Вы находитесь на странице: 1из 50

Репликация ДНК

ori
Topoisomerase I
Процессивные хеликазы, участвующие в репликации ДНК

SV-40 T антиген (3’-5’ прцессивная хеликаза, денатурирующая ДНК


со скоростью 75 – 100 п.н./мин. Использует энергию
АТФ)

Низшие и высшие
эукариоты – MCM2-7 комплекс (3’-5’ процессивная хеликаза. Активируется
фосфорилированием. Испоьзует энергию АТФ

Каталитический центр

Участок связывания АТФ


Существует большая группа ДНК полимераз, которые замещают Polδ при необходимости
реплицировать цепь ДНК содержащие поврежденные основания (тимидиновые димера
апуриновые участки, 8-оксигуанин, 6-метил гуанин)

Pol-eta
Инициация репликации

Начинается ли репликация в строго определенных участках


генома?

Основные вопросы Существуют ли специфические последовательбности ДНК,


служащие местами инициации репликации?

Какие белковые факторы участвуют в инициации репликации?

Как именно происходит инициация репликации? (последовательность


событий)
Функциональные
изучение модельных систем, таких как вирусы и плазмиды,
автономно реплицирующиеся в эукариотических клетках

Создание бесклеточных систем, позволяющих воспроизвести


Экспериментальные
процесс инициации репликации
подходы
Структурные

Картирование участков репликации в клонированных областях генома


и изучение их организации
ARS элементы Saccharomyces cerevisiae

Cloning
site
Selective
marker cлучайные фрагменты
геномной ДНК
стабильный рост если
плазмида реплицируется

трансформация
дрожжевых клеток и
Selective высев на селективную среду
marker
нестабильный рост если
плазмида не реплицируется
ARS консенсус

ORC, Origin Recognition Complex


состоит из 6 белков с молекулярными
весами от 50 до 120 КД

ORC белки чрезвычайно консервативны


Они присутствуют в клетках как низших,
так и высших эукариот
Являются ли ARS участками начала репликации, работающими в геноме?
Картирование участка начала репликации с использованием двумерного
(нейтральный/щелочной) электрофореза по Хуберману

нейтральный

щелочной
Нейтральный двумерный электрофорез по Фангману
Анализ полярности синтеза фрагментов Оказаки
или лидирующих цепей ДНК
Все реально работающие участки начала репликации в хромосомах
Saccharomyces cerevisiae колокализуются c ARS элементами

Существует много ARS элементов, которые не работают в качестве


участков начала репликации в дрожжевых хромосомах
У высших эукариот наиболее подробно изучен участок начала репликации,
Расположенный в 3’ области гена DHFR
В 3’ концевой области гена DHFR имеется протяженная (50 Кb) зона, в любом участке
Которой может происходить инициация репликации
Вероятность инициации репликации наиболее высока в области ori β, β’ и γ
У высших эукариот поиски автономно реплицирующихся последовательностей
привели к очень невыразительным и противоречивым результатам

С весьма низкой эффективностью в эукариотических клетках реплицируется любая


плазмидная ДНК. Включение в эту ДНК эукариотических инсерций повышает эффективнось
репликации вне зависимости от последовательности ДНК. В то же время существует
позитивная корреляция между длиной инсерции и эффективностью автономной репликации

Существует проблема как отличить реплицировавшуюся ДНК от инпута. Эта проблема решается
посредством анализа включения бромодезоксиуридина, либо посредством анализа характера
метилирования
GATC

Dpn I режет только ДНК,


метилированную в клетках Е Coli

Mbo I режет только неметилированную


ДНК

Sau IIIA режет ДНК вне зависимости от


метилирования
В качестве модельных систем в течение многих лет изучались участки
начала репликации ДНК содержащих вирусов (SV-40, Polyoma)
Участок начала «латентной» репликации вируса EBV содержит два функционально
Важных района, один из которых содержит сайты связывания EBNA

Сайты связывания EBNA


Плазмиды, содержащие минимальный участок связывания EBV, могут
реплицироваться в ряде линий эукариотических клеток, экспрессирующих EBNA.
При этом репликация происходит один раз за цикл.
Область двойной симметрии (сайты связывания EBNA) служит местом посадки
ORC белков
Mcm2 также связан с областью двойной симметрии, причем количество связанного
Mcm2 зависит от стадии клеточного цикла.
Эксперименты по коиммунопреципитации демонстрируют, что ORC 1-3
взаимодействуют с EBNA
Плазмида, содержащая MAR
элемент и сильный промотор способна
автономно реплицироваться в течение
продолжительного времени, причем репликация
оказывается сопряжена с клеточным циклом
(1 раунд репликации за цикл)
В автономно-реплицирующейся плазмиде, содержащей MAR элемент и
сильный промотор, репликация начинается в случайном месте, и ORC может
связываться со всеми последовательностями
В качестве фукционального теста на активность ori анализируется способность
инициировать репликацию в эктопической позиции.

