Вы находитесь на странице: 1из 137

1

Tese apresentada ao Programa de Ps-Graduao em Biologia Celular e Tecidual do Instituto de Cincias Biomdicas da Universidade de So Paulo, para obteno do Ttulo de Doutor em Cincias.

Jnatas Bussador do Amaral

CLULAS MCF-7 COMO MODELO 3D NO ESTUDO DE CNCER DE MAMA HUMANO

Tese apresentada ao Programa de PsGraduao em Biologia Celular e Tecidual do Instituto de Cincias Biomdicas da Universidade de So Paulo, para obteno do Ttulo de Doutor em Cincias. rea de concentrao: Biologia Celular e Tecidual Orientadora: Profa Dra Glucia Maria Machado-Santelli

So Paulo 2010

PARA CAROL, COM TODO MEU AMOR, CUIDADO E ENTREGA

AGRADECIMENTOS
Aps esses seis anos de doutoramento, tanta coisa aconteceu... tantas pessoas me ajudaram... Comecemos com os mais prximos: famlia! Me, Pai, Bela e Marga...muito obrigado por toda a ajuda, pelas oraes, pelas risadas e principalmente por dividirem comigo meus momentos de choradeiraao falar de um novo amaleke (momento sempre tratado com muito bom humor pelo meu pai). Agradeo tambm ao sempre solcito e boa gente Pasc por sua ajuda e pelas conversas. No posso esquecer meus sobrinhos queridos, Vincent e Olivi...que tambm me trazem momentos de paz mesmo estando o tio sempre no laboratrio. minha grande amiga Keity por SEMPRE tentar arranjar espaos em nossas agendas para a atualizao dos fofocolelis...sempre 5 agradveis minutos de conversa... Ao Roberto por toda a ajuda com as imagens, pelas horas de confocal, pelas conversas e por ter me ensinado a fazer montagens usando o padro helicoidal dos distritos de Paris. A Bety, por ser to gente boa, sempre acreditar em mim e por me ajudar tanto no momento de PNICO no Rio de Janeiro. Aos coligados e gafanhotos pelos diversos momentos de alegria: Bruno, sis, Stefnia, Cris, Humberto, Marisa Ionta, Marisa Rangel, Lu, Marco, Nati (Suzinha), Marcel, Raquel, Tati, Adam, Amalex, Raji e Carla Lambidinha. Aos amigos do setor de microscopia eletrnica: Edso e Gaspar por tanta conversa jogada fora! minha grande amiga Vanessa, essa merece muitos agradecimentos! Ali, no front da bancada, foi a pessoa que me viu mais fragilizado, mais choror. SEMPRE tinha uma frase de incentivo, nunca deixando a peteca cair...obrigado por no permitir que eu enlouquece na frente das bandas do western. Aos professores Zago e Bauer por aumentarem a minha fascinao por histologia. A Diabolim por sempre ajudar na hora do sufoco, pelas risadas e por compartilhar tamanha maldadade.

Ao Al, pelo constante contrabando de muambas e por sempre ajudar com os artigos impossveis. Aos funcionrios da Biblioteca do ICB s secretrias do departamento A Bia, pelas conversas nos momentos difceis A Dona Nancy por toda ajuda no lab. A Mich e Evandro que, alm de serem timos amigos me ajudaram DEMAIS com a citmetria de fluxo. A Camis por sempre comprar a minha gua mineral. A Vivian pela sua gentileza e conversas Ao pulia Mingau, por permitir (de forma involuntria) que eu o arrebentasse nas lutas de boxe. Aos meus grandes amigos Fbio Sauveiro e Paula...como minha vida seria sem graa sem vocs trabalhando comigo. Amigos irmos... A Amandita!! Por tamanha amizade, por me agentar. Voc legal demais! Ao parasita rei, por ser mais um amigo que no deixa de me ligar...amigo que sempre vem contar os causos. O Bra deve ser lembrado...mesmo ele no me considerando amigo... Profa Dra Glucia Maria Machado-Santelli, ou mais conhecida como Chefa. Muito obrigado por tudo o que voc me ensinou. Obrigado pelo companheirismo, pela amizade. Obrigado pela ajuda nos momentos difceis (principalmente no comeo do meu doutorado). Obrigado mesmo!

O pensamento no possvel sem uma imagem (Aristteles)

Ns, morfologistas, vivemos em um mundo de cores... (Professor Henrique Leonel Lenzi)

RESUMO
Do Amaral JB. Clulas MCF-7 como modelo 3D no estudo de cncer de mama humano. [tese (Doutorado em Biologia Celular e Tecidual)]. So Paulo: Instituto de Cincias Biomdicas da Universidade de So Paulo; 2010. A cultura celular caracterizada por permitir a manuteno de clulas vivas em laboratrio independente do organismo que a originou. A utilizao desta tcnica possibilitou a melhor compreenso dos mecanismos moleculares da clula permitindo importantes avanos cientficos no que se refere, por exemplo, a produo de vacinas e a biologia da clula tumoral. A cultura de clulas em 3-dimenses (3D) derivou-se inicialmente da cultura de clulas comumente utilizadas (clulas em monocamada). O diferencial da cultura 3D permitir que as clulas explorem as 3dimenses do espao, aumentando assim as interaes com o ambiente e entre as clulas. Quando crescidas neste sistema, as clulas formam estruturas denominadas de esferides multicelulares. Estes esferides apresentam em seu interior uma heterogeneidade celular, formao de microambiente e exposio diferencial a diversos fatores como nutrientes e oxignio. Pelo fato destas caractersticas se mostrarem muito semelhantes a tumores avasculares in vivo, a cultura de clulas 3D avanou em diversas linhas de pesquisa tornando-se um modelo bastante utilizado em ensaios radiolgicos e de quimioterpicos. Em estudos relacionados biologia do cncer de mama, vem ganhando espao a utilizao de esferides para estudos que visam compreenso da morfognese do espao luminal. Inserido neste contexto, o objetivo deste trabalho foi de desenvolver um modelo de cultura 3D que possibilitasse avaliar a formao de esferides com 3 caractersticas no descritas na literatura : a no adio de mimticos de membrana basal; o uso de linhagem tumorais e, por fim , a exposio das clulas por perodos superiores a 30 dias em cultura 3D. Mostramos que as clulas MCF-7, nas condies acima descritas, reorganizam-se em estruturas tubulares e acinares. Em ambas situaes, a formao do lmen veio acompanhada pelo estabelecimento de uma camada de clulas polarizadas, arranjo este muito semelhante ao encontrado em glndulas mamrias. Os resultados apresentados apontam para a existncia de uma populao de clulas na linhagem MCF-7 que no esto totalmente comprometidas ao fentipo tumoral. Mantidos diferenciados, os esferides de clulas MCF-7 apontam como um novo modelo para estudos relacionados formao do lmen, permitindo assim explorar o papel de diferentes vias como as relacionadas a apoptose, autofagia diferenciao e sobrevivncia celular. Palavras-chave: Culturas de clulas em trs-dimenses. Mama. Neoplasias. Apoptose. Citoesqueleto. Esferides multicelulares.

10

ABSTRACT
Do Amaral JB. MCF-7 cells as a 3D model in the study of human breast cancer. [Ph. D. thesis (Cell and Tissue Biology)]. So Paulo: Instituto de Cincias Biomdicas da Universidade de So Paulo; 2010. Cell culture is characterized by maintaining live cells in the laboratory regardless of the organism in which they originated. This technique has contributed to better understanding of molecular cell mechanisms, permitting important scientific advances, for example, concerning vaccine production and tumor cell biology. Three-dimensional (3D) cell culture initially derived from commonly used cell cultures (monolayer cell cultures). As a particularity, a 3D cell culture permits cells to explore the three dimensions of the space thereby increasing cell-cell interactions, as well as interaction with the environment. When grown in this system, cells form structures known as multicelullar spheroids. The interior of these spheroids present cell heterogeneity, microenvironment formation and different exposure to factors, such as nutrients and oxygen. Owing to the fact that these characteristics are very similar to those of in vivo avascular tumors, 3D cell culture advanced in various research lines, thus becoming a widely used model in radiology and chemotherapy essays. In studies related to breast cancer biology, spheroids are becoming widely used in the aim to comprehend luminal space morphogenesis. In this context, the objective here was to develop a 3D culture model that made it possible to analyze spheroid formation using 3 characteristics that have not yet been described in the literature: without addition of basement membrane mimetic, use of tumor cell lines and, lastly, cell exposure for periods longer than 30 days in 3D cell culture. We showed that, in the aforementioned conditions, MCF-7 cells reorganize themselves in tubular and acinar structures. In both situations, lumen formation was accompanied by the establishment of a layer of polarized cells, an arrangement that is very similar to that of breast glands. The presented results suggest the existence of an MCF cell line population not completely committed to the tumor phenotype. When maintained as differentiated, MCF-7 cell spheroids can be a new model for studies regarding lumen formation, thereby exploring the role of diiferent pathways, such as those related to cell apoptosis, autophagy, differentiation and survival.
Keywords: Three dimensional cell culture. Breast. Neoplasias. Apoptosis. Cytoskeleton. Multicelular Spheroids.

11

LISTA DE ILUSTRAES
Figura 1 - Esquema mostrando o modelo proposto por Harrison para cultivo celular............................. 18 Figura 2 - Esquema mostrando a diferena entre o arranjo espacial de culturas em monocamada e em 3 dimenses.............................................................................................................19 Figura 3 Esquema mostrando o modelo proposto por Carrel..................................................................20 Figura 4 Esquema mostrando o mtodo de cultivo celular descrito por Leighton...................................222 Figura 5 - Nmero de casos de cncer de mama no Brasil e no mundo.................................................... 25 Figura 6 - Ilustrao mostrando diferentes linhas de pesquisa que podem ser estudadas nos tumores esferides multicelulares............................................................................................................................28 Figura 7 Procedimentos utilizados na cultura 3D.................................................................................... 43 Figura 8 Linhagens de mama testadas para a formao de esferides.................................................. 56 Figura 9 Curva de crescimento de clulas MCF-7.................................................................................... 57 Figura 10 - Fases iniciais da cultura 3D de clulas MCF-7.......................................................................... 58 Figura 11 Ensaio para BrDUem esferides de clulas MCF-7................................................................... 59 Figura 12 Desenvolvimento da regio medular e cortical nos esferides de clulas MCF-7...................61 Figura 13 Alteraes na morfologia dos esferides ao logo do tempo de cultura 3D.............................62 Figura 14 - Clulas MCF-7 crescidas em monocamada-componentes do citoesqueleto............................64 Figura 15-Clulas MCF-7 crescidas em cultura 3D.-componentes do citoesqueleto.........................................................................................................................67 Figura 16 Seces opticas de esferidede clulas MCF-7 com 75 dias de cultura 3D..............................68 Figura 17 Arranjo luminal em esferides com 75 dias de cultura 3D......................................................69 Figura 18 Ensaio para laminina, BrdU e imagens de microscopia eletrnica de varredura em esferides diferenciados de clulas MCF-7..................................................................................................................70 Figura 19 Microscopia eletrnica de trasmisso de esferides de clulas MCF-7 regio cortical.........72 Figura 20Microscopia eletrnica de trasmisso de esferides de clulas MCF-7-regio medular ............................................................................................................................................. 74 Figura 21 - Microscopia eletrnica de trasmisso de esferides de clulas MCF-7-regio medular ............................................................................................................................................. 76 Figura 22 Esferides de clulas MCF-7 marcados para M30....................................................................78 Figura 23 - Quantificao por citometria de fluxo de clulas em processo de morte celular.....................80 Figura 24 Grfico de colunas dos resultados de citmentria de fluxo ....................................................81 Figura 25 Imunomarcao para LC3B e sua anlise de expresso de protenas por western blot..........83

12

Figura 26 - Imunomarcao para p-AKT e sua anlise de expresso de protenas por western blot ........84 Figura 27 Quantificao da expresso das protenas PAR-4 e p-ERK pela tcnica de western blot .......85 Figura 28 - Imunomarcao para ADAMTS-1 e sua anlise de expresso de protenas por western blot..............................................................................................................................................................86 Figura 29Ciclo celular de clulas MCF-7 obtido por meio de citmetria de fluxo............................................................................................................................................................88 Figura 30 Seleo de esferides de clulas MCF-7 diferenciados...........................................................91 Figura 31 Seleo de esferides de clulas MCF-7 diferenciados............................................92 Figura 32 Crescimento e formao de lmen em esferides de clulas MCF-7 previamente selecionadas............................................................................................................................................... 94 Figura 33 Esferides de clulas MCF-7 de clulas selecionadas...............................................95 Figura 34 - Expresso relativa de RNAm para E-caderina em monocamada e em diferentes tempos de cultura 3D...................................................................................................................................................96 Figura 35 Esquema mostrando as alteraes na morfologia de esferides de clulas MCF-7 decorrente do mtodo de cultura em 3D..................................................................................................................... 99 Figura 36 Esquema mostrando vias de sinalizao celular onde possvel observar as interaes das protenas analisadas neste presente trabalho..........................................................................................137

13

LISTA DE TABELAS

Tabela 1 Anticorpos utilizados nos experimentos de imunofluorescncia............................................45 Tabela 2 Anticorpos utilizados nos experimentos de western blot.................................................52 Tabela 3 Mdia e desvio padro do nmero de clulas encontradas no ensaio de Caspase 9.............81 Tabela 4 Mdia e desvio padro do nmero de clulas encontradas no ensaio de ploidia/ciclo celular........................................................................................................................................................89

14

SUMRIO

1 INTRODUO

16

1.1 A CULTURA DE CLULAS...................................................................................................................... 17 1.1.1 O PIONEIRISMO DE ROSS GRANVILLE HARRISSON (1870-1959) ....................................................................17 1.1.2 ALEXIS CARREL E O CORAO IMORTAL DE GALINHA (1873-1944) ................................................................18 1.1.3 A CULTURA DE CLULAS EM 3 DIMENSESHOLTFRETER, MOSCONA E LEIGHTON..............................................20 1.2 CNCER DE MAMA EM NMEROS ..........................................................................................................23 1.2.1 CNCER, UM BREVE PANORAMA .............................................................................................................23 1.2.2 O CNCER DE MAMA .............................................................................................................................24 1.3 O SURGIMENTO DOS TUMORES ESFERIDES MULTICELULARES ....................................................................26 1.3.1 CLULAS TUMORAIS E CULTURA 3D ..........................................................................................................26 1.3.2 PEQUENOS TUMORES IN VITRO ..........................................................................................................26 1.4 SIMULANDO A ORGANIZAO DO TECIDO MAMRIO: MORFOGNESE LUMINAL E CNCER.................................. 30 1.4.1 MEIO EXTRACELULAR E ALTERAES NA MORFOLOGIA DOS ESFERIDES .........................................................31 1.4.2 COMPOSTOS RICOS EM LAMININA E O TRABALHO DE OLE WILLIAM PETERSEN .................................................32 1.4.3 VALERIE M. WEAVER E A REVERSO TUMORAL ..........................................................................................33 1.4.4 COMO SE FORMA UM LMEN? ................................................................................................................34 1.5 PROTENAS ANALISADAS .....................................................................................................................36 1.6 CONSIDERAES FINAIS ......................................................................................................................37 2 OBJETIVOS 3 MATERIAS E MTODOS 39 41

3.1 MANUTENO DA LINHAGEM E A CULTURA DE CLULAS EM 3 DIMENSES .....................................................42 3.2 MTODOS PARA A DESCRIO DA MORFOLOGIA DOS ESFERIDES ................................................................44 3.2.1 MICROSCOPIA DE LUZ ............................................................................................................................44 3.2.2 MICROSCOPIA DE FLUORESCNCIA E CONFOCAL DE VARREDURA A LASER .........................................................44 3.2.3 MICROSCOPIA ELETRNICA .....................................................................................................................47 3.3 INCORPORAO DO 5-BROMO-2-DESOXIURIDINA (BRDU) .........................................................................49 3.4 QUANTIFICAO DO DNA POR CITMETRIA DE FLUXO ..............................................................................49 3.5 DETECO DE MORTE CELULAR ............................................................................................................50 3.5.1 MARCAO PARA M30 .........................................................................................................................50 3.5.2 ENSAIO DE CASPASE 9 .............................................................................................................................50 3.6 ANLISE DA EXPRESSO DE PROTENAS ..................................................................................................51 3.7 SELEO DOS ESFERIDES DIFERENCIADOS .............................................................................................52 3.8 ANLISE DO PERFIL DE EXPRESSO DE RNAM DE E-CADERINA .....................................................................53 3.9 ANLISE ESTATSTICA......................................................................................................................... 53

15

4 RESULTADOS

54

4.1 DESENVOLVENDO O MTODO E ESCOLHA DA LINHAGEM .............................................................................55 4.1.1 A LINHAGEM MCF-7 E SEU USO NA CULTURA 3D ........................................................................................57 4.2 ORGANIZAO DOS MICROFILAMENTOS DE ACTINA E DOS MICROTBULOS.....................................................63 4.2.1 CLULAS EM MONOCAMADA (2D) ............................................................................................................63 4.2.2 CLULAS CRESCIDAS EM CULTURAS 3D .......................................................................................................65 4.3 MICROSCOPIA ELETRNICA DE TRANSMISSO ..........................................................................................71 4.4 QUANTIFICAO DA MORTE CELULAR NO MODELO 3D ..............................................................................78 4.4.1 MARCAO DAS CLULAS EM APOPTOSE UTILIZANDO M30 ...........................................................................78 4.4.2 O ENSAIO PARA A DETECO DE CASPASE 9 POR CITOMETRIA DE FLUXO ..........................................................79 4.4.3 QUANTIFICAO DO PROCESSO DE AUTOFAGIA NOS ESFERIDES ....................................................................82 4.5 A EXPRESSO E LOCALIZAO DE ALGUMAS PROTENAS NA CULTURA 3D ......................................................84 4.5.1 AKT FOSFORILADA .................................................................................................................................84 4.5.2 PAR 4 E ERK FOSFORILADA .....................................................................................................................85 4.5.3 ADAMTS-1..........................................................................................................................................85 4.6 PLOIDIA/CICLO CELULAR .....................................................................................................................87 4.7 SELEO DAS CLULAS CRESCIDAS EM CULTURA 3D E A MANUTENO DE UMA NOVA LINHAGEM........................ 89 4.8 EXPRESSO DE RNAM PARA E-CADERINA............................................................................................... 96 5 DISCUSSO 97

5.1 MODELOS E PARADIGMAS................................................................................................................... 98 5.2 FATORES RELACIONADOS FORMAO DO LMEN .................................................................................103 5.3 A EXPRESSO DE AKT FOSFORILADA ....................................................................................................105 5.4 ADAMTS-1...................................................................................................................................106 5.5 TENSO DO AMBIENTE E MORFOGNESE ...............................................................................................107 5.6 ESFERIDES DE MCF-7 COMO MODELO DE CULTURA 3D ........................................................................107 6 CONCLUSES REFERNCIAS ANEXOS 108 110 125

ANEXO A - ANIMAES .........................................................................................................................126 LEGENDAS ..................................................................................................................................................126 ENCARTE COM DVD .....................................................................................................................................127 ANEXO B - ARTIGO PUBLICADO ...............................................................................................................128 ANEXO C- VIAS DE SINALIZAO CELULAR...................................................................................................137

16

1 INTRODUO

17

1.1 A CULTURA DE CLULAS Algumas descobertas cientficas mostram se to usuais e corriqueiras ao cotidiano de qualquer pesquisador atualmente, que, algumas vezes, no damos a sua devida importncia. Um exemplo disto o desenvolvimento da cultura de clulas. A manuteno de clulas vivas independentemente dos organismos de origem foi resultado da somatria de trabalhos desenvolvidos por vrios autores. Desta forma, no tentaremos aqui descrever todo o processo de descoberta, mas sim, limitaremos o nosso enfoque em algumas inovaes inseridas nesta linha de pesquisa que permitiram o desenvolvimento desta tese. Tal panorama abordar temas aparentemente no correlatos como, por exemplo, o corao imortal de galinha, esponjas do mar e at quimeras. Todavia, o ncleo comum destes tpicos se mostrar fascinante e circunstancial para a melhor compreenso deste trabalho. 1.1.1 O pioneirismo de Ross Granville Harrisson (1870-1959) Influenciados pelas descobertas de Santiago Ramn y Cajal e Camillo Golgi, vrios autores, no incio do sculo 20, debruavam-se sobre seus resultados (muitas vezes divergentes) com o objetivo de melhor se compreender o sistema nervoso (1). Harrison inseriase neste contexto por trabalhar, entre outras linhas de pesquisa, com processos relacionados formao de fibras nervosas. Visando compreender como estas se originavam e como ocorria inervao dos rgos em direo ao sistema nervoso central, ele desenvolveu um mtodo que possibilitava a retirada de clulas de embries de anfbios mantendo-as vivas em laboratrio (2). Esse experimento consistia em colocar um fragmento de tecido (normalmente medula espinhal) imerso em uma gota de linfa de anfbio vedado entre uma lamnula e uma lmina de vidro (Figura 1). Tal procedimento mostrou-se bastante eficaz por permitir que Harrison acompanhasse o crescimento e a formao das fibras nervosas, mostrando pela primeira vez que somente o tecido nervoso possua essa propriedade (uma linha de pensamento na poca sugeria que a formao das fibras ocorria no interior dos rgos e da ela migraria para a medula). No limitado a rea de neurocincias o mtodo de cultura celular assumiu um importante papel na pesquisa cientfica, sendo seu uso circunstancial para a compreenso da biologia da clula. Os trabalhos de Harrison chamaram a ateno de outro importante cientista, Alexis Carrel o qual iniciava seus estudos com cardiomicitos. A cultura de clulas agora avanaria para outro patamar.

18

Figura 1 - Mtodo proposto por Harrison para o cultivo celular (A). Primeiros desenhos feitos por Harrison mostrando o crescimento de clulas nervosas in vitro. FONTE: Figura B modificada de Harrison (1910) (3).

1.1.2 Alexis Carrel e o corao imortal de galinha (1873-1944) Apesar de possuir notoriedade no meio cientfico devido aos seus ensaios sobre suturas em vasos sanguneos (sendo at posteriormente laureado com o prmio Nobel de Fisiologia e Medicina em 1912), Alexis Carrel possua particular interesse na viabilidade e manuteno de rgos in vitro em seus estudos com transplantes. Devido a isso, em paralelo com trabalhos que envolviam a experimentao animal, Carrel iniciou seus estudos com culturas de clulas. Ao entrar em contato com o trabalho desenvolvido por Harrison, ele focou os seus esforos no somente no estabelecimento da cultura celular in vitro, mas tambm na manuteno destas por perodos mais longos fora de organismos. Aps enviar um auxiliar para aprender as tcnicas de cultura de clulas no laboratrio de Harrison, Carrel comeou a desenvolver adaptaes que as melhorasse. Inicialmente, adicionou uma srie de banhos em solues salinas para o preparo das culturas. Em paralelo a esse procedimento, substituiu o meio de cultura de linfa de anfbio para plasma de galinha e desenvolveu uma garrafa de cultura com uma entrada inclinada (Frasco de Carrel), o qual permitia a adio e substituio deste meio com maior facilidade. Outra modificao, talvez a mais importante e inovadora da poca, foi a aplicao de um rgido controle de assepsia (sendo esta metodologia muitas vezes mantidas em segredo) (4).

