Вы находитесь на странице: 1из 21

1 Lista de Exerccios

Natureza e Funo do Material Gentico

1) Num organismo diplide um pesquisador verificou que uma molcula de DNA continha 22% de GUANINA. Com base nesta informao determine qual o percentual de cada uma das outras bases. 2) Se o contedo de AT em uma molcula de DNA de 36%, quais so os contedos de todas as bases? 3) Explique porque no experimento de Avery e colegas, o material tratado com DNAse no produziu colnias patognicas. 4) Um vrus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA nucleotdeos consistindo de URACIL. Qual a frequncia de ADENINA? 5) Se um RNAm sinttico conter 35% de ADENINA e 65% de GUANINA posicionados ao longo do polinucleotdeo, que aminocidos so esperados para serem incorporados no polipeptdeo e em que propores? 6) preparado um extrato celular com clulas pnemoccicas patognicas. Que efeito ter a mistura desta cultura comum a de pnemococus no patognicos se a primeira for submetida a tratamento com: a) Protease? b) RNAse? c) DNAse? 7) Que propriedades qumicas possuem o DNA e as protenas que permitem a marcao especfica de uma ou outra destas macromolculas com um istopo radioativo? 8) Qual a contribuio do experimento realizado por Hershey e Chase para a Gentica? Como o objetivo foi alcanado? 9) Considere uma partcula viral contendo uma molcula de 200.000 pb (pares de bases): a) Quantos nucleotdeos devem estar presentes? b) E quantos tomos de fsforo?

10) Foi demonstrado experimentalmente que a maioria das sequncias altamente repetitivas de DNA de cromossomos eucariotos no so transcritas. O que isto indica a respeito da funo deste tipo de DNA? 11) O que voc entende por orientao anti-paralela das fitas de DNA? 12) Os cidos nucleicos so constitudos por cadeias polinucleotdicas. Descreva resumidamente este tipo de composto. 13) Cite as principais diferenas entre RNA e DNA quanto estrutura de nucleotdeos? 14) Quais as principais caractersticas da molcula de DNA? 15) Explique o que e porque ocorre a complementariedade de bases nitrogenadas. 16) Se uma fita de desoxirribonuclease tiver 5ATAAGCGTTAG 3, como ser a molcula de DNA? constituio

17) O DNA do fungo Neurospora crassa tem um contedo de A + T de 37%. Qual o contedo de cada uma das bases? 18) O DNA da bactria Bacillus hipoteticus tem um contedo de T + C de 46%. Qual o contedo de cada uma das quatro bases? 19) Porque surgem os fragmentos de Okasaki? 20) Qual a importncia do empacotamento do DNA e como ele se processa? 21) O istopo radioativo do nitrognio N15 pode ser usado para marcar radioativamente compostos que possuam nitrognio na sua composio, como o caso dos cidos nucleicos. Uma cultura de Escherichia coli cresceu em um meio contendo exclusivamente N15 at que todo o DNA estivesse marcado. Ento transferiu-se a colnia para um meio contendo nitrognio comum N14 e deixou-se que crescesse por, exatamente, duas geraes. Fazendo-se ento uma avaliao do DNA, quanto deveria ser encontrado contendo: a) Somente N15? b) Hbrido (uma fita N14 e outra N15)? c) Somente N14?

