Вы находитесь на странице: 1из 255



Carmen Eugenia Pia Lpez1


M. Sc. Ciencias Biolgicas; M.Sc.; M.Sc. Docencia Universitaria; Especialista en Nutricin Animal Sostenible; Especialista en Informtica y Multimedia.

Unidad 1. Seres vivos Captulos 1. Origen y Caractersticas Secciones El comienzo de la vida Evolucin celular Estructura y funcin Descripcin caractersticas 2. La Clula Estructura y funcin en eucariotas y procariotas Estructuras y organelos en eucariotas Diferenciacin entre clulas procariotas y eucariotas Fragmentos El comienzo de la vida, Experimento de Miller Las clulas primitivas , Etapas evolutivas de la clula, Teora endosimbitica

Membrana Plsmatica, funciones, tipos de transporte a travs de la membrana:transporte pasivo, transporte activo, Aplicaciones y anlisis de casos en el proceso de transporte a travs de la membrana, citoplasma, ncleo, cromatina y cromosomas, nucleolo, reticulo endoplasmtico, ribosomas, mitocondrias, aparato de Golgi , vacuolas, lisosomas, peroxisomas, centrosomas y centrolos, plastos, citoesqueleto, pared celular, diferencias entre clula animal y vegetal, interactividad sobre la clulal

Procesos Celulares Nutricin, Metabolismo, Respiracin, Fotosintesis, Relacin Divisin celular Divisn celular, interfase, mitosis, profase, metafase, anafase, telofase, citocinesis, meiosis, Interfase, profase l, metafase l, anafaseI, telofase y citocinesis I, Meiosis ll, profase ll, metafase ll, telofase y citocinesis II, divisin directa o amitosois, Interactividad sobre meiosis

3. Sistemas Orgnicos

Tejidos, rganos y Tejidos Animales: Epitelial, Conectivo, Nervioso, sistemas Muscular Tejidos Vegetales:Protector, Parenquimtico, Conductor, Sostn

Sistemas Animales: Digestivo, partes, estructura y funcin, interactividad sobre sistema digestivo , animacin sistema digestivo , Circulatorio, Tejido sanguneo, Estructura y Funcin del Corazn , Circulacin Sangunea, Animacin sobre el ciclo cardiaco y la circulacin sangunea , Mecanismo Hemostasis, Mapas conceptuales , Coagulacin sangunea , Linftico, Respiratorio, Excretor, Reproductivo , Nervioso, Neurona , Receptores Sensoriales, Organo de la Visin, oido , olfato, gusto , tacto, Muscular, Oseo, Endocrino, Glndulas y funciones hormonales Sistemas Vegetales: Organos de las plantas, Diferencias entre monocotildoneas y dicotildoneas, Organos vegetativos, Organos reproductivos 4. Microorganis- Seres acelulares mos los virus Los virus: Caractersticas, formas de accin viral, clasificacin de los virus, origen de los virus, enfermedades virales, importancia biolgica de los virus, viroides, priones, poder infectivo de los Priones Introduccin, Caractersticas de las Arqueas , Eubacterias: Cianobacterias , Importancia biolgica de cianobacterias , Las bacterias: , caractersticas, estructura , reproduccin, Intercambio gentico en bacterias , Nutricin , clasificacin de las bacterias, utilidad de las bacterias, enfermedades de origen bacteriano Los Protozoos: Caractersticas clasificacin: sacordinos, ciliados, flagelados, esporozoos. Algas: Principales caractersticas, Importancia biolgica Hongos: Caractersticas, Reproduccin Enfermedades causadas por hongos , Importancia biolgica

Seres vivos procariotas las bacterias, arqueobacterias

Los protozoos Las algas Los hongos 5. Sistemtica Introduccin Taxonoma y sistemas de clasificacin Categoras supraespecficas y claves Concepto de especie Nomenclatura Construccin de rboles filogenticos

Mapa conceptual Taxonoma Mapa conceptual Cladismo 2. Gentica 1. La informacin gentica Cromosomas , genotipo, fenotipo Leyes de la herencia Sntesis proteica Conocimientos bsicos Los pasos de la Ingeniera Gentica Transferencia de genes Desafos tecnolgicos Links 3. Ecologa 1. Ecologa Ecologa y Ecosistemas Ecologa, Organizacin del conocimiento ecolgico, Campos problmicos que aborda el eclogo, Los ecosistemas como unidad de estudio, Biocenosis, biotopo, habitat y nicho ecolgico, ejemplos de ecosistemas, Funcionamento del ecosistema, Enfoque para el estudio del ecosistema, relaciones alimentarias, Pirmides biolgicas, Biomasa y energa, Pirmide de energa, Ciclos de la materia, Productividad de los ecosistemas como base para la intervencin humana sostenible, Condiciones de las interacciones en los factores abiticos y biticos, Relaciones entre individuos, Aplicaciones para conservacin de la biodiversidad Teoras evolucionistas

2. Biotecnologa

Pensamiento sistmico y desarrollo Pensamiento agroecolgico


Este curso de Biologa busca unir la calidad acadmica de los contenidos disciplinares con posibilidades de interaccin del estudiante con las fuentes hipertextuales e hipermediales organizadas para un uso amigable y de ptimo refuerzo didctico, que motive una navegacin entusiasta en el proceso de construccin autnoma de los conceptos disciplinares y un proceso entusiasta de interaccin con las herramientas de comunicacin del curso, tales como foro, chat, correo electrnico y otros. El curso est orientado a la autogestin estudiantil de los conocimientos tericos necesarios para la comprensin de la estructura y funcionamiento de los organismos vivos en su biodiversidad como resultado evolutivo. Este conocimiento se aborda como un insumo de conocimiento transferible a futuras situaciones de desempeo profesional y de comportamiento biotico, como un bagaje de trabajo inter y transdisciplinar (orientado con procesos de investigacin formativa) totalmente necesario para seres que deben actuar con inteligencia en su medio ambiente, o sea en su base material y cultural de supervivencia como especie. En otros aspectos, se puede decir que la apropiacin terica del conocimiento en biologa, se guiar por el cuerpo disciplinar que maneja la comunidad acadmica internacional (ver estado del arte), identificando, seleccionando y organizando de manera pedaggica unos contenidos bsicos fundamentales, totalmente necesarios para aprehender los conocimientos estructurales de la disciplina, de los cuales se deriva el resto de conocimientos del rea biolgica y sus aplicaciones. El componente prctico se desarrollar mediante laboratorios previamente apoyados en vdeos didcticos introductorios y se complementar con observaciones de campo. Para efectos de precisin de conceptos el estudioso puede apoyarse en el glosario, espacio que adems de definiciones importantes, agrupa respuestas a preguntas enviadas por los estudiosos en busca de una mayor aclaracin. El objetivo es trabajar en red colaborativa de tutores y estudiosos para enriquecer este banco de definiciones y de respuestas a preguntas frecuentes.

