You are on page 1of 819

4th EMUNI Research Souk

The Euro-Mediterranean Student Research Multi-conference

2012
BRIDGING GAPS IN THE MEDITERRANEAN RESEARCH SPACE
17 18 April 2012

Conference Proceedings

Editors: Laris Gaiser, MA, Denis uri Design: Peter Florjani Published by: EMUNI University, Sonna pot 20, SI-6320 Portoro For the publisher: mag. Laris Gaiser First printing: September 2012 Print-run: 500

CIP - Kataloni zapis o publikaciji Narodna in univerzitetna knjinica, Ljubljana 001.8(082)(086.034.4) EMUNI. Research Souk (4 ; 2012) Bridging gaps in the Mediterranean research space [Elektronski vir] : conference proceedings / 4th EMUNI Research Souk [being] The Euro-Mediterranean Student Research Multi-conference, 17-18 April 2012 ; editors Laris Gaiser, Denis uri. - 1st printing. - El. knjiga. - Portoro : EMUNI University, 2012 ISBN 978-961-6805-05-6 1. Gl. stv. nasl. 2. Gaiser, Laris 263125760

Table of Contents
2 3
th About 4 EMUNI Research Souk (EMUNI ReS)

Papers / Projects

4th EMUNI Research Souk (EMUNI ReSouk)


The Euro-Mediterranean Student Research Multi-conference Bridging gaps in the Mediterranean Research Space
EMUNI ResearchSouk* is in different countries and institutions of the Mediterranean Region. multi-conference simultaneously implemented by EMUNI members in different countries of the Euro-Mediterranean region. A students research conference where participants are stimulated to present their project on one of the following UfM priorities (De-pollution of the Mediterranean, Maritime and Land Highways, Civil Protection, Alternative Energies, Higher Education and Research, The Mediterranean Business Development Initiative). An EMUNI contribution to multicultural dialogue and mutual understanding among people.
A

Recent pressures to expand higher education and the current economic crisis have also led to a significant decrease in the quality of education and research in universities, and there is an apparent lack of coordination between universities, colleges, and other technical training establishments. As a result, while the number of graduates from the different stages of education is increasing, they lack in most cases the core competences and relevant skills needed in a knowledge economy. In terms of the human potential and particularly regarding researchers, we can see that, despite possible reservations with regard to quality, the human potential becoming involved in research is on the rise. We cannot say the same in the field of R&D expenditure, where the gap between the two shores of the Mediterranean remains high. And we must speak similarly about scientific production, which clearly confirms the cognitive gap between the aforementioned Northern and Southern Mediterranean countries. Promoting access by professionals and researchers from different areas of study to greater contact with other approaches implies the advancement of a deeper and more genuine examination of key questions articulating relations between Europe, the Maghreb and the Mashrek, such as political and economic rapprochement, international migrations, security matters, growing interculturalization, environmental problems the Arab Spring, and scientific exchange. All these questions make clear the growing interdependence of the three shores, and the multiplicity of factors involved in Mediterranean relations which cannot therefore be analyzed or studied in isolation, because the Mediterranean is a single whole, diverse but integral at all levels and in all areas of analysis. This will be the main theme of this year's Research Souk.
*Souk is an Arabic word for Market or Bazaar

Papers are published as they were sent by the authors. PAPER TITLE 2ND WORLD WAR: BRIDGING THE MEMORIES OF TWO PEOPLES A COMPARISON OF LIQUID-LIQUID MICROEXTRACTION METHODS BASED ON DISPERSIVE, ULTRASOUND-ASSISTED EMULSIFICATION AND SINGLE-DROP COUPLED TO LIQUID CHROMATOGRAPHY FOR DETERMINATION OF BENFOTHIAMINE A GREEN PRECONCENTRATION TECHNIQUE PREVIOUS TO LIQUID CHROMATOGRAPHY FOR NEONICOTINOID INSECTICIDES QUANTIFICATION IN WATER SAMPLES A PRELIMINARY STUDY. RELATIONSHIP BETWEEN OBESITY AND INMUNE SYSTEM IN RATS. ADOPTION IN A COMPARATIVE PERSPECTIVE AN AUTONOMUS UNDERWATER VEHICLE WITH TOWED SURFACE BOAT FOR LONG-RANGE INSPECTION OF THE MAR MENOR ANALYSIS OF PLATFORMS FOR OFFSHORE WIND TURBINES ARSENIC: ELEMENT CARCINOGENIC AND ANTINEOPLASMATIC ARTISTIC EXCHANGES BETWEEN SPAIN AND ITALY: FRANCISCO SALZILLO AND THE MEDITERRANEAN CULTURE. ASSESSMENT OF AFFILIATION TO PHYLOGENETIC GROUPS (I TO VII) INTO THE BACILLUS CEREUS GROUP AS A VALUABLE TOOL FOR PRACTICAL APPLICATIONS IN FOOD INDUSTRY ASSESSMENT OF BY-PRODUCTS FROM FRESH-CUT PRODUCTS FOR REUSE AS BIOACTIVE COMPOUNDS: OBTAINING A WATERMELON JUICE FUNCTIONAL. ASSESSMENT OF MINIMUM ENVIRONMENTAL STREAM FLOWS BY DIFFERENT METHODS IN MEDITERRANEAN BASINS. CASE STUDY: SEGURA BASIN CACTUS PEAR FRUITS AS SOURCE OF A BIOACTIVE FOOD COLORANT CARTOGRAPHICS RE-INTERPRETATIONS CLEAN RENEWABLE BLUE ENERGY COMMUNICATION STRATEGIES FOR THE USE OF THE ICT IN THE CAMPUS MARE NOSTRUM CORRELATION AND REGRESSION IN THE TRAINING OF TEACHERS DESIGN OF THE POWER SYSTEM OF A SOLAR AUTONOMOUS SURFACE VEHICLE FOR UNDERWATER INSPECTION WORKS. DESIGNING MULTICULTURAL SPACES IN THE MEDITERRANEAN AREA DETERMINATION OF SOME ENDOCRINE DISRUPTING CHEMICALS IN BEVERAGES USING A SOLVENTLESS EXTRACTION METHOD DIFERENCES: IS THERE A NEED FOR A BRIDGE? ECONOMIC GROWTH AND EDUCATION EFFECTIVE ENFORCEMENT OF EU ENVIRONMENTAL LAW BY INDIVIDUALS & NGOS EFFECTS OF DIFFERENT DEFICIT IRRIGATION STRATEGIES ON THE YIELD AND BERRY QUALITY OF TABLE GRAPE, ORCHAD CRIMSON EL VIAJE ENTRE REALIDAD Y DESEO DEL ODISEO CERNUDIANO EMPIRICAL - DESCRIPTIVE ANALYSIS OF THE VALUES OF PARENTS AND TEACHERS IN THE REGION OF MURCIA EMPLOYEE PERCEPTION OF ANNUAL PERFORMANCE INTERVIEWS ENTREPRENEURSHIP IN EDUCATION SECTOR ENVIRONMENTAL IMPROVEMENTS IN PORT AREAS, AN APPLICATION TO CARTAGENA PORT EVALUATION OF WHEY PROTEIN REMOVAL FROM STAINLESS STEEL SURFACES IN A CONTINUOUS FLOW DEVICE FEASIBILITY STUDY OF RECLAIMED WATER USE AND DEFICIT IRRIGATION IN CITRUS CROPS. FOREST ROAD-NET AS A RULER OF SUSTAINABLE DEVELOPMENT IN A COASTAL Page 6

16 24 32 39 47 59 70 75 81 97 106 114 122 138 147 153 160 174 180 188 193 200 211 220 222 231 238 245 254 265 279

MOUNTAINOUS AREA FREE SOFTWARE AND THE ENVIRONMENT: A FITTING RELATION! GENEALOGA NAVAL WIKI: GENERATION AND DISSEMINATION OF KNOWLEDGE SHARED OVER THE INTERNET HOTEL REVIEWS DATABASES. THE CASE OF SPANISH COASTAL HOTELS HYDRODYNAMIC MODELLING FOR COASTAL MONITORING. THE MAR MENOR CASE STUDY IMPLEMENTATION OF A VECTOR CONTROL FOR GRID-CONNECTED RENEWABLE AGENT SYSTEMS INCIDENCE AND IMPACT OF LAW 34/2006, OF ACCESS TO ADVOCACY, IN THE NEW UNIVERSITY ACADEMIC ORGANIZATION IN SPAIN INFLUENCE OF SEX IN THE FLESH QUALITY OF TURBOT (PSETTA MAXIMA). INTERACTIVE EBOOKS: A TEACHING-LEARNING OPPORTUNITY FOR CLASSROOMS AND STUDENTS. INTERNACIONALIZATION OF HIGHER EDUCATION: BRIDGING THE NORTH AND SOUTH OF MEDITERRANEAN LE VOILE ISLAMIQUE DANS LESPACE EUROPEN UNE FAUSSE QUESTION MECHANISATION AND HUMAN INTERVENTION IN TRANSLATION: EVALUATION OF A MACHINE TRANSLATION OF AN ADMINISTRATIVE DOCUMENT OF THE A.U.TH. MEDICAL WASTES: A GLOBAL PROBLEM AND THE CURRENT LEGAL FRAMEWORK IN GREECE MEDIUM SIZED PORTS AND CITIES IN EUROMED REGION A PROPOSAL FOR THE FUTURE RESEARCH MICROWAVES AS ENERGY SOURCE IN ENGINEERING, INDUSTRIAL AND MEDICAL APPLICATIONS MUSSELS AS BIOMONITORS TO ASSESS ENVIRONMENTAL POLLUTION ONLINE TOOLS IN THE HOSPITAL CLASSROOMS OF THE REGION OF MURCIA OPTIMAL OPERATION OF A WASTE WATER TREATMENT PLANT USING METAHEURISTICS: A DYNAMIC MULTIBOJECTIVE APPROACH OPUNTIA BIOMASS AS BIOSORBENT: CHEMICAL CARACTERIZATION PREDICTORS OF RISK OF LEARNING DISABILITIES PRELIMINARY ISOTOPIC AND CHEMICAL ASSESSMENT OF THE KORONIA LAKE CATCHMENT PROJECT TASKS AND CONNECTING ISSBS WITH FIRMS ISSBS PROMOTING ENTREPRENEURSHIP AS A SOLUTION FOR CRISIS PROSOPON IN THE CONTEMPORARY ART PUBLIC OPINION AND ENVIRONMENT: INFLUENCE OF MEDIA IN PUBLIC OPINION OF SOCIAL PARTNERS IN THE CITY OF GRANADA PUBLIC POLICIES AND TERRITORIAL RESEARCH IN EUROMED NEXT PERSPECTIVES RETINOIC ACID-INDUCED TREACHER COLLINS SEQUENCE WITH TOOTH GERM ABNORMALITIES. EXPERIMENTAL STUDY IN RAT EMBRYOS. RISK SOCIETY AND THE PRESERVATION OF WILD NATURE. THE CASE OF THE GROUP ACTION FOR THE WILD LIFE SEQUENTIAL PATTERNS DISCOVERY IN AMBIENT INTELLIGENCE SOCIAL ADJUSTMENT IN THE CONTEXT OF SOCIAL COMPETENCE IN URBAN GROUPS SOCIAL DEMAND FOR RESTORING MEDITERRANEAN COASTAL LAGOONS SOME CONSIDERATIONS ABOUT THE RD 99/2011, WHICH REGULATES THE PHD PROGRAMS IN SPAIN STUDY OF ELECTRICAL PHENOMENA IN ORGANIC DEVICES: SOLAR CELLS, DIODES, THIN FILM TRANSISTORS THE ARAB SPRING AND THE MEDITERRANEAN COMMON FUTURE, LEARNING FROM PAST 294 295 305 311 321 330 335 343 352 367 375 381 385 395 406 415 424 432 441 449 462 470 477 484 490 498 509 519 527 534 542 548 553

SOUTHERN EUROPEAN DEMOCRATIC TRANSITIONS? THE ARK ON THE WATERS OF THE THRONE THE AUTORITARIAN ENFORCEMENT OF EU ENVIRONMENTAL LAW BY THE EU ORGANS THE CONTAMINATION OF THE BAY OF PORTMAN. PAST, PRESENT AND FUTURE THE EVOLUTION OF BREASTFEEDING IN SOUTHERN SPAIN THE FORGOTTEN CRYSTALS: RECOVERY OF MEMORY AS PROUSTIAN THEORY THE IMPORTANCE OF COMPARATIVE LAW RESEARCH IN THE MEDITERRANEAN SPACE THE POLITICAL MORALITY OF GREEK CHILDREN AND THE READING OF PINOCCHIO TRANSLATED INTO GREEK THE PORTUGUESE TILE IN THE RUDMIN ACCULTURATION LEARNING MODEL: A FUSION CASE THE POSSIBILITIES OF RESEARCH THE CASE OF AL-ANDALUS THE PROCESS OF IMPLEMENTATION OF OFFICIAL MASTERS IN SPAIN THE ROLE OF MEDITERRANEAN DIET IN GERIATRIC PHYSICAL THERAPY THE RULE OF THE APPARENT: THE IMPACT OF FRENCH FASHION IN MURCIA (1759-1808) THE TAX SYSTEM OF THE RADIOACTIVE DISCHARGES IN THE MEDITERRANEAN SEA THE UNIVERSITY RESEARCH AND ITS RELEVANCE FOR THE SOCIETY. PROTECTION AND TRANSFER THERMAL INACTIVATION KINETICS OF LISTERIA MONOCYTOGENES UNDER NONISOTHERMAL CONDITIONS IN A CONTINUOUS HEATING SYSTEM THREE HOUSES AND A MEDITERRANEAN SEA TI/NI-BASED MULTIMETALLIC SYSTEM FOR THE EFFICIENT ALLYLATION OF CARBONYL COMPOUNDS TOWARDS A GREENER ANALYTICAL LABORATORY: USE OF IONIC LIQUIDS IN DISPERSIVE LIQUID-LIQUID MICROEXTRACTION FOLLOWED BY ELECTROTHERMAL ATOMIC ABSORPTION SPECTROMETRY TOWARDS A RELIABLE BCI SYSTEM WITH A LOW COST HEADSET TRANSLATION OF DIAGNOSTIC TOOLS: NORMS IN THE TRANSLATION ACT AND EXAMPLES BY USING TOOLS OF THE QUANTITATIVE LINGUISTICS. TYPOLOGICAL CLASSIFICATION FOR THE WINES ARCHITECTURES IN EUROMED COUNTRIES ULYSSES INTRODUCTION AND PRESENCE IN ITALIAN LITERATURE UNE APPROCHE GOPOLITIQUE DE LA QUESTION DE LEAU EN MDITERRANE TRAVERS LES RIVALITS DE POUVOIRS ENTRE LES DIFFRENTES COMMUNAUTS AUTONOMES DESPAGNE. UP-GRADING OF DISCARDED FISH SPECIES IN THE ALBORAN SEA USE OF A COMMERCIAL LIPASE FOR THE BIOCATALYTIC SYNTHESIS OF POLYGLYCEROL POLYRICINOLEATE USING ENERGY BALANCE MODEL TO UNDERSTAND CLIMATE AND ITS PROCESSES VINEYARD AS AN IDENTITY ELEMENT OF MEDITERRANEAN LANDSCAPES NOTES TO A RESEARCH PROJECT WELFARE AND DISEASES OF FARMED FISH WHAT HAPPENED, HAPPENED. WHAT WILL BE, WILL BE? - A PATH-DEPENDENCY ANALYSIS OF DONATED TOURISM PROJECTS IN SOUTH EAST EUROPE WILD ANIMALS COME INTO THE CLASSROOM! AN INTERDISCIPLINARY ENVIRONMENTAL EDUCATION PROGRAM BY ARCTUROS. 563 569 579 585 593 600 611 618 626 632 637 644 649 654 662 668 680

691 696 704 713 718

730 739 749 764 773 779 787 803

Proceedings of the 4th EMUNI Research Souk

2nd WORLD WAR: BRIDGING THE MEMORIES OF TWO PEOPLES Koutrakis Spyridon (sout1972@yahoo.gr) Theologian, Graduate of the Italian Department of the Aristotle University, Professor of Italian Language Postgraduate Student B year of studies in Literature and Culture (Italian Department) in Aristotle University of Thessaloniki Bika Styliani (stelbika@gmail.com) Graduate of the Italian Department of the Aristotle University Master in Language Didactics, Professor of Italian Language Postgraduate Student B year of studies in Literature and Culture (Italian Department) in Aristotle University of Thessaloniki Tsekreli Olga (olgats76@yahoo.gr) Graduate of the Department of Philology and Philosophy of the University of Padua, Professor of Italian Language Postgraduate Student B year of studies in Literature and Culture (Italian Department) in Aristotle University of Thessaloniki

ABSTRACT Purpose of this notice constitutes the exploitation development of the registration of the personal experiences of people who have acted in a given time, as well as those who came into direct contact and rescued the testimonies and the memories of all those who had participated and which transmuted to words and to art. Based on the memories of Yannis Mperatis, Stratis Myrivilis, Lillika, Nakou, Giorgio Bassani, Angelos Terzakis, Italo Calvino and Nuto Revelli, but that does not mean that they were the only ones, who have experienced the second world war either by having participate actively - even in the first row of the front - or having remained in the rear, we are approaching art who dealt with the specific historical period (paintings, sculptures, drawings). Those writers used as material for their writings their own life stories and conveyed what experienced, desiring to bequeath to the future generations a precious material. The artists from their side other contemporary with the history event and other later of this - keep the memory alive, bridging the common experiences of the two peoples. All this can be a useful tool in the hands of the teacher in the context of the educational activity both in Greece and in Italy. In addition, we have tried to find the answers to a sequence of questions that have arisen during this specific research: - how intersect the painful personal experiences of two independent and sovereign States

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

how these concrete experiences can serve as useful tools in education at all levels how the use of those experiences is converted to image and emotion through art, in order to bridge the memories of two peoples. Moving towards such a direction, therefore, we are also introducing the interdisciplinary function of this educational activity, which involves the sciences of History, Art, Political Sciences and of course Philology.

Keyword: interdisciplinarity, teaching, art, literature, 2nd World War

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The 2nd World War and especially the Greek-Italian conflict of 1940 - 1941 was a tragic experience in the history of the two peoples through the centuries. The official history has been assigned to register what actually happened at the time, helping thereby to create a national consciousness of each nation. However, the preservation of the memory of those events, undertake (history apart) literature and art which reflect in a subjective way the events due to the influence of the personal perceptions, the experiences and the believes that every creator carries inside of existence, but also because of the conditions laid down by those who assign projects in the case of visual arts. Moreover, as George Freris mentions 1, history consists a cell of literature, which enriches with a number of items and situations, while the literature on its behalf, contributes to the recognition of history in the collective consciousness. This interaction, coupled with works of art, will cross-check the painful experiences of two peoples, Greeks and Italians in our case. The writers Yannis Mperatis, Stratis Myrivilis, Lillika, Nakou, Giorgio Bassani, Angelos Terzakis, Italo Calvino and Nuto Revelli, wanted to communicate their messages through the narration of the personal experiences of both war events lived, and everyday life. Each author within the narrative organization of its speech, presents a series of events, plots, actions and reactions in order to reach the desired result. Speaks differently but essential. Talks about war operations and military events. Shows the details, the facts of life, the various episodes that have experienced those left behind the lines. This way the atmosphere of the era gets encourage in an excellent way, laying down many of the human aspects of the drama, developing advanced interpretations and simulated live performances and events. So the reader is "obliged" to reflect critically on the same historical event through political ideologies, interests, concerns and responsibilities, if desires to stay in constant spiritual awareness through those experiences of his. The authors with their work confirm that the literature is part of social chain which compacts the society. The literary language has the potential to cause reactions, likes and dislikes, to criticize the social evolution, to give cause for thought, to question or even to be incorporated into the system willing to change it, to fight it, to fix it or improve it. According to Italo Calvino 2:

[] , (. ) , , , ,

Freris G. 2003. . In Dia-Keimena, Annual Edition of the Laboratory of Comparative Litterary History of Aristotle University of Thessaloniki. 5. Thessaloniki.
2

Calvino I. 2005. . Athens: Kastaniotis, p.34.

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

and also Lillika Nakou 3:

, .

, ! , , , ; , , , . ,

while Terzakis exclaims 4:

the time during which the Revelli 5 admits that: Sanno [the alpinists] che dalla guerra hanno tutto da perdere e nulla da guadagnare. And arrives Myrivilis 6 to show what a waste with an image:
, . , [] [] ,

History is the narration of acts of people and not of demigods and in order to provide beneficial lessons must be telling the truth with all its imperfections and meannesses man possess and reflect on his works 7. Through the reflection of remembrance that is left from these people (calendars, memoirs, official files etc.) but also with the advantage offered by time distance, nowadays we have the opportunity, recreating the era through the pages of literary books, to pass by the shame of defeat standing with courage and honesty in front of all those who have fulfilled their duty and from both sides. Art expresses ideas and emotions, giving the opportunity for people to converse with each other, to express the various aspects of their culture, to come closer and to bridge gaps 8. In our case, a series of works of art in Greece as well as in Italy perform the triple purpose of preserving the memory of the event, rendering honors to the fallen and acting in a disincentive way for the future being harsher in the value of peace. Such works of art are:

Nakou L. 2006. . Athens: Hestia, p. 47. Terzakis A. 19--?. , . Athens: Hestia, p. 92. 5 Revelli N. 2005. Le due guerre, Guerra fascista e guerra partigiana. Torino: Einaudi, p. 71. 6 Mirivilis S. 1959. To : . Athens: Hestia, p. 142. 7 Tservi . 1967. . Athens: Alvin Redman Hellas, p. 10. 8 Papanoutsos E. 2003. . Athens: Noisi, pp. 21-22.
3 4

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The monument for the fallen of 2nd World War in S. Angelo di Gatteo. The monument is intended to be a hymn to life, while underlining how fragile the authoritarian regimes are. Those concepts exactly capture the sculptural form, by the pigeons flying in the sky, while the whole upward movement refers directly to the liberation of Italy. It exalts life and celebrates

for the freedom gaine


(Monumento ai Caduti Civili della Seconda Guerra Mondiale, S. Angelo di Gatteo (FC) Italy, 2005, Studio Manzi e Zanotti Designers)

Particular reference should be made to the Monument of the fallen Italians, which has not been set up on the Italian territory, but on the Greek island of Kefalonia in order to honor the thousands of Italians who fell from the Germans after refusing to lay down theirarms. The monument is a tribute to those who did not want to surrender and were sacrificed in one of the worst wars and especially during one of the most inhuman battles that took place on the island.

10

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

While most of the monuments venerate the memory of those soldiers sacrificed in the battlefields for the defense of the homeland, similar treatment is reserved for everyday heroes as witnesses the work of Kostas Dompoulas under commission of Ipirotiki Hestia. The artwork is titled Ipeirotissa and can be admired close to the White Tower of Thessalonki, Greece.

Kostas Dompoulas (Ipeirotissa, 2,20m, bronze, 1983 Thessaloniki, Greece)

Respectively by Roberto Russo the work titled Resistenza

(La Resistenza, acrilic and string on canvas, Palazzo del Quirinale, Rome, Italy)

11

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

and by Arturo Maggio with his La seconda Guerra mondiale uphold the memory of that period for the Italian side.

(La seconda Guerra mondiale, tempera on canvas, Palazzo del Quirinale, Rome, Italy)

From the Greek side, the work of sculptor Lazarus Lameras dominates the battlefield in Kalpaki, where stands the statue in honor to hero soldier, or the unknown soldier.

(Hero soldier or Uknown soldier, 5,5m, bronze, 1966, Kalpaki Greece)

The painter Alexandros Alexandrakis with his Aera wanted to immortalize on a portray the Greek soldiers to advance on the Albanian mountains. Due to a frontal attack scene, one of

12

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

the most representative of the painter, and to the excellent organization of synthesis, is achieved the perfect impression of the epic spirit which dominated on the Albanian front.

(Aera, oil on canvas, 1.10x1,50cm, 1967, private collection)

The contribution of all of the above is not disputed in everyday life, but equally important is the role they play in the educational activity. The modern school needs to have as a base the full development of the personality of the young man, therefore not only aims at the acquisition of knowledge and information which will become its qualifications to find a profession but also will cultivate him in an emotional and humanistic way leading him to acquire aesthetic experience. The combination of these will help the student to become aware of itself and be integrated smoothly in a multicultural and ever-changing society 9. The education based on knowledge is well-grounded. The course of memory in historical events, either individually or collectively it takes place always affects the creation of the necessary national maturity 10 and maintains images, activates emotions, forms consciences. Rises the interest and helps in the sensitization of the pupil who is viewer reader simultaneously. This way a young person is being created cultivated mentally and morally who acquires the skills to become an active citizen who will participate consciously in the public affairs and will criticize and in the meantime will be able to communicate in different cultural environments, to formulate and to exchange views, thus promoting the dialogue and the development of civilization. In accordance with what Howard Gardner 11 writes in his book Art Education and Human Development and what the Syllabus 12 for the teaching of literature in Greece defines, we can understand that through the reading of a literary text and the observation of the work of art:

Papanoutsos E. 2003. . Athens: Noisi, p.14. allerghis . . 1990. . In Diadromes 18: 87-88. 11 Gardner . 1990. Art Education and Human Development. California: The Getty Institute for the Arts. Los Angeles.
9 10

13

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

universal values are being expressed and the people realize who they really are,

a mental and emotional experience, sometimes painful, is offered, that will lead to a correct interpretation of the facts, the representation of reality filtered by the author or the artist is being accomplished presenting the ideas, the values and the beliefs of the period to which they relate, our perceptions and ideas about the world and life are being aroused.

With the exploitation of works of art during tuition, is carried out a global approach to humanitarian and social content courses such as history, social and political education, religious 13. Fiction writers, artists and historians, in its own way, contribute to the not abatement of the memory for everything lived themselves and thousands of people in both Nations. Because it is meaningful that the memories of that era revive and survive so that people not to forget but continue to live, work and create in assimilating what is foreign.

12

http://www.pi-schools.gr/download/programs/depps/4deppsaps_Logotexnias_Gymnasiou.pdf Voros F. 1995. . In Ta Ekpedeytika 37 : 193-21.

13

14

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Calvino I. 2005. . Athens: Kastaniotis. Freris G. 2003. . In Dia-Keimena, Annual Edition of the Laboratory of Comparative Litterary History of Aristotle University of Thessaloniki. 5. Thessaloniki. Gardner . 1990. Art Education and Human Development. California: The Getty Institute for the Arts. Los Angeles. allerghis . . 1990. . In Diadromes 18: 87-88. Mirivilis S. 1959. To : . Athens: Hestia. Nakou L. 2006. . Athens: Hestia. Papanoutsos E. 2003. . Athens: Noisi. Revelli N. 2005. Le due guerre, Guerra fascista e guerra partigiana. Torino: Einaudi. Rigopoulos G. 1989. ;. In Ikastiki pedia 6: 34-40. Terzakis A. 19--?. , . Athens: Hestia. Tservi . 1967. . Athens: Alvin Redman Hellas. Voros F. 1995. . In Ta Ekpedeytika 37 : 193-21.

Sites (date of access 5/4/2012)

http://www.pi-schools.gr/download/programs/depps/4deppsaps_Logotexnias_Gymnasiou.pdf http://www.phorum.gr/viewtopic.php?f=45&t=123868&start=20http://www.phorum.gr/viewt opic.php?f=45&t=123868&start=20

http://prasinosmperes.gr/gr/content/&tid=117 http://www.quirinale.it/qrnw/statico/artecultura/mostre/2011_SantEgidio/immaginihtm/3_big.htm http://www.quirinale.it/qrnw/statico/artecultura/mostre/2011_SantEgidio/immaginihtm/5_big.htm

http://www.nhmuseum.gr/details2.php?lang=1&wh=1&the1id=1&the2id=7&the3id=23&thei d=28&open1=1&open2=7&open3=23&thepid=327&page=2

15

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

A COMPARISON OF LIQUID-LIQUID MICROEXTRACTION METHODS BASED ON DISPERSIVE, ULTRASOUND-ASSISTED EMULSIFICATION AND SINGLEDROP COUPLED TO LIQUID CHROMATOGRAPHY FOR DETERMINATION OF BENFOTHIAMINE Mara Bravo-Bravo, Pilar Vias, Ignacio Lpez-Garca and Manuel Hernndez-Crdoba Department of Analytical Chemistry, Faculty of Chemistry, Regional Campus of International Excellence Campus Mare Nostrum, University of Murcia, Spain mabb3@um.es

ABSTRACT A comparison was carried out using three procedures based on Liquid-Liquid Microextraction (LPME) for determination of benfothiamine (BT), Dispersive Liquid-Liquid Microextraction (DLLME), Ultrasound Assisted Emulsification Microextraction (USAEME) and Directly Suspended Drop Microextraction (DSDME). Best results were obtained by using DLLME coupled to liquid chromatography (LC) with fluorimetric detection. The sample was submitted to an enzymatic hydrolysis step using alkaline phosphatase. Then, a derivatization by chemical oxidation with ferricyanide at pH 13 to form fluorescent thiochrome was carried out. For DLLME, 0.5 mL of acetonitrile containing 90 L of 1,1,2,2-tetrachloroethane was rapidly injected into 10 mL of a sample solution containing 24% sodium chloride. Phase separation was carried out by centrifugation, and the sedimented phase was submitted to LC. The mobile phase was 90% 10 mM KH2PO4 (pH 7) solution and 10% acetonitrile at 1 mL min-1. The calibration graph was obtained using aqueous standards. The main advantage of the method is that, while direct injection of thiochrome cannot be carried out due to the high alkalinity of the extract, the use of DLLME permits a lower detection limit and provides a non-corrosive extract of BT. Keywords: Dispersive liquid-liquid microextraction, Liquid chromatography, Fluorescence detection, Benfothiamine, Nutraceuticals

16

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION Benfothiamine (BT) or S-benzoylthiamine O-monophosphate is a synthetic derivative of thiamine (vitamin B1) which, after absorption, may be dephosphorylated by cells in an enzymatic process, giving liposoluble BT. Its absorption and biodisponibility are higher (5-25 fold) than those of vitamin B1 and it is used as palliative for thiamine nutritional deficiencies (Gilman et al. 1990) and to inhibit the formation of advanced glycation endproducts (AGE), important for diabetics (Balakumar et al. 2010). The last advances on nutrition science are introducing new terms such as nutraceuticals and nutricosmetics. These products use natural ingredients, usually extracted from plants or fruits, minerals and vitamins. Liquid chromatography (LC) is a powerful analytical technique that can be used as a confirmation method or screening test for drugs, excipients, additives and contaminants from the raw material, pharmaceuticals or nutraceuticals to ensure quality and safety (Velagaleti et al. 2003). The sample preparation is a complex analytical step and the future is linked to the research and development of new analytical methods. Liquid-phase microextraction (LPME) includes several miniaturized techniques based on the extraction of the analytes into a liquid phase (Nern et al. 2009). Dispersive liquidliquid microextraction (DLLME), which is based on the use of a ternary solvent system, saves time and decreases the use of organic solvents, favouring its inclusion in the list of clean procedures (Cruz-Vera et al. 2011, Rezaee et al. 2006, 2010). Benfothiamine has mainly been determined using pharmacological methods (Balakumar et al. 2008, Snchez-Ramrez et al. 2006), and very few analytical techniques have been proposed using LC (Hoshino et al. 1984, Poongothai et al. 2010, Salem 2010). As regards to the new green sample preparation techniques, DLLME has only been applied for the determination of thiamine and its esters in different types of food (Vias et al. in press). However, no reference has been found to the coupling of LC and DLLME for BT determination. Consequently, this contribution represents the first study of BT using green chemistry principles to develop a miniaturized sample treatment procedure based on DLLME coupled to reversed-phase LC. A comparison with other LPME methods as USAEME and SDME was also carried out. Detection was performed using an enzymatic hydrolysis step followed by precolumn fluorescence derivatization involving oxidation to the highly fluorescent thiochrome. 2. ANALYTICAL PROCEDURE Samples were first submitted to an enzymatic hydrolysis step. Amounts of 0.02-0.5 g were weighed, diluted to 100-mL in a volumetric flask and filtered using a PVDF 0.45 m filter. An aliquot of 100 L was introduced into an amber 15-mL screw cap glass tube and 1 mL of

17

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

10 mM KH2PO4 buffer solution (pH 7), 25 units of ALKP and 3 mL of pure water were added. The sample was incubated in a block with magnetic stirring at 55 C for 2 h in the absence of light. Then, the sample was cooled and transferred to a 10-mL volumetric flask. For DLLME, the 10 mL aliquot submitted to enzymatic hydrolysis was placed in a 15-mL screw cap glass tube with conical bottom. Volumes of 2 mL of a 2 M sodium hydroxide solution and 50 L of 0.01 M potassium ferricyanide were added for derivatization and the mixture was vortex shaken. Sodium chloride was added to reach a 24% m/v concentration. Then, 0.5 mL of acetonitrile containing 90 L of 1,1,2,2-tetrachloroethane was rapidly injected into the sample solution using a micropipette, and the mixture was again gently shaken manually for several seconds. A cloudy solution consisting of very fine droplets of tetrachloroethane dispersed through the sample solution was formed, and the derivatized thiochrome was extracted in the fine droplets. After centrifugation for 1 min at 4000 rpm, the extraction solvent was sedimented at the bottom of the conical tube (the volume was about 40 L). Twenty microlitres of the sedimented phase were removed with a microsyringe and injected into the LC using as mobile phase a 90/10 (v/v) mixture of 10 mM KH2PO4 (pH 7)/acetonitrile at a flow-rate of 1 mL min-1. The analytical column used for the reversed-phase technique was a Discovery RP-AmideC16 (15 cm x 0.46 cm x 5 m). The fluorescence detector operated at an excitation wavelength of 375 nm and an emission wavelength of 438 nm. 3. OPTIMIZATION OF THE METHOD For the determination of BT, a prior enzymatic hydrolysis step was necessary to achieve dephosphorylation using alkaline phosphatase (ALKP). The parameters influencing the hydrolysis, namely pH, enzyme and substrate concentration, and both the temperature and time of the incubation step, were optimized (Fig. 1). Optimal values were pH 7, enzyme concentration 25 units, substrate concentration 1 g mL-1, incubation temperature 55 C and incubation time 2 h. [Include Figure 1] The oxidation to thiochrome is a very efficient, simple and fast derivatization reaction that produces a highly fluorescent derivative. An alkaline medium is needed for the reaction, and the optimal conditions were pH 13 (obtained by adding 2 mL of 2 M NaOH solution) and oxidant concentration 5x10-4 M. Separation using an amide-based stationary phase with trimethylsilyl endcapping was used. The optimal composition of the mobile phase was studied using several phosphate buffers at pH values ranging from 4 to 8 and phosphate concentrations in the 10-50 mM range. The addition of acetonitrile was assayed in an attempt to decrease the retention of thiochrome. The

18

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

best separation was achieved using a mixture (90% v/v) of 10 mM KH2PO4 buffer solution (pH 7) and 10% v/v acetonitrile. The flow-rate was 1 mL min-1. The parameters affecting the DLLME procedure, namely the type and volume of both the extraction and disperser solvents, the addition of salt and the centrifugation time, were optimized. 10 mL of an aqueous solution or a sample containing 100 ng mL-1 BT and the derivatizing reagents were submitted to DLLME. In this way, a 10 mL sample volume was concentrated into a 40 L fraction, which implied a preconcentration factor close to 250. The extraction solvent must have a higher density than water, low solubility in the same, a high extraction capacity and good chromatographic behaviour. Thus, the halogenated hydrocarbons were selected and Fig. 2A shows that the best extraction efficiency was obtained using 1,1,2,2-tetrachloroethane. The disperser solvent must be miscible with both the extraction solvent and the aqueous phase. Acetone, methanol and acetonitrile were assayed and the extraction efficiency was higher when using acetonitrile (Fig. 2B). The volume of the extractant solvent strongly affects the preconcentration factor and was studied in the 40 to 120 L range. Peak areas increased with increasing extraction solvent volumes in the range 40-90 L. On further increasing the volume of extraction solvent, peak areas decreased as a consequence of dilution, and so 90 L was selected (the volume of the sedimented phase was 40 10 L after extraction and centrifugation). The volume of the disperser solvent directly influences the formation of the cloudy solution, the degree of dispersion of the extraction solvent in the aqueous phase and, consequently, the extraction efficiency. The variation of this volume modifies the volume of the sedimented phase. Thus, the volumes assayed for the disperser solvent were 0.25-2 mL. Highest sensitivity was attained with 0.5 mL of acetonitrile. The effect of the amount of sodium chloride was studied between 0 and 24% m/v and sensitivity was higher for a 24% m/v concentration. The centrifugation time and speed, necessary to disrupt the cloudy solution and collect the sedimented phase were evaluated. A centrifugation time of 1 min and a speed of 4000 rpm were selected. [Include Figure 2] 4. ANALYTICAL CHARACTERISTICS AND VALIDATION The method was validated for linearity, detection and quantification limits, selectivity, accuracy and precision. The calibration curve using DLLME was obtained by least-squares linear regression analysis of the peak area versus benfothiamine concentration, using six levels in duplicate. The calibration parameters were ordinate 1.240.048, slope 0.2870.003 mL ng-1 and correlation coefficient 0.9998. The limit of detection (LOD, calculated as three times the standard error of the estimate) was 0.8 ng mL-1. The selectivity of the method was judged from the absence of interfering peaks at the BT elution time for blank chromatograms. No matrix compounds existed that might give a false positive signal in the blank samples. The

19

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

repeatability was calculated by using the relative standard deviation from a series of ten consecutive DLLME-LC analyses of an aqueous standard solution containing 10 ng mL-1 BT. A RSD value of 2.8 % was obtained. The matrix effect was studied by comparing the slopes of aqueous standards and standard additions calibration graphs for the different nutraceuticals, obtained by plotting concentration (at six different levels) against peak area and following linear regression analysis. A statistical paired t-test was carried out, and the p values obtained were in all cases higher than 0.05. Consequently, the matrix effect was discarded and calibration can be carried out using aqueous standards. The proposed method was applied to the determination of BT in three nutraceuticals of different characteristics. Table 1 shows the results obtained by the DLLME-LC procedure, as well as the contents declared by the manufacturer. To test the accuracy of the method, the nutraceuticals were fortified and analyzed, taking into account the known BT contents for these samples. An average recovery SD (n=9) of 96 8 was obtained. [Include Table 1] 5. CONCLUSIONS The determination of benfothiame in nutraceuticals can be carried out using a miniaturized preconcentration procedure based on DLLME coupled to LC with fluorescence detection. Very low quantities of organic solvent were needed, and so the procedure can be regarded as environmentally friendly. Furthermore, it avoids the inconvenience of the direct injection of thiochrome, which cannot be carried out due to the high alkalinity of the extract. The absence of a matrix effect allows calibration using aqueous standards, and low detection limits were obtained.

20

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCES Balakumar, P., Sharma, R. and Singh, M. 2008. Pharm. Res. 58: 356. Balakumar, P., Rohilla, A., Krishan, P., Solairaj, P. and Thangathirupathi, A. 2010. Pharmacol. Res. 61: 482. Cruz-Vera, M., Lucena, R., Crdenas S. and Valcrcel, M. 2011. Anal. Methods. 3: 1719. Gilman, A.G., Rall, T.W., Nies, A.S. and Taylor, P. 1990. Goodman and Gilman's the pharmacological basis of therapeutics, 8th ed., Pergamon Press, New York, USA. Hoshino, T., Senda, M., Hondo, T., Saito M. and Tohei, S. 1984. J. Chromatogr. A. 316: 473. Nern, C., Salafranca, J., Aznar M. and Batlle, R. 2009. Anal. Bioanal. Chem. 393: 809. Poongothai, S.,Ilavarasan R. and Karrunakaran, C.M. 2010. lnt. J. Pharm. Pharmaceut. Sci. 2: 133. Rezaee, M., Assadi, Y., Milani Hosseini, M.R., Aghaee, E., Ahmadi F. and Berijani, S. 2006. J. Chromatogr. A. 1116: 1. Rezaee, M., Yamini, Y. and Faraji, M. 2010. J. Chromatogr. A. 1217: 2342. Salem, H. 2010. Chromatographia. 72: 327. Snchez-Ramrez, G., Caram-Salas, N., Rocha-Gonzlez, H., Vidal-Cantu, G., MedinaSantillan, R., Reyes-Garca G. and Granados-Soto, V. 2006. Eur. J. Pharm. 530: 48. Velagaleti, R., Burns, P. and Gill, M. 2003. Drug Inform. J. 37: 407. Vias, P., Lpez-Garca, I., Bravo-Bravo M. and. Hernndez-Crdoba, M. Anal. Bioanal. Chem. In press.

21

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

TABLE Table 1 Benfothiamine content in nutraceuticals Samplea BT foundb, mg/capsule Terraternal BT 189 12 Smart BT 80.1 0.2 Rehab BT 12.5 0.5
b a

BT declared, mg/capsule 200 80 12.5

Mean standard deviation, n=3 Nutraceuticals contained among others: vitamin C, aminoacids, curcumine, pomegranate extract, ginger root, rice flour, cellulose, magnesium stearate, silicon dioxide

FIGURES

Fig. 1. Influence of the enzyme concentration (A) and the incubation time (B) on the enzymatic hydrolysis step. Concentration of BT, 100 ng mL-1

22

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Fig. 2. Influence of different extraction solvents (A) and disperser solvents (B) on the determination of BT by DLLME. Concentration of BT, 100 ng mL-1

23

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

A GREEN PRECONCENTRATION TECHNIQUE PREVIOUS TO LIQUID CHROMATOGRAPHY FOR NEONICOTINOID INSECTICIDES QUANTIFICATION IN WATER SAMPLES Gema Frez Melgarejo, Natalia Campillo, Pilar Vias and Manuel HernndezCrdoba* Department of Analytical Chemistry, Faculty of Chemistry, Regional Campus of International Excellence Campus Mare Nostrum, University of Murcia, E-30071 Murcia, Spain e-mail: gemaferez@um.es

ABSTRACT This paper proposes a liquid-liquid microextraction (DLLME) technique for the determination of five neonicotinoid insecticides (thiamethoxam, clothianidin, imidacloprid, acetamiprid and thiacloprid) in waters of different procedence. DLLME was performed by adding a mixture containing 100 L of chloroform (as extraction solvent) and 1.5 mL of acetonitrile to 10 mL of the sample, to which 1 g of sodium chloride was added except in the case of seawaters, forming a cloudy solution. The settled phase obtained after centrifugation of the mixture was evaporated to dryness and reconstituted in 50 L of acetonitrile, an aliquot of 20 L being submitted to reversed-phase liquid chromatography (LC) with photodiode array detection (DAD). Because the salt content in the aqueous phase affected the extraction efficiency for DLLME, seawater samples were quantified against external aqueous standards prepared in the presence of 3.5% m/v NaCl, whereas for the rest of water samples a 1.0% m/v salt was used. Detection limits in the range 14 - 48 ng L-1, depending on the sample analysed and the compound, were obtained. None of the samples analysed was found to contain residues at concentrations higher than the corresponding detection limits for each insecticide. This simple, accurate, sensitive and selective method can be used in the determination of trace levels of the five insecticides studied in water samples. Keywords: Neonicotinoid; Insecticides; Water; Dispersive liquid-liquid microextraction (DLLME); Liquid chromatography (LC).

24

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION Neonicotinoids are a group of insecticides with a wide range of chemical and biological properties, consequently they are used throughout the world for crop protection and in veterinary medicine (Maienfisch et al. 2001). These compounds act as agonists at the insect nicotinic acetylcholine receptor, leading to insect paralysis and death. The broad spectrum insecticidal activity, low application rates, mode of action and low toxicity for vertebrates, means that they account for about 15-20% the world insecticide market, imidacloprid being the most sold insecticide (Xu et al. 2006). Nevertheless, the results obtained in recent toxicological studies have suggested thiamethoxam and imidacloprid may have negative effects on human health (Green et al. 2005; Duzguner and Erdogan 2010). When a pesticide is sprayed over crop fields, directly applied to soil or released to the environment, it can reach the water by runoff or leaching through the soil. The concentration levels of pesticide residues in drinking water are obviously of public concern. The European Union Directive on water quality establishes the maximum concentration admissible for pesticides in 0.1 g L-1 for each individual substance and 0.5 g L-1 for the sum of pesticides, including their metabolites (Council Directive 1998). Liquid chromatography (LC) is the method of choice for neonicotinoid analysis because direct GC analysis is not suitable considering the thermolability and polarity of these chemicals. Although several methods have been published for the determination of neonicotinoids in different matrices, few of them are dealing with waters (Ying and Kookana 2004; Seccia et al. 2005; Zhou et al 2006; Starner and Goh 2012; Wang et al 2012). Sample enrichment techniques have to be included in the whole procedure in order to reach the low detection limits required for the analysis of waters. In this sense, solid-phase extraction (SPE) has been the most used technique (Ying and Kookana 2004; Seccia et al. 2005; Zhou et al. 2006; Starner and Goh 2012). Immunoassays have also proven as alternative methods for the determination of neonicotinoids in water samples (Li and Li 2000; Kim et al. 2003; Kim et al. 2006). Environmentally friendly sample preparation techniques have replaced classical methods, because extraction can be performed rapid and directly, without organic solvent, and even can be easily automated. Dispersive liquid-liquid microextraction (DLLME) has been successfully applied for the extraction and preconcentration of different organic compounds in aqueous samples (Rezaee et al. 2006; Zgoa-Grzekowiak and Grzekowiak 2011) but, as far as we know, it has not been applied for the determination of neonicotinoid insecticides in water samples, corresponding to the aim of the present work using LC with diode-array detection (DAD). 2 SAMPLES AND ANALYTICAL PROCEDURE Eight seawater samples were obtained from several harbours and beaches of southeast of Spain. Five river water samples, three tap water and three mineral water samples were

25

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

analysed. For DLLME, 10 mL of sample were placed in a 15 mL screw cap glass centrifuge tube with conical bottom where 1 g of NaCl has been previously weighted. No salt was added to seawater samples. A mixture containing 100 L CHCl3 and 1.5 mL acetonitrile was rapidly injected into the aqueous solution using a syringe, forming a cloudy solution. After extracting for few seconds, the mixture was centrifuged for 2 min at 4000 rpm and the organic droplets were sedimented at the bottom of the conical tube, being transferred to a 2-ml vial by means of a 100-L syringe and then evaporated to dryness with a mild nitrogen stream. The residue was dissolved in 50 L of ACN and 20 L was injected in the LC-DAD system, where the analytes were separated on a Spherisorb ODS2 column (150 mm x 4 mm, 5 m). The mobile phase consisted on a gradient programme: 8 min isocratic elution with 10:90 ACN:phosphate buffer, 7 min linear gradient to 25:75, maintained for 7 min. The mobile phase flow-rate was 1 mL min-1. The retention times of the insecticides are included in Table 1, as well as the absorption wavelengths used to monitorize each compound. [Table 1 here] 3 OPTIMIZATION OF THE DLLME Preliminary experiments were carried out in order to optimize the DLLME procedure using 10 mL of an aqueous standard solution containing the analytes at 50 ng mL-1. When extraction solvents of higher density than water were assayed, they accumulated rapidly at the bottom of the conical tube and were ease to collect. CCl4, CHCl3, CH2Cl2 and C2H2Cl4 were considered as extractants. Best recoveries were obtained with CHCl3 using 1.5 mL of ACN as disperser. In order to study the effect of the extraction solvent volume, 1.5 mL ACN containing different volumes of CHCl3 (50 - 200 L) were submitted to the DLLME procedure, while other experimental conditions were kept constant. By increasing the volume, sensitivity of all analytes increased up to 100 L and then remained constant or slightly decreased as consequence of a dilution effect. Consequently, 100 L were used. The influence of ionic strength was evaluated at 0-30% (m/v) NaCl concentrations in the aqueous phase. Concentrations higher than 20% (m/v) could not be used because the organic phase did not settle. A slight increase of sensitivity was observed for thiametoxan, clothianidin and imidachloprid when NaCl concentration increased up to 20% (m/v), the contrary effect was attained for acetamiprid and thiacloprid. Therefore, a 10% (m/v) was selected as a compromise value. To evaluate the influence of the pH in the aqueous phase, pH was adjusted to values ranging between 3 and 8 with a 0.01 M phosphate buffer solution. The volume of the sedimented organic solvent did not vary and no significant differences in the analytical signal were appreciated for the target analytes. Consequently, samples were analyzed without pH adjustment.

26

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Mixture of extractant, disperser and the aqueous phase were manually shaken for different times between a few seconds and 5 min, before submitting the mixture to centrifugation for 5 min at 4000 rpm. Similar peak areas were obtained in all cases, indicating that the DLLME procedure was practically time-independent, this being one of the most important advantages of the technique. Neither the volume of the sedimented phase nor sensitivity for the analytes changed when samples were centrifuged for different times in the interval 1-10 min at 4000 rpm, or at different centrifugation speed ranging from 2000 to 6000 rpm for 2 min. The centrifugation conditions adopted were 4000 rpm and 2 min. 4 ANALYTICAL CHARACTERISTICS The linear concentration ranges were 0.2-100 ng mL-1 for acetamiprid and thiacloprid and 0.5100 ng mL-1 for the rest of compounds. Seawaters were quantified against aqueous external standards prepared with a 3.5% m/v NaCl concentration, whereas the quantification of the rest of samples was carried out against aqueous external standards containing 1% m/v salt. Table 2 shows the slopes and intercepts obtained for aqueous calibration graphs using standards with 1% (m/v) salt. Correlation coefficients were in all cases higher than 0.996. The detection limits were calculated on the basis of three times the standard deviation of the intercept of the calibration graphs (Table 2). The quantification limits, calculated on the basis of ten times the standard deviation of the intercept of the calibration graphs, ranged between of 80 and 160 ng L-1, depending on the compound, for seawater samples and between of 50 and 115 ng L-1, for the rest of water samples analyzed. The repeatability was calculated using the relative standard deviation of the peak areas for ten successive analysis of a river water and a seawater fortified at a concentration level of 10 times the quantification limit of each compound (Table 2). [Table 2 here] 5 ANALYSIS OF THE SAMPLES AND METHOD VALIDATION None of the samples analysed contained the neonicotinoid insecticides at least above the corresponding detection limits. Therefore, the samples analysed accomplished with the EU Directive on water quality. The reliability of the procedure was checked by recovery studies for two seawaters, two river waters and one tap water spiked at two concentration levels, corresponding to 10 and 25 times the corresponding quantification limits, and analysed by duplicate. An average recovery S.D. (n=100) of 98.2 4.7 was obtained. 6 CONCLUSION An accurate and reliable method for the determination of five neonicotinoid insecticides in waters based on DLLME-LC-DAD has been developed. The proposed method has many practical advantages, including low sample consumption (10 mL), rapidity considering that

27

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

the extraction by DLLME is instantaneous, and the simplicity of the equipment used. Moreover, the use of a microextraction technique catalogued as environmentally friendly, is of a great interest considering the importance of the green analytical chemistry as actual tendency for sample treatment.

28

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Council Directive 98/83/EC of 3 November 1998 on the quality of water intended for human consumption. Duzguner, V., and Erdogan, S. 2010. Accute oxidant and inflammatory effects of imidacloprid in the mammalian central nervous system and liver in rats. Pest. Biochem. Physiol. 97:13-18. Green, T., Toghill, A., Lee, R., Waechter, F., Weber, E., Peffer, R. Noakes, J., and Robinson, M. 2005. Thiametoxam induced mouse liver tumors and their relevance to humans. Part 2: Species differences in responses. Toxicol. Sci. 86:48-55. Kim, H.J., Liu, S.Z., Keum, Y.S. and Li, Q.X. 2003 Development of an enzyme-linked immunosorbent assay for the insecticide thiamethoxam. J. Agric. Food Chem. 51: 1823-1830. Kim, H.J., Shelver, W.L., Hwang, E.C., Xu, T., and Li, Q.X. 2006. Automated flow fluorescent immunoassay for part per trillion detection of the neonicotinoid insecticide thiamethoxam. Anal. Chim. Acta 571: 66-73. Li, K., and Li, Q.X. 2000. Development of an. enzyme-linked immunosorbent assay for the insecticide imidacloprid. J. Agric. Food Chem. 48: 3378-3382. Maienfisch, P., Huerlimann, H., Rindlisbacher, A., Gsell, L., Dettwiler, H., Haettenschwiler, J., Sieger, E., and Walti, M. 2001. The discovery of thiamethoxam: a secondgeneration neonicotinoid. Pest Manag. Sci. 57:165-176. Rezaee, M., Assadi, Y., Hosseini, M.R.M., Aghaee, E., Ahmadi, F., and Berijani, S. 2006. Determination of organic compounds in water using dispersive liquidliquid microextraction. J. Chromatogr. A 1116:1-9. Seccia, S., Fidente, P., Attard Barbini, D., and Morrica, P. 2005. Multiresidue determination of nicotinoid insecticide residue in drinking water by liquid chromatography with electrospray ionization mass spectrometry. Anal. Chim. Acta 553:21-26. Wang, W.N., Li, Y.P., Wu, Q.H., Wang, C., Zang, X.H., and Wang, Z. 2012. Extraction of neonicotinoid insecticides from environmental water samples with magnetic grapheme nanoparticles as adsorbent followed by determination with HPLC. Anal. Meth. 4:766772. Xu, T., Jacobsen, C.M., Cho, I.K., Hara A.H., and Li, Q.X. 2006. Application of an Enzymelinked Immunosorbent Assay for the Analysis of Imidacloprid in Wiliwili Tree, Erythrina sandwicensis O. Deg, for Control of the Wasp Quadrastichus erythrinae. J. Agric. Food Chem. 54:8444-8449. Ying, G.G. and Kookana, R.S. 2004. Simultaneous determination of imidacloprid, thiacloprid, and thiamethoxam in soil and water by high-performance liquid chromatography with diode-array detection. J. Environ. Sci. Health Part B 39:737-746. Zgoa-Grzekowiak, A., and Grzekowiak, T. 2011. Dispersive liquid-liquid microextraction. Trends Anal. Chem. 30:1382-1399.

29

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Zhou, Q., Ding, Y., and Xiao, J. 2006. Sensitive determination of thiamethoxam, imidacloprid and acetamiprid in environmental water samples with solid-phase extraction packed with multiwalled carbon nanotubes prior to high-performance liquid chromatography. Anal. Bioanal. Chem. 385, 1520-1525.

30

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 1 Characteristics of insecticides Compound Molecular formula Thiamethoxam C8H15ClN5O3S Clothianidin C6H8ClN5O2S Imidacloprid C9H10ClN5O2 Acetamiprid C10H11ClN4 Thiacloprid C10H9ClN4S

Water solubility, M (pH 7, 25 C) 1.5 x 10-3 0.22 4.7 x 10-3 2.2 x 10-3 1.9 x 10-4

Wavelength, nm 253 270 270 245 245

Retention time, min 9.61 12.81 14.38 16.36 19.15

Table 2 Analytical characteristics of the proposed method Compound Slopea, mL ng-1 Intercepta Detection RSDc, % RSDd, % limitb, ng L-1 Thiamethoxam 3.612 0.090 0.22 0.03 25 (35) 5.0 4.2 Clothianidin 3.025 0.065 -0.32 0.03 30 (48) 5.8 3.3 Imidacloprid 3.560 0.059 0.51 0.04 34 (45) 4.5 3.1 Acetamiprid 6.730 0.042 -0.98 0.04 18 (27) 2.6 2.0 Thiacloprid 6.304 0.062 1.04 0.03 14 (25) 3.1 2.2 a b Mean value standard deviation (n=7). Values into brackets correspond to detection limits obtained for seawater samples. c Values obtained for a spiked river water sample. d Values obtained for a spiked seawater sample.

31

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

A PRELIMINARY STUDY. RELATIONSHIP BETWEEN OBESITY AND INMUNE SYSTEM IN RATS. Javier Mat Snchez, Carlos Gmez Gallego, Javier Garca Alonso, Gala Martn-Pozuelo. Inmaculada Navarro Gonzlez, Mara Jess Periago*. Department of Nutrition and Food Science, Veterinary Faculty. University of Murcia SPAIN E-mail: Javieralejandro.mate@um.es

ABSTRACT In recent years, several studies have proposed that obesity might be to inflammatory disorder. In addition, oxidative stress has been suggested as a potential inducer of inflammatory status and susceptibility to obesity and related disorders. The aim of our study was to carry out a preliminary study to characterize the impact on immune system of atherogenic diet in a Sprague-Dawley rat model. Rats were feed ad libitum with a high fat and hypercholesterolemic diet for seven weeks. After this period all the animals were euthanized and samples of blood and spleen were collected. The lymphocyte populations in all samples were analyzed by flow cytometry. Any effect of the diet was observed in lymphocytes B and T, and NK and NKT cells in peripheral blood and spleen. Statistical differences were only found in the balance between NK and NKT cells in spleen and blood. Our results suggest that there are alterations in the immune system in animals subjected to atherogenic diet as a result of the development of a possible inflammatory response, associated with a obesity related disorders like non-alcoholic fatty disease. Taking into consideration that Mediterranean diet provides a wide range of antioxidants, with a high intake of carotenoids and specially lycopene from tomato and tomato products, the addition of plant foods to human diet following the Mediterranean diet principles could have also a beneficial effects in the immune system in contrast of a diet with high fat. These results must be completed with the analysis of cytokines and gene expression with the aim of establishing the mechanisms by which unbalanced diets and obesity modulate immune responses and to confirm if the SpragueDawley model could be employ as a good animal model for human diseases.

Keywords: Lycopene, obesity, immune system, inflammatory disorder, Sprague-Dawley, atherogenic diet.

32

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

A PRELIMINARY STUDY. RELATIONSHIP BETWEEN OBESITY AND INMUNE SYSTEM IN RATS. Javier Mat Snchez, Carlos Gmez Gallego, Javier Garca Alonso, Gala Martn-Pozuelo, Inmaculada Navarro Gonzlez, Mara Jess Periago. Department of Nutrition and Food Science, Veterinary Faculty. University of Murcia SPAIN E-mail: Javieralejandro.mate@um.es

INTRODUCTION

Mediterranean diet has been proposed as a healthy nutritional model with cardioprotective effect since it provides to the human diet high level of complex carbohydrates (starch and dietary fibre), an adequate amount of mono-and polyunsaturated fatty acids, a wide variety of vitamins and antioxidants, as well as a low proportion of saturated fat. Such a nutritional profile is related to the high consumption of plant foods, legumes, olive oil, fish, and to the lower intake of red meat. In addition, the Mediterranean diet has been also associated with a low incidence of overweight and obesity. It is generally established that obesity is a serious public health problem that currently reaches the pandemic dimension in the United States. In Spain, the obesity prevalence rate reached already 14% without differences between genders (Rodrguez et al.. 2011). With the substantial increase in the prevalence of obesity in developed countries, appears a parallel increase of chronic diseases and associated clinical signs such as diabetes mellitus type 2, dyslipidemia, hypertension, coronary heart disease and stroke, cholelithiasis, osteoarthritis, heart failure, reproductive disorders and psychological disturbances. Besides these complications, obese individuals have a greater susceptibility to suffer from some types of cancer and infections. All this indicates that obesity has adverse effects on the components of the immune system and its functionality (Lamas et al., 2003). Immunological changes associated to obesity are related with changes in antibody production and response, as well as with changes in leukocyte populations and lymphocyte proliferation (Marcos et al., 2003). In addition to its role as energy reserve in the form of triglycerides, adipose tissue has important endocrine functions producing several hormones and other signal molecules that act directly on the immune system (Ahima et al. 2002). The aim of this preliminary study was to ascertain the relationship between obesity and cellular immune response through the development of an in vivo animal model with rats. To achieve this objective, rats were subjected to an atherogenic diet (hypercholesterolemic and high fat diet) to induce a higher caloric intake, leading to an overweight in the experimental group.

33

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2 2.1

MATERIAL AND METHODS Animals

Eight male Sprague-Dawley rats 8 weeks old (weighing 225-250 g), were obtained from the Animal Research Centre of the Murcia University. The rats were maintained under controlled temperature (22C), air humidity (55%) and 12 h light-dark cycle conditions for two weeks before starting the experiment. During this period they had free access to the diet and tap water. Animals were randomly divided into two groups (4 in each one) which were fed a standard laboratory diet (Teklad Global 14% Protein Rodent Maintenance diet, Harland Laboratories) and a hypercholesterolemic and high fat diet (Atherogenic rodent diet TD02028, Harland Laboratories), respectively. The animal study was carried out under appropriate guidelines and was approved by the Bioethics Committee of Murcia University. 2.2 Experimental design

Rats were fed ad libitum during seven weeks with free access to the water. At the end of the experiment all rats were deprived of food overnight, anesthetized with isofluorane and euthanized using an intraperitoneal injection of sodium pentobarbital. Blood was extracted by heart puncture and immunological changes associated to obesity are related with changes in antibody production and response and with changes in leukocyte populations and lymphocyte proliferation. Spleens were collected in all animals and were immediately prepared to the analysis of immune system cells by flow cytometry. Liver was also weighed and analysed to determine the total fat content by Soxhlet method. 2.3 Determination of differences in lymphocyte population by FACS (fluorescenceactivated cell sorting) These analyses were performed as described previously by Alam et al. (2010). Cell isolation. Single-cell suspensions of spleen cells were acquired by gently pressing the spleen through a plastic mesh. Erythrocytes of spleen and blood samples were extracted by hypotonic lysis using BD Pharm LyseTM (555899. BD Biosciences. San Jos. USA). Flow cytometry. Rat T/B/NK Cell Cocktail (558495. BD Biosciences. San Jos. USA) was employed to identify rat T, B, NK and NKT lymphocyte populations by direct immunofluorescent staining. Flow cytometry was performed using fluorescence activated cell sorter (FACS) Calibur flow cytometer (Becton Dickinson) and Cell Quest (BD) software. 2.4 Statistical analysis

Statistical analysis was performed with SPSS 15.0 software. Experimental variables were checked for normality and homogeneous variance using the Kolmogorov-Smirnoff and the Levene tests, respectively. Student-T test was applied to determine the significant differences

34

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

(P 0.05) between both experimental groups. Results are expressed as mean standard deviation. 3 RESULTS AND DISCUSSION

Table 1 shows the final body weight, height and the liver weight of the rats of both groups (group N rat fed the standard diet and group A rats fed atherogenic diet). The final body weight was higher in group A than in group N, reaching a final weight of 448.38 g and 406.75 g respectively. Hence these animals can be considered with overweight. We have chosen a nutritional model used previously by other authors (Ahmed et al., 2009) in which rats were fed the high cholesterol and/or high fat diet ad lib, leading to an obesity stage and a nonalcoholic fatty liver disease (NAFLD). In fact, in our study animals from A group also showed a fatty liver with a significant increase in the liver weight, which is related to the NAFLD. Fat contents were 16.56 1.22 % and 3.32 0.32 % in groups A and N, respectively.

Table 1. Body weight, height and liver weight of the rats of group N (standard diet) and group A (atherogenic diet).
GROUP ANIMAL 1 N 2 3 4 1 A 2 3 4 WEIGHT (g.) 366 397.5 434 429.5 466.5 350.5 530.5 446 448.38 74.52 MEAN (g.) SD (g.) HEIGHT (cm) 22.3 406.75 31.66 24.4 25 24.7 25 23.1 26 24.5 LIVER WEIGHT (g.) 9.2 10.34 12.22 11.43 19.87 19.32 20.68 20.13

Results related to the immune system cells are shown in Table 2. Cells were characterized according to their light and immunofluorescence characteristics. A single cell suspension of cells isolated was analyzed by FACS for each animal and tissue assayed. In order to determine the appropriate distribution of the cell populations, cell suspensions were stained with appropriate combinations of monoclonal antibodies. A maximum of 20000 gated events were recorded. Due to the high variability among animals no significant differences were observed in the lymphocytes B and T, and NK and NKT cells in peripheral blood and spleen. Statistical differences were only found in the balance between NK and NKT cells in spleen and blood. These differences were mainly due to a marked decrease in NK cells and increase in NKT cells in animal fed hypercholesterolemic and high fat diet. Accordingly, significant

35

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

reductions in blood NK cell population have been reported in cardiovascular disease patients (Backteman et al., 2012). Moreover, our results show an increase in B lymphocyte population in blood and spleen upon atherogenic diet consumption.

Table 2. Effect of diet on blood and spleen lymphocyte populations.


Blood B cells T cells NK cells NKT cells NK/NKT
1

Spleen A 41.10 7.91 51.07 6.69 1.60 1.05 1.26 0.91 1.35 0.30b N 51.10 2.32 27.84 2.07 5.36 0.58 1.83 0.09 2.93 0.30a A 61.56 11.83 23.85 9.80 2.62 1.84 1.12 0.68 2.20 0.36b

N 33.14 3.63 45.59 11.16 2.55 0.91 0.68 0.14 3.87 1.39a

a-b

The group N was the group feed with standard diet and the group A was fed with atherogenic diet. Statistical differences are shown with letters; groups with different letter have statistically significant differences at level of P < 0.05.

Dietary factors promote obesity and obesity-related disorders, such as fatty liver disease. Nonalcoholic fatty liver disease (NAFLD) can progress to an inflammatory process that can lead to fibrosis and apoptosis of hepatocyte (Angulo et al., 2002). For this reason changes in the lymphocytes and inflammatory mediators (mainly cytokines) have been described in animals with NAFLD associated with obesity (Adler et al., 2011). NKT cells are components of the innate immune system that regulate immune responses, and in addition accelerate liver injury by producing proinflammatory cytokines and killing hepatocytes. On the contrary, NK cells inhibit liver fibrosis via killing early-activated and senescent-activated stellate cells and producing IFN- (Solonski and Diehl, 2005). 4 CONCLUSIONS AND FURTHER STUDIES

Our preliminary results suggest that a diet with a high content in fats could affect the proper function of the immune system with changes in NK and B cells in blood and spleen. Findings from the present study appear to indicate that a Sprague-Dawley model could be employed to study how an inappropriate diet affects immune system and also whether nutritional intervention could avoid these effects. Taking into consideration that Mediterranean diet provides a wide range of antioxidants, with a high intake of carotenoids and specially lycopene from tomato and tomato products, the addition of plant foods to human diet following the Mediterranean diet principles could also have beneficial effects on the immune system compared to fat-rich diet.

36

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

These results must be completed with analysis of cytokines and gene expression with the aim of establishing the mechanisms whereby unbalanced diets and obesity modulate immune responses. Also, future studies will help to confirm whether the Sprague-Dawley model could be a feasible experimental animal model for the study of human diseases and the role played by dietary habits.

37

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCES Adler, M., Taylor S., Okebugwu K., Yee H., Fielding C., Fielding G., Poles M. 2011. Intrahepatic natural killer cell T cell populations are increased in human hepatic steatosis. World J Gastroenetrol: 7, 17(13):1725. Ahima, R. and Flier J. 2002. Adipose tissue as an endocrine organ. Trends Endocrinol Metab., 11: 327-32. Ahmed, U., Redgrave T., Oates P. 2009. Effect of dietary fat to produce non-alcoholic fatt liver in the rat. J Gastroenterol Hepatology, 24: 1463. Alam, C., Valkonen S., Ohls S., Trnqvist K. and Hnninen A. 2010. Enhanced trafficking to the pancreatic lymph nodes and auto-antigen presentation capacity distinguishes peritoneal B lymphocytes in non-obese diabetic mice. Diabetologia, 53: 346355. Angulo, P. 2002. Non-alcoholic fatty liver disease. N. Engl. J Med, 346:1221. Backteman K, Andersson C, Dahlin LG, Ernerudh J and Jonasson L. 2012. Lymphocyte subpopulations in lymph nodes and peripheral blood: a comparison between patients with stable angina and acute coronary syndrome. PLoS One. 7(3): In press. Lamas, O., Mart A., Martnez JA. 2003. Obesidad e inmunocompetencia. En: Marcos A (ed) Actualizacin en nutricin. Inmunidad e infeccin. Madrid: Panamericana: 125-32. Li, Z., Soloski M., Diehl A., 2005. Dietary factors alter hepatic innate immune system in mice with nonalcoholic fatty liver disease. Hepatology, 42(4):880-5. Marcos, A., Nova E., Montero A. 2003. Changes in the immune system are conditioned by nutrition. Eur. J. Clin. Nutr. 57 (Supl. 1):S66-9. Rodriguez, E.; Lpez B., Lpez A. and Ortega. R. 2011. Prevalencia de sobrepeso y obesidad en adultos espaoles. Nutr. Hosp. 26: 355-363. ISSN 0212-1611.

38

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ADOPTION IN A COMPARATIVE PERSPECTIVE Anja Suknaic, University Fernando Pessoa, Portugal suknaic.anja@gmail.com

ABSTRACT

In the Mediterranean area an interconnected diversity exists that can be seen also through different legal systems. The western type of legal systems such as in Slovenia and the legal systems that apply Islamic law have a different interpretation of the concept of adoption. In this paper I researched what are the main distinctions between adoption in Slovenian law and Islamic law and what are the similarities of Slovenian foster system and Islamic adoption. The differences and similarities were pointed out by the use of a comparative analysis. The results of the research have shown that adoption is not legally possible in Islamic law in a way that it is known in law system that is applied in Slovenia. However, there were discovered similarities with the foster system in Slovenia and Islamic adoption, where the legal relation between the caretaker and the child have more common points. The system of adoption is a typical example of evolution of legal regulations that in most of the world tend to change, but in Islamic world stay very traditional.

Keywords: Slovenian law, foster system, Islamic law, comparison, adoption

39

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Many couples that want to have a family and cannot have children of their own decide for the process of adoption. Adoption nowadays seems as a worked out procedure that is pretty universal among the countries functioning according to the western model. However, the Islamic world has its own set of rules and therefore also their own way of interpretation of adoption. Adoption of a child in an Arabic country that implements Islamic law is very different that in western world, or in other words it is much more difficult to perform it. In this paper the adoption system comparison between two very different law systems will be presented. This kind of comparison is important because the Mediterranean is becoming an ever more interconnected area, where it is crucial to understand each others differences and similarities in order to be able to function together better. The main subject will be the comparison between the Slovenian adoption system and the text on this subject written in the Islamic Holy book Quran, which is the main source of Islamic law. The main objective of this research will be to define the main differences and similarities, to discover what kind of form of adoption exists in Islamic law and how is this similar with Slovenian legislation on adoption. The Islamic concept of adoption will also be compared with the foster family system that exists in Slovenia, which does, as we will see further on in the paper, have much more common points than the Islamic form of adoption. The main research question to which I will try to answer with this research is: What kind of system of adoption is recognized in the Islamic law? The paper will be divided on several chapters. In the first chapter I will write about main characteristics of the adoption system in Slovenia. In the second chapter I will analyze the parts of Quran that contain statements about adoption rules. Further on I will compare the two legal systems on adoption. In the next chapter I will make a comparison between the concept of adoption in Islamic law and the foster system in Slovenia. In the last chapter I will make a conclusion in which I will, basing on my findings, answer to my research question. The writing of the paper will be based on interpretation of primary and secondary resources.

40

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ADOPTION SYSTEM IN SLOVENIA

The adoption in Slovenia is regulated by the Law on marriage and family relations in the articles (134145). In Slovenia, the only form of adoption is full adoption, which means that the adoptee is fully separated from his biological parents and settled in the adoptive family. With adoption all the rights and obligations of the adoptee to his biological parents and other relatives stop and also all the rights and obligations of the biological parents and relatives stop as well (Law on marriage and family relations, article 143). Adopted children may be only the ones whose parents are unknown or have been absent for a year, or if the parents agreed that they want to give the child to adoption. If the parents no longer have the parenting rights, that a consent from their side is not necessary (Law on marriage and family relations, article 141). The adopter can be only an adult person that is at least 18 years older form the adoptee. In special circumstances, if it is in the adoptees benefit, the person that adopts can be less than 18 years older from the adoptee (Law on marriage and family relations, article 137). According to the Law, with adoption the relation between the adoptee and his descendants and the adopter and his relatives becomes the same as between blood relatives (Law on marriage and family relations, article 142). The Law states that the adoptive couple or individual is defined, after the adoption, in the Birth register as the adoptees parents (Law on marriage and family relations, article 145).

2.1

Adoption from an Other Country

The adoption from another country is regulated by the principles of international adoption. In Slovenia the international adoption is regulated by the Hague convention on protection of children and co-operation in respect of intercountry adoption. If the couple wants to adopt a child from one of the contacting states than they have to do in accordance with the procedure determined in the convention. If the country is not a contracting state of the convention, the adoption can occur anyway, but in that case always the state of the child determines the terms and the process of adoption.

41

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The state of the child decides also which documents are necessary for the adoption and in what form they have to be presented (Ministrstvo za delo, druino in socialne zadeve 2012).

ADOPTION IN AN ARABIC COUNTRY WITH ISLAMIC LAW

If a couple wishes to adopt a child from an Islamic country which is not a contacting state of the Hague convention, than it has to do it in accordance with the regulations of the state of the child. The adoption according to Quran is quite different from the western model of adoption that we know in Slovenia. Legal adoption in not allowed and possible in Islam (Hussain 2011). In Quran (33: 4), it is written: "(...) And he has not made your adopted sons your [true] sons (...). This implies that the child you adopt cannot be your own son and you are just the caretaker or guardian, not the biological parent. In Quran (33: 5) it is written: "Call them by the names of their fathers; it is more just in the sight of Allah (...). The adoptive child has to keep the biological family`s name and surname and does not change it for the one of the adoptive family (Huda 2012). Under Islamic law, only relatives with legitimate blood relationship to the deceased are entitled to inherit from the deceased (Hussain 2011). Therefore the adopted child cannot inherit from his adoptive parents, but he inherits from his biological parents. In Quran we cannot find anything written about how much does the adopted child inherit, because he is not included in the heritage, he must get the belongings of his biological parents. However there is written that the caretakers have to take care of the belongings of the adopted child and not take them away from him: "And give to the orphans their properties and do not substitute the defective [of your own] for the good [of theirs]. And do not consume their properties into your own. Indeed, that is ever a great sin." (Quran 4:2). And it is also written that when the adoptee reaches a marriageable age, the guardian has to release the property of the adoptee, so he can manage it himself. In Quran this is written in chapter 4 paragraph 6: "And test the orphans [in their abilities] until they reach marriageable age. Then if you perceive in them sound judgment, release their property to them. (...)".

42

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

There is also a special relation between the members of the adoptive family and the adopted child after he is grown up. In Quran we can find specific prohibitions who a person in general is allowed to marry and who not, but there s no specific clause on what is the relation toward the adopted child which in fact is not in blood relation. Therefore essentially members of the adoptive family would be permissible as possible marriage partners (Huda 2012). In Quran (4:23) this is stated as:
Prohibited to you [for marriage] are your mothers, your daughters, your sisters, your father's sisters, your mother's sisters, your brother's daughters, your sister's daughters, your [milk] mothers who nursed you, your sisters through nursing, your wives' mothers, and your stepdaughters under your guardianship [born] of your wives unto whom you have gone in. But if you have not gone in unto them, there is no sin upon you. And [also prohibited are] the wives of your sons who are from your [own] loins, and that you take [in marriage] two sisters simultaneously, except for what has already occurred (...)

Because of the nature of the Islamic law, the international adoption is very difficult, usually even impossible, because the law of these states does not acknowledge adoption in any form.

COMPARATIVE ANALYSES OF TWO SYSTEMS OF ADOPTION

If we compare the adoption procedure in countries that execute Islamic law and Slovenia, we can see that the system is not very similar. In Islamic countries the legal adoption is not possible, they are not familiar with this practice, and the adopter is more a caretaker than an official parent. In Slovenia the only form of adoption is full adoption, which mean full separation from the biological parents and the adoptive family becomes the legal family. In Islamic law the adoptee is always connected with his biological parents, he doesn`t change his name and he also inherits from his biological parents, not from the adoptive family. The relation between the adoptive family and adoptee is the same as if the family is his biological family, therefore it is not acceptable for the adoptee to marry someone from his family. In Islamic law this is represented differently. Since the adoptee is not in fact treated as a member of family but is considered a member of his biological family, the members of the adoptive family would be permissible as possible marriage partners. As in the case of Slovenia an international adoption is possible and Slovenia is a member of the Hague convention, which makes the international adoption procedure with other

43

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

contracting states much easier. It also allows adoption from non contracting states, but than the adoption is more in the hands of the legislation of the country of the child. On the other hand in Islamic law the concept of full adoption is not possible and therefore also international adoption can be very difficult.

COMPARISON OF SLOVENIAN FOSTER SYSTEM AND ISLAMIC ADOPTION

In Slovenian legal system there is a system of foster family that is very similar to the concept of adoption in the Islamic world. In the Law on marriage and family relations it is defined that the foster system is a system of caretaking with which the child is enabled a normal growing up and personal development (Law on marriage and family relations, article 154). With foster system the rights and duties of the child`s biological parents don`t stop (Law on marriage and family relations, article 156). The main rights and obligations that still remain to the parents are: the right to personal contact with the child; the obligation to financially support the child; the right of the child to inherit from the biological parents (Student info. ND). In this dimension we can see the similarity with the Islamic law, where also the rights of biological parents don`t stop and child inherits from biological parents. The foster system implies that also the assets that the foster child posses are protected and managed in a right way. The social services estimate the value of belongings of the foster child and the foster family or person can change or manage these belongings only with the permission of the social services (Law on marriage and family affairs, article 189). This also resembles to the Islamic law adoption where the caretaker manages the belongings of the child, but he cannot use these belongings in his interest, he is only entitled to take care of it. The foster person however has the right to refund of all the costs that are connected with the fostering process. The money is given by the state (Law on marriage and family affairs, article 196). In Islamic law there are no special definitions about the refund of costs, except if the caretaker is poor than he can be entitled to some part of the belongings of the child he is taking care of. Taking care of an abandoned child is considered good work that needs to be done without payment, according to Quran.

44

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Another similarity that can be mentioned is also that in foster system the child keeps his family name and does not change it like in adoption. Also in Islamic law, the name of the child stays the same.

CONCLUSION

According to the research made we can see that the concept of adoption in Islamic law, does not exist in the form as it does in the western world. The comparison with the foster system in Slovenia is much more similar to the form of adoption in Islamic law. The child can never be considered as a real part of the family because, he has to keep his family name and he does not inherit from the parents. If we consider an international adoption of a child from an Islamic country that is not a contracting state of The Hague convention, than we can say the adoption is very difficult or almost impossible. Because in this case the adoption procedure is determined by the country of the child and therefore the country that has Islamic law, which does not acknowledge full adoption. Therefore the answer to the research question is that the system of adoption that is recognized in the Islamic law is a kind that is not similar to full adoption that is known to Slovenia but has more similarities to the foster system. Most of all is an abandoned child in Islamic country given a caretaker and not so much a new parent. Therefore the child does not really have a new family but always stays connected with his biological one. The abandoned children have to be taken care of, but in a much different form than in Slovenia. This kind of research helps us better understand the differences that exist in the world. Even though the world is under the influence of globalization and countries are starting to look a like there are still many existing differences, especially between the Arabic world and the western model of the world. The system of adoption is a typical example of evolution of legal regulations that in most of the world tend to change, but in Islamic world not. Therefore the cohesion is almost impossible because we have on one side very traditional regulations that exists in the same form for centuries and on the other side the regulations that change according with the evolution of the world and the people. This kind of comparison is important to show that even though Mediterranean is a very interconnected area there are still differences that exists between the European Mediterranean and Islamic Mediterranean, that have to be understood and that have to be respected in order to make the cooperation in the region efficient, because understanding and respect is a way of bridging the gaps.

45

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

Huda. 2012. Adopting a child in Islam Islamic legal rulings about foster parenting and adoption. Ahttp://islam.about.com/cs/parenting/a/adoption.htm (29. 12. 2011). World Organisation for Cross-border Co-operation in Civil and Commercial Matters. 1993. Convention on Protection of Children and Co-operation in Respect of Intercountry Adoption (The Hague, 29 May 1993, in force since 1 May 1995). Available at: http://www.hcch.net/index_en.php?act=conventions.text&cid=69 Hussain, A. (Dr.). 2011. Islamic Laws on Inheritance. Islam101. Available at: http://www.islam101.com/sociology/inheritance.htm (29. 12. 2011). Law on marriage and family relations 1976. http://zakonodaja.gov.si/rpsi/r00/predpis_ZAKO40.html (30. 12. 2011). Ministrstvo za delo, druino in socialne zadeve. 2012. http://www.mddsz.gov.si/si/delovna_podrocja/druzina/posvojitve/ (1. 2. 2012). Quran. http://quran.com/ (5. 2. 2012). Student info. ND. Roditeljska pravica. mapa/.../968455_druzinsko___plonk.doc (2. 2. 2012). www.student-info.net/sis (Slovenia)

Posvojitve.

46

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

AN AUTONOMUS UNDERWATER VEHICLE WITH TOWED SURFACE BOAT FOR LONG-RANGE INSPECTION OF THE MAR MENOR

Antonio Guerrero Gonzlez, Universidad Politcnica de Cartagena, Spain antonio.guerrero@upct.es Toms Lpez Maestre, Universidad Politcnica de Cartagena, Spain tomas.lopez@upct.es Javier Gilabert Cervera, Universidad Politcnica de Cartagena, Spain javier.gilabert@upct.es Vctor Moreno Oropesa, Universidad Politcnica de Cartagena, Spain victor.desantos@gmail.com Antonio Zamora Ayala, Universidad Politcnica de Cartagena, Spain antonioz1987@hotmail.com Javier Garcia-Vidal Simon, Universidad Politcnica de Cartagena, Spain fokkerr@gmail.com Napoli Gmez Ramrez, Universidad Politcnica de Cartagena, Spain napoli.naruto@gmail.com Inocencio Gonzlez Reolid, Universidad Politcnica de Cartagena, Spain inocenciogr@hotmail.com Jos Garca Morales, Universidad Politcnica de Cartagena, Spain josegarmorales@hotmail.com

47

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ABSTRACT

This paper describes the state of the work progress of the research group of the Underwater Vehicles Lab of the UPCT Isaac Peral at the Ship Science and Ocean Engineering Faculty. A general and technical description of the underwater vehicle AUV/ROV Aegir, which is the main vehicle of the Lab, has been included. Also a sea surface towed vehicle have been designed and fabricated to face the AUV 2011 Underwater Robotics Experiment Mar Menor Coastal Lagoon with the objective of increasing power and operation autonomy at sea. Also, the currently state of the research development have been described, from early water test in the scientific pool of Fuente lamo Technological Facilities to the first challenge participating in the AUV 2011 Underwater Robotics Experiment Mar Menor Coastal Lagoon. The AUV/ROV Aegir is proposed as a test bed for testing control techniques, underwater trajectories generation, automatic navigation, and test different multidisciplinary equipments to continue developing an underwater robot for ocean exploration. Keyword: AUV, Tow vehicles, Underwater Environment, Robotics, Mar Menor, Marine Operations, Motion Artificial Intelligence.

48

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

An Autonomous Underwater Vehicle (AUV) is a sea robot with the capacity of movement and develop missions under the sea surface without being commanded directly by an operator, therefore AUVs have power autonomy and intelligence to carry out programmed tasks. [1], [2], [3], [4], [5], [7], [8], [9]. AUVs form part of a big group of underwater systems known as Unmanned Underwater Vehicles (UUV), a classification which includes Non Autonomous Underwater Vehicles, these are underwater vehicles which are operated remotely from a sea surface station, commonly named Remote Operated Vehicles (ROV). Unmanned Underwater Vehicles (UUV) have been developed to carry out underwater missions as underwater and off-shore facilities monitoring, mine haunting, oceanography and underwater archaeology. The UPCT Underwater Vehicles Lab Isaac Peral is a multidisciplinary research group with expertise in biological oceanography, Naval Architecture, Oceanic Engineering, robotics, artificial neural networks, Electronics and IT. Today the lab is located at the Ships Science and Oceanic Engineering Faculty of Cartagena. The goal of this team is the development of equipment and techniques useful for ocean exploration. This lab has been constituted during 2010, and in this moment disposes of several granted projects for the exploration of Mar Menor [6] and the design of underwater vehicles. One of the research lines in the field of artificial intelligence is the application of neural networks biologically inspired for control and trajectory generation.

49

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

THE UNDERWATER VEHICLE

The main underwater vehicle of the UPCT Underwater Vehicles Lab Isaac Peral is Aegir, this underwater robot is a cession of the Spanish Navy to the UPCT, in a project to update a decommissioned underwater ROV/AUV designed in the 70s called Pluto and used for mine haunting tasks by the Spanish Navy for decades. Currently Pluto has been completely updated and renamed Aegir, and it has been prepared to carry out with multidisciplinary ocean missions in the underwater environment as environmental monitoring, scientific sampling and mapping.

2.1

Principal characteristics of the UV-UPCT

Table 1. Principal Characteristics of the AUV/ROV-UPCT Weight of the Vehicle: 160 Kg. Dimensions: 1680 x 600 x 600 mm Max. Speed: 4 knots (48V), 2 knots (24V). Operational depth: 300 meters. Test Data: Weight of the Vehicle: 148.4 Kg Ballast: 15 Kg. Total Weight: 163.4 Kg Displacement: 163.8 dm3 Ballast Displacement: 1.92 dm3 Nett Upthrust: 2.32 Kg Elements: Camera and Lights Side-Scan sonar Sub-bottom profiler sonar Video Camera Inertial system Acoustic Modems Depth Sensor USBL Positioning System Module of the distribution control system Submersible Ultraviolet Nitrate Analyzer Multiparametric Sonde (YSI-66000 V2-4) Power supply unit

50

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1. UPCT ROV/AUV Aegir

2.2

Interconnection of hardware components of the updated UPCT ROV/AUV

Figure 2. Interconnection of hardware components


Receptor/ Transmition

Grabaci Imagen Imagenes Recording Imagenes

Monitoring Station

Joysticks Joysticks Joysticks

ETHERNET (optional) Receptor/


Inertial Positioning

COM1

Transmition
CAN CAN BUS BUS

Propellers

Inclinometers

COM2

neuro-controller

CPU Adaptive CPU kinematic

Head Perception 1 Head Perception 2

Interface Interfaz Interfaz CAN CAN


COM4 COM4

COM3
Compass

USB USB
Imagen Capture

USB/COM
Interface Sonar

Baterry Management Water intrusion

Video Cameras

Sonar

Light Source

51

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.3

Remote Control and Monitoring of the UPCT ROV/AUV Aegir

At early stage, Aegir had been updated as Remote Operated Vehicle with the purpose of having a test bed to implement intelligence of motion and underwater tracking system to develop and implement the autonomy algorithms required to achieve the AUV condition. To control the vehicle an interface with the commands of the underwater platform has been designed.

Figure 3. Remote Monitoring of the AEGIR (1)

From the PC interface is possible to control the track, the speed, the depth, the pitch of the body and the pitch of the head. Also it is possible to activate some basics automatics modes which have been developed. The PC interface also includes the vision of the underwater camera which shows at real time the underwater vision of the vehicle.

52

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 4. Remote Monitoring of the AEGIR (2)

Through the PC interface is also possible to know in real time the electrical parameters and work conditions of the electric motors, batteries and controls. Figure 5. Deployment of the ROV/AUV Aegir in Fuente lamo test pool

53

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

THE TOWED VEHICLE

One of the principals risks to develop an AUV is the risk of lost the vehicle in open ocean missions or tests, in this way; the worst condition is when operating in underwater environment without connection with sea surface and without GPS position or underwater tracking known. At early stage of the autonomous algorithms implementation in the AUV, the risk of lost is greater, for this reason a solution has been designed to reduce the probability of lost the vehicle during open waters tests, this solution is the design, fabrication and connection of a towed surface vehicle to the AUV.

Figure 6. ROV/AUV Aegir and Towed Surface Vehicle in Mar Menor water test

This towed surface vehicle has four missions: a) Underwater environment sea surface Connection. Linked by an underwater cable with Kevlar protection, 1000Kg of towing capacity, compound of 6 power supply cables and 1 Ethernet communication cable. Cable characteristics FALMAT FMXCAT51806K12, 6 conductors 18AWG (cable section: 1 mm2), 1 data cable CAT5 (4TO). b) Air data wireless communications between the towed surface vehicle and the manned surface support vessel or port control station.

54

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Amplificatory WiFi description: Processor: Memory: Ethernet Interface: Integrated Antenna: TX Power: RX Sensitivity: Range: Bandwidth TCP/IP: Size: Weight: Casing characteristics: Maximum consume: Electric Supply: Pasive supply: Work Temperature: Work Humidity: Shock and Vibration: Antenna Description: Electrical Specification Frequency Range 2400~2500MHz Gain14.50.5dBi VSWR 1.8 : 1 max Impedance 50 Polarization Linear Vertical HPBW / Horizontal 9 HPBW / Vertical 11 Front back ratio 25dB Power handling 50w (cw) Connector N female Survival wind speed 180Km/hr Temperature -40C~+80C Humidity 100%@25C Lightning Protection DC ground (optional) Radome color Gray-white Radome material ABS, Zinc casting Weight 3 Kg Dimensions H1860 x D40mm Atheros AR2313 SOC, MIPS 4KC, 180MHz 16MB SDRAM, 4MB Flash 10/100 BASE-TX (Cat. 5, RJ-45) Ethernet Interface Connector 20dBm, +/-1dB -97dBm +/-1dB 5 Km 25Mbps+ 15,2 x 3,7 x 3,1 cm 0,18 Kgr UV plastic 4 Watts 12V, 1A (12 Watts) Passive Power over Ethernet (pairs 4,5+; 7,8 feedback) -20 C to 70 C 5 to 95% Condensed ETSI300-019-1.

55

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

c) Sea surface power generation to supply the underwater vehicle and increase its power autonomy and operation time from the sea surface. Table 2. Characteristics of the power generator Model Alternator Stability System Distortion Maximum Power Nominal Power Cubic Capacity Oil Capacity Gasoline Capacity Autonomy 50 % Noise Level (7mtrs vacuum) Starting System Dimensions Reference Lanzarote Multipolar Inverter Modulation 3% 2,2 kva 2,0 Kva 125 cc 0,45 L 10W40 7L 6,5 h 65 Db Manual/Electric 54x29x51 cm 902502

d) Global Positioning System. The Sea surface vehicle is connected to GPS system, the tracking, the position and direction of the surface towed vehicle, that with the data from the underwater platform as depth, this combined information is very useful to generate the operation position, and also for getting a closer space to focus the search and the rescue in case of lost the vehicle.

3. - EXPERIMENTS IN MAR MENOR.

In November 2011, an international experiment in underwater oceanographic robotics took place in the Mar Menor coastal lagoon; the main objective was the measurement the salinity of the seawater between the coastal lagoon and the Med Sea in the channel of the Estacio, which is the biggest exchange seawater flow between both seas with oceanographic robots. This international experiment called Underwater Experiment Mar Menor Coastal Lagoon 2011 integrated the participation of the MBARI, CETMAR, University of Girona, Polytechnic University of Catalua, University of Porto, University of Carlos III and the Polytechnic University of Cartagena as hosting institution. The UPCT LVS (Underwater Vehicles Lab) Isaac Peral joint this experiment with the ROV/AUV Aegir connected to the towed surface vehicle as showed in the picture. The mission was record data from the seawater flow between the Med Sea and Mar Menor lagoon

56

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

in a selected region marked by GPS, to achieve this mission the AUV/ROV Aegir was equipped with a CTD pump. (Conductivity (directly related to salinity), Temperature, Depth (directly related to underwater environmental pressure). The bad weather conditions, the untrained skills of the support vessel crew and the non tested design of the deployment and recovery system of support vessel for the AUV did that the UPCT vehicle was seriously damaged the first day of experiment. Too far away from give up the mission, the UPCT team worked hard to restore the system reconnecting the equipments and repairing the damages, provisional repair was done to the starboard immersion propeller nozzle, which had been broken during deployment on sea, all these job were carried out satisfactorily to put the AUV/ROV Aegir operative to finish the task of measurement the salinities of the seawater exchange flow between Mar Menor and Med Sea. Once the system was reactivated, the UPCT team come back to the scenario of the experiment, this time with an unbeatable deployment and recovery vessel operated by a trained crew from the Maritime Search and Rescue System of the Spanish Merchant Shipping Management. This time, with remote operated control and basics modes of automatic procedures were executed by the AUV Aegir to cover de designed areas bay GPS in order to measure the salinity associated to the explored area and depth.

4. CONCLUSION

The AUV/ROV Aegir is proposed as a test bed for testing control techniques, underwater trajectories generation, automatic navigation, and test different multidisciplinary equipments, in this way, AUV/ROV Aegir is an underwater vehicle easily adaptable to several missions and tasks in the underwater environment as environmental monitoring, oceanography research, scientific sampling and mapping, search and rescue operations, underwater archaeology and surveillance and security operations. This underwater vehicle has an open software and hardware architecture which allows the incorporation of new equipments or new software.