Respostas da 1 Lista de Exerccios 1. T = 28%; A = 28%; G = 22%; C = 22%. 2. T = 18%; A = 18%; G = 32%; C = 32%. 3. Porque a DNAse destri o DNA da bactria patognica no permitindo que a bactria apatognica incorporasse o DNA da bactria patognica e se transformasse em bactria patognica. 4. No se tem como determinar, uma vez que o RNA simples fita no sendo as bases pareadas. 5. AAA - 4,28%; AGA - 7,96%; AAG - 7,96%; AGG - 14,78%; GAA 7,96%; GGA - 14,78%; GAG - 14,78%; GGG - 27,46%. 6.a) Haver formao de clulas patognicas; b) Idem; c) Haver formao de clulas no patognicas. 7. O DNA rico em fsforo mas no possui enxofre, enquanto que as protenas so ricas em enxofre e no possuem fsforo. 8. Comprovaram que o material que possui atividade gentica o DNA, acompanhando a trajetria dos vrios componentes virais marcados radioativamente em um processo normal de infeco. Conseguiram demonstrar que apenas o DNA penetra na clula infectada sendo transmitido gerao viral descendente. 9.a) 400.000; b) Idem. 10. Que no codificam nenhum polipeptdeo, no tendo, portando, atividade gentica. 11. Significa que as duas cadeias polinucleotdicas de uma mesma molcula de DNA so invertidas uma em relao outra, isto , se em uma extremidade de uma delas se encontrar o radical fosfato (que ocupa a posio 5 do nucleotdeo), na mesma extremidade da outra ser encontrado o radical oxidrila (da posio 3).

12. Cada nucleotdeo constitudo por uma base cclica nitrogenada ligada a uma pentose. na posio 3 da pentose encontra-se uma oxidrila e na posio 5 um fosfato. A unio dos vrios nucleotdeos entre si promovida por ligaes fosfodister entre a oxidrila 3 de um nucleotdeo e o grupamento fosfato 5 do seguinte. 13. A pentose do RNA uma ribose enquanto que a do DNA uma desoxiribose, tendo perdido a oxidrila da posio 2. No RNA encontra-se a pirimidina uracil que no RNA substituda pela timina. 14. constituda por duas cadeias polinucleotdicas complementares uma outra orientadas antiparalelamente espiraladas para a direita, formando uma dupla hlice. 15. A unio das bases entre as duas fitas de DNA sempre especfica ocorrendo os pareamentos C-G e T-A. Tal especificidade provocada pela habilidade de formao de pontes de hidrognio (duas entre T e A e trs entre C e G). 16. 5 ATAAGCGTTAG 3 3 TATTCGCAATC 5 17. A = 18,5%; T = 18,5%; C = 31,5%; G = 31,5%. 18. No possvel determinar uma vez que T e C no so complementares. 19. Porque, embora a replicao ocorra de modo bidirecional, as DNApolimerases conseguem sintetizar apenas no sentido 5 3. Deste modo, o crescimento total 3 5 ocorre pela sntese de pequenos fragmentos 5 3 denominados fragmentos de Okasaki. 20. O empacotamento necessrio para permitir que molculas extremamente longas consigam caber em espao exguo (ncleo). Ocorre em trs etapas: espirilizao das duas fitas, originando a dupla hlice, formao de nucleossomos, com a participao das histonas, superespiralizao da cadeia de nucleossomos. 21.a) Nenhum; b) 50%; c) 50%.

2 Lista de Exerccios
Sntese Proteica

1) Quais as principais diferenas entre a replicao, transcrio e a traduo de procariontes e eucariontes? 2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequncia de bases do RNAm correspondente? b) Quantos tRNAs sero utilizados na sntese? c) Quais os anti-cdons dos tRNAs acima considerados? d) Quantos aminocidos podero ser codificados? e) Qual a sequncia de aminocidos codificados? f) Considere que esta sequncia sofra splicing e que os introns ocorram a cada 2 cdons no hnRNA, quais seriam as respostas para as perguntas acima? 3) A taxa de replicao em bactrias corresponde a 450 nucleotdeos por segundo, enquanto que em mamferos de 45 nucleotdeos. Quais as concluses que podemos retirar desta informao? 4) Assumindo a sequncia de nucleotdeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC a fita molde: a) Que aminocido codificado por esta trinca? b) Se uma mutao ocorresse e como consequncia transformasse a adenina para a forma tautomrica na replicao, que aminocido seria codificado? 5) Uma nica adio de nucleotdeos e uma deleo aproximadamente 15 pontos distantes do DNA causam a mudana na sequncia de uma protena de: LYS - SER - PRO - SER - LEU - ASN - ALA - ALA - LYS para LYS - VAL - HIST - HIST - LEU - MET - ALA - ALA - LYS a) Quais as sequncias de nucleotdeos do RNA velho e novo? b) Que tipo de RNA ? c) Qual o nucleotdeo que foi adicionado e qual foi deletado? 6) Explique o processo de exciso de introns ou "SPLICING":

