Вы находитесь на странице: 1из 29

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

NOMBRE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . APELLIDOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CALLE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . POBLACIN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . PROVINCIA . . . . . . . . . . . . . . . . . . . C.P. . . . . . . . . . . . . . . . . . . . .

BIOLOGA (Curso de Acceso)

PRUEBA DE EVALUACIN A DISTANCIA / 1 UNIDAD DIDCTICA / 1

Nmero de Expediente

Gloria Morcillo Ortega

0100008PE01A14

CURSO 2002/2003

0100008 Biologa (Curso de Acceso). Primera prueba

Prueba de Ensayo
1. Representa esquemticamente la estructura de un nucletido utilizando los siguientes smbolos para indicar los elementos que lo componen: un pentgono para la pentosa, un crculo para el fosfato y un rectngulo para la base nitrogenada.

2. Utilizando los mismos smbolos que en la pregunta 1 para representar los componentes de los nucletidos, representa esquemticamente: I) un fragmento de RNA de 4 nucletidos II) un fragmento de DNA de 4 pares de nucletidos

3. Indica la funcin principal de los siguientes orgnulos celulares:

0100008 Biologa (Curso de Acceso). Primera prueba

Ribosomas:

Mitocndrias:

Cloroplastos:

Ncleo:

Flagelos:

4. A continuacin se representa la secuencia de bases nitrogenadas de un fragmento de DNA; representa la secuencia de bases del RNA que resultar de la transcripcin de este fragmento. AGGCTATTCGATTACG

0100008 Biologa (Curso de Acceso). Primera prueba

5. Una determinada protena tiene 75 aminocidos. Cuntos nucletidos tendr el RNA mensajero que codifica para estos 75 aminocidos?

6. Consulta una tabla del cdigo gentico para deducir los aminocidos codificados por el siguiente fragmento de RNA-m: AUGGUGGCUCCAUACGGUUAA

0100008 Biologa (Curso de Acceso). Primera prueba

7. Qu quiere decir clonar un gen? Indica brevemente cules seran las etapas fundamentales que se requieren para clonar un gen humano en una bacteria.

8. Qu es una clula madre? Qu caractersticas tiene?

0100008 Biologa (Curso de Acceso). Primera prueba

Prueba Objetiva
1. Los aminocidos son las unidades que constituyen: a) los polisacridos b) los cidos nucleicos c) los genes d) las protenas e) las macromolculas 2. La estructura primaria de una enzima es: a) el orden o secuencia de sus aminocidos b) la secuencia de sus nucletidos c) la secuencia de bases nitrogenadas d) la secuencia de enlaces de hidrgeno e) la secuencia de tripletes 3. Ncleo, cloroplastos y retculo endoplsmico: a) son orgnulos de las clulas procariticas b) son orgnulos implicados en la produccin de energa c) son orgnulos celulares d) son orgnulos fundamentales para todos los tipos de clulas e) ninguna alternativa es correcta 4. Las membranas celulares estn compuestas fundamentalmente por: a) azcares y polisacridos b) fosfolpidos y protenas c) polisacridos y lpidos d) glucosa y protenas e) colesterol 5. A continuacin se indican algunas posibles diferencias entre el DNA y el RNA: 1) En el RNA el uracilo sustituye a la timina. 2) En el RNA el uracilo sustituye a la guanina. 3) El RNA es una cadena sencilla, el DNA es una doble hlice. 4) El DNA est en el ncleo, mientras que el RNA nunca se encuentra en el ncleo. Indicar cuales de estas frases son correctas: a) 1-3-4 b) 1-3 c) 1-2-3 d) 1-2-3-4 e) 3- 4 6. De las siguientes molculas cul es la que transporta los aminocidos al ribosoma para la sntesis de protenas? a) RNA de transferencia (RNA-t) b) RNA mensajero (RNA-m) c) ATP d) RNA ribosmico (RNA-r) e) todas son correctas

