Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.

8, 2012

www.iiste.org

ANALYSIS OF LOSS OF HETEROZYGOSITY OF THE TUMOR SUPPRESSOR GENES IN PAPILLARY THYROID CARCINOMA (PTC)
Hesat Aliu, Nexhbedin Beadini, Sheqibe Beadini, Gazmend Iseni Faculty of Medical Sciences Department of Molecular Biology and Biochemistry State University of Tetova, Macedonia *E-mail of the corresponding author: arburim.iseni@unite.edu.mk Abstract The loss of heterozygosity in a cell implies a loss in the normal functioning of the allele of a given gene in which the other allele has previously been deactivated. This phenomenon is usual in different tumors, which shows the lack of a tumor suppressor gene in the lost region. The aim of this study was to examine the loss of heterozygosity in papillary thyroid carcinoma (PTC). Sequences, in which certain tumor suppressor genes are seen, have been analyzed, as is the gene that codifies the M6P/IGFIIR receptor as well as three specific loci of chromosome 11. A total 98 samples have been analyzed. The half of those samples were taken from persons with papillary thyroid carcinoma and the other half were controls from tissues around the respective tumors. The micro-satellite markers in the M6P/IGFIIR gene region as well as in the three loci of chromosome 11 were multiplied by using the PCR method, whereas the analysis of allelic situation as well as the LOH phenomenon was done after the completion of the gel electrophoresis in the polyacrilamide (PAA). In the M6P/IGFII gene region, 49% of the samples were heterozygote, i.e. informative, whereas in the three regions of the chromosome 11 the percentage of heterozygotes varied between 53 and 63%. The phenomenon of the loss of heterozygosity was not present in any of the analyzed samples for the respective micro-satellite markers. Even though the number of informative heterozygote samples was above 50%, the loss of heterozygosity did not occur in any of them. We can therefore conclude that the percentage of heterozygosity is not necessarily related to the loss of heterozygosity; the papillary thyroid carcinoma in these patients was not caused by the LOH phenomenon in the given regions. Keywords: Papillary carcinoma of the thyroid gland (PTC); Loss of heterozygosity (LOH); M6P/IGF2R gene; microsatellite markers INTRODUCTION The papillary thyroid carcinoma is the most frequent type of the thyroid gland cancer and it covers up to 80 or 90% of the cases (1). It is generally accepted that the pathogenesis of cancer involves accumulation of multiple molecular abnormalities over time. Those alterations can be classified in the following 6 functional sets: self-sufficiency in growth signals due to mutations in proto-oncogenes, insensitivity to antiproliferative signals as result of mutations affecting the tumor suppressor genes, evading of apoptosis by up-regulation of antiapoptotic or down-regulation of proapoptotic molecules, limitless replicative potential due to activation of telomerase, sustained angiogenesis and capability for tissue invasion ant consequent metastasis (2). The main function of the TSGs is to regulate the cell cycle, control the proliferation processes, differentiate and maintain full genomic stability, etc. The loss or deactivation of suppressor tumor genes plays an important role in the development and advancement of many tumors. One of the characteristics of the TSGs is that both alleles of the gene have to be damaged in order for the transformation to take effect. TSGs can be deactivated by point mutations and partial or full deletions (3). TSGs can also be deactivated at a post-transcriptional level (4). The M6P/IGFIIR receptor gene is localized on the long side of chromosome 6 (6q26-27) (5). It has already been confirmed that head and neck malign tumors emerge as a result of the loss of heterozygosity for the M6P/IGFIR2 gene (6). In the liver cells, the locus in which this gene is situated is supposed to be behaving as a tumor suppressor gene (7, 8).

