Вы находитесь на странице: 1из 33

Очерки современной молекулярной

генетики
Е.Д. Свердлов ©
По курсу лекций на кафедре молекулярной биологии
Биологического факультета МГУ, 2005 год
Лекция 2.
Межвидовые сравнения
Регуляторная гипотеза
я от
ен ня
тм е
ае т м
ел ае
о д ич
чт тл
Изменения регуляции
”Относительно генов
небольшое числоприводят

ь, о о
генетических изменений в системах,
к изменению их функций в развитии

ат чт
контролирующих экспрессию генов может
и/или к возникновению

зн ет,
быть ответственным за важные
дополнительных м» чу су
функций.
организменные различия
ко хо ре междуОдни и те
человеком
и шимпанзе" [King and Wilson, 1975]
ве , я те

же гены выполняют разные функции.


ло ка ин
че рвя не
че еня
“М
Пути повышения сложности фенотипа при малом числе
генов
РЕГУЛИРУЕМОСТЬ ГЕНОМА

Способы повышения информационной емкости генома:


Использование принципа интеграции разных сигналов
в одном приемном устройстве.

Уровни регуляции экспрессии генома:

рганизация генома в ядре: хроматин и компартменты.


Процессинг синтезированной РНК (Альтернативный сплайсинг).
Использование одного гена для синтеза множества продуктов:
Усложнение
Транспорт РНКпонятия
из ядра.ген.
интез белка (Трансляция).
спользование некодирующих РНК для регуляции

Использование одного продукта для множества целей: Чем


сложнее организм тем выше нагрузка на один ген.
Некодирующие РНК
Хотя биологи много говорят о прочном связывaнии между "генaми и
кодируемыми ими белковыми продуктaми", вaжно помнить, что тысячи
человеческих генов продуцируют некодирующие РНК (нкРНК), свой
глaвный продукт [244].
Некодирующие РНК не имеют трaнслировaнных ОРС, они зaчaстую
мaлы и не полиaденировaны. Соответственно и новые нкРНК нельзя
быстро обнaружить с помощью компьюторизовaнных методик поискa
генов (которые ищут тaкие признaки, кaк ОРС) или экспериментaльного
секвенировaния кДНК или EST-библиотек (большинство которых
создaны путем обрaтной трaнскрипции с помощью прaймерa,
комплементaрного полиaденильному хвосту. Дaже если существовaли бы
полные зaконченные последовaтельности геномa человекa, обнaружение
новых нкРНК было бы зaтруднительно.
J Neurochem 1997 Apr;68(4):1372-81
Four 5-hydroxytryptamine7 (5-HT7) receptor isoforms in human and
rat produced by alternative splicing: species differences due to altered
intron-exon organization.
The serotonin (5-HT) 5-HT7 receptor subtype is thought to mediate a
number of physiological effects in mammalian brain and periphery.
Previous studies suggested that alternative
Белок 1 splicing might contribute to
5-HT7 receptor diversity as well.

Трансляция

Экзон 1 Экзон 2 Экзон 3


Вариант 1. Вырезается два
интрона.

Экзон 1 Интр Экзон 2 Интр Экзон 3

FEBS Lett 1999 Jan


29;443(3):381-4.
Alternative splicing
generates multiple mRNA Вариант 2. Вырезается два
forms of the acetylcholine интрона и экзон 2.
receptor gamma-subunit in
rat muscle.
Экзон 1 Экзон 3