0100008 Biologa (Curso de Acceso). Primera prueba

7. En la sntesis de protenas, los genes: a) son productores de aminocidos b) forman los enlaces dipptido c) determinan el orden o secuencia de aminocidos d) sintetizan los aminocidos e) regulan el transporte de los aminocidos 8. El triplete o codn UCU codifica para el aminocido serina. Esto quiere decir que: a) se necesita U y C para le sntesis de serina b) UCU es una forma abreviada de indicar serina c) si se aade UCU a las clulas se producir serina d) la secuencia UCU de un RNA mensajero codifica serina e) las bases UCU en el DNA significa serina 9. Los monmeros que constituyen el DNA se denominan: a) purinas b) bases c) nucletidos d) azcares e) aminocidos 10. La informacin gentica est codificada en el DNA por: a) la secuencia de bases nitrogenadas b) la secuencia regular de fosfato y desoxirribosa c) los aminocidos d) los nucleosomas e) todas las anteriores son correctas 11. Todas las protenas estn formadas a partir de: a) 4 tipos de aminocidos b) 20 tipos de aminocidos c) 64 tipos de aminocidos d) 64 tripletes de aminocidos y distintos tipos de enzimas e) 4 tipos de aminocidos y 4 nucletidos 12. Cul de los siguientes elementos qumicos no es abundante en la materia viva? a) carbono b) oxigeno c) fosforo d) silicio e) hidrgeno 13. De los siguientes compuestos Cul encontraremos en la materia viva en mayor cantidad? a) DNA b) protenas c) lpidos d) glcidos e) agua

0100008 Biologa (Curso de Acceso). Primera prueba

14. Una de las siguientes combinaciones representa un nucletido en una molcula de RNA: a) Guanina-desoxirribosa-fosfato b) Timina-ribosa -fosfato c) Uracilo-desoxirribosa-fosfato d) Adenina-ribosa-fosfato e) Citosina-desoxirribosa-fosfato 15. En el ncleo celular se encuentra: a) el centriolo b) los ribosomas c) la cromatina d) las mitocondrias e) el retculo 16. Los cambios en el programa gentico se denominan. a) mutaciones b) adaptaciones c) combinaciones d) seleccin e) replicacin 17. La estructura de doble hlice del DNA fue descubierta por: a) Cajal b) Mendel c) Darwin d) Einstein e) Watson y Crick 18. Una clula muscular y una nerviosa de un mismo organismo son diferentes debido a que: a) tienen diferentes genes b) tienen mutaciones c) expresan diferentes genes d) tienen diferentes orgnulos e) todas las anteriores son ciertas 19. Si UCA es un codn en el m-RNA su anticodn en el t-RNA ser: a) UGT b) UCA c) TGT d) AGU e) ninguna es correcta 20. De los siguientes elementos cual no est directamente implicado en la sntesis de protenas: a) RNAm b) ribosomas c) DNA d) RNAt e) aminocidos

CONSULTAS REFERENTES AL CONTENIDO DE LOS TEMAS Y METODOLOGA DE SU ESTUDIO

RESPUESTAS DEL PROFESOR

EVALUACIN

PRUEBA OBJETIVA Aciertos Errores Omisiones TOTAL

PRUEBA DE ENSAYO

TOTAL

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

NOMBRE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . APELLIDOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CALLE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . POBLACIN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . PROVINCIA . . . . . . . . . . . . . . . . . . . C.P. . . . . . . . . . . . . . . . . . . . .

BIOLOGA (Curso de Acceso)