57

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

[1] Antonelli G, Chiaverini S, Sarkar N, West M. Adaptive control of an autonomous underwater vehicle: experimental results on ODIN. IEEE Trans Control Syst Technol 2001;9(5). [2] Carreras, M., Yuh, J., Batlle, J., Ridao, P.: A behavior-based scheme using reinforcement learning for autonomous underwater vehicles. IEEE JOURNAL OF OCEANIC ENGINEERING 30 (2005) 416-427. [3] Garca-Crdova, F., Guerrero-Gonzlez, A., Marn-Garca, F.: Design and implementation of an adaptive neuro-controller for trajectory tracking of nonholonomic wheeled mobile robots. In Mira, J., lvarez, J.R., eds.: Nature Inspired Problem-Solving Methods in Knowledge Engineering, Lectures Notes in Computer Science. Volume 4528. Springer-Verlag Berlin Heidelberg, LNCS- 4528, Part II, ISBN: 978-3-540-73054-5 (2007) 459-468. [4] Lorentz J, Yuh J. A survey and experimental study of neural network AUV control. IEEE AUV96 Monterey; 1996. [5] Nakamura Y, Savant S. Nonlinear tracking control of autonomous underwater vehicles. In: Proceeding IEEE international conference on robotics and automation, Nice, France; 1992. [6] Prez-Ruzafa, A., Marcos, C. y Gilabert, J. 2005. The Ecology of the Mar Menor coastal lagoon: a fast-changing ecosystem under human pressure. In: Gnen, I.E. and J.P. Wolflin (Eds.). Coastal lagoons. Ecosystem processes and modeling for sustainable use and development. CRC press. Boca Raton. pp.: 392-422. [7] Porto VW, Fogel DB. Neural network techniques for navigation of AUVs. In: Proceedings of symposium on autonomous underwater vehicle technology (conference proceedings); 1990. p. 13741. [8] Silpa-Anan C, Brinsmead T, Abdallah S, Zelinsky A. Preliminary experiments in visual servo control for autonomous underwater vehicle. IEEE/RSJ international conference on intelligent robotics and systems (IROS); 2001. Available from: http://www.syseng.anu.edu. au/rsl/. [9] Yoerger DR, Slotine JE. Robust trajectory control of underwater vehicles. IEEE J Ocean Eng 1985; OE-10(4).

58

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Analysis of platforms for offshore wind turbines


J. Enrique Gutirrez(1), Blas Zamora(1), Julio E(2), Jernimo Esteve(1) (1) Universidad Politcnica de Cartagena, Spain, (2) International Center for Numerical Method in Engineering (CIMNE), Universitat Politcnica de Catalunya, Spain. jose.gutierrez@upct.es

Abstract
The growth of renewable energy promotes the search of new sources in places where until now it was not possible to extract the energy. One example of this is the offshore wind energy. This work presents the response analysis of different kinds of platform, which are usually employed like a support structure of these new wind turbines, the offshore wind turbines. It is presented the analysis of Spar Buoy Platform based in OC3 Hywind specification, Semi-submersible Platform based in OC4 Hywind specification and TLP (Tension Leg Platform) model developed by Massachusetts Institute of Technology. For the current study has been created a new tool called Morison Form, which is based in Morisons equations to describe the forced exerted by regular waves in slender element. The new tool permits us to interact with other tools like FAST Lognoter, which was created for aeroelastic analysis of wind turbines. Therefore, it is possible to carry out a complete analysis of wind turbines. The presented new tool is validated in the present work through documented cases.

Keyword: Platform design, Offshore, Challenge, Wind turbine, Response analysis

59

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Today it is well kwon that the offshore wind technology constitutes one of the most important challenges for renewable energy. Due to high cost of offshore wind technology, recently, numerous countries start a challenge to find the best suitable support platform for offshore wind turbine (Tong, 1988; Sclavounos et al, 2005; Breton & Moe, 2009). The current fixedbottom technology is limited by the increase of requirements for the installation in water depth above 20 meters. The cost reduction constitutes the main way to favour the proliferation of this technology. As onshore land to place onshore wind turbine is scarce the offshore wind solutions have been explored to solve the lack of energy sources in different parts around the world. However, these new solutions imply high cost, which may be reduced, especially for ultra deep wind turbines (Jonkman et al., 2007). Sea constitutes an aggressive environment for offshore installation. Technically, the survivability of offshore structures has been demonstrated by the marine and offshore oil industries over many decades. The Offshore Wind Energy represents an emerging energy technology. Offshore Wind Power is widely accepted by lower visual and environmental impacts. The field over study is wide because it covers some different aspect from estimating the wind resource, platform design to soil studies. It is possible to find some interest reviews of the field in the bibliography (Tong, 1988; Breton & Moe, 2009; Wang et al., 2010, amongst others). For these reasons the optimization of wind turbines structures for cost reduction constitutes the main objective in the current challenges. The major objective of this work is a rough estimation of behaviour of different kinds of support platform and shows the dynamic response of these by the forces exerted by regular waves by means of developed of new tools to facilitate this study, in this case the software Morison Form.

DESCRIPTION OF THE PROBLEM

A typical form of the response equation of free floating structure with a rigid wind turbine placed above it with six degrees of freedom for steady state sinusoidal motions can be written as:

Where MP jk , MWT jk , A jk , BP jk , BWT jk , CP jk , CM jk and CWT jk are matrixes of platform mass, added-mass, wind turbine mass, platform and wind turbine damping, hydrostatic restoring with mooring stiffness coefficients and restoring matrix for wind turbine. F j are complex amplitudes for existing forces and moments exerted on body (Faltinsen, 1999; Tracy, 2007). The last equation can be solved by substituting
60 17 - 18 April 2012

in the left hand side. This lead to

Proceedings of the 4th EMUNI Research Souk

six coupled algebraic equations for real and imaginary parts, which can be solved by standards methods. Following expression can show it:

The flow, which passes around slender element, is considered an important problem of hydrodynamics on offshore structures. The forces exerted by surface waves on a slender body in an unsteady viscous flow can be determined by Morisons equations. So, these equations are usually employed to offer these forces in offshore structures. The forces are made up of three components named: 1. Drag forces are generated by normal component of the flow velocity. These forces are proportional to the square of the velocity and the magnitude of these is adjusted by a coefficient called 'Drag coefficient' (C D ) which depends on the geometry of slender elements. 2. Inertia forces are generated by normal component of the flow acceleration. These forces are proportional to the acceleration of the flow. These forces are adjusted by a coefficient called 'Inertia coefficient' (C M ) which depends on the mass added coefficient. 3. Lift forces are oriented normal to the velocity vector and normal to the axis of slender element. These forces are proportional to the square of the velocity and the magnitude of these, are adjusted by a coefficient called 'Lift coefficient' (C D ). If the members of the structure are considered circular or similar, the lift forces are not considered in the calculus. Thus, the total linearized forces exerted per unit length by surface waves on slender elements are:

Where l is a unit vector with directional cosines, v is a local fluid velocity vector a is a local fluid acceleration vector. On the other hand, D is the diameter of slender element, S is the transversal area of the body and is the water density. There are several limitations for these integral, since they do not consider the influence of adjacent sections flow and they do not take into account the piercing phenomena. It is important to mention that the velocity and acceleration vectors are then rotating 90 degrees out of phase which each other into the plane parallel to xz - plane. 3 SOLUTIONS FOR OFFSHORE WIND TURBINES

Nowadays the increased interest in the offshore wind resource has resulted in a number of concepts of offshore floating wind turbines. Different solutions have been adopted like a support platform for ultra deep-water offshore wind turbine. It is possible to establish four common typologies for support platform in offshore wind turbine: Barge, Semisubmersible, Buoy Spar, TLP (Tension Leg Platform), which are shown in the Figures 1 and 2. (Jonkman & Buh, 2007; Twidell & Gaudiosi, 2009). - 18 April 2012 61 17

Proceedings of the 4th EMUNI Research Souk

Barge: shallow water-floating structure with a large waterplane area. Mooring lines provide the station keeping. The restoring moment is provided with a large waterplane area. Buoy Spar: long slender ballasted cylinder with a lower centre of mass. Similar as previous case the moorings only provide the station keeping. Semisubmersible: three surface-piercing floating cylinders compose most of these types of structures. The moorings only provide the station keeping. In this case the restoring is provided by the radial distribution of water plane area. TLP: buoyant cylinder with spokes that is held at its draft by its tension leg mooring. A multiple leg TLP exhibits less angular motion and a good heave response as well. It is possible to find other variations of theses structures like tension leg spar proposed by Karimirad (Karimirad et al., 2011), Sway Concept (Holmas & Amdahl, 2009) WindFloat Concept (Roddier et al, 2009) composed by three floating cylinders where the wind turbine is placed above one of these cylinders or WindSea project (http://windsea.no).

MORISON FORM

The aim of this new tool is to obtain rough and quickly estimations of the force magnitude exerted on slender bodies by Morisons equations. This tool permits the user to calculate approximately the Dynamic Response of floating structures composed by slender elements. The outputs offered by Morison Form are the motions of the structure such as rotations and displacements, the computed Morison loads, natural frequencies and some data about platform analysed such as centre of flotation, mass matrix or restoring matrix. Morison Form has been created by Department of Naval Technology at UPCT (Universidad Politcnica de Cartagena) in collaboration with CompassIS (Compass Ingeniera y Sistemas) and CIMNE (International Centre for Numerical Methods in Engineering). This tool is available for downloading in http://www.lognoter.com/c/lognoterforms/index. It permits the user to interact with other analysis programs to carry out a complete analysis of wind turbine, from its interaction with the waves and wind and determine the structural dynamics of this structure. It can be shown it the Figure 3 the interaction with FAST/Aerodyn through FAST Lognoter GUI (graphical user interface); FAST/Aerodyn is a complete code developed by NREL (National Renewable Energy Laboratory), that permits the user to model the dynamic response on conventional Horizontal Axis Wind Turbine (HAWT) with both two and three blades; WAMIT, which is a program developed by MIT (Massachusetts Institute of Technology) which permits the complete analysis of wave-structure interaction basing in potential theory and finally Morison Form allows the user to interact with RamSeries, program developed by CompassIS to structural analysis with FEM. Morison Form has the capability to classify the different types of project and organizing the information. To give the user more information about the software management, theory 62 17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

introduction and explanations are included, as well as dynamic help and adapted sight. Morison Form also includes a SQlite database to store all the user projects and handle easily. This can be observed in the Fig. 4. 5 ANALYSIS OF TYPOLOGIES

In this section it will be presented the analysis of some typologies of support platform. The buoy Spar Platform based in NREL model (Jonkman, 2010); the second typology analysed is a semisubmersible based in OC4 concept (http://www.ieawind.org). The last typology presented is the TLP platform developed by MIT, and widely studied in different works (Withee, 2004; Wayman, 2006; Tracy, 2007; Matha, 2010.,). The Table 1 shows the natural frequencies for the six-degree of freedom for the three models studied with Morison Form. These natural frequencies can be calculated for each mode with the following equation:

It can be noticed that the Buoy Spar and Semisubmersible have an analogous behaviour. The knowledge of these peaks of frequency is very important in the design of the structure to avoid the resonance phenomenon with the rotor frequency or the wave frequency. However the TLP platform has different behaviour with natural frequencies for roll and pith move to normal frequencies. These natural frequencies will change because it is necessary to take into account the mass and restoring component of the complete system, it is to say, the wind turbine mass and restoring components coming from it. The Figs. 5, 6, 7, 8, 9, and 10 show the RAO (Response Amplitude Operator) in six degree of freedom motions for the platforms analysed. It can be noticed in that figures some amplitude peak for low values of frequency in each typologies studied. It can be advised that the buoy Spar and Semisubmersible presents a better behaviour that TLP platform since the peak of amplitudes are lower in most of cases. The figures 10, 11 and 12 show the frequency response for the structures analysed in five different depths. It is shown different RAOs for each structure. The lecturer can be noticed that the behaviour of these does not vary for a depth increment. The better behaviour can be observed for Semisubmersible concept.

63

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSIONS

The present work shows a rough estimation of the behaviour in different floating structures by means the new tool, called Morison Form, created for this purpose. However, this tool only permits this rough estimation, so, to perform a complete analysis of wind turbine it is necessary to know others parameters like a matrix for wind turbine or different wave phenomenon like diffraction or interaction between slender elements, piercing phenomenon, since Morisons equations do not take into account. This preliminary study shows the lecturer that it is not clear winner for support platform for offshore wind turbine. It is possible to advert that all the typologies analysed have a similar behaviour. The future work will be centred in the improvement of the accuracy of this tool with new theory and capacities.

64

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Reference list
Breton SP, Moe H. 2009. Status, plans and technologies for offshore wind turbines in Europe and North America. Renew Energy. 34:646-54. Faltinsen O.M. 1999. Sea Loads on Ships and Offshore Structures. Cambridge Univertity Press. Holmas T, Amdahl J. 2009. Design of floating wind turbines. Computational methods in marine engineering III. Trondheim, Norway. Jonkman. J. M., Buhl. Jr. 2007. Load analysis of a Floating Offshore Wind Turbine Using Fully Coupled Simulation. WindPower 2007 Conference & Exhibition, Los Angeles, California, USA. Jonkman, J. 2010. Definition of Floating System for phase IV of OC3. NREL/TP-500-47535. Colorado, USA. Karimirad, M., Meissonnier, Q., Gao, Z., Moan, T. 2011. Hydroelastic code-to-code comparison for a tension leg spar-type floating wind turbine. Marine Structures. (24):412-435. Matha, D. 2010. Model Development and Load Analysis of an Offshore Wind Turbine on a Tension Leg Platform, with a Comparison to Other Floating Turbine Concepts. NREL/SR-500-45891. Ph. D. Dissertation. University of Colorado, USA. Roddier, D., & Christian, C. 2009. WindFloat: a floating foundation for offshore wind turbines. Part I: Design Basis and qualification process. OMAE 2009 79229. Hawaii, USA. Tong KC. 1988. Technical and economic aspects of a floating offshore wind farm. J Win Eng Ind Aerodyn. 74-76:399-10. Tracy, C. 2007. Parametric Design of Floating Wind Turbines. M. S. Thesis. Massachusetts Institute of Technology, USA. Twidell, J., & Gaudiosi, G. 2009. Offshore Wind Power. Multi-Science Pub. Co., United Kingdom. ISBN: 978-09005622-639. Sclavounos, P., Butterfield, S., Musial. W., Jonkman. J. 2005. Engineering Challenges for floating Offshore Wind Turbines. Copenhagen Offshore Wind Conference, Copenhagen, Denmark. Wang CM, Utsunomiya T, Wee SC, Choo YS. 2010. Research on floating wind turbines: a literature survey. The IES Journal Part A: Civil & Structural Engineering. (4):267-77. Wayman, E. 2006. Coupled Dynamic and Economic Analysis of Floating Wind Turbine Systems. M. S. Thesis. Massachusetts Institute of Technology. USA. Withee, J. 2004. Fully Couple Dynamic Analysis of Floating Wind Turbine System. Ph.D. Dissertation. Massachusetts Institute of Technology. USA. http://www.windsea.no/sfiles/07/1/file/windsea.pdf http://www.ieawind.org/task_30/task30_OC4_Semisubmersible.html

65

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table1: Natural frequencies Motion Buoy Spar Semisubmersible Surge Sway Heave Roll Pitch Yaw 0.05166 0.05166 0.32204 0.25751 0.25751 0.49772 0.05643 0.05643 0.05976 0.45862 0.45862 0.11924

TLP 0.14605 0.13594 2.93221 2.91931 2.91931 0.57217

Figure 1: Semisubmerisble and Buoy Spar Platforms

Figure 3: Tension Leg and Semisubmersible Platform

66

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2: Morison Form interaction

Figure 4: Caption from Morison Form

Figure 5: RAO for surge motion

67

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 6: RAO for Sway motion

Figure 7: RAO for Heave motion

Figure 8: RAO for Roll motion

Figure 9: RAO for Pitch Motion

68

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 10: RAO for Yaw motion

Figure 11: Yaw RAO for different depths in buoy Spar platform.

Figure 12: Pitch RAO for different depths in Semisubmersible OC4 platform.

Figure 13: Heave RAO for different depths in Tension Leg Platform.

69

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ARSENIC: ELEMENT CARCINOGENIC AND ANTINEOPLASMATIC Kyrmanidou E, Gkagkalidis K, Kalousis K, Kapathanasis A, Mironidou-Tzouveleki M. A Laboratory of Pharmacology, Medical School, Aristotle University of Thessaloniki. Contact email: kyrmanid@auth.gr

Arsenic (As) is an element that belongs to the Va group of in the periodic table of elements. When heated at atmospheric pressure arsenic sublimes and converts to gas directly without intervening liquid state at 614oC1. The most stable of its isotopes is 73As with a half-life of 80.3 days. Arsenic forms colorless, odorless, crystalline oxides: As2O3 and As2O5 which are soluble in water form acidic solutions. Arsenates, i.e. arsenic salts, are the basis of arsenic contamination of groundwater. It is a well-known poison that has been accused of killing of historical personalities. Due to the fact that arsenic was used by the wealthy class to murder one another, its effectiveness and discreetness it has been called the Poison of Kings and the King of poisons 2. During World War I organoarsenic compounds were used as chemical weapons. Some of them were vesicants, vomiting agents and lung irritants. Arsenic occurs in many minerals, often in conjunction with sulfur and metals, and also as a pure elemental crystal. Industrially metallic arsenic is mostly used for strengthening alloys of copper. Its trioxide is used in the preparation of pesticides, herbicides and insecticides. Lead hydrogen arsenate was used as an insecticide on fruit trees3, but direct contact resulted occasionally in brain damage among those working the sprayers. Moreover, for environmental reasons arsenic-containing chemicals are progressively abandoned. Arsenic is recovered as a side product from the purification of copper. In 2005, China was the top producer of white arsenic (As2O3) with almost 50% world share, followed by Chile, Peru and Morocco, according to the British Geological Survey and the United States Geological Survey4. Most operations in the US and Europe have closed due to environmental reasons. Naturally occurring pathways of exposure include volcanic ash and weathering of arseniccontaining minerals and ores. It is also found in food, water, soil and air. Arsenic is absorbed by all plants, but is more concentrated in leafy vegetables, rice and seafood. Arsenic is extremely poisonous, although in recent studies some species of bacteria are found to be able to use arsenic compounds as respiratory metabolites. In 2008, researchers discovered bacteria that employ a version of photosynthesis in the absence of oxygen with arsenates as electron donors. One strain has been isolated and is found to be related to the family of -Proteobacterium Ectothiorhodospira Shaposhnikovii5. Research on this field is of high importance since physical means are being examined to help clear out contaminated groundwater and soil.

70

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The combination of frequent physical appearance of this element in metals and groundwater and the imprudent use of pesticides, herbicide, insecticides and other arsenic-containing chemicals has led to an obnoxious effect on public health6. In the United States, the maximum allowed concentration in drinking water is 10ppb7. In the European Union elemental arsenic and arsenic compounds are classified as "toxic" and "dangerous for the environment" under directive 67/548/EEC. The International Agency for Research on Cancer (IARC) recognizes arsenic and arsenic compounds as group 1 carcinogens, and the European Union lists arsenic trioxide, arsenic pentoxide and arsenate salts as category 1 carcinogens. Depending on dose and time, exposure to arsenic can cause acute or chronic poisoning, even death8. Potential signs of arsenic poisoning include peripheral neuropathy, cardiomyopathy, and renal failure9. Epidemiological studies have associated arsenic exposure with different types of cancer, i.e. bladder, lung and skin cancer. In contrary to the negative consequences of exposure to the poisonous element lies the therapeutic effect of its trioxide (As2O3). It is produced by heating and reacting with atmospheric oxygen giving usually a dimmer (As4O6)10. This molecule is a hopeful drug for neoplasmatic blood diseases. In recent years, the indications of arsenic trioxide therapy for acute promyelocytic leukemia have been extended from the salvage therapy for relapse patients to the first line treatment of de novo acute promyelocytic leukemia11. Arsenic trioxide acutely increases oxygen consumption and radiosensitizes tumors, providing a new rationale for clinical investigations of arsenic trioxide in irradiation protocols to treat solid tumors12. Recently new research has been done in locating solid tumors administering arsenic-74. In comparison to the previously used iodine-124, this isotope is giving a clearer signal in the PET scan, because the body is transporting iodine to the thyroid, producing a lot of noise13. The mechanism of action of arsenic trioxide is mainly related to the induction of apoptosis (programmed cell death) in cancer cells. In particular it involves effects on the activities of JNK kinases, NF-kB transcription factor, glutathione, caspases, as well as pro- and antiapoptotic proteins. Experiments investigating the effect of arsenic trioxide on cell lines such as glioma and prostate, breast, stomach, liver, and ovarian cancer are in progress14. There are also clinical trials underway aimed at the use of arsenic trioxide with ascorbic acid, retinoid acid, and growth factors in combined therapy15. Arsenic trioxide has shown remarkable efficacy for the treatment of multiple myeloma (MM). Treatment of cultured bone marrow mononuclear cells from MM patients selectively induced apoptosis in myeloma cells while sparing most myeloid cells16. Chemo-resistance to cisplatin-centered cancer therapy is a major obstacle to the effective treatment of human ovarian cancer. Previous reports indicated that arsenic trioxide induces cell apoptosis in both drug-sensitive and -resistant ovarian cancer cells. It is found to target and degrade a class of proteins with high levels of cysteine residues and vicinal thiol groups, such as promyelocytic leukemia protein.

71

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Arsenic is a metalloid that causes multiple biological effects on cells and tissues. Depending on the specific tissue exposed and the time and degree of exposure, diverse responses can be observed. In humans, excessive high dose exposure to arsenic can have a variety of outcomes, i.e. the development of malignancies, severe gastrointestinal toxicities, cardiac arrhythmias, and death. On the other hand, one arsenic compound, arsenic trioxide (As2O3), has important antineoplasmatic properties.

72

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Agency for Toxic Substances, Disease Registry. Case Studies In Environmental Medicine (CSEM): Arsenic Toxicity. Atlanta, GA: Centers for Disease Control and Prevention, US Dept of Health and Human Services Division of Toxicology and Environmental Medicine; 2000. Publication Case studies in environmental medicine (CSEM): arsenic toxicity. Brooks, William E.. "Mineral Commodity Summaries 2007: Arsenic". United States Geological Survey. http://minerals.er.usgs.gov/minerals/pubs/commodity/arsenic/mcs2008-arsen.pdf. Retrieved 2012-05-25. Diepart C. et al.2012 Arsenic trioxide treatment decreases the oxygen consumption rate of tumor cells and radiosensitizes solid tumors. Cancer Res 72(2):482-90 Gokcen, N. A (1989). "The As (arsenic) system". Bull. Alloy Phase Diagrams 10: 1122. Jennewein, Marc; Lewis, M. A.; Zhao, D.; Tsyganov, E.; Slavine, N.; He, J.; Watkins, L.; Kodibagkar, V. D. et al. (2008). "Vascular Imaging of Solid Tumors in Rats with a Radioactive Arsenic-Labeled Antibody that Binds Exposed Phosphatidylserine". Journal of Clinical Cancer 14 (5): 13771385. Kulp, T. R; Hoeft, S. E.; Asao, M.; Madigan, M. T.; Hollibaugh, J. T.; Fisher, J. C.; Stolz, J. F.; Culbertson, C. W. et al. (2008). "Arsenic(III) fuels anoxygenic photosynthesis in hot spring biofilms from Mono Lake, California". Science 321 (5891): 967970. Bibcode 2008Sci...321..967K. DOI:10.1126/science.1160799. PMID 18703741. Lay summary Chemistry World, 15 August 2008. Lawmakers Urge FDA to Act on Arsenic Standards. Foodsafetynews.com (2012-02-24). Retrieved on 2012-05-23. Mi J. 2011 Current treatment strategy of acute promyelocytic leukemia, Front Med. 5(4): 341-7 Peryea, F. J. (2026 August). "Historical use of lead arsenate insecticides, resulting in soil contamination and implications for soil remediation". 16th World Congress of Soil Science. Montpellier, France. http://soils.tfrec.wsu.edu/leadhistory.htm. Rousselot P, Labaume S, Marolleau JP, et al. Arsenic trioxide and melarsoprol induce apoptosis in plasma cell lines and in plasma cells from myeloma patients. Cancer Res. 1999;59:10411048. Sargiotis G, Mironidou-Tzouveleki M. Use of arsenic trioxide in chemotherapy. 13th ESFIE 2007:205. Shao Q.S., Ye Z.Y., Ling Z.Q., Ke J.J.: Cell cycle arrest and apoptotic cell death in cultured human gastric carcinoma cells mediated by arsenic trioxide. World J. Gastroenterol., 2005; 11: 34513456. Tsoukali-Papadopoulou E. Selected topics of toxicology. Parisianou Publications 2008:228. Vahidnia, A.; Van Der Voet, G. B.; De Wolff, F. A. (2007). "Arsenic neurotoxicity a review". Human & experimental toxicology 26 (10): 82332. Vima Science 2007; 24 Jun:58-9. Zhu J., Okumura H., Ohtake S., Nakamura S., Nakao S.: Arsenic trioxide induces apoptosis in leukemia/lymphoma cell lines via the CD95/CD95L system. Oncol. Rep., 2003; 10: 705 709.

73

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Arsenic: element carcinogenic and antineoplasmatic Kyrmanidou E, Gkagkalidis K, Kalousis K, Kapathanasis A, Mironidou-Tzouveleki M. A Laboratory of Pharmacology, Medical School, Aristotle University of Thessaloniki. Contact email:kyrmanid@auth.gr

Abstract Arsenic, an element that belongs to the Va group of the periodic table, is a well-known poison which is guilty not only for the death of historical figures but also for environmental contamination especially of water and air. Its presence in the environment isnt necessarily a product of chemical contamination (pesticides, insecticides etc.) since it occurs as a mineral ingredient. Recent studies have found bacteria that are attracted by regions rich in arsenic and can biochemically transform the strong poison into a less toxic form of it. These properties can prove to be very useful as physical means of clearing out groundwater and soil are being examined. Depending on dose and time, exposure to arsenic can cause acute or chronic poisoning, even death. Epidemiological studies have associated arsenic exposure with different types of cancer, i.e. bladder, lung and skin cancer. In contrary to the negative consequences of exposure to the poisonous element lies the therapeutic effect of its trioxide (As2O3). This molecule is a hopeful drug for neoplasmatic blood diseases. As a result, one arsenic compound, arsenic trioxide (As2O3), is an important means of fighting many forms of cancer. Keywords: arsenic, drugs, cancer, environment.

74

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ARTISTIC EXCHANGES BETWEEN SPAIN AND ITALY: FRANCISCO SALZILLO AND THE MEDITERRANEAN CULTURE. Marina Gacto, Universidad de Murcia, Spain. mgacto@um.es ABSTRACT Our study focuses on the art and culture exchanges between Spain and Italy. The Spanish influence on some artistic and cultural manifestations of Italian southern provinces is in fact rather deep; we analyze here the religious symbols existing in both territories through the study of the Holy Week parades and the nativity scene tradition. In the 18th century, when Charles III occupied the kingdom of the Two Sicilies these religious manifestations became more popular. The monarch was the true leader of artistic changes introduced in these works. As inheritor of this richness and abundance emerges the image of the Murcian sculptor Francisco Salzillo, a true artistic genius whose work evoques the legacy of the Mediterranean magnificence through two main elements: the light and the colour. We point out the need to study the channels of communication across the Mediterranean between workshops, buyers and artists.Our analysis proves how sea and climate have shaped countries, cultures and civilizations that sprung up around these wonderful countries. Keyword: Art, Salzillo, Mediterranean, Culture, Baroque.

75

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

HISTORICAL RELATIONS: THE KINGDOM OF NAPLES

Sardinia, Sicily, Naples and the southern part of the Italian peninsula were first part of the Kingdom of Aragon, and within the arrival of the Catholic Monarchs, became part of the Spanish Kingdom. For the next several decades this area was a matter of dispute between France and Spain. The Frenchs abandoned their claims to the kingdom by the Treaty of Cateau-Cambrsis in 1559. After the War of the Spanish Succession in the early 18th century, Bourbons monarchy took custody of the territory. Both Naples and Sicily were conquered by a Spanish army in 1734, and Charles, Duke of Parma, a younger son of King Philip V of Spain, was installed as King of Naples and Sicily in 1735. When Charles inherited the Spanish throne from his older halfbrother in 1759, he left Naples and Sicily to his younger son, Ferdinand IV. Although the two Kingdoms were in a personal union under the Bourbon kings from 1735 onwards, they remained constitutionally separate. This Spanish presence for four to six centuries left many traces in the customs of this region. One of the most visible are their Holy Week religious parades, which are quite characteristic and famous in Italy. 2 CULTURAL SIMILARITIES: RELIGIOUS PARADES AND NATIVITY SCENES. -Religious parades. During Holy Week, Christians commemorate the Passion, Dead and Resurrection of Jesus Christ. For this period, from Palm Sunday to Easter Sunday, street processions are organised in most Spanish towns each evening. People carry statues of saints around on floats or wooden platforms, within an atmosphere of mourning. This religious traditional exhibition can be also observed in other catholic countries like Mexico, Colombia, Peru, Portugal, France and Italy. Each of them has their own traits and peculiarities, influenced by history, geographical situation and culture. Sicily, Sardinia and southern regions held numerous rites inherited from the domain of Aragon and the Iberian monarchies. Italy brings to light at Easter one of the legacies most neglected by the Spaniards, the Spanish cultural heritage itself. Processions are a classic product of the Counter Reformation and the Council of Trent, whose main exponents were Spain and the Jesuits; this explains the deep influence they had in the 'heel' of the peninsula.

76

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Trapani holds one of the most elaborate processions for Holy Week anywhere in the world, a day long passion procession featuring twenty floats of lifelike wood, canvas and glue sculptures of individual scenes of the events of the Passion. The Misteri the longest religious festival in Sicily and in Italy- are amongst the oldest continuously running religious events in Europe, having been played every Good Friday since before the Easter of 1612, and running out occasionally well beyond the 24 hours. Similar but smaller or shorter passion processions are hold in many other Sicilian cities, like Erice and Caltanissetta, as well as in other various Southern Italian cities, like Salerno and Taranto. Every Good Friday Palermo holds the procession of the Virgen de la Soledad. The same happens in Alghero, a Sardinian town where Catalonian is still spoken. In Campania, a Naples region, there is a Via Crucis formed by two thousand members and instituted by Spaniards down the Mount Vesuvius in 1630. Procida, one of the Flegrean Islands, is also famous because of its processions, the oldest brotherhood being established in 1583. On the other hand, Sorrento is known for the black and white hooded, foreign Manichaeism at the Italian culture, with the mysteries added en 17th century by order of the Spanish viceroy. The costaleros bearing the pasos, these huge floats carrying religious figures made of painted wood on the parades and their distinctive costumes, are not found anywhere else in Italy. During the processions they sing saetas, flamenco verses mourning Christ's passion. This tremendismo and excessive drama are characters genuinely Iberian, exclusive to Spanish country and unattached to religious beliefs. In the city of Rome, center of the Catholic Church, ceremonies are solemn, but with no trace of this tenebrous spirit. Southern processions are intended to be religious scenic performances, but in other Italian cities their Holy Week mixes pagan and religious representations. In Sicily, Spanish past is also very visible at Enna, where Spanish kings established religious confraternities based upon professional associations. In 1740 there were thirteen four of them, and nowadays fifteen still exist. As already mentioned, in Trapani, a city and comune on the west coast of Sicily, the Processione dei Misteri di Trapani, features twenty floats of lifelike wood, canvas and glue sculptures, mostly from the 17th and 18th centuries, with individual scenes of the events of the Passion. Nearby, in San Cataldo, Spanish heritage inhabits in giant papier mache representing the apostles. Catalonian and Spanish footprints are also remarkable in Sardinia; in Cagliari, the capital of the island, religious brotherhoods date from the sixteenth century. All this associations have retained their Spanish traditions intact for centuries. For example, members are called Germans, variation of hermanos (brothers). In Alghero, the week days are named in catalonian Dijous Sant and Sant Divendres, the central passage is the Sant Crist de la Misericordia and the most intense moment, is the Desclavament (unpinning). Many of these

77

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

brotherhoods were also covering liberal sects in opposition to the Bourbons monarchy and become perfect pretences for crimes; thereby in some regions Processions were forbidden. -Nativity scenes. This tradition was disseminated through the Mediterranean territories. In Spain such artistic experience goes back to the sixteenth century, when the Spanish nativity was configured. Over the next century this practice was consolidated and reached its maximum exposure throughout the eighteenth century in Europe, facing competition with the Neapolitan presepe. Bourbon reign marked its period of splendor and gave the typical character that we know today. Free from monastic classes control, became customary and was quickly spread among the estates of nobility. As the result of social and economical reality of these new promoters, cribs started to acquire its own personality with the introduction of different values. When Charles III occupied the kingdom of the Two Sicilies these religious manifestations became more popular. The monarch was the true leader of artistic changes introduced in these works, abandoning the character of modest home craft. In this atmosphere Francisco Salzillo developed his nativity scenes as a consolidated and renowned sculptor. He worked on religious themes, and almost always in polychrome wood. Some of his masterpieces include processional work and his great Nativity scene. With this composition he defined a new Spanish crib model, incorporating Italian traditions.

THE PHENOMENA OF ARTIST EXCHANGE.

Exportation and importation of wooden statues works between Naples and Spain was a very important phenomenon during the European Baroque period. Within this artists movement we can establish a close relationship between Neapolitan and Iberian Peninsula art workshops (Belda Navarro 2006). The Mediterranean shipping of art work and the artist transfer from southern Italy to Spain and viceversa, need further study in order to establish stylistic resemblances. It is quite representative the large number of Italian artists that were born in Spain, building thus connections across seas with their formation. Francisco Salzillo is an example of these relations. He was son of the sculptor Nicola Salzillo from S. Mara Capua Vetere (Caserta Province). Many sculptors went to Spain between the 17th and 18th century. In this sense Jos Martn Gonzlez argues that Spain "was an importer of sculptors" (Martn Gonzlez 1991, 219). Neapolitan art workshops contributed importantly to the development of wood statuary in the 17th and 18th century in Spain. However, it was not just a

78

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

phenomenon of import, but of mutual and fruitful exchange. Many contemporary biographers offer news on some of these artists, like Pietro Ceraso, Aniello and Michele Perrone, students Patalanao, Agostino and Antonio Ferraro Mottola, Nicola Fumo and Giacomo Colombo. 4 THE FIGURE OF FRANCISCO SALZILLO.

All social and cultural changes mentioned above affected the work of Francisco Salzillo. The new elegant and courtesan atmosphere conditioned the conception of his nativity scene figures; this is particularly seen in groups with sacred characters and in the choice of their polychrome and architectural models, intending to match the delicate environment of the bourgeois home. The influence of Mediterranean presepe is evident in the popular conception of the work and also balanced with an almost complete domination of the religious element and the pattern imposed by the devotional image (Belda Navarro, 2007). Dominated by an evangelical narrative source, the result is a new and genuine work conception; a scenario that serves for the adoption of models in polychrome wood sculpture and as an environment functioning like a simple secular reference. For this reason, the work of Salzillo emerges as a new feature in Spanish sculpture and as a European reference as well. Nothing is known about the biography of Nicola Salzillo, neither the reasons of his arrival to Murcia. Snchez Moreno hypothesized "a desire for adventure or perhaps because of relations with a gentleman from Murcia working about Spanish related affairs in Naples" ( Snchez Moreno 1945, 47), pointing out to the immense Spanish appreciation for Neapolitan sculpture, the relations between countries, the fame spread through the book travellers and the multiple artistic connections.

CONCLUSION

We want to point out the need to study these channels of communication across the Mediterranean between workshops and buyers. These are the main actors of the artistic phenomenon studied, fundamental factors that influenced the work of many artists. In this context, we emphasize the figure of Franzisco Salzillo, heir and undisputed genius of the XVIII century.

79

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Belda Navarro, C. 2006. Francisco Salzillo. La plenitud de la escultura. Murcia: Darana. Belda Navarro, C. 2007. Salzillo, testigo de un siglo. Murcia: Comunidad Autnoma de la Regin de Murcia. Martn Gonzlez, J. J. 1991. Escultura barroca en Espaa, 1600-1770. Madrid: Ctedra. Snchez Moreno, J. 1945. Vida y obra de Francisco Salzillo. Murcia: Coleccin Arte no.3.

80

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ASSESSMENT OF AFFILIATION TO PHYLOGENETIC GROUPS (I TO VII) INTO THE Bacillus cereus GROUP AS A VALUABLE TOOL FOR PRACTICAL APPLICATIONS IN FOOD INDUSTRY

Vera Antolinos Lpez, Mara Ros-Chumillas, Julia Weiss, Paula M. Periago Bayonas and Pablo S., Fernndez Escmez, Universidad Politcnica de Cartagena, Spain vera.antolinos@upct.es ABSTRACT

Recently, an 'ecotypic' structure of Bacillus cereus group populations composed of seven major phylogenetic groups (I to VII) has been proposed on the basis of genotypic and phenotypic criteria. Microorganisms members of each group show a specific thermotype and different virulence potentials among an evolutionary transition towards psychrotolerance. This classification system could means a direct practical application for the food industry, because it allows manufacturers to adopt temperature ranges for processing, storage and distribution of food products depending on the risk level associated to food contamination with specific strains of B. cereus sensu lato. Sequence of panC-housekeeping gene is used for B. cereus group affiliation to seven major phylogenetic groups (I-VII) with different ecological niches. Thermal growth range and spore heat resistance of B. cereus group microorganisms varies among phylogenetic groups. Among B. cereus group, Bacillus cereus sensu stricto is a causative agent of food poisoning. We assigned a selection of B. cereus sensu stricto strains related to food poisoning from the Spanish cultivar Collection (Valencia) to group IV strains based on panC gene sequence. To assess the ability of this classification as a valuable tool to manage B. cereus group isolates in food industry heat resistance experiments were performed. Thermal inactivation assays revealed variability of spore heat resistance within these group IV strains showing the need of additional studies to state the feasibility of this classification for practical application in food processing.

Keywords: Bacillus cereus group, panC gene, heat resistance.

81

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION

The classification of B. cereus group microorganisms into seven major phylogenetic groups (I to VII) (Guinebretire et al., 2008), which show specific thermotypes and different virulence potentials, means a direct practical application for the food industry since it allows manufacturers to establish appropriate environmental conditions for processing, storage and distribution of food products depending on the risk level associated to contamination with specific strains of this taxonomic cluster.

In this regard, this classification may lead on the one hand to improve shelf-life and microbiological quality of refrigerated products by detecting psychrotrophic microorganisms belonging to group II and VI, and on the other, to prevent health hazards through discrimination among strains of different phylogenetic clusters, especially for those belonging to group VII, III and IV which may present highest pathogenic potential (Guinebretire et al., 2008).

For successful affiliation to phylogenetic groups (I to VII) a fast and effective homology study of the pantoate--alanine ligase gene (panC) sequence has been proposed (Candelon et al., 2004; Guinebretire et al., 2008). It offers a reliable alternative to solve practical problems at industrial scale derived from the lack of typing techniques able to discriminate between B. cereus group species and strains, and to avoid the use of expensive and time-consuming classical microbiological and biochemical probes used for bacterial identification.

In the present work, a preliminary study was carried out to characterize the practical application in heat processing of major phylogenetic groups. For this purpose we selected five B. cereus sensu stricto strains of diverse isolation origin and virulence/enterotoxin genotype belonging to the Spanish Type Culture Collection (CECT). Origins encompass animals, soil and unspecific contaminations.

We performed a strain assignation to ecotype niches based on partial panC gene sequencing. Characterization of cardinal parameters is a main concern to gain a profound understanding of the relationship between physiology of B. cereus group strains and their phylogenetic affiliation. Our microbiological analysis focused on spore

82

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

heat resistance, thus establishing references for food processing and B. cereus risk assessment. Besides, a phylogenetic analysis of B. cereus group members based on the sequence of panC gene was performed.

Our study is a multivariable approach that combines strains and species h phylogenetic affiliation of isolates with characterization of their spore heat resistance.

2. THE BODY

2.1. Materials and methods

2.1.1. Bacterial strains and growth conditions B. cereus sensu stricto strains used in this study were selected from the Spanish Type Culture Collection (CECT, Valencia, Spain). All the strains used in this study are listed in Table 1. Strains were sporulated in Fortified Nutrient Agar at 30C (Mazas et al., 1995) and stored at -20C until use.

2.1.2. PanC amplification and sequencing

Two primers, panCfor and panCrev, were designed with Primer3 v 0.4.0 (Rozen and Skaletsky, 2000) software for the amplification of panC gene of the B. cereus group species on the basis of panC gene sequence of B. cereus ATCC 14579 (accession number: NP_831320.1) retrieved from the GenBank (Benson et al., 2004) (Table 2). PCR for panC gene amplification of CECT 131, CECT 148, CECT 193 and CECT 4094 strains was carried out in 25 L reaction mixtures containing 5 L 5X Colorless GoTaq Flexi buffer (Promega), 20 M of each dNTP, 0.4 M of the forward and the reverse primer, 2 mM MgCl2, 0.2 L Taq polymerase (GoTaqDNA Polymerase [5 u/L], Promega) and template DNA (50-100 ng/L). The amplification conditions were as followed: initial denaturation for 5 min (94C), 35 cycles of denaturation at 94C (15 s), annealing at 55C (30 s) and extension at 72C (30 s) and final extension at 72C (7 min). PCR was optimized for CECT 4014 strain using HerculaseII Fusion Enzyme kit (Stratagene, La Jolla, CA). The final reaction mixture volume (50 L) contained 10 L of 5X Herculase II Reaction Buffer, 250 M of each dNTP, 0.25 M of each primer,

83

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

0.5 L of Taq polymerase and template DNA (100-300 ng/L). The amplification protocol included one cycle at 95 C for 2 min followed by 35 cycles at 95C for 20 s, 50C for 20 s and 72 C for 30 s, and 10 min of final extension at 72C. PCR amplifications were performed on Applied Biosystem Thermal Cycler 9700 and aliquots of amplicons were visualized on 1 % agarose gels, stained with ethidiumbromide. Automated sequencing of PCR products was performed by Savia Biotech (Almera, Espaa) using panCfor and panCrev primers.

2.1.3. Phylogenetic analysis and affiliation to B. cereus group

Nucleotide sequence alignement and phylogenetic analysis of panC gene between microorganisms of the B. cereus group was performed with the ClustalX 2.1 program applying Neighbour-Joining method (Saitou and Nei, 1987). The analyzed data set also included panC gene sequences of Bacillus species and strains available from the GenBank (Benson et al., 2004) with the following NCBI accession numbers: B. weihenstephanensis (5841679), B. cereus ATCC 10987 (2748449), B. cereus G9842 (7186600), B. cereus AH187 (7073679), B. cereus E33L (3024889), B. cereus AH820 (7191073), B. cereus Q1 (7376764), B. cereus 03BB102 (7689603), B. cereus B4264 (7097070). B. cereus subsp. cytotoxis NVH 391-98 (5346025), B. anthracis str. Ames (1086855), B. anthracis str. A0248 (7853564), B. anthracis str. 'Ames Ancestor' (2815431), B. anthracis str. Sterne (2849787), B. anthracis CI (9454079), B. anthracis str. CDC 684 (7785245), B. thuringiensis str. Al Hakam (4546784), B. thuringiensis BMB171 (9192413) and B. thuringiensis serovar konkukian str. 97-27 (2858358).

Applying the classification system proposed by Guinebretire et al. (2008), panC gene sequences were used to assign the strains to phylogenetic groups I-VII performing the homology search algorithm offered at

https://www.tools.symprevius.org/Bcereus/english.php.

2.1.4. Heat resistance determination of B. cereus sensu stricto spores

Heat resistance determination of sporulated cells on sterile distilled water was carried out using Mastia thermoresistometer (Conesa et al., 2009). At specific time

84

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

intervals, which depended on the treatment temperature (90, 95 and 100C), samples were collected into sterile tubes, diluted, plated onto BHI agar (BHIA; Scharlau, Barcelona, Spain) and incubated at 37C for 24 h. Survival curves were fitted using Geeraerd and Van Impe Inactivation Model Fitting Tool (GInaFIT; Geeraerd et al., 2005). Maximum inactivation rate (Kmax) was obtained from log-linear model. Besides, from the log-linear model with shoulder specific inactivation rate (Kmax) and shoulder length were determined. Root Mean Sum of Squared Errors (RMSSE) (Ratkowsky, 2003) was selected as a measure of goodness of fit. The magnitude of RMSSE should be comparable to the standard deviation (as a measure of the precision of replicates) of the experimental data (Geeraerd et al., 2000).

2.2. Results and discussion

2.2.1. panC gene sequence affiliation

Affiliation of B. cereus strains CECT 131, CECT 148, CECT 193, CECT 4014 and CECT 4094 to the phylogenetic B. cereus groups I-VII was performed by amplification and sequencing of panC gene (Candelon et al., 2004; Guinebretire et al., 2008). Obtained sequences were submitted to the web tool link

https://www.tools.symprevius.org/Bcereus/english.php which performs comparison with known sequences compiled in the database of UMR408, INRA-University of Avignon (France).

Results revealed that B. cereus CECT strains tested in this study belong to group IV. Microorganisms of group IV are generally cytotoxic, some of them even highly cytotoxic. Concerning the toxygenic profile, 100% of tested strains form group IV carried the nhe gene, whereas the genes hbl and cytK2 did not consistently appear in group IV strains (Guinebretire et al., 2010).

On the other hand, this phylogenetic group, which includes B. thuringiensis and B. cereus isolates, has a temperature growth range between 10-45C which selectively determines their prevalence in different food products. Afchain et al. (2008) estimated that the genetic group IV prevailed in milk proteins and starch. Additionally, presence and growth in refrigerated food therefore should not occur, even so growth of strains of

85

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

this mesophilic group in chilled pasteurized vegetables has been reported (Guinebretire et al., 2008).

2.2.2. Phylogenetic analysis of panC gene

We performed a phylogenetic analysis with tree construction in order to study the phylogenetic relatedness of the panC gene sequences obtained in the present work for B. cereus CECT strains with those available at the NCBI GenBank (accession numbers are listed above). We had previously submitted the corresponding panC gene sequences to the web tool link mentioned above for affiliation to phylogenetic groups IVII (Figure 1).

Consistent with results of Guinebretire et al. (2008), the phylogenic tree shows two main branches. One branch clusters members of group III, IV and VI and B. cereus subsp. cytotoxis NVH 391-98 of group VII as a separate entity (Figure 1). Besides, strains from group IV and VI are closer related than those affiliated to group III. CECT B. cereus strains are closely related to other strains of the same species as well as B. thuringiensis and B. weihenstephanensis strains. This phylogenetic assessment is consistent with others previously performed. In 2011, Schmidt et al. reported that some B. cereus strains were significantly more closely related to B. anthracis or B. thuringiensis than they are to other strains of B. cereus. Thus, these results suggest high genetic similarity among B. cereus group species making a challenge differentiation at strain or species level.

2.2.3. Heat inactivation of B. cereus strains affiliated to group IV

To broaden the understanding of B. cereus strains affiliated to group IV concerning thermal processes, we characterized the heat resistance of strains CECT 131, CECT 148, CECT 193, CECT 4014 and CECT 4094 under isothermal conditions at 90, 95 and 100C. Results are summarized in Table 3.

Strain CECT 4094 was the most heat resistant one, followed by CECT 131 and CECT 148, while strains CECT 193 and CECT 4014 are the most heat sensitive ones (Figure 2A).

86

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Shoulder phenomena with length values equal or lower than 0.5 minutes were considered as not significant. Strain CECT 4094 presented a shoulder phenomenon with length values between 23.88 and 31.19 min at 90C, strain CECT 131 with values between 9.35 and 10.93 min and strain CECT 4014 with values between 2.68 and 3.51min. Shoulder length diminished at higher temperatures in a range of 2.4 to 4 times for strain CECT 4094 at 95 and 100C, whereas for strains CECT 131 and CECT 4014, shoulder phenomenon at 95 and 100C was not significant (Figure 2B). Coleman et al. (2007) reported that the length of the shoulder seems to be associated with lethal damage to one or more key spore proteins. Previous studies confirm that shoulders are widely occurring phenomena in heat resistance studies (van Zuijlen et al., 2010).

Augustin (2011) has stated that three different clusters of B. cereus group isolates linked to food poisoning can be defined: a) diarrhoeal, psychrotrophic, heat sensitive strains belonging to the genetic group II, b) diarrhoeal, mesophilic, heat resistant strains belonging to the genetic groups III, IV, V, and VII, and c) emetic, mesophilic, heat resistant strains belonging to the genetic group III. Besides, a ranking of spore heat resistance for B. cereus strains was established by Carlin et al. (2010). Those bacteria belonging to group III and VII were the most resistant to temperature injury, strains included in groups II, IV and V show an intermediate position and group VI members were the most sensitive ones. Heat resistance values of B. cereus strains connected to diarrheal foodborne outbreaks and of B. cereus food and environment strains, among which are included B. cereus affiliated to group IV, have been reported (Carlin et al., 2006) and were clearly higher than those obtained in this study at 90C indicating heat resistance variability among group IV strains. Furthermore, Kmax and shoulder length values obtained also indicate variations within B. cereus CECT strains, especially for B. cereus CECT 4094. 3. CONCLUSION

The assessment of major phylogenetic groups (I-VII) affiliation for practical applications in heat processing showed that B. cereus CECT 131, CECT 148, CECT 193, CECT 4014 and CECT 4094 strains belong to group IV on the basis of panC gene homologies studies. Thermal inactivation assays revealed variability in spore heat

87

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

resistance within these group IV strains indicating the needed of further studies to state the feasibility of this classification for practical application in food processing.

88

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCES LIST Afchain, A.L., Carlin, F., Nguyen-the, C. & Albert, I. 2008. Improving quantitative exposure assessment by considering genetic diversity of B. cereus in cooked, pasteurised and chilled foods. International Journal of Food Microbiology, 128: 165173. Augustin, J.C. 2011. Challenges in risk assessment and predictive microbiology of foodborne spore-forming bacteria. Food Microbiology, 28(2):209-13. Benson, D.A,, Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., & Wheeler, D.L. 2004. GenBank: update. Nucleic Acids Research, 32: Database issue D23-D 26. Candelon, B., Guilloux, K., Ehrlich, S.D., & Sorokin, A. Two distinct types of rRNA operons in the Bacillus cereus group. 2004. Microbilogy, 150: 601-611. Carlin, F., Fricker, M., Pielaat, A., Heisterkamp, S., Shaheen, R., Salonen, M.S., Svensson, B., Nguyen-the, C., & Ehling-Schulz, M. 2006. Emetic toxin-producing strains of Bacillus cereus show distinct characteristics within the Bacillus cereus group. International Journal of Food Microbiology, 109: 132-138. Carlin, F., Brillard, J., Broussolle, V., Clavel, T., Duport, C., Jobin, M., Guinebretire, M.H., Auger, S., Sorokine, A. & Nguyen-Th, C. 2010. Adaptation of Bacillus cereus, an ubiquitous worldwide-distributed foodborne pathogen, to a changing environment. Food Research International, 43(7): 1885-1894. Coleman, W.H., Chen, D., Li, Y.Q., Cowan, A.E. & Setlow, P. 2007. How moist heat kills spores of Bacillus subtilis. Journal of Bacteriology, 189(23): 8458-8466. Conesa, R., Andreu, S., Fernndez, P.S., Esnoz, A., & Palop, A. 2009. Nonisothermal heat resistance determinations with the thermoresistometer Mastia. Journal of Applied. Microbiology, 107: 506-513. Frankland, G.C. & Frankland, P.F. 1887. Studies on some new micro-organisms from air. Philos Trans. R. Soc. Lond. B. Biol. Sci., 173: 257-287. Geeraerd, A.H., Herremans, C.H. & Van Impe, J.F. 2000. Structural model requirements to describe microbial inactivation during a mild heat treatment. International Journal of Food Microbiology, 59: 185209. Geeraerd, A.H., Valdramidis, V.P., & Van Impe, 2005. J.F. GInaFiT, a freeware tool to assess non-log-linear microbial survivor curves. International Journal of Food Microbiology, 102: 95-105. Guinebretire, M.H., Thompson, F.L., Sorokin, A., Normand, P., Dawyndt, P., EhlingSchulz, M., Svensson, B., Sanchis, V., Nguyen-The, C., Heyndrickx, M., & De Vos, P. 2008. Ecological diversification in the Bacillus cereus Group. Environmental Microbiology, 10: 851-865.

89

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Guinebretire, M.H., Velge, P., Couvert, O., Carlin, F., Debuyser, M.L. & Nguyen-The, C. 2010. Ability of Bacillus cereus group strains to cause food poisoning varies according to phylogenetic affiliation (groups I to VII) rather than species affiliation. Journal of Clinical Microbiology, 48: 3388-3391. Lapidus, A., Goltsman, E., Auger, S., Galleron, N., Segurens, B., Dossat, C., Land, M.L., Broussolle, V., Brillard, J., Guinebretiere, M.-H., Sanchis, V., Nguen-the, C., Lereclus, D., Richardson, P., Wincker, P., Weissenbach, J., Ehrlich, S.D. & Sorokin, A. 2008. Extending the Bacillus cereus group genomics to putative food-borne pathogens of different toxicity. Chemico-Biological Interactions, 171: 236-249. Lereclus, D., Arantes, O., Chaufaux, J., Lecadet, M. 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiology Letters, 51: 211-217. Mazas, M., Gonzlez, I., Lpez, M., Gonzlez, J., & Martn-Sarmiento, R. 1995. Effects of sporulation media and strain on thermal resistance of Bacillus cereus spores. International Journal of Food Sciences Technology, 30: 71-78. Ratkowsky, D.A. 2003. Model fitting and uncertainty. In: Modeling Microbial Responses in Foods. McKellar, R., Lu, X. (eds), 151-196. Boca Raton: CRC Press. Rozen, S and Skaletsky, H.J. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology, Krawetz S, Misener S (eds), 365-386. Humana Press, Totowa, NJ,. Saitou, N., & Nei, M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4: 406-425. Schmidt, T.R., Scott, E.J. & Dyer, D.W. 2011. Whole-genome phylogenies of the family Bacillaceae and expansion of the sigma factor gene family in the Bacillus cereus species-group. BMC Genomics, 12:430. van Zuijlen, A., Periago, P.M., Amzquita, A., Palop, A., Brul, S., & Fernndez, P.S. 2010. Characterization of Bacillus sporothermodurans IC4 spores; putative indicator microorganism for optimisation of thermal processes in food sterilization. Food Research International, 43: 1895-1901.

90

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Web references https://www.tools.symprevius.org/Bcereus/english.php. Last access 06/07/2011. Contact: Guinebretire, M.H (Institut national de la recherche agronomique, Avignon, France).

Figure 1. Genetic relationship among B. cereus Group strains based on panC gene. Neighbour-Joining method (Saitou and Nei, 1987) was used for inferring three topology. Bootstrap values (10000 bootstrap replicates) are shown in the major nodes. Strains affiliation to major phylogenetic groups is designated by VII, VI, IV and III which correspond to phylogenetic groups VII, VI, IV and III, respectively.

Figure 2. Survival curves (A) at 90C of B. cereus CECT 131 (), B. cereus CECT 148 (), B. cereus CECT 193 (), B. cereus CECT 4014 (x) and B. cereus CECT 4094 (+) and (B) of B. cereus CECT 131 at 90C (), 95C () and 100C ().

91

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1

92

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2

93

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 1 Bacterial strains used in this study Abbreviation CECT131 CECT148 CECT193 CECT4014 CECT4094 Bt407 KBAB4 Strain Bacillus cereus CECT 131 Bacillus cereus CECT 148T (type strain) Bacillus cereus CECT 193 Bacillus cereus CECT 4014 Bacillus cereus CECT 4094 Bacillus thuringiensis Bt407 Bacillus weihenstephanensis KBAB4 Source CECT CECT CECT CECT CECT INRA INRA Reference Frankland and Frankland, 1887 Frankland and Frankland, 1887 Frankland and Frankland, 1887 Frankland and Frankland, 1887 Frankland and Frankland, 1887 Lereclus, et al., 1989 Lapidus et a.l, 2008

CECT, Spanish Type Culture Collection; INRA, National Institute of Agronomy Research, France.

94

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 2 PCR primers used in this study Target panC gene Primer panC for panCrev Primer sequence (5 3) CGTAAGGCAAGAGAAGAAAA TCCTTCGACTTTCTCTACCA Product size (bp) 651 Tm (C) 50/55

95

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 3 Effect of heat treatments on B. cereus sensu stricto strains


90C 95C Strain
131

100C
Sl (min)
0,75 0,00 0,00 0,00 0,19 0,00 0,00 0,00 0,00 0,00 0,00 0,46 9,06 9,95 10,19

Sl (min)
9,35 10,93 10,22

kmax (1/min)
0,23 0,24 0,23 0,30 0,28 0,30 0,42 0,47 0,49 0,43 0,45 0,45 0,13 0,09 0,11

RMSSE
0,15 0,11 0,10 0,19 0,17 0,27 0,18 0,17 0,19 0,12 0,05 0,11 0,26 0,06 0,09

Sl (min)
3,34 4,85 4,13 0,00 0,00 0,45 0,13 0,47 0,51 0,00 0,00 0,00 7,08 7,67 8,66

kmax (1/min)
0,73 0,81 0,73 1,30 1,37 1,39 1,48 1,51 1,77 2,12 2,02 2,07 0,36 0,37 0,35

RMSSE
0,25 0,14 0,13 0,10 0,12 0,08 0,29 0,27 0,25 0,26 0,20 0,22 0,19 0,16 0,25

kmax (1/min)
0,78 0,78 0,74 1,99 2,14 2,08 2,14 2,05 2,08 1,94 1,45 1,21 0,37 0,38 0,39

RMSSE
0,48 0,33 0,21 0,29 0,18 0,11 0,32 0,20 0,19 0,31 0,39 0,29 0,31 0,29 0,26

148

0,00 0,00 0,00

193

0,00 0,00 0,00

4014

3,30 3,51 2,68

4094

28,61 23,88 32,19

Sl, Shoulder length; Kmax, Maximun inactivation rate or Specific inactivation rate; RMSSE, Root Mean Sum of Squared Errors.

96

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ASSESSMENT OF BY-PRODUCTS FROM FRESH-CUT PRODUCTS FOR REUSE AS BIOACTIVE COMPOUNDS: OBTAINING A WATERMELON JUICE FUNCTIONAL.

Martha Patricia Tarazona Daz, Universidad Politcnica de Cartagena, Espaa. mtarazona@upct.es

ABSTRACT

The fresh-cut industry is constantly growing and produces thousands of tons of waste in nonedible portions that present an environmental and management problem. These by-products could be reused, in particular, to obtain bioactive compounds. Five different fresh-cut watermelon cultivars were assessed for their flesh and by-product bioactive contents. The
amount of by-product varied between 31.27 and 40.61% of initial fresh weight (f.w.) depending on the cultivar. Watermelon rind offers quantitative interest as a natural source of citrulline,

particularly Fashion, adark-skinned, seedless cultivar. More research is required on the efficient extraction of citrulline from watermelon rind and its suitability as an additive to drinks, juices or others products to produce new functional food products with valid health claims. Watermelon juice was enriched in L-citrulline and the application of heat treatment at 80C for 40 seconds was enough to reduce the microbiological counts and avoid pathogen growth, resulting in a shelf-life of 25 days when the juice was stored at 4C. L-citrulline is absorbed much better if it is a compound of the watermelon juice than administered as a pharmaceutical dissolution and its reduced muscle pain after 24 hours of physical exercise.

Keyword: By-products, bioactive compounds, L-citrulline, watermelon juice, Caco-2.

97

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION The industry of minimally processed fresh fruit and vegetables produces a large amount of waste from the inedible parts (peel, seeds, etc). These residues cause significant environmental problems and management. An alternative would consist of the reuse of functional compounds to develop new food products (Tarazona-Daz et al., 2012). For example, these compounds can be incorporated into juices to obtain functional drinks helping to improve health and/or reduce the risk of disease. The consumption of fruit juices emerges as an alternative to supplement the daily dietary recommendations in consumption of fruits and vegetables. Watermelon juice is something innovative as it is not yet in the market, and could be well accepted due to its sensory properties and its content of lycopene and citrulline.
Citrulline is a non-essential amino acid that is found in the skin and pulp of watermelon (Rimando and Perkins-Veazie., 2005; Tarazona-Daz et al., 2011). It possesses good antioxidant potential and is

an excellent vasodilator. 2. RESEARCH

2.1. Assessment of by-products from fresh-cut products for reuse as bioactive compounds. Initially, byproducts obtained from fresh-cut products such as apple, potato, cucumber, melon and watermelon, were characterized to determine the nutritional and functional value. The amount of byproducts obtained during the fresh-cut operation was in the range of 10 to 30% depending on the kind of product. The byproducts were characterized as poor in protein (< 2%) and fat (< 0.5%). The content of carbohydrates ranged from 4.37 and 23.5% and that of total dietary fibre was between a 2 to 15%. Levels of phenolic compounds (12.45 to 425.02 mg 100 g-1) and antioxidants (5.36 to 345.32 mg 100 g-1) depended on the type of by-product analyzed. In most cases, the concentration of bioactive compounds was higher in the skin than in the edible portion. Apple skin was rich in carbohydrates, antioxidants, total polyphenols (Figure 1), together to watermelon and melon skins, were rich in fibre. All by-products, except apple skin, had an important content in minerals. The potato skin had a high level of iron and potassium. Watermelon and cucumber were rich in calcium, phosphorus, sodium, manganese and zinc. The cucumber skin had a high concentration of chlorophyll (71.83 mg 100 g-1 bh). The pH (4.33 to 6.48) and moisture content (75.2 to 92.7%) of these by-products defined them as perishable, being a substrate suitable for the development of microorganisms.

98

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

400 300 100

Total antioxidant Phenolic Content Vitamin C

80

mg 100 g-1

60

40

20

0 Apple Potato Cucumber By-products Melon Watermelon

Figure 1. Total antioxidant capacity (mg AAE 100 g-1), total phenolic content (mg CAE 100 g-1), and total vitamin C of by-products from fresh-cut and vegetables. Means (n = 4) standard error.

2.2. Influence of time and temperature on functional compounds of watermelon and cucumber byproducts. Therefore they require adequate storage conditions. For this reason, duration of storage time (0, 4 and 8 days) and temperature of storage (10, 20 and 30C) was studied on watermelon and cucumber byproducts. In general, during storage, a slight increase of the pH and a reduction in the SST and the TA was observed. The reduction of the bioactive compounds was significant, particularly when time of storage was extended to 8 days. In that condition, the antioxidant activity reduced 30 to 49.72% and phenolic compounds by 52 to 61%. These reductions were higher when the temperature was 30C. Storage conditions which provided minor functional losses consisted of the use of shorter periods of time (4 days) and low temperatures (10C). 2.3. Bioactive compounds from flesh and by-product of fresh-cut watermelon cultivars. Influence of variety of minimally processed watermelon on physiochemical and bioactive compounds was studied. Pulp and skin were analyzed in order to know the potential of this fruit to obtain functional compounds. The watermelon varieties studied were with seeds (diploid) as Azabache, seedless (triploid) as Fashion, Motril and Boston and open-pollinated as Kudam, with black rind (Fashion and Azabache) or striped (Motril, Boston and Kudam). The byproduct yield ranged between 31.27 and 40.61% and was influenced by the variety. In general, all the watermelon varieties were relatively poor in antioxidant capacity and it obtained similar values between skin and pulp (4.69 versus 4.34 mg AAE 100 g-1 fw). However, the concentration of polyphenols and citrulline was significantly higher in the skin

99

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

than in the pulp, 45.8 versus 38.9 mg CAE 100 g-1 fw and 3.34 versus 2.33 g citrulline kg-1 fw (Figure 2 and 3). The lycopene content ranged between 11.6 pulp and 14.6 mg kg-1 (Table 1).

600

ab
500

a A c B A b B ab B

Rind Flesh

mg CAE kg -1 f.w.

400

300

200

100

0 Fashion Azabache Motril Cultivars Kudam Boston

Figure 2. Total phenolic content (mg CAE kg1 fw) of watermelon rind and flesh of different cultivars. Means (n = 5).
8

a
Rind Flesh

g citrulline kg-1 f.w.

bc
2

b B B

c D

0 Fashion Azabache Motril Cultivars Kudam Boston

Figure 3. Citrulline content (g kg1 fw) of watermelon rind and flesh of different cultivars. Means (n = 5) followed by the same letter are not significantly different (p 0.05) according to LSDs multiple range test. Lowercase letters compare rind samples and capital letters compare flesh samples.

100

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 2. Color parameters, texture and lycopene content in flesh watermelon of different cultivars Hue CI Texture Lycopene (1 to 9) (mg kg-1) Fashion 30.93z c 46.06 a 8.2 a 14.26 a Azabache 35.56 a 37.6 c 7.8 a 11.62 b Motril 30.63 c 46.58 a 7.0 b 13.18 ab Kudam 31.30 b 41.82 b 8.0 a 13.11 ab Boston 32.22 b 41.88 b 8.2 a 12.92 ab
Values are means (n = 5). Letters within a column followed by the same letter are not significantly different (p 0.05), according to LSDs multiple range test.
z

2.4. Optimization of the Production of Watermelon Juice: Acidification, Centrifugation, Pasteurization and Storage Temperature. When the significant concentration of L-citrulline in the watermelon byproduct was discovered, research on functional watermelon juice was studied. Physical treatments, such as centrifugation and pasteurization, followed by cold conservation at 4 and 8C up to 30 days were studied. In addition, more compatible organic acid was added to reduce the pH of watermelon, including citric and malic acid, and concentrated lemon juice. Optimization of watermelon juice required the addition of citric acid (0.05 M). It was the most compatible acidifier that provided a proper sensory quality similar to natural watermelon juice. The global quality of an un-centrifuged juice was much better than centrifuged. The effect of centrifugation reduced significantly the red colour, functional quality (Figure 3) and the acceptability of the product (Figure 4).

12 11 10 9 8 7 6 5 0
-1

C-4C C-8C NC-4C NC-8C

Licopene mg kg-1

10

15

20

25

30

Storage days

Figure 3. Lycopene content (mg kg ) of watermelon juice centrifuged (C) and not centrifuged (NC) pasteurized at 87.7 C for 20 s and kept 30 days at 4 C and 8 C. Mean (n = 3) SD.

101

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

9 8

C-4 C C-8 C NC-4C NC-8C

Overall acceptability (1-9)

7 6

Limit consumption
5 4 3 2 1 0 5 10 15 20 25 30 Storage days

Figure 4. Overall acceptability of watermelon juice centrifuged (C) and not centrifuged (NC) pasteurized at 87.7 C for 20 s and kept 30 days at 4 C and 8 C. Mean (n = 10) SD.

2.5. Influence of pasteurization temperature on the bioactive compounds a functional watermelon juice. The application of heat treatment at 87.7C for 20 seconds was enough to reduce the microbiological counts and avoid pathogen growth. However, the functional quality (mainly lycopene), and the sensory quality (colour, aroma and flavour) were affected, resulting in a shelf-life of 20 days when the juice was not centrifuged and stored at 4C. Therefore other lower thermal treatments were explored (72.2, 80 and 87.7C for 20 seconds) in a functional watermelon juice enriched with L-citrulline (12 g L-1). The pasteurization at 72.2 C for 20 seconds did not produce significant differences (versus natural watermelon juice) in the content of lycopene and citrulline. However, the use of 80C resulted in a reduction of 20.25% in lycopene and 18.74% in citrulline level (Figure 5). The watermelon juice was low in vitamin C and all pasteurization treatments reduced the concentration; 20% when applying 72.2C, or 40% at 80C. The use of 87.7 C provided a very poor functional compound juice and was rejected by the reduction in sensory parameters, rating below the commercial limit. The temperature of 80C was selected as suitable for pasteurization, providing an average quality from the functional, microbiological and sensory quality criteria.

102

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

15 14

g citrulline L-1

13 12 11 10 2 0 ZSTT 72,2 C 80 C 87,7 C Treatment

b c

Figure 5. Citrulline content (g L1 fw) of watermelon juice functional, pasteurized at 72.2; 80 y 87.7C for 20 s. Means (n = 3) SD, followed by the same letter are not significantly different.

2.6. Influence of time of pasteurization and conservation on the quality of watermelon juice. After establishing the heat treatment temperature as 80C, times of 40 and 90 s were studied in functional watermelon juice stored up to 30 days at 4C. It was observed that pasteurization at 80C for 90 s, together with the extension of the time of storage, especially from day 20, provided juice with a lower content of lycopene and citrulline than when they were pasteurized for 40 s. Pasteurization at 80 C for 40 to 90 s decreased the enzymatic activity of POD, PME and PG. The greatest inactivation was obtained in PME; 85.9% (40 s) and 88.3% (90 s), followed by POD (74.11% (40 s) and 88.52% (90 s)). The lowest percentage of inactivation was achieved in PG of 11.73% (40 s) and 15.57% (90 s). During storage, both pasteurization treatments achieved a stable enzyme activity. The rheological properties at frequencies between 0 and 40 Hz slowly began to decrease at day 25. The limiting factor to establish the shelf life of the watermelon juice was the sensory quality. Pasteurization at 80 C for 40 s achieved a shelf life of 25 days versus 15 days for juice treated for 90 s. Therefore, 80C for 40 s was selected as optimal temperature and duration of pasteurization, which provided an appropriate value for functional, sensory and shelf life. 2.7. Study in vitro of watermelon juice enriched in L-citrulline in a model of human intestinal epithelial cells. However, it was necessary to know the fraction of the amino acid L-citrulline that is absorbed in the cells and the real amount used by the body (the bioavailability). An in vitro study of intestinal absorption of L-citrulline in Caco-2 cells was performed using three treatments

103

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

(control, juice of watermelon without heat treatment (ZSTT) or a juice pasteurised at 80C for 40 s (ZTT) (Figure 6).

Figure 6. Human colon carcinoma cell line (Caco-2), expansion phase observed in inverted optical microscope (20X).

The initial speed of absorption present in ZSTT and ZTT citrulline was higher than the control (solution standard of citrulline) indicating that this amino acid is absorbed much better if it is a compound of the watermelon juice than administered as a pharmaceutical dissolution. In general, the highest absorption of citrulline was obtained after 8 minutes of cellular transport, with ZSTT which reaching the highest percentage (18.87%). 2.8. Effect of watermelon juice functional in sport performance. Finally, this manuscript demonstrates the functionality of the watermelon juice enriched in Lcitrulline on asthenia, specifically, against the recovery after an intense physical exercise using a maximum of effort test as cycloergometer. Seven sportsmen were supplied with 3 types of beverages: juice of natural watermelon, watermelon juice enriched with L-citrulline or placebo. Pedaling (r.p.m), heart rate (l.p.m), perceived exertion, muscle pain and blood lactate concentrations were evaluated. After ingestion of each treatment, no significant differences were found, except in the reduction of muscle pain after 24 hours following administration of either watermelon juice.

3.

CONCLUSION

This paper has the objective to contribute to the implementation of a sustainable, fresh minimum processing industry, where the byproducts can be reused to design functional products at a reasonable cost, helping to protect the environment and human health.

104

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Rimando, A.M., Perkins-Veazie, P.M. 2005. Determination of citrulline in watermelon rind. J. Chromatogr. A., 1078, 196-200. Tarazona-Daz, M., Viegas, J., Moldao-Martins, M., Aguayo, E. 2011. Bio-active compounds from flesh and by-product of Spanish fresh-cut watermelons cultivars. J. Sci. Food Agr., 91, 805-812. Tarazona-Daz, M., Aguayo, E. 2012. Assessment and reuse of by products from fresh-cut products. Food Sci Tech Int. Accepted.

105

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ASSESSMENT OF MINIMUM ENVIRONMENTAL STREAM FLOWS BY DIFFERENT METHODS IN MEDITERRANEAN BASINS. CASE STUDY: SEGURA BASIN

ngel Garca Garca, Francisco Pellicer Martnez, Javier Senent Aparicio University of Murcia, Spain angel.garca7@um.es, francisco.pellicer@um.es, javier.senent@um.es ABSTRACT Due to stringent existing regulations on rivers, and the need to achieve water resource goals, it is necessary to establish a regulating infrastructure for stream flows in order to maintain the river ecosystem. Currently there are many different methods to determine minimum stream flows. In this study, hydrologic, hydraulic, hydrobiological and geomorphological methods have been tested. These methods were compared, and an analysis of the minimum environmental stream flows were obtained through the different methods. In this study, the minimum environmental stream flows have been obtained for three different gauging stations situated in the Segura basin, whose climatic conditions are typical of a Mediterranean semiarid region. As result of the application of these different methods, a twenty percent difference between results was identified. This variability in results makes it necessary to review the methods and identify which one is most appropriate for each case study.

Keyword: hydrology, semiarid, regulation

106

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION As a result of the increasing demand on water resources, and due to the fact that this demand is out of phase compared to the available resources this regulation is necessary. That is why many rivers are severely regulated (Garca Jaln, 1987), modifying natural flow pattern, and affecting all the aquatic and land habitats associated (Bunn, 2002). As a result, we are forced to establish a environmental flow structure.. Setting these minimum environmental flows is a complex problem, and public awareness of its importance has grown recently. First studies about this issue were performed in the United States in the seventies (Tenant, 1976). These studies set a minimum environmental stream flow in order to protect fish farms... As time went by, an environmental river flow system was established, required for maintaining the hydrologic and biologic function of the river (Martinez-Capel, 1999), instead of setting a minimum environmental stream flow. This way, besides magnitude, other considerations are taking into account, for example, frequency, seasonality, duration or change rates, which also characterize natural flow regimes too. From all the characteristics that must be set to define an environmental flow regime, the magnitude represented by the minimum environmental stream flow was evaluated, due to the fact that this component is more decisive in order to establish the environmental flow regime. Flow river regime is the main component that determines its fluvial and land ecosystem associated. There are many different hydrologic regimes because it depends on several climatologic, orographic and geologic conditions of the basin. Thus, there does not exist any one methodology that can be used in a universal way for every basin, or applied to the entire stretch of a river.

107

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2 METHODOLOGY

Selected methods in order to define the minimum environmental stream flows in a semiarid basin like Segura basin are described in this paper. However, other methods could be used as can be seen in the reference list (Magdaleno Mas, 2005 and 2009).

2.1

dQp Method or based on moving average

With respect to dQp methods, they start from daily flow series, and are based on the determination of average flows whose lengths are d days, that are not exceeded p per cent of total years The most widely used dQp method is 7Q10, which has been used in the United States from the seventies. Besides, there are other standards that can be used too, as for example 7Q1, 7Q2, 7Q5, 7Q25, or other rates with different moving average, like 30Q10, 4Q3, 90Q10, Recents researches developed in Spain (Baeza et al., 2005), and applied in the Tajo basin, has suggested the use of the 25 days lowest moving average as the most representative index to obtain the environmental flow in a year. According to the results obtained in that research, it could be shown in dry season graphs that there is an important slope change around day 25 that suggests the use of this index to obtain moving average.

2.2

qQ Method or based on percentiles

This type of methods are based on a frequency serie analysis. They study percentiles of daily flow duration curve. They are a particular case of dQp methods, being d equal to 1, and taking into account exceeded probability. The most widely used qQ method are Q95 and Q90 (same as 1Q5, 1Q10 mentioned before). There are also references that use Q75, Q84, Q97, Q98 y Q99.

2.3

Qbm method

Qbm method, also called maintenance of the basic flow method, is a method which was born and developed in Spain (Palau, 1994; Palau and Alczar, 1996). It is based on the study of the moving average of the daily flows series, that discover types of irregularities or

108

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

discontinuities throughout the series that are associated to environmental alteration thresholds of the fluvial system. One of the variables that can be determined using this methodology is the basic flow Qb, which is considered as the absolute minimum environmental stream flow to maintain in the river bed. This is the most important element of the Qbm method, due to the fact that other parameters are obtained from that one. Basic flow, Qb, is calculated independently every year using moving averages applied to growing intervals of consecutive data (medium average flow), at the level of 1 to 100 (Alczar Montero, 2007).

RESULTS

As is shown in figure 1, described methods have been applied to three different gauging stations located in the headwaters of the Segura river. Daily data in natural systems have been used (MIMAM, 2011; CHS, 2011). The duration of the series that have been studied is over 15 years. [Figure 1 here] All the results obtained have been compared with the annual daily average flow, Qma, according to the period of time considered, this way, obtained results can be compared with another gauging station or between different rivers. [Table 1 here] Results point out that lowest values for the minimum flow are obtained applying Qq method. The highest values of minimum environmental stream flows are produced applying dQp method using d parameter equal to 30 and q equal to 10. [Figure 2 here] Applying Qb method, it can be stated that minimum flows are obtained in the early days, as is shown in the following figure. [Figure 3 here]

109

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

4 CONCLUSION

As was derived from the results of the study, it can be seen that the choice of one method or another leads to results that can be very different. This difference can reach up to 20 per cent depending on what method is used. This important flow range points out that the methods of calculation of minimum environmental stream flows should be further evaluated, in order to improve the way these environmental flows are set. The present study reports that several methods must be used in each river stretch, in order to identify which method adapts better to the environmental characteristics being studied, , comparing it to flows that could be obtained applying geomorfological or hydrobyological methods. According to the results obtained in this study, it could be concluded that it is not necessary to calculate each interval between 2 and 100. It could be sufficient to study between intervals 2 to 30. This is due to the fact that applying Qb method, where the minimum environmental stream flow is the one with the biggers relative increment, it can be stated that this increment is produced in the first intervals. In conclusion, the present study reports that further research should be orientated to find the relation between minimum flows and basic flows.

110

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Alcanzar Montero; Jorge (2007): El mtodo del caudal bsico para la determinacin de caudales de mantenimiento. Aplicacin a la cuenca del Ebro. Tesis doctoral Universidad de Lleida Bunn, S. E, Arthington AH. (2002) Basic principles and ecological consequences of altered flow regimes for aquatic biodiversity. Environmental Management 30 (4): 492-507. Condefederacin Hidrogrfica del Segura. Estadsticas hidrolgicas. www.chsegura.es Garca de Jaln, D. (1987) River regulation in Spain. Regulated Rivers: Research and Management 4 (1) Magdaleno Ms, Fernando (2005). Caudales ecolgicos: conceptos, mtodos e interpretaciones. CEDEX 2005, Mnisterio de Fomento (2005) Magdaleno Mas; Fernando (2009). Manual Tcnico de clculo de caudales ambintales. Colegio de Ingenieros de Caminos, Canales y Puertos,( 2009) Martnez-Capel, F. y Garca de Jaln, D: 1999. Curvas de preferencia de microhabitats de Leuciscus pyrenaicus y Barbus bocagei por muestreo subacuatico en el ro Jarama ( Cuenca del Tajo, Espaa). Limnetica, 17. MINAM (2011) Anuario de Aforos 2008-09 Palau, A. (1994) Los mal llamados caudales ecolgicos. Obras Pblicas. Ros II. N 28. Palau, A; Alcazar J. (1996); The basic flow: an alternative approach to calculate minimum environmental stream flow. Proceedings 2nd international Symposium on Habitat Hydraulics Ecohydraulics 2000, vol.A pags.547-558. Quebec, Canada. Tennant, D. L. (1976). Instream Flow Regimens for Fish, Wildlife, Recreation and related Enviromental Resources. Proc. of Instream flow needs Symp.:326-327.

Figure 1: Gauging Stations.

Source: Propia.

111

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 1: Minimum Flows obtained divided by Qma.


Lietor Anchuricas Novia 7Q10 0,19 0,26 0,29 21Q10 0,25 0,34 0,31 25Q10 0,25 0,34 0,33 30Q10 0,26 0,36 0,34

Source: Propia.

0,22 0,25 0,25

Qb

2Qmed 0,22 0,24 0,24

0,06 0,06 0,13

Q95

0,06 0,06 0,13

Q90

0,08 0,07 0,14

Q75

Figure 2: Obtained Results.

Source: Propia.

Figure 3

112

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Source: Propia.

113

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CACTUS PEAR FRUITS AS SOURCE OF A BIOACTIVE FOOD COLORANT Pedro J. Gimnez, Juan I. Moreno, Jos M. Angosto, Jos A. Fernndez-Lpez, Technical University of Cartagena (UPCT), Spain pj_gimenez0@hotmail.com

ABSTRACT Fruits with additional health-promoting and nutritional benefits, such as cactus pears are increasingly gaining momentum for consumers, health professionals and food scientists. Betalains are water-soluble, nitrogen-containing pigments, of growing interest as natural food colorants. They are present in most plants belonging to the Caryophyllales and are characterized by different colours due to the combination of the red-purple betacyanins and the yellow-orange betaxanthins. In this work, the betalain content in Opuntia ficusindica fruits is evaluated. Carotenoids and polyphenols are also measured. In addition, the flavonoid content is determined by HPLC with diode array detection. Furthermore, free radical scavenging properties are investigated. The results showed a strong antioxidant and colorant capacity in these fruits. This study provides basic information on the presence of bioactive compounds in cactus pear fruits in order to predict a promising future to them for commercial food applications, especially as colorant in soft drinks and dairy derivatives. Keyword: Opuntia, cactus pear fruits, natural food colorant

114

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1.

INTRODUCTION

Betalains are natural water-soluble pigments associated in most plant families of the Caryophyllales, including the Cactaceae (Zrid and Christinet, 2004). The chemical structure of these pigments derives from the betalamic acid (Strack et al., 2003). Depending on the components boned to the main structure, we can find two groups of betalains: the red-violet betacyanins and the yellow-orange betaxanthins (Fig. 1). Betacyanins are mainly present in the red beet root (Beta vulgaris) and in the redskinned cactus pear fruits. The most abundant betacyanins are betanin, isobetanin, and betanidin. Indicaxanthin is one of the most important betaxanthin, and it is the main pigment in yellow-skinned cactus pear fruits.

Figure 1. Chemical structure of betalains

Natural pigments from plants are of growing interest as substitutes of synthetic colorants in the food and pharmaceutical industry (Wissgott and Bortlik, 1996). Recently there has been increasing interest in betalains since some studies have pointed to their possible bioactive effects (Escribano et al., 1998). It has added an extra value to betalains, not only for their colorant capacity, but also because of their beneficial effects on human health.

2.

BETALAINIC PLANTS: OPUNTIA SPP.

The use of cactus pear fruits as betalain source is an interesting possibility because they show better nutritional properties than other betalainic plants. Until some years ago, only red beet (Beta vulgaris) had been considered as a source of betacyanins. However, several studies have been made concerning their presence and their stability in Opuntia fruits (Odoux and Domnguez-Lpez, 1996; Fernndez-Lpez and Almela, 2001).

115

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Moreover, cactus pear fruits do not show toxicity or allergic reactions, and this plant has minimal soil and water requirements, so may be considered an alternative for the agricultural economy of arid and semi-arid regions. Opuntia ficus-indica is the most extensively studied Opuntia species. Its fruits can be an important source of betaxanthins. Opuntia stricta is the most important source of betacyanins in Opuntiaspecies, and it may be considered an alternative of red beet (Beta vulgaris) as natural red colorant. In this work the colorant capacity of yellow-skinned cactus pear fruits is determined, their bioactive properties are also evaluated and the stability of the pigment extract is tested in order to assess its potential as natural food colorant.

3.

COLORANT CAPACITY OF CACTUS PEAR FRUIT

To determinate the colorant capacity, yellow-skinned cactus pear fruits were harvested in Murcia at maximum full maturity (Fig. 2). The fruits were hand-picked, separated into peel and pulp tissues, frozen and stored at -25 C until being used. The homogenized pulp was magnetically stirred for 20 min using ethanol:water (60:40 V/V) as solvent, in a 1/5 m/V ratio of fruit/solvent. Then, the pigment extracts were centrifuged at 15000g at 10 C for 20 minutes. The visible spectrum of the extract was recorded using a UV-visible spectrophotometer. The total betaxanthin content was referred to indicaxanthin, using a molecular extinction coefficient (=48000 L mol-1 cm1 ) at 470 nm.

Figure 2. Cactus pear fruits and indicaxanthin structure The results revealed a high betaxanthin content (209.4 g / g fresh pulp) in the cactus pear fruits analyzed. This level of betaxanthins is higher than those reported for Italian cactus pears (Butera et al., 2002) and it is similar than content found in some Mexican cultivars (Castellanos-Santiago and Yahia, 2008).

116

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

4.

BIOACTIVE PROPERTIES OF BETALAINS

Natural antioxidants obtained from plant-based extracts are currently subject on intensive research. Natural antioxidants from dietary sources include phenolic and polyphenolic compounds, antioxidant vitamins and enzymes, carotenoids and flavonoids. Therapeutic properties of the green parts of cactus pear (Opuntia ficusindica) have very long been known in the traditional medicine (Cornett, 2000; Knishincky, 1971). However, potential activities of the fruits, beyond nutritional benefits, have been explored only recently (Livrea and Tesoriere, 2006). In recent years, we have been investigating about the possibility of using cactus pear fruits as source of natural pigments (Fernndez-Lpez et al., 2002; Castellar et al., 2003; Castellar et al., 2006; Fernndez-Lpez et al., 2007; Obn et al., 2009). Due to the polyphenolic nature of betalains, joined to the presence of other antioxidant substances in the cactus pears fruit extracts it is interesting the evaluation of the bioactivity in these pigment extracts. Total phenolics were measured by UV/VIS spectrophotometry, based on a colorimetric oxidation/reduction, using the Folin-Ciocalteu reagent as oxidizing agent (Galati et al., 2003). The absorbance was measured at 760 nm, and the results were expressed in mg of gallic acid per 100 g of fresh fruit. Carotenoid determination was carried out by UV/VIS spectrophotometry. Previously, 5 g of fruits were extracted with 25 ml of hexane/acetone/ethanol (50:25:25, v/v) and centrifuged for 5 min at 5000g at 5 C. The top layer was recovered and transferred to a 25 ml volumetric flask and adjusted to 25 ml with hexane. The absorbance was measured at 450 nm using an extinction
% coefficient of -carotene, E1cm = 2505 (Rodrguez-Amaya, 2001). Flavonoid aglycones 1

(myricetin, quercetin, kaempferol, isorhamnetin and luteolin) were quantitatively analized by HPLC using as stationary phase a 5 m Spherisorb ODS2 column (4.6 x 250 mm). Previously, a solid-phase extraction (SPE) was carried out. Flavonoid identification was based on comparison of HPLC retention times with their respective standards. Table 1 summarizes the composition in pigments, phenolics and individual flavonoids detected in the Opuntia fruits. There are several papers on the antioxidant activity of betalains. Red beet is included between the ten plants with the highest antioxidant power (Halvorsen et al., 2002), but recently there is increasing evidence that Opuntia fruits also show a high activity (Feugang et al., 2006). Stintzing and coworkers have reported that the in vitro antioxidant activity of betalains in Opuntia fruits is even higher than that showed by the ascorbic acid (Stintzing et al., 2005). Table 1. Betaxanthins, carotenoids, total phenolics and flavonoids in extracts of yellowskinned cactus pear fruits.

117

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Betaxanthins Carotenoids Total phenolics Miricetin Quercetin Kaempferol Isorhamnetin Luteolin

209.4 3.5 0.03 0.01.5 2773.5 13.7 2.02 0.12 1.03 0.11 Not detected 3.50 0.35 Not detected

All data are shown in g/g fresh weight

The cactus pear fruit juice showed antioxidant activity in the DPPH test, probably due to the phenolic compounds that are effective radical scavengers. The preventive administration of the juice inhibited the ulcerogenic activity of ethanol in rat. Light microscopy observations showed an increase in mucus production and the restoration of the normal mucosal architecture. The juice is nutritionally interesting, and its dietary intake could provide protection against oxidative damage (Galati et al., 2003). It has been also corroborated that betanin and indicaxanthin can be in human LDLs increasing the resistance to oxidation (Tesoriere et al., 2004). 5. STABILITY OF BETALAINS

The stability of betalains is affected by pH, temperature, oxygen, and light (Sapers and Hornstein, 1979). As regard to pH stability, one of the major problems with natural colorants is their low stability. For example, in the case of water-soluble pigments, anthocyanins have proved to be very labile in acid medium. In the case of betalains, they are ionized at low pH and undergo colour changes at pH under 3.5 but they are not hydrolyzed, so these pigments can be used as colorants in acidic foods. The maximum stability of betalains is between pH 5.0 and pH 6.0. The thermolability of the betalains is probably the most restrictive factor in their widespread use as food colorants. Betaxanthins are more sensitive than betacyanins to thermal degradation. The thermal stability of the betalains is greatest between pH 5.0 and 6.0. Betalains are more sensitive to temperature than other natural red food colorants as anthocyanins or red cochineal. Betalains are also susceptible to lightdegradation. The photochemical destruction of these pigments involves molecular oxygen and is also pH-dependent, greater degradation occurring at pH 3.0 than at pH 5.0. Involvement of molecular oxygen in betalain degradation is not restricted to photooxidation, it has been implicated in thermal degradation as well. Pigment losses are reduced through nitrogen purging of colorant extracts. Metal ions, common food constituents or contaminants from processing equipments may function as pro-oxidants (Hendry and Houghton, 2005).

118

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

6.

CONCLUSION

Opuntia ficus-indica fruits can be used as source of betaxanthins, natural water-soluble yellow pigments for food colorant. The betaxanthin extract showed an important content of antioxidant constituents as carotenoids and phenolic compounds. This investigation confirms the potential of yellow-skinned cactus pear fruits as an important source of bioactive compounds in order to predict a promising future to them for commercial food applications, especially as colorant in soft drinks and dairy derivatives which can be produced at temperature below 40 C.

119

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Butera, D., L. Tesoriere, F. Di Gaudio, F. Bongiorno, M. Allegra, A.M. Pintaudi. 2002. Antioxidant activities of Sicilian prickly pear (Opuntia ficus-indica) fruit extracts and reducing properties of its betala.ins: betanin and indicaxanthin. Journal of Agricultural and Food Chemistry 50: 6895-6901. Castellanos-Santiago, E., E.M. Yahia. 2008. Identification and quantification of betalains from the fruits of 10 Mexican prickly pear cultivars by high-performance liquid chromatography and electrospray ionization mass spectrometry. Journal of Agricultural and Food Chemistry 56: 5758-5764. Castellar, M.R., J.M. Obn, J.A. Fernndez-Lpez. 2006. The isolation and properties of a concentrated red-purple betacyanin food colorant from Opuntia stricta fruits. Journal of the Science of Food and Agriculture 86: 122-128. Castellar, M.R., J.M. Obn, M. Alacid, J.A. Fernndez-Lpez. 2003. Color properties and stability of betacyanins from Opuntia fruits. Journal of Agricultural and Food Chemistry 51: 2772-2776. Cornett, J. 2000. How Indians used desert plants. Natural Trails Press. USA. Escribano, J., M.A. Pedreo, F. Garca-Carmona, R. Muoz. 1998. Characterization of the antiradical activity of betalains from Beta vulgaris L. roots. Phytochemical analysis 9: 124-127. Fernndez-Lpez, J.A., L. Almela. 2001. Application of high-performance liquid chromatography to the characterization of the betalain pigments in prickly pear fruits. Journal of Chromatography A 913: 415-420. Fernndez-Lpez, J.A., M.R. Castellar, J.M. Obn, L. Almela. 2007. Monitoring by liquid chromatography coupled to mass spectrometry the impact of pH and temperature on the pigment pattern of cactus pear fruit extracts. Journal of the Chromatographic Science 45: 120-125. Feugang, J.M., P. Konarski, D. Zou, F.C. Stintzing, C. Zou. 2006. Nutritional and medicinal use of cactus pear (Opuntia spp.) cladodes and fruits. Frontiers in Bioscience 11: 2574-2589. Galati, E.M., M.R. Mondello, D. Giuffrida, G. Dugo, N. Miceli, S. Pergolizzi, M.F. Taviano. 2003. Chemical characterization and biological effects of Sicilian Opuntia ficus-indica: antioxidant and antiulcerogenic activity. Journal of Agricultural and Food Chemistry 51: 4903-4908. Hendry, G.A.F., J.D. Houghton. 2005. Natural Food Colorants. Kluwer Academic Publishers, Amsterdam. Knishinsky, R. 1971. Prickly pear cactus medicine. Healing Art Press, Rochester, Vermont. Livrea, M.A., L. Tesoriere. 2006. Health benefits and bioactive components of the fruits from Opuntia ficus-indica. Journal of the Professional Association for Cactus Development 8: 73-90. Obn, J.M., M.R. Castellar, M. Alacid, J.A. Fernndez-Lpez. 2009. Production of a red-purple food colorant from Opuntia stricta fruits by spray drying and its application in food model system. Journal of Agricultural and Food Chemistry 90: 471-479. Odoux, E., A. Domnguez-Lpez. 1996. Prickly pear: an industrial source of betalains. Fruits 51: 61-78. Rodrguez-Amaya, D.B. 2001. A guide to carotenoid analysis in foods. ILSI Human Nutrition Institute Press, Washington DC.