7) verdadeira a afirmao? "Existe 1 (um) cdon e anti-cdon especfico para cada tRNA". 8) Porque apenas 61 trincas (sequncias de nucleotdeos) codificam aminocidos? 9) Voc est estudando em E. coli um gene que especifica uma protena. Uma parte de sua sequncia : - ALA - PRO - TRP - GLU - LIS - CIS - HIST Voc obtm, para este gene, uma srie de mutantes que no mostram atividade enzimtica. Isolando os produtos enzimticos mutantes, voc encontra as seguintes sequncias: MUTANTE 1 - ALA - PRO - TRP - ARG - GLU - LIS - CIS - HIST MUTANTE 2 - ALA - PRO MUTANTE 3 - ALA - PRO - GLY - VAL LIS - CIS - HIST Qual a base molecular para cada mutao? Qual a sequncia de DNA que especifica esta parte da protena? 10) comum, na natureza, encontrarmos uma frequncia de erro, de aproximadamente 1 em 10000 nucleotdeos, tanto na sntese de RNA quanto no processo de traduo do RNAm. Porque esta taxa no maior? Explique: 11) Considere a sequncia de bases nitrogenadas abaixo como parte de uma molcula de cido nucleico: 5' UGA - AUG 3' a) De que cido nucleico ela faz parte? b) Quais os outros cidos nucleicos relacionados com tal sequncia e suas respectivas bases nitrogenadas? c) Se da sequncia dada resultar um segmento de protena, quais os aminocidos que estariam presentes? 12) Como a transcrio : a) Iniciada? b) Terminada? 13) Considerando-se a sequncia de cdons 5 AUG CGA 3 responda justificando: a) De que molcula do cido nucleico faz parte? b) Qual o anti-cdon correspondente? c) De que molcula a resposta b) faz parte?

d) Qual a sequncia template (sense ou molde) correspondente? e) E a no template? f) A que molcula as duas ltimas respostas pertencem? 14) Em uma longa molcula de DNA isolou-se o seguinte segmento: 5 ATCTTTAGGCTACAGGT 3 3 TAGAAATCCGATGTCCA 5 a) Se a fita sense for 5 3, qual a sequncia de hnRNA? b) D o nucleotdeo da extremidade 5 deste RNA; c) Considerando que a molcula de DNA constituda por um exon de 6 nucleotdeos, um intron de 5 e outro exon de 6, qual o mRNA correspondente se a fita template for 3 5? 15) Molculas de rRNA so relativamente estveis, enquanto que o mRNA degradado rapidamente. Discuta possveis causas e consequncias deste fato. 16) Diga o que voc sabe sobre as fitas sense e anti-sense do DNA. 17) Discuta as principais caractersticas do cdigo gentico. 18) A fita no template (anti-sense) de um gene que tem a seguinte sequncia:
5 CCGGCTGATTTAGAAATGATGTTATATATAATATAATGTGCCCAATG 3

Qual a constituio do polipeptdeo codificado por este gene? 19)Explique como o tRNA assegura a correta traduo de acordo com as leis do cdigo gentico. 20) Considerando o molde 3 TACCGGAATTGC 5. Fornea os peptdeos produzidos considerando as seguintes situaes: a) A molcula original do DNA; b) A deleo da segunda citosina; c) Aps a deleo uma adio de timina aps a sequncia GG; d) Como seria designado o resultado final? 21) Explique porque existem na natureza vrias formas diferentes para um mesmo gene.