46

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

The genetic studies of the cervical cancer have proven frequent loss of heterozygosity by affecting multiple chromosomal regions, such as 3p, 5p, 6p, and 11q something that shows the presence of tumor suppressor genes in these regions. The majority of studies show that chromosome 11 in different regions such as 11q13 and 11q22-23 reveals LOH (9). In the chromosome 11 and more precisely locus 11q23-24 has been identified as a frequently-deletive region in a great number of tumors, including breast tumor, lung tumor and ovarian cancer from 45 to 63% (10). The fact that locus 11q22-23 is the most frequent target of the LOH phenomenon in many tumors, suggests that this region includes one or more tumor suppressor genes (11). One of the ways to analyze the tumor suppressor genes is the detection of LOH (12). In order to analyze the LOH, the polymorph regions of DNA are used, known as microsatellites. Microsatellites are tandemic sequences repeated in two to four nucleotides (mostly CA dinucletoides), which are present in different loci along all the chromosomes. Due to the high level of microsatellite loci polymorphism, an individual can possess a different number of repetitions in the homolog chromosome pair known as heterozygote. In order to find the LOH, it is necessary to compare the DNA of the tumoral tissue and the constitutive DNA of the healthy tissue in the same individual. If there are two alleles of the given microsatellite locus in the healthy tissue and one in the tumoral tissue, we can say that the LOH has occurred in that tumor. The LOH phenomenon shows a deletion of a molecule sequence of the DNA and the loss of the tumor suppressor gene (TSG) which is situated in that region. By analyzing the microsatellites in tumoral tissues we can also detect the microsatellite instability (MIS), which means that the size of the microsatellite allele in the tumor is different from the healthy tissue (13). The aim of this study was to examine: a) the heterozygosity frequency of the M6P/IGF2R gene and three loci in chromosome 11; b) LOH for the gene in the respective loci.

MATERIALS AND METHODS Tissue samples The research material samples were taken from the tumor bank (-80C) at the Molecular Medicine Laboratory Rudjer Boshkovic Institute in Zagreb, Croatia (14). Ninety eight (98) samples were examined in total forty nine (49) taken from individuals with papillary thyroid carcinoma and forty nine (49) taken from tissues surrounding the respective tumors (non-tumoral). All of the patients agreed in a written form to allow the usage of their removed tissues for scientific-research aims (informed consent). The patients age was between 14 and 72, with an average of 48. The phenol-chloroform and KSDS standard proteinase procedure was used to isolate the DNA (15). The isolated DNA was detected by the gel electrophoresis in 2% agarose and then was photographed. The microsatellite marker amplification was carried out by the polymerase chain reaction (PCR) using the Perkin Elmer Thermal Cycler 2400. The amplification reaction volume of the DNA was 25uL, and contains master mix 5 x puffer TaqMaster, 10 puffer, dNTP (10mM), basic oligonucleotides 8 pmol/ L (0,32 M), genomic DNA 200 ng, Taq polymerase 0,05 L (5 U/ L), sterilized and deionized water up to 25 L. Eight (8) different basic oligonucleotides (primers) were used in the PCR. The primer composition, anilination temperature and the size of alleles has been illustrated in Table 1 (16). The amplification was done by following this program: the initial DNA molecule denaturation lasts for three minutes at 96C and then in the following 35 cycles