19

Com o sucesso de suas culturas em monocamada (Figura 2), A divulgao de seus trabalhos tomou tamanha proporo que muitos cientistas da poca atribuam a ele a descoberta da tcnica de cultivo celular. Neste contexto, um de seus assistentes chamado Eberling modificou a tcnica desenvolvida por Carrel permitindo que a cultura de clulas derivadas de coraes de galinha fosse sub-cultivada. O sucesso foi to grande que Eberling repetiu este processo por 34 anos. Surgia assim a lenda do corao imortal de galinha. O jornal New York World Telegram telefonava anualmente para Carrel para discutir como estava a manuteno de suas famosas clulas. Aps isso, era escrito um editorial sobre o assunto sendo este muito apreciado pelos leitores, principalmente os que gostavam de fico cientfica (5).

Figura 2 - Esquema mostrando a diferena entre o arranjo espacial de culturas em monocamada e em 3 dimenses.

Foi analisando estas culturas de cardiomicitos que Carrel notou que o maior contato das clulas com o meio de cultura tinha relao direta com a viabilidade celular e com uma maior taxa de proliferao. Ele percebeu que, devido a essas caractersticas, a regio mais central de suas colnias apresentava elevado ndice de necrose (Figura 3A). Para resolver este problema ele cultivou os cardiomicitos sobre uma superfcie constituda por fios de seda. Tal adaptao permitiu uma maior interao das clulas com o ambiente, sendo que este maior contato ocorreu em diferentes planos do espao (6). Ocorria pela primeira vez uma descrio de uma cultura celular em 3 dimenses (Figura 2 e 3B).

20

Figura 3 - Desenho feito por Carrel de suas culturas com cardiomicitos, sendo a regio mais escura rea com maior ndice de necrose (A). Esquema mostrando o crescimento de clulas sobre um tecido de seda, o qual permitiu maior interao das clulas com o ambiente (B). FONTE: Figura A modificada de Carrel (1912) (6).

Aps os trabalhos de Carrel, o uso e aperfeioamento do cultivo celular em monocamada fizeram com que grandes descobertas cientficas fossem alcanadas levando, por exemplo, a produo em larga escala de vacinas; maior compreenso dos mecanismos moleculares da clula e, entre outras aplicaes, a explorao em maior detalhe da biologia da clula tumoral (5). Passariam aproximadamente 30 anos para que os trabalhos desenvolvidos Johannes Holtfreter, Aron Arthur Moscona e Joseph Leighton explorassem e conseqentemente divulgassem a cultura 3D no meio cientfico. 1.1.3 A cultura de clulas em 3 dimensesHoltfreter, Moscona e Leighton A obteno de resultados cientficos utilizando fragmentos de tecidos mantidos in vitro ganhou um espao significativo em estudos da biologia do desenvolvimento. Tal fato ocorreu, principalmente, devido ao sucesso da utilizao de embries nestes estudos. Com o freqente uso desta metodologia era de se esperar que, em um primeiro momento, a cultura de clulas em 3 dimenses tivesse como divulgadores alguns embriologistas. Johannes Holtfreter (19011992) Devido aos seus trabalhos relacionados morfognese do embrio, Holtfreter tornou-se um dos mais reconhecidos pesquisadores na rea de biologia do desenvolvimento. A sua

21

relao com experimentos que envolvessem a cultura em 3 dimenses ocorreu inicialmente em estudos que mostraram a afinidade entre os tecidos de um organismo, evidenciando neste contexto a importncia da adeso celular. Em um dos seus experimentos este autor separou os diferentes folhetos embrionrios de um embrio e, em laboratrio, os colocou novamente em contato. Alm das clulas se reagruparem nos seus respectivos folhetos, estes agrupamentos celulares possuam um grau de diferenciao equivalente a sua origem embrionria (7). Em 1944, Holtfreter descreveu um mtodo para a gerao de agregados celulares esfricos que consistia em adicionar gar na superfcie de placas de Petri, evitando assim a clulas aderissem ao fundo da placa (8). Posterior a isso, em 1947, ele derivou o mtodo de formao de culturas 3D adicionando um aparato que permitisse o movimento das placas de Petri, reduzindo ainda mais a interao das clulas com o substrato (9). As adaptaes descritas por Holtfreter so condicionais para a maioria dos mtodos relacionados com a cultura de clulas em 3 dimenses. Seus trabalhos so amplamente citados no somente devido ao seu pioneirismo, mas tambm pelo fato de seus mtodos serem usados at hoje. O uso, neste presente trabalho, de um mtodo semelhante ao descrito por este autor 76 anos depois somente um dos muitos exemplos da importncia de Holtfreter no desenvolvimento da cultura de clulas em 3 dimenses. Aron Arthur Moscona (1921-2009) Os trabalhos desenvolvidos por Moscona entre 1950 e 1970 tinham como eixo comum a anlise de como as clulas embrionrias individuais se organizavam originando tecidos e rgos. Utilizando enzimas como tripsina e hialuronidase ele dissociou tecidos de diferentes organismos e percebeu, em uma anlise inicial, que as clulas de rgos diferentes no se misturavam. Desta maneira, clulas derivadas de cartilagem de embries de aves ficavam unidas com suas congneres e no se misturavam com clulas de rim, por exemplo (10). Em outro experimento este autor dissociou uma esponja do mar amarela e misturou com clulas dissociadas de esponjas do mar laranjas, o resultado disso foi a reorganizao de 2 grupos distintos, isto , as clulas no se misturavam. Moscona tambm foi um dos pioneiros na produo de quimeras, mtodo o qual consiste na manuteno de clulas originadas de diferentes organismos os quais permanecem unidas por possurem molculas de superfcie de membrana que tenham afinidade (11). Dos vrios trabalhos que utilizou a cultura de clulas em 3 dimenses (12, 13), um publicado em 1961 (14) chama a ateno por introduzir um mtodo

22

que utiliza frascos de Erlenmeyer sob agitao para a produo destes agregados. Muitos autores referem-se a essa tcnica at hoje como mtodo de Moscona. A importncia de suas descries no somente refletem o maior aprimoramento e divulgao de tcnicas relacionadas ao cultivo celular em 3-dimenses. Moscona tambm descreveu a importncia do reconhecimento clula-clula trouxe a luz informaes importantes sobre a complexidade inerente aos organismos. Os desdobramentos dos seus resultados levaram a descoberta de estruturas importante nas clulas, entre elas podemos citar como exemplo as caderinas (15). Joseph Leighton 1921-1999 Em 1951, o cultivo de clulas in vitro era, predominantemente, baseado no crescimento celular em monocamada. Leighton, que na poca trabalhava com diagnsticos patolgicos e histognese, viu que mesmo sendo muito importante para essa poca, esse paradigma possua limitaes. Para ele, a idia de um mundo achatado estava distante de um organismo e uma viso reducionista abalizada em estudos com clulas individuais teria que ser modificado (16). Foi neste contexto que este autor revisitou os trabalhos desenvolvidos por Carrel (6), visando agora desenvolver um mtodo que levasse em conta a tridimensionalidade. Em seu trabalho (17), adicionou clulas e/ou fragmentos de tecidos em um substrato constitudo por esponjas de celulose. Em seguida, Leighton adicionou a esse conjunto um pouco de plasma extrado de embries de aves. Aps a coagulao, os agregados formados por plasma, clulas e a esponja foram colocado em um recipiente com agitao com posterior adio de nutrientes (Figura 4).

Figura 4 - Esquema mostrando o mtodo de cultivo celular descrito por Leighton.

23

A preocupao com a manuteno da arquitetura tecidual fez com que Leighton se diferenciasse dos autores descritos at agora. Em seu trabalho de 1954 (18) ele descreveu pela primeira vez alguns aspectos importantes da cultura em 3 dimenses, sendo eles: O arranjo tridimensional possibilita que clulas migrem para todas as direes. -O sistema 3D permite um aumento da superfcie celular. A difuso presente no interior dos agregados pode reter fatores secretados pelas clulas O modelo pode permitir um gradiente de difuso capaz de gerar uma alterao na morfologia celular, podendo iniciar processos relacionados diferenciao tecidual O gradativo aprimoramento nas tcnicas de cultura de clulas em 3-dimenses fez com que, aps os trabalhos de Leighton, houvesse uma distino muito clara entre os resultados em monocamada e os desenvolvidos em ambiente 3D. A decorrente irradiao desta tcnica em diferentes mtodos e aplicaes somente uma amostra da importncia daquele ano de 1951 onde, em laboratrio, a cultura de clulas comearia a se aproximar a experimentos in vivo. Assim, aps essa breve descrio sobre os trabalhos iniciais envolvendo a cultura de clulas mostraremos, na prxima seo, outro importante tema que ser abordado nesta tese: o cncer de mama.

1.2 CNCER DE MAMA EM NMEROS 1.2.1 Cncer, um breve panorama Alguns nmeros obtidos na ltima estatstica fornecida pela Organizao Mundial de Sade mostraram que em 2008 o nmero de novos casos de cncer no mundo foi de 12,7 milhes de pessoas, sendo que destas 7,6 milhes vieram a bito. Interessante mencionar que na mesma fonte citada alguns nmeros chamam a ateno (19):

24

1) 70 % destas mortes ocorrem em pases sub-desenvolvidos e em desenvolvimento. 2) 1/3 dos cnceres quando precocemente diagnosticados e tratados podem ser curados 3) 11,5 milhes de pessoas podero morrer de algum tipo de cncer at 2030, dado este que mostra uma crescente no nmero de mortes ao longo dos anos. Em se tratando de um problema de sade pblica tambm no Brasil (com uma projeo de 489.270 novos casos de cncer em 2010 segundo o Instituto Nacional do Cncer (20), tornase cada vez mais necessrio medidas que levem a diminuio do nmero de bitos bem como a melhoria no diagnstico/tratamento. Dentre essas medidas, estudos relacionados com a biologia da clula cancerosa so de significativa importncia, haja visto que muitos aspectos desta doena ainda permanecessem sem resposta. A versatilidade e autonomia das clulas metazorias muitas vezes decorrente da presena, em seu interior, de um genoma completo de todo o organismo. Tal fato pode se tornar um risco devido clulas individuais deste organismo ter acesso a informaes em seu genoma s quais normalmente no teriam. O acesso a esses genes o pode transform-los em alvos para diversos mecanismos que alterem sua estrutura e, assim, a informao contida no genoma (21). O desenvolvimento do cncer ocorre neste contexto, pois, durante um processo que envolve muitas etapas, o genoma de clulas cancerosas iniciais adquire mutaes em proto-oncogenes, genes supressores de tumor ou qualquer outro que controle diretamente ou indiretamente a proliferao celular. Diferentes combinaes destas mutaes (inclusive as decorrentes de alteraes epigenticas),so capazes de contribuir para a transformao neoplsica, sendo este processo uma caracterstica comum a mais de 100 tipos de cnceres humanos (22-25). 1.2.2 O Cncer de mama O cncer de mama possui uma etiologia variada, sendo influenciada tanto por fatores genticos bem como ambientais (26). A origem deste tumor se d, na maioria das vezes, por mutaes em clulas epiteliais constituintes dos tbulos e lbulos mamrios (27).

25

Estudos epidemiolgicos reforam a importncia deste tipo de cncer. No Brasil, segundo projees do Instituto Nacional do Cncer, para o ano de 2010 so esperados 49.240 novos casos (20). Quando comparado com outros cnceres, este mostra-se como o de maior incidncia na populao do sexo feminino (Figura 5).

Figura 5 - Nmero de casos de cncer de mama (em azul incidncia e em verde mortalidade) no mundo segundo a Organizao mundial de Sade (ano 2008) (A) e no Brasil, segundo projeo do Instituto Nacional do Cncer para o ano de 2010 (B). Fontes: Modificado de A (19) e de B (20).

O estudo do cncer mama bem como o de outros tipos de cnceres, tem mostrado que essas patologias possuem alta heterogeneidade no que refere a aos tipos celulares e a suas origens no interior dos tecidos. Alm disso, essa diversidade se estende tambm desregulao de muitas vias que governam fundamentalmente processos como morte, proliferao e diferenciao (28). Tal fato exige cada vez mais o desenvolvimento de diferentes frentes de pesquisa as quais visam trazer luz maiores informaes sobre essas doenas. Pensando nisto, muito lgico que a cultura de clulas em 3 dimenses tambm tenha (e tem) se mostrado como uma ferramenta eficaz para estes estudos. Voltaremos agora para o ano de 1967, onde McAlister e seus colaboradores (29) observaram uma peculiaridade nas clulas cancerosas que estudavam: o crescimento de colnias em uma superfcie de gar, fato este no compartilhado por suas congneres com fentipo normal.

26

1.3 O SURGIMENTO DOS TUMORES ESFERIDES MULTICELULARES 1.3.1 Clulas tumorais e cultura 3D A utilizao da cultura de clulas tumorais crescidas em ambiente tridimensional j era feita desde os trabalhos iniciais desenvolvidos por Moscona(11) ,o qual analisou a interao de clulas de melanoma em agregados celulares que ele denominou de quimeras. Esses agregados apresentavam uma morfologia semelhante aos tumores que os originaram, mantendo at as propriedades invasivas quando estas eram crescidas em associao com clulas normais. J Halpern e seus colaboradores (30) mostraram que o arranjo destes agregados bem como a sua tumorigenicidade eram diferentes quando se utilizava clulas normais do que quando se utilizava clulas tumorais. Como j comentado, foi o trabalho de McAllister e colaboradores (29) que realmente abordou o comportamento diferenciado das clulas malignas. A morte das clulas normais na presena de uma superfcie de gar era, para esses autores, uma prova das clulas normais dependia da ancoragem desta clula ao substrato. Sabia-se j naquela poca que clulas derivadas de tumores malignos perderiam essa dependncia de ancoragem, sendo esta caracterstica ento refletida na sobrevivncia das clulas na cultura 3D. Apesar de iminente, a sistematizao e padronizao de um modelo que mimetizasse o ambiente e metabolismo de um tumor ainda no tinham sido concretizadas. Isso iria mudar aps os trabalhos desenvolvidos por Sutherland e seus colaboradores em 1970. 1.3.2 Pequenos tumores in vitro O surgimento dos esferides A criao de modelos que permitissem testes de efeito e de intensidade de radiao direcionou Robert M. Sutherland e outros pesquisadores utilizao de cultura de clulas em 3D. Trabalhando inicialmente com linhagens derivadas de pulmo de Hamster, esse grupo desenvolveu uma tcnica que utilizava frascos que permitiam um fluxo do meio de cultura no seu interior (Frascos giratrios-spinner flasks), impedindo assim adeso das clulas com o substrato. Como conseqncia, os agregados de clulas assumiram uma morfologia esfrica a qual fez com que esses autores os denominassem de esferides multicelulares (31, 32). Como a formao de esferides tambm era observada em clulas derivadas de carcinomas mamrios

27

bem como de outros cnceres (33), iniciou-se o desenvolvimento de estudos que buscassem similaridades entre os resultados encontrados na cultura 3D com os encontrados in vivo. O desdobramento destes experimentos levou o grupo de Sutherland a conseguir mostrar pela primeira vez que, quando submetidos a um tratamento com radiao, os esferides 1 multicelulares apresentavam curvas de sobrevivncia celular anlogas s de tumores slidos (31, 34). Diferentes linhas de pesquisa agora focariam um aspecto importante deste modelo- a heterogeneidade celular. Em ambiente 3D as clulas no so igualmente expostas ao meio. Tal fato faz com que haja a formao de microambientes que, no interior dos esferides, podem levar a seleo de diferentes grupos celulares (35). Decrscimos regionalizados de tomada de oxignio e nutrientes podem levar, neste contexto, a formao de reas de necrose nestes esferides. Ao se olhar para essas caractersticas, paralelos com tumores slidos (principalmente avasculares) so inevitveis. Diferentes frentes de anlise que exploram essas similaridades foram desenvolvidas, sendo algumas representadas na Figura 6. Esferides: semelhanas entre modelos, vantagens e aplicaes Como j comentado, estudos envolvendo a terapia radiolgica foram uma das primeiras linhas de pesquisa bastante exploradas por meio de cultivo celular 3D. Resultados mostrando as diferenas entre o ambiente 2D e 3D, principalmente no que se refere a resistncia das clulas (36), direcionaram esta abordagem experimental para diversas linhas de pesquisa, como por exemplo estudos relacionados a radiao ionizante, a gerao de radicais livres, inibio da respirao celular e toxicidade preferencial em regies de hipxia (37, 38). Posteriormente ao grande nmero de trabalhos produzidos na dcada de 70 e 80, experimentos que envolvam cultura 3D e ensaios radioterpicos atualmente vm trazendo informaes importantes a respeito do papel de substncias radiosensibilizantes (39) e radioprotetoras (40) em algumas vias de sinalizao celulares. Outros autores (41) mostraram que o arranjo da cromatina de clulas organizadas em esferides alterado, apontando assim para uma inter-relao entre morfologia e radiosensibilidade celular.

No decorrer de todo o texto ser utilizado o termo esferide ao invs de tumores esferide multicelulares

28

Figura 6 - Ilustrao esquemtica mostrando diferentes linhas de pesquisa que podem ser estudadas nos tumores esferides multicelulares (42).

Aplicao importante dos esferides tambm o seu uso em ensaios que envolvam testes de sensibilidade a drogas. Inicialmente, este tipo de aplicao esteve sempre associado cultura de clulas crescidas em monocamada. Todavia, percebeu-se que o efeito de algumas concentraes de drogas no tinham equivalncia in vivo dos valores encontrados na cultura 2D. Muitas evidncias tm mostrado que clulas arranjadas em esferides, principalmente as localizadas no interior destes agregados, so muito mais resistentes a agentes citotxicos do que clulas em suspenso na cultura. Dos vrios trabalhos inicialmente desenvolvidos, podemos citar como exemplos estudos que mostraram maior resistncia aos quimioterpicos doxorrubicina, vincristina e mitoxantrona em esferides do que em linhagens em monocamada (43-45). Tal diferena no apenas uma resultante de problemas de difuso destas drogas no interior do esferide. Fatores como alteraes de pH, hipxia e diferentes taxas de proliferao celular tambm esto envolvidos nesta maior resistncia (46, 47). A presena destes diferentes fatores faz com que o modelo de cultura de clulas em 3D seja o modelo in vitro que mais se

29

aproxima com modelos in vivo (48-50), pois, similarmente ao j mostrado em ensaios de radioterapia, esferides tambm apresentam curvas de resistncia a drogas semelhantes s encontradas em alguns tumores slidos (51-53). A cultura de esferides tambm se destaca por conseguir restabelecer caractersticas morfolgicas e funcionais de seu equivalente tecido in vivo. Um dos fatores responsveis por isto a crescente produo de componentes de matriz extracelular o qual permite a criao de uma complexa rede tridimensional onde protagoniza um grande nmero de interaes clulaclula bem como clula-matriz. A descrio e localizao de fatores (pato)fisiolgicos, bem como penetrao, ligao e bioatividade de drogas podem ser ento simulados nestes modelos que exploram esse arranjo 3D (54, 55). Tanto a similaridade com regies avasculares de pequenos tumores, quanto com as regies intervasculares de grandes tumores slidos tornam o modelo 3D peculiar. Como explicado anteriormente, tal caracterstica mostrou-se muito til em estudos que envolviam testes com radioterapia. Adicionado a este fato, os esferides mostram uma cintica de crescimento que no somente podem ser calculada pela equao de Gompertz, como tambm por diferentes outros modelos matemticos relacionados ao crescimento de tumores (56, 57). Conseqentemente, so tambm estabelecidos paralelos no tocante ao gradiente de proliferao. Como nos tumores, a periferia dos esferides (regio cortical) o local onde ocorre o maior ndice de proliferao celular. partir deste ponto, se traarmos uma linha radial em direo ao centro (regio medular do esferide) torna-se evidente o crescente nmero de clulas que no esto em ciclo celular. Ao redor de 400 m da superfcie do esferide, possvel observar o incio de reas de necrose. A complexidade do modelo ocorre devido presena de microambientes com diferentes exposies a nutrientes, fatores de crescimento e a trocas gasosas. O agrupamento de clulas tambm altera o fluxo de liberao de catablitos, tornando a sua forma de liberao bastante heterognea. Estas variaes afetam diretamente a fisiologia celular tanto em esferides quanto em tumores. Desta forma, experimentos com esferides podem in vitro mimetizar alguns aspectos da complexidade tumoral (50, 58, 59) A cultura de esferides tambm permite que em laboratrio se utilize do uso de cocultivo de diferentes linhagens celulares (esferides heterlogos). Tal abordagem possibilita

30

crescer em associao uma clula de origem tumoral com diversas outras derivadas de linhagens normais. A adio, por exemplo, de fibroblastos, clulas endoteliais e clulas do sistema imune permite simular cada vez mais uma maior interao estroma-parnquima, caractersticas inerente de um arranjo tecidual (60-62). Com o gradual aperfeioamento da tcnica para a produo de esferides, cada vez mais se observa a utilizao deste modelo como mtodo de varredura de alto desempenho. Isso significa que, anteriormente a grandes testes clnicos, as indstrias esto utilizando esferides com o objetivo de validar o efeito de determinados compostos. Tal mudana decorrente de alguns fatores: Reduo de custos (63, 64) Inadequao de determinados modelos animais para a compreenso de vias de sinalizao de clulas humanas (65) Aspectos bioticos relacionados ao uso de animais (55) Em determinadas condies, resultados obtidos em cultura 2D mostram-se muito distantes dos organismos analisados exigindo uma gradual substituio deste modelo por culturas 3D (66, 67). Em sntese, possvel verificar que as muitas similaridades com modelos in vivo habilitam o uso esferides como uma eficiente ferramenta de estudo in vitro. evidente que tanto a cultura em monocamada bem como modelos animais possuem um importante papel na pesquisa cientfica. Todavia, por possuir caracterstica de ambas as tcnicas, o seu crescente uso se justifica. Neste contexto, mostraremos na prxima seo a importncia deste modelo em estudos relacionados ao cncer de mama e na morfognese de estruturas luminais.

1.4 SIMULANDO A ORGANIZAO DO TECIDO MAMRIO: MORFOGNESE LUMINAL E CNCER Como mostrado anteriormente, a alta incidncia de casos bem como o elevado nmero de mortes mostram a importncia da melhor compreenso dos mecanismos relacionados ao cncer de mama. Dentro deste objetivo, diversas frentes de pesquisa vm utilizando a cultura de clulas em 3-dimenses visando, por exemplo, a obteno de informaes sobre:

31

Papel das foras tensionais no arranjo tridimensional (68) Processos relacionados regulao da polaridade pico-basal tanto epitlio normal quanto em epitlio tumoral (69). Arquitetura e homeostase tecidual (70). Interferncia na expresso fenotpica decorrente de interaes clula-clula e clula matriz (71). A formao e manuteno do arranjo glandular associado presena de um lmen e a sua desorganizao decorrente de genes relacionados ao cncer (72).