22) O 5 bromouracil um mutgeno qumico anlogo timina que se caracteriza por induzir transies. Quais das seguintes substituies se espera serem induzidas com maior frequncia? Explique: a) Met > Val b) Lis > Trp c) Lis > Gln d) Pro > Arg e) Pro > Gln 23) Estudando uma mutao sem sentido em Escherichia coli um pesquisador verificou que a cadeia polipeptdica era terminada na posio relativa ao triptofano na cadeia normal. Induzindo revertentes com agentes mutagnicos capazes de provocar substituies em um nico par de bases cada um, o pesquisador encontrou 6 diferentes tipos de revertentes, cada um com diferente tipo de aminocido na posio originalmente ocupada pelo triptofano: ser, thr, leu, glu, gln e lis. A mutao sem sentido estudada era UAG, UAA ou UGA? Porqu?

Gabarito da 2 Lista de Exerccios 1. PROCARIONTES Replicao Realizada no nucleoplasma; Desenrrolamento do DNA por atuao de enzimas em uma ponta. Transcri A molcula de RNA se o constitui mo mRNA propriamente dito, sendo em seguida utilizada na sntese de protenas e posteriormente degradada. Traduo Enzimas especficas de iniciao, enlongamento e terminao prprios de procariotos. EUCARIONTES Realizada no ncleo; Incio em vrios pontos no mesmo momento; bem mais complexo, ocorrendo uma srie de modificaes do RNA antes que ele possa servir no incio do processo (introns e exons).

Enzimas especficas de iniciao, enlongamento e terminao prprios de eucariotos.

2.a) 5 UUU CUU GCU ACU AAA GCC UAA 3 b) 7 c) 3 AAA GAA CGA UGA UUU CGG AUU 5 d) 3 e) LIS - GLU - ARG - FIM - FEN - ARG - ILE fa) 5 UUU UUA AAC CA 3 fb) 3 fc) 3 AAA AAU UUG 5 fd) 3 fe) LIS - ASN - LEU 3. O tamanho da molcula de DNA de uma bactria menor e menos condensada que o DNA de um mamfero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotdeos que o DNA de procariotos. 4.a) GLN b) PRO 5.a) velho: AAA - AGU - CCA - UCA - CUU - AAU - GCU - GCU - AAA

novo: AAA - GUC - CAU - CAC - UUA - AUG - GCU - GCU - AAA b) mRNA c) Deleo de A na segunda trinca de nucleptdeos e adio de G na sexta trina de nucleotdeos. 6. O mRNA produzido pela transio em eucariotos uma molcula com muito mais ribonucleotdeos que o necessrio para a sntese de uma protena ou enzima. O hnRNA, aps sua sntese sofre um processamento no qual sero cortadas as sequncias que no estaro no mRNA final (introns). Os segmentos de DNA transcritos que estaro efetivamente presentes no mRNA final so denominados exons. 7. Sim. Para cada um dos cdons presentes em uma molcula de mRNA encontra-se uma molcula de tRNA com um nico anti-cdon complementar. Cada anti-cdon especfico para um dado aminocido, embora cada aminocido possa ter 1 a 4 anti-cdons apropriados a ele. 8. Porque 3 trincas UAA, UAG, UGA, codificam o fim da sntese denominados sem sentido e no codificam nenhum aminocido. Em vez disso, so reconhecidos pelos fatores de liberao de protenas que promovem a ejeco das subunidades de ribossomos. Portanto seu significado exatamente o fim da sntese. 9. Mutante 1: GCA - CCA - UGG - GAA - AAA - UGU - CAU (mutao de sentido errado com adio de uma trinca errada) Mutante 2: GCA - CCA - UGA (mutao de ponto - transio) Mutante 3: GCA - CCA - GGG - GUG - AAA - UGU - CAU (mutao de ponto ocorrendo primeiro transverso no terceiro par de bases e, segundo, transverso no segundo par de bases) 10. Devido aos mecanismos de reparo capazes de restabelecer a integridade do DNA. A processividade de alta fidelidade no formando a ligao se no tiver a base correta. Caso pareie uma base incorreta h enzimas capazes de perceber este erro retirando a base que foi inserida erroneamente, assegurando o correto pareamento. 11.a) mRNA b) DNA molde - 3 ACT TCA 5; c) Fim - MET