Carmen Eugenia Pia Lpez (Autora) Requerimientos Resolucin ptima 1024 x 768 px

UNIDAD 1. SERES VIVOS Capitulo 1 Origen y caractersticas El comienzo de la vida Segn los clculos ms modernos, la Tierra se form hace unos 4.500 millones de aos y un milln de aos despus aparecera la vida. En 1924, el bioqumico Alexander Oparin formul su hiptesis sobre el origen de la vida a partir molculas inorgnicas que se encontraban en una atmsfera gaseosa, carente de oxgeno y sin capa de ozono que filtrara los rayos ultravioletas. La energa de descargas elctricas producidas durante grandes tormentas o la radiacin ultravioleta facilit la unin de las molculas inorgnicas de la atmsfera primitiva como: dixido de carbono CO2, metano CH4, hidrgeno H2, nitrgeno N2, cido clorhdrico HCl, sulfuro de hidrgeno, H2S, amonaco NH3 y vapor de agua para formar molculas orgnicas simples, como aminocidos, azcares, cidos grasos y nucletidos que a su vez formaran protenas y cidos nucleicos. Las lluvias llevaron las molculas orgnicas a los mares y lagos, donde se concentraron y formaron lo que se denomin como una sopa primitiva. Dentro de esta sopa primitiva pequeas gotas de material lipdico fueron rodeadas por agrupaciones de molculas orgnicas. Eventualmente las gotas de lpidos pudieron incorporar a su estructura nuevos materiales de las molculas orgnicas que las rodeaban, con un proceso simultneo de liberacin de la energa almacenada en las molculas orgnicas. La repeticin de este proceso permiti un crecimiento de las agrupaciones moleculares que al separarse de la solucin acuosa formaron coacervados que alcanzaban cierta estabilidad para generar procesos metablicos simples, crecer y reproducirse formando coacervados hijos que a veces conservaban las propiedades qumicas de su progenitor, lo cual prefigur un rudimento de herencia, que permite hablar de un modelo para el inicio de la vida. Oparin estudi como la seleccin natural actu sobre gotas de coacervados que consiguieron captar del medio los catalizadores adecuados para llevar a cabo procesos metablicos que aseguraran estabilidad, crecimiento, reproduccin y predominio sobre las dems. Estos procesos seran la base para la formacin posteriormente de organismos ms complejos. La comunidad cientfica de entonces ignor sus ideas. de clulas ancestrales y

Grfica 1 Origen de la vida. Fuente: diseado por Carmen Eugenia Pia L. Sin embargo, en 1950 un estudiante de la Universidad de Chicago, Stanley Miller, prob la hiptesis de Oparin. Stanley Miller demostr en el laboratorio, utilizando un aparato diseado por l, los mecanismos por los cuales los rayos producidos por descargas elctricas pudieron afectar la atmsfera terrestre primitiva y a partir de la combinacin de elementos inorgnicos la posibilidad de formar los precursores de sustancias orgnicas. Para ello en un recipiente de cristal diseado para simular las condiciones de los ocanos y mares primitivos someti a descargas elctricas una mezcla de gases con composicin parecida a la de la atmsfera terrestre primitiva (CH4, NH3, H2, N2 y vapor de agua). Luego la mezcla fue enfriada y condensada. El resultado fue la formacin de una serie de molculas orgnicas como aminocidos, y otros componentes orgnicos. En la actualidad, es de alta resonancia internacional una teora aparentemente "contendiente" desarrollada por un grupo de cientficos del departamento de biologa de la Universidad Estatal de California, Fresno, quienes estn realizando investigaciones con el meteorito Murchison (que se cree form parte de un cometa) el cual contiene algunos aminocidos similares a los obtenidos por Miller. Se plantea entonces dos posibles orgenes de las primeras molculas orgnicas que originaron la evolucin de la vida en la tierra: un origen endgeno terrestre, al estilo del experimento de Miller, y un origen extraterrestre, aportado por los meteoritos tipo Murchison. Otra opcin sera que estos dos mecanismos coexistieron y se complementaron. En todo caso, cualquiera de las dos teoras permite concluir positivamente sobre la capacidad de la materia del cosmos primigenio para generar reacciones conducentes a la formacin de molculas orgnicas, las cuales en las condiciones de la tierra, encontraron condiciones aptas para dar origen a la vida, con base en los procesos que se explican a continuacin. La siguiente etapa de formacin de vida fue la sntesis abitica de polmeros orgnicos con la formacin de protenas, lpidos, carbohidratos y cidos nucleicos.

Grfica 2. Experimento de Miller. Fuente: diseado por Carmen Eugenia Pia L. 1. Agua 2. Calor 3. Vapor de agua 4. Entrada de gases. 5. Matraz con mezcla de gases simulando atmsfera 6. Descargas elctricas (electrodos de tungsteno) 7. Condensador de agua (enfriamiento) 8. Erlemeyer con molculas orgnicas. Animacin Evolucin celular Las clulas primitivas El proceso de evolucin celular es un resultado paralelo de la evolucin en las condiciones de la atmsfera primitiva hacia la atmsfera actual. Con base en el enfoque evolutivo del bilogo molecular Carl Woese, las clulas primitivas para ser consideradas unidades vivientes, de alguna manera deban contar con un mecanismo que permitiera realizar procesos de transcripcin gentica. A esta clula primitiva precursora de los diversos tipos de clulas vivientes, la denomin protobionte, y por ser el antepasado comn de todos los organismos genticamente codificados, tambin la denomin progenota.

En el siguiente mapa conceptual se resume todo el proceso.

Con base en el proceso esquematizado en el mapa conceptual se pueden ilustrar las etapas evolutivas de la clula procariota primitiva en el siguiente diagrama:

Fuente: diseadas por Carmen Eugenia Pia L. La teora endosimbitica La teora endosimbitica propuesta por la cientfica Lynn Margulis explica el origen de las clulas eucariotas a partir de la evolucin de clulas procariotas primitivas as: Alguna clula procariota primitiva perdi su pared celular rgida quedando rodeada por la membrana plasmtica que al presentar una estructura ms flexible fue replegndose aumentando de esta manera su superficie membranosa con el consecuente aumento del tamao de la clula.

Grfica 3: Proceso evolutivo planteado por la teora endosimbitica Fuente: diseadas por Carmen Eugenia Pia L

A esta clula procariota de mayor tamao y carente de pared celular se le llam Urcariota.


De acuerdo con esta teora, la clula urcariota por el mecanismo de fagocitosis ingiri pero no digiri otras clulas procariotas de menor tamao tipo bacteria con las cuales estableci una relacin de mutua colaboracin llamada endosimbiosis -vivir juntas dentro-

Una de estas asociaciones fue la que se estableci entre la clula urcariota y algunas bacterias aerobias en donde la clula urcariota anaerobia hetertrofa suministraba a la bacteria aerobia algunos componentes orgnicos para su nutricin y la bacteria aerobia a su vez permiti a la urcariota utilizar el oxgeno y realizar la respiracin aerobia o metabolismo oxidativo. La estabilizacin evolutiva de la ventajosa y competitiva interaccin urcariota-bacteria aerobia, gener a partir de la bacteria aerobia la estructura actual (organelo) presente como mitocondria en las clulas animales y vegetales.

Otra combinacin ventajosa la constituy la incorporacin de bacterias fotosintticas -cianobacterias- a la clula urcariota.


Igualmente la estabilizacin evolutiva de la ventajosa y competitiva fusin urcariotabacteria fotosinttica, gener a partir de la bacteria fotosinttica la estructura actual (organelo) presente como cloroplasto presente en las clulas vegetales.

El origen de los organelos denominados peroxisomas presentes en las clulas eucariotas se cree parti de bacterias huspedes en la clula urcariota capaces de eliminar residuos txicos como el agua oxigenada. El ncleo rodeado de membrana nuclear presente en las actuales clulas animales y vegetales se gener de alguna clula del tipo arqueobacteria o Archaeabacteria, al incorporarse en la clula hospedadora. De igual manera se piensa que la fusin de urcariotas con bacterias como las espiroquetas di origen a los cilios y flagelos de las clulas eucariotas. Por otra parte como consecuencia de las invaginaciones de la membrana plasmtica se formaron compartimentos de doble membrana que fueron rodeando cada tipo de bacteria origen de los organelos.