120

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Sapers, G.M., J.S. Hornstein. 1979. Varietal differences in colorant properties and stability of red beet pigments. Journal of Food Science 44: 1245-1248. Stintzing, F.C., K.M. Herbach, M.R. Mosshammer. 2005. Color, betalain pattern, and antioxidant properties of cactus pear (Opuntia spp.) clones. Journal of Agricultural and Food Chemistry 53: 442-451. Strack, D., T. Vogt, W. Schliemann. 2003. Recent advances in betalain research. Phytochemistry 62: 247-269. Tesoriere, L., M. Allegra, D. Butera, M.A. Livrea. 2004. Absorption, excretion, and distribution of dietary antioxidant betalains in LDLs: Potential health effects of betalins in humans. American Journal of Clinical Nutrition 80: 941-945. Wissgott, U., K. Bortlik. 1996. Prospects for new natural food colorants. Trends in Food Science and Technology 7: 298-302. Zryd, J.P., L. Christinet. 2004. Betalains. In Plant pigments and their manipulation, ed. K. Davis, Ann Plant Rev 14. Oxford/UK-Victoria/Australia.

121

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CARTOGRAPHICS RE-INTERPRETATIONS Ana del Cid Mendoza, University of Granada, Spain anadelcid@ugr.es ABSTRACT City is a very complex phenomenon to which we approach from many fronts. The recent research, carried out by the author, tries to do it from the study of its shape and successive mutations suffered, using pictures and reflection about themselves as the main research tool; and specifically the drawing of an architect, which is used as a basic tool of work and takes part of the process of understanding, creation and formalization of an idea. This research has the hypothesis that, although historical data of a city like Granada are well known and I cant be added information in this field without being a professional historian, I can provide a different kind of knowledge: the development of an own historical cartography that helps, on an immediate and intuitive way, understanding the history of the city, reflecting its own morphologic evolution and viewing the problems that currently affect the city and were born in the past. All these mechanisms for analysis and transcription of data, from different sources, to an only map are precisely the concept cartographic re-interpretation referred by the title of this presentation. Keyword: Granada, Urban History, Historical Cartography, New Maps, Interrelated Sources

122

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

City is a very complex phenomenon to which we approach from many fronts: city as an artifact or object in the territory; city as a place where people and their ideas relate; city as a piece of art, as a cultural construction carried out along the history; city as a hybrid space for the infiltrations of other virtual spaces that arise with the technological innovations The research I began in 2009, on the issue Patrimonio Histrico y Ciudad Contempornea in the school of post degree of the University of Granada, originated the work Ensayos para la reinterpretacin grfica de la historia urbana de Granada, in which the approach to the city is done from the study of its shape and successive mutations suffered, using pictures and reflection about drawing as the main research tool; and specifically the drawing of an architect, which is used as a basic tool of work and takes part of the process of understanding, creation or formalization of an idea. Graphic material production depends primarily of the observer-draftsman. This one is the reason by which an emotional link is established between this one and the object drawn already if this one is a building, a city or a landscape. Drawing is always a way of personalizing. So, drawing a city is to catch this city forever. My research, with many own maps, is about my hometown and it was born from my love for it. 2 MOTIVATION

What is a city today? Something certain is its character as living organism in crisis; and as such, it requires the recognition of historical events to understand its current reality. To interrelate past and present events and even to venture future facts it seems to be fundamental in a moment in which the conflict has been sharpened between the modern city and the historical one. Italo Calvinos text La Ciudad y La Memoria 5, in his Invisible Cities, shows a series of contradictory feelings that are born from urban changes: En Maurilia se invita al viajero a visitar la ciudad y al mismo tiempo a observar viejas tarjetas postales que la representan como era antes [] Para no decepcionar a los habitantes hace falta que el viajero elogie la ciudad de las postales y la prefiera a la presente, aunque cuidndose de contener dentro de lmites precisos su pesadumbre ante los cambios: reconociendo que la magnificencia y prosperidad de Maurilia convertida en metrpoli, comparada con la vieja Maurilia provinciana, no compensan cierta gracia perdida, que sin embargo se puede disfrutar ahora slo en las viejas postales, mientras que antes, con la Maurilia provinciana delante de los ojos, de gracioso no se vea realmente nada, y

123

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

mucho menos se vera hoy si Maurilia hubiese permanecido igual, y que de todos modos la metrpoli tiene este atractivo ms: que a travs de lo que ha llegado a ser, se puede evocar con nostalgia lo que fue 1. 3 METHODOLOGY

The tittle Ensayos para la reinterpretacin grfica de la historia urbana de Granada refers to three features of this work. One of them is obviously the subject, which has already been spoken before, and the other two refer to the research methodology employed. First, ensayar is to test or to recognize something before using it, that is what is tried in this case with the city of Granada as object of test and reflection. Also it is possible to apply the meaning of ensayo, as the writing in which the author develops his ideas, to the presentation of the results of this research, in a document where descriptive texts, chronological references, cartography, other drawings and pictures appear together in an almost spontaneous form. On the other side, the concept cartographic re-interpretation refers to the labor of returning to draw an existing mapping and to extract from the resultant drawing some conclusions, and refers to the production of new drawings that spin a historical speech according with the traditional written story. That is the essence of this work of investigation: the own production of a historical cartography that facilitates the immediate and intuitive comprehension of the complex history of the city of Granada, the reflection on its morphologic evolution and the visualization of the problems that affect the city nowadays and come from the past. All these mechanisms of analysis and transcription of information, from different sources, to a map are precisely the concept cartographic re-interpretation referred by the title of the work. 4 OBJECTIVES

Along the research new maps were generated for Granada, with diverse methods, and like views of the city in different periods: 4.1. Maps that re-draw some of the most relevant historical maps of Granada. To draw on the drawn is to read, to recognize, to analyze intentions or even to discover mistakes in the city.

Fragment of Las ciudades y la memoria.5 in: Calvino, I. Las ciudades invisibles. Madrid: Ediciones Siruela, 1994.

124

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In this case the own nature of the research imposed the first criterion for the selection of the maps: only those representations of Granada that served as instruments of the architectural discipline and that in their moment they were conceived as a reflex of the physical reality of the city for the reflection and the planning of the urban form, should be used in this research. After this, another selection was done choosing those especially significant pictures, for the historical time that they represent or for the conditions or objectives of their elaboration or for the scientific information that they contribute. After adopted these criteria, the maps of the test were: Ambrosio de Vicos map (late 16th century): it is in rigor the first urban map of Granada, and without bearing in mind its limitations and intentions, it is a reflex of the new Christian city of the 16 th.
[Figure 01]

Francisco Dalmaus topographic map (1796): with important cartographic innovations, echo of the illustrated advances, which not only has been used in this work for the study of the modern city (between 16th and 18th century) also for the analysis of the Hispanic-Muslim city, being the most ancient map that represents of faithful and closely form the urban plot of Granada at the end of the Nazar period.
[Figure 02]

Map Seco de Lucenas Arabic Granada (1910): it is an excellent piece in the mapping of the beginning of the 20th century interested in the representation of the Islamic past of the city. It does very important contributions on the tracing of the walls and on the location of relevant constructions and other infrastructures.
[Figure 03]

Map Antonio Orihuelas Nazar Granada (1995): it is one of the results of a long investigative career at the Center of Arabic Studies. The interest of this map is on the tracing proposed for the successive walls and on the location and periods of use of the Muslim cemeteries.
[Figure 04]

4.2. Maps that represent and describe the stages of growth of Granada on the current mapping. This allows to place in the today city non-existent elements, destroyed in another time or not constructed, exploiting this quality of the drawing to superpose two times in the same space. This one is a relevant quality if we understand that the real city is not only the constructed one, also it is real the one that was constructed in the past or the one that was only an imagination or a dream. The ideas of city that have been transmitted, playing in it a fundamental role the Cartography, have determined the ideological and cultural substratum for later urban interventions.

125

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

[Figure 05] - [Figure 13]

4.3. Maps of photographic paths. These maps and four photographic series complete this mechanism of relation between the old city and the contemporary one, extracting of the abstraction of the map historical elements showing them in their current condition.
[Figure 14] - [Figure 15]

4.4. Schemes. Other less complex drawings were realized to illustrate ideas raised along the research.
[Figure 16]

4.5. Texts. Though the drawing guided always the investigation, additional there is written material in different forms: - Description of the geographical conditions. - Description of the transformations of the urban plot of Granada, with the context of the political, economic, social and cultural events from the first settlements of population until ends of the 18th century. - Relation of the Regulation of Building in Granada, from the first Royal Letters until the appearance of the modern town planning in the 19th century. - Chronology with the urban and architectural milestones related to the topic of work, with the intention to place the events of Granada in a more universal context. 5 CONCLUSION

All these reinterpretaciones cartogrficas try to be a visualization of the interrelationship that takes place, with specially intense when the object of reflection is the metropolis, between the whole diverse range of documentary sources, material vestiges, philosophical reflections, cartographic, pictorial or literary images, scientific investigations and socio-economic studies. So, the conclusion is a historical recognition of Granada and its relation with the current city, as well as the experimentation of the cartographic drawing as method of research. The new resultant maps constitute a useful material to study intentions in the realities of the past, and lost opportunities; to imagine or to feel elements today absent; to read invariants urban; or to discover places with potential to be activated. Maybe so we might reach an understanding of the historical city of a different way to this that tries to embalm it, and instead produce interventions which integrates last memory to the needs of a city that aspires to be modern.
[Figure 17]

126

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

Acale Snchez, F. Plazas y paseos de Granada: de la remodelacin cristiana de los espacios musulmanes a los proyectos de jardines en el ochocientos. Granada: Universidad de Granada / Editorial Atrio, 2005. Adroher, A. M. y Lpez, A. Excavaciones arqueolgicas en el Albaicn (Granada). I. Callejn del Gallo. Granada: Fundacin Patrimonio Albaicn-Granada, 2001. Anguita Cantero, R. La ciudad construida: control municipal y reglamentacin edificatoria en la Granada del siglo XIX. Granada: Diputacin Provincial de Granada, Coleccin Biblioteca de Ensayo n 36, 1997. AA.VV. La arquitectura del Islam Occidental. Barcelona: Lunwerg Editores, 1995. Barrios Roza, J. Granada: Historia urbana. Granada: Comares, 2002. Bosque Maurel, J. Geografa urbana de Granada (ed. facs. del original de 1962, Zaragoza, Consejo Superior de Investigaciones Cientficas). Granada: Universidad de Granada, 1988. Calatrava Escobar, J y Ruz Morales, M. Los planos de Granada: 1500-1909. Cartografa urbana e imagen de la ciudad. Granada: Diputacin de Granada, 2005. Garca Bellido, A.; Torres Balbs, L.; Cervera Vera, L.; Chueca Goitia, F.; Bidagor Lasarte, P. Resumen Histrico del Urbanismo en Espaa (1 ed. publicada en 1954) 3 ed. Madrid: Instituto de Estudios de Administracin Local, 1987. Gay Armenteros, J. Granada contempornea. Breve historia. Granada: Comares, Serie Granada, 2001. Isac Martnez de Carvajal, A. Historia urbana de Granada. Formacin y desarrollo de la ciudad burguesa. Granada: Don Quijote, 1982. Jerez Mir, C. La forma del centro histrico de Granada: morfologa urbana, tipologa edificatoria y paisaje urbano. Granada: Tesis doctoral, 2002. Malpica Cuello, A. Granada, ciudad islmica. Mitos y realidades. Granada: Universidad de Granada, 2000.

127

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Orfila Pons, M. Catlogo de la Exposicin: Granada en poca romana. Florentia Iliberritana. Granada: Junta de Andaluca, Consejera de Cultura, 2008. Orfila Pons, M y Sotomayor Muro, M. Discurso pronunciado por la Ilma. Sra. D. Margarita Orfila Pons en su recepcin acadmica y contestacin del Ilmo. Sr. D. Manuel Sotomayor Muro (Acto celebrado en el paraninfo de la Facultad de Derecho el da catorce de enero). Granada: Real Academia de Bellas Artes de Granada, 2002. Vies Millet, C. Historia urbana de Granada (2 edicin, 1999). Granada: Centro de Estudios Municipales y de Cooperacin Internacional, 1987.

128

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 01

Figure 02

129

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 03

Figure 04

130

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 05

Figure 06

131

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 07

Figure 08

132

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 09

Figure 10

133

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 11

Figure 12

134

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 13

Figure 14

135

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 15

Figure 16

136

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 17

137

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CLEAN RENEWABLE BLUE ENERGY

S. Ahualli, M.M. Fernndez, G. Iglesias, M.L. Jimnez, K. Rudzka Dep. Applied Physics, School of Sciences University of Granada, 18071 Granada. Spain mdelmarf@ugr.es

ABSTRACT

The search for renewable energy resources is an inevitable race against the damage of our planet. Although solar and wind energy are leading this race, there has been a breakthrough in the field of blue energy research or also called salinity difference energy. This energy can be gained by mixing two kinds of water with different salinity. The idea was formulated first in 1954 by R. Pattle in Nature (Pattle 1954, 660). Mixing 1 m3 of fresh river water with a large amount of sea water gives a mixing energy of 2 MJ. If one would like to extract the same amount of energy from fresh water via conventional hydropower one would need a dam with a height difference of 200 m. Here we present capacitive mixing as a novel principle for electricity generation from the mixing process. Capmix is a collaborative research project in the field of Future Emerging Technologies for Energy Applications. This project is funded by the European Unions Seventh Framework Program FP7 2007/2011.

Keyword: blue energy, salinity difference energy, electric double layer, carbon electrodes.

138

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

The mediterranean sea has important rivers that discharge large amounts of fresh water into it. The river Nile, for example, discharges on average 1820 m3 /s. The power available in the form of salinity difference in this case can be estimated to be ~ 6 GW. That is to say, if the average electrical consumption in Egypt is 154 W per person, we would satisfy the current electricity demand of Cairo and Alexandria (35 millions of people) . How does this process take place exactly? When two solutions are brought together, dissolved species like ions will tend to distribute evenly over both solutions. This tendency for mixing is the driving force that can be used to extract energy. To harness this energy, mixing must proceed in a controlled way, that is to say, the mixing process must be connected to an electricity generating process. In the process here described, it is the exchange of solutions in a high-surface area capacitor which is used, instead of mixing, as we will explain below. In a solution containing salt, a conductive particle can store a certain amount of excess charge either positive or negative on its surface within the interfacial area. This is the so-called double layer, a classic topic in colloid science and electrochemistry. This accumulated charge will be even higher if the interfacial area is larger. Moreover, the ionic content of the medium is another aspect to take into account, as the capacitance of the EDL depends significantly on it.
Figure 1: Principle of energy generation via the externally-charged capacitive mixing process. Picture A shows the external charging process in sea water, while picture B shows the energy generating discharge in fresh water.

Source: <www.capmix.eu>

139

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1 shows the principle lay-out of the capacitive energy extraction based on Double Layer Expansion (CDLE). First, the capacitor is charged in sea water. This is done via an external power source and the capacitor is charged to a certain potential. If this charged capacitor is then separated from the source, left in open circuit and brought into contact with fresh water solution (Figure 1B), the potential of the capacitor rises as a result of the expansion of the double layer. The reason is that at lower ionic strength, the capacitance is smaller so we find an increase of the potential for a given charge. The capacitor is then finally discharged and energy can be harnessed. After that, the process starts again by charging again in sea water. Overall there is a transport of salt from sea water to fresh water i.e. mixing has taken place.

BASIS OF THE TECHNIQUE

The key to success in the understanding and optimization of energy production lies in the knowledge of the behaviour of the EDL present in both electrodes which are part of our capacitor. The electrodes are made of nanoporous carbon particles in order to increase the accumulated charge. In this part of our paper, we would like to present both simulation and experimental work, which have brought us to a better understanding of blue energy.

2.1

Cell Model Method Applied to the Modelling of Blue Energy

Our aim is to describe the charge-potential relationships in activated carbon electrodes when contacted with solutions containing 20 mM and 600 mM KCl (the ionic strengths of fresh and sea water, respectively) and predict the power density production by the electrodes. As mentioned, the process involves the charging and discharging of porous electrodes in contact with, alternatively, fresh and salt water (Brogioli 2009, 058501; Brogioli, Zao and Biesheuvel 2011, 10.1039; La Mantia, Pasta nad Deshazer 2011, 1810).
Figure 2. The cell model used for the calculations.

CELL MODEL
b a

a 1/ 3 = b
equilibrium (a ) = dequilibrium dr
r =b

=0

Q=

(r )4r dr
2 a

4 3 b 3

140

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Using cell models (Carrique, Cuquejo, Arroyo, Jimnez and Delgado 2009, 43), as schematically shown in Fig. 2, the porous electrode is simulated as a swarm of spherical particles: the volume fraction of solids controls the porosity, and their average size gives us the pore size. The electric potential can be calculated at each point with the Poisson Equation: 1 (1) 2 (r ) = {ez + c + (r) + ez c (r)}

m 0

Where is the electrostatic potential at each position, z is the valence of cations and anions, c their concentrations and 0 and m the electric permittivity of the vacuum and the solvent respectively. This equation is solved together with the Boltzmann distribution:
c (r ) = c exp z e (r ) / k BT

(2)

c being the equilibrium concentration far from the particle surface, k B the Boltzmann

constant and T the absolute temperature. The boundary conditions are shown in Figure 2. The second one comes from symmetry consideration and allows EDL overlap.
Figure 3: The charge-potential relationships in porous electrodes, for different salt concentrations.

Fig. 3 is an example of the potential vs. charge relationship in different cases. Note, in particular, that the potential for a given charge is higher in fresh than in sea water. This means that if the charging is performed in sea water and the discharging occurs in fresh water, a net amount of energy will be received from the system.

141

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.2

Theoretical Predictions

We show below calculations of charge-potential relations for a wide range of electrode configurations. The porous electrode characteristics will be observable at a glance considering the differential capacitance of the electric double layers filling the interparticle regions in the superelectrode. Fig. 4 shows how the capacitance increases with the potential and the volume fraction of solids (that is, it decreases when the porosity increases).
Figure 4: The specific capacitance of the porous electrode for increasing volume fractions of solids (decreasing porosities).
R=10 nm = 65% c = 20 mM c = 300 mM c = 600 mM

1010

C(F/m3)

109 108 10 100

(mV)

Assume that, as shown in Figure 5, the electrodes are charged at, say, 100 mV in contact with sea water, then they are separated from the power source or capacitor used for charging, and fresh water is let into the pores. In such situation, the electrodes are connected to an external load, this leading to discharge. The final step is contacting again with sea water and charging. The area enclosed by the cycle (energy produced during this charge minus energy input from the battery) is a measure of the maximum energy available, amounting to 2.19 MJ per cubic meter of porous electrode.
Figure 5: Schematics of the charging-discharging processes in capacitive mixing.
300 240 20 mM

(mV)

180 120 60 0 0

600 mM

7.5 MJ/m3 (192 mV) 2.19 MJ/m3 (100 mV) 1x108 2x108 3x108

Q (C/m )

142

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Calculations of energy density production are presented in different conditions (Table 1). Note that the capacitive mixing device would yield up to several MJ per m3 of carbon electrode in each cycle. This figure can be considerably reduced if the volume fraction of solids is lowered, as this means a lesser amount of solid/liquid interface. Also, the expected result is confirmed that larger particle size (meaning smaller pore diameter) also leads to the reduction of energy density production. Less intuitive and more model dependent is the effect of the charging voltage, which, in any case, must be kept below 1 V to avoid Faradaic reactions at the electrodes.
Table 1. Estimations of power density production in the capacitive mixing technique. Salt concentrations: 20 mM and 600 mM.

V0 (mV) 100 100 90 90

R (nm) 10 10 100 100

(%) 35 65 35 65

W (MJ/m3) 2.19 4.16 0.18 0.33

2.3

Electrode Development

As a brief description of our work in the laboratory, we will present how we carry out the cycles to extract energy and how we assemble the electrodes with the carbon nanoporous particles. We work with platinum electrodes which we cover with carbon particles and are closed by a filter and a washer, as shown in Figure 6. Thus we allow enough wettability as well as the compaction needed for success in the production of energy.
Figure 6: electrodes assembly

Then it is needed to perform the whole cycle of Figure 5. To that aim, we have an automatic exchange system depicted in Fig. 7. First, we charge our capacitor with a commercial supercapacitor (which plays the role of the battery) up to a certain potential (typically in the few hundred mV range). Secondly, we open the circuit and change from sea to fresh water. Thirdly, we charge our battery with the excess of charge from our capacitor. Finally, opening the circuit, we introduce salt water again and the cycle can be performed from the beginning.

143

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 7: automatic exchange system

In Figure 8, we present the experimental results when the capacitor is charged at 600 mV. We found an important voltage rise of 70 mV. This excess potential can be used to send charge back to the battery during the discharge, as it can be seen. However, a continuous leakage is superimposed on the successive steps of the whole cycle. Reducing this leakage will be our target in the next steps of our research.
Figure 8: a whole cycle
700 680 660 640 620

V=70 mV

Potencial (mV)

600 580 560 540 520 500 480 460

CAPMIX Cell Source


100 150

t (min)

We also calculate the power of the cycle. That is approximately 350 mW/m3 of each electrode or 3.5 mW/kg mass of carbon. This is yet a preliminary result and hopefully, more investigation will lead to an improvement of the power harvesting.

144

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSION

We conclude that blue energy holds great promise to become an economical and environmental energy resource, available throughout large parts of the world although the technology to economically harvest this energy has not been developed yet. This process needs in the first step an input of electrical charge, but, in the second step, more energy can be gained due to the potential increase. Moreover, the electrical work is made available without the use of any kind of electromechanical converters as dynamos or turbines. Finally, this type of energy generation is inherently clean as this process is based on natural mixing processes, which happens anyway in river deltas and estuaries. Neither CO 2 nor thermal contamination will occur. This energy source is renewable as it is based on the hydrological cycle powered by the sun.

145

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

Brogioli D., Physical Review Letters, 103, (2009) p. 058501. Brogioli D., Zhao R. and Biesheuvel P. M., Energy Environ. Sci., (2011), DOI: 10.1039/C0EE00524J Carrique F., Cuquejo J., Arroyo F.J., Jimnez M.L. and Delgado A.V., Adv. Colloid Interface Sci. 118, (2009) p. 43. La Mantia F., Pasta M., Deshacer H.D., Logan B.E., Cui Y., Nano Lett. 11, (2011) p. 1810. Pattle R.E., Nature 174, (1954) p. 660.

146

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

COMMUNICATION STRATEGIES FOR THE USE OF THE ICT IN THE CAMPUS MARE NOSTRUM Fernando Medina and Elena Hernndez, Universidad de Murcia and Universidad Politcnica de Cartagena, Espaa medinavidal1@hotmail.com ABSTRACT The University, as one of the quintessential social institutions, is also undergoing a process of profound change, framed in the overall social changes fostered by technological innovation and, above all, by the development of ICT, by changes in social relations and by a new conception of the relations technology-society that determine technology-education relationships. The introduction of ICTs in educational institutions conclusively influences the different communication processes both internal and external, especially when dealing with the university teaching field and the wider education community, as a center conductor of many aspects that refute the excellence in research, teaching and innovation. In this sense, the means, media, techniques and communication tools are expanded, modifying the framework of relations between members of the university teaching community. In this context, from an applied perspective, it is interesting to analyze the communication strategies of the recent Campus Mare Nostrum in the region of Murcia as to show from the beginning the communication process of a structural nature, both internally and externally, that will be reflected in the positioning and the projected image of the institution. Keyword: institutional communication, ICT, Campus Mare Nostrum, educational innovation

147

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1.

INTRODUCTION

The institutional communication is one of the areas of science that has experienced higher growth in recent years, both for its impact on the interested externalization of their ideal identification and for the relevance that projected image affects the development of the organization and further, for the efficacy in the fulfilling its reason for being, ie its own teleological conception (Montoro, 2002). This growing importance of communicative aspects in organizations is such that authors like Lita Lopez (2000) claim that "a new business model in which communication takes a key role must be generated." Communication is even equated with the basic essence of the new organizations in the Knowledge Society, ensuring that "a business has become a communication system specialized in its own growth." This way a modern enterprise is considered a set of human, technical and financial resources related with one another and with their environment by a communication system that brings them together and gives it a distinct personality, aiming at it growth, consolidation and survival. 2 THE ORGANIZATIONAL STRUCTURE AND COMMUNICATION

In addition, there is a close relationship between the organizational structure and communication. In this sense, Losada (2002) states that each organization, depending on it business and social purpose, size, organization chart and a number of structural conditions develops a particular model of communication. The development of such a model is directly related to the achievement of corporate goals conditioned by the size of the institution. Regarding the strategic component of the communication, it is part of the global vision of the policies of the organization in achieving the objectives and requires a planning process that meets the specific communication needs of the institution with their audiences. The realization of the strategy through a strategic communication plan, n turn, leads to mobilization of the human element towards change and consequences in the configuration of a positive public image. For an appropriate mobilization and involvement of the human component requires the correct delimitation of the audience that allows adjusting the message, the support and the communication technique to the individual interests. The traditional classification makes a distinction between internal audiences, belonging to the institution and maintaining a continued and direct relationship, and external audiences, not belonging to the institution and maintaining a casual encounter. However, it is now frequently used in the term "stakeholders"

148

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

(Grunning and Repper, 1992; Dowling, 1994; Capriotti, 1999), a concept that refers to the public having any kind of interest with the organization. 2.1. Internal communication Internal communication is emerging as a discipline experiencing a huge growth, especially for its ability to motivate and integrate people working in the institutions. The importance by the employees has been demonstrated in numerous papers and studies showing that the members of an organization are its main asset and, therefore, they are a crucial source of information and a force of change and progress that should motivated and taken care of (Del Pozo, 1997). The University, as one of the quintessential social institutions, is also undergoing a process of profound change, framed in the overall social changes fostered by technological innovation and, above all, by the development of ICT, by changes in social relations and by a new conception of the relations technology-society that determine technology-education relationships (Salinas, 1997). Moreover, the process of adaptation of Spanish universities to the European Higher Education Area (EHEA) involves a complex web of changes that affect all fields of action and levels of interaction between the institution and the different audiences. Therefore, the University is involved in a context where it is essential an accurate management of the organizational changes and consequently a good strategic management of communication, because of its consequences in terms of image and institutional reputation. As Castells states (2009), the current social model requires institutions and organizations able to manage change to suit the environment, to cope with the uncertainty caused by the rapid pace of change in the economic, institutional and technological environment. The result is increasing the flexibility in production, management and marketing. 2.2. The introduction of ICTs in educational institutions

Therefore, the introduction of ICTs in educational institutions conclusively influences the different communication processes both internal and external, especially when dealing with the university teaching field and the wider education community, as a center conductor of many aspects that refute the excellence in research, teaching and innovation. In this sense, the means, media, techniques and communication tools are expanded, modifying the framework of relations between members of the university teaching community.

149

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In this context, from an applied perspective, it is interesting to analyze the communication strategies of the recent Campus Mare Nostrum in the region of Murcia as to show from the beginning the communication process of a structural nature, both internally and externally, that will be reflected in the positioning and the projected image of the institution. The main challenges identified in the original project of the Campus of Excellence focus on the areas of teaching, research and campus life. In its development an international communications plan dovetails for disseminating the project objectives and outcomes within and outside the university community. Currently, communication media are used to combine traditional media like newspapers (supplements in major newspapers own regional 'Ababol' in Truth and 'Auditorium' in La Opinin de Murcia), radio (the International, under the name 'Campus Mare Nostrum: a commitment to the Mediterranean') and television (campaign prior to the granting of the Campus of International Excellence in spots and messages through institutional support to publicize the project to the whole society of Murcia), with the integration of new unconventional communication media such as a YouTube channel, a channel in Ivoox, its own website (www.campusmarenostrum.es) and the participation on social networks through ists own pages and Facebook, Twitter and Myspace accounts. The aim is to promote transversality and interaction with audiences. As for the international dissemination contacts are maintained with the Mediterranean States Embassies in Spain and with our Embassies abroad, to inform regularly about all the promotional material, the academic offers, and news regarding the actions held in the MNCs. 2.3. The first strategic objective of the CMN refers to Excellence and Educational Innovation The first strategic objective of the CMN refers to Excellence and Educational Innovation through new resources supporting innovation and the quality of teaching for the EEES, by exploiting the complementarity of the participating universities. Additionally, it is promoted the formation in an international environment where research is a structural part of the educational system. A system will be established to train the technicians in FP and the creation of an International Graduate School and the Personnel Training Centre in collaboration with other international institutions promoting lifelong learning and mobility of students. It was precisely teaching innovation the theme chosen in the first international event organized by the CMN, which emphasizes the importance of this aspect in shaping the image intended for the new International Campus of Excellence. The First International Conference on Teaching Innovation has encouraged communication between all actors involved in the CMN, and has extended the transmission of teaching innovation experiences in the academic

150

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

community to enhance research and teaching in the framework of the European Higher Education Area (EEES). In this sense, we can consider that the union of communication in the field of CMN to innovation and good practice enhances active learning and cooperation among students and faculty. This could constitute actual formative itineraries that, in interaction, try to find the optimal method of teaching through teams that compare various teaching methods. Therefore, the innovation implemented through collaborative learning and good practice seems they could have an effective relationship between the goals of excellence of the CMN in different areas of knowledge and disciplines that are taught to students in order to constitute effective technologic communication strategies in the university. For example, in the field of UPCT work has been carried out by the teaching team of teachers who developed planning guidelines adapted to the EEES in the first half of 2011-2012. These groups arise from the need to improve the teaching practice and to adapt to the EEES, through the exchange of experiences and teamwork, i.e. with appropriate internal communication. The result of this work is two documents related to each other, which are very useful in the manner proposed. The first document, References to the teaching profession in the UPCT, provides guidance on the development of the teaching profession and a model for assessment programs for such activity. It is proposed a set of good practices for the three dimensions that make up the teaching activity, classified into three levels: beginner, intermediate and advanced. It gathers the various aspects of the teaching profession that can be evaluated and is intended to serve, therefore, as a tool for the improvement of the teaching quality. The second document, the Glossary of Terms EEES, arises from the need, as evidenced during the working sessions of the faculty itself, to define clearly some terms used frequently in the context of the EEES and which have to do with the teaching activity, its planning and evaluation. 3 CONCLUSION

From an applied perspective, it has been interesting to analyze the communication strategies of the recent Campus Mare Nostrum in the region of Murcia as to show from the beginning the communication process of a structural nature, both internally and externally, that is and will be reflected in the positioning and the projected image of the institution.

151

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

Capriotti, P. 1999. Planificacin estratgica de la imagen corporativa. Barcelona: Ariel. Castells, M. 2009. Comunicacin y poder. Madrid: Alianza editorial. Del Pozo Lite, M. 1997. Cultura empresarial y comunicacin interna. Su influencia en la gestin Estratgica. Madrid: Fragua. Dowling, G. 1994. Corporate Reputations. Londres: Kogan Page. Equipo docente de Elaboracin de guas docentes y planificaciones adaptadas al EEES.2012. Referencias para la actividad docente en la UPCT y Glosario de trminos EEES. Cartagena, Espaa: Universidad Politcnica de Cartagena. Gruninng y Repper, F. 1992. Strategic management, Publics and Issues en Gruninng, J. Lawrence Erlbaum, Hillsale: Excelence in Public relations and Communication Management. Lpez Lita, R. 2000. Comunicacin: La clave del bienestar social. Madrid: Editorial El Drac. Losada, J. C. 2002. Prensa e imagen corporativa en la Universidad. Monografas de Ciencias Sociales y de la Comunicacin. Murcia: Universidad Catlica de Murcia Montoro, A. 2002 prlogo en Losada, J.C. 2002. Prensa e imagen corporativa en la Universidad. Monografas de Ciencias Sociales y de la Comunicacin. Murcia: Universidad Catlica de Murcia. Pastor, M. C. et al. 2011. El aprendizaje colaborativo en la docencia universitaria. Modelos en la UPCT. Programa de Redes de Investigacin en Docencia Universitaria. Equipo docente de Trabajo colaborativo. Cartagena: Universidad Politcnica de Cartagena. Salinas, J. 1997. Nuevos ambientes de aprendizaje para una sociedad de la informacin, Mster en NNTT aplicadas a la Educacin. La educacin en la sociedad de la informacin, Edutec.

152

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CORRELATION AND REGRESSION IN THE TRAINING OF TEACHERS Mara Magdalena Gea Serrano, Universidad de Granada, Espaa mmgea@ugr.es ABSTRACT Nowadays, the domain of knowledge and mathematical skills is becoming necessary, where mathematics is seen as a means to know and understand reality. Covariational reasoning is one of the most important skills in statistical performance, and the curricular guidelines of different countries give relevance to this theme, since the notion of statistical association has a special place at the non-university level. Particularly, correlation and regression are part of the mathematical school curricula in high school in some countries, like in Spain (MEC, 2007). The introduction of new statistical issues in the curriculum, involve a challenge for teachers as they have to prepare, adapt and teach the "new contents", which until very recently were not covered. It is at this point where the observation, experience or intuition of the teacher must be complemented by research on the specific difficulties of our students (Moore, 2004; Groth, 2007; Casey, 2010). In this presentation we describe a research project oriented to educate prospective high school teachers in the mathematical and didactical knowledge in relation to correlation and regression. Keyword: Correlation, regression, mathematical knowledge for teaching, pre-service teachers, high school.

153

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

When considering education as the greatest wealth and the main resource of a country and try to provide to its citizens a lifelong learning that develops over a lifetime (MEC, 2006), we need to make a commitment to quality in developing students capabilities (intellectual, cultural and emotional), in whatever level of the education system we are. This commitment requires innovative training and is eminently marked by our immediate future, raising the challenge of making learning meaningful and useful for life in society. At present, statistics is acquiring it own identity, and several authors note the importance of strengthening statistical thinking in all sectors of the population (Wallman, 1993; Moore, 2004). As Peter Moore suggested, we need improve statistical training specially in the consumer, who not only must understand statistics but, more fundamentally, has to enhance his statistical thinking. Thus the term "statistical literacy" describes the statistical skills needed in any citizen (Moore, 1990). The need to improve the preparation of teachers to teaching statistics has been recognised at an international level (for example in Franklin, & Mewborn, 2006; Mendona, Coutinho, & Almouloud, 2006; Batanero, Burrill, & Reading, 2011). Research on teaching statistics suggests that many teachers share errors and misconceptions common, those they could transmit to their students; and moreover textbooks and curricula materials do not offer enough support to these teachers (Batanero, & Diaz, 2012). The relevance of this problem leads to ICMI (International Commission on Mathematical Instruction) and IASE (International Association for Statistical Education) to organise a Joint ICMI/IASE Study focused on the education and professional development of teacher to teach statistics (Batanero, Burrill, & Reading, 2011). Below we describe a research project where the main objective is to assess the prospective teachers mathematical knowledge for teaching in high school to teach correlation and regression. We describe the foundations and the methodological framework for this research. 2 BACKGROUND

Statistics association has been widely investigated in Psychology, and since our research focuses on the training of prospective high school teachers, we start mainly from the results of two lines of research in mathematics education: the professional knowledge of mathematics teacher and investigation related to correlation and regression.

154

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.1

Correlation and regression

The concepts of correlation and regression, and in general of statistics association, extend functional dependence and are fundamental for many statistical methods that are used in making predictions and taking decisions in such areas as politics, economics, medicine and education. However, although research methodology and decision making is supported by the study of association between the relevant variables, the existence of association does not necessarily imply a cause-effect relationship, but merely the existence of a covariation between variables. Sometimes it is possible to find a high coefficient of correlation in variables in which there is no causal link (Ellet & Erickson, 1986). Besides this epistemological difficulty, psychological research has shown that judging association is not an intuitive capability. Adults sometimes prefer to base their judgment on their previous beliefs about the type of association that ought to be between the variables that are going to be studied than on the empirical contingencies presented en the data. Chapman and Chapman (1967) showed that these are common expectations and beliefs about the relationship between the variables that cause the impression of empirical contingencies. This phenomenon has been described as illusory correlation. Mathematics education research shows that exist difficulties, misconceptions in the students when they solve a covariational task (Estepa, 1994, 2007; Estepa, & Batanero, 1996; Snchez, 1999; Moritz, 2004; Zieffler, 2006). This results about statistics association should be known for teacher for improve a training more adequate to students. We highlight the following results: Confusion between bidimensional distribution and two independent sets of data; Not considering the global trend of the data; Difficulty in interpreting scatter plots regarding the dependency, sign of correlation or/and the fitting of the regression line; Difficulty in relating the sign of correlation and association type (direct, inverse or independent); Determinist conception of statistics association; Unidirectional conception of statistics association. 2.2 Mathematical knowledge for teaching (MKT)

The categorization of knowledge needed for teaching by Shulman (1986) has been widely adapted in various disciplines. Our research is based in the characterization of mathematical knowledge for teaching developed by Ball, Thames, & Phelps (2008). These authors, using previous research, perceive six domains into two major categories called content knowledge and pedagogical content knowledge. The first category is composed of common knowledge of content (CCK), specialized content knowledge (SCK), and knowledge in the mathematical horizon. The second category (pedagogical content knowledge) is composed of content

155

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

knowledge and students (KCS), knowledge content and teaching (KCT) and content knowledge and curriculum. In this research we focus mainly on the CCK, SCK, KCS and KCT of prospective teachers about correlation and regression. Since this knowledge is an unobservable construct, it would be inferred from the responses of teachers to a questionnaire; these responses will be the empirical indicators of teachers knowledge. The results are interpreted within the theoretical framework of onto-semiotic approach that below we describe briefly. 2.3 Onto-semiotic approach to mathematical education

The theoretical framework of our research is the onto-semiotic approach to mathematical education created for Godino et al. since for about a decade (Godino & Batanero, 1994 and later works) that unite cognition and mathematics instruction. A basic assumption is that mathematical learning is generated by the mental activity developed when solving problems, within a particular society, with a symbolic language and conceptual system logically organized. The authors identify basic types of mathematical objects that are interconnected: problemssituations, language, definitions, propositions, procedures and arguments. These mathematical objects will be used to define the variable to be measured in the questionnaire. They also define the related processes and several facets to analyse mathematical practices (Figure 1): institutional-personal; ostensive-non ostensive; unitary-systemic, type-example, contentexpression. Figure 1. Configuration of objects and processes

Source: Font, Planas, & Godino, 2010, p. 10

156

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PHASES OF RESEARCH

Our investigation is at an early stage in which we are analyzing the notions of correlation and regression in high school textbooks, particularly for the subject of "Mathematics for Social Sciences I". This initial research is intended to be a master Thesis work, which is planned to be presented in July. The research plan that we have designed starts from this previous work, which will be completed with a larger sample size, from which, we will get information about the treatment of these notions in the textbooks and indirectly in the classroom. In a second step, we will build a valid and reliable questionnaire test that will serve to evaluate the mathematical knowledge for teaching correlation and regression. In the building of the questionnaire we will collect and adapt items taken from previous research and we will build our own items when needed (we will do some pilot trials of items to analyze the questionnaire reliability). In the final step, we will give the questionnaire to a sample of prospective teachers in several Spanish universities; and the data collected will be analysed using quantitative and qualitative methods. 4 CONCLUSION

Our research will be useful to teachers' educators responsible to train prospective high school teachers, in the design and implementation of instructional programs for these teachers. Moreover, results would also favour the students, since a better preparation of teachers directly affect the education of their future students.

157

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Ball, D.L., Thames, M.H., & Phelps, G. (2008). Content knowledge for teaching: what makes it special?. Journal of Teacher Education. 59(5), 389-407. Available from: http://jte.sagepub.com/content/59/5/389.full.pdf+html Batanero, C., & Daz, C. 2012. Training school teachers to teach probability: reflections and challenges. Chilean Journal of Statistics, in press. Available from: http://chjs.deuv.cl/iFirst_art/ChJS010202.pdf Batanero, C., Burrill, G., & Reading, C. (Eds.) 2011. Teaching statistics in school mathematics. Challenges for teaching and teacher education. A joint ICMI and IASE study. New York: Springer. Casey, S.A. (2010). Subject matter knowledge for teaching statistical association. Statistics Education Research Journal. 9(2), 50-68. Available from: http://www.stat.auckland.ac.nz/~iase/serj/SERJ9(2)_Casey.pdf. Chapman, L.J. y Chapman, J.P. (1967). Genesis of popular but erroneous psychodiagnostic observations. Journal of Abnormal Psychology 72 (3), 193-204. Ellet, F.S., & Erickson, D.P. (1986), Correlation, partial correlation and causation. Synthese, 67, 157-173. Estepa, A. (1994). Concepciones iniciales sobre la asociacin estadstica y su evolucin como consecuencia de una enseanza basada en el uso de ordenadores. Tesis doctoral. Departamento de Didctica de la Matemtica. Universidad de Granada. Estepa, A. (2007). Caracterizacin del significado de la correlacin y regresin en estudiantes de Educacin Secundaria. Zetetik. 15 (28), 119-151. Estepa, A., & Batanero, C. (1996). Judgments of correlation in scatter plots: Students intuitive strategies and preconceptions. Hiroshima Journal of Mathematics Education, 4,. 25-41. Font, V., Planas, N.., & Godino, J.D. (2010). Modelo para el anlisis didctico en Educacin Matemtica. Infancia y Aprendizaje . 33(2), 89-105. Franklin, C., & Mewborn, D., 2006. The statistical education of PreK-12 teachers: A shared responsibility. In G. Burrill Ed., NCTM 2006 Yearbook: Thinking and Reasoning with Data and Chance (pp. 335-344). Reston, VA: NCTM. Godino, J.D. y Batanero, C. (1994). Significado institucional y personal de los objetos matemticos. Recherches en Didactique des Mathmatiques, 14(3), 325-355. Groth, R.E. (2007). Toward a conceptualization of statistical knowledge for teaching. Journal for Research in Mathematics Education 38(5), 427 437. M.E.C. (2006). Ley Orgnica 2/2006, de 3 de mayo, de Educacin. M.E.C. (2007) Real Decreto 1467/2007, de 2 de noviembre, por el que se establece la estructura del bachillerato y se fijan sus enseanzas mnimas. Mendona, T., Coutinho, C., & Almouloud, S. 2006. Mathematics education and statistics education: meeting points and perspectives. In A. Rossman & B. Chance (Eds.), Proceedings of the Seventh International Conference on Teaching Statistics. [CD-ROM] Salvador (Baha) Brasil: International Statistical Institute. Moore, D. (1990). The skills challenge of the nineties. Journal of the Royal Statistical Society. 153 (3), 265-285.

158

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Moore, D. (2004). Foreword. In D. Ben-Zvi & J. Garfield (Eds.), The callenge of developing statistical literacy, reasoning, and thinking (pp. ix-x). Dordrecht, The Netherlands: Kluwer. Moritz, J. (2004). Reasoning about covariation. In D. Ben-Zvi & J. Garfield (Eds.). The challenge of developing statistical literacy, reasoning and thinking (pp. 221-255). Dordrecht, The Netherlands: Kluwer. Snchez, F. T. (1999). Significado de la correlacin y regresin para los estudiantes universitarios. Tesis doctoral. Departamento de didctica de la matemtica. Universidad de Granada. Shulman, L. S. (1986). Those who understand: Knowledge growth in teaching. Educational Researcher, 15(2), 4-14. Wallman, K.K. (1993). Enhancing statistical literacy:Enriching our society. Journal of the American Statistical Association. 88(421), &1-8. Zieffler, A.S. (2006). A longitudinal investigation of the development of college students reasoning about bivariate data during an introductory statistics course. PhD. University of Minnesota.

159

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

DESIGN OF THE POWER SYSTEM OF A SOLAR AUTONOMOUS SURFACE VEHICLE FOR UNDERWATER INSPECTION WORKS. Inocencio Gonzlez Reolid, Universidad Politcnica de Cartagena, Spain inocenciogr@hotmail.com Napoli Gmez, Universidad Politcnica de Cartagena, Spain napoli.gomez@gmail.com Jose Garcia Morales, Universidad Politcnica de Cartagena, Spain josegarmorales@hotmail.com Antonio Guerrero Gonzlez, Universidad Politcnica de Cartagena, Spain antonio.guerrero@upct.es Victor Moreno Oropesa, Universidad Politcnica de Cartagena, Spain victor.desantos@gmail.com

ABSTRACT An Autonomous Surface Vehicle (ASV) or Unmanned Surface Vehicle (USV) consists in a boat or surface vehicle that operates without crew. These ships allow different type of missions as oceanographic research, offshore and underwater monitoring. These autonomous vehicles can be coordinated with other ships or underwater autonomous vehicles to supply communication or power. This paper discusses how may be setting up the surface vehicle for being supplied of power of conventional source and alternative source. As alternative source of power, the photovoltaic can meet an important proportion of the demand of ship power. Due to this, special modules photovoltaic for seaship will be used, that can resist marine enviorements, lightens the weight, and is flexible. The result will be an Autonomous Surface Vehicle (ASV) or Unmanned Surface Vehicle (USV) that can be used with the minor environment impact, and allow flexibility in different operations at the sea.

Keyword: AUV, Solar Autonomous Vehicles, Photovoltaic Installation, Offshore and Underwater monitoring.

160

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION The term Autonomous Surface Vehicle (ASV) or Unmanned Surface Vehicle (USV) means any vehicle that operates on the water surface without crew [1] [2]. It is an intelligent unmanned platform which is based on remote or autonomous navigation in the water. And compared to conventional surface vessels, ASV has merits such as running varied operating flexibility, zero injury and Network Information Center [3]. Operating on the water surface, the ASVS can be used for various missions that would be safer and cheaper than with human intervention, such as marine environmental monitoring, hydrology study, objective search for objects, scientific study and so on [4]. Nowadays USVs are developed by academies labs, corporations and defence departments. Its applications are so wide ranging from military operations (warfare, Mine CounterMeasure (MCM) and security, etc.), and its civil and scientific use [6]. The first experimentation with USVs was in the World War II. Canadians developed the COMOX torpedo concept in 1944 as a pre-Normandy invasion USV designed to lay smoke during the invasion as a substitute for aircraft. COMOX was designated a torpedo because it could only be programmed to traverse a fixed course. Although COMOX was not deployed, a vehicle was constructed and a successful test was completed. Meanwhile, the US Navy developed and demonstrated several types of Demolition Rocket Craft intended for mine and obstacle clearance in the surf zone. The Porcupine, Bob-Sled, and Woofus 120 were variants of converted landing craft that carried numbers of mine clearing rockets in different configurations. Unmanned operation was part of the concept, although it is unknown which, if any, of these vehicles were demonstrated as USVs [5].

Post-war applications of USVs expanded, with the USN using drone boats to collect radioactive water samples after atomic bomb blasts Able and Baker on Bikini Atoll in 1946. The 1950s-era US Navy Mine Defense Laboratory's project DRONE constructed and tested a remotely operated minesweeping boat in 1954. By the 1960s, the Navy was using target drone boats based on remote-controlled aviation rescue boats for missile firing practice, and the Ryan Firefish target drone boat was used for destroyer gunnery training. Similar to UAVs, target drone USV development and use has continued and evolved over the years. Today, the Navy operates a number of USVs as target drones, including the Mobile Ship Target (MST), the QST-33 and QST-35/35A SEPTAR Targets, and the High Speed Maneuverable Seaborne Target (HSMST).

161

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

DESCRIPTION OF THE PROPOSED SYSTEM The Photovoltaic generator consists of solar modules, is responsible for transforming the sun's energy into electrical energy passes through a charge controller prevents overcharging of the battery and discharge electrical energy is stored in batteries.

Figure 1. Electric scheme.

162

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CALCULATION OF THE PHOTOVOLTAIC INSTALLATION

1.1.1 Calculating the energy demand The consumption of electrical equipment to be operated continuously in the boat are:

Table 1. Energy consumption estimated From the theoretical energy Et (Wh), the actual energy consumption E (Wh) needed to address the multiple factors that will be lost on the vessel, is: Et (Equation 1) E= R Where R is the overall performance parameter: ka ) (Equation 2) R = (1 kb kc kv ) * (1 Pd Where: Kb: Coefficient of losses for the battery performance is at 0.05 Kc: Coefficient of losses in the inverter, it takes 0.019 Kv: Coefficient of multiple losses, wiring, connections, etc.., You take 0.1 Ka: Daily self discharge coefficient, are caught 0.005, for stationary batteries. Pd: Daily depth of discharge of the battery, usually 80% The result R is: R = (1 0,05 0,019 0,1) * (1 0,005 0,7

) = 0,825 (Equation 2)

163

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The actual energy consumption is: 4.750 = 5.758 W.h (Equation 1) E= 0,825 We obtain the battery capacity C (Ah): E 5.758 C= = = 300 A..h (Equation 3) V * Pd 24 * 0,8 Where V is the voltage nominal of the batteries, in this case V = 24 volts. We choose VICTRON monobloc batteries 12 Volt Deep Cyde ENERGY GEL 165 Ah, placed according to configuration of Figure 2, gives 24 volts and 330 amps.

Figure 2. Battery connection scheme. Distribution panels, seven pools are placed in parallel, two panels in series / each, provides a maximum intensity of 60.27 A and a maximum voltage of 40.02 volts, Figure 3.

Figure 3. Configuration solar modules Schematic.


Isc = Isc1 * Np = 8,61 * 6 = 60,27 A..h (Equation 4)

164

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Voc = Voc1 * Ns = 20,01 * 2 = 40,02V (Equation 5)

Where: Isc= Short circuit current of the installation, in A Impp = Intensity at the maximum power point of the panels, in A. Voc = Open circuit voltage of the installation, V. Vmpp= Voltage at the maximum power point of the panels, in V. Np = Number of parallel panels (7). Ns = Number of panels in series (2). Choosing a charge controller FLEXmax 80 A / 24 V.

1.1.2

Calculating the power of the generator.

Assuming a simultaneous operation for 1 hour obtain an output of 4975 W, therefore, taking into account losses of the installation itself and leaving a margin of 25%, we have: Where: Pn = Generator or power required in W Pc = Power consumed instantly, W. Pp = Power loss, 10%, in the installation, in W
Pn = PG = ( Pc + Pp) * 1,25% = (4.975 + 497,5) * 1,25% = 6.841VA (Equation 6)

Is obtained from 6.841 KVA power required at the output of the generator. We choose a generator of 7.2 KVA and 230/400 volts.

165

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 2. Item List. Description of the Equipment

1.1.3

Photovotaic Modules

Module is used PHOTOVOLTAIC ENECON ITALIA SRL of 130 Wp, made of monocrystalline silicon cells with high performance and flexible. Are used to capture and convert solar radiation into electrical energy.

Figure 4. Photovoltaic Module

166

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 3. Photovoltaic Modules Characteristics. 1.1.4 Regulator

Regulator FLEXmax will be used, its function is to prevent overcharging of the batteries and prevent discharge to the plates, when no solar radiation.

Figure 5. Charge Regulator 1.1.5 Generator

The generator is used to power down when the battery power due to low radiation or excessive consumption, also when you need an additional power supply. Incorporates box internal non-contact signal to adapt battery chargers inverters for solar panels.

167

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 6. Generator.

Table 4. Generator Characteristics.

1.1.6 Batteries

Accumulators or batteries will be used to store energy from solar photovoltaic modules, and for providing energy in times of low radiation.

168

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The Range Waterproof Gel Batteries (VRLA) In this type of batteries, the electrolyte is immobilized as gel. Gel batteries generally have a longer life and better cycle capacity.

Table 5. Batteries Characteristics.

Figure 7. Battery Characteristics.

1.1.7 Converter-Charger Battery Put a converter-charger to convert AC voltage diesel generator output to a DC voltage of 7.2 KVA, and 230/400 Vac to 24 Vdc.

169

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

SOLAR CALCULATION UNDER OPERATING CONDITIONS Solar Irradiation and Irradiance For calculating solar energy will be taken as reference the mediterranean sea, a place near La Manga, Murcia with coordenates 37.663, -0.714. And all datas about monthy global irradiation and average daily solar irradiance were taken and calculated from Photovoltaic Geographical Information System (PVGIS) database of the Institute for Energy and Transport (IET). And these datas are:
Monthly global irradiation and daily irradiance data Radiation database: Climate-SAF PVGIS Month Hh TD Gm (W/m) Jan 2540 13.3 378 Feb 3380 14.3 486 Mar 4730 16.6 588 Apr 6040 18.6 677 May 6960 21.6 727 Jun 7880 25.8 779 Jul 7790 28.1 788 Aug 6840 28.6 749 Sep 5310 25.7 653 Oct 3870 22.3 531 Nov 2700 17.2 415 Dec 2400 14.0 383 Year 5050 20.5 596 Hh: Irradiation on horizontal plane (Wh/m2/day) TD: Average daytime temperature (C) Gm: Daily solar irradiance

Table 5. Irradiation and Irradiance Solar Data. And theses are the parameters of the selected photovoltaic module:
Module Parameters in Standard Conditions ENECOM HF 130 Parameters Descriptions Pmax (W) Maximum Power Wp Isc (A) Short circuit current Voc (V) Open circuit voltage Nominal Operating Cell Temperature NOCT (C) Ns (Cells) Number of cells in serie Np (Celdas) Number of cells in parallel Voltage variation with dVoc/dT (V) temperature Values 130 8.61 20.01 47 32 1 -0.0736

Table 6. Module Parameters

170

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The next tables show some considerations of fixed values that were used in the calculation.
Standard Test Conditions (STC) Parameters Irradiance GSTC(W/m2) Normal Incidence Solar Spectrum Cell temperature Tc, STC C Values 1000 AM 1.5 25

Standard Operating Conditions (SOC) Parameters Irradiance GSOC(W/m2) Normal Incidence Solar Spectrum Environment temperature C Wind Speed m / s Values 800 AM 1.5 20 1

Photovoltaic Calculation For these calculations were used many equations for determining variable parameters of the photovoltaic modules. These equations are:

I SC,OP = I SC

Gm( 0 ) GSTC

= A (Equation 7) For the short circuit current.

TC = TD +

NOCT TD Gm( 0 ) = o C (Equation 8) For the cell temperature. G SOC

VOC,OP = VOC,STD + (TC TC,STC ) dVoc / dTc (Equation 9) For the open circuit voltage.
FF = Pmax,Mod VOC,STD I SC,STD
(Equation 10) Fill Factor, that in this case is 75.46%.

Pmax,CO = FF VOC,OP I SC,OP (Equation 11) Maximum power in operation conditions for the PV
modules.

E PV =

Hh PMP R (Equation 12) Photovoltaic energy, where PMP is the nominal power for GSTC

generator photovoltaic, and R is the overall performance ratio with value of 0.7648, due to is affected by the cells temperature.

171

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The following table shows how the power of the photovoltaic generator cans vary from end to end, with 678 Watts in January to 1319 Watts in July. Also, it is showed the variation in the energy produced by the photovoltaic generator under operating conditions, which can vary in the same way from 3,536 Watts-hour in January as its minor energy production. And the month with higher energy production is June with 10,969 Watts-hour, this due to in July the environment temperature is upper and it affects the voltage cells.
Photovoltaic Calculation under Operating Conditions Epv for 14 Modules (Wh) 3,536 4,705 6,584 8,408 9,688 10,969 10,844 9,521 7,392 5,387 3,758 3,341 7,011

Month Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year

Isc Op. (A) 3.26 4.19 5.06 5.83 6.26 6.71 6.78 6.45 5.62 4.57 3.57 3.30 5.13

Tcells (C) 29.23 34.18 38.94 42.64 44.69 46.46 46.71 45.82 43.09 38.70 32.66 29.79 40.25

Voc Op. (V) 19.70 19.33 18.98 18.71 18.56 18.43 18.41 18.48 18.68 19.00 19.45 19.66 18.89

Pmax Op. (W) (14 Modules) 678 855 1015 1153 1228 1307 1319 1258 1110 918 734 685 1024

CONCLUSION In this paper, a photovoltaic power system for AUV and ASV power supply has been described, this power system increase power autonomy of operation at sea. The photovoltaic system can be combined with a bio combustible eco friendly diesel generator to recharge batteries.

172

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST (REFERENCIAS DE NAPOLI)

[1] J. E. Manley, Unmanned surface vehicles, 15 years of development, in OCEANS 2008, 2008, vol. 2008-Supplement, pp. 14. [2] V. Kanakakis, P. Spanoudakis, and N. Tsourveloudis, Optimized design of an unmanned surface vehicle, in ELMAR, 2009. ELMAR 09. International Symposium, 2009, pp. 181184. [3] Cheng Haibian, Yang Songlin, Ma Lianxiang, Cui Jian, and He Yijia, Primary Research on Trimaran Unmanned Vessels, in Intelligent Human-Machine Systems and Cybernetics (IHMSC), 2010 2nd International Conference on, 2010, vol. 1, pp. 252254. [4] Jianhua Wang, Wei Gu, Jianxin Zhu, and Jubiao Zhang, An Unmanned Surface Vehicle for Multimission Applications, in Electronic Computer Technology, 2009 International Conference on, 2009, pp. 358361. [5] V. Bennett, Unmanned Surface Vehicles A Survey, 2008. [Online]. Available: http://www.skibstekniskselskab.dk/public/dokumenter/Skibsteknisk/Download%20materiale/2008/ 10%20marts%2008/USVsurvey_DTU.pdf. [Accessed: 09-Feb-2012]. [6] Program Executive Officer for Littoral and Mine Warfare (PEO (LMW)), THE NAVY UNMANNED SURFACE VEHICLE (USV) MASTER PLAN, 2007. [Online]. Available: http://www.navy.mil/navydata/technology/usvmppr.pdf. [Accessed: 09-Feb-2012]. [7] W. Naeem, T. Xu, R. Sutton, and J. Chudley, Design of an Unmanned Catamaran with Pollutant Tracking and Surveying Capabilities, in UKACC Control, 2006. Mini Symposia, 2006, pp. 99 113. [8] M. Caccia, R. Bono, G. Bruzzone, E. Spirandelli, G. Veruggio, A. M. Stortini, and G. Capodaglio, Sampling sea surfaces with SESAMO: an autonomous craft for the study of sea-air interactions, Robotics & Automation Magazine, IEEE DOI - 10.1109/MRA.2005.1511873, vol. 12, no. 3, pp. 95 105, 2005. [9] Jianhua Wang, Wei Gu, and Jianxin Zhu, Design of an Autonomous Surface Vehicle Used for Marine Environment Monitoring, in Advanced Computer Control, 2009. ICACC 09. International Conference on, 2009, pp. 405409. [10] Juntong Qi, Yan Peng, He Wang, and Jianda Han, Design and Implement of a Trimaran Unmanned Surface Vehicle System, in Information Acquisition, 2007. ICIA 07. International Conference on, 2007, pp. 361365. [11] Yan Peng and Jianda Han, Design and modeling of Unmanned Trimaran Surface Vehicles, in Information and Automation, 2009. ICIA 09. International Conference on, 2009, pp. 751756. [12] Autonomous Surface Vehicles Ltd - Unmanned Surface Vehicle (USV). [Online]. Available: http://www.asvglobal.com/. [Accessed: 20-Feb-2012].

173

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

DESIGNING MULTICULTURAL SPACES IN THE MEDITERRANEAN AREA Isabella Daidone, PhD candidate in Progettazione Architettonica, Dipartimento dArchitettura, Facolt di Architettura, Universit degli Studi di Palermo, Italy isabelladaidone@libero.it

Abstract
The center of the Mediterranean coincides with Sicily but for about eight hundred years this centrality has only been geometrical and geographical, certainly not cultural or economic, so that its centrality is not true in absolute sense. However, the Berlin-Palermo corridor would link the center of Europe with the center of the Mediterranean, giving Sicily back its centrality as regarding the Mediterranean and if the Berlin-Palermo Corridor extended as far as Trapani, from there it could reach Africa, one of the five economic powers in the future (BRICS). In this scenario, multiculturalism become one of the most important factors in contemporary Europe. It is a result of migration caused a variety of reasons and has transformed the spaces of the contemporary city. Architecture, when both ethical and responsible, can become an opportunity for dialogue between different peoples. A research team led by Marcello Panzarella illustrated this in their thesis on South-East Palermo the point of arrival in Palermo of the Berlin-Palermo Corridor in which an innovative typology for the Mosque in the West was elaborated. Keywords: Mediterranean, infrastructure, multiculturalism, mosque, architecture.

174

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

A POLITICAL QUESTION

The barycentre of the Mediterranean is located near Catania, but the centrality of Sicily in the Mediterranean, is only geometrical and geographical, certainly not cultural or economic, therefore it isn't altogether true. The French sociologist Henri Lefebvre asserted in the nineteen seventies that space is political, so spatial transformations are an expression of a specific political ideology. In an article in the magazine Espaces et Socits he analyzes France from a retrospective viewpoint, saying that there exist on the one hand the underdevelopment of various regions which he calls the French Desert and, on the other hand, the centralization of French society in Paris, which suggest the urgent need for decentralization. But, Lefebvre asks: How can the centralized state accept the decentralization? ( Lefevre, 1975, 1). Returning to our present situation, we shouldnt forget that last September the E.U, in Brussels discussed the possibility of redirecting the European Corridor No.1 Berlin-Palermo, to Naples via Bari, and then on to Malta. This would have the effect of suspending the present work on railway infrastructure taking place in southern Italy. One reason for this proposed change is the recent construction in Malta of a new port with advanced platform which will compete whit the port of Gioia Tauro and Augusta for the sorting of container traffic. Another motivation is that the E.U. believes that the institutions of southern Italy have lost credibility, due to their misuse or non-use of community funds. The Berlin-Palermo Corridor would connect the center of Europe with the center of the Mediterranean, giving Sicily new opportunities to regain its central position in the Mediterranean, after more than eight hundred years. However another interesting possibility is the extension of the Corridor to Trapani, and from there to Africa. In recent years Africa has been on the list of the top five emerging economies, the so-called BRICS. The Arab spring is their expression of this desire to look to the future. Traces of this infrastructure link between north and south are found in a project dating back to the fascist period: a railroad, built only in part was connect from Oran to Colom-Bchard, then crossing the Sahara desert was arrive at the River Niger, Dakar, and then to Brazil. This project also reflected a political choice: it was to be used by the Third Reich to conquer Brazil and from there, the rest of the world. Another project in 2006 was prepared by ENEA (the National Atomic Energy Agency). This contained a study on how to cross the straits of Sicily via an underwater tunnel which would then emerge on some artificial islands. This certainly would be very expensive, more feasible instead would be the upgrading of the ports of Trapani and Tunis. Another proposal has been to connect Spain and Morocco, for example the magazine Domus in the month of May 2011 launches call for ideas called Project Heracles. Previously, in January 2004, they published an article by Giancarlo De Carlo entitled "Tortuosity" in which the author reflected on the distinctive characteristics of the

175

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Mediterranean city and imagined a city-bridge connecting the two continents. He writes: I think the idea of the Mediterranean city could be a major influence in the construction of Europe and the European city; this influence would be beneficial because it would generate fruitful contradictions (De Carlo, 2004, 24). In the July 2011 issue, Domus included an open letter to the President of the Council of Europe written by Joseph Grima, director of the magazine, in which he notes that in the history of man the only two continents still without a physical connection between them are Africa and Europe. This despite the fact of their proximity and the possibility of Europes gaining much from Africas innovation and experimentations (Grima, 2011, 8). Of course if the link was the straits of Gibraltar it would not have the advantage which the straits of Sicily possess in regard to the completion of Berlin-Palermo Corridor. The latter would not only connect the two continents but also the center of Europe with the center of the Mediterranean. This is a strategic vision that has as its axiom the idea that communication routes not only carry goods but also people and with them ideas and innovation (Panzarella, 2011, 15). 2 MULTICULTURALISM - THE MOSQUE OF THE WEST

Migration has always been the vital important for Mediterranean cities. Newly arrived cultures have become part of everyday life and have fertilized society with their wealth of imagination which are expressed through complex urban forms (De Carlo, 2004, 25), so multiculturalism is one of the most important factors in contemporary Europe, resulting from migration determined by a variety of reasons. It has transformed the spaces of the contemporary city. Sicily, an island in the center of the Mediterranean, has been the scenario of great migration movements. It could find itself, as it has already done in the past, to be the gateway for the flow of people, goods, ideas and culture. Some areas of the city must be redesigned and a dialogue created with those whom we consider different. One of the primary issues concerns the needs of these new communities in relation to their faith. Religion in fact has proven to be a factor that can unite different national affiliations, while keeping them distinct. In the context of the Faculty of Architecture in Palermo, research teams directed by Pasquale Culotta, Marcello Panzarella, and Adriana Sarro studied these questions through didactic experiences in the laboratories of Architectural Design, with thesis on various themes such as the Mosque in the West. A research team led by Marcello Panzarella 1 illustrated this in their thesis on South-East Palermo, the point of arrival in Palermo of the Berlin-Palermo Corridor. In one of this thesis, the Mosque in the West 2, an innovative typology was elaborated.
1 In the research team of Palermo Sud-Est directed by Marcello Panzarella partecipants are: Isabella Daidone, Cinzia De Luca, Santo Giunta, Francesco Leto, Maria Eliana Madonia, Rossella Minore, Antonio Minutella, Giuseppina Passanisi, Luigi Piazza, Luigi Pintacuda, Laura Sciortino, Fabio Sedia.

176

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The profound difference between the urban fabric of the medina and that of modern cities posed a fundamental question about the relationship between the mosque and the faithful. Also the call to prayer by muazzin, forbidden in some western cities, needed to be taken into account in the elaboration of the project. Originally the mosque was made simply by fencing. The only necessary expressly required in liturgical prayer was for the congregation to be arranged in parallel rows facing Mecca, the mirhab, to direct the prayer of the faithful. It is possible to pray outdoors, at home or anywhere else provided that the ground reserved for the ritual prayer, salat, be bounded by some object (a rug, a mat, rocks) and be as clean as possible. Indeed, as with all rituals prescribed under the Islamic law, the condition of legal purity, tahara, is achieved through partial or full body washing, ablutions. The project had its origin when the need for the resolution of an abstract typological problem was identify: that is the linking together of the two symbolic forms, of circle and square. The circle, representing the dome in the plan, is not strictly necessary but it serves as a reminder of common representation of the mosque, both inside and outside the Islamic world. The square shape is however necessary for the disposition of the faithful in parallel lines in the direction of Mecca. The spatial structure suggest the fabric of Islamic cities, in which the streets system is ordered along the lines of a tree pattern. The main roads, darb, branch out into smaller ones and end in impasses and enclosed courtyards. At the center is the great empty space of the prayer hall. This is preceded by a vestibule with an entrance in bayonet form, typical of Islamic homes, where the faithful can leave their shoes. The prayer hall has is square in shape and its floor is subdivided into squares and rectangles arranged in a geometrical pattern in which a succession of carpets is represented and placed in an abstract way so that their colors divide the room in a hierarchical manner for elderly, men, women and children. The great dome, while acting as cover, also assumes a symbolic meaning. It discendeds smoothly to the ground like a sand dune and rise up, resempling mountains. Holes in the dome let in light and at the same time reproduce the image of the sky, as in the halls of hypaethral Shiite mosques. The vision of this project is reminiscent of a great sahn under a big palm, in this mosque is contained the Islamic city, where you can even see the sky with its constellations. It is similar to an oasis, surrounded by water and with a roof formed by the branches of the palm tree.

2 This thesis was elaborated by Isabella Daidone in the Academic Years 2008-2009.

177

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSION

Economic, political and communicative aspect have influenced the design of city, and often, nowadays architecture has become just ornamental and cosmetic for the purpose of producing marketing images directed at real estate business. In the contemporary city, architecture, should begin with a critique of its actual state, and then should be able to organize the city through specific project, capable of transforming a place from void to space. Architecture today must above all assume the responsibility and the task of transformation physical space in social terms, starting from the needs of people. Multiculturalism in society in when different cultures can live together and exchange experiences with respect and where minorities can continue to exist without any levelling or merging with the dominant culture, so keeping their particular identity. Architecture can become an opportunity for dialogue and communication between different peoples nevertheless are members of the Mediterranean culture, in which the mosque is the symbol of the collective manifestation of religious life. Figure 1: The Mosque in the West, thesis elaborated by Isabella Daidone, 2008-2009

Source: Panzarella M. 2011, Tipologie innovative, Una moschea per l'occidente, E.JOURNAL/palermo architettura n. 02, pp. 13-29. Http://www.uam-productions.it.

178

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Reference list
Culotta, P. 1992. La Moschea d'Occidente, Progetti per Palermo e Mazzara del Vallo, Medina, Palermo. De Carlo, G. 2004. Tortuosit, in Domus n. 866, p.24. (1. 2004). Lo Verde, F.M., G. Cappello. 2007. Multiculturalismo e Comunicazione, Franco Angeli Editore, Milano. Lefevre, H. 1975. Riflessioni sulla politica dello spazio, Espace et Socits n.1, edizioni Miozzi e Spinelli, Milano, p.11. (6. 1975). Grima, J. 2011. Editorial, Domus n.949, p.8. (7. 2011). Panzarella, M. 2011. Fuori gioco, E.JOURNAL/palermo architettura, supplemento n.01.1 pp. 7-15 (20.09.2011). Http://www.uam-productions.it. Panzarella, M. 2011. Il progetto di Palermo Sud-Est. Ruolo e riassetto funzionale e formale dellarea terminale del Corridoio Transeuropeo n. 1 Palermo-Berlino e del connesso parco dellOreto, E.JOURNAL/palermo architettura n. 02, pp. 13-29 (10. 2011). Http://www.uam-productions.it. Sarro, A. 2005. La Muliculturalit nella citt del Mediterraneo, Ricerche e progetti per le citt di Tunisi, Tozeur e Nefta, Grafill, Palermo.

179

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

DETERMINATION OF SOME ENDOCRINE DISRUPTING CHEMICALS IN BEVERAGES USING A SOLVENTLESS EXTRACTION METHOD
J.I. Cacho, N. Campillo, P. Vias and M. Hernndez-Crdoba Department of Analytical Chemistry, Faculty of Chemistry, Regional Campus of International Excellence Campus Mare Nostrum, University of Murcia, Spain juanignacio.cacho@um.es

ABSTRACT
A method for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol Z (BPZ) and biphenol (BP) using stir bar sorptive extraction (SBSE) in combination with thermal desorption-gas chromatography-mass spectrometry (TD-GC-MS) has been developed. Several parameters affecting derivatization and both extraction and thermal desorption of the SBSE stages were carefully optimized by multivariate designs. Insitu acetylation with acetic anhydride was used to derivatize the analytes, thus improving the chromatographic separation as well as the SBSE extraction efficiency. The optimized method was applied to analyze different commercially canned beverages. For this purpose, sample aliquots of 2 mL were diluted to 10 mL and the acetylated analytes were extracted by SBSE. Quantification of the samples was carried out against external aqueous standards and detection limits of between 4.7 and 12.5 pg mL-1, depending on the compound, were obtained. The intraday and interday precisions were lower than 6% in terms of relative standard deviation. The method was validated by means of recovery studies and satisfactory values for all compounds were attained. The samples analyzed contained higher concentrations of BPA than of the other analytes. The method can be used for routine quality control applications. Keywords: Bisphenols, Beverages, Stir bar sorptive extraction, Gas chromatography, Mass spectrometry

180

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION Bisphenols (BPs) are industrially important chemicals widely used in the manufacture of plastics and epoxy resins, the latter employed in the production of food-contact surface lacquers for cans. Trace residue levels of BPs can be released by diffusion or degradation into food or beverages (Gardziella and Pilato 2005; Kang et al. 2006). BPs are considered endocrine disruptor chemicals (EDCs) and suggested as carcinogen and mutagenic compounds (Gallart-Ayala et al. 2010). Consequently, their content in food has been restricted by the EU to 0.6 mg kg-1 (EU Commission 2004). The extensive use of BPs-based polymers, the hazards associated with their use, and the restrictive legal regulations, imply the need of efficient and sensitive analytical methods to control their human exposure. Gas chromatography - mass spectrometry (GC-MS) has been widely used for this purpose. The high sensitivity required makes necessary the use of enrichment methods. Environmentally friendly sample preparation techniques have replaced classical methods, and the use of stir bars coated with adsorbent phases (usually PDMS) has led to the development of the clean sample preparation technique stir bar sorptive extraction (SBSE), which can be hyphenated with GC using commercial thermal desorption units (TDU). SBSE has been previously employed for the determination of BPs in waters (Kawaguchi et al. 2004a and 2004b, Nakamura et al. 2004, Quintana et al. 2007, Iparraguirre et al. 2011), soils (Llorca-Prcel et al. 2009) and body fluids (Kawaguchi et al. 2004a, Kawaguchi et al. 2005), but as far as we know no procedures based on SBSE-TD-GC-MS have been reported for the determination of BPs in foods. Consequently, the aim of this work was the optimization of this combination for the determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol Z (BPZ) and biphenol (BP), and its application for the analysis of beverage samples. 2 ANALYTICAL PROCEDURE Aliquots of 2 mL of the canned beverage, previously submitted to ultrasounds and centrifugation, were diluted to 10 mL with Milli-Q water and placed in a 15 mL glass vial. 200 L of anhydride acid (AA) and 300 mg of Na2CO3 were added, and the sample solution was shaken for a few seconds. The extraction was then started by inserting the stir bar into the mixture, stirring at 600 rpm during 3 h. Next, the stir bar was rinsed with Milli-Q water and dried before being introduced into a glass desorption tube for its analysis. The experimental conditions adopted in the sample introduction system, which was composed of a Thermal Desorption Unit (TDU-2) and a Programmed Temperature Vaporization (PTV) Cooled Injector System (CIS-4) appear in Table 1, as well as those selected for the chromatographic separation and the mass spectrometry detection. [Table 1 here]

181

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

3 OPTIMIZATION OF THE METHOD Acetylation of BPs prior to SBSE improves not only chromatographic responses but also the sample enrichment in the PDMS phase of the stir bars, owing to an increase in the log Ko/w of the analytes. Parameters affecting the sample enrichment step were optimized by using multivariate designs. Extraction and derivatization parameters, such as AA volume (50 and 200 L), sodium carbonate (1 and 2 stoichiometric equivalents related to AA), NaCl (0 and 5% m/v) and methanol (0 and 10% v/v) were studied by means of a Plackett-Burman desing. Table 2 shows that NaCl and methanol concentration seemed not to be relevant factors. The volume of AA and the concentration of Na2CO3 were the variables of highest influence on the sensitivity. [Table 2 here] A more detailed study was carried for these two factors by developing a response surface (n=12), in the range 100-300 L for AA and 0.75-2.0 stoichometric equivalents of Na2CO3 related to AA, indicating that maximum sensitivity was attained with 200 L of AA and 3% (m/v) of Na2CO3. [Fig. 1 here] The most important parameter affecting SBSE is extraction time, which was investigated from 0.5 to 24 h, and equilibrium was reached for all compounds close to 3 hours, so this time was selected. The optimization of thermal desorption (TD) parameters was carried out following a Plackett Burman design: considering desorption time (5 and 10 min), desorption temperature (225 and 275 C), desorption flow (30 and 90 mL min-1), PTV heating temperature (225 and 275 C) and vent pressure (6 and 12 psi). Analysis of the effects results is summarized in Table 2. Values of 275 C and 10 min were selected as desorption temperature and time, respectively, since they positively affected the sensitivity of all compounds. Higher desorption flows increased the process efficiency, so the highest value assayed was selected. Nevertheless, the gas pressure seemed not to be a significant factor, a compromise value being selected. The analytes were retained at 25 C in the CIS, using a Peltier cooling unit, containing a liner filled with an inert support. A PTV maximum temperature of 275 C was adopted according to results in Table 2. 4 CALIBRATION, PRECISION AND DETECTION LIMITS The absence of matrix effects was confirmed by comparing the slopes obtained for aqueous standards calibration graphs and those obtained when the standard additions method was applied to three different samples using a paired t-test. Correlation coefficients higher than 0.99 were obtained for all compounds in the linearity range 20 2500 ng L-1. Detection limits

182

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

(Table 3) were calculated taking into account a signal-to-noise ratio of 3, except for BPA, whose limit of detection should be related to the uncertainty of its blank, by 3 times the standard deviation. The detection limits ranged between 0.9 and 2.5 ng L-1, depending on the compound. Taking into account that aliquots of 2 mL of sample were submitted to the analysis procedure, the detection limits for samples ranged between 4.7 and 12.5 ng L-1. The repeatability was checked by replicated analyses intraday and interday using a fortified sample at 0.5 g L-1 for each compound, relative standard deviations (RSD) appearing in Table 3. [Table 3 here] 5 ANALYSIS OF SAMPLES AND RECOVERY STUDY Ten canned beverages were analyzed using the optimized procedure, BPF, BPA or BPZ being found in eight of the samples, as shown in Table 4. [Table 4 here] Figure 2 shows a typical chromatogram obtained by SBSE-TD-GC-MS for a spiked beverage sample, proving the absence of interfering peaks at the retention time of the analytes, which were identified by retention time and mass spectra in samples and standard solutions. The method was validated by recovery assays, fortifying four different samples at two concentration levels, providing recoveries in the range 89 to 107% (n=64). [Fig. 2 here] 6 CONCLUSIONS The high concentration effect achieved by means of the SBSE technique joined with the excellent sensitivity of the MS detector, allow a rapid and sensitive procedure to be presented. The analytical characteristics and excellent recovery data prove the reliability of the procedure for beverage samples with a low sample consumption as well as simple sample treatment.

183

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST EU Commission Directive 2004/19/EC of 1 March 2004 amending Directive 2002/72/EC relating to plastic materials and articles intended to come into contact with foodstuffs. Off. J. Eur. Commun. L71 (2004) 8. Gallart-Ayala, H., Moyano, E., and Galceran, M.T. 2010. Recent advances in MS analysis of phenolic endocrine disruptors and related compounds. Mass Spectrom. Rev. 29: 776805. Gardziella, A., Pilato, L., and Knop, A. 2005. Phenolic resins: chemistry, applications, standardization, safety, and ecology, ed. Springer-Verlag, Austria. Iparraguirre, A., Prieto, A., Navarro, P., Olivares, M., Fernndez, L., Zuloaga, O. 2011. Optimisation of SBSE and in-tube derivatisationTDGCMS for the determination of several endocrine disruptor compounds in environmental water samples. Anal. Bioanal. Chem. 401: 339-352. Kang, J., Kondo, F., and Katayama, Y. 2006. Human exposure to bisphenol A. Toxicology 226: 79-.89 Kawaguchi, M., Inoue, K., Yoshimura, M., Ito, R., Sakui, N., Okanouchi, N., and Nakazawa, H. 2004a. Determination of bisphenol A in river water and body fluid samples by SBSE with in situ derivatization and TD-GCMS. J. Chromatogr. B 805: 41-48. Kawaguchi, M., Inoue, K., Yoshimura, M., Sakui, N., Okanouchi, N., Ito, R., Yoshimura, Y., and Nakazawa, H. 2004b. Trace analysis of phenolic xenoestrogens in water samples by stir bar sorptive extraction with in situ derivatization and thermal desorption-gas chromatography-mass spectrometry. J. Chromatogr. A 1041: 19-26. Kawaguchi, M., Sakui, N., Okanouchi, N., Ito, R., Saito, K., Izumi, S., Makino, T., and Nakazawa, H. 2005. Stir bar sorptive extraction with in situ derivatization and thermal desorption-gas chromatography-mass spectrometry for measurement of phenolic xenoestrogens in human urine samples. Chromatogr. B 820: 49-57. Llorca-Prcel, J., Martnez-Parreo, M., Martnez-Soriano, E., and Valor, I. 2009. Analysis of chlorophenols, bisphenol-A, 4-tert-octylphenol and 4-nonylphenols in soil by means of ultrasonic solvent extraction and SBSE with in situ derivatisation. J. Chomatogr. A 1216: 5955-5961. Nakamura, S., and Daishima, S. 2004. Simultaneous determination of alkylphenols and bisphenol A in river water by SBSE with in situ acetylation and TDGCMS. J. Chromatogr. A 1038: 291-294. Quintana, J.B., Rodil, R., Muniategui-Lorenzo, S., Lpez-Maha, P., and Prada-Rodrguez, D. 2007. Multiresidue analysis of acidic and polar organic contaminants in water samples by SBSELDGCMS. J. Chromatogr. A 1174: 27-39.

184

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 1 Experimental conditions of the TD-GC-MS procedure Thermal Desorption Unit Mode Splitless Temperature Programme 50 275 C (10 min) at 200 C min-1 Desorption Flow and Pressure 90 mL min-1, 9 psi Cooled Injector System Mode Solvent Venting Liner Silanized glass wool, 1 mm i.d. Temperature Programme 25 275 C (5 min) at 250 C min-1 GC-MS Capillary Column HP-5MS, 5% diphenyl-95% dimethylpolysiloxane 30 m x 0.25 mm, 0.25 m Carrier gas Helium (1 mL min-1) Oven Programme 75 275 C (6 min) at 50 C min-1 Transfer line temperature 300 C Quad temperature 150 C Source temperature 230 C Ionization Electron-impact mode (70 eV)

Table 2 Analysis of the effects obtained for the multivariate design Variable In-situ acetylation and extraction BP BPF BPA BPZ AA volume NS +++ ++ NS Na2CO3 stoichometric equivalent --------Methanol concentration NS NS NS NS NaCl concentration NS NS NS NS Thermal desorption of acyl derivatives BP BPF BPA BPZ TDU maximum temperature ++ + NS ++ TDU holding time + + NS ++ PTV maximum temperature ++ ++ NS NS Inlet gas flow + +++ +++ +++ Inlet gas pressure +++ NS NS NS Significance testing method: NS not significant, + positive effect, ++ high positive effect, +++ very high positive effect, negative effect, high negative effect, very high negative effect.

185

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 3 Analytical characteristics of the method RSD, % Compound BP BPF BPA BPZ Intraday, n=10 2.89 3.59 1.90 3.22 Interday, n=25 5.28 5.80 3.11 3.57 LOD, ng L-1 0.9 0.9 2.5 1.7

Table 4 Results obtained for the analysis of the samples, g L-1 Sample Tonic water 1 Tonic water 2 Sport drink 1 Sport drink 2 Tea Cola Soda Soda 1 Soda 2 Beer 1 Beer 2 BP ND ND ND ND ND ND ND ND ND ND BPF ND ND ND 0.26 0.01 0.08 0.01 0.08 0.01 ND ND ND ND BPA 0.24 0.01 ND 0.30 0.05 0.21 0.02 ND 0.67 0.03 0.39 0.01 ND 0.53 0.01 0.68 0.02 BPZ ND ND ND 0.09 0.01 ND ND ND ND ND ND

Values are mean standard deviation (n=3). ND means not detected.

186

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

LEGENDS FOR THE FIGURES

Fig. 1. Surface responses obtained for the acetylated analytes under different AA volumes and Na2CO3 stoichiometric equivalents related to AA.

Fig. 2. (A) Elution profile obtained for the Soda 2 sample fortified at 5 g L-1 concentration level for each compound . (B) Mass spectra of each compound.

187

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

DIFERENCES: IS THERE A NEED FOR A BRIDGE? Filipa Malafaya-Baptista, University Fernando Pessoa, Portugal fmb@ufp.edu.pt

ABSTRACT This paper is intended to make a brief summary and a comprehensive analysis of the set of papers presented at the 4th EMUNI Research Souk 2012 at University Fernando Pessoa, inserted in the Euro-Mediterrranean Student Research Multi-conference that was entitled "Bridging Gaps in theMediterranean SpaceResearch. The analysis presented here relates to the thematic panel Bridging Gaps in the Mediterranean Space Between Social Science Research and Techniques and represents a contribution to bring closer the traditional approaches developed within social sciences and the approaches of a technological nature, particularly in what concerns the physical territories and the social phenomena that take place in those territories.The intention is to overcome the barriers between these two scientific areas that moved away from each other as a result of this new social order that has emphasized technology over the humanistic vision of knowledge integration

Keyword: technical sciences, social sciences, integration, complementarity

188

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

As a civil engineer I felt tempted to start this introduction with the definition of bridges. Bridges are the constructions that allow us to connect two points facing an obstacle. In the engineering field these obstacles are mainly physical and todays technology allows us to solve the impossible. But the truth is that these engineering interventions have consequences which are not merely physical, they are the basis for a never ending set of human activities, always filled with other kinds of obstacles, both tangible and intangible. Sustainable development processes must recognize the need to overcome these obstacles. Do we really understand the importance of overcoming obstacles, overcoming our differences, of bringing together different points of view, different feelings? The truth is that proximity can be physical or psychological, but it can also be emotional. The physical obstacles are the easiest to overcome. When it comes to Social Science and Technichal Sciences, obstacles and proximity are often much more emotional than rational or physical. 2 TO OVERCOME THE BARRIERS BETWEEN SCIENTIFIC AREAS

The first paper confronts us with the fact that real governance, as a basis for sustainable urban development, is straightly related with a profound understanding of a regions reality, in this case the Mediterranean Basin. This is a complex region where the differences start with the interpretation of concepts such as sustainability or efficiency. Public Policies and territorial research in Euromed is a per that deals with the necessity to develop proper studies to identify features and values of a region, such as the spatial occupation model, in order to develop proposals that indeed provide adequate answers to specific territorial scenarios, respecting differences and embracing similarities. The author suggests that this kind of approach involves creating reliable database and develop appropriate indicators that will allow a rigorous and comprehensive comparison between territories and practices. The EuroMed space presents us with the opportunity to develop this kind of approach particularly with respect to public spaces and port cities in the EuroMed region, and to support the definition of criteria and priorities when it comes to resource management. This raises questions on how to achieve a balanced occupation of territories and distribution of human activities. In this sense the third presentation, Graphical representations of the wines architectures for Euromed context, represents a strong effort in building these databases, establishing comparable information benchmarks. In this paper the author tries to illustrate how technical and multy disciplinary approaches to territorial and landscape analysis can bring us closer to understanding different realities and cultures in the mediterranean spaces. These differences

189

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

frame different identities deeply connected to each space, based in rational but at the same time emotional criteria, opening new windows on how to address these problems. In fact, using comparison techniques to characterize landscape assets and structures, identifying common elements and soecificities, is possible to sort out different identities which can became unifying elements or aggregators of a certain identity, for example the Mediterranean one. The difficulty is in setting up an objective image avoiding the risk that the personal operators judgement might interfere in the selection of image and landscape elements in order to force an identity. Making the bridge with the second and fourth papers is particularly important to meet the goal that was set for this session. The second presentation, The Portuguese tile in the Rudmin Acculturation Learning Model: A fusion case can also be looked in this perspective, as an attempt to provide new answers to the fact that territories, that are indeed physical, reflect social processes where acculturation is becoming more and more frequent, bringing new challenges in the field of obstacle overcoming. The definition of identities, as social phenomena, envolves scientific studies capable to evaluate Mediterranean cultures in order to support protection and differentiation programmes in a globalized environment. The author explores the Rudmin learning model, discussing concepts such as acculturation, assimilation and multi-cultural merging, reminding us that the cultural changes can occur inside ones culture though they usually bring us concern when facing changes coming from different cultures, specially facing the strong emigration and immmigration processes. But reality keeps saying that these new mixtures are resulting in cultural diversity where material acculturation represents mutual learning. Nevertheless the contribution of technical studies should help us question ourselves whether we will have a unique hybrid culture or a full cultural assimilation by a dominant part where minorities will be cultural rare specimens. Finally, in what concerns the fourth presentation, Social Adjustment in the context of social competences in urban groups, the same challenge is proposed, establishing the bridge between technical studies and social sciences, where both the physical and psychological development scenario of children and adolescents, are considered relevant to produce social changes and interactions in the social environment. The author examines the impact of extreme social situations on behaviour and adjustment of these age groups, analysing their interactions in the social context, affected nowadays by globalization and cultural differences. The conclusion seems to indicate that, particularly in urban groups, the physical scenario is an important reference in the learning process of these children and adolescents since violent contexts, physically and psychologically speaking, prevent or hinder learning and development of social integration capabilities. The question that remains is to identify

190

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

objective differences between urban and non urban environments, maybe using technical tools to sustain this analysis. 3 CONCLUSION

These four papers represent the effort mentioned at the beginning of this paper of bringing closer the approaches within social sciences and the technological ones. The different authors recognize the importance of overcoming obstacles and restore comprehensive approaches. The truth is that bridging is essential between technique and social science, between physical and emotional, between cultural and territorial differences. Different cultures and cultural processes and approaches must be brought together, overcoming distances since distance is no longer an excuse. In fact we are now building an important bridge, or at least trying it, at the Mediterranean scale, through EMUNI Research Souk 2012.

191

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Castro, J.F.P. 2012. The Portuguese tile in the Rudmin Acculturation Learning Model: A fusion case. Paper presented at 4th EMUNI Research Souk 2012 at University Fernando Pessoa (Portugal). Elijah, D.W. 2012, Social adjustment in the context of social competence in urban groups. Paper presented at 4th EMUNI Research Souk 2012 at University Fernando Pessoa (Portugal). Madrigal, J.M.P. 2012. Public Policies and territorial research in Euromed. Next perspectives. Paper presented at 4th EMUNI Research Souk 2012 at University Fernando Pessoa (Portugal). Silva, R.P. 2012. Vineyard as identity element of mediterranean landscapes notes to a research project. Paper presented at 4th EMUNI Research Souk 2012 at University Fernando Pessoa (Portugal).

192

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Economic growth and education


Ricardo Morales Zapata, Laura Vera Abelln, Antonina Zhurman
ricardo.morales@um.es; lauravera1904@hotmail.com antonina.zhurman@um.es

Universidad of Murcia SPAIN

Abstract: In this study we intend to contrast the relationship between the economic growth of a specific country in the long term and its education level. For this purpose we will show up the value involved in the improvement of the development level and the role of education quality in the population; likewise we are going to analyze the variables which affect to education quality, such as: how does the teacher/pupil ratio affect to education quality? Can the government improve the education level by increasing the years of schooling regardless to the education quality? Should governments invest more in education in order to obtain better results? We will answer these questions, and some more, along this project.

Key Words: Economic growth, education level, education quality, expenditure, class size.

193

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. Introduction One of the multiple factors which explains the growth of a country is the importance of its human capital. This human capital can be increased improving the education quality of the country; in consequence the education could be observed as human capital which affects to future welfare and society interests (Jorgenson and Fraumeni 1992). The importance of human capital is reflected in technological innovations, promoted by education, and resulting in an increased labour productivity. (Garcia-Mila and McGuire 1992; Quan and Beck 1987) The changes that globalization generates affect positively to the human capital development. We can stand out how political and social changes promote the migration of people who want to improve their skills and knowledge taking advantage of the intellectual property from others countries, consequently we can observe how a lot of families go abroad in order to offer more learning opportunities to their children (Quan and Beck 1987). Our aim with this study is twofold. On the one hand we want to observe and try to weigh up the importance of the numerous factors which can explain the different education levels in a country, thus we will be able to recommend and evaluate how effective an educational reform can be. On the other hand, once having studied the factors that affect to education, we want to check to what extend the reform can contribute to the economic development for the country in the long term through quantitative and qualitative changes. 2. Influential factors in education Next we are going to explain the variables that affect directly to the education level and then determine whether a change in these variables has a positive or negative effect on education. According to Harbison and Hanushek (1992), some of the variables that explain how the education level in a developing country can vary are the followings: teacher/student ratio, teacher education, teacher experience and salary, expenditure for student and facilities. In this study, we are going to focus on those ones that we consider extremely important due to the recent discussions about them. - Student/teacher ratio This ratio refers to the proportion of students per teacher by comparing the number of students (equivalent to full time) to the number of teachers (equivalent to full time) in a specific level of education and the same type of institutions, which allows to indicate the quality in the education system. One of the widespread perceptions is the fact that the smaller classrooms lead to a greater approach between student and teacher, as well as a decrease in interruptions and other negative effects generated in a context of larger classrooms. However this contingent can influence on the performance of the student but no real effect can be analyzed. Other feature that affects the calculation of the student/teacher ratio is the type of level education which is analyzed as we can seen in charts 1, where a decrease in student per teacher is shown we are in a stretch of higher education.

194

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Not only the classroom size is a decisive factor that contributes to improve the performance of students, also other factors are also important but hardly measurable, for instance, the number of classes under the responsibility of the same teacher, the subjects taught, the teaching methodology, among others. Figure 1: Number of students per teacher in full-time equivalents in education

Source: Education at glance 2008.

Moreover it has been observed that the increase in reduced classrooms involves the correspondent increase in education spending because it requires a greater investment in infrastructure and human capital. One way to try to improve the performance of the student is to increase the investment in education as it has been apparently shown that there is a positive correlation between spending per student and his/her performance. -Spending in education However, in the figure 2 we can see that the highest ranked countries, according to the programme for international assessment of the students, do not necessarily have higher costs per student than others worse classified, as we can see in the case of Finland and
17 - 18 April 2012

195

Proceedings of the 4th EMUNI Research Souk

the United States; on the other hand, the lowest ranked countries have a lower spending emphasized by their low wealth.