12.a) A RNA polimerase reconhece e acopla-se sequncia promotora do DNA; b) A RNA polimerase reconhece uma sequncia de terminao no DNA, desconectando-se deste 13.a) mRNA; b) 5 CAU 3 e 5 UCG 3; c) tRNA; d) 5 TCGCAT 3; e) 5 ATGCGA 3; f) DNA. 14. a) 5 UGGACAUCGGAUUUCUA 3; b) uracil; c) 5 UAGAAAUGUCCA 3. 15. O RNA necessrio permanentemente na clula pois participa de todo e qualquer processo de sntese, enquanto que uma determinada molcula de mRNA s necessria para a sntese de um determinado peptdeo, no momento em que este for requerido pelo organismo. A sua degradao impede o acumulo excessivo tanto do prprio mRNA como tambm do seu produto especfico. 16. A fita sense a fita da molcula de DNA que serve de molde para a sntese de mRNA. Cada gene usa sempre a mesma fita como sense ou template, mas genes diferentes podem ser copiados de diferentes fitas da mesma molcula. 17. O cdigo gentico assegura a colinearidade de informaes entre a molcula de DNA e a cadeia polipeptdica, isto , a correspondncia corretamente sequenciada. degenerado, o que significa que cada aminocido pode ser codificado por mais de um cdon, mas no ambguo e universal (cada cdon codifica sempre o mesmo aminocido, mesmo em diferentes espcies). No existe qualquer tipo de separao entre cdons contguos nem sobreposies, mas existem sinais especficos de incio e fim de traduo (dois cdons de iniciao e trs de determinao). 18. PRO - ALA - ASP - LEU - GLU - MET - MET - LEU - TYR - ISO - ISO. 19. O tRNA apresenta especificidade tanto para o aminocido como para o cdon, sendo complementar e antiparalelo. Deste modo, garante a insero correta do aminocido na cadeia polipeptdica, de acordo com a sequncia de cdons presentes no mRNA.

20.a) MET - ALA - LEU - TRE; b) MET - PRO; c) MET - PRO - LEU - TRE; d) Mutao de sentido errado. 21. As formas diferentes chamadas alelos, surgem por mutao e so uma importante fonte de variabilidade e diversidade, assegurando uma maior probabilidade de sobrevivncia entre as espcies. 22. Apenas MET > VAL, pois a nica situao que envolve transio. 23. UAG, porque o nico terminador que com apenas uma alterao pode originar os seis aminocidos.