1.4.1 Meio extracelular e alteraes na morfologia dos esferides A utilizao de clulas derivadas de tecidos mamrios j vem ocorrendo desde as primeiras tentativas de cultura de clulas em 3D. Um dos primeiros experimentos utilizando essas clulas foi feito por Krystyna Dabrowska-Piaskowska em 1959 (73). Esta autora dissociou diversos tipos de adenocarcinomas (inclusive mamrio) e percebeu que quando as clulas formavam agregados elas desenvolviam a capacitao histoformativa, que segundo a autora seria a capacidade das clulas se organizarem de maneira semelhante ao tecido que a originou. Posteriormente, com os avanos na tcnica de cultivo, muitos trabalhos mostravam que a adio de componentes de matriz extracelular possibilitava modificaes na morfologia celular. Tendo em vista estes processos, no final da dcada de 70, Jason Yang e seus colaboradores (74) perceberam que clulas derivadas de tecidos mamrios (normal e tumoral) se arranjavam diferencialmente em ambiente 3D. Segundo eles, a presena de colgeno no meio de cultura possibilitou uma maior sobrevivncia das clulas durante o experimento. Associado a isto, tambm se verificou alteraes morfolgicas que remetiam a formao de dutos, arranjo este que era somente encontrado in vivo. Passado alguns anos, Hall e seus colaboradores (a maioria integrantes do grupo de Mina Bissell) perceberam que ao utilizar mtodo semelhante com clulas de mama normais era possvel observar um arranjo luminal (75). Eles observaram que na presena de colgeno tipo 1 as clulas se organizavam de forma polarizada, formavam junes e a suas regies apicais se voltavam para um espao comum de maneira semelhante ao de uma glndula mamria. Desta maneira, cada vez mais, a pesquisa em cncer de mama se aproximava da gerao modelos que mimetizavam a formao de lmen. A adio de um novo

32

componente a esse sistema modificaria de forma significativa a produo de esferides luminais. 1.4.2 Compostos ricos em laminina e o trabalho de Ole William Petersen A membrana basal uma matriz extracelular especializada que est intimamente relacionada com diferentes tipos celulares, entre eles as clulas epiteliais. Possuindo muitas funes biolgicas, a membrana basal possui na sua constituio colgeno tipo IV, lamininas, fatores de crescimento, sulfato de heparam, proteoglicanas entre outras substncias (76). A busca por uma suplementao de meio de cultura que utilizasse estes compostos mostrava-se importante, haja visto que estes podem afetar diretamente a polarizao celular, formao de lmen e possuem papel ativo em processos relacionados a progresso tumoral (21, 77). Todavia, at meados da dcada de 80, a extrao destes compostos era ineficiente sendo que muitas vezes o produto coletado se mostrava insolvel (76). Como resultante de uma srie de trabalhos (78), Hynda K. Kleinman (79) purificou um composto rico em componentes da membrana basal, o qual era extrado de um tipo de condrosarcoma denominado de tumor de Engelbreth-Holm Swarm. Conhecido comercialmente como Matrigel, esse gel rico em laminina gradativamente vem se tornando circunstancial em experimentos que envolvessem esferides de clulas mamrias. O trabalho de Ole Willian Petersen iniciaria uma nova fase, a qual se tornaria um paradigma at os dias atuais. Petersen e colaboradores (80) perceberam que a diferenciao decorrente do ambiente 3D e da adio de colgeno tipo 1, mostrava-se pobre quando comparado com a organizao tecidual. Devido a esse panorama, estes autores resolveram substituir a suplementao de colgeno por Matrigel . O experimento consistia em verificar o arranjo de clulas mamrias normais e tumorais em frente a essa nova condio. Os resultados encontrados mostraram que linhagens normais (MCF-10A e HMT-3522) bem como clulas extradas de tecido mamrio rapidamente assumiam um arranjo acinar. As clulas reorganizavam-se de forma polarizada, com junes celulares bem estabelecidas e apresentando tambm uma maior expresso de glicoprotenas na regio apical bem como colgeno tipo IV na regio basal. Quando comparadas com as clulas que eram crescidas em monocamada, ficava evidente que a presena do Matrigel (BD Biosciences, Bedford, MA, Estados Unidos) e o ambiente 3D atuavam na diferenciao dos esferides de clulas normais. Todavia, quando este protocolo era aplicado

33

em clulas derivadas de tumor de mama e em linhagens tumorais, no era observada nestas clulas nenhuma diferenciao. Dois pontos devem ser aqui enfatizados: A utilizao de Matrigel, aps este trabalho, consolidou-se na pesquisa com esferides de clulas mamrias por permitir em um curto espao de tempo diferenciao e formao de estruturas acinares. Aspectos que diferenciassem linhagens tumorais de normais poderiam ser agora mais detalhados, pois vias de sinalizao celulares eram diferentemente ativadas em ambiente rico em laminina. Assim, os resultados apresentados pelo grupo da professora Mina Bissell instigavam a comunidade cientfica a voltar o seu olhar para a matriz extracelular. Eles mostrariam, 5 anos mais tarde, que no contexto da biologia do cncer isso seria de grande importncia. 1.4.3 Valerie M. Weaver e a reverso tumoral Em 1987, Briand e colaboradores estabeleceram em laboratrio uma nova linhagem celular chamada de HMT-3522. Originaria de uma fibrose da mama, essa clula caracterizava-se por manter-se diplide aps vrias passagens e tambm por no apresentar tumorigenicidade (81). O seu freqente uso fez que alguns pesquisadores selecionassem a partir dela duas novas linhagens celulares: a no tumoral S1 e a tumoral T4-2. Weaver et al. (82) iniciaram os seus trabalhos crescendo ambas as clulas em monocamada e cultura 3D. Apesar destas clulas possurem uma origem comum, somente as clulas S1 se reorganizaram em estruturas acinares quando crescidas em culturas 3D com Matrigel . J as clulas T4-2, nas mesmas condies, mostraram-se extremamente desorganizadas. A partir destes resultados, este grupo verificou que um receptor de matriz extracelular-a integrina 1-era muito mais expressa em T4-2 do que a linhagem no tumoral S1. Utilizando de anticorpos anti- integrina 1, eles conseguiram diminuir a ligao deste receptor o com meio extracelular. Tal fato desencadeou uma mudana na morfologia destas clulas, fazendo com que as clulas T4-2 formassem cinos muito semelhantes aos encontrados na linhagem no tumoral S1. Os fentipos observados eram reversveis quando as clulas eram dissociadas e os anticorpos removidos. Esses resultados apontaram para o fato de que, pelo menos in vitro, que a matriz extracelular e seus receptores poderiam ditar o fentipo de clulas epiteliais de mama. Esse novo paradigma fez com que a

34

trade constituda por clulas mamrias, Matrigel e cultura de clulas em 3-dimenses fosse amplamente utilizada. A seguir, faremos uma breve abordagem de alguns artigos que se utilizaram deste mtodo para elucidao de mecanismos celulares intrnsecos a biologia da clula mamria. 1.4.4 COMO SE FORMA UM LMEN? Como apresentado at agora, em esferides de clulas mamrias a formao do lmen se d por uma gradativa diminuio do nmero de clulas da regio medular. Ao final do desenvolvimento, o esferide assume um arranjo acinar caracterizado por uma nica camada de clulas ao redor de um espao comum (83-85). Visando entender como a apoptose atuava na formao desta cavidade, Jayanta Debnath e colaboradores comearam a estudar esferides originados da linhagem no tumoral de mama MCF-10A (para saber mais sobre a origem desta linhagem ver (86)). Neste trabalho (87), eles modularam diferentes genes relacionados proliferao celular (ciclina D1 e HPV E7) e ao controle da apoptose (protenas anti apopttica da famlia Bcl-2)( B-cell lymphoma 2). Diferentemente do esperado, a inibio da apoptose e o aumento da proliferao celular no foram capazes de impedir a formao do lmen. Estes autores mostraram ento que talvez a morte celular por apoptose no seria a nica responsvel por essa diminuio do nmero de clulas. Fatores como a distncia dos componentes da matriz extracelular e a crescente diminuio de nutrientes na regio medular, apontavam para o tambm envolvimento de outra via de sinalizao celular: a via autofgica . A autofagia (macroautofagia) refere-se a qualquer via de degradao celular a qual, por meio de vesculas, envolva a entrega de elementos citoplasmticos aos lisossomos. Este processo fisiolgico, fortemente regulado pelo estresse celular e pela reciclagem de componentes intracelulares, possui importante papel no estudo da biologia da clula tumoral por associar-se a vias regulatrias que permitem ambiguamente tanto a supresso quanto a sobrevivncia do tumor (88-90). No contexto descrito at agora, a maior concentrao de clulas em autofagia encontra-se na regio central dos esferides (84, 91, 92). Kenna R. Mills e colaboradores exploraram a relao da morte por apoptose e autofagia tambm no modelo de esferide com clulas MCF-10A (85). Eles descreveram que o receptor TRAIL (tumor necrosis factor related apoptosis inducing ligand) ativava a produo de autofagossomos nas clulas epiteliais. Ao se bloquear esse receptor juntamente com a apoptose (esta, via superexpresso

35

de Bcl-xL), eles notaram um aumento de esferides preenchidos por clulas, isto , com a menor formao de cavidades. Alm da formao luminal, a autofagia pode tambm atuar na regio central dos esferides diminuindo a morte celular decorrente por anoikis (93). A literatura vem mostrando que ambas as vias so importantes para a formao do espao luminal, todavia, a origem da linhagem de mama tambm pode impossibilitar a organizao acinar destas clulas crescidas em ambiente 3D. Kenny e colaboradores (72) exploraram em seu trabalho as diferenas tanto morfolgicas quanto de expresso gnica em linhagens de mama crescidas em ambiente 3D. Foram analisadas 25 linhagens, as quais poderiam apresentar um fentipo normal ou um fentipo tumoral (com diferentes graus de agressividade). Novamente, estes autores confirmaram que a formao de estruturas acinares somente ocorria em clulas normais. J nas clulas tumorais, eles perceberam que quanto maior era o grau de tumorigenicidade, mais fraca era a interao das clulas no esferide. Devido a sua origem, a clula MCF-7 uma linhagem mamria que apresenta um fentipo tumoral (94). Esferides desta clula so bastante utilizados em diversos ensaios que envolvam testes de drogas e radioterapia (95, 96). Clulas MCF-7 quando crescidas em ambiente 3D com Matrigel, formam esferides que no apresentam estruturas luminais. Esse fato fez com que a alguns autores tambm utilizassem essa linhagem para melhor compreender esse fato. A modulao de molculas de adeso (97) como tambm a utilizao de co-cultura com fibroblastos (98), apontam para a possibilidade de reverso de algumas de caractersticas tumorais. Como apresentado at aqui, a pluralidade de fatores associados formao do lmen exige, cada vez mais, diferentes abordagens experimentais. Deste modo, quando se analisa com maior detalhe os modelos atualmente envolvidos com esses processos, clara a prevalncia de um trip metodolgico constitudo por linhagens mamrias normais, adio de componentes que simulem a membrana basal e tempo de cultura 3D que variem entre 4 e 15 dias. (91, 99, 100). Tais propriedades podem oferecer uma presso de seleo a qual ativariam vias de sinalizao celulares semelhantes, o que teria como resultante uma convergncia de alteraes celulares. Assim, o desafio a se transpor neste presente trabalho o desenvolvimento de um mtodo vivel para estudos do desenvolvimento do lmen, mas que considere 3 apectos:

36

Maior tempo de permanncia em cultura 3D (superior a 30 dias) A no adio de qualquer suplementao de componentes de membrana basal O uso de uma linhagem tumoral Posterior a essa primeira etapa, atentaremos para as possveis diferenas morfolgicas

encontradas ao longo do tempo de cultura 3D, sendo estes resultados comparados com as linhagens crescidas em monocamada. Para tanto, sero avaliados fatores como apoptose, autofagia, proliferao e sobrevivncia celular, diferenciao e, por fim, a presena nos esferides de uma metaloproteinase. Comentaremos um pouco mais a respeito dessas diferentes abordagens a seguir. 1.5 PROTENAS ANALISADAS A morte celular sempre foi bastante estudada em modelos de cultura 3D devido ntima relao com o microambiente tumoral e com a formao do lmen. Atuando como principal efetora deste processo, a apoptose ser abordada neste presente trabalho por meio de duas frentes. A primeira delas ser a quantificao de uma Caspase iniciadora, a Caspase 9. Essa protease especfica de cistena-aspartato, depois de ativada pelo apoptossomo, cliva outras pr-caspases iniciando assim uma seqncia de eventos que culminaro no processo de apoptose (21, 101). Em paralelo a isso, avaliaremos as alteraes da protena pr-apopttica PAR-4 (Prostate Apoptosis Response 4). Esta protena esta associada tanto via intrnseca quanto extrnseca da apoptose (102, 103). Alm de ser pouco expressa em alguns tipos de cnceres (104) ela destaca-se por possuir uma maior fosforilao pela protena quinase A na sua poro SAC (Selective for Apoptosis in Cancer). Tal caracterstica a torna um alvo seletivo, haja visto que esta regio diferentemente estimulada quando em clulas normais (105). Durante o processo de autofagia, diferentes organelas ou protenas so envolvidas por autofagossomos. Posteriormente a esta etapa, os autofagossomos fundem-se com lisossomos e permitem que os componentes engolfados sejam degradados por hidrolases lisossomais. Dos diferentes genes associados a todo o processo de autofagia, neste presente trabalho focaremos na presena da protena LC3 (microtubule associated protein 1 light chain 3) no decorrer do desenvolvimento dos esferides. A pr-forma dessa protena clivada pela ao da protena Atg4, permitindo assim que LC3 ligue-se a fosfatidiletanolamina (glicofosfolipdio). Ao se observar o fluxo de converso de LC3B-I (forma citoslica) e LC3B -2 (forma conjugada a

37

fosfatidilserina) possvel verificar a atividade dos autofagossomos no interior da clula, e, conseqentemente, acompanhar a atividade autofgica no processo (106-108). Em outra abordagem ser verificado a alterao de AKT (v-akt murine thymoma viral oncogene) fosforilada. Essa serina/treonina quinase (tambm conhecida como PKB) est inserida em diferentes vias de sinalizao celulares ativadas por fatores de crescimento, citocinas entre outros estmulos celulares (109). Essas vias, quando inserida no contexto da maquinaria tumoral, destacam-se por atuar em componentes do ciclo celular e em protenas pr-apoptticas e de pr-sobrevivncia (21, 110). A protena ERK (extracellular signal regulated kinases), na sua forma fosforilada, ser outra quinase estudada neste presente trabalho. Esta protena est relacionada via de sinalizao da oncoprotena Ras (RasRafMEKERK). Aps a sua fosforilao, ERK migra do citoplasma para o ncleo das clulas, podendo ativar diversos fatores de transcrio bem como permitir reconfiguraes de protenas associadas cromatina. Estimulando a maquinaria de sntese protica, essa cascata de eventos pode estimular a expresso de importantes genes reguladores de crescimento como, por exemplo, ciclina D1. (21, 111, 112). Tambm ser feita uma abordagem voltada para interao clula-clula. Para tanto, ser analisada a protena E-caderina. Localizada em stios de adeso intercelulares (denominados de junes aderentes) essas protenas possuem interao com componentes do citoesqueleto, principalmente os microfilamentos de actina. A expresso desta protena est intimamente conectada com o grau de epitelialidade, atuando assim como um importante supressor de tumor (113, 114). Por fim, a ltima protena que ser analisada ADAMTS-1 (a disintegrin and metalloprotease with thrombospondin motifs-1). Essa enzima possui um importante papel no renovao de protenas de matriz extracelular em vrios tecidos. A alterao em sua regulao est associada a diversos processos patolgicos, inflamao, desenvolvimento e progresso do cncer (115, 116) 1.6 CONSIDERAES FINAIS H quase 100 anos atrs, decorrente de uma pequena interveno feita por Carrel em suas culturas, iniciavam-se os estudos com cultura de clulas em 3D. Desde ento, o crescente

38

uso e a diversidade de aplicaes desta tcnica, possibilitaram um olhar mais intimista ao que se refere s interaes clula-clula e com o ambiente. Hoje, a cultura de clulas em 3D assume importante papel nos estudos relacionados morfognese luminal, permitindo acompanhar in vitro fatores regulatrios deste processo. Desta forma, o desenvolvimento de novos modelos de cultura de clulas em 3D so cada vez mais importantes devido a permitir uma melhor compreenso da formao do lmen. neste contexto que se insere este presente trabalho, o qual objetivo ser abordado a seguir.

39

2 OBJETIVOS

40

O objetivo deste trabalho foi estudar aspectos morfofisiolgicos de clulas MCF-7 na ausncia de elementos exgenos de matriz extracelular, para avaliar seu possvel uso como modelo tumoral. Deste modo, o principal foco foi avaliar a viabilidade de se manter estas culturas por longos perodos em cultura 3D (superiores a trinta dias) e analisar o comportamento destas clulas em um ambiente de maior interao clula-clula, avaliando importantes aspectos como diferenciao e morte celular. Dentro deste contexto, sero analisadas a expresso de diferentes protenas durante o perodo de cultura em 3D as quais tero seus resultados comparados com clulas MCF-7 crescidas em monocamada.

41

3 MATERIAS E MTODOS

42

3.1 MANUTENO DA LINHAGEM E A CULTURA DE CLULAS EM 3 DIMENSES Foi utilizada a linhagem celular MCF-7 (94) derivada de efuso pleural de adenocarcinoma mamrio. Esta linhagem foi obtida da ATCC (American Type Culture Collection) (Manassas, VA, Estados Unidos da Amrica) atravs do Banco de Clulas do Rio de Janeiro (catlogo no CR119). Acondicionada em ampolas de congelamento, as clulas foram mantidas em nitrognio lquido. Aps descongelamento e posterior retirada da soluo de congelamento, as clulas foram transferidas para frascos de cultura de tecidos (com rea de 25 cm2) contendo meio de cultura DMEM (meio de cultura de Eagle modificado por Dulbecco) suplementado com 10% de soro fetal bovino. A linhagem ento foi mantida em uma incubadora com uma atmosfera contendo 5% de CO2 e uma temperatura de 37 oC. As clulas arranjadas em monocamada foram submetidas a uma dissociao enzimtica com uma soluo de tripsina 0,2 % +EDTA 0,02 % (cido etilenodiamino tetra-actico). Aps a neutralizao da atividade desta enzima (utilizando o mesmo meio de cultura) e posterior retirada da soluo de tripsina-EDTA utilizando PBSA (soluo de tampo fosfato de sdio sem clcio e magnsio), as clulas em suspenso foram contadas utilizando o citmetro de fluxo Guavaeasycycle mini (Milipore Biosciences Tessicula, CA, Estados Unidos da Amrica). Padronizou-se o uso de uma densidade de clulas de 80 clulas/L de meio de cultura, para a cultura em 3 dimenses. Com o objetivo de retirar possveis fragmentos de poliestireno, as placas de Petri (com dimenses de 60x15 mm) foram previamente lavadas com PBSA. Nesse momento foi checado tambm a presena de hidrofobicidade na superfcie das placas (Figura 7A) caracterstica importante para dificultar a adeso celular. A tcnica utilizada para a formao dos esferides foi a de cultura celular em sobreposio lquida (liquid overlay) (Figura 7C), a qual consiste em no permitir a adeso na superfcie do recipiente. Foram colocados 5 mL de meio de cultura em cada placa, estas contendo 4x105clulas. As placas com os esferides foram mantidas na incubadora nas mesmas condies descritas previamente para garrafas de cultivo.

43

A cada 3 dias, todo o contedo das placas foi retirado e colocado em tubos de centrifugao (15 ml). Por gravidade, as clulas da linhagem MCF-7 (agora arranjada como esferides) se concentraram no fundo destes tubos (Figura 7B). Desta forma possvel a retirada do meio de cultura, lavagem com PBSA e posterior adio de novo meio de cultura. O tempo de crescimento dos esferides estendeu-se at 155 dias, entretanto, em alguns experimentos foram selecionadas datas especficas, sendo estas 7, 30 e 50 dias de cultura. Todos os resultados obtidos na cultura em 3 dimenses foram comparados com os resultados das clulas MCF-7 crescidas em monocamada.

Figura 7 - Fotografias de alguns procedimentos utilizados neste trabalho, sendo eles: teste de hidrofobicidade da superfcie de placas de acrlico (A), coleta dos esferides em diferentes tempos de cultura por meio de decantao (B e em detalhe o fundo de tubo de centrfuga contendo esferides), placas de Petri contendo os esferides em meio de cultura (C) e a utilizao de microscopia para a coleta dos esferides diferenciados no interior do fluxo laminar (D).

44

3.2 MTODOS PARA A DESCRIO DA MORFOLOGIA DOS ESFERIDES 3.2.1 Microscopia de Luz Imagens digitais foram obtidas em todas as fases do desenvolvimento dos esferides utilizando-se tanto de microscopia de contraste de fase quanto de campo claro. Para isso, as placas de Petri contendo os esferides bem como as garrafas de cultura contendo as clulas em monocamada, foram observadas ao microscpio invertido digital da marca EVOS AME-3302 (Aeleusden, Holanda). 3.2.2 Microscopia de fluorescncia e confocal de varredura a laser Preparo das clulas O crescimento em monocamada das clulas MCF-7 se deu no interior de placas de cultivo de celular sob lamnulas de vidro imersas em meio de cultura DMEM. Aps a lavagem destas clulas em soluo de PBSA (repetida 3 vezes em todos os procedimentos) as clulas foram fixadas com formaldedo 3,7% em PBSA por um perodo de 30 minutos. J os esferides analisados foram coletados em diferentes tempos de cultura (os quais se estenderam por at 155 dias). Para evitar fragmentao das estruturas, todos os esferides foram separados de qualquer soluo pelo processo de decantao (Figura 5B). Retirado o meio de cultura, os esferides passaram pelas mesmas etapas de lavagem e fixao descritas para monocamada. Posteriormente s lavagens em PBSA, as clulas foram permeabilizadas com uma soluo de Triton-x 100 0,5% por 30 minutos para monocamada e 1 hora (com agitao) para os esferides. Novamente lavados, o material foi agora submetido a uma soluo de bloqueio com albumina a 3% em PBSA. Depois de 1 hora clulas foram ento lavadas novamente com PBSA e seguiram para as marcaes fluorescentes. Para no tornar o texto repetitivo, optamos por suprimir os detalhes descritos acima em todos os procedimentos apresentados neste trabalho. Assim, por exemplo, ao se ler lavagem em PBSA no texto, subentende-se que foram 3 lavagens.

45

Imunofluorescncia Os anticorpos primrios (Tabela 1) foram utilizados na diluio recomendada pelos fabricantes. O volume colocado em contato com as clulas foi de 10 l para a monocamada e 30 l para esferides. Para espraiar a soluo sobre a superfcie plana da lamnula foi recortado um quadrado de parafilm e colocado sob a soluo. J nos esferides, a exposio aos anticorpos primrios ocorreu em tubos de Eppendorf de 1,5 ml. Para evitar a evaporao, as lamnulas com parafilm foram colocadas em recipientes com papel molhado (cmara mida) hermeticamente fechado. As clulas foram incubadas ao redor de 12 horas (entre um dia e outro) sendo que, nos esferides estas permaneceram em constante agitao.
Tabela 1 - Anticorpos utilizados nos experimentos de imunofluorescncia.