47

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

denaturation occurs at 96C in every 30 seconds; the repeated hybridization of oligonucleotides lasts 35 seconds at 57C (JJMI; D11S1353; D114094; D114144) and the elongation of basic oligonucleotides (primers) in 30 seconds with an additional second in every consequent cycle at 72C. the final elongation was done at 72C in 7 minutes. After the completion of the PCR reaction, the size and quality of PCR products was tested in 2% gel agarose. The amplifiers were paired in the polyacrilamide gel (PAA) 12%-14% with dimensions 20cm x 30cm. A pair consists of a PCR product, a normal tissue and a tumoral tissue of the same individual. The longitude of the electrophoresis in the PAA gel in a puffer 1xTBE at tension of P = 35W is between 18 and 20 hours, whereas a xylene cyanol colour marker was used to monitor the process of agarose gel electrophoresis and polyacrilamide gel electrophoresis (migrates at the speed of a 110 base pair DNA fragment) and a blue bromphenol (migrates at the speed of a 140 base pair DNA fragment) (17). After the completion of electrophoresis, the gel was separated from the glass and was put in ethanol 10%. After some 20-30 minutes the ethanol was removed by a water pump and a nitrite acid 1% was added in the dish. The gel is oxidized for 5 minutes in this composition. After the brief flushing, distilled water is again used to clean it at least three times whereas in the gel dish a 0.2% silver nitrate is added. The gel is incubated in it for the following 30 minutes. Then the gel is flushed well with distilled water and a cooled (+4 C) amplifier is added to the dish. After the DNA stripes become visible, the amplifier is removed and a 5% acetic acid is added in order to stop the reaction (18). By comparing the sizes of tumoral and normal markers we can conclude the presence of two different microsatellite stripes (two different alleles) in the tumor and the controlling sample, i.e. heterozygosity is present (Het) and exactly these two cases were informative for the analysis of the LOH; on the other hand, the presence of a stripe (two identical alleles) in the tumor and the controlling sample is known as homozygosity (Hom) which is not informative for purposes of LOH analysis. The LOH was expected to be confirmed only if the allele from the normal sample was missing in the tumoral one. Table 1. The composition of primers, anilination temperature and the size of used alleles to detect the LOH Amplified sequence
JJMIF JJMIR M6P/IGF2R D11S4094 F D11S4094 R For the long arm of chromosome 11 D11S1353 F D11S1353 R For the long arm of chromosome 11 D11S4144 F D11S4144 R For the long arm of chromosome 11 F 5 AGACAGGTCTTCACCACAGC R 5 ATGGCTTCCAGGTTAGTGC 57C 200 F 5 GATATGTCCCCAAATCCA R 5 CCAACGCTTAAAATGTTAGC 57C 180 F 5 CTAAAGAACAGCCAGTCA R 5 GGAGTCGGGGAATTTCTAA 57C 200 5'-TTGCCGGCTGGTGAATTCAA 5'-CTCTTCAGGTTCTCATGATA 57C 160

Alignment and composition of bases 5 to 3

Annealing temperature

Allele size (pb)

48

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

RESULTS In Photo 1 we can see some of the DNA samples isolated with phenol/chloroform from the normal and tumoral tissues with a size of 23310 base pairs (bp) and fractioned in 2% agarose gel and diluted with Tris EDTA.

Photo 1. Isolated DNA samples from normal tissues (N1) and tumoral tissues (T1) with a size of 23310 base pairs (bp)

The second photo shows PCR products of the four analyzed loci, in 2% agarose gel, with a size from 160 to 200 bp.

Photo 2. PCR products in 2% agarose gel; ST-Standart loci M6P/IGF2R, D11S4094, D11S4144, D11S1353

49

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

Table 2 shows the number of patients, respective records for each of the individuals, microsatellite markers for chromosome 11, D11S1353 F/R, D114144 F/R, D114094 F/R and marker microsatellites for IGF2R of chromosome 6; JJMIF/JJMIR and the allelic status for each of microsatellite in the polyacrilamide gel. Table 2. Patient data and allelic status for every sample
Isolated DNA samples PCR product in 12-14% polyacrilamide gel from 0,5 - 2L Isolated DNA samples PCR product in 12-14% polyacrilamide gel from 0,5 2L

Normal N.R 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 tissue NT NT NT-M NT MA NT-P NT-MAR NT-J NT SB NT S 1N 2N 3N N 1 N 2 SN4 SN5 SN7 SN8 NT13 NT15 NT16 NT17 NT19 NT20 NT22

Tumoral tissue T- T-T T-M T MA T-P T-MAR T-J T SB TS 1T 2T 3T T 1 T 2 ST4 ST5 ST7 ST8 T13 T15 T16 T17 T19 T20 T22

D11S1353 F/R Het Hom Hom Hom Het Het Het Hom Het Hom Het Hom Het Het Het Hom Hom Hom Hom Het het Het het hom hom

D114144 F/R Het Het Hom het Het Hom Hom Het Het Hom Hom Het Het Het Het Het Het Het Het Het Hom Het Hom Hom Hom

D114094 F/R Het* Het Hom Hom Hom Het Het Hom Het Het Het Hom Het Het Het Hom Hom Hom Hom Het Het Het Het Het Het

JJMIF JJMIR Hom Hom Het Hom Het Hom Hom Het Het Hom Hom Hom Hom Het Het Hom Hom Het Het Het Hom Het Hom Het Het 26 27 28 29 30 31 32 33 34 35 36 37 38 39 49 41 42 43 44 45 46 47 48 49 N.R