Estructura y funcin de los seres vivos En todos los procesos que involucren seres vivos, recursos de biodiversidad o simulaciones como en el caso de transferencia por redes neuronales y procesos inteligentes en general, se requiere conocer la estructura y funcin a nivel macro y micro de los seres vivos, como una forma fundamental para la comprensin de la realidad y para la gestin sostenible del entorno. La estructura se analiza por niveles de organizacin que normalmente se discriminan en gentico a nivel de gen; tisular: los tejidos resultantes del conjunto de clulas especializadas; el organstico donde los tejidos conforman un rgano que desempea una o varias funciones y sistmico como el sistema digestivo donde un conjunto de rganos cumplen un mismo propsito o funcin por ejemplo la digestin. Un nivel superior es el de los organismos, pero la biologa adems de estudiarlos individualmente los analiza tambin como componentes de ecosistemas y como resultado de la evolucin de las especies. Por el lado de la funcin, el estudio de la biologa analiza las condiciones en que se mantienen procesos de equilibrio biolgico interno y en relacin con el ambiente o sea la homeostasia y analiza sobre el particular, la dinmica de poblaciones o sea la sinergia de los organismos para buscar su preponderancia y sostenibilidad dentro de nichos especficos de los ecosistemas en el proceso de evolucin de las especies. Descripcin de las caractersticas de los seres vivos Los seres vivos a diferencia de los objetos inertes presentan las siguientes caractersticas: Reproduccin

Tomado de Microsoft Encarta


Uno de los principios fundamentales de la biologa es que "toda vida proviene exclusivamente de los seres vivos". Cada organismo slo puede provenir de organismos preexistentes. La autoperpetuacin es una caracterstica fundamental de los seres vivos. Animacin del proceso de fecundacin Movimiento Todos los seres vivos son capaces de moverse. Este movimiento no debe confundirse con el desplazamiento: un objeto se desplaza cuando cambia su posicin dentro de un marco referencial, en cambio un ser vivo se puede mover sin cambiar de ubicacin. El movimiento de locomocin de los animales es muy obvio: se agitan, reptan, nadan, corren o vuelan. Las plantas tienen movimientos ms lentos, por ejemplo: los tropismos, las nastias y los seguimientos solares. Los tropismos son respuestas de crecimiento de las plantas a estmulos como la luz en este caso hablamos de fototropismo que puede ser negativo si se aleja del estmulo como en el caso de las races , o positivo como ocurre con las hojas o tallos que se orientan hacia la luz. Otro tipo de tropismo es el geotropismo que es una respuesta a la gravedad, puede ser positivo como el que presentan las races que son atradas hacia el centro de la tierra o negativo como en el caso de los tallos que crecen erguidos en contra de la gravedad Las nastias ocurren independientemente del estimulo por ejemplo: cuando las flores se cierran en la noche. Los seguimientos solares cuando las plantas orientan sus hojas o flores en direccin a la luz solar, como ocurre con la flor del girasol o del algodn. Otra clase de movimiento es el flujo del material vivo en el interior de las clulas de las hojas de las plantas conocido como ciclosis. Animacin de Tropismo Negativo Adaptacin Esta caracterstica se refiere a la capacidad de todos los seres vivos para adaptarse a su ambiente y as poder sobrevivir en un mundo en constante cambio. Las modificaciones que el organismo realiza frente a estmulos del medio interno y externo para adaptarse pueden ser estructurales, conductuales o fisiolgicas o una combinacin de ellas. Es decir, la adaptacin es una consecuencia de la irritabilidad. La adaptacin trae consigo cambios en la especie, ms que en el individuo. Si todo organismo de una especie fuera exactamente idntico a los dems, cualquier cambio


en el ambiente sera desastroso para todos ellos, de modo que la especie se extinguira. La mayor parte de las adaptaciones se producen durante periodos muy prolongados de tiempo, y en ellas intervienen varias generaciones. Las adaptaciones son resultado de los procesos evolutivos.

Tomado de Microsoft Encarta El cactus tiene pliegues en forma de acorden con los que pueden dilatarse para almacenar la mayor cantidad de agua posible y sus espinas no solamente lo protegen del sol y de los animales sedientos. Los pinginos tienen unas adaptaciones nicas externas que les ayudan a conservar este calor Irritabilidad Los seres vivos reaccionan a los estmulos, que son cambios fsicos o qumicos en su ambiente interno o externo. Los estmulos que evocan una reaccin en la mayora de los organismos son: cambios de color, intensidad o direccin de la luz; cambios en temperatura, presin o sonido, y cambios en la composicin qumica del suelo, aire o agua circundantes. En los animales complejos, como el ser humano, ciertas clulas del cuerpo estn altamente especializadas para reaccionar a ciertos tipos de estmulos; por ejemplo las clulas de la retina del ojo reaccionan a la luz. En los organismos ms simples esas clulas pueden estar ausentes, pero el organismo entero reacciona al estmulo. Ciertos organismos celulares reaccionan a la luz intensa huyendo de ella. La irritabilidad de las plantas no es tan obvia como la de los animales, pero tambin los vegetales reaccionan a la luz, a la gravedad, al agua y a otros estmulos, principalmente por crecimiento de su cuerpo. El movimiento de flujo del citoplasma de las clulas vegetales se acelera o detiene a causa de las variaciones en la intensidad de la luz. Complejidad estructural Los seres vivos poseen una complejidad estructural nica para poder desarrollar todas sus actividades. Esta complejidad es mantenida gracias al flujo constante de materia y energa que pasa por los organismos.


Metabolismo Es el conjunto de reacciones qumicas que ocurren al interior de las clulas y que le proporcionan a los seres vivos la materia y energa indispensable para desarrollar sus actividades vitales. En todos los seres vivos ocurren reacciones qumicas esenciales para la nutricin, el crecimiento y la reparacin de las clulas, as como para la conversin de la energa en formas utilizables. Para mantener el metabolismo, los organismos recurren a otras caractersticas secundarias como la nutricin, excrecin y respiracin. Las reacciones metablicas ocurren de manera contina en todo ser vivo; en el momento en que se suspenden se considera que el organismo ha muerto. Homeostasis Es la capacidad de todos los seres vivos de mantener constante las condiciones fsicas y qumicas de su medio interno. La tendencia de los organismos a mantener un medio interno constante se denomina homeostasis, y los mecanismos que realizan esa tarea se llaman mecanismos homeostticos. La regulacin de la temperatura corporal en el ser humano es un ejemplo de la operacin de tales mecanismos. Cuando la temperatura del cuerpo se eleva por arriba de su nivel normal de 37C., la temperatura de la sangre es detectada por clulas especializadas del cerebro que funcionan como un termostato. Dichas clulas envan impulsos nerviosos hacia las glndulas sudorparas e incrementan la secrecin de sudor. La evaporacin del sudor que humedece la superficie del cuerpo reduce la temperatura corporal. Otros impulsos nerviosos provocan la dilatacin de los capilares sanguneos de la piel, haciendo que esta se sonroje. El aumento de flujo sanguneo en la piel lleva ms calor hacia la superficie corporal para que desde ah se disipe en radiacin. Otro ejemplo lo constituyen las plantas, cuando les falta agua cierran los estomas de sus hojas evitando la prdida de agua por evaporacin. Crecimiento Todos los seres vivos crecen a lo largo de su vida. En el crecimiento interviene la sntesis de nuevas sustancias a partir de alimento tomado del medio. El crecimiento se produce por la expansin celular y por divisin celular. El crecimiento implica un aumento del tamao. Los individuos pluricelulares crecen por aumento en la cantidad de clulas que los componen (si bien en los organismos


unicelulares se registra un crecimiento por aumento del tamao de su clula, esto es hasta un lmite definido, en el cual la clula detiene su crecimiento y se divide para formar dos organismos). El desarrollo est relacionado con las transformaciones que sufre un individuo a lo largo de su vida. As, las clulas de un individuo pluricelular adquieren diferentes formas de acuerdo a su funcin. Qu son los seres vivos? Los seres vivos, incluidos los seres humanos, somos sistemas determinados estructuralmente. Esto quiere decir que todo ocurre en nosotros en la forma de cambios estructurales determinados en nuestra estructura, ya sea como resultado de nuestra propia dinmica estructural interna, o como cambios estructurales gatillados en nuestras interacciones en el medio, pero no determinados por ste. Como sistemas determinados estructuralmente, los seres vivos son sistemas que en su dinmica estructural se constituyen y delimitan como redes cerradas de produccin de sus componentes, a partir de sus componentes y de sustancias que toman del medio: los seres vivos son verdaderos remolinos de produccin de componentes, por lo que las sustancias que se toman del medio, o se vierten en l, pasan participando transitoriamente en el ininterrumpido recambio de componentes que determina su continuo revolver productivo. Es esta condicin de continua produccin de s mismos, a travs de la continua produccin y recambio de sus componentes, lo que caracteriza a los seres vivos y lo que se pierde en el fenmeno de la muerte. Es a esta condicin a la que me refiero al decir que los seres vivos son sistemas autopoiticos y que estn vivos slo mientras estn en autopoiesis. BIOLOGA DEL FENMENO Entrevista ecovisiones n 6 SOCIAL [i] Humberto Maturna R.