Трансляция

Белок 2

Альтернативный сплайсинг повышает информационную


емкость генома
Еще один источник инновации у позвоночных это экспансия белковых семейств: около
60% семейств более многочисленны у человека, чем в любых других четырех организмах.
Поэтому дупликация генов занимала свое место среди главнейших эволюционных сил в течение
эволюции позвоночных. Многие из разросшихся семейств вовлечены в различные аспекты
физиологии позвоночных. По сравнению с двумя беспозвоночными видами представители
человека, оказывается, имеют много белков цитоскелете, защите и иммунитете, транскрипции и
трансляции. Эти экспансии явно связаны с аспектами физиологии позвоночных.
Говоря об эволюции, важно видеть, что происходит с молекулой, участвующей в развитии. В
этом отношении увеличение семейств, роль которых в развитии велика, весьма характерно для
генома человека. Например, 30 факторов роста фибробластов (FGF ) человеческого генома на
порядок выше, чем у мухи или червя. То же самое справедливо относительно 42 факторов роста
TGF-β в геноме человека по сравнению с девятью и шестью такими фактора у мухи и червя
соответственно. Эти факторы роста участвуют в органогенезе, в частности, печени и легких.
С точки зрения роста функциональной нагрузки в ходе эволюции, человек также имеют больше
белков, и считается, что эти белки попадают более чем в одну функциональную категорию (426 у
человека против 80 у червей и 57 у мух. Интересно, что 32% из них составляют трансмембранные
рецепторы.
Наконец, человеческий организм содержит большее число генов, семейств доменов и белков,
паралогов, полифункциональных белков со множеством доменов и архитектур доменов. По этой
причине сравнительно более высокая сложность протеома человека есть следствие не просто его
более крупного размера, но также и нового качества – крупных многофункциональных белков.
Соответствующий рост потенциальных возможностей разных взаимодействий белок-белок ничем
не ограничен и может являться одним из главных источников огромного роста сложности [Rubin,
2001].
SH3 и SAM (sterile alpha domain) домены участвую в белок-белковых
взаимодействиях. В сигнальных молекулах, адапторах и каркасных
белках.

Белки организованы из доменов. Доменная структура членов


семейства р53. Порядок следования доменов - доменная архитектура.
Протеом человека содержит в 1,8 раз больше архитектур, чем
нематода и в 5 раз больше, чем дрожжи
Не удивительно то, что самые элементарные клеточные функции, такие как базовый метаболизм,
транскрипция, трансляция, репликация ДНК остались консервативными со времени расхождения
одноклеточных дрожжей и бактерий. В сумме, 60% из предсказанных белков человека имеют
сходство с белками других видов, геномы которых секвенированы. Около 40% белков человека
проявляют сходство с белками фруктовой мухи или червей. И 61% белков фруктовой мухи, 43%
белков червя и 46% дрожжевых белков имеют сходство последовательностей с прогнозируемыми
белками человека.
Очень информативное сопоставление оперирует не целыми белками, а их дискретными структурными
единицами, доменами (модулями). Оказалось, что лишь сравнительно небольшая пропорция разных
идентифицированных доменов появилось в линии позвоночных, и что большинство белковых
доменов прослеживаются до общего животного предка.
В целом, согласно данным о 1262 изученных доменов и белковых семейств, лишь 70 белковых
семейств, и 24 семейства доменов были «позвоночно-специфичными». Упомянутые позвоночно-
специфичные семейства включают такие как белки защиты и иммунитета (23 семейства) и белки,
функционирующие в нервной системе (17 семейств). Они определяют значительные физиологические
различия между позвоночными и другими эукариотами. Они возникли недавно в эволюции и / или
были объектами быстрой дивергенции.
Самое явственное различие между человеческим и другими организмами с секвенированными
геномами состоит в том, что белки человека содержат больше доменов (модулей) на белок и новые
комбинации доменов. Таким образом, новая архитектура доменов, определяемая как линейное
распределение доменов в полипептиде, формировалась по мере течения эволюции. Новые
архитектуры создавались переносом, добавлением или устранением доменов, рождающим новые
белки из старых частей. Поэтому, как и предсказывалось (смотри обсуждение выше), эти новые
архитектуры строились из старых компонентов – в эволюции наблюдался настоящий ремонт
(tinkering?).
Подсчитано, что может существовать около 1500-2000 доменов, которые смогут построить десятки
тысяч модульных белков путем комбинирования различными способами.
Y- дрожжи, W нематода, F муха , H - человек
Доменная архитектура: линейное
расположение доменов в полипептидах.