Normal tissue

Tumoral tissue

D11S1353 F/R

D114144 F/R

D114094 F/R

JJMIF JJMIR

NT23 NT24 NT25 NT26 NT27 NT28 NT29 NT30 NT31 NT32 NT33 NT40 NT41 NT42 NT43 D.LN NT44 NT45 NT46 NT48 NT49 NT50 NT51 NT53

T23 T24 T25 T26 T27 T28 T29 T30 T31 T32 T33 T40 T41 T42 T43 D.T T44 T45 T46 T48 T49 T50 T51 T53

het Hom Het Het Het Het Het Hom Het Hom Hom Hom Het Hom Het Hom Het Het Het Het Het Hom Het Hom

Hom Hom Hom Het Hom Het Het Hom Hom Hom Hom Het Hom Hom Hom Hom Het Het Het Hom Het Het Hom Het

Het Het Het Het Het Het Het Hom Hom Hom Hom Hom Het Het Het Het Hom Het Hom Het Hom Het Hom Het

Het Het Het Hom Het Het Het Hom Hom Hom Hom Hom Hom Hom Het Hom Hom Het Hom Hom Het Het Het Het

50

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

Het* informative heterozygote; Hom informative homozygote The Het abbreviation refers to the heterozygote state whereas the Hom abbreviation refers to the homozygote state. The allelic status is always the same for a normal and tumoral respective sample. But, based on the results, it seems that the same individual has a different allelic status for different microsatellites. E.g. the individual N-T/T-T is homozygote for two loci of the chromosome and for another two is heterozygote. Table 3 shows the percentage of heterozygote informative samples for each of the microsatellite markers. We can see that there is a lower percentage of heterozygotes for the microsatellite marker JJMIF/JJMIR in 24 of 49 cases or 49%, and a higher percentage of heterozygotes has been recorded for the D114049F/R microsatellite marker, i.e. 31 out of 49 cases or 63%. Table 3. The percentage of heterozygotes for each microsatellite marker Basic oligonucleotides (primers) JJMIF JJMIR D11S1353 F/R D114094 F/R D114144 F/R 28/49 57% 31/49 63% 26/49 53% Percentage of heterozygotes 24/49 49%

51

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

Photo 3. PCR products in polyacrilamide gel 12%, ST (Standard), 1N-Normal, 1T-tumoral (informative) A total of 49 samples of tissues with tumor of the papillary carcinoma of the thyroid gland were analyzed along with 49 non-tumoral samples. The DNA molecules, amplified with the chain proliferase reaction were fractioned in a 12-14% gel as shown in Photo 3. The section of informative samples (heterozygote) in our study for the M6PR/IGFIIR gene was 49% or 24 out of 49 cases, whereas in the region of the chromosome 11 we had the following situation: D11S1353 F/R 57% or 28/49 of the cases, D11S4049 63% 31/49, D11S4144 53% or 26/49 of the cases. We were not able to identify the LOH for the M6P/IGFIIR gene as well as the three primer pairs for the described 11q22-23 and D11S4049, D11S4144, and D11S1353 chromosome regions in any of the informative heterozygote sample cases. DISCUSSION The M6PR/IGFIIR gene codes the multifunctional protein which is included in the lysosome biogenesis, fetal organogenesis as well as the lymphocyte-inducted apoptosis T. It is known nowadays that this gene is a tumor suppressor (19).