Figure 2:Expenditure per student according to PISA score

Source: Education at Glance: OECD Indicators 2003, and OECD, Learning for Tomorrows World First Results from PISA 2003

A detailed example to evaluate this effect can be seen in the Chart B7.2 on the study of Education at Glance (2008). In it, we can suspect a certain relationship between the total expenditure in education per student and the PISA assessment in the field of science. But, in this study, this variable is only able to estimate an approximate 15 % of the effect. Another feature of public spending, is that it varies depending on the level of study we select, because the higher this level is, the more the spending grows as it requires better qualified teachers and better adapted facilities as well. From what have been mentioned up to now we are going to introduce how the economic growth of a country can be affected by the years of schooling and its educational quality. As we can see in the figure 2, at first we observe an increasing trend between the number of schooling years and economic growth, even though the Graphic shows that an intensive increase in years of schooling does not always reflect this growth, as it depends more on quality of education during these years more than the numbers of years. Therefore according to the study each year of schooling increases long-term growth in 0.58 percentage points. But this analysis implicitly assumes that one year of schooling has a homogeneous equivalence to a steady increase in knowledge and skills regardless to the educational system. Additionally, it must be taken into account the depreciative effects on educational references of non-schooling factors In reference to the graphic Figure 4.4 of the study The Role of Education Quality in Economic Growth (Erik_A._Hanushek), it points out the impact of the reforms in the educational system over time in the GDP growth. However we can stand out these
196 17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

alterations are only observable once the students affected by the reform, end up their studies and start the working life. Another feature which shows the contrast between the 10-30 years reforms is that those which are undertaken in a lower period of time have a higher impact on the GDP growth. Hanushek (2007) concludes that it would take around 20 years to defray the spending on primary and secondary education. -Social status: As it is shown in PISA 2009 survey, there is a relationship between the degree of pupils basic skills acquisition and the social, economic and cultural status of their families. According to Table 1.1,Vol II, from PISA 2009, we can appreciate how ESCS (Economic, Social and Cultural Status) is distributed on average from the different countries compared to OECD. Negative figures show the under-average countries and positive figures show the over-average ones. We can also notice more than 50% of variation in performance among school centres basing on students social, economic and cultural( see PISA 2009 Table II. 5.1, Vol. II) On the one hand, as a clear example and the most significant case, we observe that Finland has one of the highest ESCS average values but the variability of the student performance is lower than the rest of the analyzed countries. On the other hand, those countries which had a lower ESCS average value, such as Peru, have a high variability in their performance, justified mainly by the differences of the status indicator. So, we can conclude that these results show clearly that the Spanish educational system is together with the Finnish one the most equitable country among the other ones selected. 3. Relationship between education and economic growth. Based to what has been exposed, now we are going to introduce how the economic growth of a country is affected in relation to the years to schooling and the education quality. If we see the figure 3, we can observe a growing trend between the years of schooling and economic growth. However the increase of years of schooling does not result in an economic growth increase necessarily, but also the education quality must be taken in account. Therefore, according to Hanushek & Woessmann (2007), each year of schooling increases long-term growth in 0.58 percentage points. But this analysis implicitly assumes that one year of schooling is equivalent homogeneously to a uniform increase of knowledge and skills, regardless of the

197

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

educational system. In addition the analysis takes into account the depreciable effect on education indicators by others not schooling factors that affect to learning. Figure 3: Conditional growth and the relationship with years of schooling in countries

Source: Eric A. Hanushek and Ludger Woessmann, 2007 In reference to the graphic Figure 4.4 of the study The Role of Education Quality in Economic Growth (Erik_A._Hanushek), it notes the impact of the reforms in the educational system over time in the GDP growth. However these alterations are only observable once the students affected by the reform end up his studies and join the workforce in the country. Other features stand out the contrast between the long term reforms. When education reforms take place quickly, the impact on the GDP growth is higher. Hanushek (2007) reaches the conclusion that the time to cover the expenditure on the primary and secondary education would be approximately 20 years. 4. Conclusion: In sum we could emphasize the importance of citizens education to improve the human capital and the long-term economic growth at the same time. To optimize the teaching degree in the students, there are some quantitative factors that we have to take into account such as teacher-student ratio, the numbers of schooling years or the educational investment and some qualitative factors such as the teaching quality or all of the non-schooling factors that affect the student performance as well. In spite of the great importance of the educational training in a country for its development, during economic recessions it is frequent to reduce the spending in this area with the objective to develop some austerity plans to defray additional expenditures which stem from previous national expansions. In conclusion we can state the countries do not understand the importance of the training in their long-term growth as their main considerations are at the short-term.

198

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Reference list Education at a glance 2008: OECD Indicators. Eric A. Hanushek and Ludger Woessmann, 2007. The role of education quality in economic growth. Eric. A. Hanushek, 1995. Interpreting recent research on schooling in developing countries. Garcia-Mila, T., & McGuire, T. J. (1992). The contribution of publicly provided inputs to states economies. Regional Science and Urban Economics, 22, 229241. Jorgenson, D. W., & Fraumeni, B. M. (1992). Investment in education and US economic growth. The Scandinavian Journal of Economics, 94(1992 Supplement), 5170. Programme for international student assessment, 2006 & 2009. Quan, N. T., & Beck, J. H. (1987). Public education expenditures and state economic growth: Northeast and Sunbelt regions. Southern Economic Journal, 54, 361 367

199

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

EFFECTIVE ENFORCEMENT OF EU ENVIRONMENTAL LAW BY INDIVIDUALS & NGOs

Maria Papadaki; Anastasia Triantafyllou; Eleni Fotiadou; Dimitra Nikolaidou; Asimina Michailidou Aristotle University of Thessaloniki, Greece, andanimaria@yahoo.gr, natasatriantafyllou@hotmail.com, elenilxd@yahoo.gr, diminikol@hotmail.com, semimicha@hotmail.com ABSTRACT

Effective enforcement of EU environmental law depends to a certain extent upon individuals vigilance. To this end, the possibility of individuals being able to invoke directives before their national courts constitutes a crucial step. EUCJ has spectacularly evolved its relevant case-law on this point. However, case-law with regard to individuals access to judicial proceedings to the EUCJ continues to be too strict, thus raising questions as regards EUs compliance with its international obligations. With specific regard to the right of access to justice, the Aarhus Convention Compliance Committee has recently stated (2011) that, even though the Aarhus Convention does not require an actio popularis, EU would fail to comply with its international obligations, if it continues to pose similar hurdles. Also the members states appear unwilling to transpose the requirements of the Aarhus Convention regarding the access to justice in their national legal order. On the other hand, EU seems rather coherent to the Aarhus Convections dictates concerning especially access to information and less public participation in decision-making processes relating to the environment, both at Union and national level

Keywords: effective enforcement, NGOs, access to justice

200

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1.

INTRODUCTION

Individuals, entities and NGOs play an important role in the effective implementation of EU environmental law. The EUs participation in the Aarhus Convention which assures the right to environmental information, public participation in decision making and access to justice in environmental matters as well as the evolution of the jurisprudence of the EUCJ concerning direct effect of environmental Directives equip them with a more complete legal framework for the protection of environment. In this way individuals have become an active and maybe the most important part of environmental protection by being vigilant towards violations of environmental law at national and European level. Although the form of protection is indirect, it can guarantee to a certain extent the efficient implementation of environmental law both at Union (1) and national level (2). I.European Union Level 1.1. THE RIGHT OF ACCESS TO ENVIRONMENTAL INFORMATION AND PUBLIC PARTICIPATION IN DECISION-MAKING PROCESSES RELATING TO THE ENVIRONMENT: REGULATION 1367/2006 The Aarhus Regulation provides individuals, entities and NGOs with two useful tools; the right of access to environmental information and the right of public participation in decisionmaking processes as regard environment. Practising of these rights will test the efficacy of alternative mechanisms for enforcement of European environmental law. European institutions had taken legislative action in order to enhance environmental democracy long before European Union became a contracting party of the Aarhus Convention. The right of access to documents was imprinted into the Treaty of Amsterdam, while was also recorded as a fundamental right in the Charter of Fundamental Rights. The basic legal rules that concern the right of access to documents are contained in Regulation 1049/2001 EC. Compliance of the European Union with the Aarhus Convention provisions led legislative institutions to adopt Regulation 1367/2006 EC on the application of the Aarhus Convention to the European Communitys institutions and bodies. According to Article 3 of the Aarhus Regulation, Regulation 1049/2001 EC shall apply for access to environmental information. From this perspective few changes have been introduced in Community Law. Nevertheless, the Aarhus Regulation provides a more complete scheme of protection in compares with Regulation 1049/2001 EC. The Aarhus Regulation obliges not only European Parliament, Council and Commission to provide access to environmental information, but all the Communitys institutions and bodies. In addition to, residency is not a prerequisite for application. Furthermore, the right of access to information is wider than the

201

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

right of access to documents, containing the collection and dissemination of environmental information. Article 6(1) of the Aarhus Regulation explicitly states that exceptions to the mandatory disclosure of environmental information should be interpreted in a strict manner. This indication improves the precedent status quo, because Regulation 1049/2001 EC does not include a corresponding provision. Also important is the innovation introduced by Aarhus Regulation by stipulating that the requested information related to emissions into the environment is not exempted from the mandatory disclosure, because public interest is deemed to prevail. If access is denied applicants have the right to institute the procedure of article 10 of the Aarhus Regulation. According to its provisions only environmental organizations are authorized to request an internal review. This is inconsistent, with the Aarhus Convention, which proclaims that any person has the right to resort to justice after its request for access to information has been rejected. Locus standi of access to environmental information breathes new life to the private enforcement of European Union Environmental Law. Private persons can obtain crucial information about environmental matters that allows them to manage Commissions activity against Member States in relation to their conformity with Environmental Law. Moreover, public participation depends on the access to environmental information and on informations quality. Public Participation has been incorporated in article 9 of the Aarhus Regulation, which provides for public participation in plans and programs relating to the environment. However, the Aarhus Convention includes provisions not only for public participation concerning plans and programs, but also for public participation during the preparation of executive regulations and generally applicable legally binding normative instruments. As regards this point the European legislator has not complied absolutely with Europeans Union international commitments.

In the Aarhus Convention public stands for individuals, entities and NGOs regardless of their nationality or residence. The part of the public that can participate in decision-making processes will be identified by Community institutions and bodies. The overwhelming view is that public participation is a key component of environmental impact assessment. Democratic legitimacy of the law-making process makes conformation with the rules more secure, because citizens who will be obliged to observe the rules have a

202

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

main role in their configuration. Pinpointing controversial aspects can prevent potential conflicts and public will gradually turn to be more sensible about environmental issues, since this procedure demands vigilance and continuous updating. 1.2. Access of individuals and Non-Governmental Organizations (NGOs) to EUCJ in environmental matters. The Aarhus Convention declares that the rules of contracting parties on standing to bring legal proceedings should give the public concerned wide access to justice within the scope of the Convention. The Aarhus Regulation has given effect to this provision in a specific matter. When a NGO meets certain criteria (article 11 of Aarhus Regulation), it has the right to request an internal review of an EU institutions administrative act. This regulation is not incompatible with the Aarhus Convention because the latter allows the contracting parties to determine the "public concerned" which could challenge the relevant administrative acts. An administrative act is any measure of individual scope adopted under environmental law and having legally binding and external effects. This excludes normative acts of general scope, such as regulations and directives and it covers decisions having legally binding and external effects, irrespective of their form, including those in a form of a letter. he EU institution must then reply written and if the institution refuses NGOs request, or if it doesnt reply at all, the NGO has the right according to Aarhus Regulation (article 12) to institute proceedings before the EUCJ in accordance with the relevant provisions of the Treaty. Although the NGOs standing as addressee of the reply would guarantee the admissibility of the action for annulment, the measure that would be subject the judicial proceeding would only be the written reply, not the original act. Unfortunately, the original act, which contravenes environmental law, would not be affected by the annulment of the written reply. Of course, there is nothing to prevent an NGO to bring an action under article 2634TFEU of the Treaty to seek the annulment of both the institutions reply and the original act. This action could be taken by individuals too, who dont have the right to request an internal review according to the Aarhus Regulation. However the EUCJ would then reply the classical test (Plauman test) of direct and individual concern to judge whether this action is admissible. Natural and legal persons, called non-privileged applicants, have limited possibilities to start the review procedure of EU acts before the EUCJ. They should demonstrate that the challenged act concerns them directly and individually, in other words they should prove that

203

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

they are in a unique position towards the contested act and no one else could be affected by it in the same way. This interpretation of the individual concern has represented the main limitation of NGOs and private applicants access to judicial review of EU acts before the EUCJ. The EUCJ has followed this interpretation in cases, in which environmental NGOs and other non-privileged applicants tried to challenge acts of the Commission, which according to their opinion contravened the EU environmental law. But environmental interests are by their very nature collective and diffuse and therefore almost never concern any particular person individually, in a way that this person is differentiated from all other persons. Moreover, the EJEU should not treat the NGOs in the same strict way as the other non-privileged applicants, because the Arhus Regulation grants NGOs right to access to review procedures. However, the Aarhus Convention (article 93) doesnt require contracting Parties to provide access to justice to any and all members of the public without distinction, it doesnt require an actio popularis. Such access should be provided to members of the public who meet criteria laid down in national law and as regards to the EU, criteria laid down in European law. This distinction should not be unlimited though. EU, as contracting party, should not set too strict criteria and the judicial procedures should be the presumption, not the exception. It should be mentioned that the Aarhus Convention Compliance Committee has recently published her findings and recommendations concerning compliance by the European Union. The Committee states that if the EUCJ continues to set so strict criteria on public access to justice, EU would fail to comply with article 93 of the Convention, because there is effectively no locus standi for either NGOs or individuals to challenge acts or omission of the EU institutions in judicial procedures at EU level.

2. National Level 2.1. THE RIGHT OF ACCESS TO ENVIRONMENTAL INFORMATION AND PUBLIC PARTICIPATION IN DECISION-MAKING PROCESSES RELATING TO THE ENVIRONMENT: DIRECTIVES 2003/4/EC AND 2003/35/EC The Directive 2003/4/EC, installs basic safeguards about environmental information, allowing Member States of European Union to introduce appropriate internal legislation in order to comply with their European and International commitments. The Directive includes, passive information, meaning the effective public access to environmental information by public authorities and active information, namely, dissemination of information by member states in electronic database, easily accessible to public.

204

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In comparison with Aarhus Convention, the Directive 2003/4/EC, specializes the right to public access to environmental information. Environmental information and public authority are described in the Directive in a broader way, while, on the contrary, the grounds of refusal shall be limited. Moreover, the grounds for refusal shall be interpreted in a restrictive way, taking into account for the particular case the public interest served by disclosure. In every particular case, the public interest served by disclosure shall be weighed against the interest served by the refusal. So, the Court concluded that the right to environmental information dominates towards confidentiality of commercial or industrial information(C-266/09). Neither the Aarhus Convention nor the Directive 2003/35/EC excludes the possibility to impose fees for the participation in decision-making processes when it is deemed reasonable (Case C-216/05). However, this matter is still under discussion because the imposition of participation fees discourages some of the interested parties from exercising their rights for financial reasons. Public participation in decision-making processes through certain plans/ programs relating to the environment as well as access to justice in environmental matters constitutes the objective of Directive 2003/35EC, which amends the 85/337EC and the 96/61EC particularly regarding the provision for the public's access to justice to call into question the legality of actions or omissions related to these specific processes. 2.2 Access to justice 2.2.1. Direct effect of Environmental Directives: the theory of the Directives invocability The possibility of private persons to take legal steps in order to enforce certain norms established under the auspices of the EU Treaty before national courts has significant implications for the EU environmental sector. Given the preponderance of EC environmental legislation being crafted in the legislative form of the directive, this possibility depends on the right for individuals to enforce directives.

The EUCJ has developed a new dimension to its traditional jurisprudence on direct effect in the context of environmental directives. According to this, Member State Courts have been obliged to apply provisions of EU environmental directives relied on by individuals in the context of national legal proceedings against state entities, even though the provisions would not appear to meet the criteria of direct effect of sufficient precision and unconditionality. The criterion of sufficient precision excludes provisions which are ambiguous or too vague and general in nature to lend themselves to judicial application. The essential purpose of the

205

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

criterion of unconditionality is to ensure that the reach of the doctrine of direct effect applies only to provisions of a directive that provide no margin of discretion to Member States in their application. Applied to an EU environmental legal context, only relatively few provisions of EU environmental directives meet with these requirements. Furthermore, the doctrine of direct effect can be used after the elapse of the transposition deadline only where the material provisions contained in directives purport to grant substantive rights for the benefit of individuals. This can only difficult occur as far as environmental policy concerned, which intends to benefit the collectivity of society. The leading case in this new dimension of EUCJ jurisprudence is the Kraaijeveld case (C72/95), which involved a failure by the Dutch authorities to adhere to the terms of the Environmental Impact Assessment Directive 85/337 EC in relation to a particular construction project. The margin of discretion conferred to Member States was too wide to fulfill the criteria of direct effect. Nevertheless the EUCJ, avoiding references to the direct effect doctrine, did not consider this considerable discretionary powers of Member States to be a bar or relevant consideration for the national court to take into account. The EUCJ has explained that legal duties set out in directives containing substantial elements of discretion for Member States may be enforced by individuals where the national authorities have failed to exercise the discretion within the legal boundaries set by the Directive. In this way, individuals may rely on the Kraaijeveld case in order to enforce legal duties enshrined in directives, which benefit the collectivity of society, as opposed to specific or exclusively individual legal interests. As far as the reliance on directives against private persons concerned, the EUCJ has resolutely refused to contemplate the possibility of individuals deriving obligations directly from their provisions. Although, one of the instances in which individuals may be subject to clear adverse implications as a result of reliance on a directive is the so named triangular situation, where an individual seeks to effect changes to the conduct of another private person by bringing legal action against a state authority. In the environmental sector, a triangular situation may arise in a number of contexts where state authorities are involved in the licensing of the targeted activity as required by EU environmental legislation. In Delena Wells case (C-201/02), the EUCJ made a distinction and exception where the invocation of direct effect against a state authority had mere adverse repercussion on the rights of third parties, even if the repercussions are certain. If a norm in a directive meets the criteria of direct effect or sets down limits on the exercise of Member State discretion, individuals should be entitled to enforce such provisions before national courts, regardless of adverse economic consequences for some private persons. Adverse economic effects result for various sectors of the economy and in society whenever public policy is executed.

206

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The Court has developed important legal principles concerning the rights and responsibilities of stakeholders involved in the enforcement of EU environmental law. This jurisprudence underlines that perhaps the instrument of a directive is not the most appropriate legal form for EU environmental protection requirements, given the wide discretion of Member States.

2.2.2. Access to justice in relation to environmental information and environmental decision making In following up implementation of the Arhus Convention, specific provisions on access to justice have been incorporated in Directive 2003/04 EC on public access to environmental information as well as in Directive 2003/35 on public participation to environmental decision making. The implementation of the directive 2003/4 EC requires that an applicant for environmental information from competent national authorities has access to an administrative review procedure as well as recourse to a court of law or another independent and impartial body established by law, the latters decisions being binding on public authority holding the information. Concerning the access to justice in relation to environmental decision making, the member states have a discretion to determine the "public concerned" that shall have access to justice for matters of participation in decision-making processes, provided that they require as a condition depending on the provisions of their national laws either a sufficient legal interest or the impairment of a right. Also, the member states shall have to interpret the above two conditions in such a way as to provide a wide access to justice. As far as sufficient interest is concerned, the Court in its judgment considers that the limitation of the right of appeal exclusively to associations with more than 2000 members is not in conformity with the Directive because it deprives all the local associations from the right to appeal. The Court also specifies that this right of appeal is independent in the administrative procedure concerning the decision it intends to challenge (C-263/08). The non-governmental organizations, in particular, should be accorded preferential treatment by the member states. Specifically, pursuant to the interpretation of the relevant provision and the case law of the EUCJ (C 263/08), the NGOs promoting environmental protection and meeting any requirements under national law should be regarded either as having sufficient legal interest or as having a right which is capable of being impaired so that they have access to justice.

207

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.2.3. The Draft Directive on Access to Justice in environmental matters Since the early 1990s, the European Commission had underlined the absence for both private persons and ENGOs of legal avenues for seeking redress for breaches of EU environmental law at the national level. With Member States legal systems varying from rather allowing for an actio popularis to adopting more stringent prerequisites based on the plaintiffs sufficient legal interest, a political commitment for expanding access to justice in environmental matters was included in EUs Fifth Environmental Action Programme (1993-2000). However, it was not until the adoption of the Aarhus Convention that an official legislative proposal was prepared: in 2003, the European Commission presented the European Parliament and Council of Ministers with a Draft Directive based on then article 175 EC (now 192 TFEU) with the aim of providing members of the public and qualified entities with the right to hold national public authorities liable for breaches of EU environmental law, therefore complying with EUs obligations under article 9(3) and article 9(4) of the Aarhus Convention. It is noteworthy that under article 1, said draft directive will be subject to the provisions of the other EU directives regarding access to justice, namely article 6 of Directive 2003/4/EC and article 3(7) of Directive 2003/35/EC. The core provision of the Draft Directive -article 10- obliges States to provide for adequate and effective proceedings that are objective, equitable, expeditious and not prohibitively expensive to members of the public and qualified entities concerning breaches of EU environmental law, encompassing both European and National environmental law under article 2(2). he possibility of individuals challenging acts of private persons is leaving to the discretion of the Member States. The term qualified entity is specified in article 2(c) as encompassing any association, organization or group whose objective is to protect the environment and which is recognized by individual Member States under a specific procedure set out in article 9 provided that it meets certain criteria (a.8). With respect to legal standing for challenging administrative acts and omissions - excluding legislative ones- in violation of EC environmental law, article 4 requires Member States to provide members of the public with the right of access to environmental proceedings, including the availability of interim relief, where they either establish a sufficient legal interest or maintain the impairment of a right, where the administrative procedural law requires this as a precondition. On the other hand, qualified entities under article 5, should be assured access to environmental proceedings, consisting inter alia of interim relief, even though they may not have a sufficient legal interest nor a right impaired, as long as the subject matter of the dispute is specifically covered by the statutory activities and geographical area of activities of the entity in question. A second and novel type of procedural rights is also envisaged in article 6: members of the public and qualified entities are entitled to make a

208

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

request to a competent public authority, designated by Member States, for an internal review in cases of administrative acts or omissions contravening EU environmental law. Nevertheless, due to Member States reluctance in adopting the draft directive, EUCJ in its decision in C-240/09 posed the burden of article 9s enforcement on the national judge, guided by the principles of effectiveness and equivalence and the right of effective judicial protection, given that the Conventions provisions continue to constitute part and parcel of Member States national law. An extrapolation of this concerns the issue of competence for compliance with the Aarhus Convention. According to said judgment and the relative EUs statement in Decision 2005/370/EC on the conclusion, on behalf of the EC, of the Aarhus Convention, required under article 19(5), Member States, as individual Parties to the Convention, continue to be responsible for the performance of these obligations and will remain so unless and until the Community, in the exercise of its powers under the EC Treaty, adopts provisions of Community law covering the implementation of those obligations. CONCLUSION The fact that representative groupings seeking to protect the environment are given legal standing to start administrative or judicial proceedings in environmental matters is a prerequisite in order to secure more effective enforcement of environmental law. However, latest EUCJ jurisprudence shows that EU judge, even after the Convention of Aarhus, still interprets the right of individuals even that of the environmental NGOs to appear before him for environmental issues in a very restrictive way. That is also why he received a negative report and the recommendations of the Aarhus Convention Compliance Committee. Similarly, the unwillingness of Member States to transpose the requirements of the Aarhus Convention regarding the access to justice still poses an impediment to the full realization of its principles.

209

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

1)

Jay Stephen/Jones Carys/Slinn Paul/Wood Christopher, Environmental impact assessment: Retrospect and prospect, Environmental Impact Assessment Review 27 (2007) 287-300.

2) Hartley Nicola/Wood Christopher, Public Participation in environmental impact assessment-implementing the Aarhus Convention, Environmental Impact Assessment Review 25 (2005) 319-340. 3) OFaircheallaigh Ciaran, Public participation and environmental impact assessment: Purposes, implications, and lessons for public policy making, Environmental Impact Assessment Review 30 (2010) 19-27. 4) Somsen Han, Discretion in European Community Environmental Law: An analysis of ECJ case law, Common Market Law Review 40 (2003), 1413-1453. 5) de Abreu Ferreira Sofia, The Fundamental Right of Access to Environmental Information in the EC: A Critical Analysis of WWF-EPO v. Council, Journal of Environmental Law 19 (2007), 399-408. 6) Martin Hedermann-Robinson, Enforcement of European Union Environmental Law: Legal Issues and Challenges, (2007, Routledge-Cavendish). 7) J.A.W. van Zeben, The Untapped Potential of Horizontal Private Enforcement within European Environmental Law (Winter 2010), 22 George Washington International Environmental Law Review 241. 8) B. Toth, Public Participation and Democracy in Practice Aarhus Convention Principles as Democratic Institution Building in the Developing World (2010), 30 Journal of Land, Resources and Environmental Law 295. 9) O.W. Pedersen, European Environmental Human Rights and Environmental Rights: a Long Time Coming? (Fall 2008), 21 George Washington International

Environmental Law Review 73. 10) B.E. Hill, S. Wolfson & N. Targ, Human Rights and the Environment: A Synopsis and Some Predictions (Spring 2004), 16 George Washington International Environmental Law Review 359.

210

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

EFFECTS OF DIFFERENT DEFICIT IRRIGATION STRATEGIES ON THE YIELD AND BERRY QUALITY OF TABLE GRAPE, ORCHAD CRIMSON Conesa, M.R., de la Rosa, J.M., Prez-Pastor, A, Domingo, R, Corbaln, M, Pagn, E. Politechnic University of Cartagena, Spain charo.conesa@upct.es ABSTRACT

The aim of this study was to evaluate the effects of applying different irrigation water strategies on table grape (Vitis vinifera. L) on berries growth and quality. Five irrigation treatments, ranging from moderate to severe water restriction, were applied: (i) full irrigation (FI), irrigated to satisfy the maximum crop water requirements (ETc); (ii) regulated deficit irrigation (RDC), receiving 50% of ETc during post-veraison stage and at 100% ETc in the rest of the growth cycle; and three PRD treatments (PRD 70 , PRD 30 ) irrigated at 70 % and 30 % ETc during the whole growth season, and PRD 50 where irrigation was similar to RDC but alternating the drying zone. Water saving of 40% on RDC and PRD 50 treatments regarding to FI, did not result in losses yield or poor crop quality. Moreover, this restriction in water applied, resulted in an improvement in maturity in these treatments to respect FI. However, a severe deficit applied on PRD 30 around 68 % meant a decrease in yield and reduction weight and volume of berries compared to other treatments. These results for the first year of trial indicated that PRD did not present a clear advantage (or disadvantage) over RDC with regard to weight and quality of the berries. In this sense, two years of study would be needed at least to obtain final results. Keyword: deficit irrigation, partial root-zone drying, table grape, quality berries.

211

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Needing to optimize the available water resources linked to increasing awareness on climate change has led us to develop strategies for implementation of water deficit which has achieved increasing water use efficiency. Regulated deficit irrigation strategies (RDI) as defined by Chalmers et al., (1981), are based on reducing irrigation during certain periods of the growth cycle where the crops have a low sensitivity to water stress. For that reason, their implementation, involves the knowledge of critical periods which depends on the intensity and duration of the stress. As far as table grape is concerned, this period corresponds to veraison (change of colour in red orchard). Traditionally, partial root-zone drying (PRD, Dry et al., 1998) is a deficit irrigation technique that has been studied in wine grapes (Stoll et al., 2000; Du et al., 2008). The hypothesis underlying PRD is that root-to-shoot signalling regulates the plant response to dry soil (Dodd, 2005). However, studies related to deficit irrigation through PRD strategies in table grape are scarce. In this sense, there are many researches about PRD strategies, which promote change in vegetative growth, yield and berry quality. The aim of this study is to study the influence of water restriction vines levels under PRD (70, 50% and 30% of full water requirements) on Crimson Seedless fruit growth and quality and it compares the response to this orchard to PRD observed under a classical RDI strategy and full irrigation treatment.

2 2.1

MATERIAL AND METHODS Orchard characteristics

The experiment was carried out during 2011 in a commercial field of 100 hectares of table grape cv. Crimson Seedless grafted on Paulsen 1103 located in Cieza (Murcia). Vineyards were planting frame 4 x 4 m and vines were 8 years old before starting trial. The climate recorded an annual rainfall of 188 mm and reference evapotranspiration (ETo) of 1195 mm. Irrigation water from Tajo-Segura showed an electrical conductivity (EC 25C ) to 1.3 dS m-1. The soil of the trial area was loam-clay loam which had a bulk density of 1.25 g cm-3 and organic matter content of 2.5 %. 2.2 Irrigation treatments

Five irrigation treatments were applied: a full irrigation treatment (CTL), irrigated at 100 % of the crop evapotranspiration (ETc) and similar to irrigation management followed by the farmer, (ii) regulated deficit irrigation (RDI), irrigated similar to CTL during pre-veraison (critical period) and 50% ETc during post-veraison and (iii) three partial root-zone drying (PRD) treatments: (1) PRD 50 irrigation as RDC but changing the drying zone (2) PRD 70 and (3) PRD 30 at 70 and 30% ETc respectively, during all growth cycle. Data from an automatic meteorological station were used to calculate daily reference evapotranspiration, ETo (Penman-Montheith method). A single lateral per row with four 4 L h-1 drippers per vine was

212

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

used for FI and RDI irrigation. For the PRD treatments, two laterals per vine row were used, which were equipped with two 4 L h-1 drippers on every side of the vine. Crop evapotranspiration (ETc) was estimated using ETo multiplied by a crop coefficient (Kc). This coefficient was calculated using the shaded area percentage measured beneath the vines, as proposed by Williams et al., (2003). 2.3 Measurements

Different measurements were made: (i) leaf water potential was measured weekly at predawn ( pd ) between 05:00 and 06:30 hours GMT, (ii) at midday ( t,md ) about 12:00 hours GMT, in 8 matures leaves with a pressure chamber (Soil Moisture Equipment Corp., Model 3000) following the recommendations of Hsiao (1990), (iii) soil water content ( v ), with FDR probes (model Diviner 2000) in 3 tubes of 1 m depth for treatment. At harvest, each vine was individually collected controlling their production and number of bunches. The average weight of berries was calculated as an average of a sample of 100 berries by replicate. In addition, the volume of the berries (from the equatorial and polar diameter) was determined, as well as, the firmness with meter (LFRA-Texture Analyzer, Model Brookfield) and the color of the berries with colorimeter (Minolta-CR300) in 20 of the 100 selected berries. The water stress integral (S , MPa day) was calculated annually from t,md values as (Myers, 1988).
S =

( i ,i +1 c )n
i =0

i =t

__

(MPa da)
__

[Ecuation 1]

where t is the number of measurements of t,md , i,i+1 , is the mean t,md for any i, i+1; c is the maximum t,md measured during the trial (i.e. -0,41 MPa in pre and post-veraison) and n is the number of days in the interval. Statistical analyses were performed using analysis of variance (ANOVA) and multiple comparisons among treatments using Duncan test at p<0.05 with SPSS (9.1) program. 3 RESULTS AND DISCUSION

FI remained close to soil water content v values to field capacity (390 mm m-1) along the growth cycle, which is indicative of non-limiting water supply for our type of soil (Conesa MR et al., 2012) (Figure 1). The average value was close to 350 mm m-1 of v in the PRD 50 and RDI was similar to 55-104 days after bud break (DDB), period in which both of them received identical irrigation volumes. Figure 1 shows the cycles of alternating PRD irrigation treatments, reaching the lowest values in PRD 30 , specially ( 290 mm m-1). The seasonal trend values t,md in all irrigation treatment decreased over the study period following the same dynamics that climate demand and the leaves age (Dodd, 2005). From September,

213

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

coinciding with the first autumn rains (DDB 147) there were increased values t,md to a maximum of -0,4 MPa in FI. The mean values of t,md in RDC and PRD strategies were similar to those obtained in FI except for those in post-veraison, reaching values of water stress potential of 7.34, 14.11, 14.59 and 33.12 MPa*day for RDC, PRD 70 , PRD 50 and PRD 30 , respectively (Table 2). The seasonal trend found between t,md and pd was similar, due to the good relationship determined between both of them (Figure 2). A reduction of applied water at around 40 % in RDC and PRD 50 did not result in a decreased yield, weight and fertility of clusters and berries (Table 3). However, several reduction of applied water close to 68 % in PRD 30 regarding FI, led to a decrease in volumen of berries and final yield (Table 3 and 4). This fact reflected a breakthrough in maturity in the RDC and PRD 50 against and FI. Eventually, it resulted in bigger productions in the first and second cut harvest coinciding with higher market prices (Figure 3). 4 CONCLUSION

These results show the potential suitability of table grape cv. Crimson, to be used under limited irrigation conditions. Water savings of 40 % obtained in the RDC and PRD 50 treatment did not induce the production losses or crop quality. Minimal differences t,md about CTL during pre-veraison (0.2 MPa) promoted a reduction in production, size and weight of berries. Moreover the WUE was increased in all treatments respect to FI. These results correspond to the first year of trial that has to be validated with at least two years of study. 5 ACKNOWLEDGEMENTS

This study has been developed on a commercial farm owned by Esther Fruits, S.L. under the project CYCIT (AGL-2010-19201-C04-04) financed by the Education and Science Ministry. Conesa MR, was granted a research fellowship from the FPU programme of the Spanish Ministry of Education.

214

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Conesa, MR., de la Rosa, JM., Corbaln, M., Domingo, R, y Prez-Pastor, A. 2012. Evaluacin del dficit hdrico en uva de mesa. Primeros resultados. XXX Congreso de Riegos y Drenajes. Albacete. Chalmers, D.J., Mitchell, P.D., Van Heek, L.A.G. 1981. Control of peach tree growth and productivity by regulated water supply, tree density and summer pruning. Journal American Society Horticultural Science 106, 307312. Dodd, I.C., 2005. Root-to-shoot signalling: assessing the roles of up in the up and down world of long-distance signalling in plant. Plant Soil 274, 251270. Dry, P.R., Loveys, B., 1998. Factors influencing grapevine vigour and the potential for control with partial rootzone drying. Australian Journal of Grape and Wine R. 4, 140 148. Du, T., Kang, S., Zhang, J., Li, F., Yan, B. 2008. Water use efficiency and fruit quality of table grape under alternate partial root-zone drip irrigation. Agricultural Water Management. 95, 659668. Hsiao, T.C. 1990. Measurements of plants water stress. In: Steward BA, Nielsen DR (eds) Irrigation of agricultural crops. Agronomy monograph No 30. Published by ASA, CSSA y SSSA, Madison, pp 243279. Myers, B.J. 1988. Water stress integral a link between short-term stress and long-term growth. Tree Physiology. 4, 315323. Stoll, M., Loveys, B., Dry, P., 2000. Hormonal changes induced by partial rootzone drying of irrigated grapevine. Journal Experimental Botany 51, 16271634. Williams, L.E. Phene, C.J., Grimes, D.W., Trout, T.J. (2003). Water use of mature seedless grapevines in California. Irrigation Science 22, 1118.

215

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figures and tables: Table 1: Mean values of water stress integral (MPa day) during pre and post-veraison of irrigation treatments (FI, RDC, PRD 70 , PRD 50 and PRD 30 ). Water stress integral (MPa*day) PrePostveraison veraison ----FI 0.13 7.34 RDC 0.90 14.11 PRD 70 1.27 14.59 PRD 50 5.93 33.12 PRD 30 Table 2: Annual amounts of irrigation water applied to the five irrigation strategies (FI, RDC PRD 70 , PRD 50 , PRD 30 ), crop reference evapotranspiration (ETo) and precipitation, % saving to FI and water use efficiency divided between pre and post-veraison and total water applied during experimental period. Pre-veraison Post-veraison mm ETo Rainfall FI RDC PRD 70 PRD 50 PRD 30 664 76 2066 1714 1478 1646 891 532 112 4418 2158 2782 2207 1176 TOTAL % saving FI WUE (kg m-3) season 1195 188 6484 3872 4260 3853 2067 *** *** *** 40 34 41 68 7.52 12.33 10.58 12.55 20.05

Irrigation (m3 ha -1)

216

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Tabla 3: Influence of irrigation treatment on the yield, fertility and average weight over the period of study. YIELD FERTILITY AVERAGE WEIGHT (kg vine-1) N bunch N Berries Bunch (g) Berries (g) (vine-1) (bunch-1) 78.06 a 148.75 86 486.38 5.74 a 76.41 a 158.03 89 491.06 5.49 a 83 441.89 5.32 a 72.14 ab 132.63 77.35 a 137.46 86 473.35 5.48 a 145.75 91 428.32 4.62 b 66.32 b

FI RDC PRD 70 PRD 50 PRD 30

ANOVA *** n.s n.s n.s *** *Indicates P<0.05, ** P<0.01, ***P<0.01. n.s: no significant effect (P<0.05).

Tabla 4: Influence of irrigation treatment on soluble solids content (Brix), Acidity (g L-1), mature index, conductivity electric (EC) and pH. FI Soluble solids content (Brix) 19.21 3.99a Acidity (g L-1) 48.30 a IM 3.36 a EC RDC 19.43 3.99 a 49.27a 3.12 c PRD 70 PRD 50 PRD 30 ANOVA 19.24 19.14 19.09 n.s 4.16 b 4.01 ab 4.55 c *** 46.37 b 47.92 ab 42.01 c *** 3.21 bc 3.06 c 3.22 bc * n.s

3.52 3.5 3.51 3.48 3.49 pH *Indicates P<0.05, ** P<0.01, ***P<0.01. n.s: no significant effect (P<0.05).

Tabla 5: Influence of irrigation treatment on volume (cm3), berry firmness (N), and parameters of colour (LCH).

57.66 12.12 c 28.24 c FI 57.47 10.84 ab 26.3 b RDC 57.55 12.1 c 23.89 a PRD 70 57.51 9.25 a 25.74 bc PRD 50 57.57 10 b 27.26 c PRD 30 *** n.s n.s *** * ANOVA *Indicates P<0.05, ** P<0.01, ***P<0.01. n.s: no significant effect (P<0.05).

Volume (cm3) 35.22 a 35.26 a 34.62 a 32.66 a b 28.35 b

Berry firmness (N) 9.87 9.67 7.9 8.17 7.67

(HUE)

(C)

(L)

217

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

pre-veraison 100%

post-veraison 50%
CTL RDC

pre-veraison 70%

post-veraison

pre-veraison 100%

post-veraison 50%
FI PRD50 right PRD50 left

pre-veraison

post-veraison 30%
FI PRD30 right PRD30 left

500 450
v (mm m-1)

FI PRD70 right PRD70 left

500 450 400 350 300 250 0,0 -0,2 -0,6 -0,8 -1,0 -1,2 -1,4 0,00 -0,05
pd (MPa) stem (MPa) v (mm m-1)

400 350 300 250 0,0 -0,2 -0,4 -0,6 -0,8 -1,0 -1,2 -1,4 0,00 -0,05

stem (MPa)

-0,4

pd (MPa)

-0,10 -0,15 -0,20 -0,25 -0,30 50 100 150 DDB 200 250 50 100 150 200 50 100 150 200 50 100 150 200

-0,10 -0,15 -0,20 -0,25 -0,30

DDB

DDB

DDB

Figure 1: Seasonal evolution of soil water content ( v , mm m-1), stew water potential ( stem , MPa) and predawn potential ( pd , MPa) in CTL ( ), RDC ( ), PRD 70 right ( ), PRD 70 left ( ), PRD 50 right ( ), PRD 50 left (
0,000

), PRD 30 right ( ), PRD 30 left (

).

-0,005

pd (MPa)

-0,010

-0,015

-0,020

t,md= 0,0006 + 0,0151pd r2=0,58

-0,025 -1,4 -1,2 -1,0 -0,8 -0,6 -0,4 -0,2 0,0 t, md (MPa)

Figure 2: Relation between pd and stem in all treatments over the period of study.

218

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

50

40

1er cut 2 cut 3er cut 4 cut

Yield in each cut (%)

30

20

10

0 FI RDC PRD70 PRD50 PRD30

Treatment

Figure 3: Yield percentage (%) in each cut in all production on FI, RDC, PRD 70 , PRD 50 and PRD 30 treatments.

219

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Propuesta de comunicacin de la Doctoranda de Literatura Espaola: Cristiana Fimiani (DNI: AO6442558; email: cristianafimiani4@yahoo.it; telef: 622 669 701).

Breve CV:
Licenciada en Lenguas y Literaturas extranjeras (Italiana, Inglesa y Espaola) por la Universidad de Npoles (Italia) con matrcula de honor (110/110 cum laude) y Doctoranda en el Departamento de Literatura Espaola de la Universidad de Granada. Adscrita al Programa Oficial de Doctorado inter-universitario (en colaboracin con la Universidad de Jan) El veintisiete desde Hoy en la Literatura Espaola e Hispanoamericana (La Edad de Plata), distinguido con la Mencin de Calidad por el Ministerio de Educacin y Ciencia. Las asignaturas cursadas se enfocan hacia un periodo clave de la historia literaria peninsular (la cultura del 27 en sentido amplio) que se revela especialmente favorable para indagar relaciones temticas y formales con otros momentos de la tradicin hispnica y con otras tradiciones literarias como la hispanoamericana y la europea. He obtenido el Diploma de Estudios Avanzados (DEA) y la Suficiencia Investigadora (calificacin media: 9.39 /10) y preparo en la actualidad mi Tesis Doctoral, en una lnea comparativa que confronta el simbolismo vegetal en la poesa de Antonio Machado con Eugenio Montale y Giovanni Pascoli, atendiendo al sugerente cruce entre poiesis y scientia, Ciencias Naturales y Literatura.

Ttulo: El viaje entre realidad y deseo del Odiseo cernudiano.

Lnea en que se encuadra: Arte y cultura en el Mediterrneo. Resumen: La condicin de eterno viajero peregrino en el mundo o en su propia patria forma parte consustancial del hombre y se proyecta en la figura arquetpica del Odiseo cernudiano. Que la vida es un viaje de gnoseis y peripeteias, rico de conocimientos, experiencias y aventuras hacia una terra semper incognita en busca de la propia subjetividad, es una honda verdad que ha sido glosada poticamente mltiples veces a lo largo de los siglos. En un mundo que, gracias a los continuos descubrimientos cientficos y tecnolgicos, aparece cada vez ms pequeo, vive su odisea el hombre moderno, sobre el cual se proyecta la sombra del viajero por excelencia de la cultura mediterrnea: aquel polytropos Odiseo de muchos senderos que, antiguo y moderno al mismo tiempo,

220

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

representa el hroe de la continuidad y de la metamorfosis, capaz de enlazar las dos orillas que representan nuestro horizonte ontolgico e histrico. Emblema del conocimiento del mundo y de s en el dolor, icono de la experiencia y de la sabidura, supremo artesano de la techne y consumado maestro de retrica, Ulises es un nombre (que puede ser pirandellianamente uno, Ninguno y cien mil), un significante amplio y equvoco, integrador de significados que se destruyen para renacer en mltiples direcciones (incluso contradictorias), como se refleja en los versos del sevillano Luis Cernuda, quien vivi en la patria del exilio eterno, formada con los fragmentos de sus mltiples destierros americanos y europeos. Con su mostrarse abierto al futuro desde su primera aparicin literaria, Ulises atraviesa los lmites espacio-temporales precisamente porque se ha convertido en el smbolo de toda una episteme, a travs de la creacin de su mito, una sombra que evoca diferentes imgenes sin llegar a denotar un significado preciso. En el largo periplo del hroe griego, en el que parecen estar recogidas las principales encrucijadas de la existencia humana, se funden realidad y ficcin, ciencia y arte, sed de saber y experiencia, personificadas por este paradigma nico de gnosis y aret que nos lleva atrs hacia nuestra origo, hacia la cuna de la civilizacin. Un elemento fundamental del mito odiseico es el de la ausencia involuntaria de la patria y del hogar, realidad padecida por los miles de desterrados de que est poblada la historia del hombre, en todas las latitudes y en todas las pocas. En el caso especfico de la historia peninsular, entre los exiliados de la dictadura franquista destaca el poeta sevillano, hombre siempre en camino, que no encontr nunca o no quiso encontrar un lugar donde quedarse y echar races. Este peregrino sin retorno, que seguir deambulando siempre entre realidad y sueo, entre recuerdo y deseo (los polos contrarios en eterna lucha en la obra cernudiana), sin echar de menos un destino ms fcil, tuvo siempre la conciencia intensamente romntica de ser un exiliado del mundo y la necesidad de no permanecer largo tiempo en ningn sitio, de estar siempre dispuesto a la partida, sin ningn anhelo de volver a pisar el suelo de su patria.

221

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

EMPIRICAL - DESCRIPTIVE ANALYSIS OF THE VALUES OF PARENTS AND TEACHERS IN THE REGION OF MURCIA Ana Tolino Fernndez-Henarejos anacarmen.tolino@um.es University of Murcia

ABSTRACT

This research seeks to understand and analyze, first, what values transmitted by parents to their children and teachers to their students in grades 5 and 6 of Primary Education, and another check for consistency between home and school settings. In this study enrolled a total of 310 parents and 53 teachers from several schools in the district of Cartagena, Torre Pacheco, chosen through an intentional non-probabilistic sampling. The methodological orientation has been followed is the empirical analytic (descriptive-correlational) and the technique of data collection has been indirect observation through two questionnaires. The data suggest that there is considerable interaction between the values embodied by family and school. The results are given in the research will be useful, inter alia, to design educational programs aimed at promoting education in values. Key words: Values, education, family, teachers

222

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. SOME REFLECTIONS ON EDUCATING IN VALUES In spite of the fact that the Pedagogy and more concretely the theory on the education in values is relatively young, especially in Spain, where it begins at the end of the seventies, are numerous the investigations that we can find in the matter. To speak about education in values demands to do explicit referencia to the philosophical tradition in the Spanish university, in the matter it is necessary to highlight the contributions of Imperial sand grouse and Gasset, Lopez Quintas; nevertheless, Ricardo Marn besides the philosophical vision possesses a pedagogy, helping with your writings to introduce the values in the educational practice with your work " Values, aims and attitudes in education " (1976). The same year, there was celebrated the Congress VI National of Pedagogy by the title(degree) " The education depending on the values ", and later since there gathers the teacher Escmez (2003) the topic of the values returns to disappear of the Spanish panorama, until in 1986 it appreciates a positive change. In the interest that the values wake up in the education, and the works of the social psychology contribute new theoretical perspectives, reaching the definitive impulse for that we are employed at education, wine with the Theory the Development of the Moral Reason of Kohlberg (1981), disciple of Piaget. Since then, the need and the desire to know the basic values of the persons, good be political, religious, cultural, family or school, it has been present in many experts dedicated to studying your evolution in the time and in the space. Professionals of diverse areas (Psychology, Pedagogy, Politics, Anthropology, Sociology, etc.) they have turned into a fundamental prop not only of the formal education, but also of not formally and informally. There are multiple the references that we can find on values and education, as well as events destined to think both in the theory and in the practice of the education in values. Between the most recent studies that we have gathered in this work it is necessary to highlight World Values Survey (WVS). In this respect, the present investigation tries to know the values of the educational agents in the educational community of centers belonging to the Region of Murcia. Nowadays, the family has important difficulties to carry out your mission transmisora of values because they lack valid models for the new generations, the learnings that they received are expired and little adapted for the situations that your children cross. We are present at a loss of the traditions that stops abandoned to the families in the task of educating. It is habitual, to find family multitude that there put in fabric of reason the values that, in the past, have given solidity to the human being. Of there that, nowadays, exists the sensation of not being able what values preserve and what new values the parents and mothers need in the

223

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

education of your children. Even for the educators it turns out to be very complex to happen between that values to teach from the school. In this respect, Mnguez (2009, 14) before the question what values must it teach the family?, he thinks, " there is no unanimous response. Even more, it would be nonsense enumerate those that should occupy the educational task of mothers and parents. We live in a society so plural as diverse that there exist also plural conceptions of the world and of the man, which makes any homogeneous offer of values superfluous. ". Departing from this premise, we cannot homogenize the values because as members of heterogeneous families we conceive the world with different looks, thoughts and different ways of doing, apart from living in a very changeable society with new needs, but if it fits the need to know the values that must occupy first place in the society to coexist as civic beings, to verify the values that must be transmitted from the educational community and the desirable values that want to be transmitted. Every family is free to educate your children in the values that he considers more opportune. Being certain this because it is gathered in the Spanish Constitution "the parents are free to choose what education they want to give to your children", nevertheless there moves along the risk of falling down in the promulgation of values that are opposite to a democratic way of life. Without horizon more or less shared of values of the principal educational agents (family and school) it becomes very difficult, for not saying impossibly, the development of a coherent offer of values to children or pupils. Saying in other terms, being respectful with the freedom of election of the parents in what values they want to transmit your children, nevertheless, is urgent to know what values they want to transmit to your children. This knowledge of values is basic to determine a coherent model of education between family and school. If there is no coherence between the values that transmit the families between yes and the teachers / main of your children it is possible that one could produce a desacreditacion of what the parents and mothers teach in the home and what the teachers teach in the classroom, with which the pupil can enter a situation of indecision for learning what value, because the values do not learn all simultaneously, but there are times, paces, insistences in which there are preferences to some and not for others, though the values that teach the families and the teachers are suitable. As consequence of the previous thing, promises to be the problem of the present study, that is to say, the need to know what values they prefer transmitting the parents your children, what values they are learning in the schools and to analyze the correlation that is established between both contexts, to design later a pedagogic program based on a shared project of education in values.

224

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2. THE FAMILIAR AND SCHOOL VALUES. PERCEPTION OF THE VALUES IN THE REGION OF MURCIA The work of the pedagogic integral diagnosis from the perspective to educate in values is a complicated and multidimensional matter that it needs of a systemic projection based on the beginning of the collective protagonism which essence takes root in the incorporation of all the social actors and institutions that operate in the educational environment of the student (Fernandez, T., Len, I. and Ramirez, R., 2009). Of the results obtained in the investigation "Empirical descriptive Analysis of parents and mothers in the pedanias of Cartagena and Tower Pacheco " (Tolino and Hernndez 2009), we gather in this paragraph only the perception of the parents of the familiar values, stopping for another occasion, the perception that the tutors has on the familiar values.

2.1. Aim Bearing in mind that the problem of the investigation tries to know if there exists a shared project of transmission of values between family and school, the general aim that appears is to analyze the values that the educational community (parents and teachers) transmits to pupils of the third cycle of Primary (5 and 6 ) of school centers belonging to the Region of Murcia.

2.2. Shows For the obtaining of the sample a series of centres were selected in the pedanas of Cartagena and Tower Pacheco, having in it counts the following criteria: nearness of the investigator to the context I object of the investigation, in order to have a knowledge nearer to the school reality; school centres of primary; availability and interest of the centre to take part in the investigation; presence of student body proceeding from different family types, we to be guaranteed by the withdrawal of information of the values that are given in the different family models; and finally, centres where the presence of foreign population I placed approximately I half-close 20 %, to be able to know if the school centres contemplate the values of the not autochthonous population. Bearing these criteria in mind, the public selected centres are: Our Lady of Dolores (Dolores), St Kitts (The Hut), Azorn (The Mills Marfagones), San Antonio Abuse (San Antn), Michael of Cervantes (The Aljorra), Vicente Medina (Dolores), Fontes (Tower Pacheco). The total number of invited families was of 641, and there were gathered a total of 310 questionnaires of parents and mothers, of which we can

225

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

consider valid 294 questionnaires and 16 void ones, since they were delivered in white or incomplete. Bearing this information in mind, the average participation of the families is 45,50 %. The questionnaire destined for the families could be completed on both parents (51,3 %) or only on one of them, there being gathered 32,3 % of the questionnaires elaborated exclusively by the mother and 16,5 % only by the father. On the other hand, the total of invited teachers was of sixty, of which seven did not take part, which represents approximately 10 % of sample death. In this respect, the royal producing sample of information is formed by 294 families and 53 teachers.

2.3. Methodological design This investigation places inside the studies of descriptive cut that they try to describe, to analyze and to interpret systematically a set of facts and variables that characterize them of way as they are given in the present. Bearing in mind the problem and the aims of this investigation, two questionnaires have been designed, one directed parents and mothers of the pupils of 5 and 6 of primary and other one to teachers. The first one of them offers us information about the values that the parents consider to be basic in the family life, the values that they try to transmit to your children and the school values that the teachers must transmit. Departing from the previous questionnaire, there was designed the instrument of withdrawal of information of the school context to be completed by the teachers, supporting similar dimensions, structure and procedure of cumplimentacion. This questionnaire allows us to know the perception of the teachers with regard to which they must be the values that the school must teach, which are the values that they transmit in the classroom, and the values that the family is transmitting.

2.4 Proved In the later table there is gathered the information referred to the values that the parents consider to be basic for the family life, where it is possible to detach that there are no significant differences in the values that the parents select of those that the mothers select. On the contrary, the first ten values chosen by the parents as the most important in the family life are coincidental for both. On the other hand, also an internal coherence exists between parents and mothers at the moment of determine which are the values of minor importance for the family unit.

226

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

VALUES Reciprocity Love

Loyalty Health Confidence Tolerance y respect to the others Money Independence Care and attention to the others To be a person in charge To be honest To be loyalist

Table 1. Basic values in the familiar life that the parents and mothers consider PARENTS MOTHERS VALUES PARENTS MOTHERS (%) (%) (%) (%) 10,3 8,4 To be able to 41 55,5 excuse 56,1 70,3 To be an open to 28,4 35,5 dialog person 31,6 32,9 Ambition 8,1 6,5 47,4 59,4 Austerity 5,5 5,8 43,2 56,1 Companionship 36,1 45,5 54,2 67,7 Humility 31 36,8

13,2 12,3 29,4

12,6 15,8 37,4

Leadership Cleanliness Order

5,5 28,7 25,5

7,7 44,2 33,2

59,7 37,4 21,9

69 50,6 23,5

Perfectionism Sincerity Free time

10,6 38,4 15,2

10,3 49,4 16,8

The questionnaire also allowed us to gather information with regard to ten basic values that the parents try to transmit to your children. The obtained results have been overturned in the table that appears later, arranging them of bigger than minor according to the frequency of election on the part of the parents. The qualitative information coincides with the quantitative ones, revealing that the most select values are: tolerance and I respect the others, good manners and sense of the responsibility. This aspect is linked to the second article of the teachers' questionnaire, refers to the perception that there have the teachers of the basic values that the family tries to transmit. From the analysis of information there has been extracted that three values most chosen by the teachers are: tolerance and I respect the others, good manners and to be able to talk. Whereas the teachers consider secondly the dialog, the parents do not give him so much importance (dialog in ninth place), because they consider the sense of the responsibility as elementary.
Table 2. Basic values that try to transmit the family to your children VALUES FAMILY (%) VALUES FAMILY (%) New manners 84,2 Capture of decisions 29,7 Sense of the responsibility 78,4 Sense of the economy 28,1 and spirit of now I strengthen in the work 78,4 Independence 23,5 To be able to excuse 75,5 Democracy / freedom 22,3 Integrity 61,6 Justice 21,9 Happiness 60 Obliging 19,4 Honesty 50,3 Capacity and ambition in 18,4 the life

227

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

To be able to talk Solidarity / equality To be a friend Obedience To live in peace Capable of loving

47,1 45,5 44,8 42,3 41,6 33,9

Religious person Autodisciplinary Imagination Public-spirit To share expenses Altruims

18,4 17,1 16,8 16,5 10,6 7,1

Besides the familiar values the school values have been analyzed also across three questions, the first one of them the perception of the parents gathers respect of the values that consider to be basic in the school education (to learn to coexist, I respect, effort / witness, companionship / friendship and respect to the individual differences), secondly, five values considered by the teachers as the basic ones for the school the chosen ones are the same for the parents, and finally, five values that the teachers try to transmit in the classroom are (respect, effort / witness, to learn to coexist, dialog and companionship)

Table 3. Percepcion of the school and familiar values


VALUES (SCHOOL CONTEXT) To learn to conviver Respect Effort / witness Companionship / friendship I respect to the individual differences autonomy To talk To promote the capacities of the pupil Teamwork Knowledge Effort Safety To learn to know Discipline Honesty Creativity To learn to cooperate Satisfaction Independence Altruism I respect the authority of the teacher Competence Routine Power Prestige PERCEPTION OF THE PARENTS (%) PERCEPCION OF THE TEACHERS (%) 83 81,1 79,2 67,9 64,2 60,4 54,7 52,8 50,9 49,1 45,3 37,7 37,7 37,7 37,7 32,1 30,2 20,8 15,1 13,2 13,2 9,4 3,8 1,9 0 VALUES THAT THE TEACHER TRANSMITS IN THE CLASSROOM (%) 64,2 83 71,1 54,7 47,2 45,3 60,4 52,8 49,1 49,1 39,6 34 52,8 30,2 35,8 32,1 34 32,1 18,9 11,3 20,8 17 1,9 0 0

53,9 79,4 72,6 70,3 36,8 14,5 38,7 34,2 73,5 79,4 42,9 43,5 59,7 55,8 25,5 32,6 42,3 28,4 26,8 4,8 60,3 8,4 7,7 8,1 6,1

228

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSIONS There is perceived that there is enough coincidence between the values that the parents want to transmit and the teachers to want to transmit in the classroom. So that between the values that perceive family and school they are not divergent, on the contrary there is certain agreement between them, nevertheless, it would be necessary to do another type of analysis of how the values are being transmitted in both contexts, to be able to guarantee that these values do not constitute a condition desirable and ideal, but foreign to the reality. It would be very interesting to identify clearly the values that are transmitted but also it is very important to know that parents and teachers want to transmit values to be able to realize a program of education in values. To big ranges we can indicate that this study is a modal to indicate and to insist on the values that it is necessary to teach in the school, in the home, in the societ ... and we find the need to design programs not of value in general but of the coincidental values (differentiated from family and professorship).

229

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Escmez. J. (2003). The values and the education in Spain (1975-2001). In Imperial sand grouse, P. Theory of the Education, yesterday and today. Interuniversity seminar of Theory of the Education. Fernandez, T., Len, I. and Ramirez, R. (2009). The diagnosis in the education in values. Magazine CONNECTS. 15 (90), 1-11. Minguez, R. (2009). The ethical task of educating in the school. (Consulted On March 10, 2012 in URL:www.unioviedo.es) Ortega and Gasset, J. (1973): complete Works. Magazine of West, Madrid, 7, 317. Tolino, A., Mnguez, R. and Hernndez, M.A. (2009). Empirical - descriptive analysis of the values of parents and teachers in the pedanas of Cartagena and Tower Pacheco. The IInd Days of the Master in Investigation and Innovation in Infantile Education and Primary Education. Murcia: University of Murcia.

230

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

EMPLOYEE PERCEPTION OF ANNUAL PERFORMANCE INTERVIEWS Mitja Gorenak, International Faculty for Social and Business Studies, Slovenia mitja.gorenak@issbs.si prof. dr. Eva Jereb, Faculty of Organizational Sciences, University of Maribor, Slovenia eva.jereb@fov.uni-mb.si

The following paper aims to investigate the employees perception of annual performance interviews. Firstly, a short introduction is provided which includes a thorough and comprehensive literature review, relevant to this topic. After presenting the theoretical background on this topic hypotheses were developed and tested in the empirical part of this paper, with a survey that was conducted online. A link to the survey was forwarded to each employee, working at a relatively recently set-up organization that employs highly educated workforce. A total of 36 out of 52 responses were received from employees. The data was analyzed using the statistical software SPSS for Windows. With the help of Pearsons correlation and variance analysis, the findings indicate various interesting views that employees share regarding their perception of annual performance interviews.

Abstract

Keywords: annual performance interview, employee perception, research paper.

231

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Conducting annual performance interviews may seem to be a very straight forward thing, but it is far from it. It demands a substantial amount of theoretical knowledge as well as certain practical experiences for the person who is conducting the interview. There are plenty of books and articles arguing who should be performing annual interviews, and the most useful combination still seems to be the involvement of a person being interviewed, his or her manager, and a human resources manager. Specific combination of knowledge by the human resources manager in the area of human resources and knowledge of operational work from a certain sector can provide us with the most useful answers needed to improve relations between employees and the management. 2 ABOUT ANNUAL PERFORMANCE INTERVIEWS

Although annual performance interviews have been widely researched in the past two decades, according to Gorte (2002), the roots of annual performance interviews go back into 1950s, when Drucker (2001) has developed his management by objectives theory (MBO). At about the same time, Douglas McGregor (1960) published his work The Human Side of Enterprise discussing the X and Y theory which took management circles by a storm, setting a new trend in motion, where companies have started to develop processes that were based on managing objectives and this, in turn, lead to the development of annual performance interviews, since objectives were the goal of management as well as of employees. Gruban (2004a, 3-5) goes even further by asserting that the first signs of annual performance interviews go back to the year 1887, far before modern management has evolved. Nevertheless, annual performance interviews have developed greatly within the past 20 years. Traditionally, employees were more or less told what is expected of them. Today, annual performance interviews are more focused on setting standards of behavior and expected competencies of employees. Brown and Heywood (2005) argue that new age in annual performance interviews has arrived where employees are encouraged to cooperate when setting their goals, adequate pay, career advancement and so on; thus making this not just a management job but a two way process. 2.1 Defining annual performance interview

According to Breko (2007a, 7), an annual performance interview is a systematically planned interview between an employee and his or her manager, offering an in-depth exchange of opinions regarding personal and professional development of the employee. Annual performance interview is defined by Mihali (2006, 222) as a tool that can be used to improve communication between employees and their superiors. Mihali (2006, 222) also emphasizes that annual performance interviews are a soft management tool, which needs to be performed this way and can not be performed alongside evaluation interview. Breko (2007b, 34) stipulates that annual performance interview is an open discussion where an employee has the opportunity to express his or her desires especially regarding his or her career advancement paths.

232

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.2

Annual performance interview effectiveness criteria

Though many still believe that annual performance interviews are taking too much valuable time for too little effect, many researchers have proven that this is not the case. In this respect, Walsh and Fisher (2005) have defined 5 criteria with which the success of annual performance interview can be assessed. The criteria include validity, reliability, objectivity, relevance and discrimination. Eileen Piggot-Irvine (2003, 172) claims that we can discuss the effects of annual performance interviews when we can see the interaction as confidential and supportive, and not being defensive or over-controlled. Effective performance interview is a result of mutual respect. Piggot-Irvine (2003) also presents her view on criteria of annual performance interview, her view is shown in Figure 1. Figure 1: Annual performance interview criteria for effective appraisal.

Source: Piggot-Irvine (2003, 173). In Figure 1, Piggot-Irvine (2003, 172-173) presents 10 different criteria that can be used to evaluate the effectiveness of annual performance interviews. The higher we aim at acknowledging every single criterion the better effectiveness of annual performance interview we can expect.

233

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

RESEARCH HYPOTHESES AND METHODOLOGY

For the purpose of this article we have set up the following hypotheses: H1: There is a correlation between perception of importance of annual interview and the level of education. H2: There are differences between the perception of relaxed feeling during annual performance interview and age. H3: There is a correlation between evaluation of competencies of the person who is conducting an annual performance interview and the perception of relaxed feeling during annual performance interview. Research for this article was conducted in a relatively young organization that employs highly educated workforce. For this purpose, a questionnaire was sent out to 52 employees in this organization. After a 14-day period 36 questionnaires were returned, what represents a 69,23% yield. Results that we have gathered were analyzed using SPSS statistical analysis software; we have conducted some descriptive statistics analysis, correlation analysis and analysis of variance. 4 RESULTS

Firstly, we decided to analyze demographical data. We have found that there were 48,5% male respondents and 51,5% of female respondents, the average age was 36,48 years and on average, respondents had 11,44 years of service out of which they had spent, on average, 3,40 years in the organization. Before continuing to a more in-depth statistical analysis, the reliability test for all the questions was conducted (respondents were offered answers on a scale of from 1 to 5) and the Cronbachs alpha coefficient was calculated. The value calculated is 0.863, which indicates a very good reliability of measurement according to Ferligoj et al. (1995). Secondly, we have set off to investigate a correlation between the perception of importance of annual interviews and the level of education; results are shown in Table 1. Table 1: Correlation between perception of importance of annual interviews and level of education.
Level of education 1 33 -,466(**) ,008 31 Annual interviews are important

Level of education

Annual interviews are important

Pearson Correlation Sig. (2-tailed) N Pearson Correlation Sig. (2-tailed) N

1 36

**Correlation is significant at the 0.01 level (2-tailed).

234

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

As seen from Table 1, interviewees with a higher level of education evaluated that annual performance interviews are less important; between these two variables we can see a statistically significant, though a negative, correlation (-.466**) that is relatively strong. We have also investigated potential statistical differences between the perception of a relaxed feeling during the annual performance interview and age; results are shown in Table 2. Table 2: Difference between perceptions of relaxed feeling during annual performance interviews and age.
variable I feel relaxed during an annual performance interview F p average 6,450 .002 3,37 mean age group up to 28 years from 29 to 33 years from 34 to 38 years 39 years or more

3,86 2,00 4,40 3,50

As seen from Table 2, there is a statistically significant correlation (F=6,450; p=0.002) between the perception of relaxed feeling during annual performance interview and age. From Table 2 we can see that those interviewees who are in the age group between 29 and 33 years evaluate this significantly below average (3,37) with the lowest (2,00) score. Slightly above average are those who are 39 or more years old (3,50), the other two groups are significantly above average. Finally, we have investigated the correlation between the perception of interviewers competencies and the feeling of interviewee; results are shown in Table 3. Table 3: Correlation between perception of interviewers competencies and the feeling of interviewee.
The person who is conducting an annual performance interview has proper competencies for the job. 1 I feel relaxed during an annual performance interview

The person who is conducting an annual performance interview has proper competencies for the job. I feel relaxed during an annual performance interview

Pearson Correlation Sig. (2-tailed) N Pearson Correlation Sig. (2-tailed) N

33 ,748(**) ,000 33 1 36

**Correlation is significant at the 0.01 level (2-tailed).

As seen from Table 3, those interviewees who think that the person conducting an annual performance interview has proper competencies for the job also feel more relaxed during an annual performance interview; between these two variables we can see a statistically significant correlation (.748**) that is fairly strong.

235

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSION

It was interesting to find out that those interviewees who have a higher level of education evaluated annual performance interviews as less important, what, on the one hand, seems to be quite alarming, given that these are the ones who should understand the importance of annual performance interviews. On the other hand, it is also true that they have already, in most cases, reached the peak of their career and since annual performance interviews, in many cases, are focused on that, this result may be perceived reasonable. It was somewhat expected to see that interviewees who think that the person conducting an annual performance interview has proper competencies for the job also feels more relaxed during an annual performance interview, and this emphasized the importance of proper preparation as well as proper knowledge in how to perform annual performance interviews. The last finding has shown that interviewees aged between 29 and 33 years evaluated their perception of feeling relaxed during annual performance interviews significantly below average (3,37) with the lowest score (2,00), what was difficult to interpret. However, as already explained, these are the employees in peak of their career what might be the reason why they might feel uneasy about the interview. The following article has shown some of the aspects of employee perception of annual performance interviews that are relevant. The topic as such may cause some unease with employees especially in the turbulent economic times, but for sure this is just one small aspect that still needs to be properly managed to help organizations be more successful.

236

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST 1. Brown, Michelle in John S. Heywood 2005. Performance Appraisal Systems: Determinants and Change. British Journal of Industrial Realtions 43 (4), 659679. 2. Breko, Daniela. 2007a. Pripravite se na letni razgovor: Napotki za zaposlene. Ljubljana: Planet GV. 3. Breko, Daniela. 2007b. Sodobni pristopi k vodenju rednega letnega razgovora 1: Se premalo pogovarjamo? Poslovna asistenca 2007 (10): 34-35. 4. Drucker, Peter. 2001. Managerski izzivi v 21. stoletju. Ljubljana: GV Zaloba. 5. Ferligoj, A., A., Leskovek in Kogovek, T. 1995. Veljavnost in zanesljivost merjenja. Ljubljana, Fakluteta za drubene vede. 6. Grote, Richard C. 2002. The performance appraisal question and answer book: survival guide for managers. New York: AMACOM. 7. Gruban, Brane 2004a. So kompetence nova prilonost za opeane letne razgovore? Ljubljana: Dialogos. 8. McGregor, Douglas. 1960. The human side of enterprise. New York: McGraw-Hill. 9. Mihali, Renata. 2006. Management lovekega kapitala. kofja Loka: Mihali in Partner. 10. Piggot-Irvine, Eileen 2003. Key features of appraisal effectiveness. The International Journal of Educational Management 17 (4), 170178. 11. Walsh, Kate in Dalmar Fisher 2005. Action inquiry and performance appraisal. The learning organization 12 (1), 2641.

237

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ENTREPRENEURSHIP IN EDUCATION SECTOR

Ana Petrovska 1, Tanja Micalevska2


1

Faculty of education - Bitola,Bitola, Republic of Macedonia 2 Faculty of economy-PrilepPrilep,Republic ofMacedonia


1

anickabt@yahoo.com 2tanja.micalevska@gmail.com

ABSTRACT The affirmation of knowledge and its increased importance creates opportunity for entrepreneurs to start a business in the educational sector. In most of the cases, this service has historically been publicly delivered. Today the situation is changing and interest for investing in this area is increasing. Venturing into this field has many positive effects such as: Rising the effectiveness and efficiency in providing educational services; Developing programs that focus on improving the skills, knowledge and abilities of students rather than on standardized test they can pass; Engaging teachers who are locally-recognized top teachers. Better organization and better communication between teachers and learners. These and many other advantages of education provided by private sector should result with increasing the interest for enrolling a private rather than public school. In order to highlight the opportunities and challenges which entrepreneurs face entering into this kind of businesses, I made a case study about one of the most successful private schools in Republic of Macedonia. Keyword: entrepreneurship, Macedonia, education, unmet need.

238

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION Entrepreneurship is an ability to find good business ideas products that others do and turn them needs of

into successful outcomes by customers.

providing services and the chances that

meet the not

Entrepreneurs recognize

recognize and the

unmet needs of customers. Expectations of buyers are constantly changing and they are a source of opportunities for entrepreneurs to start a successful business. To achieve this goal entrepreneurs should understand and recognize the needs of the consumers. After that, they come up with new ideas, turn them into products and services. Good entrepreneurs address the needs of the environment better than others.

2 ENTREPRENEURSHIP MAIN FEATURES he establishment of new business and entrepreneurship are related, but we can not claim that every opening of a new business is entrepreneurial or that every enterprising venture necessarily means establishing a new business. If we consider the first case we can say that the establishment of a new business can be motivated by different reasons like loss of job, searching for employment opportunities, searching employment opportunity for a family member, etc. However if the underlying business doesnt include existence of innovation, an idea that should be implemented with some degree of risk, then there is no entrepreneurship. On the other hand, the second case is related with the question: Is there a necessity to establish a new business for the existence of entrepreneurship? The answer is no. Much of entrepreneurs implement their ideas and innovations in existing enterprises. They can buy the business from the previous owner and adapt it to the new idea or start a business using the franchise. There are many ways that show entrepreneurial behavior and they are not necessarily associated with opening a new business or a small business. The truth is that entrepreneurship is often present in small and medium enterprises, but just as in previous case it should not be a rule. Recently is more common entrepreneurship in large corporations. This entrepreneurship is still known as intrapreneurship (Taki Fiti 2007). important features of entrepreneurship. First and one of the most important characteristics of the entrepreneurship is innovation. Innovation does not necessarily mean introducing a new product or service. It can refer to the introduction of a new form of organization in the enterprise, a new way of There are several

239

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

distributing existing products, new designs and so on. The introduction of the innovation and its implementing in the products requires systematic work, perseverance and responsibility. Another important feature of entrepreneurship is the belief of the entrepreneur in the viability of his idea. This is not just about starting business for profit. Profit is one of the main goals, but not the only one. There are also other important goals such as success of the enterprise, realization of the idea, personal satisfaction. To achieve the results entrepreneurs must work persistently. The belief in the success of the undertakings is what encourages the entrepreneur to take risks. Entrepreneurs enter in businesses where the risk is great but they have confidence that are able to overcome the obstacles. However the risk is calculated.

ENTREPRENEURSHIP IN MACEDONIA

After the break of Yugoslavia and the beginning of the transition process in Republic of Macedonia, it appeared so-called spontaneous entrepreneurship. The term spontaneous points that the enrichment of the economic structure of the country with new enterprises, happened without the existence of specific government measures and instruments. Despite the absence of a government program designed to support entrepreneurship, a big number of small and medium firms were established at the time. They are motivated by necessity rather than by opportunity. If we consider statistical data in Macedonia, they lead us to a conclusion that there is great interest for entrepreneurship in the country. According the data from GEM study undertaken in countries in Europe, Macedonia has the highest entrepreneurial activity measured through the key index TEA (Total Early-stage Entrepreneurial Activity). The TEA index for Macedonia is 14.5% (Donna J. Kelley 2012). It means that 14.5% from the respondents at age of 18-64 are entrepreneurs. One important thing that we should keep in mind is that despite the increasing number of established new small and medium enterprises, not all of them are result of a new idea, a new way of working. On contrary many of them are established as a way to get out of unemployment. Unlike these

entrepreneurs entrepreneurship true sense is connected with the desire to deliver a project and achieve many goals including high profits. The difficult economic situation in the

Republic of Macedonia makes it difficult to make a clear distinction between people who invest capital in an idea, and those who invest capital in enterprise with aim to improve their employment status and financial situation. The ones who are in the center of this paper are entrepreneurs who invest in an idea.

240

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CASE STUDY - MEGASOFT PLUS

The reason why I decided to work case study about Megasoft is that it is one of the companies where you can see an example of entrepreneurship in Macedonia. They started in 1990 in Bitola. Their goal was accomplishing an idea which at first looked impossible: to make an important contribution to the area of computers and its enforcement in education.

4.1 The birth of the idea In 1990's personalized computers were in use all over the world. Initially their price was high. With the development of new technology, more advanced computers were created and the costs of production decreased. Prices of computers also decreased and they became more available for people. Overtime many Macedonian families bought computers. At this point a problem appeared. The computer owners didnt have enough knowledge and skills needed to use the machines effectively. In every problem lies a new opportunity.

Specialists who have worked on the field of computer techniques recognized the opportunity and decided to offer solutions. People who had no knowledge were willing to pay to acquire it and specialists offered different courses. The idea was opening a center for learning computer skills. Founder of the school was Ljupco Petrovski graduate electrical engineer. Afte all the necessary organizational matters such as licenses, people capable of training and appropriate facilities were taken, the idea began to realize. The company was divided into two parts. The first ones aim was to offer software solutions, and the other courses were designed for children and adults. Megasoft offered wide range of software products, advanced software packets with high automaticity (Megasoft n.d.). There were also applicative computer programs for assorted use, starting from individual business to co-operative solutions for production, trading, servicing and other entities. An important characteristic were the additional services such as quality training, rich and detailed instructions, prompt and efficient support, constant upgrading the functionality and abilities of the programs. The dynamic development of computer techniques is still a challenge for the team of Megasoft Plus to the point of implementation of the construction of sophisticated, modern and comfortable computer systems. Many courses were organized for children and adults. At the beginning the courses were divided into two groups: computer courses and courses in English. The need for applicable

241

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

skills in these areas, as well as the lack of supply of this knowledge into the formal education system have led to tremendous interest in such courses. In a short period of time the activities offered by this private school has grown. The lessons were based on inter-active use of the computer which is an irreplaceable source of ideas and interesting contents which enrich education and make it interesting. After a while the courses were provided in different locations in the city. This enabled children from different parts of the town to attend classes. Also new learning areas were opened - the study of German language and mathematics.Over time other private schools started to offer these or similar services. Competition increased. The founders of Megasoft realized that only change is eternal and that they need to adapt to the new challenges. New ideas and actions were necessary.

4.2 Continuous Entrepreneurship

The one exclusive sign of thorough knowledge is the power of teaching..- Aristotle

Megasoft once again proved that the essence of entrepreneurship is not just having an idea and company is open a new enterprise. Entrepreneurial activity and operates should be on never stops. Even when new ways, new the ideas,

well established solutions

the market,

new organizational allows progress and

introduced. Thus ensures its survival and of the founders of

growth.

Entrepreneurial spirit

Megasoft never ended and they undertook a new venture in the area of Bitola.

- opening a private highschool

Secondary education until recently was conducted only in public high schools. But the amendments to the Law on Secondary Education in 2002 created conditions for

the establishment and functioning of private schools. This open the opportunity for Megasoft to create an institution that will be part of the educational system of the Republic

of Macedonia and to educate pupils in line with European standards. At the same time the school can provide education realized in modern equipped classrooms and using multimedia support in teaching. First generation high school students have enrolled in the school year 2008/2009 (First Private Gumnasiym Bitola n.d.). In order to successfully implement teaching in high school

teachers from different areas were engaged. Professors are available to students for consultation by e-mail and telephone. The school employs 16 teachers,a psychologist, a

242

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

dentist and a doctor. The amount of tuition fee is 2000 euros. For the best students there are scholarships available. Teaching is a theoretical and practical. Pupils study compulsory, elective and optional subjects. The theoretical part means using textbooks from renowned Macedonian and world authors. Books and additional literature can be found at the library. Practical training takes place in the cabinets. Gymnasium has cabinet with proper chemistry lab, office of biology, physics cabinet, cabinet for geography. What differentiates The first private Gymnasium in Bitola from public high school gymnasiums is the introduction of information technology in all spheres: in writing homeworks, essays, projects. Each pupil with the enrolment in the high school gets a laptop. Apart from regular classes, pupils have additional content and projects, sports activities, vacations, winter vacations, excursions, attending seminars, visiting museums, opera performances, etc. Talented pupils have extra classes to gain greater knowledge of the area and prepare for international competitions. Since the establishment of high school, it started cooperation with Non Governmental Organization Amos - Bitola. In international workshop in April 2011, three students participated where in they as a a ten-day were the result of

cooperation with Amos - Bitola, Republic of

only representatives of the

Macedonia. Also

cooperation with AMOS - Bitola, the students attended the Conference on Human Rights in Strasbourg in September 2011. 5 CONCLUSION Entrepreneurship in education in Macedonia has perspectives and they are more and more apparent. At the beginning only certain individuals were able to see opportunity in opening a business. Today the significance which is given to entrepreneurship and the measures taken to stimulate it result with creating new businesses. Megasoft Plus is just one of many examples of entrepreneurial activity not as something given once and for all, but as a continuous process.

243

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Kelley.J.D, Singer.S, Herrington.M.2012 "GEM 2011 Global Report." First Private Gumnasiym Bitola. http://www.ppg.edu.mk/ (4.4. 2012). Megasoft. http://www.megasoft.com.mk/ (6.4. 2012). Fiti.T. HadzinVasileva-Markovska.V.Bejtmen.M.2007. Entrepreneurship. Skopje: Faculty of economics.

244

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ENVIRONMENTAL IMPROVEMENTS IN PORT AREAS, AN APPLICATION TO CARTAGENA PORT


Jernimo Esteve(1); J. Enrique Gutirrez(1) (1) Universidad Politcnica de Cartagena, Spain jeronimo.esteve@upct.es; jose.gutierrez@upct.es

ABSTRACT
The current trend in environmental legislation leads to regulation and action for reduction pollutant emissions originated by ships while they are in port. This requires the authorities develop strategies to carry out this reduction in pollutant emissions in order to achieve more environmentally sustainable port holding. In the present work a new concept, which is in full swing, will be exposed: "Onshore Power Supply" (OPS), which is based on the provision of electricity to ships from the shore during their berth at port. In addition, it will be proposed a new conception of this strategy (OPS 2.0); for instance, the mix with power generation from renewable sources, leading to a practical application to Cartagena port and assessing their impact on environmental quality of city.

Keyword: green power, renewable energy, clean ports, OPS

245

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION
Nowadays, the operation, berthing and permanence of ships in port require considerable energy expenditure to carry out the operation of all equipment and systems. This expenditure does not only refer to enlightenment, but also to other onboard systems such as heating, hot water, ventilation, etc. which are electrical consumers, which need to be supplied energy through the diesel generators arranged for it mission. However, this generation causes environmental pollution (Moser, 2009; Hall, 2010), which today is one of the main environmental problems in port cities, due to the growth of maritime port traffic (Batley et al., 2004).

Currently, E.U. and U.S. have rules, which regulate the issuance and sulfur content in fuels consumed by ships. This requires a change in environmental policy in the port scope, as well as, investigating new ways, which leads to reduction the emissions in port. Today, it already exists the technology, which allows ships to connect to a shore power supply, allowing faster operation, simple, and environmentally friendly, this is the so-called concept "Onshore Power Supply" (OPS), which will be developed in the next section.

However, the development of this concept is associated with an infrastructure that the majority of the ports usually do not have (only 18 ports in the world have these facilities) these installations to provide electricity from shore. However, the ships usually are not fitted to receive the power from shore power supply. Thus, auxiliary motors, coupled to an altenator, generate on board the energy required. These auxiliary engines consume oil or heavy fuel oil, generating gaseous pollutants from the exhaust, as well as, noise and vibration. So, if the electricity supplied comes from shore, emissions, noise and vibration may be reduced to levels environmentally friendly.

2. ONSHORE POWER SUPPLY CONCEPT


The OPS technology is based on replacing the onboard power generation by dieselgenerator groups with electricity produced on shore (http://www.ops.wpci.nl/). Thus, OPS can be defined as a strategy to improve air quality in ports and port cities allowing reduce emissions of greenhouse gases such as CO2, SO2, NOx, if it is done by the use of renewable energy sources such as wind or solar, as will be presented in the next section of this work. The

246

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

OPS technology has been used since the 80's for supplying shore power to commercial vessels. Ferries ships were the first to use this technology, the reason was that always called at the same quay and in the same position, being easier for shore connection (Ericsson et al., 2008). Today, other types of commercial vessels such as cruise ships, container ships and Ro / Ro can be connected to onshore power grid at different ports around the world.

The process to establish this technology in port can be set in five stages (Ericsson et al., 2008):

- First stage: determination of local data. Study the types of vessels calling at port, establishing the most appropriate type to use OPS technology. Usually, they will be those ships with frequent and long stays in port, because the potential emissions reduction will be higher.

- Second Stage: technical study. Study the technical aspects concerning the infrastructure to carry out the energy supply. This could consider: technical study on electrical systems, estimation of potential emissions reductions and estimating the economic cost and environmental effectiveness of this technology.

- Stage Three: Measure Implementation. Actuation to carry out civil engineering necessary for establishing supply power systems.

- Fourth Step: Strategy review. Evaluation of the results of the previous steps.

- Fifth Stage. Performance. Extending the strategy to other ships, share experiences with other ports and with combining this strategy with others to reduce pollutant emissions.

Nowadays, the OPS system is being implemented in several North American and Europe ports, among these:

Port of Gteborg (Sweden): In 1989 this port adapted the passenger terminal for Stena Lines ferries passengers to Kiel. In 2000 it became the first port to have a high voltage connection for supply ships, engaged to Ro/Ro vessels.

247

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Port of Stockholm (Sweden): In 1985, it inaugurated a connection to ship power supply from shore intended for passenger ferries.

Port of Kemi and Oulu (Finland): In 2006 these ports adapted Ro/Ro terminals to use OPS technology.

Port of Antwerp (Belgium): Worldwide pioneer in 2008 with the installation the first OPS system operating at 50/60 Hz, it was designed to give electricity supply for container ships (http://www.marinelog.com/DOCS/NEWSMMVII/2008AUD00221.html).

Port of Los Angeles (USA): In 2004, the Port of Los Angeles in cooperation with the shipping company China Shipping Container Line became the West Basin Container Terminal in the first worldwide fitted with OPS system.

Port of Long Beach (USA): In 2005 the Port of Long Beach and oil company British Petroleum (BP) launched a project for these company oil tankers used shore power while in port. The facility was first used in 2009.

Port of Juneau (USA): In June 2001 the Port of Juneau in collaboration with Princess Cruise Lines installed the first OPS system worldwide to supply cruise ships (Tetra Tech Inc, 2007).

Port of Pittsburgh (USA): In 1991, Pohang Iron & Steel Company adapted the terminal at the Port of Pittsburgh with an OPS system to supply four Bulkcarriers while in the terminal (Environ, 2004).

Currently, many ports are implementing OPS technology Le Havre (France), Marseille (France), Civitavecchia (Italy).

In the light of the above, the presence of this methodology is not well rooted in the ports of southern Europe. The work presented at the next point would make the basins of Cartagena and Escombreras Valley in reference ports in southern Europe.

248

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

3. OPS 2.0: TOWARDS THE TOTAL EMISSION REDUCTION


In this section, it is presented an improvement of strategy OPS, through the mixing with renewable energy sources, thus, it will be closed the OPS 2.0 concept. An application of this new methodology will be applied in the basins of Cartagena and Escombreras Valley.

3.1. OPS 2.0: Concept The OPS concept has been presented in the preceding paragraphs, it starts with the supply of electricity to ships in port from the shore. However, most of this energy will come from fossil sources, from combined cycle plants, nuclear plants, etc. So, these emissions generated in port will be moved to those power generation plants on land. As, it can be seen, the net impact in emission reductions is lower than expected. Therefore, it is proposed the conception OPS 2.0, in this case, the electric supply of ships in port comes from renewable sources generated by the port itself, which will have the installation needed to carry out the operation of power supply.

3.2. OPS 2.0: Strategy applied to Cartagena and Escombreras Valley port The strategy for implementation the concept OPS 2.0, requires a complete study of renewable energy resources available in area close to the port where the strategy will be established. In the case presented, it will be apply this strategy to the basins of Cartagena and Escombreras Valley ports.

It should be noted, that both basins have the right characteristics for the combined implementation of wind turbines and photovoltaic installations. Based on the topography of the mountains of Escombreras Valley, it can be noticed the location for sitting of wind turbines, this allow to reduce the visual impact on port areas nearest to town, in addition, it is an area with low disturbance of the wind resource.

Respecting to the photovoltaic installation, to reduce project costs and visual impact, it is necessary to set as primary location for solar panels, storage decks and ceilings of the buildings located inside the port area in both terminals Escombreras and Cartagena.

249

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Both basins were analyzed. It was estimated that the area available for the establishment the photovoltaic installation is approximately 51,395 m2. It can be shown in Figures 1 and 2.

Figure 1: Area available in Escombreras Valley basin

Figure 2: Area available in Cartagena basin

Source: own elaboration.

Along with this, it was estimated the solar and wind resource available in the nearby areas of Cartagena and Escombreras terminals. In the first case, it was obtained an estimated production around 5.582 KWh/m2. However, the solar resource is only available certain number of hours per day, it makes necessary to use a solar-wind hybrid installation and covers electrical power demand for 24 hours a day. Analyzed the wind resource, it was obtained an average annual rate of wind about 6 m/s.

In order to estimate the wind-solar hybrid plant, it is necessary to know the energy required by the ships calling at the two basins. The reference used was the historic ship calls provided by the Port Authority of Cartagena during 2010. In year 2010, the total number of ship, which calls in both basins, was 1,538 ships. This number includes a mix of vessel types among which are: crude oil and product tankers, liquefied gases tankers (LPG and LNG), container liner vessels, cruise ships and bulk carriers.

To determine the energy required of these vessels in port, it was made an estimation of the power of diesel generator and associated consumption according to the description provided by the shipping company that operates the ship, it has not only given the power supply but also the environmental benefits quantified in tonnes of CO2, SO2, NOx, etc. that would no released into the atmosphere.

250

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

After classifying vessels, it was estimated simultaneous consumption of ships in port and thus the electrical power required to supply. During year 2010 the average electricity consumption of ships in port was 130 MWh/day the peak demand was recorded on September 6, 2010 of 200 MWh/day, see Fig, 3. In light of these results, the facility was sized according to the most unfavorable condition and took into account future needs from increased port traffic.

Figure 3: Daily ship electrical power consumption in port during 2010

Source: own elaboration.

With the parameters calculated above, the wind turbine system was sized with 25 wind turbines of 850 KW each. This installation would be capable of generating 225 MWh/day. The figure 4 shows the monthly potential electricity generation from the facility placed in each basin, as well as, the cumulative total for the two basins.
Figure 4: Monthly potential electricity generation in each basin

Source: own elaboration.

251

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

From the environmental point of view, the result of the implementation of this strategy in Cartagena and Escombreras basins saves 20,800.5 tons./year of CO2 emissions, 454.2 tons/year of NOx and 123.3 tons/year of SO2, see Figure 5. This would be equivalent to remove from the streets of Cartagena the emissions caused for 10,000 cars.

Figure 5: Monthly spread of CO2 emissions from diesel generators of ships

Source: own elaboration.

4. CONCLUSIONS
The implantation of the technology OPS combined with renewable energies supposes reducing to minimal levels the emission of greenhouse gases, noise and vibrations in the port environment. This represents an environmental and healthy benefit for port staff, as well as, for the population along the port.

As has been shown, the practice of this strategy proposed in this work leads Cartagena and Escombreras basins in a preferable position in the use of OPS technology. On the other hand, the main immediate challenges for this technology lie on the high cost of its implementation in order to supply all types of vessels, the adaptation of ships and ports, as well as the lack of standard law enforcement.

Finally, according to the above, OPS 2.0 technology is one of the most effective strategy to reduce emissions from ships in port.

252

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST
Bailey, D., Plenys, T., Solomon,G.M., Campbell, T.R., Feuer, G.R., Masters, J., Tonkonogy, B. 2004. HARBORING POLLUTION: Strategies to Clean Up U.S. Ports. Natural Resources Defense Council. USA. Environ International Corporation. 2004. Cold Ironing-Cost effectiveness study. Volume I. Los Angeles, California, USA. Ericsson, P., Fazlagic, I. 2008. Shore-Side Power Supply: A feasibility Study and technical solution for an shore-side infrastructure to supply vessel with electric power while in port. M. S. Thesis. Chalmers University of Technology. Goteborg, Sweden. Hall, W. J. 2010. Assessment of CO2 and priority pollutant reduction by installation of shoreside Power. Resources, Conservation and Recycling. pp. 462-467, vol. 54. ISSN: 0921-3449. Lbeck commissions Germanys first plug-in power supply for ship:

(http://www.marinelog.com/DOCS/NEWSMMVII/2008AUD00221.html). Moser, J. 2009. Onshore Power System, Connection to reduce emissions. 20th. International Conference on Electricity Distribution. Paper 0790, Prague Tetra Tech, Inc. 2007. Draft-Use of shore-side Power for ocean-going vessels. American Association of Port Authorities. Los Angeles. USA. Wold Port Climate Initiative: (http://www.ops.wpci.nl/)

253

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

EVALUATION OF WHEY PROTEIN REMOVAL FROM STAINLESS STEEL SURFACES IN A CONTINUOUS FLOW DEVICE

J.L. Jimnez Prez, D. Altmajer Vaz, M. Garca Romn, E. Jurado Alameda, M. Kanidi and M. Alexandropoulou Chemical Engineering Department, Faculty of Sciences, University of Granada, Campus Fuentenueva s/n, 18071 Granada, Spain jjperez@ugr.es

ABSTRACT The development of safe, efficient and environmentally compatible detergent formulas is an important issue for the food industry in order to ensure adequate levels of quality and safety, while saving energy and time and decreasing pollution. The effectiveness of the removal of whey protein from hard surfaces was studied using a laboratory device called Bath-Substrate-Flow. Three different buffer solutions were used as washing bath in order to analyze the effect of pH over protein washing processes. It was found that protein was denatured at strong acidic and alkaline conditions, which caused a decrease in detergency compared to neutral pH. Finally, it was found that a concentration of NaOH of 0.1 wt% was optimal for the removal of the protein. Further research is needed, particularly to analyze the effect of several factors such as temperature and use of surfactants, enzymes and strong oxidants such as ozone. The removal of insoluble (denatured) protein must also be studied, in order to optimize the cleaning of protein deposits in the food industry.

Keywords: hard surfaces cleaning, protein soil, detergency, clean-in-place system.

254

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Cleaning operations are of key importance for the food industry, in order to fulfil the required levels of food quality and safety. These operations are also time and energy consuming and have a considerable impact on the environment because of the amount and pollutant content of the wastewaters generated by them (Pascual et al., 2007). Therefore, the optimization of the industrial cleaning processes is needed in order to save costs and to prevent further contamination of surface waters (lakes, rivers, seas, etc.) by industrial wastewaters. The efficacy of the cleaning process depends on numerous factors such as the properties and concentration of the soiling agent, the properties of the substrate, the characteristics of the washing device, temperature, detergent formulation, hydrodynamic forces and the duration of the process (von Rybinski, 2007). The devices and washing procedures available for evaluating detergency in textiles are numerous (Harris et al., 1950; Ginn et al., 1966). However, the design of devices for testing washing efficiency on hard surfaces is less developed. Jurado-Alameda and co-workers have proposed a laboratory device, called Bath-Substrate-Flow (BSF), which simulates an industrial clean-in-place (CIP) system, in order to establish a suitable strategy for the development of cleaning processes. The BSF device was developed and patented by our group (Jurado-Alameda et al., 2002) and used in previous studies with both fatty (JuradoAlameda et al., 2006; Jurado-Alameda et al.,2009) and starchy soils (Jurado-Alameda et al., 2011). In the present work, we used the BSF device to study the removal of whey protein from stainless steel surfaces. Firstly, we developed a method to adhere soluble protein films to hard surfaces. After that, we studied the removal of these protein films with the BSF system. Currently, we are carrying out washing assays with denatured protein.