PRUEBA DE EVALUACIN A DISTANCIA / 2 UNIDAD DIDCTICA / 2

Nmero de Expediente

Isabel Portela Peas

0100008PE01A14

CURSO 2002/2003

0100008 Biologa (Curso de Acceso). Segunda prueba

1. De las siguientes proposiciones referidas a la nutricin humana cul no es correcta? a) Los nutrientes energticos contenidos en el alimento aportan la energa necesaria para el desarrollo de las funciones vitales. b) El objetivo de los procesos digestivos es la transformacin del alimento para obtener de l los nutrientes que contiene. c) Los carbohidratos son los nutrientes con mayor valor energtico. d) La energa contenida en los nutrientes se considera de tipo qumico y se libera en los procesos digestivos y metablicos. 2. Elija la proposicin falsa: a) El almidn es una molcula de reserva glucdica en los vegetales. b) El almidn es una molcula de reserva proteica en los vegetales. c) El glucgeno es una molcula de reserva glucdica en los animales. d) El glucgeno es un polmero de glucosa propio de las clulas animales. 3. El Ciclo de Krebs es: a) Gluclisis en la que se obtiene cido pirvico. b) Va fermentativa para la degradacin del cido pirvico. c) Va respiratoria para la degradacin del cido pirvico. d) Fotosntesis o reaccin de utilizacin directa de energa solar. 4. Elija la proposicin falsa. En la fotosntesis los organismos auttrofos: a) Sintetizan molculas de glucosa. b) Desprenden oxgeno y agua. c) Utilizan la luz solar como fuente de energa. d) Toman dixido de carbono y agua del medio ambiente. 5. Cul es la respuesta incorrecta?: a) La glucolisis es un proceso anaerbico. b) En la degradacin de la glucosa a cido pirvico se consume energa. c) La liberacin de energa es mayor en la respiracin aerbica que en la fermentacin. d) En la glucolisis una molcula de glucosa da lugar a dos de cido pirvico con liberacin de energa. 6. Elija la proposicin correcta, desde un punto de vista de balance energtico: a) La respiracin aerobia de la glucosa, en la que se sintetizan 38 ATP, es ms eficaz que la anaerobia. b) La respiracin aerobia de la glucosa es menos eficaz que la anaerobia. c) Es lo mismo una va metablica aerbica que una fermentativa. d) La respiracin aerobia de la glucosa, en la que se sintetizan 28 ATP, es ms eficaz que la anaerobia.

0100008 Biologa (Curso de Acceso). Segunda prueba

7. Elija la proposicin correcta: a) El anabolismo es la fase del metabolismo en la que grandes molculas se reducen a otras ms pequeas. b) Las reacciones de sntesis metablica se denominan anablicas y transcurren con gasto energtico. c) Las reacciones catablicas slo afectan a las molculas de glucosa, que son muy ricas en energa. d) El catabolismo transcurre con gasto energtico. 8. En el proceso de respiracin en el hombre: a) En los pulmones la sangre venosa cede oxgeno y toma dixido de carbono b) En los pulmones la sangre venosa cede dixido de carbono y toma oxgeno. c) De los pulmones sale sangre arterial cargada de dixido de carbono. d) A los pulmones llega sangre venosa rica en oxgeno. 9. En la respiracin el intercambio de gases ocurre: a) Por difusin desde una zona de baja concentracin a una de mayor concentracin. b) Por difusin entre la sangre y el aire de los pulmones. c) En la superficie respiratoria donde se difunde O2 al exterior del cuerpo y CO2 hacia el interior. d) A travs de la superficie respiratoria por transporte activo. 10. Tras el intercambio respiratorio en los alvolos pulmonares: a) La hemoglobina de los eritrocitos est combinada con CO2 en una elevada proporcin. b) Los eritrocitos poseen muy poca hemoglobina. c) La hemoglobina de los eritrocitos est combinada con oxgeno en una elevada proporcin. d) La hemoglobina de los eritrocitos est combinada con oxgeno en una mnima proporcin. 11. Describa el proceso mecnico y fisiolgico que tiene lugar en el aparato respiratorio humano durante las etapas respiratorias de inspiracin-espiracin.