52

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

The loss of this receptor has been confirmed to cause an increase in the cell proliferation and reduces apoptosis, i.e. a phenomenon that show that the M6P/IGF2R gene functions as a tumor suppressor gene (20). The analysis of the LOH is an ideal means for the study of TSGs which always behave in compliance with the Knudsons hypothesis over two hits: the deletion of one allele (the first hit) and the mutation of the second allele (the second hit) (21). The frequent LOH within the genetically defined regions has been considered as a proof of the existence of the alleged TSGs. The deletion of the long arm of the chromosome 6 has been recorded in a considerable number of cancers, including the cervical cancer, breast cancer, lung cancer, melanoma, as well as hematological cancers such as the acute lymphoblastic leukemia (22). The frequent allelic loss of the human chromosome in the 11q23-q24 region occurs in a great number of cancers, suggesting that this region is a shelter of the TSGs. The frequency of LOH in the LOH11CR2 region extends from 40% to 60% in the breast cancer, lung cancer, cervical cancer and thyroid gland, suggesting that the genes that reside in these regions can be considered as responsible candidate tumor suppressor genes, whose deactivation is needed in order to cause the above-mentioned tumors (23). Although the LOH in the papillary carcinoma of the thyroid gland has been examined in this paper, this phenomenon was not detected at any given moment. From our data, we can confirm that the papillary carcinoma of the thyroid gland for the given samples was not necessarily related to the LOH phenomenon; this might be due to the small number of samples used in this study, which will have to be proved in the future. However, a study on genetic irregularities in PTC and Hashimoto Thyroiditis (HT) and LOH for the hOGG1 gene (8-oxoguanine glycosylase), in 17 out of 18 cases (94%) the LOH in PTC occurred, and 11/15 (73%) of the cases were with LOH for HT (24). The data show that LOH affects the majority of TSGs. However, the results from our study on the given loci did not affirm this for the M6P/IGF2R gene in the 11q23-q24 region. This means that the papillary thyroid carcinoma in the given samples could have been caused by other genetic irregularities. CONCLUSION The LOH for the M6P/IGF2R gene in the chromosome 6 and the 11q23-q24 region of the chromosome 11 in the papillary thyroid carcinoma was not detected in any of the samples. The LOH analysis results for the M6P/IGF2R gene and the 11q23 region of the chromosome 11 for the given samples show that LOH is not the cause of the papillary carcinoma of the thyroid gland. Our study is consistent with the results of other authors. The majority of reports (25, 26) as our results have proved that LOH on the respective loci is not a common feature in PTC. The results conclude that the cancerogenesis of the papillary thyroid carcinoma is a multi-level process which includes many genetic modifications. In order to fully explain the molecular genetic base of this process, we should examine other genes that are part of the cell cycle.

ACKNOWLEDGMENTS This study was supported by the head of the Laboratory for Epigenomics, MD, Ph.D Koraljka Gall Troselj in Zagreb, Croatia. REFERENCES 1. N. Al-Brahim, S.L. Asa, Papillary thyroid carcinoma: An overview, Arch. Pathol. Lab. Med. 130 (2006) pp.1057-1062 2. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell, 2000, 100: pp.57-70.

53

Journal of Natural Sciences Research ISSN 2224-3186 (Paper) ISSN 2225-0921 (Online) Vol.2, No.8, 2012