3 Lista de Exerccios
Regulao Gnica

1) Porque o mecanismo do triptofano dito negativo e da lactose dito positivo? 2) O modelo do operon, formulado por Jacob e Monod, serve para explicar a regulao gnica das enzimas que degradam a lactose em E. coli. Explique o que ocorre se houvesse: a) A presena de triptofano no meio celular; b) Uma mutao do tipo substituio de bases silenciosa do gene operador (O); c) Uma mutao do tipo deleo de base nos genes estruturais (Z, Y, A); d) Presena de glicose no meio celular; e) Uma mutao de sentido errado no primeiro gene estrutura. 3) Considerando os operons lac e trp como modelos de induo e represso, respectivamente, descreva: a) A condio mais frequente de cada um destes operons; b) As alteraes ocorridas quando molculas efetoras esto presentes. 4) Os operons, que regulam eficientemente a expresso de conjuntos de genes estruturais relacionados entre si so comuns em bactrias, mas ausentes em eucariotos, isto implica que estes no controlam a expresso de seus genes? Justifique. 5) Uma mutao uma alterao na sequncia de nucleotdeos de um gene, um promotor ou um operador. Explique os efeitos de cada uma das mutaes abaixo no operon lac da Escherichia coli: a) Mutao no operador, impedindo a ligao do repressor; b) Mutao em lac i (gene regulador), impedindo a sua mutao; c) Mutao no promotor impedindo o acoplamento da RNA polimerase; d) Mutao em lac i, inibindo o acoplamento do repressor lactose; e) Mutao sem sentido em lac y; f) Mutao de localizao desconhecida, que impede a degradao de mRNA lac. 6) Diferencie repressores e indutores.

7) O operon lac responsvel pela produo de enzimas que participam da reao metablica de sntese de triptofano e constitudo por 5 genes estruturais, um operador que responde um complexo repressor/co-repressor, e um promotor. O seu gene regulador situa-se em um outro ponto do DNA. Na ausncia de triptofano ocorre sntese enzimtica? Porqu? 8) Em Escherichia coli o operon da lactose compreende 3 genes estruturais: galk, galt e gale, cujos produtos esto envolvidos no metabolismo do acar galactose. Galr codifica um repressor e a galactose um indutor do sistema. Descreva a sequncia de processos: a) Na ausncia da galactose; b) Na presena da galactose.

Gabarito da 3 Lista de Exerccios 1. Porque o operon s estar atilado na presena de lactose ou desactivado na presena de triptofano. A lactose indutora enquanto o triptofano um repressor. 2.a) No operon Lac seria indiferente; b) Haver leitura dos genes Z, Y, A e degradao da lactose pois tanto o cdon mutante como o original codificam o mesmo aminocido no alterando a leitura. c) A lactose no ser degradada pois haver mutao de sentido errado no sendo formadas as enzimas Z, Y, A. d) O operon Lac no ser ativado e no haver produo das enzimas Z,Y, A. e) A lactose no ser degradada. 3.a) Lac - O operon permanece inativado porque a protena repressora, sintetizada pelo gene regulador, se liga ao stio operador, inibindo o promotor. Isto impede o acoplamento da RNA polimerase, e deste modo, no h transcrio nem traduo. Trp - O repressor sintetizado pelo gene regulador inativo, no sendo capaz de se ligar ao stio operador do operon. Logo a RNA polimerase acopla-se ao promotor, ocorrendo transcrio e traduo. b) Lac - induzido pela lactose que, quando presente, estabelece um complexo com o repressor, inativando-o. Este perde a capacidade de se ligar ao operador, liberando assim o promotor, o que faz com que haja transcrio e subsequente sntese enzimtica. Trp - O triptofano age como co-repressor que se liga ao repressor ativando-o. O complexo repressor/co-repressor ocupa o stio operador, inibindo o promotor, que no aceita a ligao da RNA polimerase. No h traduo nem transcrio. 4. Os operons so sistemas de regulao que respondem a estmulos diretos do meio externo. Sendo eficientemente tamponados contra a maioria das influncias externas os eucariotos no necessitam de mecanismos de resposta direta mas, por outro lado, uma vez que comportam reaes metablicas muito mais complexas, tambm necessitam de sistemas de regulao gnica muito mais elaborados, o que assegurado pelos chamados circuitos pr programados de expresso gnica. Nestes, que comportam vrios escales de

