En los eucariotas la maduracin es compleja, ya que la mayora de
los genes que codifican para las protenas estn fragmentados.
Cada gen consta de varios fragmentos denominados intrones y
exones, intercalados unos con otros.

Los intrones son secuencias de bases ms o menos largas


que se transcriben, pero que no se traducen en aminocidos
cuando se forma la protenas.

Rubn del Pozo Fernndez

Los exones son las secuencias que se transcriben y s se


traducen, es decir tienen informacin para formar la cadena
polipeptdica.

As el ARN transcrito primario est formado por intrones y exones.


Su maduracin consiste en la eliminacin de los intrones y la unin
de los exones mediante un mecanismo conocido como SPLICING o
empalme.
Este proceso requiere la presencia de una enzima llamada
ribonucleoprotena pequea nuclear (RNPpn).
El proceso de splicing comienza cuando las secuencias intrnicas
forman unos bucles que provocan el acercamiento de los extremos
de los exones y contina con el corte de los intrones y la unin de
los exones, para formar un ARNm que ya est en condiciones de
salir del ncleo.
Los intrones no existen en procariontes y no se sabe qu funcin
tienen en los eucariontes. Lo que s se sabe es que, a veces, un
mismo gen puede madurar de diferentes maneras, dependiendo de
cmo se eliminen los intrones. De este modo, a partir de un solo gen
se pueden obtener distintas protenas.

Rubn del Pozo Fernndez

Похожие интересы