0100008 Biologa (Curso de Acceso). Segunda prueba

12. La molcula que ocupa el eritrocito y se oxida al captar el oxgeno es: a) Fibrina. b) El dixido de carbono, CO2. c) Hemoglobina. d) Trombina. 13. Qu tipo de molcula es la hemoglobina? a) Un polisacrido estructural. b) Una lipoprotena. c) Una protena globular de estructura cuaternaria. d) Una protena con funcin enzimtica. 14. La insulina es: a) Una enzima pancretica que acta sobre el glucgeno para liberar glucosa. b) Hormona pancretica que acta sobre el glucgeno para liberar glucosa. c) Lo mismo que el glucagn. d) Hormona pancretica que acta disminuyendo la concentracin de glucosa en sangre. 15. El aumento de glucosa en sangre a partir de glucgeno se debe a: a) Exclusivamente a la accin del glucagn pancretico. b) Tanto a la accin hormonal del pncreas como a la accin hormonal de las cpsulas suprarrenales. c) La actividad ovrica. d) Todas las respuestas anteriores son falsas. 16. Elija la proposicin correcta: Las hormonas son: a) Un producto de secrecin interna exclusivamente animal. b) Productos de secrecin interna que actan como mensajeros qumicos para regular la funcin de otro tejido u rgano. c) Biocatalizadores que actan sobre rganos internos slo a travs del sistema nervioso. d) Siempre neurohormonas. 17. La adrenalina y la noradrenalina son: a) Hormonas suprarrenales. b) Hormonas hipofisiarias. c) Enzimas pancreticas. d) Hormonas ovricas y testiculares, respectivamente. 18. Las neurohormonas son hormonas: a) Sintetizadas por el tiroides. b) Producidas por el hipotlamo. c) Segregadas por la corteza suprarrenal. d) Con funcin digestiva, por ejemplo, la insulina.

0100008 Biologa (Curso de Acceso). Segunda prueba

19. Por homeostasis entendemos: a) El equilibrio hdrico del organismo, cuando las prdidas se compensan con los ingresos. b) Equilibrio qumico interno en un organismo. c) La actividad renal. d) El resultado de la accin respiratoria. 20. En el rin de los Vertebrados, se denomina Cpsula de Bowman a: a) Cada uno de los conductos que unen el rin con la vejiga urinaria. b) Estructura bulbosa en el extremo de la nefrona que engloba al glomrulo. c) La corteza que recubre cada uno de los riones. d) Es sinnimo de urter. 21. La hipfisis: a) Produce y libera a la sangre tiroxina. b) Almacena las hormonas antidiurtica o ADH y oxitocina producidas por el hipotlamo. c) Se localiza en el cuello muy prxima al tiroides. d) Produce y libera a la sangre adrenalina. 22. Elija la respuesta falsa: a) La aldosterona es una hormona, producida por las cpsulas suprarrenales, que acta sobre la excrecin de sodio y la diuresis. b) La hormona antidiurtica ADH reduce la prdida de agua e induce la formacin de orina ms concentrada. c) La cantidad de ADH liberada a la sangre depende de la concentracin osmtica de sta. d) La hormona antidiurtica ADH aumenta la prdida de agua e induce la formacin de orina ms diluida. 23. La primera barrera defensiva del organismo la constituye: a) La piel y las mucosas. b) Los glbulos rojos. c) Los anticuerpos. d) Los antibiticos. 24. Cuando un microorganismo atraviesa la piel y las mucosas, las clulas de la zona afectada liberan: a) Histamina. b) Glbulos rojos. c) Hemoglobina. d) Pus. 25. La respuesta inmunitaria se caracteriza porque: a) Es inespecfica. b) Tiene memoria para recordar y reconocer a organismos patgenos a los que previamente haba estado expuesto. c) Se induce ante la presencia de un anticuerpo. d) Es la primera barrera defensiva del organismo.

