Вы находитесь на странице: 1из 8

N32 Lck sequence analysis


CGGA GTGTACGACTTTTGAAAGTCCCGTGATTTGTGCAAACAACTCCCATGA CGTCATGGGGTGGAGACTGAAATCCGTG AGTC AACCGCTTTCCCGCCATTGATGTACTGCAAACGCCTACACATGTTGCG ATGACATAAACGTAAGTTATCTGCCAAT AGGA AGTCTAGGCATGTACTGGCATATGGCCGTGCTACGCTAGACCTAGGA CCTGTAGAACATATTGCACGGGGTCTAAT AACA CTACT Reverse complement (5 to 3) agtagtgttattagaccccgtgcaatatgttctacaggtcctaggtctag cgtagcacggccatatgccagtacatgcctagacttcctattggcagata acttacgtttatgtcatcgcaacatgtgtaggcgtttgcagtacatcaat ggcgggaaagcggttgactcacggatttcagtctccaccccatgacgtca tgggagttgtttgcacaaatcacgggactttcaaaagtcgtacactccgc cccatgacgcaaatggcgtagcgtgtacggtgggaggtctatatagcaga gctctctgctactagagacccactgcttactggctatcgaaattatacga ctcactatagggagacccaagctggctagcgtttaaacgggccctctaga ctcgaggccaccatgggctgtggctgcagctcacacccggaagatgactg gatggaaaacatcgatgtgtgtgagaactgccattatcccatagtcccac tggatggcaagggcacgctgctcatccgaaatggctctgaggtgcgggac ccactggttacctacgaaggctccaatccgctggcttccccactgcaaga caacctggttatcgctctgcacagctatgagccctctcacgacggagatc tgggctttgagaagggggaacagctccgcatcctggagcagagcggcgag tggtggaaggcgcagtccctgaccacgggccaggaaggcttcatcccctt caattttgtggccaaagcgaacagcctggagcccgaaccctggttcttca agaacctgagccgcaaggacgcggagcggcagctcctggcgcccgggaac actcacggctccttcctcatccgggagagcgagagcaccgcgggatcgtt ttcactgtcggtccgggacttcgaccagaaccagggagaggtggtgaaac attacaagatccgtaatctggacaacggtggcttctacatctcccctcga atcacttttcccggcctgcatgaactggtccgccattacaccaatgcttc agatgggctgtgcacacggttgagccgcccctgccagacccagaagcccc agaagccgtggtgggaggacgagtgggaggttcccagggagacggaattc caccacactggactagtggatccgagctcggtaccaagctttctagaaca aaaactcatctcagaagaggatctgaatagcgccgtcgaccatcatcatc atcatcattgagttaaacgtctccagctagtaacc

Frame1, 98% identical to original N32




CGGA GTGTACGACTTTTGAAAGTCCCGTGATTTGTGCAAACAACTCCCATGA CGTCATGGGGTGGAGACTGAAATCCGTG AGTC AACCGCTTTCCCGCCATTGATGTACTGCAAACGCCTACACATGTTGCG ATGACATAAACGTAAGTTATCTGCCAAT AGGA AGTCTAGGCATGTACTGGCATATGGCCGTGCTACGCTAGACCTAGGA CCTGTAGAACATATTGCACGGGGTCTAAT AACA CTACT > (5' --> 3' complementary sequence) - 1285 nucleotides agtagtgttattagaccccgtgcaatatgttctacaggtcctaggtctag cgtagcacggccatatgccagtacatgcctagacttcctattggcagata acttacgtttatgtcatcgcaacatgtgtaggcgtttgcagtacatcaat ggcgggaaagcggttgactcacggatttcagtctccaccccatgacgtca tgggagttgtttgcacaaatcacgggactttcaaaagtcgtacactccgc cccatgacgcaaatggcgtagcgtgtacggtgggaggtctatatagcaga gctctctgctactagagacccactgcttactggctatcgaaattatacga ctcactatagggagacccaagctggctagcgtttaaacgggccctctaga ctcgaggccaccatgggctgtggctgcagctcacacccggaagatgactg gatggaaaacatcgatgtgtgtgagaactgccattatcccatagtcccac tggatggcaagggcacgctgctcatccgaaatggctctgaggtgcgggac ccactggttacctacgaaggctccaatccgctggcttccccactgcaaga caacctggttatcgctctgcacagctatgagccctctcacgacggagatc tgggctttgagaagggggaacagctccgcatcctggagcagagcggcgag tggtggaaggcgcagtccctgaccacgggccaggaaggcttcatcccctt caattttgtggccaaagcgaacagcctggagcccgaaccctggttcttca agaacctgagccgcaaggacgcggagcggcagctcctggcgcccgggaac actcacggctccttcctcatccgggagagcgagagcaccgcgggatcgtt ttcactgtcggtccgggacttcgaccagaaccagggagaggtggtgaaac attacaagatccgtaatctggacaacggtggcttctacatctcccctcga atcacttttcccggcctgcatgaactggtccgccattacaccaatgcttc agatgggctgtgcacacggttgagccgcccctgccagacccagaagcccc agaagccgtggtgggaggacgagtgggaggttcccagggagacggaattc caccacactggactagtggatccgagctcggtaccaagctttctagaaca aaaactcatctcagaagaggatctgaatagcgccgtcgaccatcatcatc atcatcattgagttaaacgtctccagctagtaacc