Anticorpo /Empresa/Breve Descrio Concentrao utilizada Anti -LC3B-policlonal (coelho) (Abcam ab51520) (Cambridge, 1:150 MA, Estados Unidos da Amrica) -Marcador de autofagosso Anti- tubulina (camundongo) (Sigma T5293) (St. Louis, MO, 1:250 Estados Unidos da Amrica) -Componente dos microtbulos Anti- tubulina (camundongo) (Sigma T5168) 1: 250 -Componente dos microtbulos Anti-ADAMTS-1 (coelho) (Abcam ab28284-100) 1:200 -Metaloprotenase Anti-laminina (coelho) (Sigma L9393) 1:200 -Constituinte da Lamina basal Anti-5-bromo-2-deoxiuridina, BrdU (camundongo) (Sigma 1:100 8434) -Anlogo da timidina, incorporado na sntese do DNA M30 conjugado a isotiocianato de fluorescena (Cyto DEATH 1:50 Roche ) (Indianapolis, IN, Estados Unidos da Amrica) -Se liga citoqueratina 18 clivada, indicando apoptose Anti-p-Akt1/2/3 (Thr 308) (coelho) (Santa Cruz-Sc 16646-R) 1:250 (Santa Cruz, CA, Estados Unidos da America) -Importante componente de diversas vias de sinalizao Anti-IgG de camundongo conjugado a isotiocianato de 1:200 fluorescena (Sigma F9137) -Anticorpo secundrio necessrio para evidenciar por fluorescncia a protena alvo (anticorpo primrio)

46

Aps nova lavagem com PBSA, os procedimentos apresentados no item anterior se repetem para a aplicao dos anticorpos secundrios. Todavia, deve se atentar que devido a conjugao com fluorforos nestes anticorpos, o cuidado com a exposio luz deve ser intensificado. Outra diferena que deve ser considerada se refere ao tempo de incubao, o qual suficiente ao redor de 3 horas para monocamada. Nos esferides, entretanto, recomenda-se estender essa incubao com o anticorpo secundrio por 6 horas. O material processado para microscopia de fluorescncia foi preparado para ser observado utilizado 3 diferentes canais ao microscpio confocal de varredura a laser. Um canal sempre foi reservado para a marcao nuclear sendo assim, quando necessrio, em algumas preparaes foram utilizadas 2 imuno-marcaes (sendo uma com anticorpo secundrio antiIgG de coelho e a outra antiIgG de camundongo). Outra opo foi adio de um corante fluorescente em paralelo com a imunomarcao. Desta maneira, aps o trmino da imunomarcao, o material foi novamente lavado com PBSA e seguindo para a colorao com corantes fluorescentes. Corantes fluorescentes Para a deteco dos microfilamentos de actina foi utilizada uma soluo contendo faloidina conjugada a FITC (isoticianato de fluorceina) (Sigma) ou a Alexa fluor 633 (Invitrogen) na concentrao de 7,5 M em PBSA. As clulas ficaram em contato com essas substncias por um perodo de 40 minutos para monocamada e at 4 horas para esferides, sendo posteriormente lavados com PBSA . As marcaes nucleares de todas as lminas utilizadas neste trabalho foram feitas por meio de um corante especfico para cidos nuclicos, o iodeto de propdeo, na concentrao de 10 g/mL (Sigma). Devido ao interesse somente pelo DNA, as clulas ficaram em contato com uma soluo de RNAase (10 mg/mL) por uma hora. Aps isso as clulas foram lavadas em PBSA. Soluo protetora de fluorescncia e a montagem das lminas Efetuada a ltima lavagem com PBSA, os esferides foram mantidos ao fundo do tubo de Eppendorf. Foram adicionados um volume de 20 l de soluo protetora de fluorescncia (anti-fading- Vectashield Burlingame, CA, Estados Unidos da Amrica) juntamente com 3 l de

47

soluo de iodeto de propdeo. Com o auxlio de uma tesoura, foi cortada a ponta da ponteira de uma micropipeta (aumentando o dimetro da entrada) e por suco os esferides foram retirados e colocados sob uma lmina de vidro. J na monocamada foi adicionado 8 l de soluo protetora de fluorescncia e 2 l de soluo de iodeto de propdeo, sendo este conjunto colocado sob uma lmina de vidro. Em ambos processos, as lamnulas de vidro foram vedadas com esmalte de unha. Para evitar um achatamento dos esferides entre as lminas e as lamnulas foram colocados 4 pontos de esmalte nas extremidades das superfcies voltadas para o material, aumentando assim a altura. As lminas foram acondicionadas em ambiente escuro e mantidas -20 oC. Anlise do material ao microscpio confocal de varredura a laser As clulas foram analisadas ao microscpio confocal de varredura a laser (Zeiss LSM 510) sendo as imagens fluorescentes adquiridas utilizando-se de laseres de Argnio (458, 488, e 514 nm), Hlio-Nenio1 (543 nm) e Hlio-Nenio2 (633 nm). As fatias pticas foram obtidas em intervalos adequados no eixo Z, entre 0,5 e 1 m. Diferentes mdulos do software LSM 510 3D (Carl Zeiss Jena, Thuringia, Alemanha) foram utilizados na anlise confocal, os quais incluem: projees das fatias, cortes ortogonais e animaes. Algumas reconstrues e animaes foram feitas no software IMARIS 7.1 (Bitplane Zurique, Canton de Zurique, Sua). 3.2.3 Microscopia eletrnica Microscopia eletrnica de transmisso Aps a retirada do meio de cultura, os esferides foram lavados com uma soluo de tampo cacodilato de sdio 0,1 M pH 7,2 e fixados com a soluo de glutaraldedo 2,5% com formaldedo 2% no mesmo tampo adaptado de (117). Aps 2 horas a temperatura de bancada (ao redor de 25 oC), o fixador foi retirado e o material passou por 3 banhos de 5 minutos em tampo cacodilato de sdio. Aps este processo iniciou-se a ps-fixao com uma soluo de tetrxido de smio a 1% em tampo cacodilato de sdio. Os esferides foram lavados em gua destilada e seguiram para uma gradual desidratao etlica de 15 minutos cada banho (50, 70, 80, 90 e 2x 100% etanol).

48

Na etapa final da desidratao o material ficou imerso em xido de propileno durante 10 minutos (2 banhos de 5 minutos), seguindo para um banho de uma mistura de resina Epon(Electron Microscopy Science, PA, Estados unidos da Amrica) mais xido de propileno (1:1) durante 5 horas. A mistura foi substituda por resina Epon pura, permanecendo as clulas nesta soluo por mais 5 horas. A incluso das clulas foi feita em formas de silicone preenchidas com a mesma resina, sendo esta polimerizada aps 72 horas em estufa a 65 oC. Aps o desbaste dos blocos de resina, foram feitos cortes em ultramicrtomo com espessura de 7m, sendo estes montados em lmina de vidro, corados com azul de toluidina e visualizados ao microscpio de luz. Escolhida a regio de interesse no bloco, foram feitos cortes na espessura de 70 a 90 nm, sendo posteriormente colocados em telas de cobre (200 mesh). O material foi contrastado em uma soluo de acetato de uranila a 4% por 30 minutos, posteriormente lavados em gua e colocados em uma soluo de citrato de chumbo a 10%. Aps serem novamente lavados, retirou-se o excesso de gua destilada e as telas de cobre foram acondicionadas em um porta-telas e mantidas em ambiente resfriado. O material foi analisado e fotografado ao microscpio eletrnico de transmisso Jeol(Queensland, Brisbane, Austrlia) 1010 (80 kV). Microscopia eletrnica de varredura As clulas foram submetidas aos mesmos processos de fixao e desidratao descritos acima (microscopia eletrnica de transmisso). O material tambm passou por uma desidratao etlica, sendo que na etapa final os esferides passaram por 2 banhos com acetona pura. Para o trmino da desidratao o material foi submetido ao aparelho de ponto crtico ou a banhos em soluo de hexametildisilazane. As clulas foram aderidas a cilindros de metal sendo este material posteriormente metalizado em aparelho de pulverizao catdica. O cilindro contendo o material foi ento analisado e fotografado ao microscpio eletrnico de varredura Jeol 6100 (30kV).

49

3.3 INCORPORAO DO 5-BROMO-2-DESOXIURIDINA (BRDU) O composto BrdU (concentrao de 0,3 mM) foi adicionado ao meio de cultura utilizado ficando em contato com as clulas por um perodo de 1 hora. Depois desta incorporao o material foi fixado com uma soluo de etanol:cido actico (3:1) por 20 minutos para monocamada e 40 minutos para esferides. Lavados com PBSA, as clulas passaram por um processo de permeabilizao com Triton. Aps lavagem com PBSA, o DNA foi hidrolisado com HCl 2N por 30 minutos sendo posteriormente lavadas. Finalmente as clulas foram imunomarcadas com anti-BrdU e os ncleos corados com iodeto de propdeo.

3.4 QUANTIFICAO DO DNA POR CITMETRIA DE FLUXO As clulas MCF-7 crescidas em monocamada e em cultura 3D passaram por um processo de dissociao enzimtica por tripsina com o objetivo de retirar estas clulas das garrafas de cultivo como tambm dissociar os esferides com diferentes tempos de cultura. Aps a neutralizao da tripsina com meio de cultura as clulas foram transferidas para tubos de centrifugao de 15 mL, sendo a suspenso centrifugada por 5 minutos a 300 G. O sobrenadante foi descartado e o precipitado formado foi ressuspenso em 1 mL de PBSA. Foi ento acrescentado 3 mL de metanol 100% 4 oC e, aps cuidadosa agitao, os tubos foram colocados no gelo por 1 hora. Novamente centrifugados (nas mesmas condies descritas anteriormente) e retirado o sobrenadante, as clulas foram novamente lavadas com 1 mL de PBSA. Aps nova centrifugao e retirada do sobrenadante, o precipitado foi ressuspenso em uma soluo contendo 200 L de PBSA, 20 L de RNAase (10 mg/mL) e 20 L de iodeto de propdeo (10 g/mL). A soluo foi cuidadosamente agitada e deixada no gelo por 1 hora. Para a anlise do ciclo celular, o DNA de cada amostra foi quantificado pelo citmetro de fluxo Guavaeasycycle mini (GE), sendo cada experimento obtido em triplicata.

50

3.5 DETECO DE MORTE CELULAR 3.5.1 Marcao para M30 Aps serem fixadas e permeabilizadas (ver item preparo das clulas), as clulas foram tratadas com RNaase por 30 minutos (10mg/mL). Lavadas novamente com PBSA, as clulas foram ento expostas ao anticorpo monoclonal M30 conjugado a FITC (CytoDEATH-Roche), o qual se liga a fragmentos de citoqueratina 18. Este material foi mantido por 12 horas (entre um dia e outro) temperatura ambiente em cmara mida e no escuro. Aps lavagem em PBSA, os ncleos foram corados com iodeto de propdeo. 3.5.2 ENSAIO DE CASPASE 9 Aps o processo de dissociao enzimtica por tripsina tanto nas clulas em monocamada quanto nos esferides, estes foram separados 100 l de cada amostra na concentrao de 1X105 clulas /mL. Aps isso, adicionou-se 10 l de Caspase Reagent working solution sendo as clulas ento encubadas por 1 hora a 37 oC. Posteriormente a esse processo foram adicionados 100 l de 1x Apoptosis Wash Buffer s amostras que seguiram para centrifugao a 300 G por 7 minutos. Aps o descarte do sobrenadante, as clulas foram ressuspendidas em 200 l de Caspase 7-AAD Working Solution diludo a 1:40 com 1x Apoptosis Wash Buffer. Aps incubao de 10 minutos temperatura ambiente e no escuro, as amostras foram lidas em citmetro de fluxo Guavaeasycycle mini (GE), sendo cada experimento obtido em triplicata. Todos os reagentes descritos neste item so parte do Guava Caspase Kit (Millipore). As populaes separadas por esses reagentes podem ser separadas em: -Clulas viveis: esta populao celular foi caracterizada pela integridade da membrana (comprovado pela no penetrao do corante 7-aminoactinomicina-7-AAD) e ausncia de marcao para o corante especfico para Caspase 9. -Clulas necrticas: como mostrado previamente na microscopia eletrnica de transmisso, a integridade da membrana das clulas que esto passando por esse processo bastante alterada. Tal caracterstica permite a entrada do corante 7-AAD, ao mesmo tempo que estas clulas se mostram negativas ao corante de Caspase 9.

51

-Clulas em apoptose: estas clulas possuem como marcador principal a positividade para Caspase 9. A no integridade da membrana faz com que sejam selecionados dois grupos; apoptose inicial- negativa para 7-AAD e apoptose final-positiva para o mesmo corante. Neste trabalho optamos somar esses valores.

3.6 ANLISE DA EXPRESSO DE PROTENAS As clulas em monocamada e crescidas em cultura 3D foram homogeneizadas em tampo RIPA (NaCl 150 mM, NP-40 1%, cido deoxicolato de sdio 0,5% em Tris 50 mM-HCl em pH 7,5) contendo inibidores de proteases na concentrao final de 2% (Sigma). Aps centrifugao a 12000 G por 10 minutos o sobrenadante foi coletado e alquotas foram separadas para a quantificao pelo mtodo de BCA (cido bicincrnico). A leitura da absorbncia foi realizada por ELISA utilizando filtro de 595 nm. As amostras foram diludas em tampo de amostra 4x (Tris 0,5 M, pH 6,8, glicerol SDS 10%, azul de bromofenol 1% e betamercaptoetanal 1% em gua milliQ) e fervidas por 5 minutos (100 C). O fracionamento das protenas foi realizado em gel de poliacrilamida 10 % com SDS (dodecil sulfato de sdio) (2 horas a 100V). Em cada poo foram colocados 30 g de protenas totais. O padro de peso molecular utilizado foi Precision Plus Standards-Dual Core Bio-Rad. A transferncia para a membrana de PVDF (fluoreto de polivinilideno) (Amersham GE Uppsala, Uppsala, Sua) foi realizada por 2 horas a 200 mA em tampo (Tris 0,025M, glicina 0,192M e metanol a 20% em gua destilada). Aps transferncia das protenas a membrana foi corada em soluo de Ponceau 0,5% por 3 minutos para verificar a eficincia da transferncia. Em seguida, a membrana foi lavada 3 vezes em TBS a 0,02 M (10 minutos cada lavagem). O bloqueio foi realizado com TBS a 0,02 M contendo leite em p desnatado a 5% e tween a 0,05% por uma hora temperatura ambiente sob agitao. Os anticorpos primrios (ver Tabela 2) foram diludos em soluo de bloqueio sendo a membrana incubada por 12 horas (entre um dia e outro) a 4 oC sob agitao. Aps sucessivas lavagens com TBS e TTBS, a membrana foi incubada com anticorpos secundrios (1:5000) (Kit ECL, Amersham GE), lavado novamente e revelado por quimioluminescncia (ECL, Amersham

52

GE) conforme especificaes do fabricante. Os resultados foram registrados em filme Hyperfilm (Amershan GE ). Para o controle da concentrao de protenas carregadas por poo do gel foram utilizados os anticorpos anti- -tubulina e anti--actina.
Tabela 2-Anticorpos utilizados nos experimentos de western blotting.

Anticorpo /Empresa/Breve Descrio Anti -LC3B-policlonal (coelho) (Abcam ab51520) -Marcador de autofagosso Anti- tubulina (camundongo) (Sigma T5293) -Componente dos microtbulos (controle do carregamento) Anti actina (camundongo) (Sigma A2228)

Concentrao utilizada 1:1000 1:1000 1:1000 1:1000 1:1000 1:500 1:500

-Componente dos microfilamentos de actina (controle do carregamento) Anti-PAR 4 (coelho) (Abcam ab49155-100) -Morte celular Anti-ADAMTS-1 (coelho) (Abcam ab28284-100) -Metaloprotenase Anti-p-ERK (Tyr 204) (coelho) (Santa Cruz Sc-7976-R) -Importante componente das vias de transduo de sinal Anti-p-Akt1/2/3 (Thr 308) (coelho) (Santa Cruz-Sc 16646-R) -Importante componente de diversas vias de sinalizao

3.7 SELEO DOS ESFERIDES DIFERENCIADOS Os esferides foram coletados aos 50 dias de cultivo em cultura 3D utilizado de uma micropipeta e com auxlio do microscpio invertido digital da marca EVOS AME-3302 (Figura 7D). Toda a coleta destes esferides diferenciados ocorreu dentro do fluxo laminar. Como critrio de seleo padronizou-se a coleta de esferides que apresentassem um arranjo alongado sem a presena de grandes massas esfricas (essas predominantes aos 30 dias de cultura, mas tambm presente em menor nmero aos 50 dias) (Figura 13).

53

Esses esferides foram colocados para crescer diretamente em garrafas de cultivo de tecidos ou aps dissociao pela tripsina. As clulas foram mantidas nestas condies (2D) at que estas obtivessem confluncia. Subcultivadas mais uma vez, o nmero de clulas foi expandido e aps dissociao pela tripsina, as clulas foram mantidas em cultura 3D nas condies previamente descritas.

3.8 ANLISE DO PERFIL DE EXPRESSO DE RNAm DE E-CADERINA Os RNAs foram extrados utilizando o kit de extrao ChargeSwitch total RNA Cell Kit (Invitrogen) e quantificados em um NanoDrop ND1000 Spectrophotometer. Para a anlise do perfil de expresso foram realizadas reaes de RT-PCR em tempo real em um aparelho da Corbett Research modelo Rotor Gene 6000 real-time cycler e o kit AgPathID One-Step RT-PCR kit (Applied Biosystems). As condies dos PCRs em tempo real foram 45oC por 10 min; 95oC por 10 min, 40 ciclos [950C por 15 seg; 550C por 20 seg; 720C por 40 seg], seguindo ento o melt. As temperaturas de anelamento foram determinadas especificamente para cada par de primers. Primers utilizados qE_Cadherin_left TACCTGCTCACGTCAAATGC qE_Cadherin_right AAAGTGATGACCTCCCATGC

3.9 ANLISE ESTATSTICA A anlise estatstica dos dados obtidos foi feita pelo teste 2 de tendncia, tomando-se como referncia o grupo crescido arranjado em monocamada. Em todas as anlises o nvel de significncia foi menor que 5% (P<0,05).

54

4 RESULTADOS

55

4.1 DESENVOLVENDO O MTODO E ESCOLHA DA LINHAGEM Como j apresentado, neste trabalho nossa anlise limitou-se a linhagens celulares comerciais de mama em uso no nosso laboratrio. Assim, foram utilizamos linhagens que variaram desde um fentipo considerado normal (MCF-10A) bem como 4 linhagens tumorais com diferentes graus de agressividade (MCF-7, T47-D, MDA-MB 231 e Hs578T). Em nosso delineamento experimental, priorizamos o uso de clulas que se adaptassem ao cultivo celular em 3D (modo de imerso em lquido), que formassem esferides estveis e que a produo destes fosse facilmente reprodutvel. A linhagem MCF-10A (Figura 8C e D), bastante utilizada em culturas 3D, apresentou problemas em relao formao de esferides. Ao serem colocadas em ambiente 3D estas clulas iniciaram um forte processo de anoikis (morte celular decorrente da no adeso). O seu uso em cultura 3D esteve sempre vinculado a adio de componentes de lmina basal ao meio de cultura, todavia, esse mtodo de cultivo no era o objetivo do presente estudo. Por outro lado, quando analisamos as linhagens tumorais, notamos que todas formaram esferides quando submetidas ao nosso protocolo (Figura 8A, B e E). A diferena entre essas linhagens foi que o nmero de esferides obtidos com as clulas mais agressivas (Hs578T e MDA-MB 231) foi relativamente menor quando comparado com as linhagens menos agressivas (MCF-7 e T47-D). Tal fato fez com que nossa anlise se concentrasse nas linhagens MCF-7 e T47-D. Desta forma, por um perodo de aproximadamente 30 dias, foram comparados os resultados obtidos com as duas linhagens crescidas em monocamada e crescidas em 3D. Em decorrncia a esses estudos iniciais foi observado que a linhagem MCF-7 melhor se adequaria as nossas anlises. Os motivos que levaram a essa escolha sero mostrados a seguir.

56

Figura 8 - Prancha composta por diferentes imagens onde se observa a morfologia de algumas linhagens de mama em monocamada (C, D e F) e quando crescidas em cultura 3D (A, B e E). A Figura C e D mostra a linhagem MCF 10A, a qual no formou esferides. Figuras A e B representam T47-D e E e F Hs578T. Imagens obtidas ao microscpio eletrnico de varredura (M.E.V) e ao microscopio confocal de varredura a laser. Iodeto de propdeo (vermelho) e faloidina acoplada a FITC (verde) foram usados nas marcaes fluorescentes. Barra equivale 25 m.

57

4.1.1 A linhagem MCF-7 e seu uso na cultura 3D As clulas MCF-7 (Figura 9) mantidas em monocamada tiveram o seu nmero de clulas contado por um perodo de 10 dias. A partir destes resultados foi calculado a fase log (crescimento exponencial) sendo elaborado assim um grfico com a curva de crescimento celular (Figura 9A). Utilizando-se destes dados foi padronizado que a data de coleta e incio da cultura em 3 dimenses fosse partir do 3 dia de cultura em monocamada pois, neste perodo, as clulas se encontram na maior fase de proliferao.

Figura 9 - Grfico mostrando o aumento do nmero de clulas MCF-7 ao longo do tempo (A). Imagem das clulas MCF-7 crescidas em monocamada vistas ao microscpio de luz com contraste de fase (B). Barra equivale 200 m.

Quando analisadas ao microscpio de luz utilizando o contraste de fase, foi observado que a maioria das clulas se encontrava isolada aps a imerso em meio de cultura. Todavia a formao dos esferides em ambiente 3D ocorreu predominantemente por agregao destas clulas e no por divises celulares de uma nica clula. O tempo de formao destes agregados ocorreu em mdia aps o 3 dia na cultura em 3 dimenses sendo que, aps esse perodo, os esferides alteraram a sua morfologia passando a ter uma superfcie mais coesa e com maior interao entre as clulas (Figura 10A, B e C). A superfcie dos esferides voltada para o meio de cultura foi analisada ao microscpio eletrnico de varredura (Figura 10D,E e F). Como conseqncia do arranjo e morfologia celulares, as membranas das clulas MCF-7 foram

58

diferentemente expostas ao meio (Figura 10E), sendo possvel observar nestas superfcies diversas projees da membrana celular (Figura 10F).

Figura 10 - Fases iniciais da cultura 3D, mostrando desde os agregados de clulas MCF-7 com 1 dia de cultura (detalhe em A), esferides com 3 dias (A), 7 dias (B) e quando vistos com 10 dias de cultura (C). Os esferides foram analisados em maior aumento (D-F, aqui com 30 dias) onde foi possvel observar uma exposio diferencial da superfcie das clulas ao ambiente externo (E) bem como projees da membrana celular (indicada pela seta em F) O material foi analisado ao microscpio de luz com campo claro e contraste de fase (A e B) por meio de cortes corados com azul de toluidina utilizando microscopia de luz (C) e por microscopia eletrnica de varredura (D-F). Barra equivale 25 m.

59

medida que se aumentava o tempo de cultura, tornou-se evidente um gradativo crescimento dos esferides decorrente de uma proliferao celular. A confirmao de tal fato ocorreu em paralelo com a morfologia (visualizao de figuras de mitose) quando foi utilizado um ensaio de incorporao de BrdU (5-bromo-2-desoxiuridina). Essa tcnica permitiu observar a sntese de DNA nos esferides (Figura 11).