0100008 Biologa (Curso de Acceso). Segunda prueba

26. Un antgeno es: a) Lo contrario de un anticuerpo. b) Cualquier sustancia extraa que es reconocida como ajena y desencadena en el organismo una respuesta inmunitaria. c) Es una protena sintetizada por un linfocito para neutralizar a un anticuerpo. d) Una clula defensiva del organismo. 27. Un anticuerpo es: a) Lo contrario de un antgeno. b) Cualquier sustancia extraa que desencadena en el organismo una respuesta inmunitaria. c) Una clula defensiva del organismo. d) Protena especfica, una inmunoglobulina, que reconoce antgenos especficos y se une a ellos. 28. El potencial neuronal de reposo tras la propagacin del impulso nervioso se logra por: a) Transporte activo de Na+ hacia el exterior neuronal y de K+ hacia el interior. b) Transporte activo de K+ hacia el exterior neuronal y de Na+ hacia el interior. c) Difusin de Na+ hacia el exterior neuronal y de K+ hacia el interior. d) Difusin de K+ hacia el exterior neuronal y de Na+ hacia el interior. 29. Un neurotransmisor es: a) Sustancia qumica liberada por la neurona presinptica y recogida por la neurona postsinptica. b) Prolongacin de la neurona presinptica que se une a la neurona postsinptica. c) Sustancia qumica que se propaga a lo largo de la neurona. d) Sustancia qumica exclusiva de las fibras mielnicas. 30. Cul es la clula que convierte estmulos en seales electroqumicas de rpida transmisin?: a) Endocrina. b) Neurona. c) Fibra muscular. d) Meitica. 31. El sistema nervioso central est formado por: a) Todas las neuronas del organismo. b) El encfalo y la mdula espinal. c) Por los nervios sensitivos y los nervios motores. d) Por los arcos reflejos.

0100008 Biologa (Curso de Acceso). Segunda prueba

32. Elija la proposicin falsa: a) Las acciones simptica y parasimptica del sistema nervioso autnomo son antagnicas. b) Los sistemas nerviosos simptico y parasimptico son anatmica y funcionalmente diferentes. c) Los nervios simpticos proceden de la regin media torcica y lumbar de la mdula espinal. d) El sistema nervioso central y el autnomo utilizan los mismos nervios para transmitir sus respuestas. 33. Elija la proposicin correcta en trminos ecolgicos: a) Los organismos descomponedores se alimentan exclusivamente de restos orgnicos vegetales. b) Los organismos productores constituyen el primer eslabn en una cadena trfica en un ecosistema. c) Los organismos consumidores de segundo orden obtienen su alimento consumiendo vegetales. d) El primer eslabn de una cadena trfica en un ecosistema son los organismos consumidores de primer orden. 34. En un ecosistema: a) Los organismos productores son auttrofos. b) Los organismos productores son hetertrofos. c) Los organismos consumidores primarios se alimentan de los secundarios. d) Los organismos descomponedores se alimentan exclusivamente de los productores. 35. El CO2 atmosfrico es incorporado al mundo orgnico de los seres vivos a travs de: a) La actividad respiratoria de los animales. b) La combustin de los restos vegetales. c) La actividad fotosinttica. d) La accin descomponedora de las bacterias del suelo. 36. Cmo es el recorrido de la energa en un ecosistema? qu organismos diferentes y con qu papel participan?

CONSULTAS REFERENTES AL CONTENIDO DE LOS TEMAS Y METODOLOGA DE SU ESTUDIO

RESPUESTAS DEL PROFESOR

EVALUACIN

PRUEBA OBJETIVA Aciertos Errores Omisiones TOTAL

PRUEBA DE ENSAYO

TOTAL

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

NOMBRE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . APELLIDOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CALLE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . POBLACIN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . PROVINCIA . . . . . . . . . . . . . . . . . . . C.P. . . . . . . . . . . . . . . . . . . . .

BIOLOGA (Curso de Acceso)

PRUEBA DE EVALUACIN A DISTANCIA / 3 1 UNIDAD DIDCTICA / 3

Nmero de Expediente

Mara P. Gonzlez Gonzlez

0100008PE01A14

CURSO 2002/2003

0100008 Biologa (Curso de Acceso). Tercera prueba

1. Los sucesos que ocurren en la ....................................... son los que ms se parecen a los de la mitosis, excepto que las clulas son .................................................. a) Interfase diploides. b) Interfase haploides. c) Meiosis II diploides. d) Meiosis II haploide.

2. Uno de los sucesos ms tempranos que ocurren en la profase I de la meiosis y que la distinguen claramente de una mitosis es: a) Prdida de la membrana nuclear. b) Condensacin de las cromtidas. c) Desplazamiento de los cromosomas hacia la placa metafsica. d) Apareamiento de los cromosomas homlogos.