Capitulo 2 La Clula
Historia Gracias a la invencin del microscopio se hizo posible investigar cmo son las clulas y los descubrimientos sobre la estructura celular que tuvieron lugar a lo largo del siglo XVII marcan una verdadera revolucin cientfica y dan origen a la Biologa moderna. El ingls Robert Hooke (1637-1703) fue el primero que utiliz el trmino "clula" en 1665 para referirse a los compartimentos vacos semejantes a celdas que observ a travs del microscopio en una lmina de corcho. Hooke observ clulas secas, despus de muchos aos los investigadores determinaron que las clulas no estaban vacas sino llenas de sustancia acuosa.


En 1673, Anton Van Leeuwenhoeck realiz observaciones de clulas vivas como eritrocitos y espermatozoides, igualmente al examinar agua de los charcos vi por primera vez organismos microscpicos. Despus del perfeccionamiento del microscopio en 1838 el botnico alemn Mathias Schleiden al observar al microscopio tejidos vegetales concluy que estaban formados por clulas y que el embrin de una planta tuvo su origen a partir de una sola clula. Un ao ms tarde el zologo alemn Theodor Schwann en sus estudios microscpicos de tejidos animales y vegetales determina que los tejidos animales estn constituidos por clulas, y que las clulas de plantas y animales presentan estructuras semejantes Estos alemanes fueron los primeros en proponer los dos primeros postulados de la teora celular, afirmando que todos los organismos vivos estn constituidos por clulas y que la clula es la unidad estructural. En 1859 el bilogo alemn Rudolf Virchow propuso que todas las clulas vienen de clulas preexistentes: omnis cellula e cellula.

La teora celular La teora celular moderna se resume en tres postulados: La clula es la unidad bsica estructural de todos los seres vivos, todos los organismos estn formados por clulas. La clula es la unidad funcional de todos los organismos. Todo el funcionamiento del organismo depende de las funciones que ocurren al interior de la clula, respiracin, reproduccin, digestin, crecimiento entre otras. Todas las clulas se originan por la divisin de clulas preexistentes (en otras palabras, a travs de la reproduccin). Cada clula contiene material gentico que se transmite durante este proceso.

Estructura y funcin en procariotas y eucariotas La clula es la unidad fundamental de la vida. Es la estructura ms pequea del cuerpo, capaz de realizar todos los procesos que definen la vida. Las clulas poseen una estructura altamente organizada, tienen capacidad de autorregulacin, de responder ante diferentes estmulos, de respiracin, de movimiento, de digestin, de reproduccin, de comunicacin, aunque no todas las clulas pueden realizar todas estas funciones. En los organismos unicelulares como los protozoos y las bacterias la clula es autnoma, realiza todas las funciones, mientras que organismos como las plantas y los animales estn formados por muchos millares de clulas organizadas en tejidos y rganos con funciones especficas.


La mayora de las clulas son invisibles para el ojo humano. Hasta el vulo femenino, que es la clula ms grande del cuerpo, no es ms grande que el punto situado al final de esta frase. El tamao y la forma varan con las funciones celulares. Todas las clulas constan de tres partes principales: La membrana citoplasmtica, el citoplasma y una regin nuclear que alberga el material gentico. Existen dos tipos bsicos de clulas segn la evolucin del mundo biolgico y el grado de complejidad en su organizacin: procariotas y eucariotas.

Diferenciacin entre clulas procariotas y eucariotas Las clulas procariotas

Grfica 4 Esquema de una clula procariota Fuente: diseado por Carmen Eugenia Pia L. Caractersticas Carecen de membrana que rodee el material gentico el cual se halla ms o menos disperso en el citoplasma. Tienen tamaos comprendidos entre 1 y 10 micrmetros. ( 1 micrmetro equivale a 1/1000mm) Son clulas caractersticas de seres como las bacterias. Se dividen por biparticin. Su citoplasma no posee estructuras membranosas Los ribosomas son de menor tamao No poseen citoesqueleto Poseen un solo cromosoma

Las clulas eucarioticas Caractersticas


Presentan una membrana nuclear que delimita el espacio donde se encuentra el material gentico. Tienen tamaos muy variables que van desde los 10 hasta los 100 micrmetros. Son clulas caractersticas de los animales, los vegetales, los protistos y los hongos. Las eucariotas se dividen por divisin mittica, por eso tienen centrolos. Poseen estructuras membranosas como el retculo endoplasmtico, y el aparato de Golgi que estn ausentes en las procariotas. Otros orgnelos de importancia capital para las eucariotas son las mitocondrias y los cloroplastos, que faltan en los procariotas. Los ribosomas son de mayor tamao. Presentan citoesqueleto.

Estructuras y organelos de la clula eucariotica

Grfica 5 clula eucaritica vegetal Fuente: diseado por Carmen Eugenia Pia L. La Membrana Plasmtica o Celular En la superficie de la clula hay una capa citoplasmtica muy delgada que forma una envoltura continua: la membrana plasmtica que separa la clula de su medio externo. Por una de sus caras, sta membrana se encuentra en contacto con el medio extracelular, por la otra, con el citosol. La membrana citoplasmtica est compuesta de lpidos, protenas e hidratos de carbono en proporciones aproximadas de 40%, 50% y 10%, respectivamente. Segn el modelo de membrana " Modelo de mosaico fluido" propuesto en 1972 por J. Singer y G. Nicolson, la membrana est formada por una doble capa lipdica a la que se adosan molculas proteicas. Si se adosan en ambas caras de la superficie reciben el


nombre de protenas extrnsecas y si, por el contrario, atraviesan la capa de lpidos, reciben el nombre de protenas intrnsecas o integrales. Los lpidos que forman la membrana son principalmente fosfolpidos, tambin encontramos cefalinas, lecitinas y colesterol. Los fosfolpidos en contacto con el agua forman una capa doble de molculas de manera que el extremo hidroflico o polar (amigo del agua) se dispone hacia el exterior de la clula, es decir, hacia el citoplasma o hacia el lquido extracelular y el extremo hidrofbico no polar o lipfilo (amigo de los lpidos, repelente al agua) se dispone dentro de la bicapa. El otro componente de la membrana plasmtica son los hidratos de carbono: glicoprotenas y glicolpidos segn se unan a protenas o lpidos. Los glicolpidos tienen funcin estructural. Las glicoprotenas forman el glicocliz que es una capa densa de carbohidratos que cubre la cara externa de la membrana plasmtica y participan en los procesos de endocitosis, en las reacciones antgenoanticuerpo y en la transduccin de seales.

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookCELL2.html#The %20Cell%20Membrane La estructura de la membrana no es esttica y tanto los lpidos como las protenas tienen gran libertad de movimientos (se comporta como un fluido). La movilidad de los lpidos en el plano de la bicapa que forman, es tanto mayor cuanto ms alta es la temperatura ambiente y las cadenas de cidos grasos estn menos saturadas y sean ms cortas. La estabilidad y estructura bsica de la membrana se mantiene gracias al colesterol que se une a los fosfolpidos mediante enlaces dbiles, manteniendo la estructura de la bicapa Los compuestos protenicos de la membrana desarrollan las siguientes funciones:


El transporte selectivo de sustancias (iones, molculas polares) de un lado a otro de la membrana. EL control de las reacciones bioqumicas que ocurren en la clula (por enzimas que aceleran o retardan las reacciones qumicas) Actuar como marcadores que identifican a las clulas para su reconocimiento por otras sustancias u hormonas.