2 2.1

MATERIALS AND METHODS Reagents and materials

Whey Protein Concentrate (WPC), obtained from Milei (Leutkirch, Germany), was used as soil, and a stainless steel conventional scrubber was used to prepare the substrate (material to be soiled). NaOH solutions were used as washing bath in the BSF device. In addition, washing tests were performed at several pH values using different buffer solutions. All the solutions used in the experiments were prepared with distilled water. The reagents were all of analytical grade or better and supplied by Panreac (Barcelona, Spain).

255

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.1.1

Buffer solutions

Three buffer solutions were prepared at various pH values (acidic, neutral and alkaline): pH 3 - This buffer solution is known as Mcllvaine buffer and contains Na 2 HPO 4 (0.041 M) and citric acid (0.079 M). pH 7 - This buffer solution is known as Srensen buffer and contains Na 2 HPO 4 (0.05 M) and KH 2 PO 4 (0.027 M). pH 11 - This buffer solution is known as Ringer buffer and contains Na 2 HPO 4 (0.077 M) and NaOH (0.023 M).

2.2

Substrate

A stainless steel conventional scrubber was cut into pieces of 2-cm diameter which were used as the substrate. Each piece should weigh between 0.8 0.85 grams. Eight pieces were used for each experiment, so that the total weight of the spheres was about 6.6 grams.

2.3

Soiling agent

A protocol was established to prepare and to deposit the whey protein over the surface of the spheres, giving the same detergency values under the same conditions. The protocol consist in preparing a protein solution of 45 wt%, dipping the spheres in the solution until the air inside comes out as a large bubble, and finally, draining off the excess protein on a metal mesh for one hour. Then, the spheres were introduced into the oven at 60C and left there for at least 12 hours until a constant weight reached. The amount of protein absorbed in the spheres was determined by weight difference.

2.4

Washing tests

The washing tests were performed in the Bath-Substrate-Flow (BSF) device proposed by Jurado-Alameda et al. (2002), which simulates a clean-in-place (CIP) process. The efficacy of the cleaning process carried out in the BSF device can be determined by the analysis of the soiling agent removed from the surface of the substrate. A simplified scheme of BSF device is shown in Figure 1, where (A) is the stirred tank containing the washing solution (500 mL of capacity); (B) is a packed column (50 mL of capacity, 2.5 cm in diameter and 8.5 cm in height) where the soiled substrate is deposited; (C) is a peristaltic pump; (D) is a thermostatically controlled bath; and (E) is a paddle stirrer. [Figure 1 here]

256

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In this study, the procedure for the washing assay consisted of the following steps: (i) preparing the washing solution; (ii) adjusting the experimental conditions (temperature, recirculation flow rate, etc.); (iii) placing the soiled substrate in the column (Figure 2); (iv) beginning the detersive process, i.e., sampling the washing bath (control) and switching on the peristaltic pump to start the washing process; (v) sampling the washing bath at fixed intervals and (vi) analyzing the protein present in the washing bath. [Figure 2 here] For these experiments, the washing process was repeated three times and was carried out at 30 C, using distilled water (control), three buffer solutions (pH 3, 7 and 11) and NaOH solutions (0.01, 0.1, 0.5, 1 and 2 wt%) as the washing baths. The stirring speed in the tank, the flow rate of the washing solution and the volume of the washing bath were kept constant at 60 rpm, 30 L/h and 0.5 L, respectively, throughout all the experiments. The detersive performance or detergency (De, %) was calculated as the percentage of soil in the washing bath (m bath ) relative to the total amount added to the substrate at the beginning of the process (m protein ), according to Eq. (1).

To apply Equation (1) we assume complete mixing of the washing solution throughout the BSF device, i.e., the composition of the washing bath is the same in each point of the system.

2.5

Analysis of protein soil

The total amount of soluble protein in the cleaning solution was analyzed by the Pierce BCA Protein Assay (Thermo Scientific) based on bicinchoninic acid (BCA) reaction for the colorimetric detection and quantitation of total protein. For this, firstly the working reagent (WR) was prepared by mixing 50 parts of BCA Reagent A (sodium carbonate, sodium bicarbonate, bicinchoninic acid and sodium tartrate in 0.1 M sodium hydroxide) with 1 part of BCA Reagent B (4% cupric sulfate). Then 0.1 mL of each sample was pipetted and mixed with 2.0 mL of the WR in test tubes. Finally, the tubes were incubate at 37 C for 30 minutes in a bath and the absorbance was measured with the spectrophotometer at 562 nm. However, the absorbance was measured directly with the spectrophotometer at 280 nm for the experiments in which water was used as washing bath, since in this case, there were not interfering substances for this direct method. In both cases, to express the experimental results in terms of protein concentration, the values of absorbance were compared to protein concentration standard curves.

257

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

3 3.1

RESULTS AND DISCUSSION Influence of the pH on the cleaning

The pH value is one of the most important parameters affecting washing process. Furthermore, it is known that the pH value have a great influence on the structure and the behaviour of proteins in water solution. Table 1 shows experimental pH values for the different washing solutions. [Table 1 here] Figure 3 shows the efficiency of protein removal (over 30 minutes of washing) from substrate at different pH values, using three buffer solutions as washing baths. The results of a control test with water as washing bath are also shown. As can be seen, the highest detergency was achieved at pH 7. On the other hand , the detergency at pH 3 and 11 was much lower, being the efficiency at pH 3 lower than at pH 11. [Figure 3 here] Therefore, it seems clear that pH exerts a great effect on the washing efficiency, presumably because of change in the protein structure. At pH 7 (neutral value), soluble protein is in its natural state (soluble) and is easily removed from the substrate. However, at pH 3 and 11 (strong acidic and alkaline values respectively) soluble protein is denatured (protein develops a gelatinous appearance) and becomes partially insoluble, thus reducing the efficiency of protein removal.

3.2

Cleaning with NaOH solutions

Timperley's et al. (1988) investigation of protein cleaning rates showed an optimal cleaning rate at NaOH concentration of 0.5 wt%. Furthermore, Bird's et al. (1991) initial work indicated the existence of an optimal concentration of NaOH near 0.5 wt%, which is used as a standard in several cleaning formulas for CIP (clean-in-place) systems. Similar results were obtained in the washing tests performed in the BSF system (Figure 4). As can be seen, the optimal concentration of NaOH was 0.1 wt% at 30 minutes washing. Despite higher initial values being achieved at a concentration of 0.5 wt% the final detergency was similar. High NaOH concentrations (1 and 2 wt%) resulted in a decrease of washing efficiency due to protein denaturation. [Figure 4 here]

258

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSIONS AND FUTURE OUTLOOKS

The effectiveness of the removal of soluble whey protein from hard surfaces was studied using a laboratory device called Bath-Substrate-Flow. Firstly, the washing efficiency was related to the pH which was found to exert an important effect on detergency, due to the protein behaviour at different pH values. Then, we studied the washing process with NaOH solutions as cleaning agent, finding an optimal concentration of 0.1 wt% in a thirty-minutes cleaning test. This research is beginning, and nowadays, we are studying the washing of denatured protein. Soon, we will also analyze important factors in washing processes such as temperature and the use of surfactants, enzymes and oxidants such as ozone, in order to optimize these processes and thereby reduce costs, time and pollution in the clean-in-place systems frecuently found at the food industry.

ACKNOWLEDGMENTS The authors are grateful for the financial support provided by the Spanish Government (Ministry of Science and Innovation) through the Project CTM 2010-16770 and the study grant to Jos Luis Jimnez Prez (Subprogram FPI-MICINN: BES-2011-043947). The authors also want to thank the Master of Chemistry, University of Granada (Spain), which subsidizes the participation of Jos Luis Jimnez Prez in the 4th EMUNI Research Souk (Murcia, Spain).

259

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Bird, M. R., and Fryer, P. J., 1991. An Experimental Study of the Cleaning of Surfaces Fouled by Whey Proteins. Food & Bioprod. Proc., vol. 69C, pp. 1321, 1991. Ginn M.E., Davis G.A., Jungermann E.,1966. Statistical approach to detergency III. Effect of artificially soiled test cloth. J. Am. Oil Chem. Soc. 43:317320. Harris J.C., Brown E.L., 1950. Detergency evaluation. I. Wash test methods. J. Am. Oil Chem. Soc. 27:564570. Jurado-Alameda, E., Bravo Rodrguez, V., Bailon Moreno, R., Nez Olea, J., Altmajer Vaz, D., 2002. Mtodo BSF (Bao-Sustrato-Flujo) y dispositivo para evaluacin de la eficacia detersiva y dispersante de tensioactivos, de coadyuvantes de la detergencia y de composiciones detergentes para superficies duras. Spanish Patent ES2251269. Jurado, E., Bravo, V., Nez-Olea, J., Bailn, R., Altmajer-Vaz, D., Garca-Romn, M., Fernndez-Arteaga, A., 2006. Enzyme based detergent formulas for fatty soils and hard surfaces in a continuous-flow device. Journal of Surfactants and Detergents 9, 8390. Jurado-Alameda, E., Bravo Rodriguez, V., Nuez Olea, J., Bailon Moreno, R., Galvez Borrego, A., Altmajer Vaz, D., 2009. Design of experiments to evaluate the detergency of surfactants on fatty soils in a continuous-flow device. Journal of Surfactants and Detergents 12, 191199. Jurado Alameda, E., Bravo Rodrguez, V., Altmajer Vaz, D., Siqueira Curto Valle, R.C., 2011. Effectiveness of starch removal in a Bath-Substrate-Flow (BSF) device using surfactants and a-amylase. Food Hydrocolloids 25, 647653. Pascual, A., Llorca, I., Canut, A., 2007. Use of ozone in food industries for reducing the environmental impact of cleaning and disinfection activities. Trends in Food Science and Technology 18, S29S35. Timperley, D. A., and Smeulders, C. N. M., 1988. Cleaning of Dairy HTST Plate Heat Exchangers: Optimization of the Single Stage Procedure. J. Soc. Dairy Tech., vol. 41, pp. 47. von Rybinski, W., 2007. Physical aspects of cleaning processes. In I. Johansson, & P. Somasundaran (Eds.), Handbook for cleaning/decontamination of surfaces, Vol. 1 (pp. 1e55). New York: Elsevier.

260

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

FIGURES

261

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1. Scheme of the BSF device.

Figure 2. Soiled substrate inside the column before and after washing with water.

262

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

80 70 60
Detergency (%)

50 40 30 20 10 0 0 5 10 15 Time (min) 20 25 30 Water pH 3 pH 7 pH 11

263

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 3. Influence of the pH on the cleaning

80 70 60
Detergency (%)

50 40 Water 30 20 10 0 0 5 10 15 Time (min) 20 25 30 0.01 %wt 0.1 wt% 0.5 wt% 1 wt% 2 wt%

Figure 4. Cleaning with NaOH solutions. Error bars are not shown for means of clarity. TABLES Washing solution Initial pH value (Before washing) Final pH value (After washing) Distilled water 6.14 0.02 6.40 0.04 Buffer pH 3 3.04 3.03 0.01 Buffer pH 7 7.17 7.18 0.01 Buffer pH 11 11.27 11.07 0.02 NaOH 0.01 wt% 11.40 8.52 0.05 NaOH 0.1 wt% 12.36 12.03 0.02 NaOH 0.5 wt% 12.82 12.72 0.01 NaOH 1 wt% 12.94 12.86 0.02 NaOH 2 wt% 13.13 13.06 0.02 Table 1. pH values of washing solutions.

264

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

FEASIBILITY STUDY OF RECLAIMED WATER USE AND DEFICIT IRRIGATION IN CITRUS CROPS. Romero-Trigueros C*, Nortes PA, Alarcn JJ, Nicols E Departamento de Riego. Centro de Edafologa y Biologa Aplicada del Segura (CEBASCSIC). Campus Universitario de Espinardo, Murcia. * Corresponding author: c.romero@cebas.csic.es

Abstract The research proposes to deepen the knowledge of the agronomic and physiological response of citrus to regulated deficit irrigation (RDI) with reclaimed water, evaluating the impact on the plant (physiology, production and quality and safety of the crop) and soil (accumulation of salts and nutrient availability). The novelty of these goals is based on the experimental approach used, which will be assessed with the cumulative effects of the RDI and the use of reclaimed water.

The project aims to approach: i) the feasibility of using reclaimed water on citrus, analyzing their influence on growth and yield as well as the quality and safety of harvests, ii) deepening knowledge of the citrus response to regulated deficit irrigation (RDI), with special attention to new aspect in the implementation of these strategies such as the irrigation with poor quality of water and iii) to determine the water use efficiency (WUE) at plant level, the patterns of water extraction in soil and optimal management of fertilizer application to crop.

Keywords: water stress, wastewater, leaf structural traits, y photosynthetic, stomatal conductance.

265

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION The current problem of shortage of water available for agriculture forces us to seek alternative water sources for our irrigation systems. In this sense, treated wastewater is an alternative water resource whose volume has increased in recent years due to concerns about the environment and compliance with the European regulation (91/271/EEC).

Among the advantages of the agricultural use of treated wastewater is the possibility offered by agriculture in reducing environmental pollution, since the direct discharge of treated wastewater to natural channels would require more costly treatment to minimize contributions of macronutrients (nitrogen, phosphorus and potassium) or organic substances that hardly mineralize. However they can be beneficial to crops when used as fertilizer (Asano and Levine, 1991; Levine and Asano, 2004). In this sense, some authors quotes an increase of 59% in organic matter accumulation with the use of treated wastewater for irrigation (Pedrero and Alarcon, 2009).

However, the use of treated wastewater may have risks for agriculture since its often has a concentration of salts, from domestic and industrial activity, higher than that found in natural water resources. The salts are not altered by the purification process and its use for irrigation could affect the physico-chemical properties of soil especially under modern intensive production systems (Ayers and Westcott, 1994; Perez-Sirvent et al., 2003; Angin et al., 2005). Therefore, an inappropriate timing of irrigation with treated wastewater can cause in the medium to long term, the accumulation of salts in the soil under drip irrigation (Darwish et al., 2005), increased soil compaction and reduction in holding capacity (Wang et al., 2003). Besides the effects on soil salinity phytotoxic problems may occur when the electrical conductivity of irrigation water is greater than 1.5 dS / m. This salinity is especially a problem for citrus, as it is a species sensitive to salt (Mass, 1993). High levels of chloride in citrus can cause a reduction in vegetative growth and lower levels of gas exchange (Cmara et al., 2003). Another element to consider is the content of boron (B), because high levels in irrigation water can cause phytotoxic effects on citrus growth and reduce productivity, contributing to the yellowing and defoliation of trees (Chapman, 1968). The treated wastewater may also contain high levels of heavy metals (Yadav et al., 2002).

266

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The work is performed under a CICYT Research Project recently begun by the Irrigation Department of the CEBAS-CSIC (AGL2010-17553), entitled "Effects of treated wastewater irrigation on citrus. Analysis and improvement of water and fertilizer use efficiency under different irrigation strategies." directed by researcher Dr. Emilio Nicols Nicols.

OBJECTIVES

Objective 1. Evaluation of the effects of the use of treated wastewater on the physiology of the plant production and crop quality. Evaluation of the effects of the use of treated wastewater and its combination with RDI strategies on citrus production and on the main physical, chemical parameters of harvests. Therefore, the project will also continuously estimate and measure the water situation of the plant (stem water potential), changes in levels of gas exchange (stomatal conductance and photosynthesis) and study nutrition at different phenological stages (leaf analysis).

Objective 2. Assessment and analysis of the CO2 absorption capacity of citrus in terms of different strategies and quality of irrigation water used. This objective will quantify the role of demand in limiting atmospheric CO2 diffusion, both stomatal and mesophyllic, in different conditions of soil and water quality. This objective will be addressed throughout the experimental process, and results will be of great significance both in improving WUE of citrus and assessing the usefullness of these plants as environmental CO2 sinks. Objective 3. Determination of WUE of citrus, and their patterns of extraction and use of water and fertilizers. This section will use techniques for determining stable isotopes (13C,
18 15

O and

N) with the objective of determining; the WUE at plant level through the

determination of 13C, the water extraction patterns by determining the 18O and the absorptive capacity of fertilizer by the determination of 15N.

The objectives of the project conforms to the National Agricultural Resources and Technologies of the National Plan 2008-2011, which gives priority to: (1) improving production and food processing in the field, (2) acquisition and elaboration of safe, healthy and high quality food products and (3) food production from the perspective of the conservation of our environment and integrated land use.

267

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PROCEDURES, MATERIALS AND METHODS

The experiment is conducted at a commercial citrus orchard, located northeast of the Region of Murcia in Campotjar, 7 km north of Molina de Segura (3807'18N, 11315'W). The experimental plot has an approximate area of 1 ha and is cultivated with 5 year-old orchard grapefruit (Citrus paradisi L. cv. 'Star Ruby) on Citrus macrophylla planted at 6 x 4 m. The soil within the first 90 cm depth have a loamy texture (42 % sand, 26 % clay and 32 % loam) with an average bulk density of 1.37 g cm-3.

The irrigation control head was equipped and supplied with two water sources; the first (T0 and T1 treatments) was pumped from the Tajo-Segura water transfer canal (EC 1 dS m-1), of good agronomic quality, and the second (T2 and T3) from the Sewage Treatment Plant of Molina de Segura North, characterized by generating a highly saline effluent (EC 3-4 dS m-1). The WWTP apply a conventional activated sludge process followed by ultraviolet application for tertiary treatment. Two irrigation treatments was established for each water quality and year; a control irrigation treatment in which the crop will be irrigated according to water requirements (100% ETc), and a regulated deficit irrigation (RDI) treatment, applying in the first year, only 50% of ETc during the second phase of rapid fruit growth. The irrigation scheduling will be weekly and based on the calculations of reference evapotranspiration (ETo) by the Penman-Monteith equation (Allen et al., 1998).

Periodically, the water situation of the plant (stem water potential) and the gas exchange (net photosynthesis, A, and stomatal conductance, gs) parameters is measured in the central trees of each replicate over the different irrigation treatments and water sources used. It also made measurements of the dynamics of vegetative growth, leaf area index (LAI), flowering, fruit setting and fruit growth for all treatments considered. Also, leaf analysis is also made to assess nutritional status of the plant at the different phenological stages. We will also install dendrometers and soil water probes for the precise calculation of the water needs and to establish thresholds for these indicators using RDI with treated wastewater.

At the end of the growing season the final production and distribution of fruit size was evaluated in the central trees of each treatment. It also measured other physical (firmness and color) and chemical (pH, soluble solids, total acidity, vitamin C and polyphenols) parameters of fruit quality (Buenda et al. 2008).

268

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Gas exchange measurements (net photosynthesis, A, and stomatal conductance, gs) were measured with a portable photosynthesis system (LI-6400 Li-Cor, Lincoln, NE, USA) between 8:00 and 10:00 h GMT in day light hours, on selected clear days.

Leaf dry mass and leaf area were also determined for each treatment. Samples were taken in three replicates per treatment in the early morning. The leaves are stored in a plastic bag with some moist paper (so that not dry and deformed) and an identification tag until you check your area. It put in a cool place or refrigerator to prevent water loss. Leaf area measured using an area meter (LI-3100 Leaf Area Meter, Li-Cor).

After measuring the leaf surface, they are stored in paper envelopes, with its identification, oven dried and weighed so as to obtain the dry weight. These envelopes are placed in an oven at about 80C for at least 2 days. After that time, the envelopes are removed from the oven, quickly placed in a desiccator with silica gel (to absorb moisture and not gain weight) is expected to cool down (at least half an hour) and weighed (to obtain and the dry weight). Total Leaf Nitrogen concentration was measured using an automatic-analyser Flash EA 112 Series (England) and Leco Truspec (Sant Joseph, USA).

Finally, all measurements of stable isotopes are conducted in the "Stable Isotope Facility at the University of California (Davis, USA)

(http://stableisotopefacility.ucdavis.edu/). Dried ground leaf samples have been sent for mass spectrometric determination of 13C, 15N and 18O.

269

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

RESULTS TO CURRENT DATE 1. Daily data Leaf structural (dry mass per unit area, 18O, and leaf N) and gas exchange parameters (net CO2 assimilation, A, stomatal conductance, gs, intracellular CO2 concentration, Ci) traits daily are determined in sun-exposed grapefruit leaves from all treatments before cited.

Below are the most significant daily relationships with the average data obtained in the maximum transpiration period, at the end of the RDI treatments:

The results of the regression analyses between area based leaf N concentration, Na, and leaf dry mass per unit area, LMA, are shown in Figure 1, for all combinations of irrigation treatment and water qualities. There are signicant relationships for both FI and DI treatments and in the two water qualities: Na=0.024 LMA+0.17 (r2=0.74***) (P<0.001) indicating a substantial increase in Na with increasing LMA.

[Figure 1 here]
2 Comment [ENN1]: Cambiar en la grfica Wa por LMA. Siempre hablar de LMA, ya que se cambia a veces en el texto por Wa

The ratio between leaf dry mass and leaf area (Leaf Mass per Area, LMA in g m ) can be understood as the leaf-level cost of light interception (Gutschick & Wiegel, 1988). Leaf dry mass consists of symplast mass (a set of all leaf protoplasts) and apoplast mass (a set of all cell walls in a leaf). The ratio between symplast and apoplast masses is positively related to any functional trait of leaf calculated per unit of dry mass. The value of this ratio is defined by cells size and their number per unit of leaf area, number of mesophyll cells layers and their differentiation between palisade and spongy ones, and also by density of cells packing. The LMA value is defined by leaf thickness and density. Negative correlation between leaf thickness and density reduces the level of LMA variability. As a consequence of this correlation the following pattern emerges: the thinner a leaf, the denser it is. The leaf intercellular CO2 partial contentrations, Ci, of plants growing under optimum conditions is generally maintained at about 70% of ambient CO2 partial concentrations, Ca, (Drake et al. 1997). So, Ci can be used as an index of the gas-phase (stomatal) limitation to CO2 assimilation rate, A. If low A were caused primarily by reduced gs, then Ci would be expected to decline with declining A, but this rarely occurs (Farquhar and Sharkey 1982). In

270

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2 it can be concluded that grapefruit trees, Ci increases significantly with decreasing photosynthesis.

[Figure 2 here] Moreover, in both figures show that the control treatment (T0 and T2) have a better relationship with deficit irrigation treatments.

On the other hand, Figure 3 shows the relationship between A and gs. In this case, the trees irrigated with saline reclaimed water had the lower levels of gs. [Figure 3 here]

1. When A is expressed as a function of leaf sodium concentration, data segregate into two distinct populations according to the irrigation water quality (Figura 4).

[Figure 4 here] 2. Oxygen isotope enrichment is defined as the enrichment in


18

O in the leaf water

(equivalently, in leaf biomass) relative to the source water. Models that explain the oxygen isotope enrichment in leaf biomass treat the relationship between the kinetic fractionation that occurs during evapotranspiration and the stomatal conductance in an empirical way. Consequently, the isotopic enrichment is always predicted to decrease with increasing stomatal conductance, regardless of the experimental evidence. In this graph, it appears as T0 and T1, trees irrigated with saline water less, responded slightly theoretical model. However, the response of the trees irrigated with reclaimed water was in a contrary way. Ie, increased stomatal conductance leads to an increase of transpiration and, therefore, results in a higher concentration of oxygen isotope 18.

[Figure 5 here]

271

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2. Seasonal data. Data of leaf structure and photosynthetic traits grapefruit sheets are measured of outer south facing and inner northwest facing seasonally during 2011. The most significant relationships are listed below:

Using data pooled from all times of year, LMA is better correlated with area-based than mass-based photosynthesis in all treatments. It is observed that sun leaves have higher levels of photosynthesis than shaded leaves, about 60% more. This results in that LMA is about 10% higher in sunny leaves. Both, shaded and sunny leaves had a slight tendency to increase the dry mass per unit area with increasing photosynthesis (Reich et al., 1990).

[Figure 6 here]
Comment [ENN2]: Creo que es ms significativa esta relacin en hojas sombreadas

The relationship between gs and A was significant during the experimental period, mainly in the shaded leaves with respect to sunny leaves values (r =0.49). Both A and gs were more than 30% lower in shaded leaves than in sunlit leaves.
2

[Figure 7 here]

272

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

5.0 4.8 4.6 4.4 4.2

Na (gNm-2)

4.0 3.8 3.6 3.4 3.2 3.0 2.8 100 120 140 160 180 200 Control transfer water RDI transfer water Control reclaimed water RDI reclaimed water

LMA (gm-2)

Figura 1. Relationship between N content per unit area (Na) and leaf dry mass per unit area (LMA) in grapefruit leaves at constrasting water quality and the two irrigation regime (FI and DI).

12

12

10

Control TW RDI TW

10

Control TW RDI RW

A (mol CO2m-2s-1)

A (mol CO2m-2s-1)

Transfer water
0 310 320 330 340 350 0 300

Reclaimed water
310 320 330 340 350 360

Ci (ppm)

Ci (ppm)

Figura 2. Relationship between A and Ci in grapefruit tree leaves (A) in transfer water and (B) for poor water quality ,using pooled data from FI and DI regimes. Regression lines in (A) A= -0.184 Ci+64.94 (r2 = 0.72**) (P<0.01) and A = -0.125 Ci +46.53 (r2=0.23) (not significant, ns), for FI (continuous line and black circle) and DI (discontinuous

line and black square), respectively, and in (B) A= -0.15 Ci+54.61 (r2 = 0.74**) (P<0.01) and
A = -0.15 Ci +51.13 (r2 = 0.89***) (P<0.001) for FI (continuous line and white circle) and DI (discontinuous line and white square), respectively.

273

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

12

A=0.17gs+29.57 (r 2=0.71***)
10

A (mol CO2m-2s-1 )

4 Control TW RDI TW Control RW RDI RW 0.10 0.15 0.20 0.25 0.30 0.35

0 0.05

gs (molm-2s-1)

Figura 3. Relationship between A and gs, in grapefruit leaves (P<0.001).

12

12

10

10

A (mol CO2m-2s-1)
Control TW RDI TW Control RW RDI RW
0.0005 0.0010 0.0015 0.0020 0.0025 0.0030

A (mol CO2m-2s-1)

Average Control TW Average RDI TW Average Control RW Average RDI RW


0.0005 0.0010 0.0015 0.0020 0.0025 0.0030

0 0.0000

0 0.0000

[Na] (gNag)

[Na] (gNag)

Figura 4. Relationship between CO2 assimilation rate and leaf sodium concentrations.

274

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

32.0 31.5 31.0 30.5 Control TW RDI TW Control RW RDI RW

O18

30.0 29.5 29.0 28.5 28.0 0.05

0.10

0.15

0.20

0.25

0.30

0.35

gs (molm-2s-1)

Figura 5. Relationship between the oxygen isotope 18 and stomatal conductance grapefruit leaves for each of the treatments. The dashed lines correspond to the trees with deficit irrigation and continuous lines of trees with irrigation control.
Regression lines 18O = -7.69 gs +31.37 (r2 = 0.35) (ns) and 18O = -2.59 gs +30.32 (r2 = 0.05) (ns), for FI and RI regimes, respectively, in trees irrigated with water of good quality (T0 y T1). Regression lines 18O = 15.05 gs +27.86 (r2 = 0.74*) (P<0.05) and 18O = 9.78 gs +29.25 (r2 = 0.28) (ns), for FI and RI regimes, respectively, in trees irrigated with more saline water (T2 y T3).

18 16 14 12

Control TW Sunlit RDI TW Sunlit Control RW Sunlit RDI RW Sunlit Control TW Shaded RDI RW Shaded Control RW Shaded RDI RW Shaded

A (molm s )

-1

10 8 6 4 2 0 100 120 LMA (gm )


-2

-2

140

160

Figura 6. Area-based net photosynthesis in relation to leaf mass per area for all treatments. Regression lines A = 0.085 LMA -0.796 (r2 = 0.31**) (P<0.01) and A = 0.052 LMA -2.13 (r2 = 0.30*) (P<0.05), for sun leaves and shaded leaves, respectively.

275

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

18 16 14 12
A (molm s )
-1

10 8 6 4 2 0 0.00 Control TW Sunlit RDI TW Sunlit Control RW Sunlit RDI RW Sunlit Control TW Shaded RDI RW Shaded Control RW Shaded RDI RW Shaded 0.05 0.10 0.15
-2 -1

-2

0.20

gs (mmol/m s )

Figura 7. Relationship between stomatal conductance, gs, and net CO2 assimilation, A, of sunlit and shaded grapefruit leaves.
Regression lines A = 39.15 gs + 5.76 (r2 = 0.42**) (P<0.001) and A = 55.93 gs +1.09 (r2 = 0.49***) (P<0.001), for sun leaves and shaded leaves, respectively.

Comment [ENN3]: No salen en la leyenda los smbolos

276

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

References

Allen, R.G., Pereira, L.S., Raes, D., Smith, M. 1998. Crop evapotranspiration-guidelines for computing crop water requirements. Irrigation and Drainage 56, FAO, Roma, 300 p.

Asano, T., Levine, A.D. 1991. Wastewater reclamation, recycling and reuse: past, present and future. Second International Symposium on Water Quality, Wastewater reclamation and Reuse, Iraklio, Greece, pp. 5-17.

Angin, I., Yaganoglu, A.V., Turan, M. 2005. Effects of long-term wastewater irrigation on soil properties. Journal of Sustainable Agriculture 26(3): 31-42.

Ayers, R.S., Westcott, D.W. 1994. Water quality for agriculture. FAO irrigation and drainage, Rome. 174 p.

Cmara, J.M., Garca-Snchez, F., Nieves, M., Cerd, A. 2003. Effect of interstock (Salustiano orange) on growth, leaf mineral composition and water relations of one year old citrus under saline conditions. Journal of Horticultural Science & Biotechnology 78: 161-167.

Chapman, H.D. 1968. The mineral nutrition of citrus. En: Reuther, W., Batchebor, L.D., Webber, H.J. (eds.). The Citrus Industry, II, p. 127-274.

Darwish, T., Atallah, T., El Moujabber, M. Khatib, N. 2005. Salinity evolution and crop response to secondary soil salinity in two agro-climatic zones in Lebanon. Agricultural Water Management 78: 152-164.

Drake, B.G., M.A. Gonzalez-Meler and S.P. Long.

1997. More efficient plants: a

consequence of rising atmospheric CO2? Annu. Rev. Plant Physol. Plan Mol. Biol. 48:609639.

Ehleringer, J.R., Osmond, C. B. 1989. Stable isotopes. In: Pearcy, R.W., Ehleringer, J.R., Mooney H.A., Rundel, P.W. (Eds.). Plant physiological ecology: field methods and instrumentation. p. 281-300. Chapman & Hall, New York, USA.

277

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Farquhar, G.D. and T.D. Sharkey. 1982. Stomatal conductance and photosynthesis. Annu. Rev. Plant Mol. Biol. 33:317-345.

Fogg, G.E., Rolston, D.E., Decker, D.L., Louie, D.T., Grismer, M.E. 1998. Spatial Variation in Nitrogen Isotope Values Beneath Nitrate Contamination Sources. Ground Water 36: 418426.
Gutschick, V.P., Wielgel F.W., 1988. Optimizing the Canopy Photosynthetic Rate by Patterns of Investment in Specific Leaf Mass. The American Naturalist 132: 67-86.

Levine, A.D., Asano, T. 2004. Recovering sustainable water from wastewater. Environmental Science and Technology 38(11): 201A-208A.

Mass, E. V. 1993. Salinity and citriculture. Tree Physiology 12: 195-216.

Pedrero, F., Alarcn, J.J. 2009. Effects of treated wastewater irrigation on lemon trees. Desalination 246: 631-639.

Prez-Sirvent, C., Martnez-Snchez, M.J., Vidal, J., Snchez, A. 2003. The role of lowquality irrigation water in the desertification of semi-arid zones in Murcia, SE Spain. Geoderma 113: 109-125.

Reich, P.B., Walters, M.B., Ellsoworth D.S., 1990. Leaf age and season influence the relationships between leaf nitrogen, leaf mass per area and photosynthesis in maple and oak trees. Plant, Cell and Environment 14: 251-259.

Wang Z., Chang, A.C., Wu, L., Crowley, D. 2003. Assessing the soil quality of long-term reclaimed wastewater-irrigated cropland. Geoderma 114: 261-271.

Yadav, R.K., Goyal, B., Sharma, R.K., Dubey, S.K., Minhas, P.S. 2002. Post-irrigation impact of domestic sewage effluent on composition of soils, crops and ground water - a case study. Environment International 28: 481-486.

278

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

FOREST ROAD-NET AS A RULER OF SUSTAINABLE DEVELOPMENT IN A COASTAL MOUNTAINOUS AREA Stergiadou A.1, Theodoridou S. 2, Zachou G. 3 Assistant Professor, Institute of Mechanical Science and Topography, Faculty of Forestry and Natural Environmet, Aristotle University of Thessaloniki, Greece. Email: nanty@for.auth.gr 2 Master Candidate in Biology School of Aristotle University of Thessaloniki, Forester and Environmentalist, Greece. d_m_n_3@hotmail.com 3 Independent Forester and Environmentalist, Aristotle University of Thessaloniki, Greece. georgia_zahou@yahoo.gr
1

ABSTRACT Coastal forest areas have been an important part of environmental sciences. Understanding and effectively addressing the complex challenges; faced by mountain pupil in an era of global change requires carefully designed and implemented research involving scientists from a range of disciplines. To address the mountain specified problems associated with inaccessibility, fragility, and marginality; we can suggest a number of measures such as: improvement of road net; rehabilitation of natural resources and regulation of their usage. Furthermore, we can adopt consumption activities in order to full field the environmental and decentralized needs of the residents in order to develop eco-tourism to a semi mountainous area. The aim of this paper is: a) to record the current situation of Cassandras road net in a semi mountainous area, b) to propose places that can be further develop and; c) to develop an estimating method of parametric system based on environmental impact assessment. The results of our research are base on; how until now this area has been managed and how we are going to reform it by our proposals; upon the usage of road net and the rural development. We used a route; which passes through several forest stands and is preferred compared to the provincial highway which is used as a connecting axis between the cities of Cassandra and Fourka. Another ultimate aim is to propose structures that could improve these sections of forest land to upgrade the area; to increase the percentage of forest road crossing and the multiple-use by hikers and visitors. As a goal is the visit ability of this semi-mountainous area by pupil with low incomes or by more affluent groups. Finishing this task, we believe it contributed even slightly to the sustainable development of the area of Cassandra; while such projects should be provided and assistance is granted by the Prefecture and local governments to expand the horizons of development of non-urbanized areas. Key words: forest road-net, ruler of sustainable development, semi mountainous area, environmental impact, Cassandra- Greece.

279

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1.

INTRODUCTION

Forested areas cover nearly the half of the Greek land (Ministry of agriculture, 2012). The existence of forest and natural habitats in Greece make them important for the environmental sciences. We believe that the necessity to solve transportation problems associated with inaccessibility, fragility, and marginality, so that we can suggest a number of measures such as: improvement of road net; rehabilitation of natural resources and regulation of their usage. The option to adopt consumption activities in order to full field the environmental and decentralized needs of the residents can be real by developing eco-tourism to a coastal mountainous places. Sustainable management and environmental protection from both quantitative and qualitative terms are in use; in order to rescue the natural environment from overdose recreations (Stergiadou, 2007). The concept of sustainable development as determined through an exhibition Brutland is not limited to the sustainable use of natural resources and natural systems, but extends to political and economic factors, and also recognizes the need for global action with the cooperation of all countries (United Nations, 1987). Sustainable development is closely linked to the sustainable management of natural resources of the planet, but also with care to satisfy the developmental and environmental needs of future generations (WCED, 1987). Sustainable development means that it preserves the overall quality of life, sustainable use of natural resources through a process where the flow for materials in various stages of processing consumption and use should facilitate or encourage optimum reuse and recycling (Stergiadou, 2001). Overgrowing combined with unpleasant environmental conditions and lack of adequate in quantity and quality, green outbreaks in urban centres led the pupil to seek leisure near the nature in suburban forests, forming a forestry recreation. By default, forest recreations are all forms of outdoor recreation that takes place in forest areas; where the forest has a preponderant role in recreational activities (Liakos, 1977). Many factors affect the demand for forest recreation as such as the population size, place of residence, living zone, occupation, economic factor, transportation factor, time, etc. Satisfying the demand for recreation requires the availability of an area; and the pupils interest for those places. The factors which are affecting the value of the proposed sites and their suitability for development of forest recreation; can be classified into three categories: a) natural factors, b) biotic factors, and c) cultural factors (Karameris, 2008).

280

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.

RESEARCH AREA

The forest road is located in the prefecture of Chalkidiki, in the Municipality of Cassandra. These road starts from Cassandra village and ends just before the entrance to the village of Fourka (map 1).

Map 1: Orientation Map The reference to the conditions of the accessibility to the road, are considered good enough as it is accessible from both Fourka and Cassandra, while leading rural roads as a low volume street of the central axis. The average gradient along the route of the road ranges between 35% - 50%. The soil is sandy and deep and there are a small number of irrigation wells. The climate of Cassandra in coastal areas is temperate but also in inland areas, its not rough. The vegetation of the area is rich with the dominant forest species: Pinus halepensis, Fagus silvatica and Picea abies. Other species scattered or in small groups and sessions mixed forest species in the ecosystem, are broadleaves, Pistacia lentiscus, Arbutus unedo, Myrtus communis, Arbutus andrachne and Erica arborea. The Quercus ilex and Fraxinus ornus, are found in northern and north-western cluster of reports, which are aside the low volume road net. The forest type which constitutes the area is mainly same aged cluster, semi-planted and trees of different ages. The largest number of trees commonly found in the lower age class. The ecological setting of the area is quite good to moderate. The Mediterranean climate of coastal regions where there are extensive olive groves is characterized by mild winters and cool summers. The microclimate in lowland areas contributes to the absence of frosts or excessively high temperatures. The coldest months are February and March but without creating problems where the

281

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

average minimum temperatures are above 0 C. The average annual rainfall ranges is 500-600cm. The majority of rain falls are during October - April. The winds that blow in the area are mainly from North-Northeast while south winds blow mainly during the summer. That mediterranean coastal climate origin a perfect fauna to the area.

3.

METHODS

We have used equipment which helped us to the termination of our research and includes: topographical map, land use map, describing sheets clusters along the way, literature data related to forest recreation and improvement of forest roads, photographs of the area and constructions. We used the design programs for the accurate mapping and design. We selected the data from our studied area. We walked along the A kategory forest road net so to identify the positions; where we can be built the proposed construction projects of recreation. We selected the locations for recreational development by taken into account some basic principles and specific factors affecting the site. These elements can be applied to each site selection of forest recreation. The principles which have been taken in order to choose recreation areas are: 1)the guest satisfaction, 2)management and access to forest and 3)the ratio of natural resource and visitor (Norman et all, 2006). Then we followed recording and processing the data, of the positions which were selected for further development. In each selected area were measured on the coordinates and the perimeter in order to provide the best accuracy and acquisition distance (map 2).

Map 2: Selected research areas

282

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Projects for improvement were proposed for the selected places, such as recreational structures (playgrounds, pik-nik places, etc) and suggestions for improvement the route along the road (with technical projects such as recreasion signs, etc.). We mad an exact selection of proposed projects in these places along the way of A kategory forest road, after careful review and assessment of the current situation in the region. The region which we examined is characterized by a clear change of the local population in the past few years 1998-2002. The town of Cassandria has 3.500 inhabitants and in the summer with the settlements is a big city of 25.000 inhabitants. The population of the region in 1998 amounted to 7.415 inhabitants, while in 2002 increased to 10.269 inhabitants (El.Stat., 2012). In particular, the forest road Cassandra Fourka, after research we conducted showed that its most frequently used by residents of these areas, despite the main road for the same areas.

Population change of Kassandra 12000 10000 8000 6000 4000 2000 0 1998 year 2002 year

10269 inhabitants 7415 inhabitants

Figure 1: Hellenic statistical authority (El.STAT., 2012)

In the research area we noticed that there are several places that could be used to enhance sustainable development in the region. These are mainly from the right side (heading from Cassandra towards Fourka) of the road where there are uncovered areas surrounded by lush vegetation that makes these areas ideal for further development. We suggest to the selected locations a number of technical projects that will enhance their respective landscapes while attracting more people to visit them for leisure activities. Practical criteria have been held in order to evaluate the absorption of the impact. The grading of these criteria depends on the following principle: We accept a situation as ideal (=100%) for the forest protection from construction. This ideal situation will be described by criteria. The following parameters have been considered: a) the duration of the negative effect, b) the influenced area, c) the sensitivity of the general public to the effect as well as the social impact and political desire. The evaluation of the later parameters will be difficult and therefore the description of an environmental Impact Accessment (E.I.A.) in a profile form will be a necessary addition (Eskioglou et all, 1995, Koutsopoulos et all, 1992, Koroneos et all, 1999, Doucas, 2004, Stergiadou, 2006). The identification and the rating of criteria for assessing environmental impacts of the proposed constructions through impact absorption will allow for comprehensive

283

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

evaluations of every construction according standards set by EU directions (Stergiadou et all, 2004, Stergiadou, 2007). 4. RESULTS

4.1 Recommended constructions and thei technical features: In all the selected locations is proposed to establish wooden garbage bins (B) as well as fire safety signs (F.S). The observance of cleanliness for recreational areas with the collection and disposal of waste is a serious problem (Papageoriou,1995), especially in our country where hasnt developed environmental awareness in the community. This should first be sought in any way the discharge of waste with well-established positions. So, it is necessary to place wooden garbage bins (1-2), because anyone can combine a walk with a rest for an outdoor lunch (picnic). The wooden garbage bins can be used to prevent the pollution created by the scattering of debris in the areas. Moreover, it is necessary tagging of fire hazard warning. Because of the increased risk of fire especially during summer months, forest areas are required to place notices to prevent and suppress such disasters. This increases the responsibility of the visitor towards the environment. Furthermore, beside these, in every region, recommended rehabilitation projects depending on the capabilities and needs of each of these in the context of forest recreation. Then, indicating the current technical projects associated with each area: 4.1.1 First Area This first place is indicated as an area of recreational exercise, since it is located within a short distance from the Cassandra, which everybody can cross by walking. It could be seen as a nearby recreation area due to its proximity to the permanent residence of the locals and the short time required to in order visiting the place. Combined with the above is that the road permeates the area has good flow. The projects proposed for this area are (photo 1): a) Football field 5x5: In the first place soccer 5x5 serving young people since it offers them: sport and exercise, stimulating and fun for both exercisers and audience, increase social behavior, charge degradation in the psychological game, training schools within the physical education lessons. The area where this stadium is proposed is sufficiently large for such technical project while being easily accessible. We recommend small football fields with the plastic surface such as turf that has prevailed for several reasons. The main difficulty is the maintenance of natural grass due to the climate, but it does not offer the same flexibility to absorb vibration of the body as the natural one.

284

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Photo 1: of te 1st area

Map 2: First Area

b) Kiosk: Near the location of the stadium can be made a wooden pavilion that will serve visitors to the area. The wooden pavilion that offers: rest and relaxation, protection from sudden weather conditions (rain, storm, etc.), offers shade from the sun and it can be a place for a snack or picnic. It is proposed for material of the projects to be wood. The wood is environmentally friendly and more suited to the forest landscapes. c) Faucet (F): The area where we propose to construct the soccer field and the kiosk will not constitute a comprehensive recreation site without a faucet. Since in the area there is a natural source, it is easy to provide water to the tap from this source. It is proposed to be stone built in order to blend aesthetically with the surroundings (map2). 4.1.2 Second area The second section is at 2.3 km from Kassandreia near the church of St. Marina, where takes placea festival from 19 to 20 July. The projects which are recommended: a) Configuring the region for the festival with folding fabric awnings b) Compost bins: In compost bins, organic waste (fruits, vegetables, leaves, etc.) are converted into a rich organic mix, which acts as soil conditioner and fertilizer. By composting we can reduce all of our household waste by 35% and reduce the trash going into landfills. This has multiple benefits: a) reduce overall quantities of waste,

285

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

b) significantly prolonged the life of the landfill after receiving less waste, c) protect the planet from global warming, d) and another problem that solves the composting organic waste is desertification of soils. The compost, which is the product of composting, returns to the soil, necessary for the soils fertility, organic and inorganic substances. In addition to compost bins, it would be useful to place recycling bins for other inorganic materials (paper, plastic, glass, cans, etc.). c) Parking with natural shading from trees: The space is sufficient for about 30-40 cars and buses. It would be also useful to place near the street, a wooden sign for parking (photo 2, map 3).

Map 3: Second Area

Photo2: 2nd area, bench and compost bins 4.1.3 Third area The third place is at the end of the route and may be a small recreation area. At this point there already: a tap and water troughs. So there could be placed some structures: a) Pic- Nic table and bench: The wooden dining table benches at this place can a rest area for walkers. In addition the vegetation and the environment in this area constitute a perfect landscape in order to visit, for outdoor dining (picnic), relaxation and entertainment to satisfy the need for recreation. b) Stone-built fountain (F) c)Wooden climbing multi-instrument: As already mentioned the place is located near the area of Fourka. For this reason it is easily accessible to families who can combine their own pleasure and amusement of their children.

286

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

d) Observatory of Wild Fauna: It is proposed the placement of Wild Fauna observatory at 300 meters away from nests of mammals and birds of prey, for environmental education for visitors and local residents. Their form depends on the particular circumstances of the observation position (raised, simply canopies, hoods, etc.) and their capacity should meet the needs visit and observation of a small group of visitors (Papageorgiou, 1996)(photo 3, map 4).

Photo3: 3rd area and proposed constructions 4.2 Along the road are proposed the following:

Map 4: Thrid Area

1. Informative signs, Kalambaka type (type A): It is proposed to place (6) notices of type A at a distance of 20m before the following points: In the 5x5 football field, at the Church of St. Marina, in the third region (interactive site). An information sign will include the elements of the Service and the names of the respective points. 2. Directional signs: Is proposed to place two (2) notices of direction, type A, which are signs of general information.

287

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2: Kalabakas information sign The summary table of proposed projects (Table 1) is: Table 1: Summary of proposed project CONFIGURATION OF SCOPE
Football field 5x5

SELECTED AREA

Garbage bins (B)

Composting bins

Benches for rest/ dining

Wooden climbing multiinstrument

Observatory of Wild Fauna

Informative signs/ Fire signs(F.S)

Faucet (F)

1st 2nd 3rd

4.3 Criteria of absorption The capacity of optical absorption of landscape shows the possibility of landscape to "acquiring" procedures such as human constructions or intense management interventions. This feature depends on topography, the forest species, the change of vegetation, etc. The gradation of absorption criteria based on: the kind of terrain conditions and the distance between the selected sites for the constructions and other interesting locations. The values of Weights are: 1 for minimum weight (not important), 2 for medium weight (important) and 3 for maximum weight (very important). It is also well known that the absorption can be measured by: the type of Forestall plants (pinus, acer, etc), the topography of the location (Table 2).

288

17 - 18 April 2012

Parking

Kiosk

Proceedings of the 4th EMUNI Research Souk

1.Terrain conditions

1.1 Forest 1.2 Mixed 3 forest 1.3 High forest 3 1.4 Selection 3 forest 1.5 Mean 3 height 1.6 Side 3 quality 1.7 3 Productivity 1.8 Slope 2 1.9 Relief 2 2 Distance from 2.1 Tourist 2 places 2.2 Highway 1 2.3 Railway 2.4 Archaeological sites 2.5 Town 1 2.6 Vilages 1 2.7 Path way 1 Sum 31 Average clause (%)

Table 2 Criteria of absorption of the selected sites Criteria of absorption S.A. 1 S.A 2 S.A 3 Weights GRADE SUM GRADE% SUM GRADE% SUM % 3 100 300 100 300 100 300 70 60 50 80 50 25 100 210 180 150 240 150 50 200 70 100 50 90 50 25 100 210 300 150 270 150 50 200 65 70 50 80 50 25 90 195 210 150 240 150 50 180

100 80 90 100 100

200 80 90 100 100 2050 66,2

100 75 90 100 100

200 75 90 100 100 2195 71

100 80 100 100 100

200 80 100 100 100 2055 66,3

4.4 Environmental study on wood construction It is recommended to use timber as a material of construction works, because it is a natural product. Especially in forest - technical constructions is used "composite wood" because it is 40% stronger than the rigid timber has 360 kp/m2 strength and weight nearly 480kg/m3. The ratio weight and strength of wood is better than conventional construction materials (Table, 3):

289

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 3: Ratio of weight and durability of wood


Material Strength (bending) Dencity Ratio of resistance kg/cm kg/m

Glulam Structural steel St37 Full timber C12 concrete

140 1400 85 80

490 7800 550 1800

0.285 0.179 0.155 0.045

Wood is the best environmental option, as it is a natural and recyclable material. Each country which is encouraged to support sustainable development, the only material available that meets the above criterion for the construction projects, is wood. 5. CONCLUSIONS - SUGGESTIONS

We separated our work in the three main pieces: a) Field Work (select one area of forest road, walking on the forest road, identifying potential points for improvement, etc.) b) recording and processing of selected data points c) designing of the proposed projects and d) presentation of final proposals to study the sustainable development of the region. Our proposals referred to improve certain parts of the right side of the road with forest recreation structures based on the principles of sustainable use. The average values for the optical absorption capacity of each selected areas for regeneration, are about the same (66,2%, 71% and 66,3%) and over 50% is necessary to accept the proposed development be compatible with the natural environment in the context of sustainable development. In the second selected area (S.A.2) the percentage is higher (71%) because the site is already formed to some extent; since there is the church of Saint Marina where during the summer there is a festival. So there the terrain slope is more moderate and the accessibility conditions are very good (Diagram 2).

290

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Absorbtion %

72 70 68 66 64 62 Absorbtion % 1st 66,2 2nd 71 3rd 66,3

Diagram 2: Absorbion percentage of our research areas We believe that these projects have low cost and the possibility of use by the general public should be provided and funded for the maintenance of sustainable rural development; employment of local population and the growth of tourism at a pace commensurate with the physical development and not with the speed desired by the short-term economic forecasts. The structures suggested reference to sustainable use of forest sections with the creation of sports facilities, recreational areas and recycling facilities.

291

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Doucas K., 2004. Forest Construction, Giachoudis press, pp.346, Thessaloniki, Greece. Eskioglou P. and Efthymiou P., 1995. Alternative stabilization methods of forest roads for an efficient and gentle mechanization of wood harvesting systems, http://www.fao.org/documents/en/docrep.jsp (6.05.2012). Hellenic statistical authority, 2012. Human population, www.statistics.gr Karameris A.K., 2008. Forest Recreation, Aristotle University Press, pp.140, Greece. Koroneos C., Bouras A., Mousiopoulos N., Balla C. 1999. Life Cycle Analysis: A Comprehensive Approach. Proceedings of Heleco 1999: Environmental Technology for the 21st Century", Vol. II, Third International exhibition and conference (3-6 June 1999, Thessaloniki), TEE, Athens. Koutsopoulos N. and Yang Q., 1992. Modelling requirements for emerging transportation system operating environments. Report DTRS-57-88-C-0078, TTD 29, John A. Volpe National Transportation Systems Center, Cambridge, MA. Liakos L., 1977. The recreation in forests. Aristotle University Press, pp. 365, Thessaloniki, Greece. Ministery of agriculture, 2012, The value of the forest. www.minagric.gr/greek/ agro_pol/dasika/forests/forests1.htm Norman J.G., Nutter K. S., Ryan S., Sallis F.J., Calfas J.K. and Patrick K., 2006. Community Design and Access to Recreational Facilitiew as Correlates of Adolescent Physical Activity and Body Mass Index, Journal of Physical Activity and Health, v.3, sup.1, p.118-128, Hyman Kinetics, Inc., UK. Papageorgiou N.K.,1996. Game Breeding, University studio press, Thessaloniki. Stergiadou A., 2001. Promotion, sustainable development and forest open up of the mountain region (regions: Grevena, Ioannina and Kilkis), Doctoral Thesis in Geotechnical School, A.U.Th., Greece. http://phdtheses. ekt.gr/eadd/handle/10442/22812 . Stergiadou A., Drosos V., and Giannoulas V., 2004. Environmental Impact Accessment from existing forest roads in Metsovo area, Proc. of 4th National Conference: Indegratedn development of Epirus, Metsovo 27-30 September 2004, MEKDE, v.2, p. 534-551, Athens. Stergiadou A., 2006. Environmental Impact Assessment (E.I.A.) for the evaluation of forest roads in mountainous conditions (case study: Valia Kalda), Proc. 1st International Conference Sustainable Management and Development of

292

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Mountainous and Island Areas, Naxos Island Greece, September 29th October 1st, v.II, pp.125-129, e-media, University of Crete, Heraclion, Greece. Stergiadou A., 2007. Sustainable development of Smixi using environmental impact assessment, Sustainable Development and Planning III, v. 2, pp.281-291, WIT press Transaction on Ecology and the Environment, Vol. 102, ISSN:1743-3541 (on-line). Stergiadou A., 2007. Sustainable developoment of coastal forested areas by using an evironmental opening up strategy. CEMEPE Proc. fo SECOTOX Conference on Environmental Management Engineering, Planning and Economics, Skiathos, June 24-28, 2007, v.1, pp. 739-744, Thessaloniki. United Nations. 1987. Report of the World Commission on Environment and Development, General Assembly Resolution 42/187, 11 December 1987. Retrieved:2007-11-14. WCED (World Commission on Environment and Development), 1987. Our Common Future. Oxford, UK: Oxford University Press.

293

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

FREE SOFTWARE AND THE ENVIRONMENT: A FITTING RELATION! Constantine Mousafiris, GreekLUG, Greece kvisitor@gnugr.org ABSTRACT An introduction to the 4 freeedoms that must be met, so that a software may be defined Free software. An overview of the historical roots of the Free Software movement and real examples showing the freedom-restricting nature of proprietary programmes. Presentation of the current projects of GreekLUG, an NGO promoting Free software and Open Standards. A discussion on the main reasons for which the use of Free Software applications is highly indicated for all sorts of environmental management. Great importance was given on the security guarantees that Free Software can offer, when it comes to the energy management sectors that are critical for a nation. A series of concrete examples, where the use of Free Software led to significant cost savings and facilitated the protection of the environment: starting with the first zero-emmissions personal computer, going through a special free software that checks out the degree of energyefficiency of a building and carrying on with the Energy Sector FOSS study. A multitude of applications, either funny projects (i.e. a free software operated cyclette), or simply weird (an egg-hatcing machine controlled by Free Software), to more serious stuff (like Open hardware Arduino-based projects or Neonatal incubators made from recycled materials, with open designs), make up for a convincing case in favour of a nicely fitting relation between Free software and the environment. Keyword: Free Software, Environment, FOSS, Open Standards, Energy management, GreekLUG

294

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

GENEALOGA NAVAL WIKI: GENERATION AND DISSEMINATION OF KNOWLEDGE SHARED OVER THE INTERNET 1 Lorena Martnez Sols 2; Celia Chan Navarro3; Juan Jos Snchez Baena4 Ctedra de Historia Naval, Campus de Excelencia Mare Nostrum, Universidad de Murcia, Espaa loremart@um.es; chain@um.es; baena@um.es

ABSTRACT This paper presents Genealoga Naval Wiki (GNWiki), a tool that has been created to share information and to generate knowledge collaboratively among users interested in Naval Genealogy. The application was built on Google Sites and received nearly 1,000 visits in its first six months of running. These visits supposed consultations of more than ten thousand pages as well as coming from links from other prestigious websites within the sphere of Genealogy and Naval History. Key words Genealogy, Naval History, Management of Information, Genealoga Naval Wiki, GNWiki, Shared Knowledge, Science 2.0.

1. INTRODUCTION Like other authors (Torres Salinas and Delgado Lpez-Czar 2009, 534-39), we believe that the social web is a novel and potential means of disseminating scientific findings. We have, therefore chosen one of the tools available - wikis with the idea of sharing some of the findings of one of the lines of research undertaken by the Ctedra de Historia Naval research group. At the same time, we believe that the tool can become a powerful means for acquiring important, enriching information through contributions by users. Moreover, as the report Ciencia 2.0.: aplicacin de la web social a la investigacin (REBIUN 2010, 3-4) clearly indicates, a feature of the social web is that all its services are participative. Users of 2.0 technologies can interact easily and openly with each other; they can share resources and communicate quickly and simultaneously. Research benefits from participative technologies as groups can share reflections, methodologies, resources and findings. Social web applications for research can be placed in three main blocks: sharing research, resources and findings.

This paper is one of the results of research projects Argos II, 11936/PHCS/09, supported by the Fundacin Sneca. 2 Grantholder FPI (Formacin de Personal Investigador) of the Fundacin Sneca-Agencia de Ciencia y Tecnologa de la Regin de Murcia. 3 Professor in Librarianship and Information Science. 4 Lecturer in History and Director of the Ctedra de Historia Naval.

295

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The main aim of this study was to create a wiki as an ideal means of sharing information among users interested in the subject matter and, at the same time, to receive information from them that, after review by the collaborators of the work group, might be of value in completing or extending the research being undertaken in naval genealogy. In other words, we have two way system in which research results can be made available quickly to interested parties, who in turn can consult these and make their own contributions to enhancing the product offered. 2. DEVELOPMENT OF THE TOOL Given the above, Genealoga Naval Wiki (Naval Genealogy Wiki) was developed as a tool designed to share information and to generate knowledge collaboratively with users interested in naval genealogy. The tool is located at <https://sites.google.com/site/genealogianavalwiki/>. Figure 1: Home page of Genealoga Naval Wiki (GNWiki).

Source: own. Following Klobas (2006, 153-63), the web hosted wiki model was chosen to generate the application, since it is the most simple and is generally free. The next step was to locate the tools classified within the model and, after consulting several directories, Google Sites was chosen. The official website describes it as: Application that enables information to be gathered at a single site (videos, calendars, presentations, attached files and text) and to share it with just a few people, your whole organization or with any Web user (Google Sites 2011). The tool management process was then performed. This involved four steps: planning, creation, maintenance and assessment.

296

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2: Life cycle of the management of a wiki.

Source: own. In the planning stage the purpose of the application was defined, and the resources, timing and technologies available were established. The actions to be performed during the procedure were also listed. In the creation stage the wiki was implanted in Google Sites and was given the name Genealoga Naval Wiki (GNWiki). The visual design was made and the content to be shared was stored. It was tested for correct functioning within the website and its existence was made known in order to attract would-be users. As a final stage in the management process of the wiki, a quantitative and qualitative assessment of the website was made. For the former the tool used was Google Analytics, a web application that offers information about website traffic and the efficiency of the marketing plan (Google Analytics 2011). Analysis covered the sixmonth period January 25, 2011, when the website began to be publicized, through to June 25. Two actions were made for the qualitative assessment. A type of log was made for the repercussions the application had from its set-up and a survey was prepared and sent to all the users, who had previously been invited to take part in the same during the dissemination campaign. The idea was to ascertain their opinions and satisfaction regarding GNWiki. The questionnaire was also displayed on the homepage of the website for unidentified users who might be interested in responding. 3. STRUCTURE OF GENEALOGA NAVAL WIKI The original structure of Genealoga Naval Wiki is shown below (Figure 3). Figure 3: Original structure of GNWiki. Homepage. Project definition. Who we are; what we want to do; what are our aims; how can we achieve them; limitations and opportunities of the project. o Historical context (the framework of the project) 5. o Midshipmen (main aim of the study) 6.
The historical context of the content is the eighteenth and nineteenth centuries, the period which spans the creation, activity and disappearance of the Military Naval Academies in Spain.
5

297

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

o Wiki (definition of this type of 2.0 tool). How to participate. This includes: how to apply for membership of the website; how to collaborate; how to create new websites with genealogies of individuals; how to improve existing websites; reminder of the subject matter treated under the application. o How to create a new page for a person. All the necessary information is given for a user to be able to create a new page within the website. Example of a page for an individual. This page offers users a model. o How to improve an existing page. Explanations on how to modify, enlarge, etc. an existing page on the website. Directory of members. A list of the users participating in the website (including names and emails). Genealogies of people. A page which provides the genealogies of the midshipmen and their families. A sample extract is provided below: o A. Arnola. - de Ambulodi y Arnola, Jos. o B. o C. Calvo. - Calvo de Castro, Micaela. - de Ambulodi y Calvo, Miguel. Crdenas. - Crdenas y Guzmn, Jernima. - Quijano y Crdenas, Diego. - (). Carrillo. - Martnez [de Espinosa] Carrillo, Juan Jos. o D. de Ambulodi. - de Ambulodi y Arnola, Jos - de Ambulodi y Calvo, Miguel. - (). Links of interest. Directory of links and web resources related to genealogy, naval history and social and family history which may be of interest to the user.

Source: own. 4. RESULTS OBTAINED WITH THE TOOL The quantitative and qualitative results obtained from assessment with the tool showed that during the first six months of the project most users were surfers who made a single visit to GNWiki, made a series of consultations and then left (Figure 4).

Midshipmen were usually young men between 16 and 18 years old from aristocratic or upper class families who would study at the Military Naval Academies before taking commissions as officers with the Spanish Royal Navy.

298

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 4: Types of visits.

VISITS
34% 66%

Source: own. While contributions have not been huge (nearly one thousand visits and ten thousand pages consulted), there are many surfers who consult the information displayed on the website many of them international - (see Figures 5 and 6), and links have been used from websites of prestige within the sphere of Genealogy and Naval History. Some users have also recommended that their acquaintances visit the website. Figure 5: Visits from different countries (table). Country Spain United States 3 Argentina 4 France 5 Mexico 6 United Kingdom 7 Chile 8 Puerto Rico 9 Uruguay 10 Italy 1 2 Source: own. Visits 695 59 51 34 19 11 10 10 9 8 Pages/Visit 12.44 8.19 4.92 10.32 3.95 4.45 7 12.70 4.56 4.25 Average time at site 00:07:57 00:03:13 00:01:24 00:02:05 00:02:51 00:03:58 00:01:24 00:04:09 00:02:07 00:05:13 Porcentage of new visits 62.73% 74.58% 80.39% 76.47% 57.89% 18.18% 100% 80% 88.89% 25% Bounce rate 26.19% 33.90% 33.33% 44.12% 52.63% 18.18% 30% 40% 44.44% 25%

299

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 6: Visits from different countries (graph).

Source: own. Websites that direct traffic to GNWiki include the forum of Todoavante 7, the website of Todoababor 8, the genealogy blog Genealoga Blog 9, the website of Genealoga Hispana 10, and the Online Campus of the course Introduccin a las Fuentes Documentales para el estudio genealgico y de la Historia de la Familia, under sectio Bibliografa, and its sub-section Enlaces web de inters, where there is a link to Genealoga Naval Wiki (Figure 7).

7 8

Available at <http://www.todoavante.es/index.php/Portada>. Available at <http://www.todoababor.es/enlaces/index.htm>. 9 Available at <http://genealogiablog.blogspot.com/2011/01/genealogia-naval-wiki.html>. 10 Available at <http://www.genealogiahispana.com/espana/Genealog-a-Naval-Wiki-GNWikil1045.html>.

300

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 7: External link from a specialist course in Genealogy.

Source: own. It can be seen that the two periods of most visits coincide with the contacts made with users: the publicizing of the website in January and the surveys in June 2011 (Figure 8). Figure 8: Total visits over the whole period analyzed.

Source: own. 5. FINAL ROUND-UP In general, the social web allows research results, sources and findings to be shared (REBIUN 2010, 3-4). Specifically, wikis, tools embedded in web 2.0., are virtual spaces for asynchronous cooperative work that allow efficient dynamic preparation of contents, which means that knowledge can be generated, enhanced and shared with users all over the world. In the particular case of our study, based on naval genealogy, the application Genealoga Naval Wiki, a social web tool, has given users access to part of the findings of our research while also offering them the chance to cease to be mere passive readers and to become active editors and providers of information.

301

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

6. REFERENCES CATTAFI, R., and ZAMBRANO, N. 2008. Comunicacin colaborativa: aspectos relevantes en la interaccin humano-humano mediada por la tecnologa digital. Enl@ce: revista venezolana de informacin, tecnologa y conocimiento 5 (1). http://www.scielo.org.ve/scielo.php?pid=S169075152008000100004&script=sci_arttext (3.8.2011). CHAIN NAVARRO, C., MARTINEZ SOLIS, L. and SNCHEZ BAENA, J. 2008. Motivar desde la innovacin en la enseanza universitaria: el blog calidad. RED. Revista de Educacin a Distancia 21. http://www.um.es/ead/red/21/chain.pdf (28.2.2012). CONCEPCIN BEZ, C. M. 2008. Wiki, intranet y repositorios documentales. Acimed: revista cubana de los profesionales de la informacin y la comunicacin en salud 18 (6). http://bvs.sld.cu/revistas/aci/vol18_6_08/aci141208.pdf (20.6.2010). eWeek. 2011. 25 Tips for a Better Wiki Deployment http://www.eweek.com/c/a/Messaging-and-Collaboration/25-Tips-for-a-BetterWiki-Deployment/ (25.8.2011). FICHTER, D. 2005. Intranets, wikis, blikis, and collaborative working. Online Magazine 29 (5). http://www.allbusiness.com/technology/computer-networksintranets/10574433-1.html (3.8.2011). FICHTER, D. 2008. Wiki while you work. Medford. http://findarticles.com/p/articles/mi_hb3328/is_200805/ai_n32273530/?tag=content ;col1 (25.8.2011). FISH, S. 2004. Which open source wiki Works for you? Onlamp.com. Lamp: the open source web platform http://onlamp.com/pub/a/onlamp/2004/11/04/which_wiki.html (5.9.2011). GONZLEZ GUERRERO, K., PADILLA BELTRN, J. E. and ARIAS ARIAS, N. C. 2011. Anlisis de los estilos de aprendizaje en la implementacin de actividades a travs de una wiki. Revista Virtual Universidad Catlica del Norte 32. http://dialnet.unirioja.es/servlet/articulo?codigo=3417650 (27.02.2012). KLOBAS, J. 2006. Wikis: Tools for Information Work and Collaboration. Oxford: Chandos Publishing, 2006, 153-163. MARTNEZ SOLS, L. 2009. Family Tree Builder como posible herramienta para la construccin de un rbol genealgico. Ejemplo prctico de la familia Tacn y Herves. Naveg@mrica. Revista electrnica de la Asociacin Espaola de Americanistas n. 2. http://revistas.um.es/navegamerica/article/view/55681 (28.02.2012). MARTNEZ SOLS, L. and SNCHEZ BAENA, J. J. 2010. Programas informticos genealgicos en espaol. Anlisis, comparacin y evaluacin. Biblios: Revista

302

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

de bibliotecologa, archivologa y museologa electrnica http://www.scielo.org.pe/pdf/biblios/n37/a02n37.pdf (28.02.2012).

37.

MARTNEZ SOLS, L., CHAN NAVARRO, C. and SNCHEZ BAENA, J. J. 2011. Continuar aprendiendo sin coincidir ni en el espacio ni en el tiempo: propuesta para la asignatura Archivstica, Documentacin y Tecnologa del Posgrado en Historia Naval. En: Congreso Internacional de Innovacin Docente. Universidad Politcnica de Cartagena, del 6 al 8 de julio de 2011. MORAL VILLALTA, M. 2007. Una herramienta emergente de la Web 2.0: la wiki. Reflexin sobre sus usos educativos. Unin: revista iberoamericana de educacin matemtica 9: 73-82. http://www.mendeley.com/research/una-herramientaemergente-la-web-20-la-wiki-reflexin-sobre-sus-usos-educativos/#page-1 (19.6.2010). PENNESI, M. 2011. Devolvamos el protagonismo al alumnado! En: HERNNDEZ ORTEGA, J., PENNESI, M., SOBRINO LPEZ, D. and VZQUEZ GUTIRREZ, A. (coord.). Experiencias educativas en las aulas del siglo XXI: innovacin con TIC. 145-148. http://dialnet.unirioja.es/servlet/articulo?codigo=3772873 (27.02.2012). REBIUN. 2010. Ciencia 2.0.: aplicacin de la web social a la investigacin. http://eprints.rclis.org/bitstream/10760/3867/1/Ciencia20_rebiun.pdf (26.8.2010). REINOSO PEINADO, A. J. 2009. Anlisis de la incorporacin de una plataforma wiki a la docencia de la asignatura nuevas tecnologas de la informacin. RED U: Revista de Docencia Universitaria 5 (Ejemplar dedicado a: Wiki y educacin superior en Espaa (II parte)). http://revistas.um.es/red/article/view/92931 (22.6.2010). RICHMOND, S. A., SPENCE, P. R. and FULLER, B. D. 2011. Using the Wiki in the college classroom. Academic Exchange Quarterly. 15 (2): 103. RODRGUEZ, J. A. 2007. La gallina de los huevos de oro de nuevo est en peligro. Signo y pensamiento 26 (50): 126-147. http://redalyc.uaemex.mx/redalyc/src/inicio/ArtPdfRed.jsp?iCve=86005009&iCve Num=9198 (3.8.2011). SNCHEZ BAENA, J. J. and CHAN NAVARRO, C. 2009. El Patrimonio Histrico Documental de la Armada y su difusin en la sociedad del conocimiento. Patrimonio cultural y derecho 13: 247-264. TORRE, A. 2006. Web Educativa 2.0. Edutec: Revista electronica de tecnologa educativa 20. http://edutec.rediris.es/Revelec2/revelec20/anibal20.pdf (3.8.2011). TORRES SALINAS, D. and DELGADO LPEZ-CZAR, E. 2009. Estrategia para mejorar la difusin de los resultados de investigacin con la Web 2.0. El profesional de la informacin 18 (5): 534-539. http://ec3.ugr.es/publicaciones/f30653777t353626.pdf (30.4.2010).

303

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

LLE MUST, A. M. 2000. Nuevas Tecnologas en la enseanza y en la difusin de la Historia: Informtica e Historia en la Universidad de Estonia. En: ARANDA PREZ, F. J., SANZ CAMAES, P. and FERNNDEZ IZQUIERDO, F. (coords.). La historia en una nueva frontera = History in a new frontier. Cuenca: Servicio de Publicaciones de la Universidad de Castilla-La Mancha.

304

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

HOTEL REVIEWS DATABASES. THE CASE OF SPANISH COASTAL HOTELS


Juan Pedro Mellinas, Universidad Politcnica de Cartagena, Spain losmellinas@yahoo.es Soledad-Mara Martnez Mara-Dolores, Universidad Politcnica de Cartagena, Spain soledad.martinez@upct.es Juan Jess Bernal Garca, Universidad Politcnica de Cartagena, Spain juanjesus.bernal@upct.es

ABSTRACT The Web 2.0 allows users to provide content, make comments, share ideas, images and videos with the whole web. In this context, millions of travellers give their opinion about hotels, in different websites, quantifying their level of satisfaction with the service received, and providing information on their profile as a consumer. This phenomenon has led to huge databases with millions of reviews, scores and comments always available, always updated and for free. In academic literature, the use of this methodology is taking on increasing importance, displacing traditional surveys or acting in a complementary manner. Several concepts have been defined in the last years to describe this new reality: Virtual Ethnography, Netnography, Wisdom of Crowds or Collective Intelligence. We consider Booking.com and Tripadvisor.com the main sources of reviews about hotels and try to quantify its relevance and statistical reliability. For this research, we focus on the hotels in the Spanish coast, the first touristic destiny in the Mediterranean Sea. Keyword: reviews, hotels, databases, web 2.0, mediterranean.

305

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION The phenomenon Web 2.0 was defined in 2005 by Tim O'Reilly, but has achieved a truly significant scale from 2009, with the popularity of social networks and websites specialized in reviews about products and services. The concept of Web 2.0 tries to describe the phenomenon by which users become partakers of the web and not mere passive viewers of information. The user provides content, make comments, share ideas, images and videos with the whole web or just restricted communities. All these applications are necessarily very simple, to make it very accessible to hundreds of millions of people. The success of this new dimension of the Internet has led to huge databases with millions of reviews, scores and comments on various topics, products and services. Academic literature has seen in the web 2.0 a usable source of information for certain disciplines and researches. Conventional surveys usually have an economic cost and important limitations on number of surveys. The existence of hundreds, thousands or millions of Internet users generated opinions on certain matters, provides researchers valuable information of self-interview individuals. It hardly could be achieved by traditional methods and without any economic cost. Ethnography researchers have paid special attention to the Internet as valid data source for academic research (Hine, 2000; Kozinets, 2002, 2006). Hine (2000) uses the term virtual ethnography to refer to this methodology, while Kozinets (2002) defines the term netnography to refer to a similar concept. Drawing conclusions about a subject, after seeking the views of thousands of individuals, is a method studied by several authors. James Surowiecki (2004) published The wisdom of crowds: Why the many are smarter than the few and how collective wisdom shapes business, economies, societies and nations. It describes how the aggregation of information in groups, resulting in decisions that are better than could have been made by any single member of the group. For his part, Toby Segaram (2007) developed the concept of Collective Intelligence based on the idea of capturing relevant information from large databases of opinions on the Internet, through sophisticated mathematical algorithms. In this way the study can cover much larger geographic areas (all countries with a minimum level of Internet connections) and data can be collected anywhere and at any time (Mann and Stewart, 2000). The case of hotels reviews is one of the clearest examples that illustrate this new reality. Millions of travelers give their opinion, quantifying their level of satisfaction with the service received, and providing information on their profile as a consumer. Websites provide the data in a quite structured way, so can be used for researches about hotel industry (Martnez, Bernal and Mellinas, 2012). We focus in the two main reviews databases about hotels in Europe: Booking.com (Booking) and Tripadvisor.com (Tripadvisor). Our research try to find out how useful can be these databases for the measure of customers satisfaction in Spanish coastal hotels, specially form the statistic point of view. 2 MEDITERRANEAN COASTAL TOURISM Mediterranean Sea is the main touristic destiny in the world and it is not only because of the cultural richness, left by the most important civilizations in history. The main factor that attracts tourists to the Mediterranean is its nice weather and beautiful beaches. But we cannot

306

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

assure that Mediterranean beaches are the best in the world, probably Caribbean or Polynesian beaches are better indeed. Weather use to be nice from April to October, but the rest of the year is difficult to see temperatures over 20C. Mediterranean Sea is near several rich and cold countries whose citizens can easily travel to Mediterranean beaches. In less than three hours, a tourist from Central or Northern Europe, can move to some of the different destinies that Mediterranean countries offers. It is also relatively cheap for tourists, because of differences of economic development and prices between North Europe countries and Mediterranean countries. The best example of this reality is Spain, the second country in the world in terms of tourism revenues and disputing the second position, in terms of number of tourists, with USA and China. This success is mainly attributable to so called sun and beach tourism, which since the 60's had a great development in this country. Tourism industry accounts for 11% of the Spanish economy, being the main export sector (INE, 2011). 3 BOOKING.COM AND TRIPADVISOR.COM DATABASES Booking is an online travel agency specialized in online hotel reservations, being the European leader in this sector. Booking receives more than 30 million unique visitors per month, more than 300.000 nights are booked every 24 hours and 201.515 hotels sell through its website. Booking has more than 12 million verified reviews in the last 14 months, from travelers that have booked with Booking and have visited the hotel (Booking, 2012). According to data published by the Consulting Susquehanna Financial Group (Fox, 2000), on a research of 200 hotels in October 2011, the 61.50% of the sales of European hotels are done through internet. But the most significant aspect of this research refers that 50% of internet sales was made using Booking, 20% using the hotel website and the remaining 30% was distributed among the rest of online travel agencies. TripAdvisor is the world's largest travel site with more than 50 million visitors each month, 20 million registered members and over 60 million reviews and opinions (Tripadvisor, 2012). Although Tripadvisor is headquartered in the USA, 40% of users of this website are from Europe. United Kingdom has 5.3 million users, 2.6 million France and 2.2 million Spain. Segmentation possibilities offered by this websites, allows the analysis of specific geographical areas, types of hotels and customers groups. All hotels obtain a global score and also a different score for several parameters: Clean, Comfort, Location, etc. The amount of reviews registered in Booking and Tripadvisor seems to be useful for the measure of customers satisfaction in hotels, following the principles of cited authors (Hine, 2000; Kozinets, 2002, 2006). But we wonder if these databases include a representative sample of hotels of any zone. We also have to find out if the amount of reviews per hotel is large enough for obtain reliable statistical results. 4 MEASURING THE POWER MEDITERRANEAN SPANISH HOTELS OF TRAVELLER REVIEWS IN

Our research is focused on the hotels of three, four and five stars considered as part of the sun and beach tourism, located on the Mediterranean coast and Spanish islands (Canary islands are included). We try to know if the databases provided by Booking and Tripadvisor are valid for future studies about this type of hotels in this geographical area.

307

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The segmentation of hotels, as to their type, can be often difficult and can respond to subjective criteria. For this reason, we rely on the Booking classification system, that within its "Hotel theme" has a category called "Beach / Seaside". We also select "Hotel" for the Hotel type category, avoiding hostels, apartments, Guest accommodations and Bed&Breakfast. We collect all the information disposable at Booking for the defined type of hotels. The sample includes 1,384 hotels with at least 10 reviews. We make an additional search in Tripadvisor looking for all that hotels obtained from Booking. We find all of them except 11, that does not appear in Tripadvisor. Results are show in Table 1 and Table 2. [Table 1 here] [Table 2 here] In both cases, samples of hotels obtained have an important number of reviews per hotel. The average is over 100 and 71% of hotels selected in Booking has 50 or more reviews. For Tripadvisor, this percentage goes to 63%. Spain has a total of 16,563 tourist accommodations (INE, 2011), with a total capacity of 1,707,037 places of accommodation. Booking database contains 13,934 hotels in Spain (Booking, March 2012) that means 84% of all Spanish hotels. For this study we have selected 3, 4 and 5 stars hotels, which account a 32% of total establishments, but contain 76% of the accommodation places in the country. The 14 selected provinces have a total of 6,840 tourist accommodations, 41% of the national total. But in terms of accommodation places, represent 70% of the country's hotel capacity. According to data obtained from Booking, the percentage of establishments considered as "Beach / Seaside" in these provinces is 50%. 5 CONCLUSION Results show that the samples obtained from Booking and Tripadvisor are completely suitable for studies on the hotel sector. Booking contains 84% of Spanish hotels and most of them have an important number of reviews. The data from Tripadvisor seems to be very similar. The huge volume of reviews about hotels that are continuously generated by users, make this system especially suitable for different studies: competition, consumer satisfaction, market, etc. It is easy to get very relevant information, always available, always updated and for free. It is an important tool for public institutions, which can easily make studies about the hotel industry, so more extensive researchers can be made by scholars. This methodology also opens up possibilities for private entities that seek to evaluate the performance of their hotels and competitors. Once we have confirmed the validity of this methodology, the next step is to develop researches measuring tourist satisfaction about Spanish coastal hotels. The information provided will allow us to achieve conclusions, avoiding the economic cost of traditional surveys.

308

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Booking. 2012. Overview. Http://www.booking.com/general.engb.html?sid=8224f6ad9773cc0a7f52b046351fa9c0;dcid=1;tmpl=docs/about (28. 2 . 2012) Fox, L. 2011. Booking.com driving 50% of European online hotel reservations. TNOOZ. http://www.tnooz.com/2011/10/14/news/booking-com-driving-50-of-european-onlinehotel-reservations/ (27. 2 . 2012) Hine, C. 2000. Virtual ethnography. London: Sage Publications Ltd. INE. 2011. Encuesta de ocupacin hotelera. Instituto Nacional de Estadstica (National Institute of Statistics. Spain). http://www.ine.es/inebmenu/mnu_hosteleria.htm (27. 1 . 2012). Kozinets, R. V. 2002. The field behind the screen: using netnography for marketing research in online communities. Journal of marketing research, 39(1): 61-72. Kozinets, R. V. 2006. Click to connect: netnography and tribal advertising. Journal of Advertising Research, 46(3): 279-288. Martnez, S.M, Bernal, J.J., Mellinas J.P. 2012. Los hoteles de la Regin de Murcia ante las Redes Sociales y la Reputacin online. Revista de Anlisis Turstico. [Accepted]. Mann, C., & Stewart, F. 2000. Internet communication and qualitative research: A handbook for researching online. London: Sage Publications Ltd. OReilly, T. 2005. What is Web 2.0: Design patterns and business models for the next generation of software. http://oreilly.com/web2/archive/what-is-web-20.html (27. 1 . 2012) Segaran, T. 2007. Programming collective intelligence: building smart web 2.0 applications. O'Reilly Media. Surowiecki, J. 2004. The wisdom of crowds: why the many are smarter than the few and how collective wisdom shapes business, economies, societies, and nations. London: Little, Brown. Tripadvisor. 2012. About Tripadvisor. http://www.tripadvisor.com/pages/about_us.html (28 . 2 . 2012)

309

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 1: Total number of hotels and reviews


DATABASE BOOKING TRIPADVISOR Number of hotels 1,384 1,373 Number of reviews 185,408 199,693 Average reviews per hotel 134 145

Source: Data from Booking.com and Tripadvisor.com Table 2: Number of hotels per review range Number of Reviews 0 0-9 10-49 50-99 100-299 +300 Hotels on Booking 0 0 402 354 484 144 % Bk
0% 0% 29% 26% 35% 10%

Hotels on Tripadvisor 11 91 415 248 435 184

% TA
1% 7% 30% 18% 31% 13%

Source: Data from Booking.com and Tripadvisor.com

310

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

HYDRODYNAMIC MODELLING FOR COASTAL MONITORING.THE MAR MENOR CASE STUDY


F. Lopez-Castejon, Technical University of Cartagena, Spain, francisco.lopez@upct.es J. Gilabert, Technical University of Cartagena, Spain, javier.gilabert@upct.es

ABSTRACT
The Mar Menor is one of the largest (135 km2) Mediterranean coastal lagoons located on the southeastern coast of Spain. It is very important due to his high ecological values and touristical activities. The objective of this project is to understand the lagoon hydrodynamic and the water exchange between the Mar Menor and the Mediterranean Sea. To achieve this goal during two years the Mar Menor has been monitoring with a high spatial and time resolution. All the data collected has been used to understand the hydrodynamics processes in the lagoon and developed a high resolution 3D model of it. Keyword: Mar Menor, ROMS, sea level, coastal lagoon, coastal monitoring

311

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION The Mar Menor is one of the largest (135 km2) Mediterranean coastal lagoons located on the southeastern coast of Spain (Figure 1) with a mean salinity of 45 PSU and a very variable sea temperature, changing from 8 C to 30 C. It has a mean depth of about 4 m with a maximum of 6 m separated from the Mediterranean Sea by a sand bar of 100 to 1500 m wide. This sand bar is called La Manga. The Mar Menor is very important for touristical activities and it is included in the Ramsar conventions list for the conservation and sustainable utilization of wetlands. The comunication with Mediterranean sea is by 3 narrow channels, Las Encanizadas, El Estacio and Marchamalo, each with different characteristics. Las Encanizadas is the northern channel and has the bigger area of the three, with length of 2 km and wide 1 km. Its a weting/drying area, rule by the wind and atmospheric pressure. His maximum depth its 1.5 m, and the medium 0.5 m. El Estacio is the only navigation channel, with a 50 m width and homogeneus depth of 5 m. Marchamalo is the southern and smaller one, with 20m width and 1 m depth. This channel has very high sediment dynamic and must be dredge each 3 years to allow the water flux. [Figure 1 here]

OBJECTIVE The monitoring system started three years ago and finished on January 2012. It had the objective to monitor the main hydrodynamic, oceanographic and meteorological parameters of the Mar Menor, providing temporary reliable data series in order to select and test a very high resolution numerical model capable to predict the 3D current flows and sea elevation within the entire Mar Menor region in response to both meteorological factors and the adjacent and the Mediterranean Sea circulation. These capabilities could be used for predicting the spread of organisms throughout the Mar Menor, as well as to know the reaction of this lagoon to the climate change, specially the likely variations of the sea level, the derived fluctuations in temperature, or the variation of other environmental parameters related also to human works. To be more specific, this project had the following objectives: To identify the main parameters for the hydrodynamic characterization of the Mar Menor. To select the adequate numerical model for the Mar Menor characterization. To obtain the enough temporal data series to validate the numerical models. To do that, it was necessary to deploy a wide range of different instruments throughout the Mar Menor lagoon and surroundings. These instruments was anchored on the sea bed and recorded sample data to an internal memory, for long periods of time (months

312

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

to years). In order to gather the recorded data, it was necessary to recover from the sea floor the deployed instruments using professional divers.

DATA ACQUIRED Meteorological We collected during two years all the meteorological data provided by the nearest Spanish Meteorological Agency station, located on the North west coast of the Mar Menor, near San Javier town. The data collected was wind, air temperature, global radiation, atmospheric pressure and humidity. Sea level The flux between Mediterranean sea and Mar Menor is mainly force by the sea level difference between them, in order to study this flux and the internal lagoon sea level variation, 5 sensor were deployed inside the lagoon and 2 in the Mediterranean Sea, all about 4 m depth, with a measurement interval of 10 sec. In the Figure 1 we can see the position of the sea level recorded deployed.

[Figure 2 here]

Currents A current meter was deployed in each channel to study the balance exchange between Mediterranean Sea and Mar Menor. As well, three current meter were deployed in the lagoon, two near the west coast, where high current are expected to be and one between the islands trying to register the influence of the island on the lagoon current system. We can see on the Figure 2 their position as red triangle. All the adcp register current, temperature , pressure and waves, although the wave measurement have a high cost in battery and memory we considered important to study the wave parameters inside the lagoon.

[Figure 3 here]

313

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MODEL (ROMS) The model used to simulate the hydrodinamics processes of the Mar Menor was ROMS. Following the are the mainly characteristic of this model: Free-surface. Terrain-following. Primitive equations ocean model. Widely used by the scientific community for a diverse range of applications. ; (Budgell, 2005; Warner et al., 2005a, b; Wilkin et al., 2005) Includes accurate and efficient physical and numerical algorithms, several vertical mixing schemes, multiple levels of nesting and composed grids Includes several coupled models for biogeochemical, bio-optical, sediment, and sea ice applications For this project we have use a branch of ROMS called ROMS-AGRIF developed by a collaborative work between IRD (Institut de Recherche pour le Developpement), INRIA (Institut National de Recherche en Informatique et en Automatique), and UCLA (Department of Atmospheric and Oceanic Sciences). This branch allow us to run two way nesting simulation, necessary to simulate La Manga channels properly. We worked with 6 nesting meshs with different resolution, from 150 m to the parent grid to 5 m to the smaller child, corresponding to the area of Marchamalo channel. In the Figure 3 we can see a plot of the grids used and the area modelized. The model was forced in the boundaries by the sea level registered at the sensor deployed on the Mediterranean sea ath the north of La Manga, near San Pedro del Pinatar, wen can see it as a white circle in the Figure XXXX. The surface was forced with the wind registered at the meteorological station, (red circle on Figure XX).

[Figure 4 here]

AUV 2012 EXPERIMENT The model developed for the Mar Menor during this project was used as a support decision system during the AUV 2012 Experiment. The main scientific goal of the experiment was to determine the influence domain of the saltier tongue of water going out the lagoon through The Estacio channel towards the Mediterranean Sea. In order to

314

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

achieve this goal, several institutions were involved in the experiment, some of them with AUVs and others bringing support to the operations. Following there are the participating institutions: Universidad Politcnica de Cartagena Universitat de Girona SARTI Group, Universitat Politcnica de Catalunya LSTS, Universidade do Porto PLG Group, Universidad Carlos III SOCIB CETMAR, Vigo MBARI The boundaries forcing for the model run during the experiment was the data collected by a oceanographic buoy deployed at the north of La Manga in the Mediterranean sea. The purpose of the couple system buoy-model was to enable researcher real time hydrodynamic data of the study area and to estimate of the saltier tongue extension (Figure 5). This information could be accessed through a webpage and helped in planning the deployment of each day.

[Figure 5 here]

PRELIMINARY RESULTS

Thanks to this project we have started to understand the hydrodinamic of the Mar Menor and the forcing that control the water exchange between the lagoon and the Mediterranean sea. The prelimanary results show a complex pattern of exchange, control by the wind and the sea level variations, with different time lags for each of the forcing and channels. The model developed has been validated with the data collected, showing a good correlation between empiric data and model output. In the Figure 6 we show 15 days plot of the current at 3m, the blue line represent the data collected and the red one the model output for this point and depth. We can see how the model represents properly the hydrodynamic of these days. [Figure 6 here]

315

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The model developed will helped us to understand the hydrodynamic of the lagoon and study how will affect, for example, Mediterranean sea level changes or dredging in La Manga channel to the hydrodynamic of the lagoon and therefore to the ecosystem. The Figure 7 show an extreme wind (SW, 13 m/s) simulation for the coastal lagoon, we can see how strong southwest winds push water to the north of the lagoon. [Figure 7 here] ACKNOWLEDGMENT Coastal Monitoring System for the Mar Menor Coastal Lagoon, Regional Government of Murcia, Spain, (PEPLAN 463.02-08 CLUSTER).

316

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST
Budgell, W.P., 2005: Numerical simulation of ice-ocean variability in the Barents Sea region, Ocean Dynamics, DOI 10.1007/s10236-005-0008-3. Warner, J.C, C.R. Sherwood, H.G. Arango, and R.P. Signell, 2005a: Performance of four Turbulence Closure Methods Implemented using a Generic Length Scale Method. Ocean Modelling, 8, 81-113. Wilkin, J.L., H.G. Arango, D.B. Haidvogel, C.S. Lichtenwalner, S.M. Durski, and K.S. Hedstrom, 2005: A regional Ocean Modeling System for the Long-term Ecosystem Observatory. J. Geophys. Res., 110, C06S91, doi:10.1029/2003JC002218.

317

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1 Localitation of the Mar Menor coastal lagoon.

Figure 2 Sea level sensor distribution in the Mar Menor .

318

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 3 Currentmeter distribution in the Mar Menor .

Figure 4 Nesting grid used for Mar Menor Modelling. Parent grid resolution 150 m. Smaller grid resolutin 5 m.

319

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 5 Surface salinity model ouput run during the AUV 2012 Experiment.

Figure 6 Time serie for the current data collected at 3 m (blue line) and the model output for this point.

Figure 7 Model ouput for a run forcing with 10 m/s Southwest winds. In color sea elevation, the red colors correspond to the higher values. Le lines correspond to the flux of the surface current.

320

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

IMPLEMENTATION OF A VECTOR CONTROL FOR GRID-CONNECTED RENEWABLE AGENT SYSTEMS Nstor F. Guerrero-Rodrguez, Gino de J. Roa, Alexis B. Rey-Bou. Universidad Politcnica de Cartagena (UPCT), SPAIN Nestor.guerrero@upct.es, gino.roa@upct.es, alexis.rey@upct.es

ABSTRACT The aim in this paper is the implementation of a vector controller for a voltage source inverter used as a power conditioner and link between the primary renewable energy source and the low voltage 3-phase utility grid. The strategy employed for the vector control of the 3-phase inverter will be a d-q control. The primary renewable energy sources may be a Photovoltaic Generator (PV) or a Fuel cell system (FC). There are two possible control strategies for the PV system: voltage source control or current source control, meanwhile the voltage source control strategy is used for the FC system. A summarized procedure for applying the d-q control to a grid-connected renewable agent will be shown in the paper and some simulations are run to show the d-q control performance in the 3-phase grid-connected inverter. MATLAB/SIMULINK tool from The MathWorks, Inc. will be used to carry out simulations. Keyword: Renewable agent, Photovoltaic Generator, Fuel Cell Generator, 3-phase Voltage Source Inverter, grid-connection, d-q control

321

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION News sources of energy such as Photovoltaic, Wind, Fuel Cell, etc., have been connected to the utility grid with the aim of power injection with good power quality as a collaborative effort towards the mitigation of the greenhouse effect. Renewable agents connected to the low-voltage 3-phase utility grid must obey certain standards in both the control and the power quality. The connection of renewable agents to the utility grid must be properly controlled; this control system must be designed according to the expected operating conditions of the primary energy source (different values of irradiance, variation of wind speed, quantity of energy in the fuel cell, etc.) (Stefano Barsali and Davide Poli 2003:1-5) and to the utility grid conditions (Unitary Power Factor, synchronization, islanding protections, etc.). To deal with the aforementioned facts, new control algorithms have been designed focusing on improving the performance of the connection of primary renewable energy agents to the low-voltage 3-phase utility grid (Liping Su, Guojie Li, and Zhijian Jin 2011:724-729).