Figura 11 - Esferides da linhagem MCF-7 submetidos a 7 dias de cultura 3D. Destaque para a marcao para anti-BrdU (azul), mostrando clulas que estavam em a sntese do DNA. Para a marcao fluorescente foi utilizado iodeto de propdio para visualizar o DNA (vermelho) e o anticorpo secundrio Alexa 633 para marcar o anticorpo anti-BrdU. Reconstrues foram obtidas ao microscpio confocal de varredura a laser. Barra 20 m

Essa primeira fase do estudo provou a viabilidade do mtodo, haja visto que mesmo aps a perda de adeso celular as clulas MCF-7 formaram esferides estveis. A partir deste momento o foco da pesquisa voltou-se para quais seriam as possveis modificaes nos esferides em perodos mais longos de cultura 3D. Foi observado que a morfologia esfrica sofreu alteraes ao longo do tempo devido a uma agregao contnua entre clulas e tambm entre esferides. Entretanto, tal fato associado prpria proliferao celular fez com que os esferides aumentassem seu tamanho ao longo do tempo. Ao redor do 20 dia de cultura e com dimetro mdio de 300 m, os esferides das clulas MCF-7 (quando analisados ao microscpio de luz), comearam a apresentar uma rea escurecida localizada centralmente na regio medular (Figura 12A). Ao longo do tempo foi

60

observado crescente aumento desta regio, sendo que ao redor do 30 esse crescimento mostrou certa estabilizao no que se refere forma esfrica (Figura 12B). Em uma anlise inicial, utilizando-se de cortes histolgicos corados com azul de toluidina, foi verificado a presena de corpos apoptticos bem como clulas com morfologia caractersticas de processos de apoptose e necrose (Figura 12D). Ao mesmo tempo em que ocorria o crescimento da regio medular, a regio cortical apresentou o surgimento de agrupamento de clulas os quais se mostraram semelhantes a brotamentos (Figura 12A-C e 13C). Estas estruturas foram descritas nas culturas a partir do 20 dia, apresentando um crescimento constante o qual foi acompanhado por at 155 dias (Figura 13D). Estes resultados mostraram boa adaptao das clulas MCF-7 ao ambiente 3D, o qual possibilitou a descrio das alteraes da morfologia destes esferides. Posteriormente a essa anlise inicial, verificamos quais seriam as relaes entre alteraes na morfologia e citoesqueleto. Para tanto, foram analisados possveis modificaes nos microfilamentos de actina e nos microtbulos sendo estes observados por microscopia confocal de varredura a laser.

61

Figura 12 - Esferides da linhagem MCF-7 submetidos cultura 3D por 20 (A e B) e 30 dias (C e D). Note a formao da regio medular (M) a qual foi posteriormente acompanhado pelo crescimento de um brotamento com clulas (seta) na regio cortical (Co). A anlise de cortes histolgicos corados com azul de toluidina mostrou a heterogeneidade celular da regio medular (D). Fotos obtidas ao microscpio de luz com campo claro. Barra 50 m

62

Figura 13 - Alteraes na morfologia das clulas MCF-7 desde a monocamada (A) 7 dias (B), 30 dias (C) e 50 dias de cultura 3D (D). Imagens obtidas ao microscpio de luz com campo claro. Barra 400 m.

63

4.2 ORGANIZAO DOS MICROFILAMENTOS DE ACTINA E DOS MICROTBULOS 4.2.1 Clulas em monocamada (2D) As modificaes foram evidenciadas por reconstrues em 3-dimenses de imagens obtidas ao microscpio confocal de varredura a laser. Nas fases iniciais da cultura as clulas recm aderidas apresentaram protuses indicativas de atividade migratria (Figura 14A e B), sendo possvel observar que marginalmente a membrana destas estruturas, houve uma maior intensidade de marcao para os microfilamentos actina (Figura 14A). Tais componentes tambm se mostraram arranjados em pequenas pontuaes, preferencialmente localizadas na superfcie de contado com o substrato (Figura 14B). Na monocamada tambm foi possvel observar a formao de fibras tensionadas (stress fibers). Estes agregados lineares de microfilamentos esto localizados tanto marginalmente aos limites celulares, como tambm de forma retilnea no citoplasma (Figura 14C). Tambm foi observada uma intensa marcao para os microfilamentos de actina em regies de contato entre as clulas (Figura 14D). A organizao dos microtbulos, ao contrrio do descrito para actina, apresentou poucas diferenas de localizao no interior das clulas analisadas (Figura 14). Concentrados na regio perinuclear e dispostos radialmente no citoplasma da clula, os microtbulos estenderam-se at muito prximo dos limites celulares. A disposio tpica deste componente do citoesqueleto tambm foi confirmada nas clulas mitticas, onde foram observados microtbulos arranjados de forma peculiar para a formao do fuso mittico (Figura 14D).

64

Figura 14 - Clulas MCF-7 crescidas em monocamada. Foi possvel observar a maior concentrao dos microfilamentos de actina nas protruses das clulas (seta), nas fibras tensionadas (stress fiber) e entre clulas contguas (cabea de seta). Os corantes fluorescentes usados foram iodeto de propdio (em vemelho) e faloidina conjugada a FITC (verde). Em azul foram utilizados anticorpo anti e anti tubulina, sendo posteriormente marcados com anti-IgG de camundongo conjugado com CY5. M = mitose. Barra 20 m. Imagens obtidas ao microscpio de confocal de varredura a laser

65

4.2.2 Clulas crescidas em culturas 3D Em paralelo as descries dos componentes do citoesqueleto, a microscopia confocal de varredura a laser possibilitou a obteno de maiores informaes a respeito das alteraes morfolgicas dos esferides ao longo do tempo de cultura. As Figuras 15A, B e C mostram esferides com 3, 5 e 7 dias de cultura 3D respectivamente. Nos primeiros dias de cultura, foi possvel observar que a marcao para os microfilamentos de actina apresentou-se mais intensa nas clulas localizadas na regio central quando comparadas com as clulas mais perifricas ao esferide (Figura 15A). Ao redor do 5 dia de cultura os esferides comearam a apresentar uma marcao para F-actina mais homognea (Figura 15B). Associado a isso, tornou-se cada vez mais evidente um crescente contato entre as clulas. Essa maior interao tambm ocorreu em esferides com 7 dias (Figura 15C) os quais mantiveram a sua morfologia esfrica com uma maior densidade de clulas, esta, resultante principalmente de processos de diviso celular (evidenciados por figuras de mitose). Ao longo do tempo de cultura 3D o crtex dos esferides apresentou-se como uma rea bastante interessante, pois, nesta regio, foi observada uma proliferao celular diferenciada acarretando na formao de estruturas denominadas de brotamentos corticais. Na Figura 15D foi possvel verificar o dinamismo deste processo, haja visto que em um mesmo esferide (aqui com 30 dias de cultura) foi visualizado brotamentos em fase inicial ocorrendo ao mesmo tempo que brotamentos bastante desenvolvidos. Inserido neste panorama, duas caractersticas mostraram-se importantes: a crescente morte celular (evidenciadas nesta anlise por meio da presena de fragmentos celulares e ncleios picnticos) e a morfologia alongada assumida por esses brotamentos. A morte celular nesta fase pode, nos esferides maiores (acima de 300 m), estar relacionada ao aumento da hipxia e diminuio de nutrientes. Todavia o que nos chamou mais a ateno foi a presena deste processo no interior das estruturas alongadas e o seu papel ativo nas modificaes dos esferides, fazendo com que estes assumissem uma morfologia acinar. Ao redor de 50 dias (apesar de estarem presentes desde o 30 dia de cultura), ficou evidente a predominncia de estruturas alongadas quando comparado com o esperado arranjo

66

esfrico das culturas 3D (Figura 15E e F). Adicionado a isto, de forma progressiva, os esferides com essa morfologia modificada mostraram uma diminuio do nmero de clulas da sua regio medular. Por meio de reconstrues de seces pticas, obtidas ao microscpio confocal de varredura a laser, foi observada a formao de uma camada contnua constituda por uma monocamada de clulas. Presente tanto nas estruturas acinares (Figura 15G, com 75 dias) quanto nas tubulares (Figura 15H com 155 dias) esta monocamada cortical margeou uma cavidade recm formada, a qual foi denominada espao luminal (Figuras 16 e 17). Foi verificada nas camadas mais externas destes esferides diferenciados (principalmente ao redor do arranjo acinar) a presena de componentes de laminina- fato este indicativo de polarizao destas clulas (Figura 18C).

67

Figura 15 - A legenda desta prancha est localizada no verso da pgina ao lado.

68

Os resultados encontrados mostraram que os microtbulos, no contexto da cultura 3D, apresentam as mesmas caractersticas descritas para a monocamada (Figura 15C, D, E G e H). Todavia, o outro componente analisado os microfilamentos de actina- apresentaram-se arranjados de forma peculiar nessas culturas mais diferenciadas. Todas as clulas da camada cortical, estas voltadas para o espao luminal, mostraram na regio apical uma intensa marcao para actina. Tal caracterstica delimitou toda rea do espao luminal (Figura 16, 17 e 18), deixando bem claro a ligao das estruturas tubulares com as acinares (Figura 17). A proliferao celular tambm ocorreu nestes esferides tubulares, fato este verificado por meio de ensaios com BrdU (Figura 18B).

Figura 16 - Esferides de clulas MCF-7 com 75 dias. As clulas esto arranjadas em uma monocamada (Mo), voltadas para uma luz (Ls). Note a maior concentrao dos filamentos de actina na regio apical destas clulas (seta). Os corantes fluorescentes usados foram o iodeto de propdio (em vermelho) e faloidina conjugada a FITC (verde). Barra 50 m. Seces pticas obtidas ao microscpio de confocal de varredura a laser.

69

Figura 17 - Clulas MCF-7 crescidas por 75 dias em cultura celular em 3 dimenses. Foi possvel observar que o acmulo de actina est presente por toda a cavidade luminal (tanto na poro acinar quanto na tubular) (seta em B e D). Em D, regio com arranjo acinar vista em corte ortogonal. Os corantes fluorescentes usados foram iodeto de propdio (em vermelho) e faloidina conjugada a FITC (verde). Barra 50 m. As reconstrues foram obtidas ao microscpio de confocal de varredura a laser. Imagens obtidas utilizando o software Imaris 7.1 (A e C).

70

Figura 18 - Arranjo tubular de esferide com 50 dias de cultura (A). Em A1 foi possvel observar a cavidade no interior do esferide (linhas tracejadas em branco) (visto em corte ortogonal). Em maior detalhe desta estrutura (A3) foi possvel observar o arranjo em monocamada (Mo). A Figura B mostra sntese de DNA em esferides com 75 dias. Em esferides com esse mesmo tempo de cultura foi possvel observar clulas da camada cortical positivas para laminina (C). Esferide com 75 dias observado ao microscpio eletrnico de varredura (M.E.V) (D). Os corantes fluorescentes usados foram iodeto de propdio (em vermelho) e faloidina conjugada a FITC (verde). Ambas as imunomarcaes foram evidenciadas com anti-IgG de camundongo conjugado a CY5. M=mitose Barra 50 m. Imagens A-C foram obtidas ao microscpio de confocal de varredura a laser

Os resultados obtidos por microscopia confocal a laser mostraram que a formao de estruturas alongadas no era somente uma resultante de agregao de clulas ao acaso. Alm disso, esta tcnica possibilitou verificar a gradual formao de uma estrutura luminal cercada por esferides modificados em tbulos e cinos. Com o objetivo de ter uma maior resoluo deste processo, os esferides seguiram para uma anlise ultraestrutural, a qual ser mostrada a seguir.

71

4.3 MICROSCOPIA ELETRNICA DE TRANSMISSO As gradativas mudanas na morfologia dos esferides ao longo do tempo apontavam para uma seqncia de eventos os quais resultaram na formao de estruturas tubulares/acinares com arranjo luminal. Entre esses eventos, foi mostrado previamente que a apoptose presente na regio medular e a concomitante diminuio do nmero de clulas da regio cortical estariam atuando como protagonistas destas modificaes. A tcnica de microscopia eletrnica de transmisso inseriu-se neste contexto devido ao fato de atuar como um experimento comprobatrio de alguns processos, podendo citar como exemplo as alteraes celulares presentes na via autofagia. Nas fases iniciais da cultura 3D (nos primeiros 10 dias) as clulas da linhagem MCF-7 mostraram uma interao bastante heterognea decorrente da disposio de suas membranas celulares. As clulas arranjadas preferencialmente de forma esfrica, mantiveram pontos de contato com suas vizinhas os quais aumentavam a sua interao ao longo do tempo. Outras clulas mostraram-se dispostas mais corticalmente, expondo parte de sua membrana para a face externa do esferide (como j mostrado em microscopia eletrnica de varredura). Na regio cortical foram observados clulas com morfologia esfrica intercaladas com clulas mais alongadas tendo como conseqncia reas diferentemente expostas a face externa do esferide. A atividade proliferativa mostrada com ensaios de BrdU tambm foi confirmada pela presena de figuras de mitose, as quais foram caracterizadas por clulas esfricas que em seu interior mostravam seces de cromossomos (devido o efeito de corte) bastante eltron densos (Figura 19A). A razo entre eucromatina/heterocromatina aponta para a atividade metablica das clulas. Neste contexto, foi observado nesta fase inicial que a maioria dos ncleos das clulas MCF-7 no estavam compactados, mas sim, apresentando uma maior quantidade de eucromatina e tambm com nuclolos evidentes.

72

Figura 19 - A morfologia da camada cortical de esferides de clulas MCF-7 sofreu alteraes ao longo tempo, passando por uma fase proliferativa (5 dias em A) posteriormente seguida por uma crescente diminuio do nmero de clulas (mostrada em B com 30 dias). Com a espessura prxima a uma monocamada, as clulas desta regio mostraram um arranjo polarizado com a presena de junes celulares (C) e um arranjo colunar com a regio apical voltada para o espao luminal (Ls) (mostrado nos destaques de C1 e C3 com 75 dias de cultura). Imagens foram obtidas ao microscpio eletrnico de transmisso, sendo que A1, B1 e C5 so regies equivalentes em cortes histolgicos corados com azul de toluidina e vistas ao microscpio de luz. C2 e C4 mostram em detalhe a superfcie apical voltada para a regio luminal. At=autolisossomo, Ac=clula apopttica, D=desmossomo, F= filamentos Intermedirios, L=lipdeos, M=mitose.

73

Posteriormente a esta fase, o foco da nossa anlise foi a formao da regio medular e a formao da camada cortical. Para tanto, analisamos esferides com 25, 30, 45, 75 e 155 dias de cultura 3D. Diferentemente da anlise anterior, a interface entre as camadas medular e a cortical tornou-se bastante evidente ao longo do tempo. Isso se deu pelo fato de que na camada medular o contato entre as clulas MCF-7 bem menos intenso quando comparado com a regio cortical (compare as Figuras 19A e 19B). Em um primeiro momento, observamos na camada cortical clulas arranjadas de maneira semelhante ao encontrado nos esferides iniciais, todavia, a visualizao de clulas com diferentes eltron densidades bem como com diferentes nveis de compactao nuclear, sugere uma maior diversidade celular tanto no que se refere morfologia quanto ao seu estado fisiolgico. Com uma crescente diminuio do nmero de clulas da regio cortical (Figura 19B) foram descritas alteraes morfolgicas que indicam um processo de polarizao celular. A primeira destas foi o aumento de junes celulares, principalmente desmossomos. Estas estruturas apresentaram-se organizadas, atuando no aumento da interao clula-clula. A presena de filamentos intermedirios e o arranjo destes com os desmossomos tambm podem ser indicativos de uma maior diferenciao celular. Em concordncia com este processo, foi verificada a formao de complexos juncionais (Figura 19C). A tendncia de formao de uma camada de clulas na regio cortical dos esferides esteve sempre associada polarizao celular. Visto com bastante freqncia a partir de 45 dias, as clulas desta regio comearam a apresentar uma morfologia colunar onde, com uma regio apical agora definida, mostraram-se voltadas para a regio medular. Ao se examinar em detalhe as projees de membrana localizadas nesta regio, vimos que alm de numerosas estas estruturas sugerem que talvez haja a liberao de compostos celulares na regio medular em esferides mais velhos (Figura 19 C2 e C4). Devido a essas caractersticas evidenciadas ultra estruturalmente, corroboramos os resultados prvios de microscopia confocal de varredura a laser, os quais apontavam para a formao de um espao luminal constitudo por uma monocamada de clulas colunares.

74

Figura 20 - A legenda desta prancha est localizada no verso da pgina ao lado

75

A regio medular, mostrada aqui nas Figuras 20 e 21, foi caracterizada por possuir um menor contato entre as clulas MCF-7. Tal fato foi decorrente do elevado processo de morte celular nesta regio o qual, ao longo do tempo, teve como conseqncia a diminuio da densidade celular (Figura 20A, B e C). Paralelamente a apoptose, a crescente presena de clulas necrticas sugere a atuao de outras vias fisiolgicas na diminuio do nmero de clulas (Figuras 20C e D). Algumas clulas apresentaram um aspecto vacuolizado, muitas vezes decorrentes de intensa atividade autofgica (presena de autolisossomos) ou resultado de degradao celular associada a vias de morte (Figura 20E, F e G). Em maior detalhe vimos que a gradual compactao e formao de ncleos picnticos pode esta acompanhada da degradao de componentes do citoplasma (Figura 21A) a qual pode ter como conseqncia a formao de clulas apoptticas (Figura 21B) ou clulas necrticas (Figura 21C e D). A presena de fragmentos celulares pode ter relao com o grande nmero de clulas necrticas que, aps a perda da integridade da membrana, liberaram seus componentes citoplasmticos na regio medular. A presena de processos autofgicos foi evidenciada principalmente pelo diagnstico de vesculas contendo dupla membrana, os autofagossomos. Concomitante a isso, vesculas contendo material eltron denso em degradao apontam para a formao de autolisossomos, os quais foram encontrados tanto em clulas em processo de autofagia bem como em clulas em processo de necrose (Figura 21D e E).

76

Figura 21 - A legenda desta prancha est localizada no verso da pgina ao lado

77

A presena de clulas no interior de outras clulas uma caracterstica tanto de processos relacionados fagocitose, bem como entose (118, 119). Apesar de esta caracterstica ter sido encontrada nas clulas analisadas, no possvel, utilizando a ultra-estrutura, delinear qual via celular estaria sendo predominante. Desta forma, foi adotado o termo entose/fagocitose no decorrer deste texto para a descrio deste processo. Tanto na regio medular (Figura 21F) quanto na regio cortical (Figura 21G) foram observadas o processo de fagocitose/entose. Em todas as clulas analisadas, a clula interiorizada apresentava elevado grau de degradao dos seus componentes intracelulares. Na Figura21F, foi possvel observar uma clula com elevada atividade autofgica (presena de autolisossomos). Na Figura 21G a clula interiorizada possui elevada fragmentao da membrana e extravasamento do contedo citoplasmtico, o qual apontaria para processos de necrose celular. O que chama a ateno nesta ltima imagem a presena de um retculo endoplasmtico rugoso bastante desenvolvido na clula que est interiorizando, sendo possvel at observar a formao de vesculas de secreo (Figura 21G1 ). A microscopia eletrnica de transmisso adicionou maiores informaes a respeito da morfologia celular de clulas MCF-7 comprometidas com a sinalizao para a morte celular. Todavia tornou-se necessrio a utilizao de marcadores especficos capazes de separar os diferentes tipos de morte celular, bem como quantificar o nmero de clulas que estariam passando por esses processos. Assim, a fase posterior de nosso trabalho envolveu principalmente a quantificao por citometria de fluxo dos esferides analisados. Fato este que mostraremos a seguir.

78

4.4 QUANTIFICAO DA MORTE CELULAR NO MODELO 3D 4.4.1 Marcao das clulas em apoptose utilizando M30 Devido ao fato de ligar-se com a poro clivada da citoqueratina 18, (processo presente nas fases iniciais da apoptose) a tcnica de M30 possibilita a visualizao de clulas apoptticas antes de apresentarem alteraes caractersticas deste processo. Foi observada, novamente, predominncia de clulas apoptticas na regio medular sendo esta mais intensa partir do 30 dia de cultura (Figura 22A). Todavia, mesmo em esferides com maior tempo de cultura esta marcao tambm esteve presente no interior do agora recm formado espao luminal. Em paralelo a isso, novamente foi notado concomitante presena de ncleos picnticos e fragmentos nucleares (Figura 22B).

Figura 22 - Esferides de clulas MCF-7 com 30 dias (A) e 115 dias de cultura (B) marcados pela tcnica de M30. Notar a elevada presena de clulas com ncleos picnticos (Np) em B. A marcao nuclear foi feita utilizando o corante fluorescente iodeto de propdeo. Reconstrues obtidas ao microscpio confocal de varredura a laser, sendo os resultados tambm analisados no software Imaris 7.1 . Barra 20 m.

79

4.4.2 O ensaio para a deteco de Caspase 9 por citometria de fluxo Visando ainda ampliar o panorama de informaes a respeito do papel da apoptose no sistema, optamos em paralelo ao estudo da clivagem da citoqueratina 18 analisar a expresso de uma Caspase iniciadora, a Caspase 9. O kit utilizado permitiu analisar o nmero de clulas viveis, necrticas e clulas apoptticas (com e sem integridade de membrana) em esferides com diferentes tempos de cultura. Os resultados mostrados com essa tcnica confirmaram as descries morfolgicas prvias, as quais apontavam para a diminuio das clulas viveis ao longo do tempo de cultura 3D em detrimento do aumento do nmero de clulas em processo de morte (ver Figura 23, 24 e Tabela 3). Todavia, foi notada uma existncia de um padro que aproximava os valores encontrados permitindo separ-los em 2 dois grupos; o 1 constitudo pelas clulas em monocamada e esferides com 7 dias de cultura e o 2 grupo composto pelos esferides com 30 e com 50 dias de cultura. Tanto o nmero de clulas apoptticas quanto o de clulas necrticas foi mais elevado no segundo grupo de amostras, sendo sempre os resultados mais altos encontrados nos esferides com 30 dias de cultura 3D.

80

Figura 23 - Quantificao por citometria de fluxo de clulas em processo de morte celular usando Guava Caspase 9 SR Kit. No quadrante inferior esquerdo clulas (-) para o reagente de caspase e (-) para 7-AAD. O quadrante inferior direito mostra clulas (+) para o reagente de caspase e (-) para 7-AAD. No quadrante superior direito clulas (+) para o reagente de caspase e (+) para 7AAD. Por fim, no quadrante superior esquerdo as clulas (-) para o reagente de caspase e (+) para 7-AAD. Clulas MCF-7 em monocamada foram tratadas com radiao ultravioleta e analisadas como controle positivo para apoptose (A). MCF-7 em monocamada (B), esferide com 7 dias de cultura 3D (C), com 30 dias (D) e com 50 dias (E).

81

Figura 24 - Representao grfica dos resultados apresentados em forma de dot plot (Figura 22).

*= p<0,05
Tabela 3 - Mdia e desvio padro do nmero de clulas encontradas no ensaio de Caspase 9.