Figure 42 (Y, yeast; W, worm; F, fly; V, vertebrate). Protein names are below the diagrams. The
domains are SET, a chromatin protein methyltransferase domain; SWI2, a superfamily II
helicase/ATPase domain; Sa, sant domain; Br, bromo domain; Ch, chromodomain; C, a cysteine triad
motif associated with the Msl-2 and SET domains; A, AT hook motif; EP1/EP2, enhancer of polycomb
domains 1 and 2; Znf, zinc finger; sja, SET-JOR-associated domain (L. Aravind, unpublished); Me,
DNA methylase/Hrx-associated DNA binding zinc finger; Ba, bromo-associated homology motif. a–c,
Different examples of accretion.
Продолжение знакомства со
сравнительной геномикой
Появление 233 Zn-finger генов Наиболее значительные
стероидных гормонов увеличения в числе генов у
Появление большого Появление генов мозга человека: (i) приобретенные
числа Zn-finger генов. Появление генов развития. иммунные функции; (ii) нервная
Нет генов рецепторов Отсутствие генов регуляции система (iii) межклеточные и
стероидных гормонов гематопоэза Появление внутриклеточные сигнальные
Бактерии
сигнальных систем системы в развитии и гомеостазе;
(anthrax) (iv) гемостаз; и (v) апоптоз.
www.rkm.com.au/ Нематода
ANTHRAX/ Дрожжи www.nematode.net/S
pecies.Summaries/Ca
enorhabditis.elegans

Что значит быть Что значит быть


Что значит быть
эукариотом человеком?
многоклеточным
Количество
клеток 1 1 959 1014
Нейронов 0 0 302 1010
Количество
генов 470 - 4288 6034 19000 30 -100000
Количество 45 -62 63 36 5 - 10?
идентифицированных
генов (%)
Животные имеют общие регуляторные системы. Почему же человек отличается от червяка? Происходит
ли это потому, что эти системы включаются в разное время при развитии? Или все таки появляются
новые гены?
Figure 46 Conserved segments in the 
human and mouse genome. 
Хромосомы человека

With about 200 conserved segments between mouse and human an

about 100 Myr of evolution from their common ancestor360, we ob
tain an 
estimated rate of about 1.0 chromosomal rearrangement being fi
xed per 
Myr.

Хромосомы мыши
Частота рекомбинаций на единицу длины хромосомы в
среднем возрастает с уменьшением длины хромосомы

Figure 16 Скорость рекомбинации в данном плече хромосомы, усредненная по длине


плеча в зависимости от длины плеча в Мб. Для больших хромосом средняя скорость
рекомбинации близка, но по мере уменьшения длины плеча скорость увеличиваетя
заметно
Rate of recombination averaged across the euchromatic portion of each chromosome arm
plotted against the length of the chromosome arm in Mb. For large chromosomes, the average
F M

Мейоз 1
Мейоз 1

Мейоз II

Рекомбинант Рекомбинант МатьII(M)