IMPLEMENTATION OF THE VECTOR CONTROL

2.1 PHOTOVOLTAIC SYSTEMS (PV) Photovoltaic cell is an electric device that produces electric energy when exposed to direct sunlight and connected to a load (Frede Blaabjerg, Zhe Chen, and Soeren Baekhoej Kjaer 2004, 19:1184-1194). A power conditioning system is needed to convert the DC quantities into AC quantities, as well as to balance the power flow between the renewable agent and the utility grid; this task can be done in the DC or AC stage of the system (Frede Blaabjerg et al. 5 A.D., 53 NO 5). 2.1.1 Description of the system: For renewable energy grid-connected systems, the purpose is to control the power flow between the primary renewable energy source and the utility grid, as well as the power factor of the inverter-grid connection with high power quality. It is necessary that the power conditioner guarantees the maximum efficiency by controlling the power factor of the inverter-grid connection, making use of the reactive power theory which allows the control of the instantaneous active and reactive powers in decoupled d-q axes. The Figure 1 shows a Block diagram of the Power and Control Subsystems for a 3-phase gridconnected system. INSERT HERE Figure 1 2.1.2 Power subsystem: The power subsystem is depicted in the Figure 1. The dc/dc converter is used to look for the maximum power point in the PV Generator according to a

322

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

specific irradiance and temperature; the function of the inverter is to convert the generated DC voltage into a suitable AC current for the 3-phase low-voltage utility grid (Frede Blaabjerg, Zhe Chen, and Soeren Baekhoej Kjaer 2004, 19:1184-1194). The LC filter is connected at the output of the inverter to reduce the harmonics produced by the inverter (M.Hashem Nehrir 2009); the EMI filter is necessary to mitigate the electromagnetic interferences (Rengang Chen et al. 2003, 1:296-300 ); an isolation transformer between the input and output power is required in many countries where such systems are installed for safety and galvanic isolation (Frede Blaabjerg, Remus Teodorescu, Marco Liserre, and Adrian V.Timbus 5 A.D., 53 NO 5). 2.1.3 Control subsystem: In the bottom of the Figure 1 is depicted The Control Subsystem. Its main modules are: the Synchronization Algorithm for attaining a controllable power factor in the connection that must detect the phases of the 3-phase utility grid with optimal dynamic response; d-q PLL structure and DSOGI-PLL can be used for this (P.Rodrguez et al. 2006:17); the maximum power point tracking (MPPT) algorithm in order to extract the maximum available power of the PV generator; the two inner Current Regulators; and the outer dc bus Voltage Regulator. This control has been performed using PI controllers: the outer loop regulator compares the DC voltage in the link capacitor with the reference which comes from the block that executes the MPPT algorithm, while the inner control loop uses two controllers to regulate the d-q components of the line currents. In the Figure 2 is depicted a block diagram of the equivalent small-signal model of the cascaded control for the 3-phase VSI used for PV systems. INSERT HERE Figure 2 2.2 FUEL CELL SYSTEMS (FC) Fuel cells are devices that convert the chemical energy of fuel directly into DC electrical energy. FC has a wide variety of potential applications including micro power, transportation, and cogeneration applications. Most significant advantages are its low emission levels of greenhouse gas emissions and high energetic density (M.Hashem Nehrir 2009). FC systems must be able of deliver a predetermined amount of real and reactive power to the grid, or be able of follow a time-varying load profile and therefore, it is necessary a proper controller (M.Hashem Nehrir 2009). Although the voltage of a fuel cell is usually small, with a theoretical maximum being around 1.2 V, fuel cells may be connected in parallel and/or in series to obtain the required power and voltage (Frede Blaabjerg, Zhe Chen, and Soeren Baekhoej Kjaer 2004, 19:1184-1194). 2.2.1 Description of the system: A grid-connected FC system is interfaced to the 3-phase utility grid through a set of power electronic devices, and like PV systems, the aim of the controller is to guarantee the maximum efficiency. The power conditioning systems, including

323

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

inverters and dc/dc converters, are often required in order to supply normal customer load demand or send electricity into the grid (Frede Blaabjerg, Zhe Chen, and Soeren Baekhoej Kjaer 2004, 19:1184-1194). 2.2.2 Power subsystem: The power subsystem for FC consists of a dc/dc boost converter between the fuel cell and the inverter in order to increase the dc bus voltage for the inverter input (Frede Blaabjerg, Zhe Chen, and Soeren Baekhoej Kjaer 2004, 19:1184-1194). It is also necessary a VSI to interconnect the fuel cell system to the utility grid for instantaneous real and reactive power control purposes (C.Wang, M.H.Nehrir, and H Gao 2006, 21:586-595). A Super-capacitor or battery banks is connected to the dc bus to provide storage capability and fast dynamic response to load and a coupling inductor is connected to control the real and reactive power flow between the FCDG system and the grid and to limit power disturbance and fault currents transients (M.Hashem Nehrir 2009). 2.2.3 Control subsystem: The controllers for the boost dc/dc converters are designed to keep the dc bus voltage within 5% of the desired values (C.Wang, M.H.Nehrir, and H Gao 2006, 21:586-595). The inverter controller controls the real and reactive power flows to the utility grid. P, Q power track their respective reference values, which can be set either as fixed values or to follow a certain load demand (C.Wang, M.H.Nehrir, and H Gao 2006, 21:586595). The main components of the dc/dc converter can be determined by the prescribed technical specifications (Ned Mohan, Tore M.Undeland, and William P.Robbins 2002). It is necessary to shape and control the inverter output voltage in amplitude, angle, and frequency (IEEE 2003) in order to control the power flow between the FC system and the utility grid. 3 CASE OF STUDY

To implement the aforementioned facts, some simulations with a grid-connected PV system of 10kW will be done. It has the next characteristics: The VSI is made with IGBTs switching at 12208Hz (F sw ). The nominal voltage of the 3 phase utility grid U AC (rms) = 230V (phase-to-neutral) and fundamental frequency f=50Hz. The dc bus voltage V CC =600V; the values of the LCL are: L=1.1mH, C=4F and R=0.0465. The parameters of the control module are: Inner current loop: K PWM =400V, f cI =407Hz, PM I=63.5. Where: K PWM is the gain of the inverter, f cI is the inner loop crossover frequency, and PM I is the phase margin. Outer voltage loop: u ACd =230V, C link =2200F, f cV =12.2Hz, PM V =PM I, c = . Where: C link is the value of the dc-link capacitor, u ACd is the d component of space vector u AC , f cV is the outer loop crossover frequency, PM V is the phase margin, and c is the damping factor of the closed-loop 2nd order transfer function.

324

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Using this parameters the constants of the PI regulators can be calculated (Buso S and Mattavelli P). 3.1 SIMULATIONS The simulations have been performed with MATLAB/SIMULINK models. A simulation of the time evolution of the dc bus voltage is depicted in Figure 3: a step in irradiance is exerted at 0.2s, and can be viewed as a perturbed variation in the irradiance over the PV modules by changing the valued of the PV current, and a step in reactive power is exerted at 0.59s. In both cases, it can be seen the regulation of the dc bus voltage by the outer loop assuring the system stability. INSER HERE Figure 3 A simulation of the time evolution of the voltage and grid current at phase 1 is depicted in Figure 4: a step in reactive power of 4KVAr is also exerted at 0.59s. Prior the reactive step the current and voltage are synchronized in phase and frequency, whereas after the reactive step, there exist a lag of the current due to the decrease of the power factor of the inverter-grid connection. INSERT HERE Figure 4 The simulations shown above show that the designed control has the ability to control the power flow between the PV and FC systems, as well as to control power factor of the connection when disturbances occur in the generator, eg. the irradiance .

325

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1 Block diagram of the Power and Control Subsystems for a 3-phase grid-connected system.

326

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2 Block diagram of the continuous equivalent small-signal model of the cascaded control for the 3-phase VSI for PV systems.

Figure 3 Simulation of the time evolution of the dc bus voltage for a step in irradiance at 0.2s, and a step in reactive power at 0.59s

327

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 4 Simulation of the time evolution of the utility grid voltage and the grid current in phase 1 for a step in reactive power at 0.59s.

4 CONCLUSIONS This paper summarizes certain control methodologies for photovoltaic (PV) and fuel cells (FC) systems used in distributed generation systems. The paper showes briefly how those systems are formed and its main parts are explained in detail, foccusing in the current and voltage source control, respectively. The current source control of an inverter for a grid connection system has been validated through simulations, showing that the designed control is capable of controlling the power flow between the PV system and the utility grid, as well as the controlling of the power factor of the inverter-grid connection, even when perturbations such as the irradiance occur in the PV generator.

328

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST MATLAB/SIMULINK. The MathWorks, Inc. <http://www.mathworks.com/> [Last checked November 2011]. Buso S, and Mattavelli P. Digital Control in Power Electronics. Morgan & Claypool Synthesis Series (Lectures on Power Electronics #2;Jerry Hudgins,University of Nebraska-Lincoln) 2006. C.Wang, M.H.Nehrir, and H Gao. 2006. Control of PEM Fuel Cell Distributed Generation Systems. IEEE Transactions on Energy Conversion, 2006, 586-595. Frede Blaabjerg, Remus Teodorescu, Marco Liserre, and Adrian V.Timbus. 5 A.D. Overview of Control and Grid Synchronization for Distributed Power Generation Systems. IEEE, 5 A.D. Frede Blaabjerg, Zhe Chen, and Soeren Baekhoej Kjaer. 2004. Power Electronics as Efficient Interface in Dispersed Power Generation Systems. IEEE, 2004, 1184-1194. IEEE. 2003. IEEE Standard for Interconnecting Distributed Resources with Electric Power Systems. Liping Su, Guojie Li, and Zhijian Jin. 2011. Electric Utility Deregulation and Restructuring and Power Technologies (DRPT), 724-729 . M.Hashem Nehrir CW. 2009. Modeling an Control Of Fuel Cells. New Jersey: John Wiley & Sons, Inc. Ned Mohan, Tore M.Undeland, and William P.Robbins. 2002. Power Electronic: Converters, Applications and Disegn. Wiley. P.Rodrguez, R.Teodorescu, R.Teodorescu, A.V.Timbus, M.Liserre, and F.Blaabjerg. 2006. New Positive-sequence Voltage Detector for Grid Synchronization of Power Converters under Faulty Grid Conditions. IEEE: 1-7. Rengang Chen, Shuo Wang, van Wyk JD, and Odendaal WG. 2003. Integration of EMI filter for distributed power system (DPS) front-end converter. IEEE l, 2003, 296-300 . Stefano Barsali, and Davide Poli. 2003. Innovative techniques to control inverter interfaced distributed generators. 17th International Conference on Electricity Distribution: 1-5.

329

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INCIDENCE AND IMPACT OF LAW 34/2006, OF ACCESS TO ADVOCACY, IN THE NEW UNIVERSITY ACADEMIC ORGANIZATION IN SPAIN 1 By: Juan Pablo Murga Fernndez Becario de Investigacin de Derecho Civil, Universidad de Sevilla Email: jpmurga@us.es Salvador Toms Toms Becario de Investigacin de Derecho Procesal, Universidad de Sevilla Email: salvador.tomas@us.es KEY WORDS: Law 34/2006, of Access to Advocacy, Academic organization in Spain. SUMMARY: In this communication we intend to describe the fundamental aspects of the Law 34/2006, of Access to Advocacy, which has entered into force in October 2011. With this Law, Spain, as the rest of European countries, regulates for the first time the accession to the legal professions. Until the referred date, anyone with a Law Degree could practice the legal profession without more needs than enrolling themselves in a School of legal practice. This had to change due to the European requirements, as such
This communication has been prepared in response to the submission deadline (March 31, 2012). Law 34/2006 fo 30 October, has been modified by the Third Final Provision of Royal Decre-Law 5/2012 of March 5, of Mediation in Civil and Commercial Matters; modification which responds to some of the students claims. A result of this social mobilization is the popular legislative initiative submitted to the Congress of Deputies (the 13th of December, 2011), which presents a proposition of a Law that amends Law 34/2006. This proposal has expired due to the expiration of the dead line for the necessary collection of signatures that establishes articule 7.3 of the Organic Law 3/1984, 26 March, that regulates the Popular Legislative Initiative (this whole process can be consulted in the Official Bulletin of the Parliament hereinafter, OBP-, number D-31, February 7, 2012, p. 83). Our study focuses on the current regulation, although we are aware of a future and possible alteration of its articles. We forecast this circumstance in view of the initiatives that the different parliamentary groups are carrying out in the Chamber of Deputies. As a matter of fact, the Parliament Group UP & D has made oral questions about the possible measures to prevent the discrimination that the entry into force of Law 34/2006 might provoke to those law graduates who havent adjudged themselves in a Law School; specially due to the fact that there hasnt been a proper development of the postgraduate studies (OBP, Chamber of Deputies, number 19, March 14, 2012, p. 49). There has also been a non-legislative proposal submitted by the Socialist Group (OBP, Chamber of Deputies, number D-61, March 23, 2012, p. 12), as well as by the IU, ICV-EUiA, CHA Groups (OBP, Chamber of Deputies, number D-21, January 23, 2012, p. 4). And, curiously, the PP Group (even though the subsequent reform of the Government has not been the same one as the proposed by its own Parliamentary Group OBP, Chamber of Deputies, p. 5-). Also in the Committees on Education, Sport and Justice have been raised legislative proposals by the Socialist, IU, ICV-EUiA, CHA Parliamentary Groups (OBP, Chamber of Deputies, number D.-23, January 25 2012, p. 10).
1

330

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

an important profession, with so many social interests involved, cannot be open to practice just by the fact of paying an amount of money to a School of legal practice. We also put this new regulation in relation with the Process of Bolonia, as the system for accessing to the practice of legal professions includes the realization of an official Master program; Master program that is part of the referred Process.

331

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In this communication, we intend to make some reflections about the impact of the Law 34/2006 of 30 October, with entry into force on the 31st of October 2011 2, will have under the current structure of second and third studies according to the European Area of Higher Education (EHEA). The 31st of October 2006, the famous Law of Access to Advocacy was published in the Spanish Official Gazette (BOE), which through a short series of articles (it is only composed of seven articles and various transitional and final provisions), incorporates to our legal system the new conditions that will be required to obtain the qualifications as a barrister and solicitor. Therefore, it is an essential Law not only for the professional practice, but also for the membership in the bar associations. The said Legal Act 34/2006, after a long and tedious process of negotiation between the various sectors concerned, has been developed by the Royal-Decree 755/2011, 3 of June, which approves the Regulation of the Law 34/2006 3. By means of the legal Act that we are studying, , as reflected in its Statement of Reasons, the Spanish legislator has considered the comparative law experience, which has shown that the action before the courts and other legal assistance activities require the prior approval of a professional capacity that goes beyond the acquisition of professional qualification. Hence the need to create rules and procedures to ensure the effective acquisition of the skills required for advocacy profession. Moreover, Law 34/2006 is intended as a step towards the official approval of the legal professions in the whole of Europe, in order to ensure the fluidity of movement and establishment of professionals, which is one of the pillars of the Single Market of the European Union 4. On this basis, according to Law 34/2006 (see Article 2) and its implementing regulation, except for special cases (we shall see them later), the accreditation for the exercise of the legal profession depends on four fundamental conditions: Possess an official university a Law Diploma or degree. Overcome a given specialized training, in the terms that we will see afterwards. Develop a formative period of practice in institutions, organizations or offices related to the exercise of legal professions. Pass a test for the final assessment of the respective professional skills. In regards to the specialized training, the Law 34/2006 (Articles 2 to 5) and its implementing regulation (Chapter II), indicates that this specialized training will have a regulated and official character and will be given: by universities (public and private),
2 3

Third Final Provision. Published in the Official Gazette (BOE), the 16th of June, 2011. 4 The importance of this law is more than palpable, since Spain was the only European country that had no access to regulated professions of barrister and solicitor. This new system will permit the practice of both professions in any country of the European Union.

332

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

through courses accredited jointly by the Ministries of Justice, Education and Science; and as well by schools of legal practice created by bar associations and approved by the General Council of Law. For both training cases, through universities or through schools of legal practice, the Law 34/2006 and its implementing regulation state that the training must have a specifically practical content, which is concreted in a range of strictly professional skills that must comprise at least 60 credits ECTS of the whole training process. Together with the practical training that we have referred to previously, the implementing regulation of Law 34/2006 adds the need to pursue additional external practices, which constitute 30 credits ECTS (Article 14), that must be developed in whole or in part in any of the following institutions: courts or tribunals, prosecutors offices, companies, professional lawyers firms, legal and human resources departments of public administrations, and official institutions. Lastly, as for the final evaluation, which is the completion phase of the professional training, Law 34/2006 (Article 7) and its implementing regulation (Article 17), state that the candidate must prove that counts with the sufficient practical skills for the exercise of the advocacy profession, as well as the knowledge of the relevant ethical and professional standards. This final evaluation is done by unique commissions convened by the Ministry of Justice and the Ministry of Science and Education. The composition of these commissions is left for a future regulatory development, although the Law 34/2006 notices that the evaluation for the access to the Advocacy profession must have a unique content for the all the Spanish territory in each call; the commissions have to be convened at least once a year; and there cant be an establishment of a limited number of places 5. Once we have exposed the fundamental aspects of Law 34/2006 and its implementing regulation, we must question ourselves the impact that this legal regulation will have in relation with the new organization of university education established in the framework of the EHEA, given that the said Law shall entry into force at the same time as the final process of implementation of the common area of higher education (specifically with the second and third cycle university studies). Indeed, as noted above, to obtain the professional title of barrister and solicitor (access of advocacy we have referred to in general, due to the terminological differences that exist between the common and continental law systems), the legal regulation that we have analyzed requires the completion of a specialized training phase. The recent experience and the proper implementing regulation of Law 34/2006 show that this

Of great interest due to its clarity, see TRIGO SIERRA, E., Ley de Acceso a las profesiones de abogado y procurador, en Actualidad Jurdica Ura y Menndez. Crnica Jurisprudencial, n16, 2007, pp. 203 y 204.

333

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

specific training phase is articulated mainly through official Master Degrees (second cycle studies), according to the current regulation given by RD 1393/2007 6. At this point, the question seems obvious: doesn`t the situation previously described guarantee a practical factual monopoly of the flow of graduates in Law towards Masters for the access to advocacy 7? As a matter of fact, being the official Master Degree the key channel through which the compulsory specialized training needed for accessing to the legal profession will be done, this will cause a great decrease of the success and acceptance of the rest of Master Degrees offered in the Law Faculties of our universities. This matter is no trivial, since we run the risk of forcing students to do this Master for access to advocacy, as it will possibly be the only viable option to meet their future career with some success. This can actually cause the extinction of other Master programs of great scientific interest, slowing therefore the research and development of the Spanish society.

Article 4. 1. C), in fine of the implementing regulation of Law 34/2006 afirms: The courses can be configured according what is referred to in letter a) training given by universities-, and in any case, its curriculum must have been previously verified as an education program leading to the award of an official Masters Degree. 7 GIL RODRGUEZ, J., Objetivos y lneas maestras del nuevo doctorado, In Documentos de Trabajo del Congreso sobre los marcos institucionales de la investigacin de Grupo Seis de Derecho Civil, pp. 12.

334

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INFLUENCE OF SEX IN THE FLESH QUALITY OF TURBOT (Psetta maxima). Juan Diego Rojo, Marina Santaella, Carmen Martnez, Rosa Cal, Jorge Hernndez-Urcera and Mara Jess Periago. Department of Nutrition and Food Science, Veterinary Faculty. University of Murcia SPAIN E-mail: juandiego.rojo@um.es

ABSTRACT Turbot (Psetta maxima, also known as Scophthalmus maximus) has been widely farmed in the last decades. In order to a better understanding of the final quality of this species, quality parameters of the flesh were studied on 6 specimens of farmed turbot. Fish specimens were harvested with a mean weight higher than 2000 g, and were classified in two groups according to sex. Several physical-chemical parameters were determined in flesh. Moisture, protein, total fat, fatty acids profile and ash were analysed to know the chemical composition, and textural mechanical properties (hardness, springiness, chewiness, cohesiveness, gumminess) were determined objectively with a texturometer. No significant differences between males and females were observed, neither in the physical and chemical nor in the instrumental textural parameters analysed. Related to the fatty acid profiles, turbot flesh of both sex, showed a high percentage of PUFA, and specially n-3 polyunsaturated fatty acids, which indicate the high nutritional quality of this species, as this fatty acids are recognised as beneficial to human health by decreasing cardiovascular and inflammatory disorders.

Keyword: turbot, flesh quality, reared fish, textural properties, proximate composition, polyunsaturated fatty acids.

335

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INFLUENCE OF SEX IN THE FLESH QUALITY OF TURBOT (Psetta maxima). Juan Diego Rojo, Marina Santaella, Carmen Martnez, Rosa Cal, Jorge Hernndez-Urcera and Mara Jess Periago. Department of Nutrition and Food Science, Veterinary Faculty. University of Murcia SPAIN E-mail: juandiego.rojo@um.es 1. INTRODUCTION Fish is an important food of the human diet around the world, and provides a significant amount of high quality proteins, vitamins, trace minerals and other essential nutrients such as n-3 polyunsaturated fatty acids (PUFAs), which have shown potential benefits to human health, particularly in the prevention of cardiovascular diseases (Horrocks and Yeo, 1999; Simopoulos, 1991; Calder, 2004; Balk et al. 2004). It is generally accepted that the flesh quality of fish is influenced by many factors such as stress, feeding regime, life style, environmental conditions and season (Huss, 1999).

Turbot (Psetta maxima) is a highly valued marine flatfish farmed in northern waters in Europe especially along the Atlantic coast and appreciated by consumers. It is known to have high dietary protein requirements and in juvenile turbot high levels of dietary lipids appear to have adverse effects on growth and body composition (Danielssen and Hjertnes, 1993). Turbot has a high commercial value and it is widely appreciated in Europe for its flesh characteristics (white colour, intense and good flavor and firm texture) (Martinez et al., 2010). However, consumption of wild turbot has undergone a marked decrease because of its low availability, which is reflected in their market price. In recent years, the increasing production of these species as an aquaculture product has made it more available to consumers (Aubourg et al., 2005). Currently, a considerable proportion of the total European turbot production (about 6000 t annually) comes from aquaculture, principally along the Atlantic coast of Spain and France (Busetto et al., 2008). It is important to evaluate the flesh quality of the reared fish in order to provide to the consumers a fresh product with similar characteristics than the wild specimens. However the quality parameters could be affected by several factors including the sex of fish. Consequently, the main objective of this study was to the difference between the flesh quality of male and female of reared turbot. To achieve the objective the proximate composition and the textural properties of flesh was analysed.

336

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2. MATERIAL AND METHODS 2.1 Fish samples Six farmed turbot were studied: 3 males and 3 females. Farmed specimens were obtained at the Instituto Espaol de Oceanografa (Centro Oceanogrfico de Vigo). For this study, fish specimens were selected with a weight higher than 2000 g and were kept in tanks without feeding for 24 hours. Fish were anaesthetized and then immersed in ice cold water (hypothermia).

2.2 Sample Treatment Fish were washed with tap water, then the surface wiped with tissue and subsequently weighted, measured, eviscerated and classified in two groups (male and female). After that four fillets were obtained from each fish. Turbot fillets were submitted in box with ice pellets to the Veterinary Faculty of Murcia, within 24 hours of harvest. Textural properties were measured in the epi-axial fillet whereas for the analysis the four fillets were homogenised.

2.3 Sample Treatment The four fillets in each fish were minced with an Omnimixer (at 4000 rpm for 5 s) to determine the physical and chemical parameters. Flesh including the dorsal (epi-axial) and ventral (hypo-axial) areas were homogenised since, from a nutritional point of view, we have considered that the proximate in a homogenised portion of the whole flesh, as an edible portion of fish, gives better information about the total fat. All analyses for proximate composition and fatty acid profile were performed using standard methods (AOAC, 2002). The moisture was determined by drying samples in a Selecta oven (Barcelona, Spain) to reach a constant weight. Total protein was determined by the micro-Kjeldahl method, and a factor of 6.25 was used to convert total nitrogen to crude protein. The samples were digested using a Kjeltec 1007 digester (Tecator, Ho gana s, Sweden) and distilled using a Kjeltec 1026 distilling unit (Tecator). The lipid content was extracted in the dried flesh samples with diethyl ether in a Soxtec System HT 1043 (Tecator). Ash content was determined by incineration of a sample in a muffle furnace at 525C for 24 h.

Fatty acids content was determined after the extraction of flesh with chloroform-methanol (2:1, v/v) and obtained by decantation overnight. Lipids were dissolved in hexane and the fatty esters methylated by 2N potassium hydroxide in methanol. The separation and

337

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

quantification of the different fatty acids were made with gas liquid chromatography. The relative proportion of each fatty acid in the sea bass flesh was expressed as a percentage of the total fatty acids. The sums of the saturated fatty acids (SAFA), the monounsaturated (MUFA), the polyunsaturated (PUFA), the total content and the ratio between n-3 and n-6 fatty acids were also calculated.

Texture parameters were measured in raw flesh by penetration of a probe perpendicularly to the cross-section of the 1cm thick steak (in parallel to the muscle fibres). A texture analyzer TA-XT2 (Stable Micro Systems, Surrey, England) equipped with a 25-Kg load cell was used. The probe was a flat ended stainless steel cylinder with a diameter of 10 mm and a pace of 1.1 mm/s.

2.4 Statistical analysis Statistical analysis was performed with SPSS 15.0 software. The mean and standard deviation of each group of data were calculated. Experimental variables were checked for normality and homogeneous variance and Student-T test was applied to determine the significant differences (P 0.05) between females and male of reared turbot.

3. RESULTS AND DISCUSSION In Table 1 the chemical composition and textural parameters of the females and males turbot flesh are summarized. The flesh of female showed a higher content of moisture and protein, and a lower fat content than flesh from male specimens; however no significant differences were observed in the analysed chemical parameters (Table 1).

Table 1. Proximate composition and textural parameters of turbot flesh. Parameters Moisture (%) Protein (%) Ash (%) Fat (%) Cohesiveness Females (n=4) 74.29 0. 35 19.14 0.42 1.12 0.07 5.46 0.07 0.44 0.01 Males (n=3) 70.42 3.89 16.17 2.41 0.99 0.07 6.17 0.81 0.43 0.04

338

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Chewiness (Nmm) Springiness (Nmm) Hardness (N) Gumminess (N) Adhesiveness (Ns)

69.06 54.26 3.88 1.01 37.12 20.45 16.36 8.69 -0.23 0.02

131.96 59.96 4.98 1.18 62.67 21.74 25.52 8.55 -0.56 0.39

Fat content is related with moisture, since fat and water account for approximately the 80% of the total composition of the flesh (Huss, 1999) (77 and 80% in our results). The chemicals composition are in concordance with those reported by other authors in the scientific literature without consideration to the fish sex. Related to the fatty acid profiles no differences were found in the percentage of saturated, monounsaturated and polyunsaturated fatty acids between males and females, due to the fish were fed with the same diet, which determine the fatty acid composition of the flesh (Grigorakis et al., 2002; Izquierdo et al., 2003 and 2005; Montero et al., 2005; Mnari et al., 2007). Moreover, turbot flesh showed a high percentage of PUFA, which indicate the high nutritional quality of the fed used during rearing providing a good proportion of PUFA.

Concerning the instrumental textural parameters, no significant differences were found between turbot females and males (Table 1), due to the high variability found between specimens. However a tendency was observed in the hardness, chewiness and gumminess, since flesh from male turbot showed higher values than flesh from males. Figure 1. Fatty acids profiles express as percentage in turbot flesh.

339

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

4. CONCLUSIONS

In general, the quality parameters of fish flesh depend on several factors. In reared fish the external conditions during growing and the life style are strictly controlled, hence the variability must be related to intrinsic factors of fish. These results suggest that in turbot (with a body weight higher than 2000 g) there is no relationship between the sex and the flesh quality.

340

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

AOAC 2002. Official Methods of Analysis. 17th edn, Gaithersburg, MD: AOAC. Aubourg, S.P., Pieiro, C., Gallardo, J.M. and Barros-Velazquez, J.B. 2005. Biochemical changes and quality loss during chilled storage of farmed turbot (Psetta maxima). Food Chemistry 90: 445-452. Balk, E., Chung, M., Lichtenstein, A., Chew, P., Kupelnick, B., et al. 2004. Effects of omega3 fatty acids on cardiovascular disease risk factors and intermediate markers of cardiovascular disease. Evid. Rep. Technol. Assess. Busetto, M.L., Moretti, V.M., Moreno-Rojas, J.M., Caprino, F., Giani, I., Malandra, R., Bellagamba, F. and Guillou C. 2008. Authentication of farmed and wild turbot (Psetta maxima) by fatty acid and isotopic analyses combined with chemometrics. Journal of Agricultural and Food Chemistry 56: 2742_2750. Calder, P.C. 2004. n-3 Fatty acids and cardiovascular disease: evidence explained and mechanisms explored. Clin. Sci. 107:111 Danielssen, D. and Hjertnes, T. 1993. Effect of dietary protein levels in diets for turbot (Scophtalmus maximus) to market size. In: Fish Nutrition in Practice (edited by S. Karushik & P. Luquet). Pp. 8996. Biarritz (France): INRA Editions. Grigorakis, K., Alexis, M.N., Taylor, K.D.A. and Hole, M. 2002. Comparison of wild and cultured gilthead sea bream (Sparus aurata): composition, appearance and seasonal variations. Journal of Food Science and Technology. 32: 477-484 Horrocks, L.A. and Yeo, Y.K. 1999. Health benefits of docosahexaenoic acid (DHA). Pharmacological reseach 40: 211-225. Huss, H.H. 1999. El pescado fresco: su calidad y cambios de su calidad. Documento Tcnico de pesca 348. Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin, FAO, Roma, Italia.

341

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Izquierdo, M.S., Obach, A., Arantzamendi, L., Montero, D., Robaina, L. and Rosenlund, G. 2003. Dietary lpids sources for sea bream and sea bass: growth performance, tissue composition and flesh quality. Aquaculture Nutrition 9: 307-407. Izquierdo, M.S., Montero, D., Robaina, L., Caballero, M.J., Rosenlund, G. and Gines, R., 2005. Alterations in fillet fatty acid profile and flesh quality in gilthead seabream (Sparus aurata) fed vegetable oils for long term period. Recovery of fatty acid profiles by fish oil feeding. Aquaculture 250: 431444. Martnez, B., Miranda, J.M., Nebot, C., Rodriguez, J.L., Cepeda, A. and Franco, C.M. 2010. Differentiation of Farmed and Wild Turbot (Psetta maxima): Proximate Chemical Composition, Fatty Acid Profile, Trace Minerals and Antimicrobial Resistance of Contaminant Bacteria. Food Science and Technology International 16: 435. Mnari, A., Bouhlel, I., Chraief, I., Hammami, M., Romdhane, M.S. El Cafsi, M. and Chaouch, A. 2007. Fatty acids in muscle and liver of Tunisian wild and farmed gilthead sea beam, Sparus aurata. Food Chem. 100: 1393-1397. Montero, D., Robaina, L., Caballero, M.J., Gine, R. and Izquierdo, M.S. 2005. Growth, feed utilization and flesh quality of European sea bass (Dicentrarchus labrax) fed diets containing vegetable oils: a time-course study on the effect of a re-feeding period with a 100% fish oil diet. Aquaculture 248: 121134. Simopoulos, A.P. 1991. Omega-3 fatty acids in health and disease and in growth and development, a review. American Journal of Clinical Nutrition 54, 438-463.

342

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTERACTIVE EBOOKS: A TEACHING-LEARNING OPPORTUNITY FOR CLASSROOMS AND STUDENTS. Manola Civiletti, University of Palermo, Italy manola.civiletti@gmail.com ABSTRACT A modern education system should be able to create fully formed individuals, capable of imparting themselves lifelong learning with a cooperative and autonomous approach. Introducing new media paradigm and tools in education seems more and more a requirement of the present times, as they can support teaching-learning processes inspired by personalization and socio-constructivism. Contemporary Italian normatives mandate the production of mixed textbooks (traditional paper textbooks supplemented with online material) and the dissemination of technology in classrooms, but the methodological approach followed in practice is still left to be desired. Interactive ebooks are a bridge between tradition and innovation, and can be employed as invisible technologies in a media system. This approach develops different learning styles and metacognition, increases a sense of selfefficacy, avoids the risk of cognitive overload. Im going to present an instance of an interactive multimedia book for secondary education, describing the real-world application of the aforementioned ebook in an educational context equipped with technological tools (like IWBs), and highlighting the advantages as well as the critical issues for both classroom and home usage. Ill then demonstrate a rationale for media application in day-to-day teaching. Keyword: interactive ebooks, IWB, teaching-learning processes

343

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Todays society is characterised by a proliferation of mass-media and an exponentional increase of new knowledge; such knowledge can be readily shared everywhere through these media. A modern education system should be able to create fully formed individuals, capable of imparting themselves lifelong learning and finding useful information amidst the chaos that is the Web. It should also develop individual differences and promote social construction of knowledge. As such the education system must foster the introduction of new media; failing to do so would mean abdicating its traditional role in socialising new generation, risking to widen the gap between the digital natives and the teaching materials, and giving up the significant educational and communicative opportunities they offer. Interactive ebook can be usefully employed in a system of effectively interacting media in order to improve teaching-learning processes; such system should not be a mere translation from paper to digital, but must be designed using the full potentiality of each concurring media (Cambi and Toschi 2006, 39). A vast amount of italian teachers are still resisting the use of new media, fearing the annihilation of students meta-reflexion. Let us briefly recap the main characteristics of media: - media are cognitive technologies (Calvani 1999), metaphore of a mental structure typified by fluidity, contamination, interaction; - media promote cognitive and sensorial restructuring that transfer mental tasks and functions to phisical supports, reducing cognitive load and increasing a state of wellbeing; - media are part of the cultural and experiential imprinting of pupils; - media encourage the activation of prior and informal knowledge in order to obtain meaningful learning. 2 BOOKS AND DIGITAL MEDIA

Why there exists so much diffidence towards media in education? Teachers fear the loss of importance of books, as symbols of a cognitive model based on truthts that are universal and confined, and as such controllable. Multimedia, interactivity, hypertextuality, virtuality and network logic are crumbling the knowledges sense of ownership; the real conflict is between a lytic knowledge, supported by printed books, and its liquid counterpart, where immediateness, shallowness and temporariness prevail (Maragliano 2004). First and foremost books are media in their own right; they use the invisible technology called writing and move further humans limits of knowledge, memory and communication.

344

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

They are not monolytic, they do not transfer knowledge in an autoritary and univocal fashion; as a matter of fact, reading calls for an interpretative activity by the user. The various textual and para-textual elements then configure the books as an open structure (Lvy 1995); a book can be considered as an hypertext, that requires the reader to be able to navigate and gather the various nodes of content. For all these reasons, the idea of using digital media in educational context should not be regarded with dismay. 2.1 Hypermedia and the hypermedia ebook

The non linear communicative structure of digital hypermedia simplifies knowledge building in a manner similar to that of the human mind, which usually links concepts expressed in different language codes. It may be useful to consider media as a system, in which they can produce a complex activity of signification by mutually and synergically interacting between them; in turn, this process allows to customise the learning experience and the comparison between different points of view, following a successful integration of abstraction and immersion logic (Abruzzese e Maragliano, 2008). A wider offer of informative stimuli may require an higher cognitive load, so a good choice and design of media may be significative. A viable path may be found in offering a digital version of a traditional paper book with links to expanded textual matters and multimedia objects. To this end I have produced a multimedia ebook focused on Science content for secondary education. 3 DIGITAL CONTENTS OF THE HYPERMEDIA EBOOK

Multimedia contents, such as animations, lectures and interactive tests, video of some laboratory experiments, self-grading tests) are accessible from various ebook pages. [figure 1] Interactivity stimulates kinesthetic intelligence, trains the oculomotor system and helps discovery learning. The immediate feedback from the interactive activities supports the metacognitive processes and the self-efficacy sense. As an example, interactive and multimedia lessons are used to explain the different roles of digestive, respiratory and circulatory systems, the structure of a cell and of the sun, and the lunar phases. This type of lessons contains images and diagrams with embedded hot areas; clicking on one of such areas plays an audio file, and perhaps a simple animation, explaining the corresponding element. [figure 2] Such simulation allows the overcoming of some perceptive and motor limits by extending our perceptive and cognitive faculties and letting us interact with processes and ideas that: - are far from us in time and space;

345

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

- are too big or too small to be known directly; - are too slow or fast for our biological clock; - are of an abstract nature; - are too dangerous or costly. The risk of cognitive overload is counterbalanced by the numerous advantages WRT the verbal explanation by itself; enlarging and reducing, slowing or accelerating phenomena that cannot be observed by themselves has the added bonus of a complete control that can be practiced directly by the learner. The auditory dimension is usually more appreciated by the young generations than the silent process of reading a written text; the so called split-attention effect, the risk that the attention gets divided between the different sense domains, can be avoided by carefully balancing the ratio between audio, video and written text. Learning about something is further improved by illustrating it via audio, as the two different cognitive channels, auditory and visual, get engaged at the same time (Calvani 2011, 81). Moreover visual and verbal information are processed in independent portions of the working memory, so these do not compete with each other. Therefore, multimedia lessons that take advantage of both the visual and the verbal elements are more beneficial than those that use only one of them (Dual-Mode Effect, Smith R. M. 2008, 75), Images, both static and dynamic, can immediately describe a phenomenon and its internal relationships. A correct use of visual material supports attention, activates prior knowledge, lessen the cognitive load; in some instances images can be of help in creating mental models and supporting motivation. Video experiences, small movies in which teenagers illustrate simple experiments often using household materials, can be a good source of ideas for activities to held in laboratories, and can also increase epistemic curiosity and a learning-by-doing attitude. [figure 3] Self-grading interactive tests are usually multiple choice tests done in a ludic spirit, whose answers can be given individually or as a team. As the learner answers, a score-keeping feedback in form of a audio or video signal is given. When the questions are finished, a report with all the answers, both right and wrong, and eventual corrections is given. [figure 4] Such tests help improve cognitive capabilities when done individually, stimulate competition (between teams) and cooperation (within teams), and increase the learning motivation. The contents described above seem to promote cognitive processes that are the building blocks for significative learning; each communication code can fruitfully be employed as a facilitator for the learning process, assuring its success.

346

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1: Screenshot of a page of the interactive book; the links to multimedia activities are highlighted.

Figure 2: Screenshot of an interactive lesson on lunar phases; clicking on an entry from the list, the user can start the animation and audio explanations concerning the selected phase.

347

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 3: Screenshot of a video of a laboratory experiment; students are building a fruitpowered battery.

Figure 4: Screenshot of an interactive self-assessment involving students gathered in two teams.

348

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

USING INTERACTIVE EBOOK AND IWB TOGETHER

In this section I will try and outline the specific effects of using the interactive ebook in a learning communication context concerning a cutting edge learning tool, IWB (the interactive whiteboard), an advantageous tool for teachers, as it mimics the old blackboard (Bonaiuti 2009, 15). The reason for this is not limiting ourselves to just uncritically introducing objects in the learning space, but its complete rethinking in the classroom, and the development of strategies centering the learners and the classroom in the learning process (Zambotti 2009). It is necessary to carefully handle resources without forgetting the principles of multimedia communication and the existence of specific limits in the cognitive system by choosing the teaching resources and presenting them in a clear and efficient manner. Thanks to IWB it seems that in the classroom the generation gap is shortened and the consideration of teachers by the digital natives, members of the so-called screen generation (Rivoltella 2006), increased. By showing the interactive book in the classroom on IWB, teachers can drive learners gaze to the book part they are dealing with, and using highlighting, enlargement and selection tools they can focus attention on the parts that are considered as important. The wow effect (Beauchamp and Parkinson 2005) becomes exciting participation, a phenomenon that can dampen learning (Calvani in introduction to Bonaiuti 2009); this highlights the importance of keeping attention alive, and what are the didactic consequences of using IWB in the classroom, and especially of the interaction between IWB and the interactive book. Teaching the same topic by written text, oral explanation, images, animations and movies exploits individual differences and facilitates multiple intelligences and cognitive styles (McKenzie 2005). Showing the ebook on IWB is also useful in the test phase: the student can use the images in the book and the interactive conceptual map as a base for a personal exposition of the contents. The different reasoning modalities can be rendered evident by this way of teaching; the teacher can show them in order to stimulate the self-observation of learners, and by observing others to comprehend the differences among different learning styles, easing metacognition and the cognitive conflict. The teacher can facilitate the socio-cognitive conflict during teams test administration, encouraging discussion and driving learners to explain their choices and to self-correct, using their mistakes as a good chance to produce new shared knowledge. The active interaction with contents by the learners, demonstrating their abilities and knowledge, can help improving their sense of self-efficiency. It is evident that the potentialities presented by the interactive ebook can synergistically interact with those of IWB in a new and ecological pedagogical perspective, in which technologies are not intruders in the daily teaching, but cognitive instruments and learning environments in order to improve the teaching activities in the classroom.

349

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSION

A well-designed interactive ebook can be a good bridge between traditional teaching tools and new media, and enhance classroom activities and individual home learning; it conveys content in the sequential form typical of the printed book, but can also be aimed toward an education method based on a network logic, due to presence of links that allow to view different multimedia content. The possibilities offered by interactive ebooks can be paired with IWBs, in a pedagogical approach that is reassuring and renewed at the same time; they can also be an effective tool for the development of independent learning skills. The ebook can also be independently used at home by the learners; in this context, every student has a huge amount of learning aids available on a single framework, that encourages the growth of different cognitive styles and multiple intelligences. The chance to use familiar tools, such as computers, for studying as well as for leisure is certainly a considerable reason for the students to increase their own motivation. The students can easily peruse ebooks to find specific topics quickly, especially during the review phases. Following this, they can choose to read just a topic, as well as view the linked animations or videos, interact with active training lesson, or be engaged in interactive selfassessments tools. Moreover this type of test facilitates metacognitive processes in which learners can selfevaluate their understanding of a subject and the skills they have acquired. The ability of perusing knowledge on paper, computers, tablets or smartphones, up to and including the Net, also increases the benefits of cross-mediality or trans-mediality, by letting the students learn in a familiar and welcoming environment.

350

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Abruzzese A., and Maragliano, R. (eds.), 2008, Educare e comunicare. Spazi e azioni dei media, ed. Mondadori Universit, Milano. Beauchamp, G., and Parkinson, J., March 2005, Beyond the wow factor: developing interactivity with the interactive whiteboard in School Science Review, 86 (316): 97103 Accessed October 23, 2011. http://arrts.gtcni.org.uk/gtcni/bitstream/2428/49478/1/beyond+the+wow+factor.pdf Bonaiuti, G., 2009, Didattica attiva con la LIM. Metodologie, strumenti e materiali con la Lavagna Interattiva Multimediale, ed. Edizioni Erickson, Trento. Calvani, A., 1999, I nuovi media nella scuola: perch, come, quando avvalersene, ed. Carocci editore, Roma. Calvani, A., 2011, Principi dellistruzione e strategie per insegnare. Criteri per una didattica efficace, ed. Carocci editore, Roma. Cambi, F., and Toschi, L., 2006, La comunicazione formativa. Strutture, percorsi, frontiere, ed. Apogeo, Milano. Lvy, P., 1995, Quest-ce que le virtuel, ed. La Dcouverte, Paris. Maragliano, R., 2004, Nuovo manuale di didattica multimediale, ed. Laterza, Bari. McKenzie, W., 2nd ed. 2005, Multiple intelligences and instructional technology, ed. ISTE, Washington, DC. Rivoltella, P.C., 2006, Screen generation: gli adolescenti e le prospettive dell'educazione nell'et dei media digitali, ed. Vita e Pensiero, Milano. Smith, R.M., 2008, Conquering the content: a step-by-step guide to online course design, ed. John Wiley & Sons, San Francisco, CA, USA. Zambotti, F., 2009, Didattica inclusiva con la LIM. Strategie e materiali per lindividualizzazione con la Lavagna Interattiva Multimediale, ed. Edizioni Erickson, Trento.

351

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTERNACIONALIZATION OF HIGHER EDUCATION: BRIDGING THE NORTH AND SOUTH OF MEDITERRANEAN Haridian Afonso Falcn, ISSBS, Slovenia, haridian.afonso101@alu.ulpgc.es Nazaret Galante Henrquez, ISSBS, Slovenia, nazaret.galante101@alu.ulpgc.es Carmen Nayra Gonzalez Morales, ISSBS, Slovenia, carmen.gonzalez119@alu.ulpgc.es Yanira Ruiz Herrera, ISSBS, Slovenia, yanira.ruiz101@alu.ulpgc.es

ABSTRACT Higher education enables the transformation, promotes change and social progress over the years. The economy and society are more interested in knowledge, therefore higher education and research now act as essential components of cultural, economic and environmentally sustainable development of individuals, communities and nations. This report aims to establish a diagnosis on the situation of higher education in an international context. We've covered the following topic including some general information about higher education systems in Europe and Euro-Mediterranean area, focusing on internationalization. In the first part of the paper we make a comparison between Spain and Slovenia and in the second part we focus on four countries, two European countries (Finland and England) and two of the EURO-MED (Morocco and Egypt). Key words: higher education, internationalization, mobility, Euro-Med

352

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION In current times, where the global competitiveness is an important factor for national strength, the higher education has become an important tool for reducing the barriers between European Union countries and other countries in general. In recent years, with the European Higher Education Area and the implementation of the Bologna process, has sought to achieve homogenization and enhance the quality of European education systems, thus facilitating mobility between countries. In this paper, we analyze the similarities or the differences that exist in the higher education system between Spain and other countries. First, we do a comparison between Spanish and Slovenian higher education, focusing on the higher education system and internationalization. Then, we do an international comparison analyzing two countries of the EU, Finland and United Kingdom, and last, two EURO-MED countries, Morocco and Egypt. In this part, the analysis is on the same factors that in the case of Slovenia, but in a less exhaustive form. 2. COMPARISON BETWEEN SPAINISH AND SLOVENIAN HIGHER EDUCATION 2.1. The Higher Education System.

2.1.1. Higher Education System in Spain The Spanish higher education system consists of the following lessons: university education, artistic education, higher grade training cycles. Higher education is mainly provided by both public and private universities. It distributes authority over education between the State, the Autonomous Communities and the Universities. Organisation of studies in Spain (www.tostudyinspain.com) Academic year: The academic calendar in Spanish universities tends to be similar throughout the country: lectures begin in October and the academic year ends in June. Methods of teaching: Teaching methodology includes lectures, seminars and practical work under the supervision of a tutor. Attendance, while not always obligatory for some tuition forms, is strongly recommended, as it constitutes a fundamental part of university education. Lectures last for 50-60 minutes and professors often use audiovisual materials as teaching aids. Students are assessed through final examinations in February, in the case of one semester courses; or in June, in the case of courses that run throughout the academic year, or one semester courses run in the second semester. Students who do not pass examinations are able to re-sit in September.

353

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In some cases, professors may choose to set various evaluative activities (exams, projects, etc.) throughout the year which, if successfully completed, can replace the final examination. Grading system (Wikipedia: academic grading in Spain, n. y.): In Spain, the grading system used in higher education is: 10 with distinction: "Matrcula de Honor". (The number of students eligible for this grade is usually limited by statute to less than 5% for a given assessment, or, in small groups, to 1 student in 20. 9-10: "Sobresaliente" ("outstanding"). 7-8.9: "Notable" ("very good"). 5-6.9: "Aprobado" ("pass"). 0-4.9: "Suspenso" ("fail"). Number of students: During the academic year 2009/10 1,412,472 students enrolled in university studies degree and first and second cycle, which accounted for 1.5% more than in the previous year. (www.ine.es) Bologna process: In Spain the system to adapt to the Bologna process had the same structure as in other countries (like Slovenia), only that its implementation was the later. The Spanish legislation for the new university cycles was not established until October 2007, being implemented throughout the country during 2010/2011.

2.1.2 Higher education system in Slovenia Tertiary education in Slovenia comprises higher vocational college education and higher academic and professional education. The higher education can be offered by public or private institutions and by single higher education (samostojni visokoolski zavodi). In Slovenia, we can find several types of higher education institutions: universities, faculties, art academies and independent higher education institutions (samostojni visokoolski zavodi). All of them can be established by the State, Parliament or by native or foreign organisations and individuals (CMEPIUS, 2011,4). Organisation of studies in Slovenia (CMEPIUS, 2011,4): Academic year: In Slovenia the academic year begins in October and lasts until the end of September in the following year. It is divided into two semesters: the winter semester usually runs from October to January and the summer semester from February to the middle of July. Methods of teaching: Higher education institutions use different teaching methods lectures, seminars, exercises, colloquia and written assignments. Grading system: In Slovenia the grading system used in higher education is unified: 10 = excellent (percentage of knowledge: 91 100 %), 9 = very good (81 90 %),

354

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

8 = very good (71 80 %), 7 = good (61 70 %), 6 = satisfactory (51 60 %), 5 - 1 = fail (less than 51 %). Number of students: The number of highly educated people in Slovenia has increased. Statistics show that the number of students has more than tripled since 1991. The share of higher education students per thousand inhabitants has risen from 19.1% in 1991 to 41.1% in 2005.

Table 1: Number of enrolled students in Slovenia No. Of Enrolled Students Academic year Undergraduate Postgraduate 1991/92 2005/06 2009/10 36.504 73.967 98.973 1.647 8.344 15.900 Total 38.151 82.311 114.873

Source: Statistical Office of the Republic of Slovenia Bologna process: Slovenia joined the Bologna process upon signing the Bologna Declaration in 1999. A degree system based on three main cycles has existed in the Slovenian higher education system since the 1960s but the length and the structure of studies did not correspond with the Bologna guidelines; therefore, in 2004, a new structure of higher education studies was introduced. Like some other EU countries, Slovenia decided to gradually implement the Bologna reforms, so that by the 2009/10 academic year only the so-called postreform study programmes will be offered. Until then, the Slovene higher education institutions will offer both, pre- and post-reform study programmes. The last opportunity students will have to enrol in pre-reform study programmes is the 2008/09 academic year and they will have to finish their studies by 2015/16 at the latest. Once new study programmes are adopted, they will gradually replace the existing pre-reform study programmes. The first new study programmes started in the 2005/06 academic year. Internationalization in Spain and Slovenia

2.2

The academic mobility is essential for internationalization in higher education in EU. In fact, it could be considered the fundamental core on which inspire all actions considered in the EHEA (European Higher Education Area). For years there are numerous student exchange programs but the process of internationalization and globalization in the

355

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

European higher education began to grow from the creation of Erasmus programme. In addition, we are going to compare student mobility (incoming and outcoming). (Cuestin Universitaria, 7.2011, pp. 32-39) Table 2. Erasmus students SPAIN (outgoing-incoming)

Source: European Comision Erasmus Statistics 2000-2010 Table 2 shows we can see how Spain for first year already had many Erasmus incoming and outcoming students. During 2009/2010 Spain was the country that welcomed foreign students and one of the more students exported to other Member States. In that year Spain was the preferred place for international students and received more than 35,000 incoming students under the Erasmus program. Similarly, in the same year most students enjoyed the financial public support for studying abroad. Table 3. Erasmus students SLOVENIA (outgoing-incoming)

Source: European Comision Erasmus Statistics 2000-2010 In contrast, in Slovenia in academic year 2000/01 there were a few Erasmus students. In 2009/10 there were less than two thousand students in exchange programme, although their numbers have increased since 2000/01. During academic year 2009/2010 Slovenia had 1368 outgoing Erasmus students and 1271 incoming Erasmus students. The vast majority of students belong to the countries of the former Yugoslavia, mainly due to historical and cultural connection, as well as linguistic affinity. Foreign students account for 10 percent of doctoral studies, confirming the quality of graduate studies in Slovenia. (The Official Travel Guide by Slovenian Tourist Board, n.y) In the figure below we can see how Spain is a leader in both outgoing and incoming students in EU. France, Germany, United Kingdom and Italy, the most important countries of Erasmus students, have less incoming or outgoing than Spain. While Slovenia does not even reach the 2000 Erasmus students. But the numbers of students both outgoing and incoming students in Slovenia are in balance.

356

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1. Incoming (green) and Outgoing (blue) students

Source: European Comision Erasmus Statistics 2000/10 SI: Slovenia; ES: Spain

To compare these countries we should also have account several factor such as geography situation, language and weather because these characteristics influence in students to choose the perfect place. Spain is located in south of Europe and it includes the Balearic Islands and Canary Islands, it is a big country. While Slovenia is in the center and it is a small country. Slovenia is in a strategic area because it borders Austria, Croatia, Hungary and the Adriatic sea, so foreign students will be able to visit all of them. (Wikipedia: Geography of Spain, n.y.; Geography of Slovenia, n.y.) Spain is surrounded by beaches. Normally the weather is nice, reaching high temperatures in summer and not too low in winter. The weather in Slovenia is rather extreme, very hot in summer and quite cold in winter. For people who love skiing, the best place is undoubtedly Slovenia and for those who like water sports, the appropriate country is Spain if you choose an island or a town near the coast. (Wikipedia: Climate of Spain, n.y.; Climate of Slovenia, n.y.) The official language in Spain is Spanish and in Slovenia it is Slovenian language. Its more difficult to learn Slovenian language than Spanish language. The English level is higher in Slovenia than Spain. The most Spanish people do not know English language while Slovenian people can speak English although it is no perfect. So English language in Spain is a problem for the country but it allows to foreign people to learn quickly the Spanish because they will also have regular classes in Spanish language. (Wikipedia: Spanish language, n.y.; Slovenian language, n.y.)

357

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

So Spain is not only a major seaside destination for tourists from around the world, it is also one of the favorite destinations. However, Slovenia is no a popular country to exchange students. But I think Slovenia will be able to increase the level of incoming and outgoing students. Slovenia should attract the attention of foreign people due to the mobility is very important for country and for people too because the mobility is an opportunity for personal development, to know new cultures, to improve language learning, to enhance the sense of European identity and to encourage independent thinking and innovative. (European Comission Statistics, 2009-2010) 3 INTERNATIONAL COMPARISON

3.1 Finland 3.1.1 General information about higher education system in Finland The characteristic appearance of Finnish higher education is that it presents a binary structure formed by universities and polytechnic institutions, each with its profile, objectives and specific ethos. With respect to access to higher education we must emphasize that the National Matriculation Examination allows admission to higher education in Finland; they can also access, students who have completed upper secondary education professional cut. The requirement admission to polytechnic institutions, meanwhile, stands at the prior approval any of the two routes of upper secondary education. Additionally, these institutions value the work experience and, on numerous occasions, made entrance exams. On the other hand, university degrees, and adapted to European higher education system, are encrypted in the first degree Degree, Bachelor, which can be obtained after three university courses and assumed the completion of 180 credits ECTS in Graduate second degree, Master, which corresponds to two years of study and 120 ECTS credits, and finally, in the final degree of Doctor. For its part, the degree system of polytechnic institutions comprising a first cycle to be completed in three or four years, corresponding to 180-240 ECTS credits, depending on field of study. Similarly, this system has a second cycle degree, corresponding to 60-90 ECTS and contains an additional year of full-time study (Minedu, n. y.). 3.1.2 Internationalization in Finland In Finland, student exchanges and international traineeships have become more and more popular. In 2009, almost 9,400 Finnish students headed abroad on an exchange or traineeship for at least 3 months. At the same time, almost 8,800 international exchange students or trainees came to Finland.

358

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Almost half (48%) of all outgoing exchanges and traineeships take place through the European Unions Erasmus programme. The corresponding figure is 74% in incoming mobility. The biggest host countries for outgoing Finnish students are Germany, Spain, the United Kingdom and Sweden, while the biggest countries of origin of incoming students are Germany, France, Spain and Italy. Asian countries are becoming increasingly important partners of student exchanges and internships. China, Thailand, Malaysia and Japan are already big target countries for Finnish students, and China and South Korea are major countries of origin for incoming students. (Study in finland, n. y.) 3.2 United Kingdom 3.2.1 General information about higher education system in UK Students normally enter university from age 18 onwards, and study for an academic degree. Historically, all undergraduate education outside the private University of Buckingham and BPP University College was largely state-financed, with a small contribution from top-up fees, however fees of up to 9,000 per annum will be charged from October 2012. There is a distinct hierarchy among universities, with the Russell Group containing most of the country's more prestigious, research-led and researchfocused universities. The state does not control university syllabuses, but it does influence admission procedures through the Office for Fair Access (OfFA), which approves and monitors access agreements to safeguard and promote fair access to higher education. Unlike most degrees, the state still has control over teacher training courses, and uses its Ofsted inspectors to maintain standards. 3.2.2 Internationalization in UK Globally, the UK is the second largest destination for students studying abroad, behind only the USA. The Government told us that during the period 2009/10, there were approximately 406,000 foreign students studying at universities in the United Kingdom while the number of UK students studying abroad was only about 33,000.A study of British secondary school pupils intending to study abroad showed that the majority preference was for North American universities (56.5 per cent) rather than European ones (21.8 per cent). The British Council is the designated national agency for Erasmus in the United Kingdom and works closely with the Government regarding the operation of the programme. During the period 2010/11, they told us that there were 12,873 UK Erasmus participants, the highest number since the programme started in 1987.The

359

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

increase in participation seems to be, in part, due to the inclusion of work placements in the Erasmus programme since 2007, which many of our witnesses considered to be a positive step. However, as we have already noted, outward mobility from comparator countries including France, Germany and Spain is still approximately three times that of the United Kingdom and, as a result, the United Kingdom is a substantial net receiver of Erasmus students from elsewhere in the EU. Regarding possible reasons for British students' continued reluctance to participate in mobility programmes, the 28% of students decided not to study abroad because of uncertainty about language; 11% were unaware that opportunities were there at all and did not know that they could do it; and 37% cited financial implications. The growing trend of using English as the dominant language in the academic world, as well as in the EU institutions, should not encourage the United Kingdom to be unconcerned about the opportunities and benefits presented by learning and working in another language. The United Kingdom has already fallen behind in language-learning capability. If this is not reversed it will not only threaten its ability to participate fully in EU programmes such as Erasmus but will also severely hamper individuals' employability and the country's competitiveness within the Single Market and beyond. 3.3 Morocco 3.3.1 General information about higher education system in Morocco Morocco has made significant strides in education over the past decades. The Government allocates about 26% of its annual budget for education. The education system in Morocco has undergone several reform and unification programmes in an effort to reduce regional differences in quality and standards, and to ensure universal access to education throughout the country. In 1963, education became compulsory for Moroccan children. The higher education system consists of both private and public institutes. There are 14 public universities in Morocco, in addition to a large number of private universities. Admission to public universities requires only baccalaureate, whereas admission to other higher public education, such as, engineering school require competitive special tests and special training before the exams. (Wikipedia, Education in Morocco, n. y.) Morocco carried out its university reforms since September 2003. And now the system of higher education in Morocco is divided into three cycles: - Bachelor cycle. - Master cycle. - Doctoral cycle.

360

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

So the Bologna cycle structure is fully implemented in all or most study fields because universities have a three-cycle structure. Moreover, higher education in Morocco has also implemented the European Credit Transfer System (ECTS). Statistics for the academic year 2008/2009 show a total of 320 institutions of higher education, of which 142 were public and 178 private. These institutions had a total of 339 044 students, distributed as follows: 308 503 in the public institutions and 30 541 receiving private higher education. 3.3.2 Internationalization in Morocco Morocco has participated in the Tempus programme since 2002. TEMPUS is a European Community programme designed to help the process of social and economic reform in the Partner Countries of the Western Balkans, Eastern Europe, Central Asia, North Africa and the Middle East. Cooperation with European universities has helped in the implementation of the reform of higher education in Morocco. The Tempus programme lent powerful impetus to the preparation of new curricula and to the introduction of new forms of governance and evaluation. The Arab States have 177 000 international students. Half comes from Algeria, Morocco and Tunisia. This region experienced the largest increase in student mobility between 1999 and 2004, with a rate of mobility to the stranger who rose from 2.3% to 2.9%. Mauritania, Morocco and Qatar also have high mobility rates to foreign countries: 22%, 15% and 13% respectively. Two out of three international students studying in the Arab States in Western Europe and another 12% goes to North America. In Morocco, the mobility rate to 15% abroad. The five destinations for Moroccan students are France, Germany, Belgium, USA, Netherlands. Morocco also receives students from abroad around 6000, said UNESCO in 2006. About 13% remains in the region, representing the second lowest share. Within the region, Jordan is the main destination and receives about 13 500 students from other Arab states. 3.4 Egypt 3.4.1 General information about higher education system in Egypt The higher education system offers two types of undergraduate degrees: bachelors (bachelors of arts and bachelors of science) and diplomas. The bachelors degree is awarded by public and private universities after four, five or six year programmes (or their equivalent in private higher institutes). The diploma (mainly called vocational qualifications) is granted after a two-year degree programme in a technical college or private middle institute. In addition, the public higher education system also grants diplomas, masters (MA and MSc) and PhD degrees after fulfilling the requirements of

361

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

different postgraduate programmes. However, there is a mismatch between the number of students who are enrolled in the two types of degrees: 93.5% of those enrolled are studying for a bachelor degree, while only 6.5% are studying for a diploma. A major drawback of the HE system is that, apart from individual efforts in some institutes, the Ministry of Higher Education (MoHE) does not have a national framework for increasing the international relevance and competitiveness of its higher education system. Neither is there any link with major global structural reform processes, such as the Bologna Process adopted by the European Union which relates to three levels: bachelor degrees (three years), postgraduate masters degrees (two years) and PhDs (three years). 3.4.2 Internationalization in Egypt It is evident that Egypt is trying to improve all aspects of internationalization in its higher education system, especially in trying to meet international standards of quality and in order to increase the potential of human capital. Egyptian faculty members can travel overseas both for short and long exchanges, which can take the form of either post-doctoral missions/grants, visiting professors or long-term sabbatical leave, and short-term participation in conferences, training and other forms of capacity development. Most overseas students in Egypt are from the Arab world. Similarly, foreign professors and experts contribute to different activities in Egypts higher education sector. The majority is from the US and UK and they usually come to Egypt as trainers. The total number of Egyptian undergraduate students studying abroad through government missions is 3 289, distributed as shown in Figure 2. Figure 2. Distribution of Egyptian students studying abroad

The figure shows the distribution of the number of graduate students, representing the faculty assistants in public universities, is highest in North America and Europe, while the distribution of undergraduate students is highest in the Arab world, possibly because they are residing with their families.

362

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSION

After analyzing these four countries, we can say that Finland is known for its good educational system. However, international mobility is not a frequent destination for students, this country ranks number 40 as destinations for study abroad. Meanwhile, the UK ranks second in this ranking, since it is one of the most chosen destination for the continuation of their studies. One reason is the expansion of English as the universal language. But for the same reason, students in the United Kingdom did not study abroad because they are not motivated by the need to learn another language. As Euro Med countries, both Morocco and Egypt are trying to improve all aspects of internationalization in higher education system, most foreign students who come to these countries are Arabic world. Finally, Spain is one of the leading countries in terms of international mobility, both outgoing and incoming students, and while in Slovenia the number does not reach such important level of foreign students.

363

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCES

CEMPIUS, Centre of The Republic of Slovenia for Mobility and European Education and Training Programmes (2011), Higher Education in Slovenia [online] Available at http://www.mfdps.si/Files///MHEST%20CMEPIUS%20HE%20in%20SI.pdf Cifras clave de la Educacin (2007) [online] Available at http://eacea.ec.europa.eu/education/eurydice/documents/key_data_series/088ES.pdf Consejera de Educacin de la Cominidad de Madrid (2009). Estudio comparativo de la educacin: Finlandia y Comunidad de Madrid. Anlisis y Recomendaciones. Madrid: M-50. -2009. [online] Available at http://www.doredin.mec.es/documentos/01420102008363.pdf Education in Morocco (n. y.). [Online] Available at http://en.wikipedia.org/wiki/Education_in_Morocco Wikipedia. Egyptian Universities (n. y.). [online] Available at http://en.wikipedia.org/wiki/Egyptian_universities Erasmus Statistics (n. y.). [Online] Available at http://ec.europa.eu/education/erasmus/doc/stat/0910/report.pdf Financiacin de las Universidades (n. y.). [online] Available at http://www.financiacionfacil.es/financiacion-universitaria/ Higher Education in Egypt. Country Review Report (n. y.). [online] Available at http://mhespu.org/new/admin/uploads/resources/Higher%20Education%20in%20Egypt%20Count Co%20Review%20Report2010051910025220101011084324.pdf Higher Education in Morocco. (n. y.). [Online] Available at http://eacea.ec.europa.eu/tempus/participating_countries/morocco_en.php#surveys Instituto Nacional de Estadstica (INE), Estadstica de la Ensanza Universitaria en Espaa (2009/2010) [online] Available at http://www.ine.es/prensa/np655.pdf International Students across the Globle (n. y.). [online] http://www.theaustralian.com.au/higher-education/student-migration-map La financiacin de la universidad espaola (n. y.). [online] Available at http://www.fundacionfaes.org/record_file/filename/549/00251-05__la_financiacion_de_la_universidad_espa_ola.pdf La internacionalizacin Universitaria, pp. de estudiantes 32-39 universitarios [Online] (2011). Cuestin Available at

364

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

http://www.lacuestionuniversitaria.upm.es/web/grafica/articulos/imgs_boletin_7/pdfs/L CU-7-4.pdf?PHPSESSID=pm8cvgo6ta7f9k4s8e2jih1kv6 Ministerio de Educacin, Cultura y Deporte (n. y.). [online] Availabe at http://www.educacion.gob.es/eu2015/prensa/2011/junio/erasmus Ministry of Education, Finland. Education and Science in Finland (n. y.). [online] Available at http://www.minedu.fi/export/sites/default/OPM/Julkaisut/2006/liitteet/eng_opm15.pdf Mora, J. G. (1997a). Market trends in Spanish higher education, Higher Education Policy, 10, 3/4, 187-198. Mora, J. G. (1997b). Equity in Spanish higher education, Higher Education, 33, 3, 233-249. Mora J. G. y Garca-Aracil, A. (1999). Private Costs of Higher Education in Spain, European Journal of Education, 34, 2, 95-110. News bbc (n. y.). [online] Available at http://news.bbc.co.uk/2/hi/uk_news/education/8271287.stm OECD (2011). OECD Economics Surveys: Slovenia 2011, OECD Publishing [online] Available at http://dx.doi.org/10.1787/eco_surveys-sun-2011-en OCDE (2000). Education at a Glance. OCDE, Pars. Panorama de la educacin. Indicadores de la OECD (2011). [online] Available at http://www.educacion.gob.es/dctm/ministerio/horizontales/prensa/documentos/2011/09/ informe-espanol-panorama-de-la-educacion-2011.pdf?documentId=0901e72b80ebfbb1 Parliament, United Kingdom (n. y.). [online] Available at http://www.publications.parliament.uk/pa/ld201012/ldselect/ldeucom/275/27507.htm Qrossroads, Higher Education in Europe (Spain) (n. y.). [online]. Available at http://www.qrossroads.eu/higher-education-in-europe/spain-66 Slovenia, Wikipedia (n. y.). [Online] Available at http://es.wikipedia.org/wiki/Eslovenia. Spain, Wikipedia (n. y.). [Online] Available at http://es.wikipedia.org/wiki/Espaa. Spain is leader as target Erasmus. Pblico.es (2011). [Online] Available at http://www.publico.es/380449/espana-lider-como-destino-erasmus. Stadisitcs of mobility in Morocco (n. y.). [Online] Available at http://www.uis.unesco.org/Library/Documents/ged06_es.pdf

365

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Study in Finland (n. y.). [online] Available at http://www.studyinfinland.fi/front_page_news/101/0/more_foreign_students_than_ever _in_finnish_higher_education_institutions_3 Studying in Slovenia (n. y.). [Online] Available at http://www.slovenia.info/es/Estudiar-en-Eslovenia.htm?studij_v_sloveniji=0&lng=7 Study in Spain (n. y.). [online] Available at http://www.tostudyinspain.com/spanishuniversity-system/ Wikipedia, Academic grading in Spain (n. y.). [online] Available at http://en.wikipedia.org/wiki/Academic_grading_in_Spain Wikipedia, Education in England (n. y.). online] Available at http://en.wikipedia.org/wiki/Education_in_England#Higher_education

366

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

LE VOILE ISLAMIQUE DANS LESPACE EUROPEN UNE FAUSSE QUESTION Juliana Santos, University Fernando Pessoa, Portugal 24566@ufp.edu.pt

RSUM

La question du voile islamique de corps entier est trs actuelle, non consensuelle et est sur la table en Europe plus que jamais. C'est pour cela qu'il est important de se plonger dans la question et de comprendre ce qu'il y a derrire. Il faut compreendre pourquoi le voile islamique dans l'espace europen est en ralit une fausse question. Trois arguments sont ici utiliss en vue de clarifier la question et ainsi montrer que: d'abord, l'augmentation du nombre de musulmans est directement li la question lgislative de l'interdiction de la voile dans l'espace publique; ensuite, le groupe cible de l'interdiction du voile est insignifiant critre de la minorit; enfin, en visant cette interdiction, on dtourne l'attention des cas de vraie violence contre les femmes. L'interdiction du voile islamique dans l'espace public semble tre effectivement une vague contagieuse qui a frapp l'Europe aprs le 11 septembre. En regardant les projections pour 2030, on comprend que l'Europe a peur d'accueillir l'Islam comme religion europenne, ce qui est pourtant dj une ralit.

Mots-cls: voile, projection, minorit, Islam, Europe

367

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

L'interdiction du voile islamique semble tre une vague contagieuse qui a frapp l'Europe aprs le 11 septembre, au moment o le terrorisme est un thme tellement en vogue et que l'Islam est tellement prsent dans les mdias partout dans le monde. Peut-on dire que la France a ouvert un dangereux prcdent ? De faon rpondre la question-problme qui se pose dans cet article, trois arguments seront poss sur table. On souhaitera avec cet article ajouter un point de plus la connaissance de cette question, et dsirons surtout susciter chez le lecteur une rflexion critique.

POURQUOI LA QUESTION DU VOILE ISLAMIQUE DANS L'ESPACE

EUROPEN EST-ELLE UNE FAUSSE QUESTION?

Il y a trois arguments pour justifier que la question du voile islamique dans l'espace europen est une fausse question, arguments que l'on dveloppera : 2.1. Premier argument: La prvision 1 d'une augmentation leve du nombre de musulmans en 2030 est directement lie la question lgislative de l'interdiction du voile dans l'espace public.

La population musulmane au sein de la population europenne devra augmenter de 5,8% (2010) 7,8% (2030). Sachant ceci, le cadre suivant montre quels sont les pays qui connaitront le plus grand accroissement de population de religion musulmane. 2

Ces projections sont bases sur les nouvelles naissances et les immigrants ainsi que les dcs et les immigrants. Ces calculs ont t effectus par les dmographes du Forum Pew, qui ont collabor avec des chercheurs de l'Institut international pour analyse des systmes appliqus (IIASA) en Autriche sur les projections pour les tats-Unis et les pays europens. 2 Les estimations sont en milliers. Les chiffres peuvent ne pas correspondre exactement cause de l'arrondissement.

368

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Pays

Royaume-Uni Russie France Italie Allemagne Espagne Sude Belgique Pays-Bas Autriche

Estimation de la population musulmane 2010 2.869.000 16.379.000 4.704.000 1.583.000 4.119.000 1.021.000 451.000 638.000 914.000 475.000

Estimation de la population musulmane 2030 5.567.000 18.556.000 6.868.000 3.199.000 5.545.000 1.859.000 993.000 1.149.000 1.365.000 799.000

Augmentation numrique projete 2010-2030 2.698.000 2.177.000 2.156.000 1.617.000 1.426.000 838.000 542.000 511.000 451.000 324.000

Source: The Pew Forum on Religion & Public Life: The Future of the Global Muslim Population, janvier 2011.

La pourcentage de musulmans par rapport au total de la population des pays europens (exclura la Russie de cette slection) sera en 2030 dans l'ordre dcroissant suivant:

- 5%-10% en France, Allemagne, Sude, Autriche, Belgique, Pays-Bas; - 4%-5% (Royaume-Uni); - 2%-4% (Italie, Espagne).

Cependant, il faut faire attention au fait que les pays o la population musulmane tend augmenter sont trs actifs en terme de discours et mme lgislativement dans l'interdition du voile islamique de corps entier dans les lieux publics.

2.1.1

France, Allemagne, Sude, Autriche, Belgique et Pays-Bas: 5%-10%

En France, la loi est entre en vigueur le 11 avril 2011. Les amendes infliges aux transgresseurs seront de 150 et/ou d'une mesure de citoyennet. Toutefois, les sanctions seront vu au cas par cas, les cas les plus graves sont ceux dans lesquels la femme est oblige de porter la burqa ou niqab. Cela correspondrait une amende d'environ 15.000 et/ou un an d'emprisonnement du responsable. L'interdiction est officiellement appel "Projet de loi interdisant la dissimulation du visage dans lespace public".

369

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Les femmes vtues de la burqa ou niqabs sont interdites d'entrer dans les services publics comme les hpitaux ou les autobus, parce que la loi rend illgal le fait qu'elles couvrent leurs visages dans les lieux publics franais, quelques exceptions prt 3.

La loi ne se rfre ni l'islam, ni au voile. Les fonctionnaires insistent que la loi contre les lments couvrant le visage n'est pas discriminatoire, car elle s'appliquerait tout le monde, pas seulement les musulmans. Pourtant, ils citent une foule d'exceptions, y compris les casques de moto, ou des masques pour des raisons de sant, l'escrime, le ski ou les carnavals.

En Allemagne, mme en n'ayant pas une interdiction de jure, le Ministre Fdral des Transports a confirm qu'il y a une interdiction de facto dj en place sur la conduite des vhicules automobiles. Les tats ont l'autonomie ncessaire pour changer leurs lois localement.

En Sude, le Premier Ministre Fredrik Reinfeldt, le partenaire de la coalition du Parti du Centre et le leader de l'opposition Mona Sahlin aussi ont rejet l'ide dune interdition.

En Autriche, 7 sur 10 personnes veulent une loi anti-burqa, selon un sondage de l'agence viennoise de l'opinion publique Karmasin.

En Belgique, la loi est entre en vigueur en 23 juillet 2011. Avant que la loi ne soit adopte, la burqa a t dj interdite dans plusieurs districts sous les anciennes lois locales conus l'origine pour empcher les gens de masquer leurs visages compltement l'poque du carnaval.

Au Pays-Bas, la loi est entre en vigueur en 27 janvier 2012. Les amendes pour port de la burqa en public pourrait aller jusqu' 380 euros.

Les exceptions sont les suivantes : - Ou prescrits ou autoriss (par exemple, casque de vlo); - Pour des raisons de sant (par exemple, des masques contre la grippe); - Pour des raisons professionnelles (par exemple, pendant l'enlvement de l'amiante); - Pour des raisons sportives (par exemple, l'escrime); - Pour des raisons culturelles ou festives (par exemple, pendant le carnaval).

370

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.1.2

Royaume-Uni: 4%-5%

Au Royaume-Uni, il n'y a pas d'interdiction, mais les coles sont autorises se forger leur propre code vestimentaire aprs une directive de 2007 qui a suivi plusieurs affaires judiciaires trs mdiatises. En plus, un sondage en 2011 a indiqu que 66% de la population soutient l'interdiction.

2.1.3

Italie et Espagne: 2%-4%.

En Italie, le projet de loi a t approuv par une commission parlementaire le 2 aot 2011, mais attend encore l'approbation du Parlement.

En Espagne, bien qu'il n'existe pas de plans pour une interdiction nationale, la ville de Barcelone a annonc une interdiction dans certains espaces publics, comme les bureaux municipaux, les marchs publics et les bibliothques.

2.2. Deuxime argument: La proportion des femmes qui portent la voile par nombre de musulmans sur le pays est trs basse - critre de la minorit.

Voyons les quatre cas suivants:

En France, de 5 millions de musulmans, seulement 2.000 femmes sont cibles par cette loi, ce qui reprsente 0,00319% de la population entire du pays.

En Belgique, de 638 mil musulmans (ce qui correspond 6% du total de la population belge), seulement 30 sont cibls par cette loi, soit 0,00028% de la population.

Tant en Autriche qu'en Italie, il n'y a pas de chiffres oficiels sur combien de femmes sont cibles par cette loi. "Dans mes 20 ans en Italie, je ne pense pas que j'ai vu une dizaine de femmes qui portent le voile, explique Izzeddin Elzir, le directeur de l'Union des communauts islamiques en Italie (UCOII), l'organisation musulmane la plus grande du pays. Selon Elzir, la plupart des musulmans en Italie ont adopt une cole de l'Islam qui ne ncessite pas que les femmes gardent leur visage couvert. "En t, il y en a plus, car il y a

371

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

beaucoup de touristes [en provenance des pays arabes]," dit-il. "Mais ici, en Italie, nous voyons peine des cas comme a".

2.3. Troisime argument: Contrairement aux arguments prsents par les uns pour l'interdiction, pnaliser les femmes qui portent la burqa ne les librent pas; c'est plutt l'inverse. Voyons ci-dessous trois raisons:

D'abord, l'augmentation de l'islamophobie. Dans tous cas, les coles de droit islamique maliquite et hanafite, dont la majorit des musulmans en Europe proviennent, ne voient pas le voile comme une obligation de l'Islam. L'utilisation du voile est une coutume qui apporte des complments la loi islamique, en une matire qui n'tait pas rglemente. En outre, la coutume n'est pas contraignante.

En ce qui concerne la burqa, elle n'a aucune place dans l'Islam et serait mme une coutume traditionelle pr-islamique qui a t "ressuscite" il y a vingt ans et entre dans les moeurs sous linfluence des Talibans.

Ensuite, Il faut que les gouvernements protgent les droits de lHomme des femmes voiles. L'Assemble parlementaire du Conseil de l'Europe a publi une recommendation (1927/2010) sur "L'islam, l'islamisme et l'islamophobie en Europe." Dans sa section 3.13, lAssemble demande au Comit des Ministres "dinviter les Etats membres ne pas adopter une interdiction gnrale du port du voile intgral ou dautres tenues religieuses ou particulires, mais protger les femmes contre toute violence physique et psychologique ainsi que leur libre choix de porter ou non une tenue religieuse ou particulire, et de veiller ce que les femmes musulmanes aient les mmes possibilits de prendre part la vie publique et dexercer des activits ducatives et professionnelles; les restrictions lgales imposes cette libert peuvent tre justifies lorsquelles savrent ncessaires dans une socit dmocratique, notamment pour des raisons de scurit ou lorsque les fonctions publiques ou professionnelles dune personne lui imposent de faire preuve de neutralit religieuse ou de montrer son visage".

Enfin, avec cette interdiction, on dtourne l'attention des cas de vraie violence.

372

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Selon M. Zajam, en 2008, 157 femmes ont t tues par leurs maris ou partenaires en France. En 2007, ce chiffre tait de 166, et 410 mil femmes qui ont dclar avoir souffert de violence domestique par leur partenaire. Il faut enfin toujours garder l'esprit que l'Islam est une religion europenne aussi.

CONCLUSION

L'interdiction du voile islamique dans l'espace publique semble tre effectivement tre une vague contagieuse qui a frapp l'Europe aprs le 11 septembre. Les gouvernements semblent suivrent le parcours d'autres pays voisins, notamment la France, le premier pays en Europe o est entre en vigueur une loi portant sur cette interdiction, suivi par la Belgique et les PaysBas. L'Allemagne, l'Italie et l'Espagne font preuve d'une interdiction de facto dj en place. Le dbat a secou la classe politique en Sude, qui a rejett l'ide dinterdiction, ainsi que la classe politique et l'opinion publique au Royaume-Uni et en Autriche.

On justifie le premier argument de cette fausse question par le fait que les pays o la population musulmane tend augmenter sont trs actifs en terme de discours et mme de legislation prvoyant l'interdition du voile islamique de corps entier dans les lieux publics, comme nonc plus haut. Par rapport au deuxime argument, le critre de la minorit s'applique tout au moins en France, en Belgique, en Autriche et en Italie. Le nombre des femmes cibles par l'nterdition est vraiment bas ou encore inconnu. Le troisime argument soutient que, contrairement aux arguments prsents par certains pour l'interdiction, pnaliser les femmes qui portent la burqa ne les librent pas; c'est plutt l'inverse si on considre l'augmentation de l'islamophobie, de la restriction des droits de lHomme des femmes voiles par les gouvernements comme rsultat de linterdiction, et du dtournement de l'attention des cas de vraie violence contre les femmes qui existent dans ces pays. Nous tenons souligner l'ide que la situation tudie ici n'aspire pas tre exhaustive de la comprhension du phnomne qui se vit en Europe. Il y a plusieurs autres pays europens qui subissent les consquences des mesures prises par la France, et qui peuvent donner lieu une tude plus opportune.

373

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Assemble Nationale (France). 2010. "Projet de loi interdisant la dissimulation du visage dans lespace public." Conseil de l'Europe (Assemble Parlementaire). 2010. "Recommendation 1927: Islam, Islamism and Islamophobia in Europe." Davies, L. 2010. "France: Senate Votes for Muslim Face Veil Ban." Guardian.co.uk. Faris, S. 2011. "In the Burqa Ban, Italy's Left and Right Find Something to Agree On." Time, 4 aot. McPhee, S. 2005. "Muslim Identity: The European Context." Sussex Migration, September. The The Pew Forum on Religion & Public Life. S/D. "The Future of the Global Muslim Population: An Interactive Feature." The Pew Forum on Religion & Public Life, http://features.pewforum.org/muslim-population-graphic/ - /Europe Ren, D. 1978. Os Grandes Sistemas do Direito Contemporneo. 2 ed. Lisboa: Editora Meridiano. S/A. 2012. "Kabinet Stemt in Met Boerkaverbod Wet Met Veel Haken En Ogen." nrc.nl S/A. 2011. "Seven in 10 Back Burka Ban." Austrian Independent. S/A. 2011. "The Islamic Veil across Europe." bbc.co.uk S/A. 2006. "Keine Burka Hinterm Steuer." netzeitung.de The Pew Research Center. 2011. "The Future of the Global Muslim Population: Projections for 2010-2030." Pew Research Center. The Pew Forum on Religion & Public Life. 2011. "Religion in the News: Islam and Politics Dominate Religion Coverage in 2011." The Pew Forum on Religion & Public Life, http://www.pewforum.org/Government/Religion-in-the-News--Islam-and-PoliticsDominate-Religion-Coverage-in-2011.aspx. Thompson, H. 2011. "Two Thirds Brits Want Burqa Ban." YouGov, http://labs.yougov.co.uk/news/2011/04/14/two-thirds-brits-want-burqa-ban/. Zajam, M. 2010. "Burqa Ban: What It Means for the West." TwoCircles.net.

374

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MECHANISATION AND HUMAN INTERVENTION IN TRANSLATION: EVALUATION OF A MACHINE TRANSLATION OF AN ADMINISTRATIVE DOCUMENT OF THE A.U.TH. Valentini Santa, Aristotle University of Thessaloniki, Greece Email valentini.santa@gmail.com ABSTRACT When, in the 17th century, Descartes and Leibniz submitted their proposals for universal numeric codes linking words between languages, they could not have assumed that those were the first steps of the modern science of Computational Linguistics. Even in the mid 1950s, in the Georgetown-IBM experiment, when the utility of this experiment was found inadequate, no one could have predicted the rapid evolution of Machine Translation (MM) a few decades later. On the contrary, this sector is of increasing interest as it is associated with the financial management of the pre-translational process. The overriding issue raised today is whether the mechanized translation systems can meet the increased demands in translation with minimal human intervention, particularly when they leave the range of mere phraseology and deal with technical or specialized texts. In this question we will try to give an empirical answer through the evaluation of the translation of an administrative document using machine translation, juxtaposing the final product of the PM with the final translation derived with human assistance (HAMT-HumanAssisted Machine Translation). Primarily, the points of compatibility and divergence between the two translations will be identified, taking as a point of reference the need of the reader, native or not speaker of the target language, to understand the information in this specific administrative document. Finally, the points of divergence will be classified, on the basis of the areas which, according to the linguists, are the structure behind translation: Phonetics and Phonology, Morphology, Syntax, Semantics and Pragmatics. Key words: Machine Translation (MT), Statistical Machine Translation (SMT), HumanAssisted Machine Translation (HAMT), Machine Translation Evaluation, Translation Errors

375

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

The origins of this paper lie in the assignment to the author to correct the product that came from the MT to the English language of an administrative document, the Regulation on the conclusion of Bilateral Agreements of Scientific Collaboration of the A.U.Th. with foreign congener Universities or equivalent Institutions of Higher Education. During the correction, it was obvious that the regulation had to be read in the original language of the text, the Greek version, as the final result of the MT was quite obscure in many points and confusing in others. After several corrections derived either from conscious awareness of the language by the translator-editor or the cross-reference and documentation of the terminology used in the compilation of this administrative document, we got to the final text which can be characterized as an HAMT product, i.e. Human Aided Machine Translation. 2 2.1 THE MACHINE TRANSLATOR THE PRODUCT The translation tool The Machine Translator

The translation which the author was asked to edit was the result of one of the most widely used machines of free of charge MT, appearing in the top ten among the preferences of thousands of internet users: the Google Translate. This machine is a statistical machine translation service. The statistical MT (SMT) is a model of MT in which translations are produced by statistical principles whose parameters derive from the analysis of parallel bilingual texts (Brown 1993). According to its manufacturers, when Google Translate generates a translation, it detects patterns in millions of documents, human translation products, in order to make the most intelligent guesses for the final result, what would be an appropriate translation. According to Hutchins (2010), the advantages of SMT are that these systems are developed quickly with relatively little data, while their performance tends to be at the same, and in some cases better, level as Rule-based Machine Translation (RBMT) systems, according to metrics such as the BLEU, NIST, METEOR, HTER, which offer the opportunity for researchers to monitor the efficiency of translation processes of various MT systems. 2.2 Examination- Analysis of the MT product

In this paper, we will try to focus on the irregularities that occurred during the MT of this administrative document and will attempt to categorize them with the aim to evaluate the system use. As mentioned by Kasapi (2002), translational errors are detected a) in the use of words, b) in the application of grammatical rules, and c) the performing of linguistic acts. Therefore, they are categorized into: a) lexical errors, b) syntactic errors, c) interpretive errors and d) factual errors.

376

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Below, we will mention some of the most indicative problems encountered by the author during the editing of the text. In order to draw better conclusions about the mistakes that are analyzed, we will assume that the original Greek text is the premise, the translation resulting from the human intervention is the hypothesis and the MT product is the reference (Pado 2009), simplifying the metric procedures used for the evaluation of MT systems within the human limits. Thus, we will reach the conclusions we need in order to categorize the most dominant mistakes. Example 1 HYPOTHESIS: The duration is defined in calendar years, to facilitate their financial management. REFERENCE: This time period specified in calendar years, to facilitate their economic management. period: specified: context economic: Example 2 HYPOTHESIS: The International Relations Committee (IRC) appoints a Coordinator for each Agreement. REFERENCE: For each agreement set by the International Relations Committee (CGC), a Coordinator. CGC: factual error, lack of reference to the specific operating body and its acronym set: Interpretive error, wrong verb to translate the appointment of a Coordinator and syntax error, omission of the introductory verb "be" used in the passive voice On the whole, the sentence follows a word-to-word translation creating a syntactic chaos, as the flexibility in Greek syntax does not allow a similar treatment in the English language. At the same time, it is more appropriate in this sentence to use active voice rather than passive. Example 3 HYPOTHESIS: The selection of Faculty Members who will participate in the specified by the Agreement visits is made every year. Interpretive error, we are looking for the "duration" syntactic error, omission of the introductory verb "be" used in the passive voice Interpretive error, the statistical system uses a word which does not match the lexical error, "economic" is a word that refers to the economic theory

377

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE: The choice of DEP to participate in procedures under the Agreement visits every year. DEP: factual error, the machine does not recognize the Greek acronym

choice: Interpretive error, this is about a selection that came from consultation processes On the whole, the sentence presents multiple syntactic errors but the main problem is the lack of a main verb and the various omissions. Example 4 HYPOTHESIS: If a member of the Committee IRC is also a Coordinator of an Agreement he does not take part in the evaluation process of the Committee for the Agreement in question. REFERENCE: If a member of ACI Committee Coordinator Agreement is far from the evaluation process of the Commission on the disguised Agreement. ACI: factual error, the machine does not recognize the Greek acronym

is far from: lexical error, the level of language, the exclusion from the proceedings, is not recognized Commission: Interpretive error, the machine makes the combination probably with the European Commission, which, statistically, occurs more often disguised: lexical error, the selection procedure of the word is obscure.

The MT product presents multiple problems on its whole. The most frequent ones are observed mainly in morphology, in syntax, in sentence level, and in idioms as well as ambiguities. The final product would be informative for a native speaker but would not solve the communicational needs of a non-native speaker. 3 EVALUATION OF THE MT PRODUCT

For the evaluation of the final product of the MT, we will use the scale established by Sofer (2006, 39-43), which rates the translators efficiency to a scale of 0 to 5. According to this scale and the criteria developed by Sofer for each level of the evaluation, this translation could be classified in level 2. In this level, the translation skill is sufficient for simple authentic material, uncomplicated and on familiar subjects in a predictable sequence. It may reproduce descriptive language for frequently occurring events, social announcements and simple technical material for the general reader. There are some misinterpretations and the reproduction of speech is limited to familiar sentence patterns. The vocabulary used is of an adequate level and has relatively good control of the language, its morphology, and the

378

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

most frequently used syntactic structures. The translation produced can be understood by a native speaker of the language, but not from a foreigner. We could not classify this translation in the 2 + level as it is considerably lower in several areas such as the personal reaction to the content, the good knowledge of grammar, the vocabulary proficiency, and the ease and flexibility in the translation process. On the other hand, the translator is typically classified in the 4 + level: he possesses an increased ability to translate using a vast vocabulary, understands idioms, everyday expressions and even slang. He has a strong sensitivity to sociolinguistic and cultural references and is able to maneuver in different circumstances and style according to the professional or educational needs. 4 CONCLUSION

It is a common assumption by modern scientists who are active and engaged in the field of MT that the translation machines are a widely used alternative to the needs of modern translation. According to Cavalier (2001), the MT reduces the workload for professional translators and leads to cost-effective and timely production methods. He adds that in many cases, MT can definitely be used to automate the first translation (draft) stage and quite often completely removes the need for undertaking any second (post-editing) phase (Cavalier 2001, 367). Vitek (2000) agrees with this view about the cost but he proceeds to another caveat: "The problem is that the machine does not understand the meaning of the document at all. Therefore, although most of the technical terms used by a machine will be correct, it is up to the reader to make sense of those words haphazardly jumbled up together by a non-thinking machine. Kasapi supports the existence of interscientificity in translation, and lists the various disciplines involved in this, such as linguistics, psychology, ethnology and philosophy, pragmatology, dialectology and terminology. Starting from these, it is logical to assume that one needs more than a non-thinking machine to carry out the translation work to a satisfactory extent. At this point, we ought to mention a highly intelligent phrase by Vitek (2000) which reflects the modern reality in an unrestricted way: Building a Tower Of Babel from Silicon Bricks. The continuous development of MT is leading us towards a fully automatic translation of high intelligence. But we must admit that, at this particular moment, there is still a long way towards achieving such a goal, and what can best describe the current situation, as mentioned in Sofer (2006), is a quote by Timothy Hunt: Computers will never replace translators, but translators who use computers will replace translators who dont.

379

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST

A.U.Th. Regulation on Bilateral Agreements. Http://www.auth.gr/inter/affiliations/contents/ kanonismos_el.html (14.4.2012) Brown, P. F., V. J. Della Pietra, S. A. Della Pietra, R. L. Mercer. (1993). The Mathematics of Statistical Machine Translation: Parameter Estimation, Computational Linguistics 19 (2). Cambridge, USA: MIT Press. Http://acl.ldc.upenn.edu/J/J93/J93-2003.pdf (14.4.2012) Cavalier, T. (2001). Perspectives on machine translation of patent information, World Patent Information 23 (4). Geneva: Elsevier. Google translate. Http://translate.google.com/about/intl/en_ALL/ (14.4.2012) Hutchins, J. (2010). Outline of Machine Translation Developments in Europe and America, JAPIO yearbook. Tokyo: Japan Patent Information Organization. Http://www.hutchinsweb.me.uk/JAPIO-2010.pdf (14.4.2012) Kasapi, E. (2002). Technikes anagnosis, akroasis & perilipsis keimenon. Thessaloniki: University Studio Press. Pado, S., D.Cer, M. Galley, D. Jurafsky, C.D. Manning, (2009). Measuring Machine Translation Quality as Semantic Equivalence: A Metric Based on Entailment Features, Machine Translation 23 (2-3, pp 181-193). New York: Springer. Http://www.nlpado.de/~sebastian/pub/papers/mt09_pado.pdf (14.4.2012) Sofer, M. (2006). The translators Handbook, 6th rev. ed.. Rockville: Schreiber Publishing. Vitek, S.V. (2000). Reflections of a Human Translator on Machine Translation, Translation Journal 4 (3). Http://translationjournal.net/journal/13mt.htm (14.4.2012)

380

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MEDICAL WASTES: A GLOBAL PROBLEM AND THE CURRENT LEGAL FRAMEWORK IN GREECE M. Mironidou-Tzouveleki, Anesthesiologist - Professor in Pharmacology, Medical School, Aristotle University of Thessaloniki, Greece Email: mmyronid@auth.gr ABSTRACT According to Directive 2006/12/EP (European Parliament) waste is any substance or object in the categories set out in Annex I (Q1-Q16) which the holder discards or intends or is required to discard. 20% of the total amount of waste generated by health-care activities is considered hazardous material that may be infectious, toxic or radioactive. Non-rational management of pharmaceutical waste puts at risk many occupational groups, but also civil population living near hospitals. The solution of the problem consists of collection, transport and temporary storage, and then the processing and proper disposal.