Clulas Viveis 2D 3967176

7 dias (3D) 4255122

30 dias (3D) 3290171

50 dias (3D) 349170

Clulas em Processo de Apoptose 2D 7 dias (3D) 965166 669102 Clulas em Processo de Necrose 2D 7 dias (3D) 6921 7625

30 dias (3D) 1417201

50 dias (3D) 127018

30 dias (3D) 29332

50 dias (3D) 23956

82

Como descrito previamente por microscopia eletrnica, a autofagia outro processo presente durante a formao da estrutura luminal. Devido a sua relao com a morte celular e com processos morfognicos, a anlise posterior teve como objetivo a quantificao da autofagia ao longo do tempo de cultura 3D, possibilitando assim a comparao deste processo com os observados para morte celular. 4.4.3 Quantificao do processo de autofagia nos esferides Devido a sua interao a processos relacionados formao de autofagossomos, a protena LC3B vem sendo cada vez mais utilizada como indicador de processos autofgicos. Nas clulas, essa protena pode tanto apresentar-se na sua forma citoplasmtica (LC3B-I) ou associada diretamente com a membrana plasmtica dos autofagossomos (LC3B-II). Os resultados obtidos por western blot mostraram que a expresso protica da forma citoplasmtica (LC3B-l) foi baixa em clulas crescidas em monocamada. Entretanto, ao se analisar a expresso desta protena em ambiente 3D, verificou-se um crescente aumento de expresso ao longo do tempo de cultura. J a forma associada aos autofagossomos (LC3-II), teve a sua expresso aumentada de maneira crescente desde a monocamada at esferides com 30 dias de cultura (sendo este ponto o de maior intensidade de marcao). Aps esta data, em 50 dias, houve uma significativa reduo da expresso de LC3B-II (Figura 25B) nos esferides analisados. Como conseqncia desta primeira abordagem, esferides com 30 dias de cultura foram marcados por imunofluorescncia, sendo que a maior positividade a esta marcao ocorreu na regio medular anteriormente a formao do espao luminal (Figura 25A). A diferena da expresso protica ao longo do tempo e nos diferentes modos de cultivo (2DX3D) mostrou, primeiramente, um concomitante aumento de 3 processos fisiolgicosautofagia, necrose e apoptose- em esferides com 30 dias de cultura. Alm disso, a somatria dos resultados obtidos mostrou que associado as alteraes morfolgicas algumas protenas poderiam ser expressas diferentemente. A partir deste momento, o trabalho se concentrou em alteraes na expresso de diferentes protenas, fato este que ser explorado a seguir.

83

Figura 25 - Clulas MCF-7 crescidas em cultura 3D por 30 dias mostrando fase anterior a formao do espao luminal (A). Notar positividade para a protena LC3B na regio medular (detalhe na reconstruo feita pelo software Imaris 7.1 ). Imuno marcao feita com anti-LC3 e anti-IgG de coelho-FITC (mostrado em verde) e marcao nuclear feita com o corante fluorescente iodeto de propdeo (vermelho). As reconstrues foram obtidas ao microscpio confocal de varredura a laser. Barra 10 m. A quantificao da expresso da protena LC3B foi feita pela tcnica de western blot (B). M=monocamada, 7, 30, 50=dias de cultura 3D

84

4.5 A EXPRESSO E LOCALIZAO DE ALGUMAS PROTENAS NA CULTURA 3D 4.5.1 AKT fosforilada Akt, uma serina/treonina quinase a qual pode fazer mediao entre fatores de crescimento e sobrevivncia celular. A expresso desta protena em clulas crescidas em monocamada mostrou-se baixa quando comparada com clulas crescidas em 3D. Todavia, nas fases iniciais da cultura 3D, houve um elevado aumento de AKT fosforilada (p-AKT) (mostrado aqui com 7 dias de cultura), com posterior diminuio da sua expresso ao longo do tempo (com 30 e 50 dias, mostrados na Figura 26D). Por imunofluorescncia, observamos uma maior positividade para p-AKT nas clulas localizadas na regio cortical de esferides com 7 dias de cultura (Figura 26A-B). Nos outros pontos analisados, a intensidade da marcao mostrou-se menor (Figura 26C).

Figura 26 - Clulas MCF-7 crescidas em cultura 3D por 7 dias (A e B) e 50 dias(C). Notar marcao para pAKT na regio cortical dos esferides com 7 dias mostradas em conte ortogonal (A) e aps tratamento para se obter volume (software Imaris 7.1) em B. Imuno-marcao feita com anti-p-AKT e anti IgG de coelho-FITC (mostrado em verde),marcao nuclear feita com o corante fluorescente iodeto de propdeo (vermelho) e faloidina-633 (azul) . As reconstrues foram obtidas ao microscpio confocal de varredura a laser. Barra 20 m. A quantificao da expresso da protena p-AKT foi feita pela tcnica de western blot (D). M=monocamada, 7, 30, 50=dias de cultura 3D

85

4.5.2 PAR 4 E ERK FOSFORILADA A expresso da protena pr-apopttica PAR-4 se manteve semelhante desde a monocamada at esferides com 30 dias de cultura 3D. J aos 50 dias de cultura foi possvel observar uma maior marcao quando comparada com os pontos anteriores (Figura 27). J a protena ERK fosforilada (tirosina 204), apresentou uma maior expresso na monocamada. Em ambiente 3D, as clulas dos esferides diminuram a expresso desta protena ao longo do tempo, o qual culminou em uma baixa expresso nos esferides com 50 dias de cultura (Figura 27).

Figura 27 Quantificao da expresso das protenas PAR-4 e p-ERK pela tcnica de western blot M=monocamada, 7, 30, 50=dias de cultura 3D

4.5.3 ADAMTS-1 A expresso desta metaloproteinase mostrou-se mais intensa na monocamada e nas fases inicias da cultura 3D (7 dias). Aos 30 dias e, principalmente aos 50 dias, foi possvel observar uma diminuio desta expresso (Figura 28E). A anlise por imunofluorescncia mostrou uma intensa marcao desta protena na regio nuclear, sendo que nos esferides essa marcao foi mais evidente na regio do nuclolo. ADAMTS-1 tambm foi visualizado na

86

superfcie das clulas crescidas em monocamada, estando este padro ausente em ambiente 3D (compare Figura 28B com 28D).

Figura 28 - Clulas MCF-7 mostradas aqui quando arranjadas em monocamada (A e B) e em 30 dias de cultura 3D (C e D). A marcao da protena ADAMTS-1 (em verde) mostrou-se intensa na regio nuclear, sendo que na monocamada tal marcao foi tambm acompanhada de pontuaes na membrana celular (evidenciadas na reconstruo mostrada em B). Reconstrues obtidas ao microscpio confocal de varredura a laser, obtendo o volume destas utilizando o software IMARIS 7.1 (B e D). Imunomarcao feita com anti ADAMTS-1 e anti-igG de coelho acoplado a FITC. Foram tambm utilizados os corantes fluorescentes iodeto de propdeo para a marcao nuclear e faloidina-TRITC para os microfilamentos de Factina. Barra 10 m. A quantificao da expresso de ADAMTS-1 foi feita pela tcnica de western blot (E). M=monocamada, 7, 30, 50=dias de cultura 3D.

87

At ento, todos os experimentos descritos previamente indicaram a existncia de diferenas entre os pontos at ento analisados. Seguindo esta linha, resolvemos verificar a possibilidade de alteraes relacionadas ao ciclo celular, fato este explorado no prximo item. 4.6 PLOIDIA/CICLO CELULAR Novamente nossa anlise focou os pontos onde, na cultura 3D, foram verificados as maiores alteraes morfolgicas. Assim, monocamada e esferides com 7, 30 e 50 dias de cultura foram analisados por citometria de fluxo sendo o DNA das clulas corado com iodeto de propdeo (todos os resultados descritos nesta sesso esto representados na Figura 29 e na Tabela 4) A populao hipodiplide cresceu ao longo do tempo de cultura, todavia, quando comparada com os resultados obtidos em monocamada, foi observado que o nmero de clulas nessa classe ploidia era maior na monocamada do que em esferides com 7 dias. A porcentagem de clulas que se encontravam na fase G1 do ciclo aumentou significantemente na mudana do ambiente 2D para 3D. Entretanto, no decorrer do tempo de cultura 3D a porcentagem do nmero de clulas em G1 se manteve muito prxima. A maior porcentagem de clulas na fase S foi descrita nas clulas crescidas em monocamada. J em ambiente 3D, foi possvel visualizar uma diminuio desta fase principalmente em 30 dias de cultura. A anlise da fase G2-M nos pontos estudados apontou para uma diminuio da porcentagem de clulas nesta fase sendo esta fase maior no ambiente em monocamada, com uma diminuio progressiva medida que avana o tempo de cultura 3D. Os resultados tambm mostraram que a freqncia do nmero de clulas com ploidia igual ou maior que 5C (hipertetraplides) diminuiu de forma bem significativa quando as clulas crescidas em monocamada passam a ser mantidas em ambiente 3D. Com este ltimo experimento foi possvel traar um panorama das diferenas existentes entre as clulas crescidas em monocamada e em ambiente 3D. Diante disso e da viabilidade do mtodo, surgiu uma nova questo. Seria possvel selecionar esses esferides diferenciados?

88

Quando colocados novamente para crescer em monocamada, o que poderia ocorrer? Tais questionamentos levaram ento a srie de experimentos mostrados a seguir.

Figura 29 - A legenda desta prancha est localizada no verso da pgina ao lado.

89

Tabela 4 - Mdia e desvio padro do nmero de clulas encontradas no ensaio de ploidia/ciclo celular. Os nmeros marcados em verde no apresentaram diferenas significativas entre eles (comparar na mesma populao de clula).

2D Hipodiplide G1 S G2-M Hipertetraplide 4,060,69 23,672,08 16,590,89 20,200,81 35,483,94

7dias (3D) 1,610,19 58,142,21 13,760,63 16,292,01 10,240,36

30 dias (3D) 5,651,58 62,802,61 8,221,19 14,961,34 8,360,49

50 dias (3D) 12,781,54 59,721,04 10,650,88 8,710,17 7,841,41

4.7 SELEO DAS CLULAS CRESCIDAS EM CULTURA 3D E A MANUTENO DE UMA NOVA LINHAGEM Para manter uma homogeneidade no que se refere populao de esferides com aspecto tubular e acinar, optamos por coletar esferides diferenciados (aps 50 dias de cultura 3D) (Figura 7D) e retorn-los ao crescimento em monocamada. Para tanto, em uma primeira abordagem, as clulas em suspenso resultantes da dissociao dos esferides foram colocadas para crescer em garrafas de cultivo de tecido (Figura 30). A morfologia destas clulas, quando analisadas por meio de microscopia de contraste de fase, mostrou-se muito semelhante aos resultados encontrados para a linhagem MCF-7 (Figura 30A-C, com 0, 3 e 5 dias de cultura respectivamente). Posteriormente a essa descrio, novamente foram analisados a organizao dos microfilamentos de actina e os microtbulos deste retorno das clulas a monocamada. No foram observadas diferenas significativas na morfologia destes componentes comparando a linhagem derivada de esferides com linhagens MCF-7 (Figuras 30D-F). Em algumas clulas, entretanto, foi observada a formao de vacolos os quais, em alguns casos, se mostraram positivos para faloidina-FITC (Figura 30F). A segunda abordagem metodolgica consistiu em colocar os esferides diferenciados aps 50 dias de cultura 3D (Figura 31A) diretamente nos frascos de cultivo. J nas primeiras 24 horas as clulas destes esferides apresentaram forte adeso superfcie (Figura 31 B e C). Aps isso, ao longo do tempo de cultura, foi observado uma crescente migrao destas clulas a qual se iniciou marginalmente aos esferides (Figura 31D e E com 2 e 3 dias respectivamente) assumindo um posterior direcionamento radial ao seu redor (Figura 31F e G aps 4 dias). Neste

90

processo, ficou evidente a gradual diminuio de clulas arranjadas em 3D em detrimento do espraiamento e aumento de migrao destas clulas. Cortes ortogonais de reconstrues obtidas ao microscpio confocal de varredura a laser possibilitaram a anlise desta transio da cultura 3D para monocamada (Figura 31G).

91

Figura 30 - Aps serem mantidas em cultura 3D por 50 dias, os esferides de clulas MCF-7 foram dissociados (A) e as clulas colocadas para crescer arranjadas em monocamada, as quais mostradas aqui com 1 dia de cultura (B) 3 dias (C) e 5 dias (D-F). Foi observada em algumas clulas a presena vacolos (seta). Imagens obtidas por microscopia de luz de campo claro (A) e com contraste de fase (B e C). As imagens D, E e F foram obtidas ao microscpio confocal de varredura a laser. Foram utilizados os corantes fluorescentes Iodeto de propdeo (vermelho) e faloidina-FITC (verde). Em azul foram utilizados anticorpo anti e anti tubulina, sendo posteriormente marcados com anti-IgG de camundongo conjugado com CY5. Barra A, B e C 100 m ;D, E e F=20 m

92

Figura 31 - A legenda desta prancha est localizada no verso da pgina ao lado

93

Aps o estabelecimento das clulas crescidas em monocamada, estas passaram novamente pelo processo de formao de esferide em cultura 3D. As clulas em suspenso agruparam-se de maneira semelhante ao j descrito para formao de esferides, isto , assumiram um crescente arranjo esfrico decorrente da maior interao entre as clulas. Na Figura 32, foi possvel acompanhar essa fase formao desde as clulas em suspenso (Figura 32 A) at esferides com 2 e 5 dias (Figuras 32B e C, respectivamente). Posterior a essa data, foi observado alteraes na morfologia que apontavam para a diferenciao, o qual podemos citar como exemplo o crescente aumento dos brotamentos corticais. Ao redor de 15 dias ficou evidente que o processo de seleo dos esferides diferenciados foi bastante eficiente, haja visto que nesta fase foram descritos uma populao de esferides tubulares muito grande (Figura 32D). Alm da presena de diferenciao (Figuras 32 E, F G e H), foram observados esferides arranjados em forma de cino (Figura 32F). Analisados por mais 10 dias, totalizando 25 dias de cultura 3D, os esferides resultantes deste processo de seleo (Figura 33A e B) apresentaram morfologia muito semelhante ao dos esferides com 50 dias usados para a formao da linhagem. Eles foram analisados por meio de microscopia confocal de varredura a laser, com o objetivo de verificar o a disposio dos microfilamentos de actina bem como a formao do arranjo luminal. A Figura 33C, mostra esferides arranjados de forma tubular, onde possvel observar a maior concentrao dos microfilamentos de actina no espao luminal. A anlise de reconstrues destes esferides (Figura 33E) mostrou a tambm existncia da formao de uma monocamada margeando espao luminal tanto na poro tubular (Figura 33D) quanto na poro acinar (Figura 33F), esta que mostrou-se bastante desenvolvida.

94

Figura 32 -Aps dissociao por tripsina (A) as clulas MCF-7 selecionadas voltam a assumir a forma de esferide quando em cultura 3D (B com 2 dias e C com 5 dias). Nestas clulas j foi possvel observar grande nmero de esferides tubulares ao redor de 15 dias de cultura (D e mostrado em detalhe em E). Ao redor do 20 dia de cultura observou-se o aumento do arranjo tubular (F, G e H) sendo possvel em alguns esferides visualizar o arranjo acinar (seta em I). Imagens obtidas ao microscpio de luz com campo claro. Barra 100 m

95

Figura 33 - A legenda desta prancha est localizada no verso da pgina ao lado.

96

4.8 EXPRESSO DE RNAm PARA E-CADERINA A protena E-caderina possui importante papel em processos relacionados a interaes clula-clula. Devido a isso, tornou-se necessrio verificar se a mensagem para a sntese desta protena estava sendo expressa em esferides de clulas MCF-7. Tendo como referencia a cultura em monocamada, que se padronizou como expresso relativa igual a 1, foi observado que a expresso do RNAme-caderina diminuiu aos 7 dias de cultura 3D. Entretanto, ao longo do tempo, foi observado uma crescente na expresso sendo esta, em mdia, 60% mais expressa aos 50 dias de cultura 3D (quando comparada com monocamada). Um fato interessante foi que nos esferides derivados do processo de seleo (ver seo 4.7) a expresso do RNAme-caderina foi em mdia 173% maior. Deve-se lembrar que as clulas que constituem estes esferides passaram por uma fase em monocamada (2D), retornado posteriormente a cultura 3D. Desta maneira, podemos inferir que clulas que expressam mais E-caderina so mais selecionadas durante este processo.
3,5 3 Expresso relativa 2,5 2 1,5 1 0,5 0 Ecad Monocamada 1 7 dias 0,136 30 dias 0,44 50 dias 1,605 Retorno 2,738

Figura 34 - Expresso relativa de RNAm para E-caderina em monocamada e em diferentes tempos de cultura 3D. A ltima coluna (retorno) se refere aos esferides derivados da linhagem MCF-7 selecionada de esferides j diferenciados. Todos os valores tiveram um p<0,05.

97

5 DISCUSSO

98

5.1 MODELOS E PARADIGMAS O desenvolvimento de estruturas luminais no decorrer da organognese epitelial apresenta-se como essencial tanto na formao dos diferentes tipos de vasos em um organismo bem como e na gnese de rgos como pncreas, pulmes e as glndulas mamrias (120, 121). Essa complexidade intrnseca morfognese luminal de tecidos mamrios decorre de uma ntima relao entre clulas epiteliais e o seu microambiente. A reproduo e anlise deste processo in vitro mostram-se um desafio devido a diferentes vias regulatrias atuarem na formao do lmen. Como j mostrado, a linhagem MCF-10A (derivada de tecido mamrio normal) vem se mostrando como modelo padro no que se refere a estudos in vitro voltados a formao luminal (71, 122, 123). Na maioria dos trabalhos que envolvem esferides desta linhagem, a adio de Matrigel insere-se neste sistema como um mimetizador de membrana basal. A conseqncia de tal mtodo propiciou, principalmente aps experimentos de Petersen e Weaver (80, 82), o desenvolvimento de estudos que relacionassem a influncia do Matrigel na formao luminal bem como tumorignese. Os resultados apresentados nesta tese apontam, pela primeira vez na literatura, que a convergncia de trs diferentes caractersticas-linhagem MCF-7, maior tempo de cultivo 3D e a no suplementao com Matrigel-podem produzir esferides diferenciados (Figura 35). A gradual perda da polarizao celular um dos indicativos de alteraes neoplsicas em tecidos mamrios (124, 125). Deste modo, de se esperar que modificaes celulares que levem a formao de um espao luminal sejam diferentemente manifestadas em linhagens MCF-7. Tal fato ocorre devido esta linhagem ser derivada de metstase de carcinoma ductal invasivo (94, 126), condio que a diferenciaria, e muito, de um tecido normal. Clulas MCF-7 em ambiente 3D com Matrigel rapidamente se organizam em esferides com fortes interaes clula-clula. Esse arranjo em forma de massa de clulas (segundo classificao sugerida por Kenny et al. (72) no sofre o processo de cavitao, isto , no apresenta a formao de lmen decorrente da morte das clulas localizadas na regio medular. Tal morfologia no alterada mesmo quando os esferides desta linhagem so submetidos a diferentes substratos como polissacardeos (quitosana) e polmeros (cido polilactico) (127, 128).

99

Figura 35 Esquema mostrando as alteraes na morfologia de esferides de clulas MCF-7 decorrente do mtodo de cultura em 3D proposto neste trabalho.

100

Em 2003, Kirshner e colaboradores (97) trabalhavam com uma glicoprotena transmembrnica de adeso clula-clula denominada de CEACAM1 (carcinoembryonic antigen-related cell adhesion molecule 1). Devido essa glicoprotena ser constitutivamente expressa em clulas normais, este grupo ento transfectou o gene que a codifica em clulas MCF-7 e observou quais seriam as alteraes na morfologia. Diferentemente do at ento descrito na literatura, os esferides de clulas MCF-7 transfectadas quando em contato com Matrigel formavam lmen de maneira semelhante ao descrito para MCF-10A. Recentemente Chen e colaboradores (129), utilizando-se deste mesmo mtodo conseguiram uma eficincia de at 95% de esferides com arranjo luminal em culturas de clulas MCF-7. Por fim, a formao de lmen na linhagem MCF-7 tambm foi obtida em um sistema de co-cultura. Krause et al.(98) desenvolveram um sistema que era constitudo por uma cultura primria de fibroblastos, clulas MCF-7 e uma mistura de Matrigel +colgeno tipo I. Outro fator importante foi o tempo de cultura deste experimento, o qual se estendeu por at 6 semanas. A leitura dos resultados acima nos leva a comparar os diferentes modelos com os resultados apresentados neste presente trabalho. Como j foi mostrado, a forma de cultivo 3D desenvolvida por nosso grupo no somente permitiu esferides com arranjo acinar, mas tambm com arranjos tubulares. Tal fato aponta para o envolvimento tanto do processo de cavitao, quanto de brotamento na formao de estruturas luminais (120). Estas caractersticas foram somente compartilhadas com esferides crescidos no modelo de cocultura (98). Diversos fatores podem atuar no processo de seleo de populaes celulares dentro de linhagens j estabelecidas (126, 130). A cultura em 3-dimenses, neste contexto, mostra-se tambm como um fator de presso de seleo por favorecer a proliferao de clulas fracamente responsivas a sinalizao para anoikis. Deste modo, podemos inferir que nas fases iniciais do crescimento dos esferides, algumas populaes de clulas MCF-7 foram as que melhor se adequaram a perda de adeso com o substrato. Apesar de estabelecida desde a dcada de 70, um crescente nmero de trabalhos vem mostrando a existncia de diferentes sub-populaes celulares na linhagem MCF-7. Um exemplo bastante estudado recentemente a presena de clulas tronco em linhagens derivadas de tecidos mamrios. Em populaes tumorais, a pequena frao de clulas tronco caracterizada pelo fentipo CD44+ e CD24-, o qual permite a separao destas clulas por citometria (131, 132). Quando separadas do

101

restante da populao, as clulas tronco se arranjam em pequenos agregados denominados de mamosferas, os quais tem se mostrado muito mais resistente aos tratamentos quimioterpicos e radioterpicos (133). Essa heterogeneidade celular tambm pode estar associada formao de lmen encontrada em nosso trabalho. Os resultados apresentados aqui apontam para a possibilidade de que algumas populaes celulares estariam, mesmo em um contexto de linhagem tumoral, direcionadas a reverso deste fentipo. Alguns aspectos devem ser enfatizados a respeito deste assunto: O surgimento e manuteno da morfologia polarizada nas clulas A estabilizao e manuteno de domnios na membrana plasmtica so essenciais para funes celulares e desenvolvimento dos organismos. Neste contexto, a morfologia celular polarizada permite uma distribuio assimtrica de molculas biologicamente ativas como protenas, RNAs bem como de organelas (134). Mostramos que ao longo da cultura em 3-Dimenses houve uma gradual formao de uma nica camada de clulas ao redor de um lmen. A morfologia caracterstica para clulas polarizadas foi confirmada pela ultraestrutura e pela presena de uma maior concentrao de microfilamentos de actina na regio apical, fato este que correspondente ao encontrado em microvilosidades (135). Na superfcie das clulas voltada para o meio de cultura (o que seria equivalente a regio basal da clula) a maior intensidade de marcao para laminina tambm um indicativo de polarizao celular. Alteraes no ciclo celular A cultura em 3 dimenses permitiu observar diferenas no nmero de clulas hipertetraplides. A diminuio desta caracterstica em ambiente 3D sugere que clulas MCF-7 com essa ploidia tenham um desenvolvimento melhor quando crescidas em monocamada. Lu et al. (136) mostraram que na linhagem tumoral de mama MDAMB 231, o crescente nmero de clulas hipertetraplides confere a estas clulas um aumento no seu potencial metasttico. Deste modo, ao analisarmos os nossos resultados, podemos inferir que a diminuio do nmero de clulas hipertetrapides no ambiente 3D tambm seja um indicativo da gradual seleo de uma populao

102

celular com potencial para diferenciao. Outra diferena evidnciada foi o aumento da porcentagem de clulas na fase G1 do ciclo aps serem submentidas a cultura 3D. A regulao desencadeada por pontos de checagem na fase G1 possui importante papel na progresso normal do ciclo. Tal caracterstica bastante alterada no cncer (137). Nossos resultados mostram que o ambiente tridimensional interfere nesta fase do ciclo, fato este evidenciado pela semelhante porcentagem de clulas em G1 no decorrrer de toda cultura 3D. O aumento da expresso de RNAm para E-Caderina E-caderina um dos mais estudados supressores de tumor em cncer de mama Esta molcula possui um importante papel na organizao e polaridade do epitlio sendo a sua disfuno relacionada progresso tumoral e metstases(138). Partindo destas informaes, os resultados obtidos pela tcnica quantitativa de RT-PCR por tempo real mostram que quanto maior o tempo de cultura 3D, maior a expresso de RNAm para E-caderina. Juntamente com a anlise morfolgica, este fato mostra que a cultura 3D permitiu uma maior interao das clulas entre si ao longo do tempo de cultura. Desta maneira, estes resultados reforam a viabilidade do modelo por este permitir a formao de um arranjo luminal com complexas interaes clula-clula. O aumento da expresso de RNAm para E-caderina manteve uma crescente na cultura 3D mesmo aps os esferides diferenciados (com 50 dias) terem sido colocados para crescer na forma de monocamada. Tal caracterstica sugere que as clulas selecionadas pelo modelo de cultura 3D mantenham uma maior expresso de E-caderina, fato este que explicaria a formao de esferides diferenciados em um perodo de tempo menor. Aps essas consideraes, retomaremos a discusso sobre os modelos de cultura 3D que utilizam linhagem MCF-7. A importncia do uso do Matrigel nos diferentes sistemas de cultura em 3-dimenses indiscutvel. Entretanto, os dados do presente trabalho mostraram que a adio deste componente no foi necessria para iniciar os processos relacionados cavitao dos esferides. Como j apresentado anteriormente, a experimentao em cultura 3D de linhagem MCF-7 que obteve resultados mais prximos aos nossos se utilizou de um complexo sistema composto de colgeno + Matrigel e fibroblastos (98). Neste contexto, a

103

hiptese defendida nesta tese de que existam na linhagem MCF-7 clulas que apresentam caractersticas mais prximas as encontradas em clulas normais. De alguma maneira ainda no to bem compreendida, essas clulas se adaptariam melhor a forma de cultivo 3D proposto nesta tese. Juntamente com o crescimento desta populao celular aumentaria tambm a presena de fatores relacionados diferenciao tais como laminina e E-caderina. No pode tambm ser descartada a possibilidade deste mtodo reverter o fentipo de forma contrria a transformao maligna, sendo a diferenciao e diminuio da proliferao independente da seleo.