www.iiste.org

3. Hye Seung Lee et al. Tumour suppressor gene expression correlates with gastric cancer prognosis. Journal of Pathology J Pathol 2003; 200: pp.3946. 4. Philipp-Staheli J, Payne SR, Kemp CJ. p27Kip1; Regulation and function of a haploinsufficient tumour suppressor and its misregulation in cancer. Exp Cell Res 2001; 264: pp.148168. 5. C.K. Hu, S. Mccall, J. Madden, H. Huang, R. Clough, R.L. Jirtle, M.S. Anscher. Loss of heterozygosity of M6P/IGF2R gene is an early event in the development of prostate cancer, Prostate Cancer Prostatic. Dis. 9 (2006) pp. 62-67. 6. Jamieson et al. M6P/IGF2R loss of heterozygosity in head and neck cancer associated with poor patient prognosis. BMC Cancer 2003, 3, pp. 1-9. 7. Oka et al. M6P/IGF2R Tumor Suppressor Gene Mutated in Hepatocellular Carcinomas in Japan. Hepatology Vol. 35, No.5, 2002; 1153-1163. 8. Jang et al. Clinical significance of LOH for M6P/IGF2R in patients with primary hepatocellular carcinaoma. World journal of gastroenterology; 2008; 14; 9; 1394-1398. 9. Pulido et al. Identification of a 6-cM Minimal Deletion at 11q23.123.2 and Exclusion of PPP2R1B Gene as a Deletion Target in Cervical Cancer. Cancer Research; 2000; 60, 6677-6682. 10. Martin et al. The BCSC-1 locus at chromosome 11q23-q24 is a candidate tumor suppressor gene. PNAS; 2003; vol. 100; no. 20; 11517115222. 11. Pulido et al. Identification of a 6-cM Minimal Deletion at 11q23.123.2 and Exclusion of PPP2R1B Gene as a Deletion Target in Cervical Cancer. Cancer Research; 2000; 60, 6677-6682. 12. Ying Huang et al. Loss of Heterozygosity Involves Multiple Tumor Suppressor Genes in Human Esophageal Cancers, Cancer research 52. (1992) 6525-6530. 13. Bojana Petrovi, Milica Perovi, Ivana Novakovi, Jasmina Atanackovi, Branka Popovi, Ljiljana Lukovi, Spasoje Petkovi, Analysis of loss of heterozygosity of the tumor suppressor genes p53 andBRCA1 in ovarial carcinomas, Vojnisanitetski pregled 63. (2006) 813-818. 14. Grbesa et al., Loss of IGF2 and maintenance of H19 imprinting in papillary thyroid carcinoma. Elsevier Editorial System(tm) for Cancer Letters, 2008. (Manuscript) 15. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16. (1988) 1215. 16. Aliu, H. Humbja e heterozigotetit n karcinomn papilare t gjndrs tiroide, Tez magjistrature (2010), 49. 17. Anderson LA, Friedman L, Osborne-Lawrence S, Lynch E, Weissenbach J, Bowcock A, et al. High-density genetic map of the BRCA1 region of chromosome 17q12-q21 (1993) Genomics. 18. S. Creste, A. Tulmann Neto and A. Figueira. Detection of Single Sequence Repeat Polymorphisms in Denaturing PolyacrylamideSequencing Gels by Silver Staining. Plant Molecular Biology Reporter 19: 299306, December 2001 19. Killlian et al. Manose 6-receptor phosphate/insulinlike growth factor 2 receptor (M6P/IGF2R) variants in American and Japanese populations. Hum Mutat 2001; 18: 25-31. 20. Yamada et al. Loss of the gene encoding mannose 6-phosphate/insulin-like growth factor II receptor is an early event in liver carcinogenesis. PNAC.USA. Vol. 94; 10351-10355. 21. Troselj GK. Doctoral thesis, 2000. 22. Cesari et al. Prakin. A gene imolicated in autosomal recessive juvenile parkinsonism, is a candidate tumor suppressor gene on chromosome 6q25-q27. PNAS; Vol 100; no 10, 5956-5961. 23. Martin et al. The BCSC-1 locus at chromosome 11q23-q24 is a candidate tumor suppressor gene. PNAS; 2003; vol. 100; no. 20; 11517115222. 24. Herman et al. Cytogenetic and molecular genetic studies of follicular and papillary thyroid cancers. J.C.I. 1991 25. R.Ramirez-Lorca et al., Loss of heterozygosity and genetic association analyses within 11q13.5-q14 chromosomal region in papillary thyroid carcinoma. Endocrine Abstracts (2006) 11 P791 26. Ewa Brzeziaska et al., Loss of heterozygosity and microsatellite instability in the 3p24.2~3pter region in papillary thyroid carcinoma. Arch Med Sci 2007; 3, 3: 192-199

54

This academic article was published by The International Institute for Science, Technology and Education (IISTE). The IISTE is a pioneer in the Open Access Publishing service based in the U.S. and Europe. The aim of the institute is Accelerating Global Knowledge Sharing. More information about the publisher can be found in the IISTEs homepage: http://www.iiste.org CALL FOR PAPERS The IISTE is currently hosting more than 30 peer-reviewed academic journals and collaborating with academic institutions around the world. Theres no deadline for submission. Prospective authors of IISTE journals can find the submission instruction on the following page: http://www.iiste.org/Journals/ The IISTE editorial team promises to the review and publish all the qualified submissions in a fast manner. All the journals articles are available online to the readers all over the world without financial, legal, or technical barriers other than those inseparable from gaining access to the internet itself. Printed version of the journals is also available upon request of readers and authors. IISTE Knowledge Sharing Partners EBSCO, Index Copernicus, Ulrich's Periodicals Directory, JournalTOCS, PKP Open Archives Harvester, Bielefeld Academic Search Engine, Elektronische Zeitschriftenbibliothek EZB, Open J-Gate, OCLC WorldCat, Universe Digtial Library , NewJour, Google Scholar