Keywords: pharmaceutical waste, medical waste, toxicity, health institutions

381

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Pollutants are known since the Middle Age as products of processing raw materials (flax, hemp) in rope and textile manufacture and paper industry, of dead animals in tanning and parchments manufacturing, as well as of the burial of the dead. According to Directive 2006/12/EP (European Parliament) waste is any substance or object in the categories set out in Annex I (Q1-Q16) which the holder discards or intends or is required to discard. Pharmaceutical wastes pursuant to Directive 91/689/EEC of 12/12/1991 are the anatomical and pharmaceutical products, as well as the medicines. These are part of the hazardous waste list. According to WHO 80% of the total amount of waste generated by health-care activities is general waste. The remaining 20% is considered hazardous material that may be infectious, toxic or radioactive. Health care wastes include followings categories: 1. Infectious Waste 2. Pathological and anatomical waste 3. Hazardous pharmaceutical waste 4. Hazardous chemical waste 5. Waste with high content of heavy metals 6. Vessels under high pressure 7. Sharp objects 8. Highly infectious waste 9. Genotoxic/Cytotoxic waste 10. Radioactive waste

In Greece, in accordance with the Government Decision 37591/2031 there are: 1. Medical Waste Urban Nature, similar to household waste 2. Hazardous Medical waste (HMW), which can be a) waste of purely infectious character b) waste that have both toxic and infectious character
382 17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

c) waste of purely toxic nature (non-infectious) 3. Other Medical waste (radioactive, batteries, etc)

Dispersal routes of medicines in the environment may be: -excretion after injection, ingestion or inhalation of medicinal products -removal after washing to the point where local medication was applied -the disposal of unwanted or expired medicines and -waste from commercial or industrial use.

Pharmaceutical wastes include also pesticides, which can cause acute or chronic poisoning, hypersensitivity reactions, cancer, mutagenic or teratogenic effects. They can also reduce the resistance of the organism and influence drug metabolism. Medicinal products may cause environmental effects such as alteration in metabolism in male fish, genealogical malformations or extinction of entire populations. Non-rational management of pharmaceutical waste puts at risk: a) people working in storage, transport and management of the waste, b) employees in private and public hospitals, c) patients and hospital visitors. d) workers at waste landfills, e) residents near health care units, as infectious waste are disposed in household bins. The results of human exposure depend on the toxicity of the medicinal product and the duration of exposure to a certain quantity. The solution of the problem consists of collection, transport and temporary storage, and then the processing and proper disposal.

383

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST 1. http://www.healthcarewaste.org 2. , KYA 37591/2031/2003, , B, . 1419 3. COUNCIL DIRECTIVE of 12 December 1991 on hazardous waste (91/689/EEC), OJ L 377, 31.12.1991, p. 20 4. DIRECTIVE 2006/12/EC OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 5 April 2006 on waste, Official Journal of the European Union 2006, L114/9

384

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MEDIUM SIZED PORTS AND CITIES IN EUROMED REGION A PROPOSAL FOR THE FUTURE RESEARCH Jos Snchez, Technical University of Lisbon, Portugal jose23sanchez@gmail.com

ABSTRACT

In this paper is exposed the evolution of the relation between port and city along history. From an initial stage where city and port worked as one, to a conflictual period during which both appeared as separate entities, to an actual situation where the waterfront regenerations projects are happening all around the globe. The focus is made in the Euro-Med region, mainly in mid scale cities. The big urban centres have resources to make important waterfront projects, but what happens with mid scale portcities? How can they carry out their own regeneration operations? Finally if the medium scale is the one that truly structures the Mediterranean territory, a proper research should be made to reach guidelines that could help in the rebuild process of these cities, for ensuring a balance development of the region.

Keywords: waterfront, medium scale, Mediterranean, port, city

385

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

The relation between city and port has evolved during time. Nowadays we can find several examples of cities that have created different urban regeneration projects in waterfronts areas. In the Euromed context there are few examples of this kind of operations, mainly in big scale cities with main ports. When we better analyse the Mediterranean region we see that the cities that really structure this territory are the medium scale cities. For these cases there are different challenges than for the big scale metropolises. We need to make proper research that allows this medium scale to have major guidelines to follow in case of several shifts in their port situation, and that force them into an important urban reconfiguration.

THE EVOLUTION OF THE PORT CITY RELATION

During long parts of History the port and the city worked as one. Many of Ancient and actual cities have their origin on their port. The port activities had a direct impact in the city structure, and they both evolved together. The growth in the port industries and commerce would directly mean a growth for the city. This stage of the symbiosis between the two realities continued in an increasing path. As the sea traffic growth, and the era of the great explorer started, several cities reached a status of global metropolis. Cities as Lisbon, Barcelona, or Genova became capitals of commerce and therefore in association with the cultural interchange also cultural poles. At the XIXth century this total interaction was ended. With the industrial revolution the cities and port started to act as separate entities. The port begun to have closed areas, walls and fences were created to put apart the population of the city. Also the scale of the boats, machinery and cargo increased. The ports were no longer a living part of the city, but started to be a machine world, where people where no longer welcome.

386

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1. Industrial revolution landscape. Antwerp 1877.

This conflict continued, as the scale and the port grew, and more the port became an inhuman space. With transport revolution, and the beginning of the railway system, increasing barriers where created. No longer was only a fence, but railways with commercial trains transporting goods for the ships. The industry associated with the merchandise also started to grow in an increasing path. At the same time the city started to deny its relation with the port. The areas near it became degraded spaces, often related with illegal activities, and delinquency. Simultaneously the pollution started to be a serious problem, since the port activities became a source of smoke, and bad odours. The situation persisted in time, all the way through the 20th century. When container cargo became the main load for the ships this situation even increased. Also the continuous advance in mechanical equipments allowed bigger boat size, heavier machinery and a more inhuman environment. The port worked by itself, in many cases totally autonomous to the city. This navy gigantism also caused associated problems to the city. The traffic load increase, the transports crossing the town left no positive income but were the source of traffic and pollution issues. The first breaking point of this conflictual relation happened in the mid 20th century. In two American cities, Boston and Baltimore, the first important waterfront regeneration process took place. The project sites were brownfields left by disabled industries, port warehouses and

387

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

old docks. Both these cities had been important ports in past times, but different economy flows forced a decrease of their activity. These first operations helped to create a new point of view over the old port areas. In Europe the first waterfront projects took place in London, few years later than those in the USA. Also, in the Netherlands, in Rotterdam and Amsterdam new operations to rehabilitate the old piers and docks started to happen. Just in the late 80s and early 90s some Mediterranean cities started waterfronts projects, like Genoa or Seville. Barcelona became a benchmark. With occasion of the 92 Olympics they made a big project for the old waterfront. The Port Vell intervention gained public spaces for the city and allowed a new development for the town.

Figure 2. Port Vell in Barcelona.

In more recent years port cities all around the globe have started to regenerate their waterfront. In Europe, the cities that started long ago still continue with their operations, and new ones have given a new look to this kind of projects. In different context there have been successful interventions, like Hamburg or Oslo in northern Europe, or Bilbao in Spain.

388

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

As we can see the scope where these projects take place is very complex. There are several constraints. The reality of these cities has suffered dramatic changes due to the different port context. Very often what once was the main motor of the city, in terms of economy and work, disappears, or suffers from a major mutation. These violent changes leave deep marks into the city. In several fields the impact is severe; the economical hit is obvious, but also in terms of social structure. Unemployment becomes a serious problem. Also in terms of urban structure the shift is important. Suddenly the city finds itself with less resources and significant urban territories unoccupied that easily become a source of problems. In some of the mentioned projects the cultural facilities and new public space play a main role. These new cultural amenities must be crucial part of the urban regeneration process. These new areas that the city gains must be taken as an opportunity to recover the relation with the water, without forgetting the port identity. In this process the cultural industries must play a key role. The activities and new dynamics that these facilities can provide might be the beginning of the new waterfront situation, and a possible new alternative to old habits. Culture has some advantages that can make it a good solution for disabled areas. It can create new fluxes, of very different kind of people, so the waterfront truly becomes public, and anybody can be there and enjoy it. We are not just talking about show business, museum or other leisure or contemplative activities, but also some knowledge productive facilities, as universities, institutes or even associated offices. Also the port use to be saw as the main gate to contact different realities, somehow the cultural industry can play that role, as the vehicle that connect us to the world. These cultural amenities should also include the local needs for education and every day cultural activities, as libraries or civic centres.

THE MEDIUM SCALE CITY

As we can see in the map, in the Mediterranean region there are not many large metropolises. Cairo and Istanbul are probably the only two cities that can be considered in an international scale as global urban centres. After these two main cities we can see several towns that have a population of a few millions and in some cases are administrative capitals, in other are important centres for the international flows of commerce, economics or culture. In the Mediterranean context we can

389

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

consider these cities as the main ones, the big scale. Their status and their resources allow them to proceed with important urban regeneration projects. In the short review of the evolution of the port-city relation we have seen that in the Mediterranean countries the main interventions have been in these big cities, often taking advantage of major events in a global scale.

Figure 3. Mediterranean population map.

When we analyze the Euro-Med context we notice that in this region is the medium scale city that truly structures the territory. In this context, what can we consider the medium scale port city? basically the cities that are not these big metropolitan areas, that do not have the same resources, and the port in many cases, has an even more important role for its economical, social and urban structure. In case the port suffers from a major shift and leaves massive brownfields or disabled infrastructure it is even harder for these middle scale cities to find a way to adapt themselves to the new reality. Port areas have needs for big scale spaces, even if its not a main port, still

390

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

needs areas of big impact in the municipality that hosts it. In the medium scale cities this situation is yet clearer. Cities as Saida in Lebanon, Sousse in Tunisia, Heraklion in Greece or Viana do Castelo in Portugal are clear examples of the situation early presented. These towns have a medium scale, going from 60 000 inhabitants to just over 250 000. They have several economy sectors in their structure, but the port and the industries attached to it are crucial for their development. In these cases for example, there is also another condition that often repeat itself, and it is that the main port areas are located in front of the historic city centre. This situation makes the action in these areas even more delicate.

Figure 4. Satellite view of Heraklion in Greece.

FUTURE RESEARCH

Considering the present situation of the Mediterranean context it is crucial to develop a proper research about the relation between medium sized ports and cities in this region. It is not a matter of having to expel the ports from the cities, since, as said before, ports are in many cases the reason for the birth of the city. It is necessary to find a balance between the port and the city development. In many cases the city does not want to look for alternative scenarios.

391

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

This region has always been an area of intense cultural and political activity. Taking into account recent events we must seriously consider different possible scenarios. Medium scale cities do need to find alternatives for their development model. The current economy crisis shows us no situation can be taken for granted. It is possible that current solid sectors from the local economy suffer from major shifts and the city has to adjust to these sudden changes. Besides the economy crisis, and looking at long-term development, it is easy to see that in this globalized world is a tendency for the centralization of activities in big centres. This situation happens in different fields. In the maritime traffic the current situation still allows mid scale ports to exist. But in a near future, and in a context where major shipping companies are even buying their own private ports, it is difficult to seriously consider that most of the mid scale port have a positive prospect. The main ports are growing in fast path, and the most realistic scenario is that they will have an even larger capacity, clearly harming the smaller maritime centres. In this situation several question arise. How do mid scale cities adjust to the possible changes in their port? How can they absorb the large port areas in case that the port gets disabled? What are the alternatives, and how can they be implemented? What role can play the cultural industry in the urban regeneration process? Where do the mid scale cities get resources from for their transformation?

CONCLUSION

The new demanded research is necessary for the development of the Mediterranean region. In fast changing economical times, it is very difficult to predict what is going to be the future growth of the city. It is not only about the economical situation, but also about cultural issues, historical concerns, and evolving without losing the identity. This study has to reach all the parameters and disciplines that can help to build guidelines to face this situation. Not just urbanism, or sociology, but also ecological engineer, economics, politics, etc.

392

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The medium scale must be the context of this research because as we have seen it is in this background that relies the past richness and the future development in the Mediterranean region.

393

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Borja, J. and Muxi Z. 2003. El espacio pblico: ciudad y ciudadana. Barcelona. Electa. Busquets I Grau, J. 1999. La urbanizacin marginal. Barcelona. Ediciones UPC. Brutotomesso, R. 2009. Un nuevo Paisaje Portuario. In Rev. Portus, n 18 (2-3). Venice, Ed. Rete - Associazione per la collaborazione tra Porti e Citta'. Guimares, F. J. 2006. Cidade porturia, o porto e as suas constantes mutaes. Lisboa. Parque Expo 98. Llovera, J. A.. 2010. La transformacin de los puertos desde la Revolucin Industrial. Rev. Portus, n 19 (14-21). Venice. Ed. Rete - Associazione per la collaborazione tra Porti e Citta. Meyer H. 1999. City and Port. Transformation of Port Cities London, Barcelona, New York, Rotterdam. Utrecht International Books. Schubert, D. 2004. Transformacin de zonas portuarias y costeras en desuso: experiencias, posibilidades y problemas. Mag. ciudades n 8.

DIGITAL BIBLIOGRAPHY http://www.commune-sousse.gov.tn visited in 13.04.2012 18:40 http://www.saida.gov.lb visited in 13.04.2012 17:20 http://www.heraklion.gr visited in 13.04.2012 18:25 http://tyros.leb.net/sidon/# visited in 13.04.2012 17:25 http://www.cm-viana-castelo.pt/ visited in 13.04.2012 19:00 http://www.haifa.muni.il visited in 13.04.2012 19:15

394

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MICROWAVES AS ENERGY SOURCE IN ENGINEERING, INDUSTRIAL AND MEDICAL APPLICATIONS Francisco J. Clemente-Fernndez, Roco Murcia-Hernndez Universidad Politcnica de Cartagena, Spain Francisco.clemente@upct.es, Rocio.murcia@upct.es

ABSTRACT Since microwave energy discovery during the World War II as an energy source, there has been a great evolution of this technology. Microwaves are considered as an alternative, clean, fast and efficient energy source and also as a controllable technique capable to generate heat. Nowadays it is strange not to find a home that counts with a microwave oven for helping in the everyday life cooking. This fact is due to its reliability, efficiency and also because they are pretty much affordable for the family finances. In this paper we will give an overview of several uses of microwaves as energy source in engineering, industrial and medical applications. Firstly we make a review of the applications in the food industry, and then we give a summary for those drying processes and microwaveassisted vulcanization and polymerization which use microwaves as the core technique in their procedures. Finally we present some innovative medical techniques where microwaves involvement has meant a great step forward. Keywords: Microwave heating, Drying, Food industry, Medical applications.

395

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

The first microwave ovens were developed around 1946, when in a bit of serendipity, engineer Percy LeBaron Spencer noticed that microwave communication equipment could be used to heat food. Since then, a lot of efforts and advances have been carried out. In this paper we give an outline of the most important microwaves applications in the engineering, industrial and medical fields. 2 FOOD INDUSTRY

Historically, it is in the food industry where microwave applications got started. In fact, nowadays quite a lot of industrial products are cooked by means of microwaves such us bacon, chicken, meat, fish, and doughnuts [Thuery 1992]. We should always take into account several important points when we apply microwaves in food industry like for instance hygienic conditions, nutrition facts and organoleptic properties. In this section of the paper we will examine those points and also the effect of microwave cooking on different animal and vegetable products, considering the advantages and disadvantages of each industrial process. Firstly and considering the loss factor defined in next formula (1), which varies with temperature:
r = r tan

[1]

where r is the dielectric constant and tan is the loss tangent. Observing the following Table 1 we can firmly define that lean products have high permittivity values at positive temperatures whereas fatty materials absorb very little electromagnetic energy derive from their low permittivity values. [table 1 here] It is also important to have in mind that dielectric properties of food are not only a function of their water content, but also of the physical and chemical state of this water content. In general the dielectric behavior of food product follows two phases; a liquid phase containing free water and dissolved ions and a solid phase containing bound water, lipids, proteins and colloidal carbohydrates. Microwave cooking obeys the classic heat equation:

W = mC T

= Pt

[2]

where W is the energy in Joules, m is the mass in kg, C is the heat capacity (Jkg-1K-1), T is the temperature increase, P is the power in Watts and t is the time interval in seconds. As main disadvantage we should not forget that when a piece of food is cooked by means of microwave energy, the outcoming heating might not be uniform owing to several reasons such as: The field uniformity within the oven could not be proper.

396

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The product to be heated is heterogeneous (for example: skin, muscle, bone). The product shape also determines where the electric field concentration appears. 2.1 Animal products Red meat: Microwave cooking originates mainly deep heat deposition and selective heating that depends on the permittivity of tissues and above of all cooking time. In general studies microwave cooking is shown to be satisfactory for the retention of proteins, amino acids, phosphorus, potassium, and nitrogenous products, as well as regarding B1 and B2 vitamins. Poultry: Based on studies under poultry meat cooked with microwaves we can assert that properties are better preserved by microwaves; the retention of B6 is 92.6%, and also the retention of proteins and mineral salts. What is most important is the improvement in the energy efficiency: for example, 5 minutes of microwave cooking are equivalent to 20-30 minutes in water and 45-50 minutes in steam. Bacon and fat: This has been one of the most successful applications since there are a lot of advantages. Microwave cooking provides a better color, appearance, taste as well as a better conservation for the nutrients. The energy save was around 30% and 50% and there is a possibility to get the fat back, no cancerous NYPR and no fumes and bad smells neither. Fish: As a curiosity we remark the Gigamet which is a stainless steel system incorporating two parallel tunnels of cross section slightly larger than the size of the tins, which are transported one after another on two conveyor belts. The microwave power consumption is 24 kW for 2.800 tins (105 grams/each). It is a novel technique because it includes metal parts inside the cavity, but in this case the arcing is avoided due to the design.

2.2

Vegetable products

In the torrefaction process the usage of microwave is quite remarkable. After including the usage of a resonator applicator the final reached temperature is only 130 C but the result has proved to be very much satisfactory.

2.3

Baking products

Some applications for baking products are baguettes and doughnuts production. For the first application it is needed to use either hot air or infra-red rays for getting the crust. What Doughnuts concerns and as it is a very much porous food, with only 4 microwave minutes we can obtain the same result as with 25 convective minutes. So with a power of 11 kW at 2.45 GHz, 48000 units per hour can be produced.

397

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In the next figure we can see the picture of the original microwave oven patent by Doctor Percy L. Spencer [Spencer 1950] and one of the first early microwave ovens which were much larger than those we have today about the size of a refrigerator [IEEE 2012]. [figure 1 here] 3 DRYING PROCESSES

Traditional drying processes have low energy and time efficiency due to several factors. First of all, energy transmission is produced by conduction and convection from the surface and therefore the heat transfer is slow, especially if we are dealing with thick materials. Also, the speed of the process highly depends on the psychrometric air conditions, i.e. temperature and relative humidity, making the drying process more difficult in winter. Moreover, gas and gasoil, which are highly contaminating, are usually employed combined with traditional techniques. Thus, microwave-assisted drying is clearly seen as an alternative to traditional drying due to several advantages: Microwave heating can be considered as volumetric and therefore is much faster than convection processes. The surface of the material is not dried up since the water evaporation is produced mainly inside the material. Drying uniformity is improved when using microwaves. Microwave-assisted drying is quite independent from the air conditions. Lots of examples can be found regarding microwave-assisted drying processes. For instance, an industrial process dealing with pasta is presented in [Thuery 1992]. The advantages of using microwaves versus traditional drying are clearly stated: 75% saving on processing space, 60% energy saving, 75% saving on cleaning and maintenance, less amount of bacteria and a better quality of the product. Microwave energy is also used in the drying of leather [Monz-Cabrera 2000, MonzCabrera 2001, Monz-Cabrera 2002]. Traditionally, the drying has been performed by means of convective ovens (hot air) or in the open air, taking several hours. Microwave-assisted drying provides several advantages such as the reduction of the processing time to few minutes, smoother pieces of leather with uniform humidity distribution and independence from the weather conditions. In figure 2 it is shown the oven employed for the drying of leather. [figure 2 here] Another typical application where microwaves are employed is the drying of wood [Thuery 1992]. Several actual applications have been developed all around the world for the processing of pieces of wood such as pine parquet or wooden frames. The energy losses are

398

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

reduced to 2% versus the 22% of a conventional process. This type of drying is also an efficient way of insect control. Microwave-assisted drying of paper has also been researched as an alternative to traditional drying remarkably reducing the operation time. In fact, in [Goerz 1967, Miranda 2002] it is shown that the power can be reduced by up to 50% in comparison to traditional processes, providing uniform humidity content. 4 MICROWAVE-ASSISTED VULCANIZATION AND POLYMERIZATION

One of the most successful applications of microwave heating is the vulcanization of rubber [Thuery 1992]. The main problem of traditional vulcanization is that the heat is transferred very slowly from the surface due to the low thermal conductivity of rubber. In this way, the use of microwaves provides several advantages: Microwave heating is independent from the thermal conductivity so the temperature is risen very fast. Whereas in traditional heating the surface is hotter than the interior, when using microwaves heating uniformity can be achieved provided that the applicator is properly designed. Microwaves allow the possibility of a continuous-flow processing versus the traditional batch processing. Energy efficiency is improved up to 30%. Better quality for thick profiles greater than 20 mm. Since there are several kinds of rubber with different dielectric properties, it might be necessary the use of fillers or mixtures that increase the loss factor so that the material can be processed with microwaves. Regarding the polymerization of thermosetting resins such as polyester or epoxy, microwaves are employed to fabricate reinforced materials, since these resins are hardened when heated. An example of Spanish technology in marble industry is shown in [Requena-Prez 2007, Romera-Fernndez 2004] where it is shown that it is possible to apply microwave energy to cure these resins. Resins are employed in marble industry to provide protection against chemicals or fractures and an attractive shiny look. Traditional polymerization processes employ resistance heaters or UV ovens. The polymerization is inefficient and slow, and large storage areas are needed for the marble slabs to finish the curing process. When using microwaves under certain conditions, the slabs can be processed in a continuous way that takes just 80 seconds provided that the marble is preheated. In figure 3 it is shown the actual microwave oven employed in this application. [figure 3 here]

399

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MEDICAL APPLICATIONS

Hyperthermia is a cancer treatment that involves heating tumor cells within the body. Elevating the temperature of tumor cells up to 42.5 C results in cell membrane damage, which, in turn, leads to the destruction of the cancer cells. The hyperthermia process is one of the microwave medical applications we can find as an innovative curative technique with the help of nano/micro particles. For this request the particle can be heated up, which leads to their use as an hyperthermia agent, delivering toxic amounts of thermal energy to targeted bodies such as tumors or as chemotherapy and radiotherapy enhancement agents, where a moderate degree of tissue warming results in more effective malignant cell destruction. In broad terms, the procedure involves dispersing magnetic particles throughout the target tissue, and then applying an EM field of sufficient strength and frequency to cause the particles to heat. This heat conducts into the immediately surrounding diseased tissue whereby, if the temperature can be maintained above the therapeutic threshold of 42 for 30 min or more, C the cancer is destroyed. In the next figure 4 we can observe some of the hyperthermia applications [Murat 2006, Lammers 2011]: [figure 4 here] Other fashion medical applications are those intended for diagnostic imaging. For example a thermoacoustic molecular tomography with magnetic nanoparticle contrast agents for targeted tumor detection can be carried out. Basically certain magnetic nanoparticles FAFe(3)O(4)/PANI should target the tumor and afterwards the tumor is irradiated by pulsed microwave at 6 GHz for thermoacoustic detection and imaging. The results indicate that thermoacoustic molecular imaging with functionalized iron oxide nanoparticles may contribute to targeted and functional early cancer imaging. Next in figure 5 a possible application of microwave tomography for breast cancer detection is shown [Sabouni 2011]. [figure 5 here] 6 CONCLUSION

To sum up we can assert that microwaves are very much multidisciplinary and can be applied in several fields of industrial and technological areas for improving results and efficiency in diverse processes. We hope that this kind of work helps people to understand better this energy source and help them to accept microwaves as a near and harmless technology in their everyday life. ACKNOWLEDGEMENTS This work was supported in part by the Fundacin Sneca, Agencia de Ciencia y Tecnologa de la Regin de Murcia, under the Sneca predoctoral fellowship with reference 16381/FPI/10.

400

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Goerz, D. J. and J. A. Jolly. 1967. The economic advantages of microwave energy in the paper industry. Journal of Microwave Power and Electromagnetic Energy 2 (3): 87-94. IEEE. 2012. Microwave Ovens. http://ghn.ieee.org/wiki/index.php/Microwave_Ovens Lammers Rianne J.M., Witjes J. Alfred , Inman Brant A., Leibovitch Ilan ,Laufer Menachem, Nativ Ofer, Colombo Renzo. 2011. The Role of a Combined Regimen With Intravesical Chemotherapy and Hyperthermia in the Management of Non-muscle-invasive Bladder Cancer: A Systematic Review. European Urology 60. 81-93. Miranda, J. M. et al. 2002. Ingeniera de Microondas. Tcnicas Experimentales. Madrid: Prentice Hall. Monz-Cabrera, J., A. Daz-Morcillo, J. M. Catal-Civera, E. de los Reyes. 2000. Study of Kinetics of Combined Microwave and Hot Air Drying of Leather. Journal of the Society of Leather Technologists and Chemists 84: 3844. Monz-Cabrera, J., A. Daz-Morcillo, J. M. Catal-Civera, E. de los Reyes. 2001. Effect of Dielectric Properties on Moisture Leveling in MicrowaveAssisted Drying of Laminar Materials. Microwave and Optical Technology Letters 30 (3): 165168. Monz-Cabrera, J., A. Daz-Morcillo, J. M. Catal-Civera, A. J. Cans, E. de los Reyes. 2002. Enthalpy Calculations for the Estimation of MicrowaveAssisted Drying Efficiency on Laminar Materials. Microwave and Optical Technology Letters 31 (6): 470474. Murat Tun, nal amdali, Cem Parmaksizoglu, Sermet ikriki. 2006. The bio-heat transfer equation and its applications in hyperthermia treatments, Engineering Computations, 23 ( 4) : 451 463. RequenaPrez, M. E., M. P. VilaMarn, J. RomeraFernndez, J. MonzCabrera, and A. MartnezGonzlez. 2007. Development of a Novel MicrowaveAssisted Polymerisation System for the Natural Stone Industry. Journal of Microwave Power and Electromagnetic Energy 40 (4): 198210. Romera-Fernndez, J., M. P. Vila-Marn, D. Snchez-Hernndez, A. Daz-Morcillo, A. M. Martnez-Gonzlez, J. Monz-Cabrera. 2004. Procedimiento de polimerizacin de resinas aplicadas sobre el mrmol mediante el uso de microondas. ES 2 245 880 Patent. Sabouni Abas. 2011. Ultra-WideBand (UWB) Microwave Tomography using Full-Wave Analysis Techniques for Heterogeneous and Dispersive Media. A Thesis submitted to the Faculty of Graduate Studies of The University of Manitoba in partial fulfillment of the requirements of the degree of Doctor of Philosophy Department of Electrical and Computer Engineering University of Manitoba Winnipeg, Manitoba, Canada.

401

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Thuery, J. 1992. Microwaves: Industrial, Scientific and Medical Applications. Norwood, MA: Artech House. Figure 1: First microwave oven patent (left). An early Radarange microwave model (right).

Figure 2: Microwave oven employed for drying of leather.

402

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 3: Microwave oven employed for the curing of resins in marble slabs.

Figure 4: Some hyperthermia applications. Bladder tumours (left) and thigh tumours (right).

403

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 5: Clinical imaging system configuration for microwave tomography.

Table 1: Dielectric properties of some food products Product Cooked beef Raw beef Raw beef Steak Smoked bacon Corn oil Soya oil Cooked cod Milk Egg white Potato Temperature C 20 20 60 25 25 25 25 20 20 20 78.9 7.3 Humidity (%) 67.8 73.8 73.8

r
41.6 48.3 39.5 40.0 2.50 2.53 2.51 46.5 51.0 35.0 81.0

tan
0.31 0.28 0.29 0.3 0.05 0.06 0.06 0.26 0.59 0.5 0.38

404

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

405

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

MUSSELS AS BIOMONITORS TO ASSESS ENVIRONMENTAL POLLUTION Dimitris Karagiannis1, Ioannis N. Vatsos1*, Panagiotis Angelidis1
1

Laboratory of Ichthyology, Faculty of Veterinary Medicine, Aristotle University of Thessaloniki , POBox 395, TK 54124, Greece * email ivatsos@vet.auth.gr ABSTRACT

Certain organisms play a critical role in the complex relationships between the biotic and abiotic elements that exist in the aquatic environment. The monitoring of these organisms and particularly those that occupy lower places in the food chains may provide a representative picture of the effects of any environmental factor, as for example pollution, on the higher levels of biological organization. The term biomonitoring, refers to the systematic use of live organisms to assess changes in the environment, especially in the aquatic ecosystem and is conducted either in the field or under laboratory conditions. Today, the general consensus is that all environmental assessment programs should include both the chemical analysis of environmental samples as well as biomonitoring. Bivalves meet all the criteria in order to be used as biomonitors: they can be found attached to solid substrates in almost all geographical areas, they can easily adapt to environmental changes, they have an appropriate for most analyses size and their physiology is relatively simple and extensively studied. However, the most interesting characteristic of bivalves is that they uptake their necessary nutrients through active filtration of the surrounding water. This filtration process allows these organisms to bioaccumulate many substances at much higher concentrations than those that exist in the surrounding environment. For over twenty years, mussels and particularly those of the genus Mytilus spp. have been used as biomonitors. Apart from the absolute concentration of a certain pollutant within the tissues of the mussels, a number of physiological parameters of the mussels are also used as bioindicators in biomonitoring studies. These parameters usually represent non-specific responses of the mussels to the stress invoked by external stimuli and include: survival rate, growth, reproduction, respiration and clearance rates and attachment capability. The assessment may also involve the examination of various enzymes, or the function of certain cells of mussels, as for example haemocytes. Keyword: Biomonitoring, mussels, environmental pollution

406

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

BIOMONITORING

The term biomonitoring, according to Van Der Oost et al. (2003), refers to the systematic use of live organisms to assess changes in the environment, especially in the aquatic ecosystem and is conducted either in the field or under laboratory conditions. Initially, all monitoring regimes were based on chemical methods to detect and quantify the various pollutants in field samples, such water and sediment, until certain issues emerged proving that approach problematic (Jamile 2001). In particular, many researchers observed that by merely detecting the contaminants in the aquatic environment they could not evaluate the overall environmental impact and especially on the aquatic organisms. Furthermore, they encountered serious obstacles when they attempted to quantify very low concentrations of substances that occurred in nature (Narbonne, 2000; Phillips and Rainbow 1994). Thus it was suggested that certain aquatic organisms could be used as environmental indices, overcoming the above problems. Today, the general consensus is that all monitoring programs should include both the chemical analysis of environmental samples as well as biomonitoring. In general terms, the strategies that are applied to study environmental pollution in the aquatic environment can be outlined as a two step procedure. 1. Quantification of the concentration of the various contaminants (e.g. heavy metals, pesticides, etc) in field samples and particularly the water column and sediment. 2. Quantification of the adverse effects by the contaminants on the aquatic organisms. These effects can be assessed at various biological levels, such as in certain molecules or cells, in individual organism, in certain species, or even in an entire bio-community (Bayne 1986; Jenkins and Sanders 1986). However, in most cases the assessment of the negative effects on individual organisms, and particularly those that occupy lower places in the food chains, may provide a representative picture of the effects on the higher levels of biological organization, such as all the individuals of a certain species living in an area, or the entire bio-community that exists in the same environment (Bayne 1986). In this assessment the modelling approach is often used. The above procedure is sometimes also called integrated monitoring (de Zwart 1995). The application of biomonitoring has the additional advantages that it can be cheaper, more accurate and even more sensitive than the conventional chemical analysis. Nevertheless, the chemical analysis can never be totally replaced by biomonitoring as in some cases the observed effects on individual organisms can be easily interpreted and linked to certain substances.

407

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

BIVALVES AS INDICES FOR BIOMONITORING

As mentioned before, some organisms have a critical role in the complex relationships that exist in the aquatic environment between the abiotic and the biotic components. Monitoring of these organisms may reflect the overall condition of a certain environment, including the level of pollution. There are many criteria according to which the selection of these organisms is made. These criteria in brief are the following (Phillips and Rainbow 1994). 1. The organisms should be abundant in the ecosystem 2. The organisms should be easy to find and collect 3. The handling of these organisms should be easy and all the required analyses can be conducted 4. The organisms should be endemic in the specific environment 5. The organisms should age within a short period of time and thus all the observations on the bioaccumulation related to their age are feasible 6. All the contaminants should exist in adequate concentrations within their tissues, without killing them or even causing serious alterations in their physiology 7. There should be adequate information on their physiology and their behavior All organisms living in a certain environment do not bio-accumulate the same substances, or even at the same rates (Phillips and Rainbow 1988). The rate of accumulation is greatly affected by the feeding habits of each species and their preferences. Bivalves are organisms that exhibit all the necessary characteristics described previously for biomonitoring. They can be found attached to solid substrates in almost all geographical areas, and exhibit a preference for areas rich in nutrients, such as along the coastlines and at estuaries, where fresh water from rivers is mixed with the sea. They can easily adapt to environmental changes, such as water temperature and dissolved oxygen, or even nutrient availability (Viarengo and Canesi 1991). They have an appropriate for most analyses size, and their physiology is relatively simple and studied extensively by many authors. The most interesting characteristic of bivalves is that they uptake their necessary nutrients through active filtration of the surrounding water. This filtration process allows the organisms to bioaccumulate many substances at much higher concentrations than those that exist in the surrounding environment (Salanki et al. 2003). For example, Hathaway (2001) using wild fresh water mussels as biomonitors found that the concentration of microcystin, a substance produced by blue-green algae, in their livers was 5-100 times the concentration found in the environment.

408

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Furthermore, the author observed that in many lakes throughout New Hampshire the alterations in the concentration of microcystine in the livers of the mussels followed the alterations of microcystine in the environment. 3 RESPONSES OF MUSSELS USED AS BIOLOGICAL INDICES

For over twenty years, mussels and particularly those that belong to genus Mytilus spp. have been used in various studies to biomonitor environmental pollution (Smolders et al. 2002). Apart from the absolute concentration of a certain substance within the tissue of the mussels, the effect of various pollutants on a number of physiological parameters of the mussels is also used to assess the overall status of an environment (Smolders et al. 2002). These parameters usually represent non-specific responses of the mussels to external stimuli and include: survival rate, growth (usually expressed as condition index), reproduction, respiration and clearance rates and attachment capability. In addition, the assessment may also involve the examination of various enzymes, or the function of certain cells of mussels, as for example haemocytes. The most important physiological responses of mussels, which are used in biomonotoring surveys, are presented below. 3.1 Survival rate

Investigation on the mortality observed during and after acute and chronic exposure to various contaminants is one of the first assays that can assess the toxicity of those contaminants. Although for other aquatic animals, such as fish and algae, certain established guidelines on the performance of such assays exist (OECD), for mussels no such protocols have been developed (de Zwart 1995). Therefore, in surveys where mussels are used the protocols which exist for the other animals are followed. Of particular interest is the ability of mussels to survive outside the water. This ability is quite important to mussels, as they encounter this situation very often in nature, as part of their everyday life. Thus, as a simple assay, the total mortality and the period during which this mortality is observed, after exposing the mussels to air, may be indicative of their overall condition. This ability can be seriously affected by pollution (Karagiannis et al. 2011). 3.2 Growth

Growth represents the final result of many complex interactions between many physiological functions and therefore, its assessment indicates the overall effect of any stressful condition. The assessment of the effects of environmental pollution on the growth of mussels includes the measurements of various somatometric indices, such as shell dimensions, total weight, total shell

409

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

weight, wet and dry meat weight. However, in many cases many of these indices, such as shell dimensions, are influenced by many other environmental factors, such as temperature and salinity and thus they fail to indicate differences due to pollution (Roberts et al. 1986). In addition, all parts of mussels do not develop at the same rate throughout their life and this can further complicate any comparisons. On the other hand, other indices can be more useful. Smolders et al. (2002) studying the effects of different industrial effluent waters on various physiological parameters of zebra mussels (Dreissena polymorpha) observed significant differences in wetweight/dry-weight ratio according to the level of pollution. Maybe the most informative index in relation to growth is scope for growth (SFG). In essence, it represents the percentage of the absorbed energy used for survival, growth and reproduction. However, as for many growth parameters, a long period of exposure is required to indicate significant suppression, as noted by Smolders et al. (2002). 3.3 Reproduction

Reproduction can be greatly affected by many pollutants. The usual effect that is observed is retardation or lack of spawning. Some contaminants appear to accumulate particularly in gonads rather than in other organs of mussels, as for example DDT (Bacchetta and Mantecca 2009). The contaminants can affect reproduction in many ways depending on the causal agent. For example, some substances can cause significant degeneration in the tissues of the mussels (Lowe 1988), while other studies indicated that organic pollutants can affect the peroxisome proliferation (Ortiz-Zarragoitia and Cajaraville 2006). 3.4 Respiration and feeding rate

As a general rule, metabolic rate in mussels tends to increase when exposed to various toxicants, although in some cases this is not observed (Smolders et al. 2002). As a consequence of this increase, the organisms increase their respiration (usually expressed as oxygen consumtion per dry body weight) and use more energy to maintain a physiological equilibrium. El-Shenawy et al. (2006) reported that after exposing mussels (M. edulis) to various concentrations of atrazine observed that the oxygen consumption and the ammonia excretion increased. This phenomenon however, occurs up to a certain level of exposure, above which the organisms may suffer serious pathologoanatomical alterations, which can compromise their ability to respond and thus the respiration rate decreases. Feeding rate, also expressed as clearance rate, refers to the ability of the mussels to filter water in order to uptake microorganisms present in the water. It is well known that when mussels and bivalves in general, are exposed to adverse environmental condition respond by reducing the

410

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

movement of their valves (El-Shenawy et al. 2001). Consequently, the feeding rate and the food absorption are reduced (Smolders et al. 2002; Shuhong et al. 2005; El-Shenawy et al. 2006). 3.5 Attachment capability

Mussels are littoral organisms and thus they are often prone to the action of tides and waves. Firm attachment to solid substrates is therefore vital to their survival. This is achieved by means of the byssal threads, which contain collagen and are produced by a gland. The enumeration of these threads reflects how strong the mussels to attach to substrates and whether this capability is compromised. Many environmental factors affect the number of byssal threads, as for example temperature, salinity and water movement (Young 1985). Interestingly, it has been shown that many pollutants can reduce or even inhibit the production of the byssal threads. The mechanism through which the various pollutants act depends on the substance and in many case is unclear (El-Shenawy et al. 2001). 3.6 Enzymatic activity and DNA degradation

The activity of many enzymatic systems in mussels and particularly those associated with the response of the animals to oxidative stress due to environmental contaminants has been assessed as biomarker in many recent studies, as for example that by Vidal-Lin et al. (2010) who examined the antioxidant enzymes in mussels, Mytilus galloprovincialis, to monitor pollution in Spain. The connection of environmental pollution and gene alteration or DNA degradation (Depledge 1998) is well established. Many pollutants bind to DNA causing mutagenesis and carcinogenesis. In many bivalve species, including mussels, a haemic neoplasia related with environmental pollution is well documented (Elston et al. 1988). It is characterized by proliferation of enlarged circulating haemocytes. Thus, many environmental studies have already incorporated the assessment of DNA degradation and particular that observed in haemocytes as biomarker (Klobuar et al. 2008). The haemocytes of the bivalves are of particular significance due to their role in the immune system of mussels, as well as in transporting various substances between tissues. 4 USE OF MUSSELS TO ASSESS THE TOXICITY OF ATRAZINE

In the Laboratory of Ichthyology, at the Faculty of Veterinary Medicine, A.U.Th we used mussels M. galloprovincialis as biomonitors to assess the short-term and long-term effects of atrazine. Atrazine is a herbicide that was widely used in the recent past. Although now many countries have banned its use, its residues still remain in the environment. In this study, the indices that were used to examine the effects of atrazine were: (a) accumulated mortality after a

411

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

3- and 21-day exposure period, (b) the formation of byssus and (c) the viability of the exposed mussels in air. The results, which were published in the journal Aquaculture International (Karagiannis et al. 2011), showed that the LC50 after a 48 h exposure was found to be 6.33 ppm. However, lower concentrations of the substance although did not kill the mussels provoked notable effects on the other parameters. Thus, regarding the byssus formation, the formation of byssal threads was significant suppressed in the mussels that were exposed to 2 and 1 ppm atrazine compared to the control group, while no byssal threads were formed by the mussels exposed to 10, 8 and 5 ppm. Significant negative effect was also noted in the ability of the exposed mussels to survive in air. The assays that were used in this study were simple and rapid and provided useful information on the effects of atrazine on the aquatic community.

412

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Bacchetta, R. and P, Mantecca. 2009. DDT polluted meltwater affects reproduction in the mussel Dreissena polymorpha. Chemosphere 76: 13801385. Bayne, B.L. 1986. Measuring the effects of pollution at the cellular and organism level. In: The Role of the Oceans as a Waste Disposal Option, ed. G. Kullemberg, 617-634. Riedel, New York, NY, de Zwart, D. 1995. Monitoring water quality in the future Volume 3: biomonitoring. Rijksinstituut voor Volksgezondheid en Milieu RIVM. http://rivm.openrepository.com/ rivm/bitstream/10029/10424/1/719102049.pdf Depledge, M.H. 1998. The ecotoxicological significance of genotoxicity in marine invertebrates. Mutation Research 399: 109122 El-Shenawy, N.S., R. Greenwood, I.M. Abdel-Nabi, Z.I. Nabil. 2006. Effect of atrazine and lindane on the scope for growth of marine mussel (Mytilus edulis). Acta Zoologica Sinica 52 (4): 712-723. El-Shenawy, N.S., R. Greenwood, Z.I. Nabil, I.M. Abdel-Nabi, R.A Hanna. 2001. Shell valve movement behaviour and byssal formation of the mussel, Mytilus edulis, as an early warning response to lindane and atrazine exposure. Egyptian Journal of Biology 3 (2): 63-71. Elston, R.A., M.L. Kent, A.S. Drum. 1988 Progression, lethality and remission of hemic neoplasia in the bay mussel Mytilus edulis. Diseases of Aquatic Organisms 4: 135-142. Hathaway, R.A. 2001. Mussels as Biomonitors of Lake Water Microcystin: A Final Report for the Summer 2000 Microcystin Monitoring Study. Centre for Freshwater Biology, http://www.freshwaterlife.org/servlet/BinaryDownloaderServlet?filename=1068137849041_ Mussel_20Monitoring_20Report.pdf Jamile, K., 2001. Bioindicators and biomarkers of environmental pollution and risk assessment. Science Publishers, Enfield. Jenkins, K.D. and B.M. Sanders. 1986. Assessing biological effects of contaminants in situ. In: Urban Runoff Quality. Eng. Found. Conf. Proc., ASCE/Henniker, NH, pp. 170- 181. Karagiannis, D, I.N. Vatsos, P. Angelidis. 2011. Effects of atrazine on the viability and the formation of byssus of the mussel Mytilus galloprovincialis. Aquaculture International 19(1): 103-110. Klobuar, G.I.V., A. tambuk, K. Hylland, M. Pavlica. 2008. Detection of DNA damage in haemocytes of Mytilus galloprovincialis in the coastal ecosystems of Katela and Trogir bays, Croatia. Science of the Total Environment 405: 330-337.

413

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Lowe, D.M. 1988. Alterations in cellular structure of Mytilus edulis resulting from exposure to environmental contaminants under field and experimental conditions. Marine Ecology Progress Series 49: 91-100. Narbonne, J.F., 2000. History-biological basis of the use of biomarkers in ecotoxicology. In Use of biomarkers for environmental quality assessment, ed. L. Lagadic, T. Caquet, J.C. Amiard, F. Ramade, 1-8. A.A.Balkema, Rotterdam. Ortiz-Zarragoitia, M., M.P. Cajaraville, 2006. Biomarkers of exposure and reproduction-related effects in mussels exposed to endocrine disruptors. Archives of Environmental Contamination and Toxicology 50(3): 361-369. Phillips, D. J. H. and P.S. Rainbow. 1994. Biomonitoring of trace aquatic contaminants. Chapman & Hall, New York. Roberts, D.F., M. Ellitott, P.A. Read. 1986. Cadmium Contamination, Accumulation and Some Effects of This Metal in Mussels from a Polluted Marine Environment. Marine Environmental Research 18: 165-183. Salanki, J., A. Farkas, T. Kamardina, K.S. Rozsa. 2003. Molluscs in biological monitoring of water quality. Toxicology Letters 140/141: 403-410. Shuhong, W., H. Huasheng, W. Xinhong. 2005. Bioenergetic responses in green lipped mussels (Perna viridis) as indicators of pollution stress in Xiamen coastal waters, China. Marine Pollution Bulletin 51: 738743. Smolders, R, L. Bervoets, R. Blust. 2002. Transplanted zebra mussels (Dreissena polymorpha) as active biomonitors in an effluent-dominated river. Environmental Toxicology and Chemistry, 21(9): 18891896. Van Der Oost, R., J. Beyer, N.P.E. Vermeulen. 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environmental Toxicology and Pharmacology 13: 57-149. Viarengo, A. and L. Canesi. 1991. Mussels as biological indicators of pollution. Aquaculture 94: 225-243. Vidal-Lin, L., J. Bellas, J.A. Campillo, R. Beiras. 2010. Integrated use of antioxidant enzymes in mussels, Mytilus galloprovincialis, for monitoring pollution in highly productive coastal areas of Galicia (NW Spain). Chemosphere 78: 265272. Young, G.A. 1985. Byssus-thread formation by the mussel Mytilus edulis: effects of environmental factors. Marine Ecology - Progress Series 24: 261-275.

414

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Online tools in the hospital classrooms of the region of murcia JOS LUIS SERRANO SNCHEZ, UNIVERSITY OF MURCIA, SPAIN
jl.serranosanchez@um.es M Paz Prendes Espinosa, University of Murcia, Spain pazprend@um.es

ABSTRACT
The investigation presented has a conclusion of improving the educative attention that children who find themselves in the care of hospital receive during considerable amount of time (and that during this period, they attend classes overseen by the hospital) through the use of ICT. After undergoing the investigations and experiments related to the topic, we come to the conclusion that in the majority of cases, the playful use of ICT in the hospital classrooms dominates the educative. Through this investigation, our intention is to form a module of curricular integration with ICT, through the creation of an online tool that categorizes diverse digital educational resources and tools with the use of Web 2.0, that can have educative applications in the hospital classroom. This educative experiment originates from the collaboration between investigators from different universities, experts in educative technology and the teaching staff from hospital classrooms in the region of Murcia. In this assignment we present the actions taken, the phase in which right now we find the project and the actions yet to be completed.

Keyword: hospital classrooms, ICT, hospital, ALTER

415

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ONLINE TOOLS IN THE HOSPITAL CLASSROOMS OF THE REGION OF MURCIA Jos Luis Serrano Snchez, University of Murcia, Spain jl.serranosanchez@um.es M Paz Prendes Espinosa, University of Murcia, Spain pazprend@um.es

THE EDUCATIVE ATTENTION IN HOSPITALS

Hospital Pedagogy is the branch of education that means to help hospitalized children in developing and maintaining a normal and natural lifestyle as possible, taking on education while having an illness and being hospitalized. According to Lizasoin (2011, 20), it is considered that the fundamental objective of Hospital Pedagogy is centered in mainitaing and avoiding the process of educative marginalization for children of a school age that find themselves admitted to hospital. The author adds that this finality must be the same as general education: the search for the persons integral development, including an anomalous situation like being ill and hospitalized. This branch of knowledge was developed from the creation of hospital classrooms. Nowadays we think of hospital classrooms as school units whose principal objective is the educative attention for young patients between three and sixteen years old or for patients attending obligatory education. Education professionals work in these classrooms at the disposition of the patients and their family members. For this, the administrations want to guarantee that the hospitalized student is able to continue with the educative process and improve his/her medical conditions whilst staying in hospital. The hospital classroom is an open and flexible area, principally aware of the hospitalized childs needs, where he/she may come and go freely, with the possibility of leaving the class depending on the requirement of attending his/her medication and care, and may later on re-join the group and tasks (Guilln y Meja, 2002, 18). The main objectives for the hospital classroom are of a formative educational nature, not only to achieve pedagogic objectives established by the center of reference, but is also necessary to prepare the child to overcome different situations that could arise during his/her care. According to this principal, Violant, Molina and Pastor (2011) point out the following objectives: continue the established curriculum; facilitate the integration of the student in public/private schools at the end of their stay in the hospital, giving them a feeling of security and self-opinion; achieve that the student adequately values the different dimensions of his/her illness; provide communication with others; stimulate creativity; use ICT in favor of affective social and communicative development.

416

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

It is evident that these classes are peculiar because of where they are situated, keeping in mind that although they present similar characteristics, each one is different by numerous and variable functions, for example; the peculiarities of the hospital student body. (Serrano y Prendes, 2011). 1.1 ICT educative possibilities in the Hospital Classroom

We must not be surprised by the great quantity of possibilities that ICT can offer us in the general educative field if we keep in mind that societys progress depends on the quality of the educative system, being evident the relation between social and educative technology. Dertouzos (2000) reflects part of this idea affirming that technology goes hand in hand with humanity and to carry out an authentic progress, both must be of equal stature. The outstanding benefits that ICT can contribute towards education are: increase of quality, diversity, effectiveness of teaching systems; universal access to information; amplifying the possibilities of training; invaluable help in methodology (individual or group) that the student carries out activities by himself/herself; design a learning environment; favour creativity and motivation; personalize training; promote the cooperation between students, teachers and schools (Serrano y Prendes, 2011). Besides from these benefits, Bartolom (2004, 216) considers them necessary in education because they are the necessary tools for intellectual work. On the other hand, we must keep in mind that the incorporation of technologies for the teaching-learning process is vital, being that this new generation, process information in a different way than before, and for that we need to employ strategies that include ICT (Aguiar, 2011, 104). Nowadays ICT offers new possibilities of improvement for educative attention with hospitalized students, affecting diverse dimensions, such as: the process of teaching and learning; the conduct of the hospital classroom and between the different agents; psychological level; and the continuous training of the teaching staff. These can convert into an instrument of great utility to maintain that ill children and young adults may continue with a most normal lifestyle as possible. The greatest benefits that these technologies can have can increase in this peculiar environment, having diverse devices at hand that can access fun and educational content, besides providing the possibility to keep in daily contact with family members, friends and their own school. This way it is possible to weaken the feeling of separation and isolation one can suffer from being in such a place (Bienzle, 2008). In a work from before (Serrano y Prendes, 2011) we lay out the possibilities of ICT in educative attention in the hospital classrooms, we shall not dwell any further on this point. After review of the research and experiments of use with ICT in hospitalized classes, we conclude that the majority of the experiments from before (national and international) make use of ICT centred in two principal axes: on one hand, it is used for the use of gaming and

417

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

helping children escape the reality of their current situation and on the other, to enhance the communication between children in different classrooms. Some of these projects are: mundo de estrella, Teleducacin en aulas hospitalarias, aula en lnea, Proyecto E-Hospital, The Starbright Foundation, Sterreking, Ciberhosto, SOLAS Project, At Eile Project, Proyecto Global Aulas Fundacin Telefnica Hospitales... Therefore, after following approach to different jobs with ICT in hospitals, our proposal centres on the use of these for the supporting of teaching-learning of hospitalized students. This proposal gave place to the ALTER Project, which we will describe briefly below. 2 ALTER PROJECT

The ALTER Project. Alternativas Telemticas en Aulas Hospitalarias: una experiencia educativa (www.um.es/aulashospitalarias.es), approved by Resolution on the 29th of December, 2009 and financed by the aid of projects for research in Humanities and Social Sciences formed in the Sneca Program 2009, it aims to improve the students education and labour staff with the use of ICT. This project is lead by M. Paz Prendes and includes the participation of researchers from the Investigation of Educative Technology Group and the University Of Murcia, Researchers of the University of Santiago De Compostela and the University of the Illes Balears. Besides these, support is also given from the Education Council, training and employment of the Region of Murcia and with the inestimable collaboration of the teaching staff in the hospitals; University hospital Virgin De La Arrixaca, University Hospital Santa Lucia, H.G.U. Reina Sofa and H.G.U. Morales Meseguer de la Regin de Murcia. This investigation began in 2009 and will finalize and the end of 2012, after the extension by one year from the funding body.

2.1

Development of the project

In figure 1, we show the relation of jobs which are stretched out with actions related to the ALTER Project. In turn, we intend to place the reader in the phase that is currently the Project.

418

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1. Phase relation and publications of the ALTER Project


Description of the Project
(Rodrguez, Castaeda y Prendes, 2010)

Protocol Tool Teacher Training


(Serrano, Gutirrez y Prendes, 2011)

Evaluation of the pilot experience


(Serrano y Gutirrez, en prensa)

Proposed Model of ICT curriculum integration in classrooms hospital

Experiment development evaluation Proposal for improvement

Tool design ALTER Re-thinking of the evaluation plan

The shadowed box indicates the phase in we find the project while writing this assignment. After studying the possibilities of ICT in hospital classrooms, the particularities of the hospitalized student and the design of the protocol tool (network zone where activities categorized by areas, educative steps and methodology were found and in which used tools from Web 2.0) the pilot experiment was carried out as well as the evaluation, of which was carried out for 3 months in different hospitals. Then we obtained a set of conclusions (Serrano and Gutierrez, in press) based on the results of the evaluation of the experiment. The approaches to improve were organized into three big blocks: Formative and informative actions, educative integration with ICT, improvement of protocol. In the last block of approaches, the team of research decided to substitute the Protocol tool for a new application called ALTER. Below, we will highlight the principal characteristics and its functional aspects.

2.2

ALTER tool

This application 1 is a data base integrated on the ALTER Project website that permits the hospital teachers to use and incorporate all digital educative resources online which are categorized by different criteria easily and freely without having to register. In addition to a selection of categorized Web 2.0 tools from a study (Torres, 2011) made under the ALTER Project. In the first phase, the researchers of the Project, experts in Educative Technology, performed a selection of digital educational resources in a network under a set of criteria taking into account the needs and peculiarities of the hospital classrooms. Later teachers were able to remove or add new resources or Web 2.0 application tools. Below we show aspects of functionality and structure of the application.

On www.um.es/aulashospitalarias.es/. Is possible the application graphic design of application will be able to change

419

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 2 (screenshot of search option screen and search results)

1. Curricular area selection. On this panel one is able to select la online tools option, offering a category of tools in a content criteria search. 2. Depending on the chosen curriculum area, there is the possibility to make a more concrete search following the contents of this area, contents selected by the hospital class teachers keeping in mind the Primary and Secondary curriculum. 3. Education Level select. 4. Research search button. 5. From the owl icon we can access a list of recommendations of online tools created by the investigation team. 6. Button to edit data already entered in the ALTER application. With the aim to Project the integrity of the data base, to access this option, it is necessary to have an access key that only the investigators and participating teachers of the project know. 7. List of Educative digital resources online according to the search. 8. Access to the resource. Figure 3 (screenshot of the search results)

1. Title and access to the educative digital resource online. 2. Description of the resource, source, licence

420

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

3. Ability to display educational applications based on whether at the time of addition is incorporated. 2.3 Evaluation plan

The evaluation plan (Table 1) of experience is consists of eight instruments of information collection. It will be necessary three evaluation moments (initial-process-end) and the participants are: students of hospital classrooms; families; researchers and teachers hospital classroom. Table 1: evaluation plan (In: number of instruments)
Initial Teachers hospital classroom Families Students of hospital classrooms Researchers In1 In2 In3 In4 Process End In5 In8 In6 In7

All instruments of evaluation were validated at PI2TE (Research International Panel in Education Technology) offered for EDUTEC Association 2. Numerous are advantages 3 of this service for researcher, that receive the validation report after his/her request. The researcher will be the responsible of management all instruments. Only participate the students whose hospitalitation exceed fifteen days or they can use ALTER tool at least five sessions. The researcher will do observations (In3) about the use of ALTER tool of teachers and students. At the end experience, we will publish all results on Webpage of ALTER Project 4 3 CONCLUSION

Traditionally in hospital classrooms, activities of a playful nature have principally been carried out. However the tendency has changed substantially in the last decade, being that in this context the teachers come offering an education more bordered with the curriculum, keeping in mind the emotional and physical status and type of illness the child bears, we must remind ourselves that the childs health care comes strictly before the curricular education given in the classroom. ICT offers us enormous possibilities for the educative attention in hospitalized classrooms, as we have briefed in this assignment. Emulating the tendency from before, these technologies

2 3

http://gte2.uib.es/panel/ http://gte2.uib.es/panel/content/ventajas 4 http://www.um.es/aulashospitalarias/resultados.html

421

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

were used primarily for leisure, encouraging a multitude of experiments and investigation projects. For this reason and by the work done in the framework of the Project and ALTER tool design, we aim to improve the educative attention of the hospitalized student thanks to the use of ICT, knowing that these technologies represent a substantive contribution to the improvement of education and training, what is essential is that teachers using these technologies can depend on the well-equipped pedagogical models" (Escudero, 2009, 20). Therefore, our final objective is the creation of a curricular integration module of ICT in hospital classrooms, coinciding with Po (2004) in which these technologies are going to demand the creation of new learning modules, new ways and strategies of searching, organizing, processing and use of information (62).

422

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Reference list

Aguiar, M.V. (2011). Jvenes en la sociedad red: nuevas habilidades para las nuevas generaciones. In F. Martnez, and I.M. Solano. Comunicacin y relaciones sociales de los jvenes en la red, 97-110. Alicante: Marfil Bartolom, A. (2004). Aprendizaje potenciado por la tecnologa: razones y diseo pedaggico. In F. Martnez and M.P. Prendes. Nuevas Tecnologas y Educacin, 216-234. Madrid: Pearson. Bienzle, H. (2008). Introduccin. In H. Bienzle (Ed.). eHospital: e-learning para pacientes hospitalizados. Wien: Die Berater. Dertouzos, M.L. (2000). Prefacio. In T. Berners-Lee (spanish edition) Tejiendo la red. Madrid: Siglo XXI Guilln, M. and Meja A. (2002). Actuaciones educativas en Aulas Hospitalarias. Atencin escolar a nios enfermos. Madrid: Narcea Lizasoin, O. (2011). Pedagoga Hospitalaria. Compendio de una dcada. Logroo: Sinndice. Po, A. (2004). Relacin entre formacin y tecnologas en la sociedad de la informacin. In F. Martnez and M.P. Prendes, Nuevas Tecnologas y Educacin, 59-62. Madrid: Pearson Rodrguez, T., Castaeda L. and Prendes, M.P. 2010. Protocolo de Atencin Educativa en red con TIC para alumnos en situacin de hospitalizacin prolongada. EDUTEC (Bilbao, Espaa) Serrano, J.L. and Gutirrez, I. (en prensa). Experiencia de uso del Protocolo de Atencin Educativa en Red en las Aulas Hospitalarias de la Regin de Murcia. Alcoy: Marfil. Serrano, J.L. and M.P. Prendes. 2011. Mejora educativa en las aulas hospitalarias. Proyecto ALTER. Congreso Internacional EDUTEC (Mxico) http://es.scribd.com/doc/72471416/Mejora-educativa-en-las-aulas-hospitalarias-ProyectoALTER (17.02-2012) Serrano, J.L., Gutirrez, I. and Prendes, M.P.(2011). Protocolo de atencin educativa en red. Proyecto ALTER. 2 Congreso Internacional uso y buenas prcticas con TIC. Mlaga. Torres, A. (2011). Aprovechando las posibilidades de la Web 2.0: Una propuesta de herramientas para el Proyecto ALTER. Informe de Trabajo de Fin de Mster Violant, V., Molina, M.C. and Pastor, C. (2011). Pedagoga Hospitalaria. Bases para la atencin integral. Barcelona: Laertes

423

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

OPTIMAL OPERATION OF A WASTE WATER TREATMENT PLANT USING METAHEURISTICS: A DYNAMIC MULTIBOJECTIVE APPROACH Isabel Gracia and Jose A. Egea Universidad Politcnica de Cartagena, Spain josea.egea@upct.es ABSTRACT This paper deals with the dynamic optimization of a wastewater treatment plant model for nitrogen removal. Two process variables (i.e., aeration factor in a tank and internal recycle flow rate) are selected as control variables and their time profiles are approximated using the control vector parameterization (CVP) technique. Two conflicting objectives have been considered to formulate a multiobjective optimization problem, namely the quality of the effluent and the plant economy. To solve the multiobjective problem and find the Pareto front the epsilon-constraint technique has been considered. In order to solve this complex problem the scatter search metaheuristic has been applied. Results reveal that this approach is successful to find optimal operation policies in this type of plants. Keywords: dynamic optimization, global optimization, multiobjective optimization, wastewater treatment plant, metaheuristics

424

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Optimization and control are fundamental tools to meet the strict standards that wastewater treatment plant (WWTPs) must comply with, while also trying to reduce costs. A common aspect in the design and optimization of WWTPs is that their associated mathematical models present dynamic nature and non-linearity. The optimization of such models can be a very difficult task thus robust (global) optimization methods should be used to address this problem (Moles et al, 2003; Egea et al., 2007). As additional obstacles we should consider the presence of several conflicting objectives to be optimized at the same time, like e.g. productivity and sustainability, which advises the use of multiobjective formulations. In this work we have considered a challenging model describing a waste water treatment plant for nitrogen removal developed by European Cooperation in Science and Technology (COST) 624 work group (Jeppsson and Pons, 2004). 1.1 Simulation benchmarking plant

The International Water Association (IWA) Task Group on Respirometry, together with the European COST work group, proposed a standard simulation benchmarking methodology for activated sludge plants. The COST 624 work group defines the benchmark as a protocol to obtain a measure of performance of control strategies for activated sludge plants based on numerical, realistic simulations of the controlled plant. The layout of this benchmark plant combines nitrification with pre-denitrification by a fivecompartment reactor with an anoxic zone. A secondary settler separates the microbial culture from the liquid being treated (Figure 1). [figure 1 here] Two manipulated variables, i.e., the aeration factor in the last anoxic reactor and an internal recirculation flow rate have been chosen to optimize two different performance indexes: the quality of the effluent (in terms of amount of pollutants) and the economy of the plant. The dynamic optimization problem has been formulated and solved using the control vector parameterization (CVP) approach (Vassiliadis et al., 1994), which divides the time horizon into a number of intervals. The control variables are then approximated within each interval by means of basis functions, usually low order polynomials, with fixed or variable length along the time. This parameterization transforms the original (infinite dimensional) problem into a non-linear programming problem where the systems dynamics must be integrated for each evaluation of the performance index. For solving the multi-objective optimization problem, we have used the epsilon-constraint technique (Haimes et al., 1971), in which one of the objectives is optimized and the rest are formulated as additional constraints.

425

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PROBLEM FORMULATION

The multiobjective optimization problem is formulated as follows:


Min F = [ f1 , f 2 ]

(1)

With f1 = EQ , which represents the term of effluent quality in units of kg pollution units d-1 and it is defined by
TSS TSSe (t ) + COD CODe (t ) + t14 days 1 + BOD BODe (t ) + TKN TKN e (t ) + Qe (t )dt T 1000 t0 + NO NOe (t )

EQ =

(2)

Where T is the time horizon, TSSe, CODe, BODe,TKNe, and NOe are, respectively, the total suspended solids, chemical oxygen demand, biological oxygen demand, total Kjeldahl nitrogen and nitrites/nitrates nitrogen, all of them measured in the effluent. Qe is the effluent flow rate. The coefficients i are taken from Vanrolleghem et al. (1996). The second objective function f 2 is a weighted combination of the operational costs which include aeration energy, pumping energy and sludge production.
f 2 = AE + PE + 3 Psludge

(3)

The weights are chosen based on the work by Vanrolleghem and Gillot (2002). More details about how to calculate these terms as well as the system dynamics can be found in Copp, 2002. and in the web page maintained by the benchmark authors 1. The problem is subject to the systems dynamics, the initial values for the state variables and bounds for the control variables:

x = F ( x(t ), u (t ), t ) x(t0 ) = x0 ul u uu
The control variables ui (namely the aeration factor in the fifth reactor and the internal recycle flow rate) are approximated using polynomials of degree one. The lengths of the time intervals are considered as variables, for a total number of 22 decision variables.
In the formulation above, x is the set of state variables (and x is its time derivative), u is the decision vector which represents the control variables (both the control values and the length of the time intervals). F represents the systems of differential-algebraic equations which define the plants mathematical model. t is the time (t0 and x0 represent the initial time and
1

(4)

http://www.ensic.inpl-nancy.fr/benchmarkWWTP/Bsm1/Benchmark1.htm

426

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

the values of the state variables at the initial time). Finally, u l and u u are the lower and upper bounds for the control variables and for the lengths of time intervals. The problem has been solved an advanced implementation of the scatter search metaheuristic which has successfully been applied to the solution of dynamic optimization problems (Egea et al., 2009). The choice of a metaheuristic for solving the problem is justified because preliminary tests indicated that the used of local gradient-based optimization methods lead to suboptimal solutions.

COMPUTATIONAL EXPERIMENTS

The aim is to simultaneously optimize two competitive objectives: the effluent quality and the plant economy. The Pareto front provides an idea about the balance of both objectives, thus allowing to select the optimal operation conditions which best fit our requirements. Since we use the -constraint approach, we will only minimize fx1 (i.e., the effluent quality, EQ) and will add fx2 (i.e., the economic term) as an additional constraint. f2

(5)

This problem is solved for different values of , based on the results obtained in previous single-objective optimizations.

= [14500, 15300, 16100, 16900]


The solutions from the different optimization problems associated to each value of , together with the solutions obtained from the single-objective optimizations, are used to build the Pareto front. In this case we directly apply the scatter search method assuming multimodality. Two runs were carried out for each value of . Table 1 shows the results of the procedure. The Pareto front is shown in Figure 2

[Table 1 here] [Figure 2 here]

The Pareto front reveals that both objectives are competitive and it is not possible to improve one of them without damaging the other. Besides, we do not find any flat area in the Pareto front, which means that apparently we can not find any work conditions in which improving one of the objectives does not deteriorate the other significantly. In any case, this Pareto front allows us to choose the best operating conditions to fulfil any specific requirement.

427

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In Figure 2 we have also included the solution provided by the default control strategy proposed by the benchmarks authors (2 PI controllers to maintain the oxygen concentration in tank 5 and nitrates concentration in tank 2 at certain levels, see Copp 2002). We can observe that it corresponds to a suboptimal solution even if not too far from the Pareto front. We must also note that this proposed control strategy was not necessarily chosen to optimize the same objective functions we have formulated.

CONCLUSIONS

Dynamic optimization of wastewater treatment plants is a difficult task due to the dynamic nature of their associated mathematical models, (e.g., multimodality, noise). Other aspect to be considered is the presence of more than one objective which can be competitive with each other. We have formulated a multiobjective dynamic optimization problem and have solved it making use of advanced metaheuristics (i.e., the scatter search method) to overcome the problems of multimodality and/or noise. The use of efficient global optimization methods as well as the multiobjective formulation, allow the user to be able to choose among different operation conditions (all of them optimal) depending on specific needs or requirements. The Pareto front obtained reveals that indeed the proposed objective functions compete with each other thus it is not possible to optimize one single objective without damaging the other one. Future work will be focused on the use of surrogate model-based optimization methods to reduce the number of simulations needed to locate high quality solutions.

428

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Egea, J.A., D. Vries, A.A. Alonso, J.R. Banga. 2007. Global optimization for integrated design and control of computationally expensive process models. Industrial and Engineering Chemistry Research 46(26): 9148-9157. Egea, J.A., E. Balsa-Canto, M.S.G. Garca, J.R. Banga. 2009. Dynamic optimization of nonlinear processes with an enhanced scatter search method. Industrial and Engineering Chemistry Research, 48(9): 4388-4401 Haimes, Y.Y., L.S. Lasdon, D.A. Wismer. 1971 On a bicriterion formulation of the problems of integrated system identification and system optimization. IEEE Trans. Syst. Man Cybern., SMC(1): 296297 Jeppsson, U., M.-N. Pons. 2004. The COST Benchmark Simulation Model-Current State and Future Perspective. Control Eng. Pract. 12(3), 299-304. Moles, C.G., G. Gutierrez, A.A. Alonso, J.R. Banga. 2003. Integrated Process Design and Control via Global Optimization-A Wastewater Treatment Plant Case Study. Chem. Eng. Res. Des. 81 (A5): 507-517. Vanrolleghem P., U. Jeppsson, J. Carstensen, B. Carlsson, G. Olsson. 1996. Integration of wastewater treatment plant design and operation a systematic approach to cost functions. Wat. Sci. Technol., 34(3-4), 159-171. Vanrolleghem, P., and S. Gillot. 2002. Robustness and economic measures as control benchmark performance criteria, Wat. Sci. Technol., 45: 117-126, Vassiliadis, V.S., R.W.H. Sargent, C.C. Pantelides. 1994. Solution of a class of multistage dynamic optimization problems. 1: Problems without path constraints. Industrial & Engineering Chemistry Research, 33(9):21112122.

429

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

FIGURES AND TABLES

Figure 1. Plant layout.

Figure 2. Pareto front.


1.8 1.7 1.6 1.5 1.4 1.3 6500 x 10
4

Pareto front Author's solution

fx2 (Economic Term)

7000

7500

fx1 (EQ)

8000

8500

9000

9500

430

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Table 1 Results for the multiobjective approach

14500 15300 16100 16900

fx 1 8097.6 7312.5 6877.6 6680.5

fx 2 14500 15300 16100 16900

Simulations 11061 13282 14421 16378

431

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

OPUNTIA BIOMASS AS BIOSORBENT: CHEMICAL CARACTERIZATION Avils Gonzlez, M.D.; Angosto, J.M. and Fernndez-Lpez, J.A. Department of Chemical and Environmental Engineering, Technical University of Cartagena, Cartagena, Spain. mdolores.aviles@gmail.com ABSTRACT Ectodermis of Opuntia has been characterized using scanning electron microscopy, infrared spectroscopy and thermogravimetric analysis. The results obtained from the characterization techniques indicate that the metal ion remains on the surface of the sorbent material. The effects of different parameters affecting the biosorption process were studied. The protonated Ectodermis of Opuntia exhibited the higher Cr (VI) uptake capacity at pH 2. Opuntia biomass can be proposed as an effective, low-cost and environmentally friendly natural sorbent for the removal of chromium from aqueous solutions. Keyword: Biosorption, Biomass, Opuntia, Wastewater treatment, Chromium

432

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Water contamination with heavy metal ions is a very serious threat to ecosystems around the world, so, the regulations concerning the discharge of contaminants to the environment are becoming more and more stringent. For example, metal ions may induce strong impact on the quality of water bodies, on wild and domestic life, and consequently on human healthy. (Gonzlez Bermdez et al. 2011, 122). The need to achieve low levels of heavy metals in industrial effluents has led to the development of new methods of disposing of them, so as to be effective and economic disposal, with respect to the classical techniques of separation (precipitation, osmosis, electrochemical treatments, etc). Biosorption is an alternative method suitable for the treatment of wastewater. It is characterized by low cost and high removal of metals, especially at low concentration of metal in solution. (Gonzlez Bermdez et al. 2012, 68). According to their origin, we can classify between biosorbents from microbial biomass, and waste materials from food and agricultural industry. The latter are of particular interest because, in addition to solving a major environmental problem with managing this waste, this kind of biomass is widely avaible, inexhaustible, and inexpensive material that exhibit significant speficity for the heavy metal ions (Garg et al. 2006, 61). In this paper we study the preparation and chemical characterization of biomass of Opuntia, because Opuntia abundance makes it a good low-cost candidate for industrial utilization. In addition to the elemental analysis, we used infrared spectroscopy, scanning electron microscopy and thermogravimetric analysis. Then, we start the study of their capacity as biosorbent to remove heavy metal ions in wastewater.

2 2.1

MATERIALS AND METHODS Conditioning of Ectodermis of Opuntia

Natural Ectodermis of Opuntia. The Ectodermis of Opuntia was collected from Cartagena (Spain). The raw sample was washed with distilled water and after that, it was dried in air oven at 60 C. Once the biomass cooled off, it was crushed, milled and sieved into three fractions (0.85-0.5, 0.5-0.25, <0.25 mm) and stored in desiccators.

433

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Protonated Ectodermis of Opuntia. In order to prepare the protonated biomass, the 0.85-0.5 mm fraction (Ectodermis) was treated with a 1M H 2 SO 4 solution (Panreac, Barcelona, Spain) (145mL/10g) for 24h. Before using it, the Opuntia biomass was thoroughly washed as many as three times with ultra-pure water from an Elix 3 Milli-Q system (Millipore, Bedford, MA; USA) and dried in air oven at 60 C and stored in desiccators.

2.2 2.2.1

Characterization test. Scanning electron microscopy (SEM)

The surface morphology of Ectodermis of Opuntia was investigated by scanning electron microscopy (SEM), Hitachi S-3500N (Hitachi High-Technologies Corporation, Tokyo, Japan), coupled with a system of analysis for energy dispersive X-ray spectroscopy (EDS), Bruker AXS Microanalysis, to determinate the chemical composition. Samples were mounted on carbon stubs using carbon tape, at the morphology of the biomass surface was imaged at a 500X magnification, 15 kV accelerating voltage and 30 Pa chamber pressure. The biomass Opuntia elemental composition was established with a Quantax 200 EDX analyser coupled to a scanning electron microscope (Buker AXS INC., Madison WI, USA), with a detector energy resolution of 128 eV. 2.2.2 Fourier transform infrared analysis (FTIR)

FTIR spectroscopy was used to confirm the presence of the functional groups in samples. Infrared spectra was adquired with a Thermo Nicolet 5700 Fourier transformed infrared (FTIR) spectrometer (Thermo Nicolet Analytical Instruments, Madison, WI, USA), provided with a deuterated triglycine sulphate (DTGS) detector and KBr optics. The spectra collected were an average of 20 scans with a resolution of 16 cm-1 in the range of 400-4000 cm-1. Spectra were controlled and evaluated by the OMNIC software. 2.2.3 Thermal analysis (TGA).

The thermogravimetric analysis was carried out using a TA instruments TGA/DSC 1HT Mettler- Toledo, which was operated in an oxidizing atmosphere at a heating rate of 30 Cmin-1 from 30 to 1075 C. 2.3. Batch biosorption experiments

The stock solution of Cr (VI) at the concentration of 1g/L was prepared using K 2 Cr 2 O 7 (Panreac, Barcelona, Spain) and deionised water (Milli-Q). This stock solution was used for the preparation of test solutions by dilution. The initial pH was controlled with NaOH 0.1M and HCl 0.1M. The biomass in amount of (0.5; 1 and 2) g/L was added to the solution in order to analyze his influence over biosorption process. Batch adsorption experiments were carried out in 100 mL Erlenmeyer flasks containing 50 ml of Cr (VI) synthetic solution, on an orbital

434

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

shaker at 150 rpm for 48 h. After this time, samples were filtered using a 0.45 m PVDF Millex syringe-driven filter unit (Millipore, Bedford, MA, USA). Next, for metal detection in aqueous solution the colorimetric method was used to measure the concentration on the chromium species. A solution of 1-5 diphenylcarbazide in acid forms a pink complex with Cr (VI), which can be spectrophotometrically analyzed at 540 nm. 3 3.1 3.1.1 RESULTS AND DISCUSSION. Characterization of Ectodermis of Opuntia. Chemical and SEM analysis.

The scanning electron micrographs (Fig.1 (a) and (b)) clearly show irregular and porous structure of the biosorbents. In this biomass, the main elements constituting the structure of natural Ectodermis of Opuntia were oxygen, carbon, potassium and calcium, altogether accounting for 99.04% of the composition, according to SEM studies (Fig. 2 (a) and (b)). When biomass was conditioned by the acid treatment, potassium and calcium decreased in the analysis (Fig. 2b). The elemental composition of biomass protonated changed after the contact with a Cr (VI) aqueous solution. (a)

(b)

Figure 1. SEM images for Ectodermis of Opuntia (a) before and (b) after the contact with a Cr (VI) aqueous solution. The pH of the aqueous media was 4, the amount of Ectodermis of Opuntia was 50 mg and the contact time was 24 h.

435

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

(a)
cps/eV 14

12

10

K C Ca

Al

Ca

0 1 2 3 keV 4 5 6 7

(b)
cps/eV 14

12

10

K C Ca

Cr O

Al

Ca

Cr

0 0 1 2 3 4 keV 5 6 7 8

Figure 2. Elemental composition for Ectodermis of Opuntia (a) before and (b) after the contact with a Cr (VI) aqueous solution. The pH of the aqueous media was 4, the amount of Ectodermis of Opuntia was 50 mg and the contact time was 24 h.

3.1.2

Infrared spectroscopy analysis.

The FTIR spectra for the Natural Ectodermis of Opuntia are shown in Fig.3. These spectra display a number of absorption peaks, indicating the complex nature of the examined biomass. The FTIR analysis shows broad bands at 3268cm-1 that it is indicative of the presence of the OH groups of cellulose and NH groups which are very involved in the biosorption process (Gonzlez Bermdez et al. 2012, 70). The absorption peak at 2917cm-1 is assigned to CH stretching, and those at 1609 cm-1 to C=O. The absorption peak at 1409 cm-1 is assigned to the symmetric bending of CH 3 . The bands at 1316 cm-1 and 1049 cm-1 are

436

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

indications of carbohydrate units (Yun et al. 2001, 4355). Similar results have been previously proposed for Ectodermis of Opuntia (Barrera et al. 2006, 849).
105 100 95 90 85

3268.17

2917.65

2851.56

%Transmittance

80 75 70 65 60 55

1409.25 1316.62 1242.13

1609.50

45 4000

3500

3000

2500 2000 Wavenumbers (cm-1)

1500

1000

Figure 3: FTIR spectra of Natural Ectodermis of Opuntia.

3.1.3

Thermal analysis

The Figure 4 shows the thermogravimetric behaviour of the Ectodermis of Opuntia. This analysis provides information regarding the mass reduction of the material with temperature. The maximum weight loss due to degradation is 92,28% because of, the formation of CO 2 , H 2 O and SO 3 . When the temperature reaches 450C, the amount of material remains constant indicating the inorganic fraction of the biomass, from ions Cl- present in the Ectodermis of Opuntia.

Figure 4: Thermal behavoir of Natural Ectodermis of Opuntia.

437

17 - 18 April 2012

510.47
500

417.81

50

1026.06

775.19

816.21

Proceedings of the 4th EMUNI Research Souk

3.1.4.

Effect of pH on Cr (VI) biosorption

The pH of the aqueous solution is an important controlling parameter in the heavy metal adsorption processes because there, a competition between the metallic ions and the protons for the same active site occurs. Since the pH of the solution can significantly influence the removal of heavy metals, it is, therefore, an important condition for biosorption of Cr (VI) ions. Therefore, a pH study was done, in order to define the optimal pH as a parameter, before the design another experiments. Figure 5 shows the removal of Cr (VI) mainly depends on the proton concentration. The lower the proton concentration, the higher the efficiency of the Cr removal. Similar result has been reported by Yang and Chen (2008, 301) and Gonzlez Bermdez et al. (2012, 70), that indicate that the highest uptake in their Cr (VI) sorption was found at pH 2.0 and at this pH the biosorption is independent of the metal concentration.

Figure 5 : Effect of pH on Cr (VI) biosorption using Ectodermis of Opuntia (contact time: 48 h; room temperature; particle size: 0.85-0.5 mm ; sorbent dosage: 0,5 g/L). 3.1.5. Effect of the sorbent dosage

A preliminary study of the effect Ectodermis of Opuntia concentrations is presented in Figure 6. Biosorption experiments were carried out with an initial Cr (VI) concentration of 10 mg L-1 and biosorbent dose ranged from 0.5 to 2 g, after 48 hours contact at 150 rpm and at pH value of 2. The amount of adsorbent significantly influenced the extent of Cr (VI) biosorption. The biosorption of metal ions increased with increasing biomass dosage.

438

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 6 : Effect of sorbent dosage on Cr (VI) biopsortion using Ectodermis of Opuntia (contact time: 48 h; room temperature; particle size:0.85-0.5 mm ; initial metal concentration: 10 mg/L; pH:2).

CONCLUSION

Ectodermis of Opuntia biomass was tested as a low-cost natural biosorbent for hexavalent chromium removal from aqueous solutions. SEM analysis confirms the metal presence of the control biomass. EDX analysis confirms the metal presence in the sorbent material after contact with the solutions. The thermogravimetric analysis indicates that at a temperature of 450 C there is a large mass consolidation. The process was pH dependent, with an optimum value at 2.0.

439

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Barrera H, Urea-Nnez F, Bilyeu B, Barrera-Daz C, 2006. Removal of chromium and toxic ions present in mine drainage by Ectodermis of Opuntia. Journal of Hazardous Materials B 136 (2006) 846-853. Garg U.K., Kaur M.P., Garg V.K., Sud D., 2007. Removal of hexavalent chromium from aqueous solution by agricultural waste biomass. Journal of Hazardous Materials 140 (2007)60-68. Gonzlez Bermdez Y., Rodrguez Rico I.L., Guibal E., Calero de las Hoces M., Martn-Lara M.A., 2012. Biosortion of hexavalent chromium from aqueous solution by Sargassum muticum brown alga. Application of statistical desing for process optimization. Chemical Engineering Journal 183(2012)68-76. Gonzlez Bermdez Y., Rodrguez Rico I.L., Gutirrez Bermdez O., Guibal E., 2011. Nickel biosorption using Gracilaria caudata and Sargassum muticum Chemical Engineering Journal 166 (2011) 122131. Yan, L. and Chen, J.P. 2008. Biosorption of hexavalent chromium onto raw and Chemicals modified Sargassum sp. Beioresource Technology 99 (2008) 297-307. Yun, Y.S., Park, D., Park, J.M. and Volesky, B.2001. Biosorption of trivalent chromium on the brown seaweed biomass. Environmental Science Technology 35 (2001) 4353-4358.

440

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PREDICTORS OF RISK OF LEARNING DISABILITIES

Annamaria Pepi, Agata Maltese, Lidia Scifo, Department of Psychology, University of Palermo, Italy E-mail: lidia.scifo@unipa.it

Abstract
Involves all the skills, knowledge and attitudes that are presumed to be precursors of the development of conventional forms of reading and writing (Whitehurst and Lonigan, 1998). It been traced a continuity of development between the first emergent literacy skills, starting from kindergarten, and early reading skills (Phillips BM et al). Children who have difficulty in the early stages of learning to read is very likely continue to present both in later school years further failures in this area (Cornoldi,Tressoldi, 2007) triggered

a negative spiral and problematic process (Tressoldi e Vio, 1996). There are numerous empirical confirmation of the importance of early identification of difficulties associated with the early stages of literacy emerging (Gijsel, M.A.R., Bosman, A.M.T. e Verhoeven, L. , 2006).

Keyword: predictors of risk, learning disabilities, learning of reading and writing, emergent literacy and formalized

441

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION the written language is configured as an evolutionary continuity that is

Learning

developed from

an early

acquisition phase, traditionally called "emergent literacy".

(Badian, 1988; Teale e Sulzby, 1986; Pinto, 1993; Whitehurst e Loningan, 1998; Pepi, 2004) . Learning the written language has its origins in the earliest stages of a child's life, before the start of formal (Teale e Sulzby, 1986). Learning the written language has its origins in the earliest stages of a child's life, before the formal teaching of reading and writing. Children may present particular difficulties for some will be expressed simply in over time, acquisition, and for others it will be translated into big difficulties of memorization and automating the process of read-write. In first grade children who come to the reading and writing are very heterogeneous and each subsequent

learning is greatly influenced by both the basic skills (cognitive, language, short-term memory, etc.), and the methodology used in teaching (Jimnez JE et all, 2010; Wilson, S. B., & Lonigan, C. J., 2010; 2011). Moreover, given the presence of different cultures and therefore different linguistic codes within the classroom, there is the need

for intervention is targeted at strengthening (empowerment) of basic skills, and to the construction of risk profiles allow the organization of educational

interventions implemented at an early stage, based on advanced learning technologies.

THE BODY

Were conducted three studies of longitudinal type. There were 741 subjects involved in research and will be taken from the last year of primary school (5 years), until the end of first grade (6 years).

FIRST STUDY: Analysis of emergent literacy construct and formalized METHOD Participants The sample consisted of 600 children, equally distributed by gender, belonging to middle socio-cultural level, will exclude cognitive problems in children. Instruments and Procedures Participants in the first phase in January and February will be given evidence of "reademerging." In the second phase of this study, the following year, again in the period of

442

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

January and February, participants will be assessed by tests administered in reading and writing formalized advanced. The tests used in this research are administered to

children individually and include tests that measure cognitive skills, language skills and general competence to investigate the specific tasks that literature indicates as

constituting the construct of literacy and emerging, as indicated by the literature: cognitive assessment socio cultural indicators (questionnaire for parents: information sociometry) questionnaire on children's reading and writing invented the language skills (vocabulary) the phonological skills (phonological awareness ) knowledge of letters the decoding of words observation and information of children by teachers

SECOND STUDY: Analysis of socio-cultural and linguistic disadvantage Participants The sample in the first phase consists of 600 children, equally distributed by gender, sociocultural level belonging to medium high and medium low and different ethnic groups, who have cognitive problems. Instruments and Procedures The same as the first study

THIRD STUDY: Treatment Identified the group of children defined "at risk", it continues with a new study to evaluate the potential effectiveness be divided into of a preventive treatment. The children "at groups and were followed for two risk" will years, both in

three distinct

May last year of pre-schools, and the following year in the same month the first year of primary school. The first The group will undergo not a training enhancement through be subjected to no treatment special instruments (control group).

second

group will

The third group will be engaged in another activity that should not assume any intervention, such as listening to music.

443

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ANALYSIS OF DATA For the analysis of the data you plan to use the Structural Equation Model and Structural Equation Modeling (SEM), which is a useful tool in psychological research for the explanation of complex phenomena (Figure 1). The SEM is the limit between the parametric and nonparametric statistics as extensively discussed in a recent article on their causal bases (J. Pearl, 2011). The 'application of the SEM, in our research

project could prove effective as it is of utmost importance the problem of measuring the individual variables, as often in the complex constructs the variables of interest can rarely be measured satisfactorily, or because they represent concepts can not be measured or because no adequate measuring instruments. In this research project should allow the use of SEM to study the links between the observed and latent variables underlying the validity and reliability of measures, i.e. their ability to effectively convey these theoretical concepts and knowing how to express stability even in repeated measurements over time.

444

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1: PLOTTING OF STRUCTURAL EQUATIONS MODEL OF EXPECTED

445

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

3 -

CONCLUSION Construction of a model of emerging literacy for the Italian language from which to be extended to other transparent languages In particular, we want to verify the relevance of the different components involved in the process of literacy and the nature of their relationships in preschool age Check the weight that each component of literacy is emerging for the purpose of learning to read and write at the end of the first year of primary school. To analyze the evolution of the individual components of the construct, since preschool at the end of the first year of primary school (formal instruction), thus the "predictive relationship" between the component of 'emergent literacy preschool children and those of reading and writing formally (risk profile). In addition, you want to check the relevance of socio-cultural disadvantage on learning of reading and writing (linguistic and ethnic minorities). In addition, you want to check the relevance of socio-cultural disadvantage on learning of reading and writing (linguistic and ethnic minorities). In addition, the identification, monitoring and treatment of a defined group of children "at risk" in order to evaluate the potential effectiveness of a preventive treatment.

446

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Reference list
Allan NP, Lonigan CJ. Examining the dimensionality of effortful control in preschool children and its relation to academic and socioemotional indicators. Dev Psychol. 2011 Jul;47(4):905-15. Badian, N.A. (1988) The prediction of good and poor reading, before kindergarten entry: A nine-year follow-up, in Journal of Learning Disabilities. Chiesi, F., Menzione, M., Primi, C.I modelli di equazioni strutturali nella ricerca in psicologia: istruzioni per l'uso di una tecnica di analisi multivariata, in Giornale Italiano di Psicologia. Maggio 2004;32(2):385-403. Compton DL et al. Selecting At-Risk First-Grade Readers for Early Intervention: Eliminating False Positives and Exploring the Promise of a Two-Stage Gated Screening Process. Journal of educational psychology. 2010;102(2):327-340. Corbetta P. (2002) Modelli di analisi multivariata per le scienze sociali. I modelli di equazioni strutturali. Ed. Il Mulino. Cornoldi C. ,Le difficolt di apprendimento a scuola. Ed. Il Mulino, 1999 Cornoldi C., Difficolt e disturbi dellApprendimento. Ed. Il Mulino, 2007. Cornoldi, C e Pra Baldi (1979), Funzioni mnestiche, percettive e linguistiche implicate nei primi apprendimenti scolastici: unindagine su alcuni strumenti predittivi, in Ap-Rivista di Applicazioni Psicologiche. Ehri, L. C., Nunes, S. R., Willows, D. M., Schuster, B., Yaghoub-Zadeh, Z. e Shanahan, T (2001), Phonemic awareness instruction helps children learn to read: Evidence from the national reading panels meta-analysis, Reading Research Quarterly. Fowler MG et al. Preschool risk factors as predictors of early school performance. Journal of developmental and behavioral pediatrics: JDBP. 1986;7(4):237-41 Gijsel, M.A.R., Bosman, A.M.T. e Verhoeven, L. (2006), Kindergarten risk factors, cognitive factors, and teacher judgements as predictors of early reading in Duth, in Journal of Learning Disabilities. Good RH et al. Reviewing outcomes: Using DIBELS to evaluate kindergarten curricula and interventions. In: Vaughn SR, Briggs KL, editors. Reading in the classroom: Systems for the observation of teaching and learning. Baltimore: Brookes;2003. pp. 221-259. Jimenez Glez JE et al. Is it true that the differences in reading performance between students with and without LD cannot be explained by IQ? Journal of Learning Disabilities. Mar 1994;27(3):155-63 Jimnez JE, Rojas E.[Effects of Tradislexia videogame on phonological awareness and wordrecognition in dyslexic children]. Psicothema. 2008 Aug;20(3):347-53. Jimnez JE,Hernndez-Valle I, Ramrez G, Ortiz Mdel R, Rodrigo M, Estvez A, O'Shanahan I, Garca E,Trabaue Mde L. Computer speech-based remediation for reading disabilities: thesize of spelling-to-sound unit in a transparent orthography. Span J Psychol.2007 May;10(1):52-67. Kenny, D. A. and Milan, S. (2011). Identification: A non-technical discussion of a technical issue. In Handbook of Structural Equation Modeling (R. Hoyle, ed.). Guilford Press, New York, This volume. Lonigan CJ et al. Test of Preschool Early Literacy. Austin, TX: PRO-ED; 2007. Lonigan CJ, Burgess SR, Anthony JL. Development of emergent literacy and early reading skills in preschool children: evidence from a latent-variable longitudinal study. Dev Psychol. 2000 Sep;36(5):596-613.

447

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Ortiz R, Jimnez JE, Garca Miranda E,Guzmn Rosquete R, Hernndez-Valle I, Rodrigo M, Estvez A,Daz A, Hernndez Expsito S. Locus and nature of perceptual phonologicaldeficit in Spanish children with reading disabilities. J Learn Disabil. 2007Jan-Feb;40(1):80-92. P.E. Tressoldi e C. Vio (a cura di), Diagnosi dei disturbi dellapprendimento scolastico.Ed Erickson, 1998 . Pearl, J., The Causal Foundations of Structural Equation Modeling, Chapter for R. H. Hoyle (Ed.), Handbook of Structural Equation Modeling. New York: Guilford Press. TECHNICAL REPORT August 2011, R-370. Pepi A. Imparare a leggere: dalla prevenzione allintervento . Ed Palumbo, 2004 Phillips BM et al. Predictive validity of the get ready to read! Screener: concurrent and longterm relations with reading-related skills. Journal of Learning Disabilities. Mar-Apr 2009;42(2):133-47. Pinto, G (1993). Dal linguaggio orale alla lingua scritta. Firenze: La Nuova Italia Predictive validity of the get ready to read! Screener: concurrent and long-term relations with reading-related skills. Phillips BM, Lonigan CJ, Wyatt MA. J Learn Disabil. 2009 MarApr;42(2):133-47. Epub 2008 Dec 12. Puranik CS, Lonigan CJ, Kim YS. Contributions of Emergent Literacy Skills to Name Writing, Letter Writing, and Spelling in Preschool Children. Early Child Res Q. 2011 Sep;26(4):465-474. Puranik CS, Lonigan CJ. Early Writing Deficits in Preschoolers With Oral Language Difficulties. 2011 Oct 4. [Epub ahead of print]. Skibbe LE, Justice LM, Bowles RP. Implementation processes associated with a home-based phonological awareness intervention for children with specific language impairment. Int J Speech Lang Pathol. 2011 Apr;13(2):110-24. Sulzby, E. (1985). Childrens emergent reading of favorite storybooks A developmental study. Reading Research Quarterly, 20,458-481. Sulzby, E. (1986). Writing and reading: Signs of oral and written language organization in the young child. In W. H. Teale & E. Sulzby (Eds.), Emergent liferacy: Reading and writing (pp. 50-87). Norwood, NJ: Ablex. Whitehurst GJ, Lonigan CJ. Child development and emergent literacy.. Child Dev. 1998 Jun;69(3):848-72. Review. Williams, L. J. (2011). Equivalent models: Concepts, problems, alternatives. In Handbook of Structural Equation Modeling (R. Hoyle, ed.). Guilford Press, New York, This volume Wilson SB, Lonigan CJ. An evaluation of two emergent literacy screening tools for preschool children. Ann Dyslexia. 2009 Dec;59(2):115-31. Epub 2009 Oct 16. Wilson SB, Lonigan CJ. J Learn Disabil. Identifying preschool children at risk of later reading difficulties: evaluation of two emergent literacy screening tools. 2010 JanFeb;43(1):62-76. Epub 2009 Oct 12.