5.2 FATORES RELACIONADOS FORMAO DO LMEN Por meio de diferentes abordagens foi mostrado que a apoptose est associada ao processo de cavitao para a formao do lmen. No nosso modelo, a presena da apoptose refletiu em uma gradual diminuio do nmero de clulas da regio medular, sendo que nos pontos finais analisados (30 e 50 dias de cultura 3D) o nmero de clulas em processo de apoptose aumentou. Debnath et al. em 2002 (139) e Debnath e Brugge em 2005 (140) j mostraram que o bloqueio de vias importantes da apoptose (protenas anti apopttica da famlia Bcl-2) no capaz de impedir a formao do lmen. Mills et al.(85) utilizando-se de um modelo semelhante sugerem que a cavitao de esferides de clulas MCF-10A seria uma conseqncia da eliminao celular por autofagia e apoptose, duas vias distintas que se complementariam. Tais caractersticas tambm foram encontradas nos resultados apresentados neste presente trabalho. A maior expresso de LC3B associada ao autofagossomo ocorreu ao redor do trigsimo dia de cultura 3D, fase esta correspondente a fase com maior nmero de clulas em apoptose. O efeito da ativao de ERK tanto em fatores pro quanto anti-apoptticos (111), insere os resultados obtidos com a sua forma fosforilada no processo de formao luminal. Anderson et al. (122), descreveram que em esferides de clulas MCF-10A a ativao de RAF 1 levaria a fosfolilao de ERK. Depois disto, ERK fosforilada ativaria uma protena pr apopttica da famlia Bcl-2, a BIM (141). Eles mostraram que, quanto maior era a presena de ERK fosforilada, menor era a formao de um espao luminal. Isso ocorre, segundo estes autores, devido protena BIM fosforilada ser direcionada para a degradao via proteossomo. No contexto do nosso modelo, obtivemos resultados semelhantes, haja visto que nos esferides com o lmem

104

mais desenvolvido (50 dias de cultura 3D) encontramos a menor expresso de ERK fosforilada. Esferides com esse tempo de cultura mostram outra caracterstica importante, a maior expresso de PAR-4. A protena PAR -4 possui um importante papel na ativao da apoptose. A sua ligao tanto com a via intrnseca quanto extrnseca deste processo faz com que ela seja alvo de estudos relacionados com progresso tumoral (142, 143) e sobrevivncia do cncer (144). Os resultados encontrados em esferides com 50 dias de cultura mostraram aumento da expresso desta protena quando comparado com os outros tempos de cultura analisados. Pelo fato da morfologia predominante em 50 dias de cultura 3D ser a de arranjo luminal, nossos resultados apontam para um possvel papel desta protena com a formao do lmen. Nagai et al. (145) avaliaram a expresso de PAR-4 em diferentes tumores de mama, mostrando a possibilidade de uma relao entre a inativao desta protena com um fentipo mais agressivo. Com experimentos in vitro, esse grupo mostrou em esferides de clulas MCF-10A, a positividade para PAR-4 nas clulas localizadas na regio medular. Essa equivalncia de resultados sugere que Par-4 tambm possua papel na formao de estruturas luminares, tanto em MCF-10A quanto em MCF-7. Durante a formao do lmen, algumas clulas apresentaram uma morfologia muito semelhante descrita para o processo de entose. Este processo envolve a invaso de uma clula viva dentro da outra, seguido pela degradao das clulas internalizadas por enzimas lisossomais. Descrito em tumores e em linhagens de mama (entre elas MCF7 em suspenso) a ocorrncia de entose est associada a populaes celulares privadas de fixao a matriz extracelular (119). Quando crescidas em ambiemte 3D as clulas MCF7 apresentaram na formao do lmen clulas em apoptose e em autofagia sendo envolvidas por entose, no entanto, tambm foram encontradas clulas em entose na regio cortical do esferide. Tal fato sugere que ligaes clula-clula podem regular esse processo. Um evento comumente descrito em esferides a formao do chamado ncleo necrtico. Esta classificao decorrente da semelhana morfolgica e conseqente comparao entre a regio central dos esferides com regies similares em metstases avasculares. O processo de necrose, o qual por muito tempo foi associado principalmente a hipxia (146), no se apresentou como fator crucial na formao do lmen, haja visto a presena marcante de apoptose e autofagia. Por meio de uma anlise ultraestrutural, foi verificado clulas em estgio de necrose em todos os esferides, inclusive no interior do lmen.

105

A sua proximidade com clulas da monocamada cortical diminuem as chances destas clulas estarem em hipxia. Nossos resultados apontam para outras vias estarem regulando o processo de necrose. Golstein e Kroemer (147) discutem as vias de sinalizao da necrose celular, havendo a possibilidade deste processo ser decorrente da falha tanto da apoptose quanto da autofagia Desta maneira, mostramos que o modelo de cultivo celular em 3 dimenses estabelecido neste presente trabalho mostrou-se adequado para melhor compreender os processos relacionados a formao do espao luminal. A similaridade com resultados descritos para modelos que utilizam linhagens normais refora ainda mais que, nestas condies, caractersticas de clulas normais podem ser restabelecidas.

5.3 A EXPRESSO DE AKT FOSFORILADA PTEN (phosphatase and tensin homolog) uma fosfatase com uma atividade supressora de tumor que via interao com PI3K (phosphatidylinositol 3-kinases) regula a atividade de Akt (148) Quando ativada, AKT-fosforilada um intenso promotor de sobrevivncia uma vez que antagoniza e inativa vrios componentes pr-apoptticos como Bad (Bcl-xL/Bcl-2-associated death promoter) e caspase 9 (148, 149). Akt tambm tem influncia no ciclo celular atravs da regulao de ciclina D1 como tambm inibindo p27Kip1 (150, 151). Frente a essas possveis interaes, nossos resultados mostram uma intensa atividade desta protena nas primeiras fases da cultura 3D. Tal fato talvez esteja relacionado a dois fatores principais: a resistncia a anoikis e a proliferao celular. Debnath e colaboradores (151) ao estudarem essa protena em esferides de clulas MCF-10A tambm descreveram o aumento da sua expresso nas fases inicias da morfognese, relacionando esse fato a uma maior resistncia a anoikis. No nosso modelo, foi possvel estabelecer uma relao mostrando que quanto maior a expresso de AKT fosforilada, menor o processo de morte celular. Porm, pelo fato das clulas imunomarcadas localizarem-se na regio cortical (na maioria das vezes em diviso celular), talvez os nossos resultados representem principalmente a interao desta protena com o ciclo celular.

106

5.4 ADAMTS-1 Quando comparamos os resultados obtidos entre a linhagem tumoral (MCF-7) com uma linhagem de clula normal (MCF-10A) (dados no mostrados), foi observado uma intensa imunomarcao para ADAMTS-1 na regio nuclear das clulas MCF-7. Tal caracterstica foi semelhantemente descrita em outra protena pertencente superfamlia das metzincinas, a ADAM-10. McCulloch et al. (152) compararam imunohistoqumicas e western blots de cortes anatomopatolgicos de tecido prosttico normal com tecido neoplsico descrevendo pela primeira a presena tanto de uma regulao diferencial bem como diferentes funes desta protena. Arima et al. (153) analisaram a expresso de ADAM-10 em linhagens de adenocarcinoma prosttico, conseguindo relacionar a presena desta protena no ncleo com receptores de andrgeno. Neste presente trabalho no foi possvel, somente com a morfologia, inferir quais seriam as conseqncias da marcao nuclear em clulas tumorais. Entretanto, fica claro que exista uma localizao diferenciada desta protena ao se comparar 2DX3D, apontando para possveis diferenas de funes. A protena ADAMTS -1 uma metaloprotenase com funo cataltica em substratos ricos em proteoglicanas, como versicam e agrecam (154). Todavia, muitas evidncias vm mostrando um importante papel desta protena em questes relacionadas invaso tumoral e metstase (115, 116). Estudos que relacionam nveis desta protena e cncer tem se mostrado bastante contraditrios. Alguns autores mostraram que essa protena mais expressa em cnceres de mama e pncreas, muitas vezes associado a um pior prognstico (155, 156). Por outro lado, Porter et al. (157) mostraram que os cnceres de mama apresentaram uma menor expresso desta protena. Devido a esse impasse Liu et al.(158) descreveram que quando secretada na sua forma completa (com 125 kDa), ADAMTS-1 tem funo pr-apopttica. Porm, quando fragmentada seu papel alterado assumindo ento uma funo antiapopttica. Vimos que em esferides com 50 dias de cultura, somente o fragmento com 41kDa apresentou diferenas entre os grupos analisados. Apesar da diminuio deste fragmento em esferides mais diferenciados, no ainda possvel afirmar se diminuio deste fragmento possui relao com esse processo de formao luminal.

107

5.5 TENSO DO AMBIENTE E MORFOGNESE A regulao da tenso mediada pelos componentes do citoesqueleto interage dinamicamente com fatores externos clula. Assim, um ambiente que permita crescimento celular em diferentes planos per se j pode ser considerado um estmulo, o qual possibilita conseqentes alteraes morfognicas. Ao se analisar a formao de esferides de clulas MCF7 com lmen, foi descrito a presena de crescentes brotamentos corticais regionalizados. Tal caracterstica associada tambm a uma formao luminal nestes brotamentos mostra que o mtodo de cultivo com maior tempo de cultura e ausncia de complementao de laminina pode ser usado para o estudo da tubolognese. A formao destas estruturas assemelhou-se a micromorfognese descrita por alguns autores (68, 159) os quais a relacionam com o estresse mecnico decorrente de alteraes da matriz extracelular. O aumento tensional, tanto endgeno quanto exgeno, quando mediado por uma dureza prolongada da matriz pode ativar vias mecanoregulatrias (ERK e Rho) relacionadas e estabilizao de contatos focais(160). Wozniak et al. (161) sugerem que clulas de mama em ambientes onde a matriz e mais flexvel Rho quinase (ROCK) down regula a atividade de Rho levando a uma seqncia de eventos as quais resultam para uma diferenciao em tbulos.

5.6 ESFERIDES DE MCF-7 COMO MODELO DE CULTURA 3D Os resultados apresentados neste trabalho mostraram a possibilidade da utilizao de esferides derivados de linhagens tumorais em estudos relacionados formao luminal. A morfologia diferenciada, a qual integra dutos e cinos, torna promissora a utilizao deste modelo proposto. Quando associado a um processo de seleo, vimos que essas mudanas na morfologia podem ser obtidas em um menor espao de tempo. Tal fato viabilizaria a utilizao destes esferides nos moldes dos modelos de cultura 3D atuais (esferides de MCF-10A, por exemplo). Assim, aspectos estudados somente em linhagens normais podem agora ser analisados em um modelo que apresente a mesma caracterstica, s que obtido por meio de uma linhagem tumoral.

108

6 CONCLUSES

109

Os resultados apresentados neste trabalho permitem concluir que: A formao de estruturas acinares e tubulares (ambas com espao luminal) em esferides de clulas MCF-7 no dependente de uma suplementao com componentes de membrana basal. As modificaes tanto na morfologia quanto na expresso das protenas analisadas no esto limitadas as mudanas do ambiente 2D para 3D. Estas podem tambm ocorrer ao longo do tempo de cultura em 3- Dimenses. O mtodo de formao de esferides proposto por esse trabalho permite o uso de linhagens MCF-7 como modelo para estudos relacionados formao do lmen. Clulas que j passaram pelo processo de diferenciao durante a cultura 3D, mesmo aps seu retorno a monocamada, formam esferides com arranjo luminal em um menor perodo de tempo. -

110

REFERNCIAS

111

REFERNCIAS* 2 1. Keshishian H. Ross Harrison's The outgrowth of the nerve fiber as a mode of protoplasmic movement. Journal of Experimental Zoology Part A: Comparative Experimental Biology. 2004;301A(3):201-3. 2. Harrison RG. Observations on the living developing nerve fiber. Anatomical Record 1907;1:116-8. 3. Harrison RG. The outgrowth of the nerve fiber as a mode of protoplasmic movement. Journal of Experimental Zoology. 1910;9(4):787-846. 4. Witkowski JA. Alexis Carrel and the mysticism of tissue culture. Medical History. 1979;23:279-96. 5. Friedman M, Friedland GW. Medicine's 10 Greatest Discoveries. New Haven: Yale University Press; 2000. 6. Carrel A. On the permanent life of tissues outside of the organism. Journal of Experimental Medicine. 1912;15:516-28. 7. Byrnes WM. Ernest Everett Just, Johannes Holtfreter, and the origin of certain concepts in embryo morphogenesis. Molecular Reproduction and Development. 2009;76(10):912-21. 8. Holtfreter J. A study of the mechanics of gastrulation. Journal of Experimental Zoology. 1944;95(2):171-212. 9. Holtfreter J. Neural induction in explants which have passed through a sublethal cytolysis. Journal of Experimental Zoology. 1947;106(2):197-222. 10. Johnson LG. Patterns & Experiments in Developmental Biology. 3rd ed. Boston: McGraw-Hill Companies; 2001. 11. Moscona A. The development in vitro of chimeric aggregates of dissociated embryonic chick and mouse cells. Proceedings of the National Academy of Sciences of the United States of America. 1957;43(1):184-94.

*De acordo com: International Committee of Medical Journal Editors. Uniform requirements for manuscripts submitted to Biomedical Journal: sample references. Available from: http://www.icmje.org [2007 May 22].

112

12. Moscona A. Cell suspensions from organ rudiments of chick embryos. Experimental Cell Research. 1952;3(3):535-9. 13. Moscona A. Formation of lentoids by dissociated retinal cells of the chick embryo. Science. 1957;125:598-9. 14. Moscona AA. Rotation-mediated histogenetic aggregation of dissociated cells : A quantifiable approach to cell interactions in vitro. Experimental Cell Research. 1961;22:455-75. 15. Winzler RJ. Carbohydrates in Cell Surfaces. In: Bourne GH, Daniele JF, Jeon KW, editors. International Review of Cytology. London: Academic Press; 1970. p. 77-125. 16. Schaeffer WI. In memorium -- a tribute to Dr. Joseph Leighton. Methods in Cell Science. 1999;21(1):1-4. 17. Leighton J. A sponge matrix method for tissue culture. Formation of organized aggregates of cell in vitro. Journal of the National Cancer Institute. 1951;12:545-61. 18. Leighton J. The growth patterns of some trasnplantable animal tumors in sponge matrix tissue culture. Journal of the National Cancer Institute. 1954;15:275-93. 19. World Heath Organization. Cancer Statistics. 2010 [cited 2010 nov 16]; Available from: http://globocan.iarc.fr/factsheets/cancers/all.asp. 20. Instituto Nacional do Cncer. Estimativa 2010. Rio de Janeiro; 2010 [cited 2010 nov 16]; Availablefrom: http://www.inca.gov.br/estimativa/2010/index.asp?link=conteudo_view.asp&ID=5. 21. Weinberg RA. A biologia do cncer. Porto Alegre: Artmed; 2008.

22. Hahn WC, Weinberg RA. Rules for Making Human Tumor Cells. New England Journal of Medicine. 2002;347(20):1593-603. 23. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57-70.

24. Lelivre S. Tissue Polarity-Dependent Control of Mammary Epithelial Homeostasis and Cancer Development: an Epigenetic Perspective. Journal of Mammary Gland Biology and Neoplasia. 2010;15(1):49-63.

113

25. Sawan C, Vaissire T, Murr R, Herceg Z. Epigenetic drivers and genetic passengers on the road to cancer. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis. 2008;642(1-2):1-13. 26. Ellsworth RE, Decewicz DJ, Shriver CD, Ellsworth DL. Breast Cancer in the Personal Genomics Era. Current Genomics. 2010; 11:146-61. 27. Tiezz DG. Epidemiologia do cncer de mama. Revista Brasileira de Ginecologia e Obstetrcia. 2009;31(5):213-5. 28. Kreeger PK, Lauffenburger DA. Cancer systems biology: a network modeling perspective. Carcinogenesis 2010;31(1):28. 29. McAllister RM, Reed G, Huebner RJ. Colonial growth in agar of cells derived from adenovirus-induced hamster tumors. Journal of the National Cancer Institute. 1967;39:43-53. 30. Halpern B, Pejsachowicz B, Febvre HL, Barski G. Differences in Patterns of Aggregation of Malignant and Non-Malignant Mammalian Cells. Nature. 1966;209 (5019):157-9. 31. Sutherland RM, McCredie JA, Inch WR. Growth of multicell spheroids in tissue culture as a model of nodular carcinomas. J Natl Cancer Inst. 1971;46:113-20. 32. Inch W, McCredie J, Sutherland R. Growth of nodular carcinomas in rodents compared with multi-cell spheroids in tissue culture. Growth. 1970;34:271-82. 33. Sutherland R, Durand R. Radiosensitization by nifuroxime of the hypoxic cells in an in vitro tumour model. International Journal of Radiation Biology. 1972;22:613-8. 34. Sutherland RM, Inch WR, McCredie JA, Kruuv J. A multicomponent radiation survival curve using an in vitro tumour model. International Journal of Radiation Biology. 1970;18:4915. 35. Kim JB. Three-dimensional tissue culture models in cancer biology. Seminars in Cancer Biology. 2005;15(5):365-77. 36. Durand RE, Sutherland RM. Effects of intercellular contact on repair of radiation damage. Experimental Cell Research. 1972;71(1):75-80. 37. Siemann DW, Sutherland RM. The Interaction between Adriamycin and Radiation in a Solid Murine Tumor. Radiation Research. 1980;83(2):345-59.

114

38. Durand RE, Brown SM. Effects of lucanthone on chinese hamster V-79 cells I. Interaction with radiation in monolayers and spheroids. International Journal of Radiation Oncology*Biology*Physics. 1980;6(11):1525-30. 39. Stephanie H, Inga L, Iris E, Nils C. 3D cell cultures of human head and neck squamous cell carcinoma cells are radiosensitized by the focal adhesion kinase inhibitor TAE226. Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology. 2009;92(3):371-8. 40. Stephanie H, Iris E, Katja S, Michael H, Gustavo BB, Nils C. Caveolin-1 mediated radioresistance of 3D grown pancreatic cancer cells. Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology. 2009;92(3):362-70. 41. Storch K, Eke I, Borgmann K, Krause M, Richter C, Becker K, et al. Three-Dimensional Cell Growth Confers Radioresistance by Chromatin Density Modification. Cancer Research. 2010 May 15, 2010;70(10):3925-34. 42. Carlsoon J, Yuhas JM. Liquid-overlay culture of cellular spheroids Recent Results in Cancer Research. 1984;95:1-23. 43. Sutherland RM, Eddy HA, Bareham B, Reich K, Vanantwerp D. Resistance to adriamycin in multicellular spheroids. International Journal of Radiation Oncology*Biology*Physics. 1979;5(8):1225-30. 44. Kerr DJ, Wheldon TE, Hydns S, Kaye SB. Cytotoxic drug penetration studies in multicellular tumour spheroids. Xenobiotica. 1988;18(6):641-8. 45. Bichay TJ, Inch WR. Resistance of V79 multicell spheroids to mitoxantrone: drug uptake and cytotoxicity. Cancer Drug Delivery. 1987;4 (4):201-11. 46. Jaaskelainen J, Kalliomaki P, Paetau A, Timonen T. Effect of LAK cells against threedimensional tumor tissue. In vitro study using multi-cellular human glioma spheroids as targets. The Journal of Immunology. 1989;142(3):1036-45. 47. Lin R-Z, Chang H-Y. Recent advances in three-dimensional multicellular spheroid culture for biomedical research. Biotechnology Journal. 2008;3(9-10):1172-84. 48. Friedrich J, Ebner R, Kunz-Schughart LA. Experimental anti-tumor therapy in 3-D: Spheroids old hat or new challenge? International Journal of Radiation Biology. 2007;83(1112):849-71.