Не выявлено коротких специфических последовательностей ДНК, обеспечивающих


активность ori. Фактически место положение ori определяется предпочтительной
возможностью посадки комплекса ORC белков, что обеспечивается взаимодействием
целого ряда факторов, в том числе и локальной структуры хроматина
Ori β из локуса DHFR может работать в качестве репликатора в эктопических
позициях. Делеционный анилиз репликатора позволил выявить несколько
существенных элементов.

1. GGCC тетрануклеотид, локализованный


непосредственно в области начала репликации
(делеция или замена на GATC приводят к резкому
снижению активности репликатора

2. АТ- богатая последовательность (делеция или


замена на случайную последовательность приводят
к резкому снижению активности репликатора.

Однако, можно заменить эту АТ-богатую


последовательность на функциональный аналог
из участка начала репликации домена ламина B2
3. Перманентно изогнутая последовательность ДНК (делеция или замена на
последовательность, не способную образовывать изгиб, приводит к снижению
активности репликатора
4. Сайт связывания белка RIP60, усиливающего изгиб в ДНК
Участок начала репликации домена бета-глобиновых генов человека состоит
из двух независимых репликаторов, каждый их которых может работать в
эктопических позициях
Внутри каждого из двух репликаторов ori домена бета-глобиновых генов
имеются абсолютно необходимые участки
абсолютно необходимой для работы одного из двух репликаторов домена
бета-глобиновых генов является асимметричная пуриновая последовательность

AGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGTCAGGG

активный промотор β maj гена не нужен для работы репликатора


Все заключения, сделанные при анализе работы репликатора в эктопических
позициях подтвердились и при делеционном анализе репликатора в нормальной
хромосомной позиции в человеческой хромосоме 11 (в гибридных куриных клетках DT40)
Репликаторы позвоночных животных не имеют выраженной видовой
специфичности. Репликатор из генома человека работает в эктопических
позициях в геноме клеток китайского хомячка, и наоборот

PCR probes

клетки клетки
человека хомячка
Участок начала репликации локуса ламина В2 человека работает в качестве
репликатора в эктопических позициях. Для проявления активности репликатора
абсолютно необходима область, с которой связывается ORC (290 bp фрагмент ДНК,
защищенный белками от ДНказы). Замена этого участка на посторонний подавляет
активность репликатора.
Два АТ-богатых участка в пределах закрытой футпринтом области не существенны
для работы репликатора

Nucleotide substitutions in the in vivo-protected sequence do not abrogate the


replicator activity. (A) The in vivo-protected region (OPR) is indicated by a gray
line below the sequence (nucleotides 3900 to 4000) of the lamin B2 origin. The
replication start site (OBR) and two almost identical 12-mers (boxed sequences)
are indicated. The mutated sequence in eLamB2* is shown immediately under
the arrows.
Наличие CpG островка усиливает активность репликатора
В зоне инициации репликации локуса DHFR нет никаких абсолютно необходимых
для инициации репликации элементов последовательности ДНК
Для нормальной работы зоны инициации
репликации локуса DHFR необходим активный
промотор DHFR, а возможно и осуществление
транскрипции

нормальный локус DHFR

естественная делеция, убирающая 75 Кв фрагмент


ДНК, включающий промотор DHFR, первый экзон
и первый интрон гена DHFR

искусственная делеция 65 Kb перед генном DHFR


при сохранении промотора и короткой (1,9 Kb)
5’-концевой области

Участок начала репликации гена родопсина


(внутренний контроль)
можно заменить промотор на гетерологичный из клеток Дрозофилы
при этом инициация репликаци происходит нормально

собственный промотор
DHFR,

проба – ori β

промотор одного из
генов теплового шока
дрозофилы

проба – ori β
В клетках высших эукариот инициация репликации в принципе может происходить
где угодно.
В эмбриональных клетках (до стадии средней бластулы) и в экстрактах из клеток
ксенопуса инициация происходит через короткие интервалы (на молекуле ДНК) и
без всякой специфичности в отношении последовательностей

В неэмбриональных клетках сушествуют предпочтительные места инициации


которые могут быть достаточно короткими (репликатор домена бета-глобиновых
генов) и достаточно протяженными (зона инициации репликации локуса DHFR)

Короткие репликаторы характеризуются наличием ряда необходимых элементов


(АТ-богатые последовательности, полупуриновые/полипиримидиновые блоки,
изогнутые последовательности ДНК). Набор и сочетание этих этих элементов
могут быть разными в разных репликаторах.

Вопрос о том, нужна ли трансрипция близлежащих генов для активации


репликатора остается пока неясным. Принципиальным является доступность
сайта связывания ORC, которая может быть обеспечена разными способами
Этапы инициации репликации у эукариот

Сdc6 и Cdt1 необходимы для посадки MCM2-7 белков на связанный с ДНК МСМ 10

Сdc7 (Dbf4-зависимая киназа) фосфорилирует МСМ2 следствием чего является активация


латентной хеликазы

разрушение митотических регуляторов


при посредстве APC (Anaphase-Promoting-Complex)
повышение уровня Cdc6 и Cdt1
ORC цикл, исключающий возможность повторной инициации до прохождения митоза