genes, a ativao sempre ocorre em cadeia, e a regulao processa-se tanto a nvel de transcrio como de processamento de hnRNA. 5.a) O operon expressa-se continuamente; b) Idem; c) O operon nunca se expressa; d) Idem; e) Ocorre sntese da beta-galactosidase, mas a cadeia da beta-galactosdeo permease sintetizada apenas at o ponto da mutao e no h sntese de betagalactosdeo transacetilase; f) Acumulo de mRNA na clula, sempre degradando lactose. 6. Repressor - uma protena sintetizada pelos genes reguladores e especfica para cada operon. A sua funo ligar-se ao stio operador inibindo a expresso do operon. Indutor - uma molcula efetora que atua nos sistemas de induo e, uma vez presente, forma um complexo com o repressor, impedindo a sua ligao ao operador, deprimindo assim o operon. 7. Sim porque se tratando de um operon reprimvel, a sua expresso contnua a menos que esteja presente o co-repressor especfico que, neste caso, o triptofano. 8.a) Galr sintetiza o repressor que se liga ao operador, isto provoca a inibio do promotor, que no aceita a ligao da RNA polimerase e, portanto, no h expresso do operon pois no haver transcrio nem traduo. b) Como indutor, a galactose liga-se ao repressor sintetizado por galr, impedindo sua ligao ao operador. Logo haver o acoplamento da RNA polimerase e a consequente transcrio e traduo do operon.

4 Lista de Exerccios
Diviso Celular e Alteraes Cromossmicas

1) Imagine 2 planta de gentipo AA e aa. Como voc sintetizaria um triplide de gentipo Aaa? Esquematize: 2) Estudando os cromossomos de um co macho, com distrofia muscular (gene recessivo, ligado ao X), descobriu-se que ele tinha um cromossomo Y e dois cromossomos X (caritipo 79, XXY). Seus pais eram normais e sem distrofia muscular. Qual foi o erro que deu origem a esse animal? Em qual dos pais ocorreu este erro? Por qu? 3) Esquematize e compare as clulas germinativas, na prfase I e prfase II em uma espcie caracterizada pelo genoma 2n=6. 4) Quantos cromossomos h nas clulas do intestino na anfase II? 5) Como voc sintetizaria um pentapoliplide (5n)? Esquematize. 6) Em uma espcie cujo nmero haplide 19 quantos dos elementos abaixo devem haver em cada clula: a) Cromtide na metfase I? b) Cromossomos na anfase mittica? c) Cromtides na metfase II? d) Cromossomos no final da telfase II? 7) Uma clula de gentipo Aa sofre mitose. Quais os gentipos das clulas filhas? 8) Uma clula de gentipo Aa sofre meiose. Quais os gentipos das clulas filhas? 9) Quantos tipos diferentes de gametas sero produzidos pelos seguintes gentipos, se todos os genes estiverem situados em cromossomos diferentes? a) AA b) Aa c) AaBB d) AaBb e) AABbCC f) AaBBCcddEe

10) Quantos e quais os tipos de gametas podem ser produzidos pelo seguinte gentipo heterozigoto AaBbCc, considerando que os loci A, B e C se encontram todos no mesmo cromossomo e no ocorrem mecanismos de recombinao? 11) Um indivduo produz os gametas AB, Ab, aB e ab em igual proporo. a) Qual o seu gentipo? b) Os genes A e B encontram-se no mesmo cromossomo? Justifique. 12) Em que estgio do ciclo celular ocorre a replicao do DNA? 13) Existem 40 cromossomos nas clulas somticas do rato. a) Quantos cromossomos um rato deve receber de sua me? b) Qual o nmero haplide do rato? 14) A aveia abssnia parece ser um tetraplide com 28 cromossomos. Se a aveia comum um hexaplide desta mesma srie, quantos cromossomos deve possuir? 15) O nmero haplide de um certo organismo 12. Quantos cromossomos devem ser encontrados em: a) Um monossmico? b) Um trissmico? c) Um tetrassmico? d) Um trissmico duplo? e) Um nulissmico? f) Um monoplide (ou haplide)? g) Um triplide? h) Um tetraplide? 16) Considerando um cromossomo normal com a sequncia de bandeamento 12345678 determine o tipo de alterao e o provvel esquema de pareamento com o homlogo normal em cada uma das situaes abaixo: a) 12365478 b) 125678 c) 1234345678 d) 12345876