Funciones de la membrana celular La membrana mantiene la integridad estructural de la clula, pero adems controla la actividad celular, sus funciones bsicas son: Proteger las clulas y mantener las condiciones necesarias para el desarrollo de las funciones vitales. Regular los intercambios de sustancias entre el medio exterior e interior. Comunicar a la clula con otras clulas Mantener la identidad celular Recibir y transmitir informacin

Tipos de transporte a travs de la membrana El transporte a travs de la membrana ocurre por dos mecanismos transporte activo y transporte pasivo. Transporte pasivo Es un proceso de difusin de sustancias a travs de la membrana. No requiere gasto de energa celular, se realiza a favor del gradiente (es decir, de donde hay ms hacia donde hay menos) de concentracin, de presin o de carga elctrica. Hay varios mecanismos de transporte pasivo: Difusin simple: Si dos sustancias de diferente concentracin se encuentran separadas por una membrana semipermeable, las molculas de la sustancia (soluto) con mayor concentracin atraviesan la membrana hacia la solucin menos concentrada para igualar las concentraciones de soluto. Ejemplo: El agua, el dixido de carbono, el oxgeno, molculas solubles en lpidos como las vitaminas A, E, algunas hormonas esteroideas, atraviesan la membrana de esta forma. Difusin facilitada: es la difusin de molculas y los iones solubles en agua a travs de la membrana, con la participacin de las protenas de la membrana. Las protenas pueden formar poros o canales con dimetros especficos y cargas elctricas que permiten el paso selectivo de iones. Los iones de Na +, K+, Ca2+, Clatraviesan la membrana de esta manera.


Hay canales que permanecen abiertos y otros que solo se abren cuando llega una molcula portadora que se une a las molculas e induce a una variacin de la configuracin que abre el canal, o bien cuando ocurren cambios en la polaridad de la membrana. Es as como la difusin puede ser facilitada por protenas portadoras que se unen a las molculas facilitando la apertura del canal y su paso a travs de la membrana. Los neurotrasmisores atraviesan la membrana de esta forma. Osmosis: cuando 2 disoluciones se encuentran separadas por una membrana semipermeable el solvente (agua) pasa a travs de la membrana desde la regin de mayor concentracin de solvente hacia la de menor concentracin hasta igualar las concentraciones. La concentracin de agua dentro y fuera de las clulas animales es igual (isotnica), por lo tanto no existe tendencia del agua a entrar o salir de stas La smosis es clave para la supervivencia de los seres vivos. La absorcin de agua y minerales a travs de las races de las plantas ocurre a travs del mecanismo de smosis, igualmente la reabsorcin de agua y minerales en el rin. Transporte activo En el proceso de transporte activo tambin actan protenas de membrana, pero stas requieren energa celular en forma de ATP, para transportar las molculas al otro lado de la membrana. Se produce cuando el transporte se realiza en contra del gradiente electroqumico. Mecanismo de transporte activo para molculas de bajo peso molecular Para el transporte de molculas de bajo peso molecular y en contra del gradiente se requiere la ayuda de las protenas de transporte denominadas bombas, por su similitud con las bombas de agua. Las protenas de transporte utilizan energa para mover las molculas en contra del gradiente de concentracin. Son ejemplos de transporte activo la bomba de Na+/K+, y la bomba de Ca.++ La bomba de Na+/K+ requiere una protena de transporte que bombea Na+ hacia el exterior de la membrana y K+ hacia el interior. La absorcin de minerales en las plantas es un ejemplo de transporte activo Mecanismos de transporte activo para molculas de elevado peso molecular Existen dos mecanismos principales para el transporte de estas molculas en contra del gradiente: endocitosis y exocitosis Endocitosis


La endocitosis es un proceso de incorporacin de sustancias del medio externo a la clula mediante una invaginacin en la superficie exterior de la membrana que engloba las partculas o lquidos a ingerir. Una vez las partculas o sustancias dentro de la invaginacin se produce la estrangulacin de la invaginacin originndose una vescula que encierra el material ingerido el cual es transportado al interior del citoplasma. Segn la naturaleza de las partculas englobadas, se distinguen diversos tipos de endocitosis: pinocitosis y fagocitosis. Pinocitosis. Implica la ingestin de lquidos y partculas en disolucin a travs de una invaginacin de la membrana plasmtica que forma pequeas vesculas o vacuolas que luego se introducen al citoplasma con los lquidos ingeridos. La pinocitosis incorpora grandes molculas como glcidos, cidos grasos y aminocidos, por ejemplo, del quilo alimenticio en las microvellosidades intestinales La fagocitosis implica la incorporacin de partculas grandes, o de microorgansimos a travs de extensiones de la membrana plasmtica, denominadas pseudpodos los cuales engloban las partculas, luego los extremos de los pseudpodos se fusionan dando origen a una vescula o vacuola alimenticia con las partculas dentro. Las partculas incluidas en la vacuola son digeridas por enzimas digestivas llamadas lisosomas. La fagocitosis la realizan las amebas en su proceso digestivo, los leucocitos para destruir bacterias y las clulas de microgla del sistema nervioso que destruyen y eliminan las neuronas muertas por heridas o por envejecimiento. Exocitosis La exocitosis es el proceso contrario a la endocitosis. Tiene como objetivo la excrecin de sustancias, ocurre cuando una macromolcula o una partcula debe pasar del interior al exterior de la clula. Las macromolculas contenidas en vesculas citoplasmticas creadas por el aparato de Golgi, se desplazan hasta la membrana plasmtica, la membrana plasmtica y la vescula se fusionan y la vescula vierte su contenido al medio extracelular. Productos de desecho de la digestin celular, secrecin de hormonas son vertidas hacia el lquido extracelular por este mecanismo. En toda clula existe un equilibrio entre la exocitosis y la endocitosis para que quede asegurado el mantenimiento del volumen celular. Aplicaciones y anlisis de casos en el proceso de transporte a travs de la membrana Tanto las clulas animales como vegetales deben vivir en un medio isotnico, (es decir, la concentracin del medio en que se encuentra la clula es igual a la


concentracin del medio interno de la clula) porque de lo contrario se ven afectados por la ley de la smosis. Cuando la clula se encuentra en un medio externo con una concentracin salina, o protinica, menor que en su citoplasma o medio interno, diramos que el medio externo es hipotnico con respecto a ella. La clula reaccionara buscando el equilibrio, con lo cual, tomar molculas de agua del medio externo y se hinchar mediante un proceso llamado turgencia, es decir, se hincha hasta que finalmente se puede producir la lisis o rompimiento. Cuando una clula se encuentra en un medio externo que posee una mayor concentracin que su medio interno, se dice que es hipertnico con respecto a la clula. En este caso, la clula intentar adaptarse al medio expulsando molculas de agua de su citoplasma al medio externo. Este fenmeno originaria una deshidratacin en la clula llamado plasmlisis. Es un fenmeno reversible. Ejemplos. Si regramos una planta con agua de mar, las clulas de los pelos de las races (por donde se capta el agua y las sales minerales), al tratar de buscar el equilibrio entre los medios se deshidrataran, sufriran una plasmolisis y por consiguiente, moriran. Las hojas de lechuga se ponen turgentes cuando se dejan en agua y luego al aliar la ensalada se arrugan. Al dejarlas en agua se estn colocando en un medio hipotnico, por lo que mediante un proceso osmtico entrar agua al interior de las clulas de la lechuga, atravesando sus membranas celulares que son semipermeables; se producir por tanto el proceso de turgencia. Al aadirle la sal del alio, el medio se convierte en hipertnico y ocurre el proceso inverso: las hojas pierden agua pues esta se desplaza al medio externo (de mayor concentracin salina) por smosis, lo que da lugar a que se arruguen las hojas. Los glbulos rojos normalmente tienen una forma bicncava y se encuentran suspendidos en un lquido denominado plasma que contiene sales, protenas y otros solutos. La concentracin del interior celular del glbulo rojo, as como de todas las clulas de mamfero en general, equivale a una concentracin de NaCl de 154 mM. Las soluciones que se administran va venosa deben ser isotnicas para los eritrocitos en esta situacin no hay entrada ni salida neta de agua a los eritrocitos u otras clulas sanguneas (equilibrio osmtico). Si se administra a los glbulos rojos una solucin de mayor concentracin de solutos, el glbulo rojo se deshidrata y su volumen disminuye. En este caso los glbulos rojos sufren un cambio en su morfologa discoidal, deformndose debido a que se ha producido la salida de parte del agua de su citoplasma al medio externo debido a la ley osmtica. Esta falta de agua produce un arrugamiento celular y una perdida de volumen debido al fenmeno de plasmolisis como lo demuestran los arrugamientos de su membrana que deja de estar tersa