3. En qu momento de la meiosis las clulas se vuelven haploides? a) Profase I b) Anafase I c) Telofase I d) Profase II

4. Existe una variedad de uvas pasas sin semillas cuyas clulas son triploides, es decir, con tres copias de cada cromosoma. Qu estadio del ciclo celular no podrn completar estas clulas triploides? a) Meiosis I b) Periodo S c) Meiosis II d) G2 5. Como Vd. Sabe, al final de la meiosis se originan cuatro clulas con cromosomas no idnticos que darn origen a una gran variabilidad de los gametos. En qu fase de la meiosis se va a producir esta variabilidad? a) Profase I b) Anafase I c) Telofase I d) Profase II

0100008 Biologa (Curso de Acceso). Tercera prueba

6. Haga una comparacin entre meiosis y mitosis con relacin a: 1) Comportamiento de los cromosomas. 2) Nmero de cromosomas. 3) Identidad gentica de los descendientes.

7. Busque las diferencias ms notables que existen entre la reproduccin asexual y la reproduccin sexual e indique su significado biolgico.

0100008 Biologa (Curso de Acceso). Tercera prueba

8. Cul de las siguientes afirmaciones, referida a la mitosis, es falsa? a) Una nica clula da origen a dos clulas hijas iguales. b) Los cromosomas homlogos se aparean en la profase. c) Durante la anafase los centrmeros se dividen. d) En la metafase se forma la placa ecuatorial o metafsica.

9. Indicar brevemente en qu consisten las siguientes mutaciones: 1.0 Delecin; 2. Duplicacin; 3. Inversin y 4. Traslocacin.

10. Escribir el genotipo de: a) Un individuo de una lnea pura dominante. b) Un homocigtico recesivo para un carcter. c) Un heterocigtico para dos caracteres. d) Un hbrido en un caso de herencia dominante. e) Un individuo diheterocigtico. f) Un polihbrido. g) Los descendientes obtenidos del cruzamiento de a) y b).

0100008 Biologa (Curso de Acceso). Tercera prueba

11. Los saltamontes tienen en sus clulas somticas dos cromosomas X, si se trata de una hembra, y un nico cromosoma sexual X si se trata de un macho. a) Qu sexo tendr un saltamontes que tiene 23 cromosomas en sus clulas somticas? b) Cuntos autosomas tendr en sus clulas somticas? c) Y en los gametos? d) Tendr gametos sin ningn cromosoma sexual?

12. Explicar que son los genes letales. Si una mujer lleva en uno de sus cromosomas X un alelo letal recesivo y en el otro cromosoma X el alelo normal dominante. Qu tanto por ciento de sus descendencia, tanto hijos como hijas, sobrevivir si se casa con un hombre no afectado por ese alelo?

13. Hacer un esquema que explique la metodologa experimental de Mendel.

0100008 Biologa (Curso de Acceso). Tercera prueba

14. A qu se debi el xito de Mendel frente a los investigadores de su poca que trabajaban en el tema de la herencia?

15. Poner un ejemplo que muestre una excepcin a las leyes de Mendel y razonar el motivo por el que stas no se cumplen.

0100008 Biologa (Curso de Acceso). Tercera prueba

16. Sealar si son verdaderas o falsas las siguientes afirmaciones: a) Los genes letales siempre presentan desventajas evolutivas. b) Los genes localizados en la parte no homloga de los cromosomas sexuales se llaman genes ligados al sexo. c) El fenotipo de un individuo depende de los genes que posea, de las posibles interacciones entre ellos y de los factores ambientales. d) La manifestacin del fenotipo, en el caso de los genes recesivos ligados al sexo, es ms frecuente en el sexo heterocigtico.