448

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PRELIMINARY ISOTOPIC AND CHEMICAL ASSESSMENT OF THE KORONIA LAKE CATCHMENT Ch.Papacharalampou1,3, E. Dotsika1, K. Albanakis2,3, A.Antoniadis4, G.Zalidis5 chrysoulapapa@bio.auth.gr1,3,edotsika@ims.demokritos.gr1,albanaki@geo.auth.gr2,3, aanton@balcenv.gr4, zalidis@agro.auth.gr5 1 N.C.S.R. Democritos, Institute of Materials Science, Stable Isotope Unit, 15310, Ag. Paraskevi
Attikis, Greece 2 Aristotle University of Thessaloniki, Faculty of Geology, Department of Physical and Environmental Geology, Thessaloniki, Greece 3 Interdisciplinary Postgraduate Study Program Ecological water quality and management at a river basin level, Faculties of Biology, Geology & Civil Engineering, Aristotle University of Thessaloniki, 54124, Thessaloniki, Greece 4 Balcan Environment Center, 57200 Lagkadas, Thessaloniki, Greece 5 Aristotle University of Thessaloniki, School of Agriculture, Thessaloniki, Greece

ABSTRACT During recent decades, the catchment of Lake Koronia has undergone severe quantity reduction and quality deterioration in terms of its water resources. We examined the isotopic composition of the water and the geochemical characteristics of the area. The water circulation in the catchment and the relationship between surface water and groundwater, are examined by the isotopic composition of the samples. Isotopic (18 and D) and chemical analyses both on surface and underground water samples were performed in this study. In total, 15 boreholes dispersed across the catchment, the main stream (Bogdanas) of the study area and Lake Koronia were sampled. By the use of stable isotopes of water, the source altitude, the communication between the aquifers and the lake, as well as the interaction between water and rock are investigated. Isotopic analysis showed that the main origin of the water in the catchment is meteoric and the differences among the samples are due to different source altitude. Chemical analysis proves the quality deterioration of the water and its interaction with the environment rocks. Keywords: stable isotopes, hydrochemistry, Lake Koronia

449

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION Integrated management of wetlands through targeted monitoring using techniques of good practice is defined in the Water Framework Directive 2000/60/EU (Guidance Document No.12). Monitoring and interpretation of groundwater status and functions are also perquisites for directly dependent terrestrial ecosystems. Such a case of a dependent terrestrial ecosystem at risk is the Koronia wetland, located in Northern Greece. Due to the absence of an integrated water resources management plan in the area, both surface and groundwater resources fail to come up to the water needs arising from human activities. In addition, the underlying aquifers and their interaction with surface water (lake, rivers) play a critical role in the state of this water system. Former studies (BRGM 1972, Vatseris 1992, Vafeiadis et al., 1993, Veranis & Arvanitis 2001, Veranis & Kartitzoglou 2002, Zalidis et al., 2004) came to the false conclusion of no hydraulic contact between aquifers. A more recent study of the catchment (Mylopoulos et al., 2007) proves the interaction between aquifers, but fails to observe the groundwater-surface interaction. In this study a geochemical approach is attempted, focusing on the good practice techniques of stable isotopes. 2. THE BODY

2.1 Theoritical backround Stable isotopes analyses take advantage of the natural tracing of water, as a result of the alteration of their isotopic composition during the different stages of the hydrological cycle. Thus, isotopic analysis provides information about the movement of water masses. The stable isotopes widely used for water monitoring are the D (or 2H) and the 18O. The regions source altitude effects on the value of
18

O in groundwater. This effect is

proved to be homogenous for every region and for the Axios River Basin (Northern Greece) an altitude increase of 100m causes a decrease of the value of 18O by around 0,2 (Dotsika et al., 2010). A linear relation between D and 18O exists. In cases of recent rainfall water or superficial water that has not been through evaporation processes, the inclination of the respective line

450

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

has values between 6 and 8. Inclination values ranging from 4 to 6 are attributed to water that has gone through evaporation of important rate. It is noted that the correlation equation of rain water in Greece is as follows (Dotsika et al., 2009): 2=8,718 + 19,5. The respective equation for global rainfalls is 2=818 + 10 while the equation that expresses the rain water of Eastern Mediterranean is 2=818 + 22 (Craig 1961, Craig et al., 1963).

2.2 Study area Lake Koronia belongs to the water district of central Macedonia (10th water district) and consists the western part of the hydrologic basin of Mygdonia, in Northern Greece, covering an area of 778Km2. The study area is protected by the Ramsar Convection and several other national and European conventions, while it constitutes a complex wetland of great environmental importance. (Figure 1). The study area is situated on the geological boundary between the Serbomacedonian Massif and the Circum-Rhodope belt of Greece. The basement rocks are composed of metamorphic rocks of the pre-Alpine and Alpine periods, such as gneiss, amphibolites, shales, quartzites, marbles and granite. A series of mixed sediments (250m thick in average) of Miocene-Oligocene age is deposited over the basement rocks, consisting of clay, sand, conglomerates and marls (Psilovikos 1977). Normal active faults of E-W direction interrupt the geological formations and occur to the submersion of the basin (Traganos 1982, Mercier et al., 1979). In the Koronia catchment groundwater is hosted in an aquifer system consisting of two layers, providing both phreatic and under confined recharge conditions (Zalidis et al., 2004). The thickness of the aquifer layers increases progressively while moving towards the center of the catchment. Recent studies (Mylopoulos et al., 2007) led to the conclusion of interaction between the two layers and the partial interference of impermeable formations (i.e. clay).

2.3 Materials and methods Groundwater and surface water samples were collected during August 2011 and December 2011 respectively. In total, 18 water samples were collected, including 15 samples of groundwater (14 boreholes- with depths from 60m to 195m, 1 hot water of Langadas field-

451

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

sample D7), 2 samples of surface water (Koronia Lake and Mpogdanas River) and 1 sample of the drinking water of Langadas town. The analytical scheme included field measurements of pH, temperature and conductivity. Filtered (0,45 m), acidified (with 3 1:1) water samples (500 ml) were collected for determination of cations. Untreated samples were collected for analyses of anions. The major chemical constituents (Na+, K+, Ca2+, Mg2+, F-, Cl-, Br-, HCO 3 -), along with nutrients (NO 3 -, NO 2 -, SO 4 2-, PO 4 3-) were determined according to standard analytical methods (APHA, 1985) in the Balcan Environment Center, located in Langadas, Thessaloniki, Greece. Samples (not acidified) were also subjected to isotopic analysis of 18O and 2H. From all sampling locations 50 ml of water was taken under isotopic analysis and each water sample was measured twice. The analytical error is 0,1 for 18O and 1 for 2H. The 18O compositions of water in the samples were determined from CO 2 equilibrated with the water (Epstein and Mayeda, 1953). The 2H compositions of water were determined form the H 2 generated by the Zn-reduction method (Coleman et al., 1982). The isotopic analyses were made at the Stable Isotope Unit, National Centre for Scientific Research Democritos located in Athens, Greece, on a Thermo Scientific Delta V Plus mass spectrometer (Isotope Ratio Mass Spectrometer -I.R.M.S.). The results for 18O and 2H are expressed in the conventional notation: as differences from Standard Mean Ocean Water (SMOW). 2.4 Hydrochemistry Water samples have been analyzed for the main constituents (Table 1). On the basis of the contents of the seven ion species, the water samples may be categorized in 6 chemical types, as follows:

Calcium-bicarbonate (Ca-HCO 3 ) waters: In total, six out of 18 samples (33,3% in total and 40% of groundwater samples) belong to this group (samples D1, D6, D9, D11, D12 and D14). Their average values of temperature, pH and TDS are equal to 26,2oC, 7,5 and 299,5 mg/l respectively. In this group, the water samples of the Ca(Na)-HCO 3 type could also be joint, representing in total another 33,3% (groundwater samples D4, D5, D13, D15, surface water from Mpogdanas river and drinking water of Langadas). Alkaline-bicarbonate (Na-HCO 3 ) waters: Three (D2, D3 and D10) samples of groundwater belong to this group, representing 16,7% in total. Their temperature ranges from 24oC to 28oC, their pH from 7,9 to 8 and their TDS from 362 mg/l to 373 mg/l. In this group the groundwater sample D8 is also added, presenting Na(Ca)-HCO 3 chemical composition.

452

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Two more chemical types in water samples appear in the catchment: Na-HCO 3 (Cl) representing the lake sample and Na-SO 4 (HCO 3 ) representing the hot water from Langadas field. The chemical correlations (Na+, K+, Ca2+ and Mg2+ with Cl-) (Figure 2) of water samples do not resemble to those of sea water, suggesting their meteoric origin. Additional evidence for the meteoric origin of groundwater and surface water provides the Cl/Br ratio (Figure 3). The higher ionic charge of water samples compared to meteoric water is attributed either to marine aerosols or to the interaction water-rock, as described below. The chemical composition of the groundwater samples, as described above, shows the presence of two separate aquifers: one shallow calcareous aquifer and a subjacent alkaline, deeper one. The predominance of Ca2+ in the shallow aquifer is connected with the dissolution of calcareous rocks and indicates a shallow and short-lasting water circulation. On the other hand, the Na+ abundance of the second aquifer suggests a deeper and longer lasting circulation of water, allowing the interaction between silicate environmental rocks and groundwater. The strong correlation between F- and Cl- contents demonstrates also the interaction between silicate rocks and water. The intermediate chemical water types indicate the mixing of the two different aquifers. The chemical composition of hot water is similar to that of cold samples, suggesting the mixing between aquifers during the upward movement of hot water. In addition, direct communication of the shallow aquifer with Mpogdanas River is indicated through chemical water types, while lake water sample is slightly differentiated from groundwater samples, suggesting also their communication.

2.4 Isotopic composition In Figure 4 the isotopic values of the samples (Table 1), the isotopic composition of seawater, the Global Meteoric Water Line (GMWL), the East Mediterranean Water Line (EMWL) and the Hellenic Meteoric Water Line (HMWL) are presented. The samples of groundwater and surface water are plotted in the field designated by the GMWL and the EMWL, as well as, on the HMWL, except for the water sample of Koronia Lake. The equation describing the relationship between 18O and 2H for the study area is as follows: 2 () = 4,47 18 () 15,04 (R2=0,7). The deviation of the Koronia sample from the line of rainwater is related with evaporation processes on the lakes surface. This can be seen by the slope of the region line (around 4,5),

453

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

which could be attributed to superficial evaporation and also to mixing with seawater, a case that would enrich the aquifers significantly in Cl-, a fact that is not observed in this case. Indeed, a slope between 4 and 6 is attributed to meteoric waters that have been through evaporation (Craig 1961, Craig et al., 1963). The values measured in groundwater samples are homogenous; proving the mixing between the aquifers, while surface water values are similar to those of groundwater, indicating their communication. The values of the samples create two separate groups. The first group has isotopic composition of 18O lower than -8 and the second group higher than -8. The values of water are homogenous in each group and they plot in the field of Hellenic Meteoric Water. In the first group (values lower than -8) an isotopic enrichment is observed in comparison with the water samples of the first group. This isotopic enrichment could be attributed to different source altitude. The enrichment zone could be determined by the use of isotopic degree, which is the relation that connects heavy isotopes of the water with altitude. In this study the
18

O degree is used because its measurements are more precise and comparison

values were available in bibliography (Dotsika et al., 2010). Taking into account the isotopic degree of 18O of the Axios basin (0,2/100 m) and the difference of the 18O values of the two groups (2) it seems that the supply zone of the first group is 1000m higher than this of the second group.

CONCLUSION

In conclusion, the main origin of both groundwater and surface water in the Koronia wetland is meteoric. Regarding groundwater, two different aquifers are developed: a shallow, calcareous one and a second deeper, alkaline. Mixed chemical types of water prove their interaction. Isotope analyses show two zones of source altitude, located in a level difference of 1000m. Moreover, lake-aquifer interaction is suggested, both of isotope and chemical evidence.

454

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCES APHA, AWWA and WPCF (1995). Standard Methods for the examination of water and wastewater, 18th edition, Washington DC. Coleman, M.L., Shepard, T.J., Durham, J.J., Rouse, J.E., Moore, G.R., (1982). Reduction of water with zinc for hydrogen analysis. Anal. Chem. 54, 993995.

Craig, H. (1961). Isotopic variations in meteoric waters. Science 133:91-404. Craig, H., Gordon, L.I., Horibe, Y. (1963). Isotopic exchange effects in the evaporation of water. 1: Low temperature experimental results. Journal of Geophysical Research 68, 5079-5087. Dotsika E., Lykoudis S., Poutoukis D., (2010): Spatial distribution of the isotopic composition of precipitation and spring water in Greece. Global and Planetary Change, 71, 141-149. Epstein, S., Mayeda, T., (1953). Variation of Geochim. Cosmochim. Acta 4, 213224. Mercier, J., Mouyaris, C., Simeakis, T., Angelighis, C (1979). Intra-plate deformation: a quantitative study of the faults activated by the 1978 Thessaloniki earthquakes. Nature 278: 45-48. Mylopoulos, N., Mylopoulos, Y., Veranis, N., Tolikas, D. (2007). Groundwater modeling and management in a complex lake-aquifer system. Water Resour Menage (2007) 21:469-494. DOI 10.1007/s11209-006-9025-3. Psilovikos, A. (1977): Paleographic evolution of the Mygdonia basin, PhD Thessis, Aristotle University, Greece (in Greek). Traganos, G. (1982). Preformed report on geothermal exploration in the basin of Mygdonia. Solicitous study, Athens, p.28, in Greek. Zalidis, G.C.., Takavakoglou, V. and Alexandridis, Th. (2004): Revised Restoration Plan of Lake Koronia. Aristotle University of Thessaloniki, Department of Agronomy, Laboratory of Applied Soil Science, Pages 236+Annexes, in Greek, English Summary.
18

O content of waters from natural sources.

455

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 1: Koronia catchment, water samples and their water chemical type

456

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure2: Ion correlation (Na+, K+, Ca2+, Mg2+ to Cl-) for the water samples collected in the Koronia wetland.

457

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 3: Correlation between Cl- and Br- for the water samples collected in the Koronia wetland

458

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Figure 4: Isotopic composition of water samples.

459

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Sample D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 D11 D12 D13 D14 D15 Mpogdanas Lagkadas Koronia

Na+ 3,8 6 6 3 5,9 1,6 6,3 4,1 2,4 8,1 1,2 1,8 4 1,3 3,8 1,9 1,3 119,3

K+ 0,06 0,07 0,09 0,06 0,04 0,07 0,14 0,07 0,02 0,05 0,01 0,04 0,06 0,03 0,08 0,09 0,04 0,78

Ca2+ 6,3 3,3 2,7 5,5 7,8 6,1 4,5 3,7 5,8 3,3 5,0 5,3 4,0 6,6 3,8 2,5 2,8 2,5

Mg2+ 2,8 1,4 1,0 2,6 5,0 3,0 2,0 1,6 1,9 0,9 1,6 2,4 1,8 1,5 1,6 1,6 1,3 28,6

F0,01 0,17 0,11 0,04 0,03 0,02 0,11 0,13 0,01 0,06 0,01 0,01 0,03 0,01 0,13 0,02 0,04 0,13

Cl1,55 1,43 0,84 1,66 6,56 1,35 0,53 0,38 0,74 2,07 0,68 1,38 0,72 0,64 0,58 1,49 0,93 48,24

Br0,002 0,002 0,001 0,001 0,003 0,001 0,001 0,001 0,001 0,004 0,001 0,000 0,001 0,000 n.d. 0,001 0,001 0,044

SO 4 20,83 1,40 2,59 1,30 0,99 1,30 3,45 1,50 1,23 0,51 0,83 0,93 0,54 0,84 1,41 0,72 0,86 37,6

HCO 3 10 7,4 6,0 7,2 10,6 6,3 8,6 7,3 7,2 9,6 6,1 6,8 8,6 7,7 6,7 3,5 2,9 52

Chemical type Ca-HCO 3 Na-HCO 3 Na-HCO 3 Ca(Na)-HCO 3 Ca(Na)-HCO 3 Ca-HCO 3 Na-SO 4 (HCO 3 ) Na(Ca)-HCO 3 Ca-HCO 3 Na-HCO 3 Ca-HCO 3 Ca-HCO 3 Ca(Na)-HCO 3 Ca-HCO 3 Ca(Na)-HCO 3 Ca(Na)-HCO 3 Ca(Na)-HCO 3 Na-HCO 3 (Cl)

18 -7,7 -8,2 -9,0 -7,8 -7,6 -8,0 -7,1 -7,6 -7,8 -8,5 -9,0 -7,3 -8,1 -8,0 -6,6

2 -49 -51 -58 -47,5 -50,1 -51,5 -48 -49 -47,5 -51,7 -47,5 -54 -55 -49,8 -52 -51 -49

460

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

461

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PROJECT TASKS AND CONNECTING ISSBS WITH FIRMS ISSBS Gregor Jagodi, ISSBS, Slovenija gregor.jagodic@mfdps.si ABSTRACT This contribution represents a method of connection between faculty and businesses. Given the fact that the economy/companies associated with the lack of integration with higher education institutions and faculties, the concept of working ISSBS in this respect differs significantly. Companies are due to difficult market conditions and unrelenting struggle for survival, are insufficiently aware of the possibilities and opportunities that could be harnessed to improve their situation. One of these is certainly cooperation with universities, where they potential employees attend schooling/training. The concept, which was developed in ISSBS, is aimed at businesses. Students in the course of his study program at the subjects Enterprise or Business creation and growth, are faced with preparing a business plan for the business idea of their choice. In the framework of this course also includes preparation of project tasks that must be business oriented. Of course, we could offer in terms of case studies of foreign examples, but for our small and competitive economic environment are not the most suitable. Faculty in different ways seek potential business, which could lead to a project task, and with them the purpose and objectives of the project work. Main goal of the company and the faculty is greater integration of theoretical knowledge and practical business activity, according to market conditions in which the company functions. Networking between faculty, students and businesses have a positive impact on employment opportunities, while the latter enables companies to reduce their operating costs, since students have the solutions written in the context of project tasks, can help faster and with less cost to improve its operations. Keyword: enterprise, cooperation, project performance, employment, competitiveness

462

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Slovenian companies are in cooperation very passive. Small and medium-sized companies mainly rely primarily on their own knowledge and experience (Antoni et al, 2002). From their mode of action, that are self sufficient. This way of thinking makes the ways of functioning on the market. Limitations described in essence initiates the closing of the environment and too much focus on its operations, which in the vast majority is not organized enough rational. In cases where there are available options, which are often even free for participants, most of these companies does not respond, because they are sure to have all the knowledge and that no one can help them in their operations due to its specific activity. Some companies go even further and on invitations to participate reply that they are not interested, that they have to deal with the crisis market conditions and that they hardly survive. Sublimity of this does not help much that could be rescued from this situation, therefore, should be aware of the need to change mindsets and, consequently, also its operation. In short, we should adapt to market conditions in which they operate, but they do not know how, unable, or even refuse to do (Ruzzier et al, 2008). Faculty wants in its curriculum to offer students the value added in the upcoming content. Students in the case of project tasks - as cooperation with businesses, learn most, because they have all the information resources of the company and support skilled and business-oriented speakers, which in these activities encourage, guide and assist them in finding the best possible solution (Jagodi and Dermol 2012). This added value, companies should recognize as beneficial to themselves and become actively involved in co-operation. This would have considerable potential to influence the content of courses and enrichment, which would clearly benefit to all involved.

MEANS OF COOPERATION AND IMPLEMENTATION OF THE ACTIVITY

Since the companies have lack of independent interest for the integration and cooperation, it takes a lot of activities by ISSBS that companies involved. The integration is largely dependent also on the engagement of lecturers who engage companies and their owners to participate.

463

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.1

Getting companies to participate

At the beginning companies did not have a lot of interest to participate in the project tasks. We tested several possible ways of inviting them to: mailing; information through monthly notices RGZC 1; direct mail and invitation to participate; meetings with recruiters at various companies where students are engaged in professional practice; lecturers personal acquaintance with the owners, directors or managers of companies. As the most successful approach was shown the personal acquaintances of lecturers with owners, directors or managers of enterprises. In this way it was possible to present a number of advantages and benefits of participation by enterprises, as well as confidence in the success of the activity was greater because of acquaintances and business connections outside the curriculum of the Faculty. The most interesting is the fact that many companies have not responded to invitation of RGZC, which was invited to participate in their monthly notices. Many directors of these companies are even in RGZC board, but who nevertheless chose not to participate. They probably think in the direction that students who have no work experience, can not help to solve their business situations in which they find themselves, while neglecting the fact that, precisely because they are not burdened with the operation of company, are a potential source of great ideas that companies can deliver better performance and more competitive market, new product development and in particular for increased adaptation of products and services to customers (Lans et al 2008; Gribben 2010, Holcomb et al 2009, Bird 1988, Boyd Vozikis 1994). First companies have been very satisfied with this projects tasks, so they wanted to further cooperation and a more detailed treatment of difficult situations with which they met in the course of his business. Their satisfaction with the results of projects tasks have been also provided to its business partners and fellow entrepreneurs. Now some companies already seek alone the possibilities for cooperation within the framework of project tasks.

RGZC - Regional Chamber of Commerce, Celje

464

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.2

Modes of implementation of cooperation

On ISSBS we approached to carry out cooperation professionally, enthusiastically and with a full measure of responsibility. Our first step was to examine the potential companies that are available, depending on market conditions and their market position. Firstly, we calibrated primarily on companies in the region, which is easier to carry out frequent contact during the preparation of project tasks. Based on careful analysis of the potential companies, we have prepared proposals, which the project work would be of interest for selected potential companies. With such molded basic templates, we contacted the companies or its owners, directors or managers, and agreed to the meeting at which we could present opportunities for cooperation. Presentations were animated and sure enough, that we are the right partner for them and that they are then in their companies, with management board members or managers of areas, prepared project proposals for this tasks. Table 1: Review the number of topics and firms by year of implementation year 2010 2011 2012* Number of firms 2 8 10 Number of topics 7 9 16

Source: Own by Jagodi


* in 2012 is based on the number of businesses and functions only for the period January to April

This was the basis for preparing the description of the company's performance and status in the industry. We have also added the purpose and objectives of the project work, which the final project report must fullfil and a proposed solution could help the company to resolve the situation. Such a proposal companies then supplement and transform and they prepare a short presentation to a group of students who will write the project work. The presentation was conducted as part of regular lectures and the students are obtained for next to get known with the topic, objectives and expectations of project tasks, meanwhile they also realized the market situation in which companies operate and the problems they have to face. Students have 8 weeks to prepare the content of project work within are constantly monitored, supported and directed by professionally qualified tutor who has plenty of its own corporate experience. Mentor also works with management of the company, thereby ensuring the relevance of the project work.

465

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

At the end is followed a public presentation of project tasks. In this context, are gather in addition to the companies for which they wrote of the project work and other potential companies who want in the future the task of writing it, or generally interested public. Companies and mentor, together assess the performance of the project work and public presentations, and the give additional questions, which help to explain the proposed solution.

2.3

The added value for stakeholders

What is the primary meaning of the project work and their public presentation, stakeholders can assess, which we are able to define it as: companies that was making the project work for; Students in groups that are preparing the project work; Faculty and The interested public. Companies get insight into the basic theoretical knowledge of students, understanding the business problem, which was delivered, and the ability to present possible solutions to this situation that the enterprise operation should require minimal financial inputs and provide abundant yield. In addition, they have the opportunity to assess which of the students (students in the group that were preparing project work for company, as well as from other groups), have a large enough potential for them, it would be worth thinking about to be offered opportunity to participate prior to employment and the assessment of the ability to understand the business environment companies. Companies whit this significantly reduce the cost of staffing and also reduce the time to introduce new employees to full functional capacity (Sandberg 2000, Brown 1993, Richey 2000). Students with the preparation of the project work get the skills of teamwork, basic research, collaboration, analysis and understanding of the business world. In addition, a public hearing on completed projects gives them the opportunity to represent to potential employers, thereby increasing their employment opportunities after graduation. Just getting the practical experience with the research problem allows them to significantly speed up understanding of the business environment and faster integration into the collectives of enterprises, where they will be looking for market opportunities for their career (Lans et al 2008; Dermol 2010, Erikson 2003). The faculty ISSBS with this way of working gains the reputation, and of course in terms of desirability for study participation in its programs to potential new students. Not only this gives graduates a great traveler in the form of invaluable and versatile skills, but this also affects their improved employability. This is of course fundamental mission, with this mission

466

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

to help companies to come as quickly as possible with as little cost to the best potential employees that will enable the development of these enterprises. Interested public and companies that are considering participation in the project tasks, are gaining because they mingle with potential candidates, can see and evaluate their skills and understanding of the business environment, as well as the possibility of using the presented ideas in its business environment.

2.4

Opportunities for enhancing cooperation in the future

Opportunities that we see in the future, are mainly in the fact that ISSBS wants to become a central element networking among students, public institutions and enterprises, as well as take care of technological development and prosperity of the region. We can do this only if the companies will recognize in our efforts its benefits and to exploit them for their better performance. Opportunities for cooperation are not only in the context of project work, but also through participation in various committees, meetings and conferences, demonstrations and general recruitment and searching for potential employees. Participation, of course, brings benefits to all stakeholders and has a positive impact on the social environment and the perception of opportunities by students.

CONCLUSION

The time of crisis is ideal for connecting companies with the faculty, because the companies need fresh ideas and approaches to the market, enabling them to competitive struggle for existence and strengthening of market share. And the easiest way is education of potential employees who could contribute with their ideas, innovative approaches and understanding of consumer behavior, contribute to improving the business, and through project work to know the business world. The benefits are mutual, and provide businesses with lower cost, unencumbered views on resolving the situations in which they find themselves, especially a lot of flexible options verification of potential, future employees, before the company has to their employment be costly.

467

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

So we can say that ISSBS acts as an interface between suppliers and demanders, and demanders have much better conditions for the selection and review of potential candidates, as in the case of notice of vacancy and search for suitable candidates within the framework of classical selections.

468

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Antoni, B. Hisrich, R. D. Petrin, T. in Vahi, A. (2002). Podjetnitvo. Ljubljana: GV zaloba. Bird, B. (1988). Implementing Entrepreneurial Ideas: The Case for Intention. Academy of Management Review, Vol. 13, No. 3, str. 442 - 453. Brown, R. B. (1993). Meta-competence: A recipe for reframing the competence debate. Personnel Review, Vol. 22, No. 6, str. 25 - 36. Boyd, N. G. in Vozikis, G. S. (1994) The Influence of Self-Efficacy on the Development of Entrepreneurial Intentions and Actions. Entrepreneurship: Theory & Practice, Vol. 18, No. 4, str. 63 - 77. Dermol, V. (2010). Usposabljanja zaposlenih in njihov vpliv na organizacijsko uenje in uspenost v slovenskih storitvenih podjetjih (doktorska disertacija). Ljubljana: Ekonomska fakulteta, Univerza v Ljubljani. Erikson, T. (2003) Towards a taxonomy of entrepreneurial learning experience among potential entrepreneurs. Journal of small business and enterprise development, Vol. 10, No. 1, str. 106 - 112. Gribben, A. (2010). ETF Pilot Project _Entrepreneurship in Higher Education_ Phase 2. Belfast. Holcomb, T. R. Ireland, R. D. Holmes Jr. R. M. in Hitt, M. A. (2009). Architecture of Entrepreneurial Learning: Exploring the Link Among Heuristics, Knowledge, and Action. Entrepreneurship: Theory & Practice, Vol 33, No. 1, str. 167 - 192. Jagodi, G. in Dermol, V. (2012). Biti podjeten, biti inovativen biti podjetnik. Celje: ISSBS. Lans, T. in Hulsink, W. Baert, H. Mulder, M. (2008). Entrepreneurship education and training in small business context: Insights from the competence-based approach. Journal of Enterprising Culture, Vol 16, No. 4, str. 363-383. Richey, R. (2000). The legacy of Robert M. Gagne. In The legacy of Robert M. Gagne (p. 295), ERIC Clearinghouse on Information and Technology, Syracuse, NY. Ruzzier, M., Antoni, B., Bratkovi, T. in Hisrich, R. D. (2008). Podjetnitvo. Koper: Drutvo za akademske in aplikativne raziskave. Sandberg, J. (2000). Understanding human competence at work: an interpretetive approach. Academy of Management Journal, Vol 43, No. 1, str. 9 - 25.

469

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PROMOTING ENTREPRENEURSHIP AS A SOLUTION FOR CRISIS

Tanja Micalevska 1, Ana Petrovska2


1

Faculty of economics - Prilep,Prilep, Republic of Macedonia


2

Faculty of education,Bitola,Republic ofMacedonia

tanja.micalevska@gmail.com, 2anickabt@yahoo.com

ABSTRACT It is a fact that we live in a time when the world faces crisis. First, it was the credit crunch in the United States of America, then the crisis of public debt in the Euro zone. We analyzed the factors that caused the crisis and the events that marked the period 2007-2011. These events led to reductions of the worldwide production and decreases of the international trade, causing turbulences in the financial markets. Indeed, the world is now facing some of the consequences, but others are yet to be seen. The solutions for dealing with the crisis implications can be found in the enterpreurship. Entrepreneurs create innovation, take risks, combine, recombine and substitute resources in order to use them in the most productive way. They establish small and medium enterprises and enhance the countries economic structure. Moreover, the entrepreneurship can be used as an enormous employment potential. By studying and improving it, we can fulfill one semingly distant vision and may achieve greater productivity. Therefore, we would like to highlight the gains of studing the discipline of Entrepreneurship such as achieving economical, social and environmental development. Keyword: global economic crisis, entrepreneurship, measures.

470

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1 INTRODUCTION It is a fact that we live in a time when the world faces crisis. First, it was the credit crunch in the United States of America, then the crisis of public debt in the Euro zone. Indeed, the world is now facing some of the consequences, but others are yet to be seen. The solutions for dealing with the crisis implications can be found in the enterpreurship. 2 THE GLOBAL ECONOMIC CRISIS The global financial crisis began in 2008. The origin of this crisis are in the United States of America (U.S.A), but it soon spread throughout Europe and Asia

2.1

The credit crunch in USA

One of the most important factors for the credit crunch is the continued reduction in interest rates in the U.S.A from 2001 to 2004, when it stabilized at 1% (Board 2011). Another important factor is the reducing of the legislation in the sphere of regulation of the financial sector. Here you can highlight the withdrawal of "The Glass-Steagall Act" (Munchau 2010). Apart from the deregulation in the financial system, significant failure of the regulations is their circumvention by means of financial innovation such as the process of securitization. Securitization is a process through which the issuer creates a financial instrument by combining other financial assets, and then sells the group of "repackaged" instruments to investors (Dictionary n.d.). In other words, it allows conversion of illiquid assets (mortgages) in liquid securities ABS (Asset-backed securities) and MBS (Mortgagebacked securities) and CDO ( Colateralized Debt Obligation), which are used for further sale to investors. Over time were made more complex innovations were made such as CDS (Collateralized Debt Securities), which were insurance of CDO, but they were created as swap arrangements. Therefore the rules that apply to insurance policies did not apply for them. Low interest rates in the U.S. caused to increase the number of mortgage loans for houses. Banks through the process of securitization turned mortgages into marketable securities and sold them to investors. In the period from 2003 to 2005 prices of houses continuously grow. Blinded by greed for higher profits, banks began to offer mortgage loans for poorer families who did not meet the criteria for getting a loan. These loans are called subprime mortages. With rising interest rates by the FED in 2004 and 2006 (Board 2011), many borrowers could not pay debts and their houses were confiscated and sold. That led to a

471

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

drastic reduction in the price of houses. With the decline in the price of houses, cash flows expected from mortgages declined. Investors began to realize losses. Banks had kept part of the CDS instrument in their own balance. The inflow of these investments became uncertain and many financial institutions suffered losses in billions of dollars. Some of them are Bearn Stearns, the two largest companies for support the mortgage lending in U.S.A - Fannie Mae and Freddie Mac, Lehman Brothers, the largest insurance company AIG. Measures for dealling with the crisis were undertaken. One of them is the TARP (Troubled Asset Relief Program). After the election of Barack Obama for president, he introduced a new stabilization plan. Apart from this plan other measures were taken such as monetary (policy of zero interest rates, quantitative easing) and fiscal measures - plan for recovery and reinvestment. The crisis in the U.S. officially ended in June 2009. In Europe, the impact of the crisis continued. 2.2 The crisis in Europe The global crisis that happened in USA in 2008 affected almost every country in Europe. Many of the countries experienced reduction in production, employment and investments. First country in the euro area hit by the financial crisis was Greece. The country was the most indebted of all countries in the euro zone. It also appeared the danger that Greece would not be able to pay the debt for government bonds, which matured in 2010. Concerned about the situation in Greece, authorities started reforms: austerity plan preparation, tax increases, freezing salaries and pensions. These actions of the government were not accepted by the population and caused political unrest. This situation has hampered the implementation of the reforms and negatively impacted the value of the euro. To avoid further decline in value, and loss of confidence in the currency, the European Union together with the IMF offered aid to Greece in the form of loan. The amount available in the first year was 110 billion euro, of which 30 billion provided by IMF and 80 billion by euro area. In 2011 the country faced another threat of bankruptcy. Therefore, the IMF decided in March to grant another loan of 4.1 billion dollars. In future, as part of a plan for privatization, the country will sell uninhabited islands. However, most important measure taken was the reduction by half from debt at the meeting of European leaders in Octobar 2011. The future of Greece is still uncertain. Other countries affected by the crisis were Ireland, Italy, Portugal and Spain.

472

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2.3 Crisis implications The economic crisis has had severe impacts on the real economy, economic growth and development, as well as world trade. Foreign direct investments and other investments have fallen drastically. The main reasons for the decline are : 1)lost confidence in the financial system, 2) lack of demand globally 3) the existence of supply chains in the modern world 4) measures taken by governments in response to the crisis to increase the production activity and employment. In early 2010 the situation improved. However, the problem of unemployment continue to concern policymakers in the countries. Fugure 1

Source: www.ilo.org 3 ENTREPRENEURSHIP AS SOLUTION FOR CRISIS

Bad times are good times for startups. - Bill Warner

It is a fact that we live in a time when the world faces bad times. In the last few years in almost every country people face problems such as unemployment, poverty, financial difficulties and so on. Much of the population despair because of low incomes or no incomes at all. In our research we are interested in those people who do not leave things to run by themselves but rather take destiny into their own hands. Specifically we are interested about population that fosters entrepreneurial spirit.

473

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

We can classify a man as a person that has entrepreneurial spirit if he can see the invisible or better said he can look beyond what appears at first glance. Entrepreneur is willing to risk, experiencies problems as challenges, is result oriented, possesses energy and

internal motivation to complete the deals, have capacity for great work. Other characteristics of entrepreneurs are striving for excellence, optimism, possessing organizational skills,

needfor independence. They are people who are responsible, comprehensive, ready for change. Entrepreneurs create innovations, take risks, combine, recombine and substitute resources in order to use them in the most productive way. The entrepreneurs with the establishment of small and medium enterprises enhance the countries economic structure. Also, they provide increase in the supply of various goods and services, maintain a satisfactory level of competition and improve the efficiency of the markets (Taki Fiti 2007). Enterpreurship can be used as a strategic intervention that could accelerate the development process in post crisis period. This can be accomplished if we realize that firms based on constant innovation can become life-saviors in times of crisis. So far, governments the world over have been handing large financial packages to big banks, auto companies, and large infrastructure items. Instead that, governments should focus on creating the context for entrepreneurship to flourish. They can take actions like creating supportive politics in order to improve the business climate and institutional infrastructure. Also they should promote entrepreneurship in education and offer courses and training programs. Creating favorable political environment and improving the business climate includes providing (Best Practice Guide for a Possitive Business and Investment climate 2006) Security (if companies do not believe that their people and assets will be secure, then they will not believe this of their investments either), Legislative stability (Constantly changing legislation aects the ability of investors to project their returns. Moreover, adjusting business practices such as accounting and auditing, environmental outputs and workforce management adds to an investors cost) Transparency (Greater transparency is a greater degree of communication with the public) Corruption (corruption through lobbying, relationship-building, use of the media and other tactics costs investors both money and time)

474

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Tax policy (ineective, discriminatory taxation policies can discourage the payment of taxes by taxpayers.) Investment in infrastructure (roads, transport networks, utility distribution networks, water supply, telecommunications networks, public services) Facilitate financing through banks and promote alternative modes of financing. Promoting entrepreneurship in education is another very important issue. By studying and improving it, we can fulfill one semingly distant vision and may achieve greater productivity. Many countries in EU made efforts to introduce entrepreneurship to pupils in primary and secondary school. Except in formal education learning programs and trainings should be included in informal education. Organizang seminars, conferences and workshops is of particular importance. There participants can present their ideas, communicate with each other, exchange experiences, gain practical knowledge and skills. Also, can be added the courses of foreign languages as a vital tool in the business world.

CONCLUSION

The solutions for dealing with the crisis implications can be found in the enterpreurship. The entrepreneurship can be used as an enormous employment potential. We want to offer a few areas: The first area is the so-called green initiatives. Today people give a huge importance to the environment, the health of the population, alternatives sources of energy etc. Young entrepreneurs should invest in these initiatives by working with technologies that protect the environment, opening stores for healthy food, finding better methods for production. In many countries there are benefits for this type of investments. Another area is running business online. This can help entrepreneurs to save a lot of time and money. Moreover it is very important for business to be continuously available for its customers, to constantly meet their needs, to examine the market and adapt their behavior to it. Nowadays the existence of a business online is not only an advantage but a necessity. The more information technology develops the more working with technologies that protect the environment, opening stores for healthy food, finding better methods for production. In many countries there are benefits for this type of investments.

475

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Baxter, Samuel C. 2011."Beyond the EU Debt Crisis." The Real Truth. Real Truth. http://www.realtruth.org/articles/110228-001-europe.html (3.5. 2011). BBC.2008.US bail out Freddie and Fannie. http://news.bbc.co.uk/2/hi/americas/7603166.stm (23.3. 2011). OSCE. 2006.Best Practice Guide for a Possitive Business and Investment climate. Viena Board, Federal Reserve.2011. "Selected Interest Rates--Historical Data." Economic Research & Data. Board of Governors of the Federal Reserve System. http://www.federalreserve.gov/releases/h15/data.htm (13.4. 2011). Dealbook.2008."JPMorgan Raises Bear Bid to $10 Per Share." DealBook. The New York Times Company. http://dealbook.nytimes.com/2008/03/24/jpmorgan-raises-bear-bid-to-10per-share/ (21.3. 2011). Dictionary. Securitization. Investopedia ULC. http://www.investopedia.com/terms/s/securitization.asp (16.3.2011). Munchau, W.2010. The Meltdown Years: The Unfolding of the Global Economic Crisis. Munchen: Carl Hanser Verlag. Fiti.T. HadzinVasileva-Markovska.V.Bejtmen.M.2007. Entrepreneurship. Skopje: Faculty of economics.

476

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PROSOPON IN THE CONTEMPORARY ART


Josep Tornero Sanchis, University of Murcia, Spain josep.tornero@um.es

Abstract
The genealogy of the symbolized face in the visual arts, together with the genealogy of the imago, constitutes a transmission way whose symbolic values refer to sacred signs: hierophanies (M. Eliade, 1998, pp. 14-15). The difficult of the symbolic transmission of these hierophanies lies, as it is expressed by Eliade himself, in the effort and the discomfort against to what we would understand today for an opposition to the moral reality. But the representation of a face as imago can only makes references, from his own hermeneutic knot, to that sacred which has formed and has put into context the womb nucleus that we still denominate as western culture.

Keywords: prosopon, sacred, face, mask, person, Greek tragedy, hypostasis, symbolism

477

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1.

INTRODUCTION

An etymology of the face. The etymological history of the face gives us back an origin full of ambivalences. From the Greek prosopon (): person, mask, surface but also, vultus, faade and face. Prosopon is what is shown, what appears in front as the prefix pro indicates. The face is what faces forward, what is put before the eyes, what is put in front, forward, what is offered. It is at the same time the mask, the passing to the strange, and the other, to the indefinable and to the otherness, through oneself. The diffused limits among the god, the animal and the man are sensed in prosopon. Mask and face are presented in the same way, they face up to the look, they are proposed in the face to face. The person, the character, appears as third meaning and at the same time, as transfiguration, metamorphosis; in that unit that is prosopon as hypostasis, of the transfiguration of an individual that, in the archaic Greece, had not been formed as individual yet, not even exposed, as we see, to the problem founded in reason and modernity that identify us from the own concept of identity with an unit based in the substance ego.

2. PROSOPON AND THE PATHOS AS SYMBOLIC VALUE OF THE GREEK TRAGEDY.

The current diversity in the representation of the face deals with the problem of the identity from all theoretical assumption in a contemporary framework in what, as says Agamben, it makes necessary rethink the own concept of identity from beginning to the end from an identity post historical that it is an identity without person, a split between both figures that block, for the thinker, the personal ethical principles which have dominated the western ethic for centuries (2011, p. 70).

In order to cover a wider conception of the process of diversity which metamorphoses in his visual essence, as it would say George Simmel (2006), or to define it together

478

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

with Didi-Huberman (2008, 2009): as the return of a pathos that makes explode before us the history of the images, at this point, we will look through the researches of JeanPierre Vernant in order to come close to the Greek figure of Dionisos, the incarnation of the other, already exposed in Nietzsches philosophy (2000). It is here where appears sacred powers which are demonstrated in the own Dionysian otherness, in the own individual otherness through prosopon. In that sort of exchanges of games and affects between the Greek men and the deity was accepted the otherness as part of the unit, of oneself. That is, the god turns into an image of men through prosopon, it offers a representation that concerns face, a human appearance, in that flow of likeness between the divine and the human (J. Clair, 1999, p. 182). It is in that hierophany of the own polysemy of prosopon where it is carried out an ethical and moral responsibility in the greek people, where the other, embody at the same time by the individual and the deity, forms part of the corpus of holiness trough face, mask and person the character which obtains each one of the entities that take part in the diffused limits of the possession, of the use of the mask and her equivalence to a transfiguration: the hypostasis god-man-animal.

2.1.

Prosopon as hypostasis.

In The Gay Science, F. Nietzsche gives to aphorism 361 the following title: Of the problem of the actor (Nietzsche, 2002 (1881), 361). Presented this product as a problem, that is, as a phenomenon which appears, according to F. Nietzsche, as realityappearance which is linked with the essence of the artist, who assumes the role of the other, needing that falseness by means of the mask, like knowledge instrument of the other. The prophet of a social interaction of masks, as Beln Altuna reproach him (2010), place himself, curiously, in a moral and ethical side that concern more the classical tradition than the Germany romanticism theories.

479

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The association is not accidental, but rather it makes evidence when we check encodings of aesthetic experiences in the classical antiquity. By this way, we find in Horace, in his poetry, the artist in need of adopting different masks and faces. What is hidden behind those masks not is his more real ego, but Horace, in a sense that we will have to precise later on, is those faces and those roles. And it is in those faces and those masks, in those different characters of the theatrum mundi in which we live in, where the necessity of social and moral integrity comes up. (Salvador Mas, 2006, pp. 259-260). The current controversy starts in 1929, moment in which appears The scientific conception of the world as positive utopia, Freud answers in a sceptical way with the El malestar en la cultura, where the traps and virtues of the language are reconsidered. It is also when Jung will publish a series of essays which will cover the unconscious mind terms and the individuation problems, taking up, in one of his essays, the phenomenon of the greek actor and the mask as definition model of the different personal characters of the individual again, pointing out the person etymology as first count of the analysis of each person. (Carl Gustav Jung, 2010, p. 71).

Also, the mask reveals us horror, the tremendum, the abyss that reflects the ineffable Other. Abyssus abyssum invocat (the abyss invokes the abyss). Vernant will point out the Gorgona mask as the passage to the death; the previous instant before entering the realm of Hades. In his eyes we see the phantom that we are, the stone, the spectrum in which we have turned into. From the hyperborean world, far away from immortals and mortals, in Gorgo involves an unifying point between both of them. His otherness is multiplied, embodies the face of the war fury. It is the face of the vast hbris, the head and the last facies that we see as emissary of the death. (J-P. Vernant, 2001, p. 64).

In this manifestation of the sacred through the represented face, we should still stop in this new term: the head, kar, is the complete human being in the dead world. A hooded head, hiding in the night, like among darkness, through them, blurred in the opaque reflection. Maybe a head without face (J. Clair, 1999, p. 186). A new term that insists on different symbolic values of the sacred which have to do with the representation of the face. But beyond the association of blotting out the human trace which is referred by Clair, the kar could be equivalent to psyche in Homer still far from the concept of the soul in the Early Modern History, but linked to the sacred significantly, to the

480

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

strange relation between life and death and the own entity of Persfone, since both terms are interchangeable on occasions (Jan N. Bremmer, 2002, p. 27). Head and kar are used in The Iliad (I.3, XI.55) and in The Odyssey (3.74, 2.237) without distinction, but that ambiguity in the terms involves the possibility that both of them represented the same thing, that is, the whole person (Jan N. Bremmer, op.cit.).

In the several symbolic values which coexist in each representation of the face there is a new moral and ethic approach that, beyond the facies, the face, and the vultus beyond the own identity of the individual; the classical tradition in her pluralism, in her polytheism, reappears with her great symbolic powder to ask us and to cohabit in that muddy field of the postmodern era where the identity and the person seem to have arrived to an irrevocable split.

3.

CONCLUSION

With the postmodern era, the recognition and the personal identity take place from the machine and because of the machine, moving away from face to face. If the biomechanics has split prosopon of the identity, precisely an artistic-religious instinct an artificial instinct it makes remain the belief that we are, we still see ourselves in the represented face which is reproduced by the image. In this sense, we become aware of the ethos, of the personality, of that which makes us see ourselves as an ego through pathos, of a transmission from outside that still keeps the origin of the sacred in his different singularities, which take part of the origin-womb of the Western culture. If the biomechanics announces a blurred triumph of positivism, a kind relation between the machine and the individual, in the prinicipium individuationis we can still find the shield and the defense before the terror after that victory. Still, in the downfall of the Self, exists the validity of prosopon, of his hypostasis, in that relation that affects the individual with the outside: katholiks, the universal, re-emerging from a fetishistic moral and from a look which is still able to perceive the transmission, the pathos of an image, and to join every feeling and certainty in a joint code.

481

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

It is the transfiguration of the ego in the multiplicity of a represented face, in the multiplicity of the ages of a human being face, of the living, which metamorphoses day by day. It is the pact between the individual and the deity, between the sacred and the profane. Prosopon involves the movement, making us create ourselves a character and an otherness at the same time: an oneself who remains in the root us of the first person of the plural of Spanish and splits up in that plurality: ego-other (nos-otros).

In this manner we can advise in the contemporary artistic manifestations of the represented face the polysemy of prosopon in his plural and diversified context. And it is our job to rescue the symbolic transmission founded in the aesthetic values of our Western culture. Reopening the debate beyond the individual identity or the own identity without person (G. Agamben, 2011, p. 72), because it covers the hermeneutic knot of returns of symbolic and sacred values which take part of his polysemy.

482

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Reference list
Agamben, Giorgio (2011) Desnudez. Barcelona: Anagrama. Altuna, Beln (2010) Una historia moral del rostro. Valencia: Pre-Textos. Bremmer, Jan N. (2002) El concepto del alma en la Grecia antigua. Madrid, Siruela. Clair, Jean (1999) Elogio de lo visible. Barcelona: Seix Barral. ------ (1998) La responsabilidad del artista. Madrid: Visor. Didi-Huberman, Georges (2008) Ante el tiempo. Historia del arte y anacronismo de las imgenes. Buenos Aires: Adriana Hidalgo Editora. ------ (2009) La imagen supervivente. Historia del arte y tiempo de los fantasmas segn Aby Warburg. Madrid: Adaba Editores. Eliade, Mircea (1998) The Sacred and The Profan. Barcelona: Paids Ibrica. Homer (2000) The Iliad. Madrid: Gredos. Jung, Carl Gustav (2010) The Relations Between the Ego and the Unconscious. Barcelona: Paids. Mas Torres, Salvador (2006) Pensamiento romano. Una historia de la filosofa en Roma. Valencia: Tirant lo Blanch. Nietzsche, Friedrich (2000) The Birth of Tragedy. Madrid: Alianza Editorial. ------ (2002) The Gay Science. Madrid: Edaf. ------ (2010) Posthum Works (1869-1874) Vol. I. Madrid: Tecnos. Simmel, George (2006) Rembrandt: Ensayo de filosofa del arte. Buenos Aires, Prometeo Libros. Vernant, Jean-Pierre (2009) Mito y religin en la Grecia antigua. Barcelona: Ariel. ------ (2001) La muerte en los ojos. Figuras del Otro en la antigua Grecia. Barcelona: Gedisa.

483

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PUBLIC OPINION AND ENVIRONMENT: INFLUENCE OF MEDIA IN PUBLIC OPINION OF SOCIAL PARTNERS IN THE CITY OF GRANADA Luca Prez Gonzlez, University of Granada, Spain lperezgon@hotmail.es ABSTRACT The development of the new technologies in a short space of time has brought handspreading and transformation of the media, one of the advances that have radically changed our lives. Its expansion and mass diffusion in an age where technology drivesand creates new forms of communication causes them to be a key element in the analysis of contemporary societies. That is why what comes out the importance of research in the field of mass media and in particular, the influence of these in society, given a key as public opinion in bringing out the analysis and focusing on an area that is becoming the cornerstone of urban policies such as the environment. All in all, setting a goal of this study investigating the presentation and treatment by both the media of the city of Granada and by citizens of this city the subject of the environment by assessing the relationships between the information provided by these and the existing public opinion in the city around the environment. Keyword: mass media, environment, public opinion, content analysis, news.

484

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

1. INTRODUCTION Today, communication flows are enhanced by the mass of new technologies and democratization. We live in the information society to quote Manuel Castells (2001) and now we have gone from a material society to a knowledge society, where what is valued is the creation and management of human knowledge. New technology has transformed all spheres of life of individuals and the power relations have been transformed. The experience of people (both material and symbolic) comes on the heels of access to information and communication. In recent decades has enhanced the idea of the influence of media in our daily lives, we live more and more through the product of the mass media, and within the consumer society, is strengthened the idea of media consumers, the messages conveyed by the media become a reality for us. A comprehensive review of developments that have taken communication theories and analyzes of media and public opinion has enabled this research to select the main theoretical shape in the theory of agenda setting, considering the latter as a set of ideas about the influence of the media in the selection of news and facts on the part of individuals. This theory was largely exposed by Maxwell McCombs (2006) and his main thesis is that the media are creators of the images that people have about the world and on certain items, reflecting the inability of them to get themselves first-hand knowledge of all events that occur, namely, that he stars from the idea that people have partial information, and are the media who come to complete this information and therefore are creators of the images people have about social reality. All in all, from this theoretical assumptions are extrapolated from that part of this theory to reality Granada to investigate what the public agenda from the influence of media in the population of Granada, analyzing information they handle and ordering the most important issues on environmental problems in the city of Granada. And is that the field of environment is a topic that has recently gained great interest from various scientific disciplines. The global dimension has acquired the degradation of the environment highlights the need to adopt a global perspective to analyze the phenomenon of pollution and degeneration of the global ecosystem. Although today, sustainable development and environmental issue are settled in most political agendas and is part of the transverse aspects in any contemporary democracy, being true to its philosophy of "meeting the needs of the present without compromising the ability of future generations to meet their own needs" (World Commission on Environment and Development, 1988:67).

485

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

2. METHODOLOGY Therefore, this research was directed to conduct a review of the newspapers for news related to major environmental problems that occur in the city of Granada. In the same vein, we intended to establish the climate of opinion, conducting a review of the opinions that have Granadas citizens about the dimensions and environmental problems they think and judge that there are in Granada. With all this, this research proposed a methodology based on secondary analysis of data. Thus, the method selected was the review of secondary data on the one hand, and periodic review of some of the other. The framework establishes the methodology that takes into account the one hand, analysis of data on the views of / the Granada / as, primarily through the barometers of opinion, on the other hand, the news that the papers presented and to provide certain information about events, reflecting a particular view of the facts and creating a particular climate of opinion. It was decided to develop a system of environmental indicators as a framework for analyzing the current state of the same in the city of Granada and worked on the basis of a list of indicators broken down quantitatively measurable variables to extract the most relevant data on environment in Spain, Andalusia and Granada. The environmental indicators were those relating to urban areas in its social dimension, namely, that reflect the social interaction with the environment, as those relating to purely environmental issues were meaningless in this investigation. Table 1: System of indicators Air quality index Noise pollution Production, collection and treatment of urban waste annually Areas and green spaces

Environmental quality indicators

Source: Compiled from Commission of the European Communities (2002) and Ministry of Environment of the Junta de Andaluca (Andalusian Environmental Indicators).

2.1 Design of the content analysis of press Was established as a main objective of this section the content analysis of press, first quantitative and, second, qualitative from Granada Hoy and Ideal journal newspapers, since they are only two local newspapers in the city of Granada continuously available in time. The main theme of media content analysis was the treatment of the environment by the newspapers analyzed, namely, how they present the news on the environment.

486

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The media through which it carries out this objective is the newspaper in its printed edition. Established a period of one year for the analysis of the holders of both papers, from January to December 2010. In total, there was a review of the news of 724 daily newspapers, 362 newspapers and 362 Granada and Ideal daily newspaper, both from the local print edition of Granada. A review of the holders belonging to the local news section, located on the front pages of both newspapers, according to the geographical boundaries of this research. Both Granada Hoy and Ideal newspaper, the local news covered approximately one third of total pages. It also established a system of coding and categorization in order to isolate and classify the elements under study, in this case, the headlines. The classification was performed initially in response to broad categories, which coincide with the major environmental problems of Granada. Within these categories, subcategories established a system of dealing with different dimensions emerged from the review of the news and try to exhaustively classify the news, taking into account the main actors that interact with environmental problems in the city of Granada. Regarding their reliability, it proceeded to conduct an assessment of interobserver agreement, to provide independence, objectivity and consistency to the system of categories with which we worked. Finally, in the last phase of media content analysis was performed a content analysis of qualitative press publishers of both newspapers, in order to establish what are the ideological lines of both newspapers and show the opinions and attitudes, in order , speaking with both newspapers about environmental issues.

3. ANALYSIS OF THE RESULTS After the review of the local news of the 724 newspapers were extracted a total of 88 news related to environmental problems in the city of Granada and the data from the press analysis of these headlines was observed that treatment of the environment is not at first a subject at the top of the agenda of the media. The shortage of news found for a whole year in the two main local newspapers shows the lack of importance of environmental issues to the media. With regard to the opinion of the public about air pollution, has been selected in Andaluca Ecobarometer being the only one that breaks down the environmental problems and provides answers to what are the environmental problems that people perceive. Air pollution in 2010 was one of the two most important environmental issues for 18.1% of the Andalusian citizens, namely it was more or less relevant for people but not enough the seriousness of air pollution in this city.

487

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

If we compare this with the treatment given in the analyzed newspapers, news about air pollution accounted for 9% of all the news, although differentiation by newspapers, Granada Hoy newspaper was the most wich published news about air pollution, as in Ideal daily news there was one in this category. On the other hand, the opinion of people on the subject of urban noise in 2010 Ecobarometer states that the noise is the main environmental issue for 28.8% of them, standing at the top of the environmental problems and a similar percentage of dirt in the streets. As for treatment that was given in newspapers to noise pollution, appears to be a relevant issue out as news. In fact, it ranked as the third environmental problem that there was more news in this period and that 14% of these were related to this category. Granada Hoy newspaper led the publication of news in this category, posting a total of 8 news, while Ideal newspaper only published half, 4. With regard to municipal waste, for Granada is also important the issue of municipal waste in the city of Granada, and that 11.8% of those surveyed in 2010 by the CADPEA (Electoral and Politic Analysis and Documentation Centre in Andaluca), cleaning the municipality assumed one of the main problems of the city, as in the newspapers analyzed, where municipal waste were the main environmental issue in the news environment. Almost 40% of news were related to municipal waste (33 articles), the main environmental problem addressed in the news analyzed by far. Finally, the opinion on the lack of gardens and green areas stood at fourth place environmental issues, with a response rate of 21% of andalusians citizen and in terms of vision offered by newspapers, the issue of green space remains in an intermediate position with respect to the total of news, 9% of the total were related news spaces or green areas matching their percentage in the headlines related to air pollution. The number is small for the total news to be published during the year, a total of 8 news related to the city's green spaces may generate a public opinion where the issue about the importance of green space does not appear and where does not stimulate an approach to a more eco-city. All in all, this research concludes argued that the amount of news displayed in newspapers does not adequately reflect the magnitude of the environmental problems facing today the city of Granada. The theme of urban waste, air pollution and noise are issues that should worry more if possible to the public in Grenada and established as one of the main topics for discussion in society. The lack of news related to some categories proposed in the coding system presupposes the pre-selection of news media in Granada, or not enough importance is given to certain events.

488

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Castells, M. 2001. La era de la informacin. Vol. III: Fin de Milenio. Mxico, Distrito Federal: Siglo XXI Editores. Comisin de las Comunidades Europeas. 2002. Anlisis de la lista abierta de indicadores de cabecera medioambientales. Informe de la Comisin al Consejo. Bruselas, 20.09.2002, COM (2002) 524 final. Comisin Mundial del Medio Ambiente y del Desarrollo. 1988. Nuestro futuro comn. Madrid: Alianza Editorial. Consejera de Medio Ambiente. Indicadores ambientales de Andaluca. http://www.juntadeandalucia.es/medioambiente. (19.10.2011). McCombs, M. 2006. Estableciendo la agenda. El impacto de los medios en la opinin pblica y en el conocimiento. Madrid: Paids Comunicacin.

Graphic 1: Percentage of news according main categories of analysis, 2010.

Source: Prepared by the author, 2011.

489

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

PUBLIC POLICIES AND TERRITORIAL RESEARCH IN EUROMED. NEXT PERSPECTIVES Jos Manuel Pags Madrigal, University Fernando Pessoa, Portugal Observatrio de Politicas Pblicas e Territrios (OPPTerr) madrigal@ufp.edu.pt cualesquiera que sea su forma, su arquitectura o la civilizacin que la ilumine, la ciudad mediterrnea es siempre hija del espacio,creadora de rutas y, al mismo tiempo creada por ellas "Whatever its form, its architecture or civilization that iluminates, the Mediterranean city is always daughter of the space, creating routes and at the same time created by them. . 1

ABSTRACT

EuroMed space presents some common areas of interest to the researcher. We highlight the following: Population concentration along the Mediterranean coast; Phenomenology of specific "urban sprawl"; Territorial imbalances between coastal and inland continental. Only a proper study of the characteristics and values of the region will allow a proposal tailored to their specific solutions. Such studies must rely on a database able to define the characteristics that establish comparable indicators to build a significant enough sample to analyze behaviors and solutions to the identified problems. This paper attempts to define future research in this area of research, basically as far as public spaces and port cities in the EuroMed region is concerned.

Keyword: EuroMed, Public spaces, Port cities, Database

111

Braudel, F. El Mediterrneo y el Mundo Mediterrneo en la poca de Felipe II. Fondo de Cultura Econmica. Madrid. 1976.

490

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Territorial research in EuroMed region allows the definition of systems based on a series of clear characteristics that have been consolidated over the years. A glocal reading system to define the commonalities, both in terms of the possible morphological responses that can be given against global problems detected. However, this leaves some space that allows adaptation of the proposals designed according to the various local characteristics identified. The concentration of population on the coastline, which has been promoting public policies of the countries of northern Mediterranean basin, began to be exported as a model of territorial development inthe southern side. The implications of this model are immediate expansion, causing a depletion of population and territorial imbalance in the inland.

While growth is detected where urban sprawl gives way to diffuse areas where coastal continuum is a formal solution that gives way to new geographical definitions with the emergence of new territorial identities that override some of the previously existing.

One of the points where this phenomenon is palpable is the consideration, evaluation and ownership of public spaces. The EuroMed region, particularly the Mediterranean, was based from a morphological consideration of public space as the true backbone where to build the world of personal and group relations. A research on public space in the region will provide solutions for the review of these areas that are considered vital in a region where at least 75% of the time consumed in open spaces throughout the year.

Finally, from

a macro-territorial Mediterranean port

system is

undergoing a

profound

transformation. The concentration of port activities at certain points that can compete with other nodes in the world requires the review of roles to play for ports and even mediumscale evaluation of the relationship between port and cityon that scale.

This

document is

meant

as a

warning to

the

points discussed

above. Only from a serious and

a systematic investigation, cross-and

interuniversity can understand

rigorous proposal that will address the problems identified with appropriate safeguards.

491

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

POPULATION CONCENTRATION

Mediterranean cities were the cradle of European urbanization. During many centuries there was a natural equilibrium among the European urbanizations rates and the southern and eastern regions into Mediterranean. This situation was changing from the dawn of 19th century with a dominant position for Europe.

Mediterranean Basin is one of the most urbanized regions in the world. In 1995 the average of urban population was 62%. The absolute growth was bigger for Libya and Turkey between 1950 and 1995, with plus 58% and 41% respectively. Geopolis database 2 has registered in 1995 a global amount of 3,962 urban areas with more than 10,000 inhabitants in the Mediterranean countries. The mapping of these areas can demonstrate the reproduction of the coastal lines with remarkable precision. Only the great islands like Corsica, Crete, and Cyprus are out of this pattern, caused by their specific topographies. Libya is an exception.

We can conclude that Mediterranean coastline has now become intensively urbanized.

Vistual Database (http://e-geopolis.eu/?lang=en) with demographic elements from 1800.

492

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The third parts of the 651 regions of the Mediterranean-rim countries, (221) are touching the Mediterranean coastline. These Mediterranean coastal regions are twice as densely populated as the countries' regions as a whole, i.e. 96 inhabitants/km2 on average as opposed to 47 inhabitants/km2.

The analysis of this table can explain this urban phenomenon: Several parallel processes were happening at the same time: Cyclical economical crisis in the rim countries were favouring the population concentration. On the other side the demographic growth favoured by the better healthy conditions and the rural depopulation helped to get this situation

493

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Other economical conditions like the idea to identify new touristic paradises on the coast lines have helped to provoke this.

2.1 2.1.1

Urban Sprawl and Mediterranean The current situation

The special conditions about the ways of occupying space around the Mediterranean Sea generated a series of population concentrations with a very specific image. This image is a direct consequence of the littoralisation (costalizacin). Europe has come to export this model of employment to certain areas of the Mediterranean, especially when certain economic conditions favorable to it, or geo-strategic conditions so provide.

Mr Khalid Al-Hnaifat, major of Greater Tafilah (JO) indicated in its report summarizing the scope of the main threats ARLEM land for the Mediterranean:

The rapid increase in urban population Social progress is not adequate in the region and has led to increased rates of unemployment and consequently to poverty, which means deprivation of a large number of people of clean drinking water and the lowest level of sanitation The impact of coastalization, crawling towards the coast, the concentration of population and economic activities on coastal areas and tourism urbanization added burden on the population growth in the southern and eastern regions of the countries of the Mediterranean basin. This situation did not change the situation in rural areas in the interior of these countries that opened up to the global economy. Overpopulation: this phenomenon of urbanization and crawling towards the coast is still continuing even now, especially in Turkey and other countries Maintaining a clean, healthy and sustainable environment is a challenge for local and regional authorities The lack of a suitable transportation network . Where noted, the increasing use of private cars or taxis, and this increases the environmental pollution in the cities.

Undoubtedly, all these issues are exacerbated by the phenomena of

urban

sprawl

imported from north Mediterranean countries that have nothing to do with the natural balance territorial previously been much more complicated and possible solutions. These situations are clear, for example, in the case of Lebanon, where it is very difficult to identify the different urban realities given the established territorial continuity,especially on the coast, and in the northern region of this country. The other examples shown are clear regarding the current problem.

494

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

In these cases, we ask:

Where will the urban and social identity of the new Mediterranean? What are the solutions can be generated in the context of a coherent and consistent with the historical development of these territories? What is the role of researchers to find solutions to problems?

2.1.2

The proposed solutions take 3.

Khalid Al-Hnaifat defined in their paper a number of steps to

Comments

consequential actions described enable us to define a series of lines that directly affect researchers in the Mediterranean area. When Al-Hnaifat refers to the way how local and regional autoriades can contribute to find solutions to the problems defines the following modes of action:
Identifying the factors related to projects and activities, needs and solutions in the regions cities, specialized on decentralized survey activities, best practices and monitoring capabilities. Creating an information exchange mechanism a "Stock Exchange" of best practice Putting in place twinning programs between local and regional authorities in the Mediterranean that will develop urban development through the exchange of experiences Promoting popular participation and decision-making and strengthening democratic development in local and regional authorities Better knowledge of all the existing programs, projects and funding available in the area of urban development.

A clear concept is underlying all these measures, the creation of an updated and vigorous database ; agile and valid for the exchange of experiences, studies, problems and solutions that advance with reference to urban and territorial essences of these territories.

Draft report on urban development in the Mediterranean.Commission for Economic, Social and Territorial Affairs of the Euro-Mediterranean Regional and Local Assembly (ARLEM) Jordan, September 22010

495

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

CONCLUSION

Good governance is the basis for sustainable urban development. This governance must be based on the understanding of specific interpretations of the Sustainability, the Subsidiarity, Equity, Efficiency, Transparency and accountability, Civic engagement and citizenship and Security.

And this governance depends on a thorough understanding of the problems that exist in the Mediterranean Basin. In this work we are called to participate from the joint efforts of researchers from the Mediterranean area. The initiatives are being developed from Union for the Mediterranean (UfM). Emuni is participating actively into the Secretariat for Transports and urban development. This secretariat is concerned to prepare the Project Guidelines for Stimulation and Gathering of Potential Project Proposals and Initiatives, for its appraisal and assessment, and for the labeling of these projects related to the EuroMed region The Paris Declaration initiated the process of the UfM in 2008.

Last senior experts meeting on March 2012 at Barcelona continued to work on these lines. We think that the development of a database is vital for consideration, learning problems and the possible application of best practices previously tested and verified.

496

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST For a larger information about urban agglomerations in the Mediterranean basin we suggest the consultation of these web-sites: http://www.mcrit.com/spesP/Maps2-2.htm http://e-geopolis.eu/spip.php?article239&lang=en Documents about these problems, produced in the last two years are into these references: http://unipd-centrodirittiumani.it /public/docs/Arlem_ecoter__urban_ development_2010.pdf http://www.ufmsecretariat.org/wp-content/uploads/2012/04/EMSUS-Diagnosis-of-theMediterranean-cities-situation.pdf http://www.planbleu.org/publications/urbsprawl.pdf For a better comprehension about the metholodogy proposed from the Observatory for Public policies and Territories University Fernando Pessoa, you can consult this publication: Pags Madrigal, J., Malafaya, F. 2012. Territrios como laboratios. Territories as laboratories. Ed. List. Trento.

497

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Retinoic Acid-induced Treacher Collins Sequence with tooth germ abnormalities. Experimental study in rat embryos.
Ioannis Makaronidis, Ioanna Basli, Elpida-Niki Emmanouil-Nikoloussi

Laboratory of Histology-Embryology & Anthropology, School of Medicine, Aristotle University of Thessaloniki, Thessaloniki, Greece

iomakaro@gmail.com, emmanik@med.auth.gr

Abstract
Treacher Collins Syndrome, a relatively rare congenital condition, has its pathogenesis linked to abnormalities in neural crest cell migration. Neural crest cells migrate from the early embryonic dorsal neural folders to the first and second pharyngeal arch and contribute to the development of several craniofacial elements, among which the most important are facial bones, soft tissues, ear and eye structures. Tooth germs are also included into the craniofacial elements. Their initial developmental procedure is the production of signalling molecules from the stomodeal epithelium, under which mesenchyme and neural crest cells are situated. The pathogenesis and orofacial defects determining Treacher Collins Syndrome are mostly obscure and discussed into several articles in the international literature. The aim of this study was to determine whether Treacher Collins Syndrome could be induced after administration of teratogenic drugs. As retinoids are one of the most specific groups of drugs in inducing craniofacial malformations, we selected all-trans retinoic acid (tretinoin), one of the most frequently used retinoic analogues. All-trans retinoic acid was administered per os to pregnant rats at a single dose of 100 mg/kg b.w. on their 11.5 gestational day , an essential time period for craniofacial differentiation of the rat. Pregnant rats were euthanized under a toxic dose of ether on the 20th gestational day. Foetuses were extracted by perpendicular laparotomy and observed under stereomicroscope for the characterisation of their craniofacial malformations. Their heads were proceeded for histochemical and scanning electron microscopic observation. The study results confirmed that experimental administration of all-trans retinoic acid at a single dose on gestational day 11.5 can lead to major craniofacial abnormalities similar to those observed in human Treacher Collins Syndrome. Keywords: Treacher-Collins, mandibulofacial dysostosis, craniofacial abnormalities, retinoic acid, tretinoin

498

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

INTRODUCTION

Treacher Collins Syndrome, also known as mandibulofacial dysostosis, is a congenital condition affecting 1:50:000, as noted by Martelli-Junior et al. (2009), to 1:10,000 children born, as mentioned by Weiner et al. (2012) (Martelli-Junior et al., 2009; Weiner et al., 2012). As stated by Dixon (1995), whereas the syndrome can be a family trait following the autosomal dominant pattern of inheritance, 6 out of 10 new cases are believed to be caused by new mutations (Dixon, 1995). According to de Oliveira Lira Ortega et al. (2007), the defective gene mainly implicated as a causative factor for the syndrome is the TCOF1e gene. In patients with Treacher Collins syndrome, this gene causes quantitative insufficiency of a protein called treacle that probably acts as a transcription factor (de Oliveira Lira Ortega et al., 2007). Weiner et al (2012) pointed out that TCOF1 is mapped into chromosome 5 (5q32-q33.1) (Weiner et al, 2012). Kumar et al. (2011) attributed to the protein product a major role in embryogenesis (Kumar et al., 2011). A lesser amount of neural crest-derived cells reaches the area of the first and the second pharyngeal arch, according to Passos-Bueno et al. (2009), as a result of treacle insufficiency (Passos-Bueno et al., 2009). However, Stevenson et al. (2007) recognised the existence of conditions with a phenotype similar to TCOF-related Treacher Collins syndrome that can be attributed to different genetic disorders. At their research paper they have reported a case with mandibulofacial dysostosis most likely caused by a 2;17 chromosome translocation, whereas the sequence of TCOF was found to be normal. The abnormalities described were attributed to HOXD gene cluster. Moreover, they reviewed previously reported cases with a variety of chromosomal abnormalities, such as 3p24 deletion, 4p deletion, pericentric invasion of chromosome 2 and 5;13 balanced translocation (Stevenson et al., 2007). The pathogenetic mechanisms that lead to abnormalities of the first and second pharyngeal arch may thus vary. The abnormalities found at Treacher Collins syndrome have, as noted by Poswillo (1977), craniofacial location. Moreover, they are characterised by bilateral symmetry (Poswillo, 1977). In general, they are skeletal, ophthalmic, auricular, nasal and oral. Kumar et al. (2011) enlisted the major characteristics of the syndrome: the phenotype consists of antimongoloid palpebral fissures, hypoplasia of the malar bones, malformation of the auricle along with microtia and conductive deafness, eyelid coloboma, micrognathia and cleft palate (Kumar et al., 2011). However, Marszaek et al. (2002) classified cleft palate in the infrequently-observed manifestations, along with hypertelorism and mental retardation, whereas they pointed out that lower eyelid coloboma is a major characteristic of the syndrome , in contrast to the more rarely observed upper eyelid coloboma. They also added the morphological characteristic of

499

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

fishlike appearance and preauricular hair displacement to the major findings of the syndrome. Moreover, they proposed a category of commonly found symptoms that included malformation of the nose, macrostomia, defects of the auricle and deafness and a variety of oral findings such as macrostomia and high-arched palate, as well as malocclusion and open bite (Marszaek et al., 2002). Finally, Arvystas and Shprintzen (1991) underlined the importance of upper airway abnormalities happening in the syndrome and are related to sleep apnoea, conditions which can be observed due to possible obstruction of the upper airway (in cases of the syndrome). The authors attributed those conditions mostly to skeletal abnormalities (Arvystas and Shprintzen, 1991), whereas Marszaek et al. (2002) related sleep apnoea and sudden infant death syndrome observed to the mandibular deficiencies, atresia of the choanae and glossoptosis of severe Treacher Collins cases (Marszaek et al., 2002). The initiation of the tooth formation procedure is considered to be the production of signalling molecules in the stomodeal epithelium. Information is then transferred to the underlying mesenchyme, in which cells deriving from the neural crest are situated (Seppala et al., 2006). As a result, dental abnormalities are also expected to be found at the Syndrome. However, they are not stable; dental findings from the literature are analysed at the discussion. Posnick and Ruiz (2000) as well as Katsanis and Jabs (2004-2011) reviewed the characteristics of the syndrome more extensively (Posnick and Ruiz, 2000; Katsanis and Jabs, 2004-2011).

Retinoid analogues are widely used in the treatment of various diseases, including cystic acne, psoriasis (Emmanouil-Nikoloussi et al. 2000a), photoaging (Singh and Griffiths, 2006) and acute promyelocytic leukemia (Fenaux, 2007). However, retinoids have been proved capable of producing various developmental malformations in foetuses. These may range from severe craniofacial anomalies, as outlined by Emmanouil-Nikoloussi et al. (2000, 2003) and Wise et al. (2007) to forelimb digital malformations, as described by Emmanouil-Nikoloussi et al. (2008) (Emmanouil-Nikoloussi et al., 2000a; Emmanouil-Nikoloussi et al., 2003; Wise et al. 2007; Emmanouil-Nikoloussi et al.). The uptake of retinoids during foetal development might also result to mandibulofacial dysostosis. A possible pathogenetic link could be the interaction of retinoids with neural crest cells that has been pointed out by Li et al. (2010). All-trans retinoic acid, as previously shown by Sulik et al. (1987, 1989), can lead to craniofacial abnormalities resembling those of Treacher-Collins Syndrome, if administered at 8d16h, 9d0h or 9d6h after fertilisation in mice, or, according to Emmanouil-Nikoloussi et al. (2000), at day 11.5 of gestation in rats (Sulik et al., 1987; Sulik et al., 1989; EmmanouilNikoloussi et al., 2000a).

500

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Johnston and Bronsky (1991) stated that 13-cis retinoic acid administered during the period of the formation of the trigeminal ganglion can as well lead to similar manifestations; neural crest cells are thought to be affected secondarily (Johnston and Bronsky, 1991). Granstrm and Kirkeby (1990) induced Treacher Collins Syndrome in rats by administering etretinate at gestational day 8.5 (Granstrm and Kirkeby, 1990). 2 MATERIALS AND METHODS

Female Wistar rats, 10 weeks old and weighting 200-250 g, were used for this experimental work. The conditions of temperature and lighting in which the animals were maintained were controlled (20oC 2oC, 12-hour light/dark cycle). Rats were provided with food and water ad libitum. Two females were mated with one male for a period of three hours. Gestational day zero was defined by the presence of a copulatory plug. The pregnancies were prima gravida. All trans-retinoic acid was suspended in corn oil under low-light conditions. The suspensions were stored in dark glass vials. The dosage was calculated as per kg body weight of the pregnant rats. Pregnant rats were divided into three groups, two of which were fed via gastric intubation either retinoic acid suspended in corn oil or corn oil alone as described: Group 1 received 100 mg of retinoic acid per kilogram of body weight on gestational day 11.5. Group 2 received corn oil on gestational day 11.5. Group 3 received no treatment.

The treatment timing was chosen as, according to the rat embryonic development, gestational day 11.5 is essential for craniofacial differentiation (Emmanouil-Nikoloussi et al., 2000a) Pregnant rats were euthanised by inhalation of a lethal dose of ether on gestational day 20. Perpendicular laparotomy was performed in order to extract the embryos from the uterus. The embryos were washed with saline, weighted, examined and photographed under a stereomicroscope. The heads of the embryos were microdissected under a stereomicroscope. Some of them were additionally fixed in neutral formalin for three days, dehydrated with alcohol, dried by the critical point method, attached with a drop of Dotie onto stubs, coated with a 10-20 nm layer of gold and observed under a Scanning Electron Microscope-SEM.

501

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

The heads of the remaining embryos were fixed in 10% neutral formalin for 10 days and decalcified in 5% formic acid for 10 days. Finally, they were embedded in paraffin and 7 mthick frontal sections were prepared and stained with Heidenhains Azan or with 0,2% toluidine blue and histologically assessed. All the above-mentioned procedures were performed at the Laboratory of Histology, Embryology and Anthropology of the Aristotle University of Thessaloniki, Greece, in accordance to the Helsinki Guidance for Animal Practice.

RESULTS

In the first group, severe craniofacial abnormalities were observed. In general, malar, maxillary and mandibular hypoplasia were present, along with depressed midface and ophthalmic and auricular morphological findings, all consistent with those observed in Treacher Collins Syndrome (fig. 1 & 2)

Fig.1

Fig. 2

Macroglossia and a palatal cleft among the primary and secondary palate as a result of hypoplastic maxillary processes were also present (fig. 3). The tooth germs of the molars were severely affected. In some cases, they were so malpositioned that the impression of a double tooth was formed: two tooth germs with independent dental laminae and enamel organs would end up one against the other in a way that the two dental papillae would fuse together. At the area of fusion, a decrease in the mesenchymal aggregation was noticed. The enamel organs were well formed and external enamel epithelium, stellate reticulum and inner enamel epithelium could be well identified. It is evident that further development of such dental germs would be abnormal, with a most likely fusion of the roots, if the root formation would take place during childhood in humans. One of the two fusing germs was most likely a supernumerary one (fig.1 & 6).

502

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

A similar image was also observed with two tooth germs perpendicular to each other so that the apical extension of the dental papilla of the first would come across the enamel organ as well as the dental papilla of the second one (fig 1 & 5).

Fig. 3

Fig. 4

Fig. 5

Fig. 6

In other areas, hypoplastic tooth germs could be found, yet overally maintaining their normal structure. The alveolar process above the malformed tooth germs was also impaired. Some parts of the alveolar bone could be found protruding in the oral cavity, phenomenically misplaced and sometimes after having formed a narrowing after which they would get bulkier. The orientation of the tooth germs would not cause their eruption through these parts of the alveolar bone. Furthermore, these malformations could also be found along with elongated dental laminae (fig. 3-6). Due to the stage of tooth development (bell stage), there can be no safe observation regarding the calcification of the hard dental tissues and the related anomalies. No abnormalities were observed on groups 2 and 3.

503

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

DISCUSSION

As underlined by Lumsden (1988), neural crest cells are involved in tooth development. (Lumsden, 1988). Given that the pathogenesis of Treacher Collins syndrome, as already described at the introduction, is related to the neural crest cells of the first two pharyngeal arches, dental abnormalities would be of no surprise. Indeed, as it will be analysed, dental findings in Treacher Collins Syndrome have already been described in clinical cases but not until now described in experimental animal histological sections. Furthermore, the clinical findings described are not stable and they can even be conflicting, whereas the description of oral and dental findings is usually inadequate in the international literature. Magalhes et al. (2007) summarised the characteristics of the syndrome and mentioned enamel hypoplasia, malocclusion, cleft palate and shortened soft palate in the most common findings. They also reported two new human cases, a female and a male, both presenting anterior open bite, caries and narrow palate. Additionally, the female presented trismus and gingivitis (Magalhes et al., 2007). Da Dilva Dalben et al. (2006) focused on the dental abnormalities of Treacher-Collins patients and described their findings thoroughly. 9 out of the 15 patients examined presented dental abnormalities, such as dental hypoplasia or hyperplasia, ectopic, rotated, supernumerary and T-shaped teeth, tooth agenesis and enamel opacities. Cleft palate, combined cleft lip and palate as well as macrostomia were also observed (da Silva Dalben et al., 2006). Kasat (2011), in a case report, presented a woman with proclined maxillary incisors, spacing in the anterior teeth and root stumps in three out of four first permanent molars. The palate was narrow and high arched (Kasat, 2011). Shere et al. (2011) presented a man with anterior open bite, crowding of the anterior teeth and multiple carious cavities. The palate was high arched and presented a partially cleft, as the uvula was bifid (Shere et al., 2011). Martelli-Junior et al. (2009) described seven patients with Treacher Collins syndrome. They all had malocclusion, 3 of them had anterior open bite, the soft palate of 1 was shortened and cleft palate was not among the findings (Martelli-Junior et al., 2009). In previous experimental studies, Emmanouil-Nikoloussi et al. (2000) and Gunston et al. (2005) described the effect of retinoid acid in the development of the palate. Clefting of the palate in various degrees depending on the timing and the dosage was observed, that might be consistent with the characteristics of Treacher Collins Syndrome (Emmanouil-Nikoloussi et al., 2000b; Gunstom et al., 2005).

504

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

According to our results, cleft palate was present. Ectopic, malpositioned, hypoplastic and supernumerary teeth were also observed. The fused germs could result in abnormal, hyperplastic dental structures. However, we cannot comment on the calcification-related abnormalities such as the enamel hypoplasia and the enamel opacities clinically observed. Moreover, the type of malocclusion that would finally be established cannot be predicted in such experimental animal models. Yet, the tooth germ abnormalities detected, along with the hypoplasia of the maxilla and the mandible, were more than sufficient to suggest that the occlusion would be severely impaired.

CONCLUSION

From our research analytical results, it was confirmed that experimental administration of alltrans retinoic acid (tretinoin) to pregnant rats at a single dose on gestational day 11.5 led to major craniofacial abnormalities in rat embryos similar to those observed in human Treacher Collins Syndrome. The dental findings were also irregular.

505

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

REFERENCE LIST Arvystas M., R. J. Shprintzen. 1991. Craniofacial morphology in Treacher Collins syndrome. Cleft Palate Craniofac. J. 28 (2): 226-30; discussion 230-1. da Silva Dalben G., B. Costa, M. R. Gomide. 2006. Prevalence of dental anomalies, ectopic eruption and associated oral malformations in subjects with Treacher Collins syndrome. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 101 (5):588-92. de Oliveira Lira Ortega A, L.M. Liarte Figueiredo Zwir, A. L. Ciamponi, A. S. Guimares, L.G. Alonso. 2007. Radiological findings and dynamic aspects of stomatognathic structures in Treacher Collins syndrome: clinical case report. Cleft Palate Craniofac J. 44 (6): 678-82. Dixon M. J. 1995. Treacher Collins syndrome. J. Med. Genet. 32 (10): 8068. Emmanouil-Nikoloussi E. N., M. Goret-Nicaise, A. Manthos, C. Foroglou. 2003. Histological study of anophthalmia observed in exencephalic rat embryos after all-trans-retinoic acid administration. J. Toxicol. Cut. Ocul. Tox. 22 (1,2): 33-46. Emmanouil-Nikoloussi E. N., M. Goret-Nicaise, C. H. Foroglou, E. Katsarma, A. Dhem, N. Dourov, T. V. Persaud, J. A. Thliveris. 2000a. Craniofacial abnormalities induced by retinoic acid: a preliminary histological and scanning electron microscopic (SEM) study. Exp. Toxicol. Pathol. 52 (5): 445-53. Emmanouil-Nikoloussi E. N., M. Goret-Nicaise, P. Foroglou, C. Kerameos-Foroglou, T. V. Persaud, J. A. Thliveris, A. Dhem. 2000b. Histological observations of palatal malformations in rat embryos induced by retinoic acid treatment. Exp. Toxicol. Pathol. 52 (5): 437-44. Emmanouil-Nikoloussi E. N., M. Goret-Nicaise, P. Foroglou, J. A. Thliveris, C. KerameosForoglou. 2008. All-trans-retinoic acid-induced disturbance of forelimb digital apeptosis in mouse embryos: A preliminary scanning electron microscope (SEM) tudy. Eur. J. Anat. 12 (1): 25-32. Fenaux P., Z. Z. Wang, L. Degos. 2007. Treatment of acute promyelocytic leukemia by retinoids. Curr. Top. Microbiol. Immunol. 313: 101-28. Granstrm G. and S. Kirkeby. Prenatal diagnosis by isoenzymic differentiation of Treacher Collins' syndrome induced by retinoids in rats. Scand. J. Plast. Reconstr. Surg. Hand Surg. 24 (3): 177-83. Gunston E., E. N. Emannouil-Nikoloussi, B. J. Moxham. 2009. Palatal abnormalities in the devoloping rat induced by retinoic acid. Eur. J. Anat. 9 (1): 1-16. Johnston M. C., P. T. Bronsky. 1991. Animal models for human craniofacial malformations. J. Craniofac. Genet. Dev. Biol. 11 (4): 277-91. Kasat V. 2011. Franceschetti syndrome. Contemp. Clin. Dent. 2 (3): 245-8.

506

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Katsanis S. H. and E. W. Jabs, 2004-2011. Treacher Collins Syndrome, in: Pagon R. A., T. D. Bird, C. R. Dolan, K. Stephens, M. P., editors. GeneReviews [Internet]. Seattle (WA): University of Washington, Seattle; 1993-. Kumar M., R. Kumar, M. Tanwar, S. Ghose, J. Kaur, R. Dada. 2011. Cytogenetic and clinical assessment of a family with treacher collins syndrome. Case Report Med. 2011 (2011): 708450. Li N., R. N. Kelsh, P. Croucher, H. H. Roehl. 2010. Regulation of neural crest cell fate by the retinoic acid and Pparg signalling pathways. Development. 137 (3): 389-94. Lumsden A. G. 1988. Spatial organization of the epithelium and the role of neural crest cells in the initiation of the mammalian tooth germ. Development. 103 Suppl: 155-69. Magalhes M. H., C. B. da Silveira, C. R. Moreira, M. G. Cavalcanti. 2007. Clinical and imaging correlations of Treacher Collins syndrome: report of two cases. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 103 (6): 836-42. Marszaek B., P. Wjcicki, K. Kobus, W. H. Trzeciak. 2002. Clinical features, treatment and genetic background of Treacher Collins syndrome. J. Appl. Genet. 43 (2): 223-33. Martelli-Junior H, R. D. Coletta, R. T. Miranda, L. M. Barros, M. S. Swerts, P. R. Bonan. 2009. Orofacial features of Treacher Collins syndrome. Med. Oral Patol. Oral. Cir. Bucal. 14 (7): E344-8. Passos-Bueno M. R., C. C. Ornelas, R. D. Fanganiello. 2009. Syndromes of the first and second pharyngeal arches: A review. Am. J. Med. Genet. A 149A (8): 1853-9. Posnick J.C., R. L. Ruiz. 2000. Treacher Collins syndrome: current evaluation, treatment, and future directions. Cleft Palate Craniofac. J. 37 (5): 434. Poswillo D. E. 1977. The embryological basis of craniofacial dysplasias. Postgrad. Med. J. 53 (622): 517-24. Seppala M., M. Zoupa, O. Onyekwelu, M. T. Cobourne. 2006. Tooth development: 1. Generating teeth in the embryo. Dent Update. 33(10): 582-4, 586-8, 590-1. Singh M. and C. E. Griffiths. 2006. The use of retinoids in the treatment of photoaging. Dermatol. Ther. 19 (5): 297-305. Stevenson D.A., S. B. Bleyl, T. Maxwell, A. R. Brothman, S. T. South. 2007. Mandibulofacial dysostosis in a patient with a de novo 2;17 translocation that disrupts the HOXD gene cluster. Am. J. Med. Genet. A 143A (10): 1053-9. Sulik K. K., M. C. Johnston, S. J. Smiley, H. S. Speight, B. E. Jarvis. 1987. Mandibulofacial dysostosis (Treacher Collins syndrome): a new proposal for its pathogenesis. Am. J. Med. Genet. 27 (2): 359-72. Sulik K. K., S. J. Smiley, T. A. Turvey, H. S. Speight, M. C. Johnston. 1989. Pathogenesis of cleft palate in Treacher Collins, Nager, and Miller syndromes. Cleft Palate J. 26 (3): 20916; discussion 216.

507

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Weiner A.M., N.L. Scampoli, N.B. Calcaterra. 2012. Fishing the molecular bases of Treacher Collins Syndrome. PLoS One 7 (1): e29574. Wise M., E. N. Emmanouil-Nikoloussi, B. J. Moxham. 2007. Histological examination of major craniofacial abnormalities produced in rat foetuses with a variety of retinoids. Eur. J. Anat. 11 (1): 17-26.

508

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

Risk Society and the preservation of Wild Nature. The case of the group Action for the Wild Life Panos Charitos Department of Theology - Aristotle University of Thessaloniki Greece

ABSTRACT

Over the last decade, humanity faced the far reaching results of the ecological crisis: climate change, the loss of biodiversity, the increased levels of atmospheric pollution, the rise on the level of the oceans which already forces large populations to migrate and the high rate of deforestation in the developing countries (IPCC 2007; World Bank Global Report, 2011). The global environmental crisis is related to the concept of risk that becomes central in the advent of modernity. Risk is the modern approach to foresee and control the future consequences of human action which emerges as the unintended consequence of radicalized modernization (Beck, 1999) and become a major force of political mobilization in our days. In that case what is the meaning of wild nature; Are there still areas that count as wild; How can we act to protect them; In order to answer to this question one has to think on the role of the symbolic through which risks and danger are mediated and urge to action. We argue for the need to rethink about previous dualisms and particularly for the need to gap the distance between Nature and Man. Moreover we argue for the ecological potential that the reinvention of new images of Wild Nature can have in the context of the risk society. Finally, we discuss the case of the non-governmental group Action for the Wild Life as we think that demonstrates a successful example of the way that we can treat wild nature in a global risk society. Keywords: wild nature, environmental crisis, risk society, otherness

509

17 - 18 April 2012

Proceedings of the 4th EMUNI Research Souk

ECOLOGICAL CRISIS IN THE CONTEXT OF THE RISK SOCIETY

Over the last decade, humanity faced the far reaching results of the ecological crisis: climate change, the loss of biodiversity, the increased levels of atmospheric pollution, the rise on the level of the oceans which already forces large populations to migrate and the high rate of deforestation in the developing countries (IPCC 2007; World Bank Global Report, 2011). Ecological crisis points to the fact that different ecological problems and natural disasters are can no longer been treated based on our scientific knowledge and technical solutions but instead they require our participation in taking decisions about risks which involve both the scientific community but also the non-experts (Beck 1999). In our global risk society, risks are characterized by three features: they are delocalized since their consequences are spatially and temporarily dispersed (Giddens 2000), they are incalculable in principle and always open to the future and finally they resist to any logic of compensation and construction of safety zones which haunted first modernity (Ewald, 2002). In addition, the diffusion of risks between different subsystems 1 (i.e. the political, the social, the economical) creates new forms of political participation and new dimensions of sub-politics (Giddens, Beck & Lash 1991; Beck 1995). Finally, the risks linked with the ecological crisis reveal the socially constructed nature of notions like security, danger and nature and point to the role that mediation has (through the symbolic) in mobilizing action. This doesnt mean that we should abandon every idea about an existing reality as many post-modernists emphasize but rather that we need to rethink how certain notions are organized through a constant interaction with social processes and the political task of rethinking their content 2. The ecological crisis reshapes the institutions of the early modernity, creates new types of relations with distant others and challenges the content of older distinctions like those between the national and the international, the local and the global, the expert and the audience of non-experts. The risks, related to the ecological crisis require new methodological and conceptual tools since they transgress older boundaries between nation-states and social classes (Giddens 2009; Beck 2006). From the above it is inferred that the ecological crisis fosters the creation of a global public sphere, opens new forms of agency while challenging previous forms of authenticity and finally requires the democratization of scientific and technological
1

Beck refers to a radicalization of modernity which occurs as the basic institutions of early modernity such as the state, the expert systems, the commerce system and the military- once credited with the task of calculating and controlling new dangers are undermined by a growing awareness that they are inefficient and they can even be counter-productive. (Beck 2003; 2006). An interesting approach that tries to evade the pitfalls of postmodern constructionist theories and the disadvantages of older essentialist descriptions of Nature is the model of radical structural proposed by Laclau and Mouffe (1985, see also Mouffe, 1993) and further discussed by Stavrakakis (1998) and Stavrakaki, Louloudis and Georgiadou (1999).
17 - 18 April 2012

510

Proceedings of the 4th EMUNI Research Souk

progress (Beck 2006, Stavrakakis 1998). Risks do not create distance but quite, on the contrary, a high level of intertwinement between decision makers, science experts and citizens (Hajer 2003, 161). It has been argued that due to the global dimensions of the ecological crisis and the high leverl of intertwinement it is now hard to find any place not been affected by human activities (Katz 1997, 103-104). This means that Wild Nature can no longer be understood as a sacred remote place but on the contrary it acquire