Мейоз
Отец (F)
Геномы подвергались множественным перегруппировкам в эволюции, но длинные сегменты оставались
консервативными между видами.
Примерно 342 консервативных сегментов между человеком и мышью было идентифицировано до сих
пор,9 и минимальное число перегруппировок, требуемое чтобы трансформировать геном мыши в
геном человека было оценено как 295. Принимая что прошло 75 Myr с момента существования их
общего передшественника9, каждый может рассчитать что примерно 2 хромосомных перегруппировки
фиксировались за 1 Myr. Большинство перегруппировок имело место вероятно в геноме мыши. Среди
млекопитающих грызуны возможно характеризуются необычно высокой скоростью хромосомных
перегруппировок. Для сравнения, оченьмало перегруппировок наблюдается среди приматов, изучение
широкого ряда млекопитающих предполагает что средняя скорость хромосомных изменений
составляет всего 0.2 перегруппировки в 1Myr.15 Исследование синтении между хромосомами человека
и мыши, курицы, рыб Fugu rubripes и зебры позволяет заключить что многие дупликации почти
хромосомной длины происходчят еще со времен начала дивергенции позвоночных. Более того,
консервативные сегменты наблюдаются у еще более удаленных видов таких как муха и червь.15
С появлением дополнительных данных по геномам разных видов станет более понятным
работает этот вид молекулярных часов с разными скоростями у разных эволюционных ветвей.
Возможно эти данные позволят вывести кариотипы общих предшественников.
Мышиный геном позволил в первый раз осуществить прмое сопоставление двух геномов
человека и мыши.9 Примерно 40% генома человека может быть выровнено (aligned) с геномом мыши.
Эти последовательности по-видимому представляют собой большуючасть ортологичных
последовательностей которые остались в обоих линиях с момента существования общего
пердшественника. Другие же последовательности были делетированы в одном или в обоих геномах.
Поскольку доля генов мыши, не имеющих гомологов в геноме человека (и наоборот), составляет менее
1% эти делеции должны были происходить в нефункциональных частях генома (ЗДЕСЬ У АВТОРОВ
ЛОГИЧЕСКАЯ ОШИБКА). Предполагая, что размер генома последнего общего предшественника
человека и мыши был около 2.9 миллиардов пар оснований и что 24.4% генома человека (около 695
миллионов bp) состоит из повторов, которые появлись после расхождения линий, ведущих к человеку
и мыши, эти вновь появившиеся повторы должны были компенсировать ту часть генома которая
была утеряна благодаря делециям. Основываясь на подобных предположениях авторы
последовательности генома мыши полагают, что примерно 1,300 Mb последовательностей было
компенсировано появлением повторов момента существавания последнего общего прешественника
человека и мыши. Как бы грубы ни были эти оценки они дают представление о масштабе геномных
перегуппировок в процессе эволюции..
Продолжение знакомства со
сравнительной геномикой
Снова об ортологах и
паралогах
S. Horai et al. Recent African origin of modern humans revealed by complete sequences of hominoid
mitochondrial DNAs Proc. Natl. Acad. Sci. USA, 92, 532 - 536, 1995

Человек
о ги
л
то

4,9 MYR
Ор

и
Шимпанзе

ог
л
то
и е
Ор
ци ни
нк ене
фу зм

Горилла
И

6.56 MYR
Паралоги
(Одинаковая
функция?)

Орангутанг
13 MYR

Хромосома 1 Хромосома 2
Christos Ouzounis, Orthology: another
terminology muddle Trends in Genetics 1999,
15:445
Концепция ортологии, один из терминов, который широко
использовался в последние несколько лет был предложен Walter
Fitch в 1970 ( Ref. 1). Fitch использовал этот термин для
определения генов, которые передаются вследствие образования
видов, в противоположность дупликации внутри вида (паралогия).
Это определение, тем не менее, не означает, что два ортолога или
кодируемые ими белки будут иметь одну и ту же функцию.

Различие между ортологами, которые возникли в процессе вертикальной


передачи от общего предка и предполагается что они имеют одну и ту же
функцию, от паралогов которые происходят вследствие дупликации и
перетасовки доменов (domain shuffling) внутри генома и, следовательно, могут
иметь дивергировавшие фукции, чрезвычайно важно при полногеномных
сравнениях. Неудача в таком определении может приводить к функциональным
ошибкам при классификации и неверным молекулярно-эволюционым
реконструкциям.