17) O cromossomo 1 da Drosophila possui a sequncia gnica ABCDEF e o cromossomo 2 a sequncia MNOPQR. Uma alterao cromossmica resultou nos arranjos ABCPQR e MNODEF. Determine o tipo de alterao ocorrida e todas as possibilidades de segregao durante a gametognese. 18) Classifique os arranjos cromossmicos simbolizados abaixo: a) n b) 2n c) 2n + 1 d) 2n 1 e) 2n + 2 f) 3n g) 4n h) 2n + 1 + 1 i) 2n 2 19) Suponha que parte do brao curto de um cromossomo 5 da espcie humana se ligue no reciprocamente ao brao longo do cromossomo 13. Este fenmeno considerado uma translocao simples balanceada, uma vez que todo o material gentico est presente e o fentipo , portanto, normal. Contudo, quando um dos cromossomos 5 apresenta a falta de um segmento no seu brao curto ocorre uma anomalia conhecida como cri du chat e trs cpias do brao curto levam morte logo aps o nascimento. Se uma pessoa portadora de translocao simples se casa com um companheiro normal, determine o resultado esperado, considerando: a) As caractersticas cromossmicas; b) As caractersticas fenotpicas.

Gabarito da 4 Lista de Exerccios 1. Cruzamento entre AA e aa induzindo mutao nos genes aa (fazendo com que permaneam ligados). 2. Mutao. O erro ocorreu na me onde houve ligao dos cromossomos que no se separaram durante a meiose. Ela pode ser heterozigota sendo fenotipicamenete normal. O pai s fornece Y no tendo como passar a distrofia. Para o macho, basta a presena de apenas um gene recessivo para que manifeste a doena. 3. Prfase I: nmero de cromossomos = 6 e nmero de cromtides = 12; Prfase II: Nmero de cromossomos = 3 e nmero de cromtides = 6. 4. No intestino no ocorre anfase II. No intestino so clulas somticas que sofrem apenas mitose e no meiose. 5. Cruzamento entre um 8n + 2n ou 4n + 6n. 6. a) 76; b) 76; c) 38; d) 19. 7. Todos Aa 8. 50% A e 50% a. 9.a) 1; b) 2; c) 2; d) 4; e) 2; f) 8. 10. Se no ocorrer recombinao entre eles, permanecero os mesmos cromossomos: ABC e abc. 11.a) AaBb; b) No, porque se estivessem no mesmo cromossomo a formao dos quatro tipos de gametas seria devida ocorrncia de permuta, que no ocorre em todas as clulas e as propores seriam diferenciadas. 12. Fase S. 13. a) 20; b) 20. 14. 42. 15.a) 23; b) 25; c) 26; d) 26; e) 22; f) 12; g) 36; h) 48.

16.a) Inverso intercalar heterozigota; b) Deleo intercalar heterozigota; c) Duplicao intercalar heterozigota; d) Inverso terminal heterozigota. 17. Translocao recproca heterozigota. Possveis gametas: ABCDEF, MNODEF, ABCPQR, MNOPQR, ABCDEF, MNOPQR, MNODEF, MNOPQR, ABCDEF, MNOPQR, ABCPQR, MNODEF. 18.a) Haploidia ou monoploidia; b) Diploidia; c) Trissomia; d) Monossomia; e) Tetrassomia; f) Triploidia; g) Tetraploidia; h) Dupla Trissomia; i) Nulissomia. 19.a) Caractersticas cromossmicas: 1 normal: 1 translocado simples balanceado: 1 portador de deleo heterozigoto do brao curto do cromossomo 5: 1 portador de duplicao heterozigota do brao curto do cromossomo 5;
b)1 cri du chat: 2 normais: 1 morte precoce.