Por el contrario, cuando el glbulo rojo es colocado en una solucin hipotnica o de menor concentracin de solutos, como el agua, el agua entra al glbulo rojo , este se hincha, se produce lisis o rotura de los glbulos rojos debido a la entrada de agua del medio externo al interior de la clula, como se observa en la en la figura lV Por este motivo cuando se produce una herida resulta conveniente lavarla con suero salino (de igual composicin salina que el plasma sanguneo), resultando perjudicial lavarla con agua destilada. Al lavar un herida (clulas vivas) con suero salino, no se altera el equilibrio osmtico de las clulas, por lo que no sufrirn dao; en cambio, si se lava con agua destilada, se las somete a un medio muy hipotnico, por lo que sufrirn una entrada masiva de agua por procesos osmticos, que las perjudica, pudiendo llegar a destruirlas. Citoplasma El citoplasma forma un fluido viscoso que circunda el ncleo y est limitado por la membrana plasmtica. Se compone bsicamente de agua y numerosas sustancias minerales y orgnicas disueltas en solucin coloidal. Las sustancias minerales contenidas estn ionizadas. Sobre todo hay potasio, sodio, calcio y magnesio, en dosis extremadamente exactas. Las sustancias orgnicas son bsicamente protenas y en menor proporcin lpidos, carbohidratos, cidos nucleicos. En el citoplasma de la clula eucariota encontramos el citoesqueleto, orgnelos como las mitocondrias, los lisosomas, el ncleo, adems de un sistema de membranas el retculo endoplasmtico, unos grnulos los ribosomas y vacuolas en clulas vegetales. La funcin del citoplasma est relacionada con los procesos metablicos encargados de las sntesis de compuestos como aminocidos, lpidos, carbohidratos entre otros.


El Ncleo

Fuente: diseado por Carmen Eugenia Pia L El ncleo es el organelo que gobierna todas las funciones de la clula. Las principales funciones son: crecimiento y reproduccin celular, almacenamiento y organizacin de los genes, trasmisin de la informacin gentica. En las clulas eucariotas el ncleo est rodeado por una membrana nuclear, mientras que en las procariotas no existe dicha membrana, por lo que el material nuclear est disperso en el citoplasma. En las clulas eucariotas al ncleo tambin se le llama carioplasma, se localiza en el centro de la clula y suele tener una forma redondeada o elptica en las clulas prismticas. El ncleo de una clula eucariota puede presentarse en dos formas distintas, segn sea la etapa en que se halle la propia clula. En las clulas que no estn en divisin y consecuentemente su ncleo no est en proceso de transformacin, el DNA se encuentra combinado con protenas como las histonas, dndole una apariencia fibrilar. Esta combinacin de DNA y protenas se llama cromatina. Durante la divisin celular o mitosis la cromatina se condensa en cromosomas susceptibles de ser coloreados y observados al microscopio ptico. Los cromosomas tienen como funcin portar los factores hereditarios o genes y trasmitir la informacin gentica de una clula a otra sin modificarla ni empobrecerla, esta transmisin ocurre durante la divisin de la clula. No se conoce todava de modo exacto la estructura de cada cromosoma, pero se supone que cada uno de ellos consta de una o varias dobles hlices de ADN, varias veces envueltas sobre s mismas. El nmero de cromosomas de cada clula es constante para cada especie, pero se reduce a la mitad en las clulas sexuales o gametos. A raz de este fenmeno, estas


clulas se denominan haploides, frente a la denominacin de diploides que tienen las dems clulas. Cromatina y Cromosomas

Grfica Cromosoma Fuente: diseado por Carmen Eugenia Pia L La cromatina que se puede observar durante la interfase a travs del microscopio electrnico como filamentos muy delgados y retorcidos est constituida por ADN, protenas y cidos nucleicos; pero cuando la clula entra en divisin la cromatina se organiza en estructuras individuales que son los cromosomas Un cromosoma es una molcula de ADN muy larga que contiene una serie de genes. Un cromosoma est formado por dos cromtidas. En cada una de ellas hay un nucleofilamento de ADN replegado e idntico en ambas cromtidas. Las cromtidas estn unidas a travs del centrmero. En las cromtidas tambin se observa un cinetcoro que es el centro organizador de microtbulos que se forman durante la mitosis y que ayudan a unir los cromosomas con el huso mittico. El Nucleolo Se encuentra dentro del ncleo de clulas eucariticas aparentemente sin membrana delimitadora y asociado con una regin especfica de un cromosoma llamado organizador nuclear, que al parecer atraviesa al nucleolo. Cuando la clula eucariota permanece sin dividirse (perodo de interfase), el nucleolo se puede observar al microscopio ptico como un organelo de color ms oscuro, de tamao pequeo (1 a 7 micrmetros) y de forma redondeada. El nucleolo est compuesto por de protena, ARN y ADN. El tamao y la morfologa de los nucleolos vara en funcin de la especie, del tipo celular y del estado fisiolgico de la clula. Es as como su nmero y tamao aumentan durante la sntesis de protenas. Durante la divisin celular el nucleolo desaparece. La funcin del nucleolo es la sntesis de ribosomas.


En las clulas procariotas el nucleolo esta ausente. El Retculo Endoplasmtico

Fuente: diseado por Carmen Eugenia Pia L Se encuentra en todas las clulas eucariotas y ocupa hasta el 10% del espacio interior de stas. Se trata de un sistema de membranas cuyas dimensiones dependen del estado fisiolgico de la clula: es ms reducido en las clulas poco activas o poco diferenciadas. El retculo endoplasmtico forma una red de pequeos canales mltiples, comunicantes entre s, que atraviesan el citoplasma y van desde la membrana nuclear hasta la membrana plasmtica. Su funcin consiste en transportar materiales dentro de la clula a manera de un sistema circulatorio. En puntos diversos forma pequeas cavidades o vesculas, y est constituido por una doble lmina que limita dos espacios: el citoplasmtico y el reticular. El espacio que queda limitado en el interior se denomina lumen. La membrana externa puede ser rugosa, con la presencia de ribosomas y se denomina retculo endoplasmtico rugoso, o lisa carente de ribosomas y en este caso se denomina retculo endoplasmtico liso. El retculo endoplasmtico liso es responsable de: la sntesis de fosfolpidos y colesterol y el procesamiento de sustancias txicas procedentes del exterior de la clula. La actividad del retculo endoplasmtico rugoso est estrechamente relacionada con la sntesis de protenas y viene determinada por la presencia de ribosomas. Ribososmas Son organelos compactos y globulares, se encuentran tanto en las clulas procariotas como en las eucariotas. Estn compuestos por ARN y protenas. Son unos grnulos cuyas dimensiones se miden en millonsimas de milmetro, se hallan situados sobre las membranas del retculo endoplasmtico rugoso o sobre la cara externa de la membrana nuclear, o incluso aislados en el plasma.