Chervitz S,A, Aravind L, Sherlock G., Ball K., Koonin E, Dwight SS, Harris
MA, Dolinski K, Mohr S., Smith T, Weng S., Cherry JM, Botstein D,
Comparison of the Complete Protein Sets of Worm and Yeast: Orthology
and Divergence Science 282, 2022 - 2027, 1998
Единое Геномно-
информационное поле
Таблица. Гомологии (%) протеома человека с другими
протеомами
Только прокариоты 1
Эу- и прокариоты 21
Животные и др. эукариоты 32
Позвоночные и др. животные 24
Только позвоночные 22
Нет гомологий 1
Недавно секвенированный геном мыши продемонстрировал,
что приблизительно 99% генов мыши имеют гомологов в
человеческом геноме.9 Пока неясно что представляют собой
оставшиеся 1% предсказанных мышиных генов:
действительно они не имеют чловеческих гомологов или
просто они остаются в несеквенированной части генома
человека.
ЖИВЫЕ ОРГАНИЗМЫ РАЗНОЙ
СЛОЖНОСТИ ПРОИЗОШЛИ ОТ
ОБЩЕГО ПРЕДШЕТВЕННИКА И
СОХРАНЯЮТ МНОЖЕСТВО СХОДНЫХ
ГЕНОВ.
БОЛЕЗНЬ ГЕН ГЕН ФУНКЦИЯ
ЧЕЛОВЕКА ЧЕЛОВЕКА ДРОЖЖЕЙ ГЕНА ДРОЖЖЕЙ
НЕМАТО-
ДА ДРОЗОФИ- НАСЛЕДСТВЕН M SH2 M SH2
МЫШЬ ЛА НЫ Й РЕПАРАЦИЯ
НЕПОЛИПОЗ- ДНК
НЫ Й M L H1 MLH
РАК ТОЛСТОЙ
КИШКИ
ЧЕЛОВЕК М У КОВИСЦИДОЗ CFTR Y CF1 У СТОЙЧИВОСТЬ К
М ЕТАЛЛАМ
БОЛЕЗНЬ WND CCC2 ТРАНСПОРТЕР
ВИЛЬСОНА- М ЕДИ
КОНОВАЛОВА
БАКТЕ-
ДРОЖЖИ АТАКСИЯ- ATM TEL 1 P13 КИНАЗА
РИИ
ТЕЛЕАНГИЭКТА-
ЗИЯ
М ИТОНИЧЕСКАЯ DM Y PK1 S/T ПРОТЕИН-
ДИСТРОФИЯ КИНАЗА
НЕЙРОФИБРО- NF1 IRA2 ИНГИБИРУ ЮЩИЙ
М АТОЗ, ТИП 1 РЕГУ ЛЯТОРНЫ Й
БЕЛОК

Единое геномно-
информационное поле
Внутривидовые сравнения
геномов.
Полиморфизм.
ОПРЕДЕЛЕНИЯ

Полиморфизм: присутствие в популяции нескольких аллелей гена с


частотой не менее 1% каждая.
Мутация: аллель встречающаяся в популяции с частотой ≤ 1% (Alan
J. Schafer, J. Ross Hawkins DNA variation and the future of human
genetics Nature Biotechnology, 16, 33, 1998 1)
Геномные болезни: болезни, происходящие в результате
изменений вследствие рекомбинаций ДНК (Lupski JR TIG, 14(10)417 -
422(1998)
Õðîìîñîìíûå áîëåçíè: ïðîèñõîäÿò â ðåçóëüòàòå íåíîðìàëüíîñòè â õðîìîñîìах,
êîòîðûå ÿâëÿþòñÿ следствием больших перегруппировок, дупликаций
делеций.
Моногенные болезни: болезни, которые происходят вследствие
мутации в одном гене.
Полигенные болезни: болезни, для которых требуется
одновременное присутствие мутаций или редких аллелей в
нескольких генах.
Мультифакториальные болезни: болезни, в которых
взаимодействует окружающая среда и генетические компоненты.
(Environmental) Негенетические áîëåçíè: болезни происходящие
принципиально от воздействий окружающей среды.
(Sheffield VC, Stone EM, Carmi R Use of isolated inbred human
Варианты SNP

Species-specific Shared
monomorphs (53) Human-specific SNP (4)
SNP (54)

GATCGATCGATCGATCGACCGATCGATCGATCGATCGATCGATC
ве к
GATCGATCGATCGATCGACTGATCGAGCGATCGAGCGATCGATC
ло
Че
GATCGATCGATCGATCGACCGATCGATCGATCGATCGATCGATC