17. Completar las siguientes afirmaciones: a) Los genes que determinan las variaciones del mismo carcter y que ocupan loci correspondientes en los cromosomas homlogos se llaman b) Al trozo de ADN, de un determinado cromosoma, que determina un carcter se le denomina c) Cualquier alelo que tiene capacidad para manifestar su fenotipo en un individuo heterocigtico se le denomina d) Los genes de un mismo cromosoma tienden a ser heredados juntos y se les conoce como

18. Explicar pormenorizadamente al menos dos formas por las que puedan originarse nuevas especies.

0100008 Biologa (Curso de Acceso). Tercera prueba

19. A qu causas cree que se debe que el guila real est en peligro de extincin?

20. Qu justificacin cientfica propondra un lamarckiano y un darwiniano para explicar la adaptacin a la carrera veloz de los herbvoros de llanura?

0100008 Biologa (Curso de Acceso). Tercera prueba

Problemas
1. El color negro de la lana de los corderos es debido a un alelo recesivo n frente a su alelo N que produce color blanco. Al cruzar un cordero blanco con una oveja blanca se obtiene un corderito blanco. Cuando ste se cruza con una oveja negra nace un borrego negro. Indicar razonadamente los genotipos de todos los animales del problema.

2. En la especie humana existe una enfermedad autosmica recesiva que es la ceguera para los colores. Las personas que la padecen tienen una visin restringida a los tonos grises. Una pareja con visin normal pero en la que ambos tienen un padre con ceguera para los colores, le pide consejo gentico para saber la probabilidad que tienen de tener hijos afectados. Cul sera su respuesta?

3. El color del plumaje de los periquitos es debido a dos pares de genes. El color amarillo es producido por el par AA o Aa siendo blanco el aa. El segundo par BB o Bb produce el pigmento azul siendo el bb blanco. Un genotipo aabb no fabrica ningn tipo de pigmento y el plumaje es blanco. Cuando el genotipo es AABB produce los dos tipos de pigmento, azul y amarillo, y el resultado es un plumaje verde. Qu genotipo tendr un periquito azul? Qu resultado obtendremos de cruzar un periquito amarillo (AAbb) con uno verde heterocigtico (AaBb)?

0100008 Biologa (Curso de Acceso). Tercera prueba

4. Se presenta ante un juez una demanda de divorcio en la que el marido alega que sus dos primeros hijos, uno con grupo sanguneo AB y otro con grupo sanguneo O, son suyos, mientras que un tercero, de grupo sanguneo B, no lo reconoce como suyo. Deducir los grupos sanguneos de la pareja e indicar si el juez con los datos aportados puede resolver a su favor.

5. Supongamos que un gen A1 determina un color rojo y es dominante en las hembras, mientras que su alelo A2 produce el color negro y es dominante en los machos. Indicar los resultados que obtendramos al cruzar un individuo A1A1 con otro A2A2. Los resultados que obtenemos variaran si consideramos que el primer individuo es el macho y el segundo la hembra o a la inversa? Razonar todos los pasos seguidos.

10

0100008 Biologa (Curso de Acceso). Tercera prueba

6. Cuatro amigos que se desplazan juntos tienen un accidente de automvil y mientras tres de ellos salen ilesos el cuarto tiene una fuerte hemorragia que necesita con urgencia una transfusin. El mdico plantea una donacin entre ellos y los datos que aportan son los siguientes: 1. El herido es del grupo sanguneo A y Rh+ 2.o Uno de los amigos es del grupo O y sabe que sus padres son los dos Rh-. 3. Otro de los amigos no conoce su grupo pero sabe que sus padres son uno del grupo O y el otro del grupo A. 4. El ltimo del grupo tambin desconoce su grupo sanguneo pero sus padres son los dos del grupo B Rh+ . Con todos estos datos qu amigo o amigos del herido puede ser donante?

7. Una joven que tiene coagulacin normal de la sangre pero que tiene un padre hemoflico, se casa con un hombre hemoflico. Deducir el genotipo de la pareja e indicar los genotipos, fenotipos y probabilidades de tener hijos con hemofilia.

CONSULTAS REFERENTES AL CONTENIDO DE LOS TEMAS Y METODOLOGA DE SU ESTUDIO

RESPUESTAS DEL PROFESOR

EVALUACIN

PRUEBA OBJETIVA Aciertos Errores Omisiones TOTAL

PRUEBA DE ENSAYO

TOTAL

Похожие интересы