115

49. Mueller-Klieser W. Multicellular spheroids. Journal of Cancer Research and Clinical Oncology. 1987;113(2):101-22. 50. Hirschhaeuser F, Menne H, Dittfeld C, West J, Mueller-Klieser W, Kunz-Schughart LA. Multicellular tumor spheroids: An underestimated tool is catching up again. Journal of Biotechnology. 2010;148(1):3-15. 51. Miller BE, Miller FR, Heppner GH. Factors Affecting Growth and Drug Sensitivity of Mouse Mammary Tumor Lines in Collagen Gel Cultures. Cancer Research. 1985;45(9):4200-5. 52. Steeg PS, Alley MC, Grever MR. An Added Dimension: Will Three-Dimensional Cultures Improve Our Understanding of Drug Resistance? Journal of the National Cancer Institute. 1994;86(13):953-5. 53. Kunz-Schughart LA, Freyer JP, Hofstaedter F, Ebner R. The use of 3D cultures for highthroughput screening: the multicellular spheroid model. J Biomol Screen. 2004;9:273-84. 54. Cukierman E, Pankov R, Stevens DR, Yamada KM. Taking cell-matrix adhesions to the third dimension. Science. [10.1126/science.1064829]. 2001;294:1708-12. 55. Elliott NT, Yuan F. A review of three-dimensional in vitro tissue models for drug discovery and transport studies. Journal of Pharmaceutical Sciences. 2010. In Press. 56. Kim SHJ, Park S, Mostov K, Debnath J, Hunt A. Computational investigation of epithelial cell dynamic phenotype in vitro. Theoretical Biology and Medical Modelling. 2009;6(8):10-6. 57. Chignola R, Schenetti A, Andrighetto G, Chiesa E, Foroni R, Sartoris S, et al. Forecasting the growth of multicell tumour spheroids: implications for the dynamic growth of solid tumours. Cell Proliferation. 2000;33(4):219-29. 58. Mazzoleni G, Di Lorenzo D, Steimberg N. Modelling tissues in 3D: the next future of pharmaco-toxicology and food research? Genes & Nutrition. 2009;4(1):13-22. 59. Kunz-Schughart LA, Kreutz M, Knuechel R. Multicellular spheroids: a three-dimensional in vitro culture system to study tumour biology. International Journal of Experimental Pathology. 1998;79(1):1-23. 60. Feder-Mengus C, Ghosh S, Reschner A, Martin I, Spagnoli G. New dimensions in tumor immunology: what does 3D culture reveal? Trends Mol Med. 2008;14(8):333-40.

116

61. Morales J, Alpaugh M. Gain in cellular organization of inflammatory breast cancer: A 3D in vitro model that mimics the in vivo metastasis. BMC Cancer. 2009;9(1):462. 62. Pietras K, stman A. Hallmarks of cancer: Interactions with the tumor stroma. Experimental Cell Research. 2010;316(8):1324-31. 63. DiMasi JA, Hansen RW, Grabowski HG. The price of innovation: new estimates of drug development costs. Journal of Health Economics. 2003;22(2):151-85. 64. DiMasi JA, Grabowski HG. Economics of New Oncology Drug Development. Journal of Clinical Oncology. 2007;25(2):209-16. 65. Rangarajan A, Hong SJ, Gifford A, Weinberg RA. Species- and cell type-specific requirements for cellular transformation. Cancer Cell. 2004;6(2):171-83. 66. Abbott A. Cell culture: Biology's new dimension. Nature. 2003;424(6951):870-2.

67. Mueller-Klieser W. Tumor biology and experimental therapeutics. Critical reviews in oncology/hematology. 2000;36(2):123-39. 68. Ingber DE. Tensegrity-based mechanosensing from macro to micro. Progress in Biophysics and Molecular Biology. 2008;97(2-3):163-79. 69. Schmeichel K, Bissell M. Modeling tissue-specific signaling and organ function in three dimensions. J Cell Sci. 2003;116(Pt 12):2377-88. 70. Ingram M, Techy G, Ward B, Imam S, Atkinson R, Ho H, et al. Tissue engineered tumor models. Biotechnic & Histochemistry. 2010;85(4):213-29. 71. Dhimolea E, Maffini MV, Soto AM, Sonnenschein C. The role of collagen reorganization on mammary epithelial morphogenesis in a 3D culture model. Biomaterials. 2010;31(13):362230. 72. Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman P, T. , et al. The morphologies of breast cancer cell lines in three-dimensional assays correlate with their profiles of gene expression. Molecular oncology. 2007;1(1):84-96. 73. Dabrowska-Piaskowska K. Observations on the histoformative capacities of tumor cells dissociated by digestion with trypsin. Experimental Cell Research. 1959;16(2):315-23.

117

74. Yang J, Richards J, Bowman P, Guzman R, Enami J, Mccormick K, et al. Sustained growth and three-dimensional organization of primary mammary tumor epithelial cells embedded in collagen gels. Proceedings of the National Academy of Sciences of the United States of America. 1979; 76(7):3401-5. 75. Hall HG, Farson DA, Bissell MJ. Lumen formation by epithelial cell lines in response to collagen overlay: a morphogenetic model in culture. Proceedings of the National Academy of Sciences of the United States of America. 1982;79(15):4672-6. 76. Benton G, George J, Kleinman HK, Arnaoutova IP. Advancing science and technology via 3D culture on basement membrane matrix. Journal of Cellular Physiology. 2009;221(1):18-25. 77. Nelson WJ. Remodeling Epithelial Cell Organization: Transitions Between FrontRear and ApicalBasal Polarity. Cold Spring Harbor Perspectives in Biology. 2009;1(1) 33-40. 78. Kleinman HK, Martin GR. Matrigel: Basement membrane matrix with biological activity. Seminars in Cancer Biology. 2005;15(5):378-86. 79. Kleinman HK. Basement membrane complexes with biological activity. Biochemistry. 1986;25:312-8. 80. Petersen OW, Ronnov-Jessen L, Howlett AR, Bissell MJ. Interaction with basement membrane serves to rapidly distinguish growth and differentiation pattern of normal and malignant human breast epithelial cells. Proc Natl Acad Sci USA. 1992;89:9064-8. 81. Briand P, Petersen OW, Van Deurs B. A new diploid nontumorigenic human breast epithelial cell line isolated and propagated in chemically defined medium. In Vitro Cell Dev Biol. 1987;23:181-8. 82. Weaver V, Petersen O, Wang F, Larabell C, Briand P, Damsky C, et al. Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J Cell Biol. 1997;137:231-45. 83. Bissell MJ, Radisky D. Putting tumours in context. Nature Rev Cancer. 2001;1:46-54.

84. Debnath J, Muthuswamy SK, Brugge JS. Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods. 2003;30:256-68.

118

85. Mills KR, Reginato M, Debnath J, Queenan B, Brugge JS. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is required for induction of autophagy during lumen formation in vitro. Proc Natl Acad Sci USA. 2004;101:3438-43. 86. Soule HD, Maloney TM, Wolman SR, Peterson WD, Brenz R, McGrath CM, et al. Isolation and Characterization of a Spontaneously Immortalized Human Breast Epithelial Cell Line, MCF10. Cancer Research. 1990;50(18):6075-86. 87. Debnath J. The role of apoptosis in creating and maintaining luminal space within normal and oncogene-expressing mammary acini. Cell. 2002;111:29-40. 88. Maiuri MC, Tasdemir E, Criollo A, Morselli E, Vicencio JM, Carnuccio R, et al. Control of autophagy by oncogenes and tumor suppressor genes. Cell Death Differ. 2008;16(1):87-93. 89. 90. Levine B. Cell biology: autophagy and cancer. Nature. 2007;446:745-7. Levine B, Kroemer G. Autophagy in the Pathogenesis of Disease. Cell. 2008;132(1):27-42.

91. Underwood JM, Imbalzano KM, Weaver VM, Fischer AH, Imbalzano AN, Nickerson JA. The ultrastructure of MCF-10A acini. Journal of Cellular Physiology. 2006;208(1):141-8. 92. Mills KR, Reginato M, Debnath J, Queenan B, Brugge JS. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is required for induction of autophagy during lumen formation in vitro. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(10):3438-43. 93. Fung C, Lock R, Gao S, Salas E, Debnath J. Induction of autophagy during extracellular matrix detachment promotes cell survival. Mol Biol Cell. 2008;19:797-806. 94. Soule HD, Vazguez J, Long A, Albert S, Brennan M. A human cell line from a pleural effusion derived from a breast carcinoma. Journal of the National Cancer Institute. 1973;51(3):1409-16. 95. Debeb BG, Xu W, Mok H, Li L, Robertson F, Ueno NT, et al. Differential Radiosensitizing Effect of Valproic Acid in Differentiation Versus Self-Renewal Promoting Culture Conditions. International Journal of Radiation Oncology*Biology*Physics. 2010;76(3):889-95. 96. Ivascu A, Kubbies M. Diversity of cell-mediated adhesions in breast cancer spheroids. International Journal of Oncology. 2007; 31:1403-13

119

97. Kirshner J, Chen CJ, Liu P, Huang J, Shively JE. CEACAM1-4S, a cell-cell adhesion molecule, mediates apoptosis and reverts mammary carcinoma cells to a normal morphogenic phenotype in a 3D culture. Proc Natl Acad Sci USA. 2003;100:521-6. 98. Krause S, Maffini M, Soto A, Sonnenschein C. The microenvironment determines the breast cancer cells' phenotype: organization of MCF7 cells in 3D cultures. BMC Cancer. 2010;10(263) 99. Guo H-B, Johnson H, Randolph M, Nagy T, Blalock R, Pierce M. Specific posttranslational modification regulates early events in mammary carcinoma formation. Proceedings of the National Academy of Sciences. 2010;107(49):21116-21. 100. Debnath J, Muthuswamy S, Brugge J. Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods. 2003;30:256-68. 101. Allan LA, Clarke PR. Apoptosis and autophagy: Regulation of caspase-9 by phosphorylation. FEBS Journal. 2009;276(21):6063-73. 102. Overexpression of Par-4 sensitizes TRAIL-induced apoptosis via inactivation of NFkappaB and Akt signaling pathways in renal cancer cells. Molecular cell. 2005;20(1):33-4.

103. Zhao Y, Rangnekar VM. Apoptosis and tumor resistance conferred by Par-4. Cancer Biology & Therapy. 2008;7 (12):1867-74. 104. Joshi J, Fernandez-Marcos PJ, Galvez A, Amanchy R, Linares JF, Duran A, et al. Par-4 inhibits Akt and suppresses Ras-induced lung tumorigenesis. EMBO J. 2008;27(16):2181-93. 105. Gurumurthy S, Goswami A, Vasudevan KM, Rangnekar VM. Phosphorylation of Par-4 by Protein Kinase A Is Critical for Apoptosis. Mol Cell Biol. 2005;25(3):1146-61. 106. Chen Z-H, Lam HC, Jin Y, Kim H-P, Cao J, Lee S-J, et al. Autophagy protein microtubuleassociated protein 1 light chain-3B (LC3B) activates extrinsic apoptosis during cigarette smokeinduced emphysema. Proceedings of the National Academy of Sciences. 2010;107(44):18880-5. 107. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, et al. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. 2000;19(21):5720-8.

120

108. Mario G, Fernndez AF, Cabrera S, Lundberg YW, Cabanillas R, Rodrguez F, et al. Autophagy is essential for mouse sense of balance. The Journal of Clinical Investigation. 2010;120(7):2331-44. 109. Manning BD, 2007;129:1261-74. Cantley LC. AKT/PKB signaling: navigating downstream. Cell.

110. Srinivasan S, Koduru S, Kumar R, Venguswamy G, Kyprianou N, Damodaran C. Diosgenin targets Akt-mediated prosurvival signaling in human breast cancer cells. International Journal of Cancer. 2009;125(4):961-7. 111. Kolch W. Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochem J. 2000;351:289-305. 112. Calvo F, Agudo-Ibez L, Crespo P. The Ras-ERK pathway: Understanding site-specific signaling provides hope of new anti-tumor therapies. Bioessays. 2010;32(5):412-21. 113. Chao Y, Shepard C, Wells A. Breast carcinoma cells re-express E-cadherin during mesenchymal to epithelial reverting transition. Molecular Cancer. 2010;9(1):179. 114. Onder T, Gupta P, Mani S, Yang J, Lander E, Weinberg R. Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Cancer Res. 2008;68:3645-54. 115. Tortorella MD, Malfait F, Barve RA, Shieh HS, Malfait AM. A review of the ADAMTS family, pharmaceutical targets of the future. Curr Pharm Des. 2009;15(20):2359-74. 116. Rocks N, Paulissen G, Quesada-Calvo F, Munaut C, Gonzalez M-LA, Gueders M, et al. ADAMTS-1 Metalloproteinase Promotes Tumor Development through the Induction of a Stromal Reaction In vivo. Cancer Research. 2008;68(22):9541-50. 117. Karnovsky MJ. A formaldehyde-glutaraldehyde fixative of high osmolality for use in electron microscopy. Journal of Cell Biology 1965;27:137-8A. 118. Le Bot N. Entosis: cell death by invasion. Nat Cell Biol. 2007;9(12):1346-.

119. Overholtzer M, Mailleux AA, Mouneimne G, Normand G, Schnitt SJ, King RW, et al. A Nonapoptotic Cell Death Process, Entosis, that Occurs by Cell-in-Cell Invasion. Cell. 2007;131(5):966-79.

121

120. Lubarsky B, Krasnow MA. Tube Morphogenesis: Making and Shaping Biological Tubes. Cell. 2003;112(1):19-28. 121. Martn-Belmonte F, Yu W, Rodrguez-Fraticelli AE, Ewald A, Werb Z, Alonso MA, et al. Cell-Polarity Dynamics Controls the Mechanism of Lumen Formation in Epithelial Morphogenesis. Current Biology. 2008;18(7):507-13. 122. Anderson LR, Sutherland RL, Butt AJ. BAG-1 overexpression attenuates luminal apoptosis in MCF-10A mammary epithelial cells through enhanced RAF-1 activation. Oncogene. 2009;29(4):527-38. 123. Freitas VM, Rangel M, Bisson LF, Jaeger RG, Machado-Santelli GM. The geodiamolide H, derived from brazilian sponge Geodia corticostylifera, regulates actin cytoskeleton, migration and invasion of breast cancer cells cultured in three-dimensional environment. Journal of Cellular Physiology. 2008;216(3):583-94. 124. Debnath J, Brugge JS. Modelling glandular epithelial cancers in three-dimensional cultures. Nat Rev Cancer. 2005;5(9):675-88. 125. Mailleux AA, Overholtzer M, Brugge JS. Lumen formation during mammary epithelial morphogenesis: insights from in vitro and in vivo models. Cell Cycle. 2008;7(1):57-62. 126. Lacroix M, Leclercq G. Relevance of Breast Cancer Cell Lines as Models for Breast Tumours: An Update. Breast Cancer Research and Treatment. 2004;83(3):249-89. 127. Fischbach C, Chen R, Matsumoto T, Schmelzle T, Brugge JS, Polverini PJ, et al. Engineering tumors with 3D scaffolds. Nat Methods. 2007;4:855-90. 128. Dhiman HK, Ray AR, Panda AK. Three-dimensional chitosan scaffold-based MCF-7 cell culture for the determination of the cytotoxicity of tamoxifen. Biomaterials. 2005;26(9):979-86. 129. Chen C-J, Nguyen T, Shively JE. Role of calpain-9 and PKC-[delta] in the apoptotic mechanism of lumen formation in CEACAM1 transfected breast epithelial cells. Experimental Cell Research. 2010;316(4):638-48. 130. Burdall S, Hanby A, Lansdown M, Speirs V. Breast cancer cell lines: friend or foe? Breast Cancer Res. 2003;5(2):89-95.

122

131. Fillmore C, Kuperwasser C. Human breast cancer cell lines contain stem-like cells that self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Research. 2008;10(2):R25. 132. Grimshaw M, Cooper L, Papazisis K, Coleman J, Bohnenkamp H, Chiapero-Stanke L, et al. Mammosphere culture of metastatic breast cancer cells enriches for tumorigenic breast cancer cells. Breast Cancer Research. 2008;10(3):R52. 133. Calcagno AM, Salcido CD, Gillet J-P, Wu C-P, Fostel JM, Mumau MD, et al. Prolonged Drug Selection of Breast Cancer Cells and Enrichment of Cancer Stem Cell Characteristics. Journal of the National Cancer Institute. 2010 November 3, 2010;102(21):1637-52. 134. Shivas JM, Morrison HA, Bilder D, Skop AR. Polarity and endocytosis: reciprocal regulation. Trends in Cell Biology. 2010;20(8):445-52. 135. Hogan BLM, Kolodziej PA. Molecular Mechanisms Of Tubulogenesis. Nat Rev Genet.. 2002;3(7):513-23. 136. Lu X, Lu X, Kang Y. Organ-specific enhancement of metastasis by spontaneous ploidy duplication and cell size enlargement. Cell Res. 2010;20(9):1012-22. 137. 137. Yan J, Luo D, Luo Y, Gao X, Zhang G. Induction of G1 arrest and differentiation in MDA-MB-231 breast cancer cell by boehmeriasin A, a novel compound from plant. International Journal of Gynecological Cancer. 2006;16(1):165-70. 138. 138. Baranwal S, Alahari SK. Molecular mechanisms controlling E-cadherin expression in breast cancer. Biochemical and biophysical research communications. 2009;384(1):6-11 139. Debnath J, Mills KR, Collins NL, Reginato MJ, Muthuswamy SK, Brugge J. The role of apoptosis in creating and maintaining luminal space within normal and oncogene-expressing mammary acini. Cell. 2002;111:29-40. 140. Debnath J, Brugge J. Modelling glandular epithelial cancers in three-dimensional cultures. Nat Rev Cancer. 2005;5(9):675 - 88. 141. O'Connor L, Strasser A, O'Reilly LA, Hausmann G, Adams JM, Cory S, et al. Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J. 1998;17(2):384-95.

123

142. Barradas M, Monjas A, Diaz-Meco MT, Serrano M, Moscat J. The downregulation of the pro-apoptotic protein Par-4 is critical for Ras-induced survival and tumor progression. EMBO J. 1999;18:6362-9. 143. Moreno-Bueno G, Fernandez-Marcos PJ, Collado M, Tendero MJ, Rodriguez-Pinilla SM, Garcia-Cao I, et al. Inactivation of the candidate tumor suppressor par-4 in endometrial cancer. Cancer Res. 2007;67:1927-34. 144. Goswami A, Burikhanov R, de Thonel A, Fujita N, Goswami M, Zhao Y, et al. Binding and phosphorylation of par-4 by akt is essential for cancer cell survival. Mol Cell. 2005;20:33-44. 145. Nagai MP, Gerhard R, Salaorni S, Fregnanit JHGT, Nonogaki S, Netto MM, et al. Downregulation of the candidate tumor suppressor gene PAR-4 is associated with poor prognosis in breast cancer. International Journal of Oncology 2010;37:41-9. 146. Acker H, Carlsson J, Durand RE, Sutherland R. Spheroids in cancer research. Berlin Heidelberg: Springer-Verlag; 1984. 147. Golstein P, Kroemer G. Cell death by necrosis: towards a molecular definition. Trends in Biochemical Sciences. 2007;32(1):37-43. 148. Carnero A, Blanco-Aparicio C, Renner O, Link W, Leal JF. The PTEN/PI3K/AKT signalling pathway in cancer, therapeutic implications. Curr Cancer Drug Targets. 2008;8(3):187-98. 149. Bellacosa A, Chan TO, Ahmed NN, Datta K, Malstrom S, Stokoe D, et al. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene. 1998;17:31325. 150. Testa JR, Bellacosa A. AKT plays a central role in tumorigenesis. Proceedings of the National Academy of Sciences of the United States of America. 2001;98(20):10983-5. 151. Debnath J, Walker SJ, Brugge JS. AKT activation disrupts mammary acinar architecture and enhances proliferation in an mTOR-dependent manner. J Cell Biol. 2003;163:315-26. 152. McCulloch DR, Akl P, Samaratunga H, Herington AC, Odorico DM. Expression of the Disintegrin Metalloprotease, ADAM-10, in Prostate Cancer and Its Regulation by Dihydrotestosterone, Insulin-Like Growth Factor I, and Epidermal Growth Factor in the Prostate Cancer Cell Model LNCaP. Clinical Cancer Research. 2004 ;10(1):314-23.

124

153. Arima T, Enokida H, Kubo H, Kagara I, Matsuda R, Toki K, et al. Nuclear translocation of ADAM-10 contributes to the pathogenesis and progression of human prostate cancer. Cancer Science. 2007;98(11):1720-6. 154. Brown HM, Dunning KR, Robker RL, Pritchard M, Russell DL. Requirement for ADAMTS-1 in extracellular matrix remodeling during ovarian folliculogenesis and lymphangiogenesis. Developmental Biology. 2006;300(2):699-709. 155. Kang Y, Siegel PM, Shu W, Drobnjak M, Kakonen SM, Cordn-Cardo C, et al. A multigenic program mediating breast cancer metastasis to bone. Cancer Cell. 2003;3(6):537-49. 156. Masui T, Hosotani R, Tsuji S, Miyamoto Y, Yasuda S, Ida J, et al. Expression of METH-1 and METH-2 in Pancreatic Cancer. Clinical Cancer Research. 2001;7(11):3437-43. 157. Porter S, Scott SD, Sassoon EM, Williams MR, Jones JL, Girling AC, et al. Dysregulated Expression of Adamalysin-Thrombospondin Genes in Human Breast Carcinoma. Clinical Cancer Research. 2004 April 1, 2004;10(7):2429-40. 158. Liu Yj, Xu Y, Yu Q. Full-length ADAMTS-1 and the ADAMTS-1 fragments display pro- and antimetastatic activity, respectively. Oncogene. 2005;25(17):2452-67. 159. Huang S, Ingber DE. The structural and mechanical complexity of cell-growth control. Nat Cell Biol. 1999;1(5):E131-E8. 160. Paszek MJ. Tensional homeostasis and the malignant phenotype. Cancer Cell. 2005;8:241-54. 161. Wozniak MA, Desai R, Solski PA, Der CJ, Keely PJ. ROCK-generated contractility regulates breast epithelial cell differentiation in response to the physical properties of a threedimensional collagen matrix. J Cell Biol 2003;163(3):583-95.

125

ANEXOS

126

ANEXO A - ANIMAES LEGENDAS Todas as animaes descritas abaixo se encontram gravadas em um DVD anexado ao final desta tese.

Animao 1-Reconstrues obtidas a partir de seces pticas (microscpio confocal de varredura a laser), mostrando a formao do lmen em esferides de clulas MCF-7.

Animao 2-Reconstrues obtidas a partir de seces pticas (microscpio confocal de varredura a laser), mostrando a organizao das clulas quando arranjadas em esferides com 7 dias de cultura 3D. Animao obtida utilizando o software Imaris 7.1

Animao 3-Reconstrues obtidas a partir de seces pticas (microscpio confocal de varredura a laser), mostrando imunomarcao (em verde) para p-Akt em clulas crescidas aps 7 dias de cultura 3D. Animao obtida utilizando o software Imaris 7.1

Animao 4-Srie de imagens obtidas ao microscpio de luz utilizando campo claro onde possvel observar esferides diferenciados com 50 dias de cultura

Animao 5-Reconstrues obtidas a partir de seces pticas (microscpio confocal de varredura a laser), mostrando o espao luminal por dentro de esferides diferenciados. Esferides com 25 dias de cultura (linhagem selecionada para formar lmen)

127

ENCARTE COM DVD

128

ANEXO B - ARTIGO PUBLICADO

do Amaral J, B, Shiniti Urabayashi M, Maria MachadoSantelli G. Cell death and lumen formation in spheroids of MCF-7 cells. Cell Biology International. 2010 Feb 1;34(3):267-74.

129

130

131

132

133

134

135

136

137

ANEXO C- VIAS DE SINALIZAO CELULAR

Figura 36 Esquema mostrando vias de sinalizao celular onde possvel observar as interaes das protenas analisadas neste presente trabalho. Esquema obtido utilizando o software Meta Core