Fuente: diseado por Carmen Eugenia Pia L

En los ribosomas tiene lugar la sntesis de protenas, es decir, la unin de los aminocidos de una protena siguiendo una secuencia establecida genticamente. Mitocondrias

Fuente: diseado por Carmen Eugenia Pia L Son minsculos orgnelos celulares, se hallan, generalmente en gran nmero, en casi todas las clulas vegetales y animales (clulas eucariotas). Las mitocondrias Suelen tener forma de saco tubular, ovalado. Observadas al microscopio electrnico presentan dos membranas separadas. La membrana interna presenta crestas o repliegues hacia el interior que aumentan la superficie de la membrana. Contiene numerosas protenas de transporte y otras con funciones muy especializadas, como los complejos que forman la cadena respiratoria y el ATP (trifosfato de adenosina) La membrana externa. Contiene numerosas protenas que regulan los intercambios de sustancias con el citosol (parte lquida del ciptoplasma). Se destacan las protenas de canal, las cuales forman grandes poros que la hacen muy permeable. Las mitocondrias se constituyen en fbricas de energa celular; ellas extraen la energa de las molculas alimenticias y la almacenan en forma de ATP, dicha energa es utilizada en todos los procesos metablicos, esto se lleva a cabo a travs de la respiracin celular.


El proceso de oxidacin de alimentos se constituye en la respiracin celular aerobia, y consiste en una serie de reacciones catalizadas enzimticamente y tiene como propsito la produccin de energa biolgicamente til ATP en clulas que viven en presencia de oxgeno. En este proceso, se transfieren electrones desde la glucosa (molcula proveniente del alimento) hasta el oxgeno molecular para producir energa, bixido de carbono y agua

Glucosa + 6O2 CO2 + 6H2O + 36 ATP

Aparato de Golgi

Fuente: diseado por Carmen Eugenia Pia L Es un organelo comn a todas las clulas eucariotas y est especialmente desarrollado en aquellas que tienen actividad secretora. El aparato de Golgi se deriva del retculo endoplasmtico y est constituido por una serie de cavidades planas paralelas, delimitadas por una membrana, en cuya periferia hay unas vesculas llamadas asimismo de Golgi. La funcin del aparato de Golgi consiste en: El aislamiento dentro del citoplasma y mediante una membrana, de algunas sustancias (por ejemplo separa protenas, de lpidos) Empacar esas sustancias en las vesculas con el fin de llevarlas al interior del propio citoplasma o a su parte exterior. Intervenir en los procesos de secrecin y la excrecin celular Proteger a la clula de la accin txica de determinadas sustancias. Intervenir en la formacin de los lisosomas

Vacuolas Las vacuolas son organelos abundantes en las clulas vegetales y bastante escasos y muy pequeos en las clulas animales. Estn rodeadas de una membrana denominada tonoplasto y en su interior se encuentra una sustancia fluida de composicin variable. Las vacuolas pueden ocupar entre un 5 y un 90% del volumen celular, aunque, de hecho, casi siempre es superior al 30%. Desempean funciones muy diversas, hasta el punto de que en una misma clula pueden encontrarse vacuolas con funciones distintas. En las clulas vegetales las vacuolas intervienen en los siguientes procesos:


Constituyen reservas de sustancias nutritivas (azcares, grasas), que estn a disposicin de las necesidades de la clula. Actan como almacenes de productos txicos para la clula. Dan soporte a la clula. Contribuyen al crecimiento de los tejidos. En organismos unicelulares sirven para realizar el proceso digestivo. Eliminan el exceso de agua que entra a la clula.

Lisosomas Los lisosomas son organelos caractersticos de las clulas eucariotas. Son ms abundantes en clulas animales. Son pequeas vesculas de forma y tamao variables, aunque, por lo general, son esfricas. Los lisosomas estn limitados por una membrana y en su interior, contienen enzimas como lipasas y nucleasas. Los lisosomas se encargan de: La hidrlisis de macromolculas. Esas macromolculas pueden proceder del exterior de la clula por endocitosis, como las sustancias nutritivas que deben digerirse. Digerir organelos de la propia clula defectuosos, que no funcionan bien o que envejecen Destruir microorganismos como virus o bacterias nocivos para la clula.

Peroxisomas Estn presentes en las clulas eucariotas y pueden encontrarse dispersos por el citoplasma o bien estrechamente relacionados con otros organelos como mitocondrias o cloroplastos. Son organelos pequeos y esfricos, rodeados por una membrana, contienen: enzimas oxidasas y catalasas. Las funciones de los peroxisomas son: Llevar a cabo reacciones oxidativas de degradacin de cidos grasos y aminocidos por accin de las oxidasas. Es as como, las oxidasas utilizan el oxgeno molecular para eliminar tomos de hidrgeno de los sustratos. Como resultado de esta oxidacin en unos casos se obtiene agua y en otros perxido de hidrgeno. Degradar el perxido de hidrgeno sustancia que es muy txica para la clula, por accin de la enzima catalasa, con la produccin de agua y oxgeno. Intervenir en reacciones de detoxificacin (por ejemplo, gran parte del etanol que bebemos es detoxificado por peroxisomas de clulas hepticas)


Centrosomas y Centrolos

Los centrosomas estn constituidos por un par de centrolos presentes en clulas animales. Su funcin principal es formar las fibras del huso acromtico en el proceso de divisin celular. Los centrolos se encuentran en nmero par, son muy pequeos y de difcil observacin en el perodo de interfase. Observado con el microscopio electrnico, cada centrolo aparece como un cilindro hueco, con un dimetro de 0,15 micras y una longitud de 0,5 micras. La pared del centrolo est constituida por una serie de agrupamientos de tbulos. Los centrolos se hacen visibles durante la divisin celular, cuando los centrolos desempean su funcin principal consistente en la produccin del huso mittico. Los centrolos forman tambin los cilios y flagelos de las clulas. Plastos o Plastidios

Fuente: diseado por Carmen Eugenia Pia L Los plastos se encuentran exclusivamente en las clulas vegetales, tienen forma de disco o esfrica limitados por una membrana doble. Se agrupan en tres tipos: cloroplastos, leucoplastos y cromoplastos. Los cloroplastos son caractersticos en vegetales y en algunas algas unicelulares. Estn rodeados por una membrana doble: la externa que presenta plegamientos o crestas y es muy permeable, y la interna lisa, es decir sin crestas, menos permeable que la externa y con numerosas protenas especializadas en el transporte selectivo de sustancias.


La membrana interna contiene un semifluido denominado estroma compuesto de enzimas, ADN y ribosomas. Dentro del estroma se localizan unos sculos aplanados y membranosos, a los cuales en forma individual se les llama tilacoides y contienen el pigmento verde o clorofila, as como otros pigmentos. Los tilacoides tienden a formar apilamientos denominados grana, los cuales se conectan entre s formando una red de cavidades. Los cloroplastos tienen como funcin realizar la fotosntesis. Leucoplastos: Son estructuras incoloras o blancas que almacenan almidn, grasa protenas y otras sustancias. Cromoplastos: Dan color a las flores, la cscara y la pulpa de muchos frutos y son organelos con pigmentos de diferentes colores, excepto el verde. Citoesqueleto Presente en clulas eucariotas est compuesto por una red de fibras proteicas en forma de microfilamentos, filamentos y microtbulos gruesos. Las funciones del citoesqueleto son: Dar forma y sostn a la clula. Facilitar el movimiento celular ameboideo y de migracin por accin del deslizamiento y ensamblado y desamblado de los microfilamentos y microtbulos. Ayudar al sostn, posicin y movimiento de organelos. Participar en la divisin celular al mover los cromosomas hacia las clulas hijas y al contraer el citoplasma para su divisin.