Диверген
ция
н зе
GATCGATCGATGGATCGCCCGGTCGCGCGATCGAGCGATCGATC
п а
GATCGATCGATGGATCGCCCGGTCGCGCGATCGAGCGATCGATC и м
Ш
GATCGATCGATGGATCGACCAGTCGATCGATCGATCGATCGATC Полиморфизм
внутривидовые различия в
Chimp-specific одном локусе
Shared
monomorphs (12858) SNP (18)
Различия
последовательности между
MK Halushka et al., Nature Gen. 22, 239, 1999
видами - дивергенция
Вариации последовательности и Мононуклеотидный
болезни полиморфизм (Single
nucleotide polymorphisms,
[Мутации] Sequence analysis of SNPs)
individuals and families with disease
phenotypes reveals causative [SNP] Natural sequence
mutations. Substitution of a C by a T variation occurs between
in this gene sequence (the SH2D1A any two copies of the
gene on the X chromosome) causes human genome. Most
uncontrolled proliferation of variations are SNPs
immune B and T cells in response to involving single base
an Epstein-Barr virus infection. substitutions — the rest are
Variations in genes can also cause insertions or deletions. A
individuals to respond differently to SNP is detected by
the environment, medicines, sequencing a particular
allergens, chemicals and toxins. region from different
individuals, who may
have identical
(homozygous; T/T or C/C
in this example) or
different (heterozygous;
T/C) bases at the
polymorphic site.
С
Хромосома 1
Хромосома 1
Mини- и микросателлиты.
Повторяющиеся последовательности различаются по структуре и длине
повторяющейся единицы, по количеству этих единиц в повторе и по количеству
повторов в геноме.
Высокоповторяющиеся последовательности > 105 копий
Cреднеповторяющиеся - 102 до 105 копий
Низкоповторяющиеся - 2 до 100 копий.
Минисателлиты, VNTR (от Variable Number Tandem Repeats). Состоят из коротких
( 5 - 80 пар оснований) повторяющихся единиц с образованием участков ДНК
длиной 0,1 -20 килобаз. Обычно имеют повышенное содержание G+C. Сильно
варьирующие по длине минисателлиты часто называют также гипервариабельными
областями, в англоязычной литературе HVR (HyperVariable Regions). Общее число
разных типов минисателлитов в геноме человека неизвестно, но оценивается такой
цифрой, как 1500. Минисателлиты часто распределены в геноме не случайно. В
геноме человека, например, они имеют тенденцию группироваться ближе к концам
хромосом.(Интересно, что в геноме мыши такой предпочтительности не
наблюдается). Для данного локуса число аллельных вариантов минисателлита, т.е.
число вариантов, отличающихся длиной повтора, может превышать 20. Это
означает, что гетерозиготность по такому локусу может достигать 95%.
Микросателлиты, STR (Short Tandem Repeats). Длина повторяющейся единицы от 1
до 6. Число повторяющихся единиц от 10 до 60. Распределены в геномах
практически случайно. Встречаемость: человеческий геном на каждые 6 килобаз,
Растениях - 29 килобаз. Граница, разделяющая мини- и микросателлиты условна.
Таблица 1. Примеры некоторых мини и микросателлитов, встречающихся в геноме человека [2,9].

повторяющаяся содержание в геноме(%) количество на геном


единица
T 0.3 10(5)
C 0.0002 10

TA низкое низкое

AG 0.2 5*10(4)

CA 0.5 >10(5)

CG низкое ?

СAG 0.005 10(3)


Аллель 1
Аллель 1
N1 N2 N4
Гаплотип 1 N3
L1
L3

Константная 2
Константная 1
Вариаб Полиморфизмы

L2 L4
Гаплотип 2
N1 N2 N4 N3
Аллель 2 Аллель 2

Локус 1 Локус 2
Гаплотип: порядок следования элементов в хромосоме или ее части

AC AC AC AC AC AC Микросателлит

Любой участок генома - локус. В данном локусе разных геномов могут содержаться
разные последовательности - аллели. Полиморфизм это различие между аллелями
одного и того же локуса.