Pared Celular Presente en las clulas eucariotas vegetales y fngicas, externa a la membrana plasmtica. Bsicamente est compuesta de celulosa, y en menor cantidad de otras sustancias como la hemicelulosa, los pectatos o pectinas, lignina, suberina, cutina, protenas, sales minerales y ceras. La pared celular cumple un papel importante en la absorcin, transpiracin, secrecin y traslocacin. Sirve de proteccin contra la desecacin y de defensa contra bacterias y otros patgenos Diferencias entre la clula eucariota vegetal y animal La clula eucariota vegetal Utiliza la materia inorgnica para sintetizar compuestos orgnicos. Aprovecha la energa lumnica para que tenga lugar el proceso anterior.


Utiliza despus la energa qumica de las molculas orgnicas que ella ha sintetizado. Desarrolla un proceso de nutricin auttrofa. Presenta pared celular. Contiene plastos. Tiene mayor nmero de vacuolas

La clula eucariota animal No puede sintetizar molculas orgnicas a partir de molculas inorgnicas. No aprovecha la energa lumnica en la sntesis de molculas orgnicas. Depende de las molculas orgnicas que toma del exterior y de la energa qumica que estas contienen. Desarrolla un proceso de nutricin hetertrofa. Tiene mayor nmero de lisosomas. Presenta centrolos. .

Interactividad sobre la clula

Procesos Celulares

Consiste en la captacin de materia para crecer, reponer las partes de la clula que estn envejecidas y disponer de materias primas para las distintas actividades celulares y obtener la energa. Todos estos procesos se realizan mediante reacciones bioqumicas.


Es el conjunto de reacciones que se producen dentro de las clulas de los seres vivos, estas reacciones son catalizadas por enzimas concretas. Hay dos grupos de reacciones metablicas: Anabolismo (sntesis) Es el conjunto de reacciones cuyo objetivo es la obtencin de molculas complejas y ricas en energa (glcidos, cidos grasos) a partir de molculas simples. Estas reacciones consumen energa que se incorpora a la molcula sintetizadadora, son reacciones endergnicas. Catabolismo (degradacin) El conjunto de transformaciones bioqumicas que las clulas realizan a partir de molculas energticamente ricas. Se produce energa qumica disponible para otras reacciones y se obtienen productos ms simples. Son reacciones exergnicas.


La materia y la energa que proporciona la nutricin ponen en marcha todas las reacciones metablicas, el proceso comienza con la entrada de nutrientes del exterior.

Respiracin celular

Es una oxidacin de molculas orgnicas para suministrar energa a plantas y animales. La energa obtenida se utiliza para unir un grupo de fosfatos de alta energa ADP y formar un portador de energa a corto plazo el ATP. En las clulas vegetales la respiracin se realiza a partir de la glucosa obtenida en la fotosntesis. En las animales, se realiza a partir de la glucosa obtenida al ingerir los alimentos. La respiracin necesita: Monmeros de la grandes biomolculas (glucosa). Molculas transportadoras de electrones. Molcula receptora que es el oxigeno. Un espacio cerrado para que se lleve acabo la transferencia de electrones, este espacio es la mitocondria.

Hay dos tipos de respiracin: respiracin aerbica y respiracin anaerbica. Respiracin Aerbica El oxgeno libre se utiliza para oxidar molculas orgnicas y convertirlas en bixido de carbono y agua con alta liberacin de energa. Respiracin Anaerbica Respiracin propia de levaduras, algunas bacterias anaerobias, y ocasionalmente presente en los tejidos cuando no interviene el oxgeno. El sustrato orgnico no est totalmente oxidado y la produccin de energa es baja al convertirse la glucosa de los tejidos musculares en cido pirvico por gluclisis y tambin en cido lctico, que luego puede oxidarse cuando vuelve la presencia de oxgeno.


La fotosntesis es el paso previo de los seres auttrofos para obtener la materia que utilizar en procesos posteriores. Su objetivo es obtener molculas orgnicas (glcidos) a partir de molculas inorgnicas. Para que esto ocurra se necesita: Luz Cloroplasto con pigmentos: Clorofila. Molculas transportadoras y receptoras de electrones


Sucede: Al incidir la luz en la clorofila, se produce el desprendimiento de electrones activados. Las molculas transportadoras de electrones los llevan hacia el aceptor final. En el espacio cerrado del cloroplasto se intercambian los electrones sin dispersarse. La eficacia es mxima.

Fases de la fotosntesis Fase dependiente de la luz El cloroplasto capta la energa lumnica que se invierte en: Activar la clorofila para que se desprendan electrones. Romper molculas de agua. Formar molculas de ATP que contienen en sus enlaces la energa qumica procedente de los electrones activados.

Fase independiente de la luz. No requiere presencia de luz. Se llama tambin fase de fijacin del carbono porque se capta CO2 atmosfrico, que se incorpora para formar glucosa, proceso que permitir producir almidn. Los glcidos (glucosa, almidn) obtenidos se utilizarn tambin en la sntesis de otro tipo de biomolculas como los aminocidos, los lpidos y los nucletidos. Relacin

Consiste en captar las condiciones del ambiente y elaborar las respuestas ms indicadas para sobrevivir en cada caso. Las clulas deben presentar sensibilidad respecto a ciertos estmulos como son: la luz, las sustancias qumicas, el contacto con otros elementos. Las reacciones frente a estos estmulos son respuestas. Ejemplo: el movimiento de corrientes citoplasmticas que provocan que la clula se pueda desplazar. Estos desplazamientos se realizan mediante: seudpodos, cilios y flagelos. Los seudpodos: son prolongaciones del citoplasma que arrastran y desplazan la clula. Este movimiento caracterstico de amebas y leucocitos se conoce como ameboide. Se origina por variaciones de la viscosidad del citoplasma al pasar del estado de sol al de gel, o por una disminucin de la tensin superficial.


Cilios y flagelos: son tubos redondeados, que salen desde la membrana plasmtica y se prolongan fuera de la clula. Su movimiento es vibrtil. Los cilios son pequeos y numerosos y el desplazamiento se produce por movimientos bruscos como ltigos. Los flagelos son de mayor tamao, su cantidad es menor (puede haber solo uno) y su movimiento es suave. Otro tipo de respuesta ante condiciones ambientales muy desfavorables, es el de algunas clulas que producen esporas (estructuras muy resistentes) las cuales engloban una parte del citoplasma y el cromosoma para protegerlo y conservarlo. Las esporas pueden resistir mucho tiempo y cuando las condiciones mejoran, las esporas absorben agua, activan su metabolismo y la clula se reproduce. Otros procesos celulares fundamentales son los de divisin celular: mitosis y meiosis, los cuales por su importancia se tratan por separado. DIVISIN CELULAR Segn el tercer principio de la teora celular, las clulas se originan a partir de otras clulas; este proceso se denomina divisin celular. La divisin celular puede ocurrir por mitosis en las clulas somticas (las que forman el cuerpo) y tienen dos juegos de cromosomas (2n) o por meiosis en las clulas germinativas que originan los gametos (vulo y espermatozoide) con nmero haploide (n) de cromosomas. La divisin mittica permite que de una clula madre se originen dos nuevas clulas hijas, con las mismas caractersticas morfolgicas y fisiolgicas de la clula preexistente. El objetivo de la divisin mittica es conseguir la duplicacin de la clula de modo que las dos clulas hijas reciban la dotacin cromosmica idntica a la de sus progenitores. En los organismos unicelulares la divisin mittica da origen a un nuevo organismo. En los organismos multicelulares las clulas somticas diploides se reproducen para formar tejidos, rganos, para reemplazar las partes envejecidas, desgastadas, muertas y para permitir el crecimiento del organismo. Las etapas a travs de las cuales pasa una clula de una divisin celular a otra constituyen el ciclo de la clula. La duracin y las caractersticas del ciclo celular son variables y dependen del tipo de clula y de las circunstancias en que se desarrolla. Ciclo celular


El ciclo celular se divide en dos fases principales: La interfase perodo durante el cual los cromosomas se duplican y La mitosis fase en la cual los cromosomas duplicados se reparten en dos ncleos

Al final de la mitosis ocurre la citocinesis cuando la clula se divide originando dos clulas hijas.

La mayor parte del tiempo del ciclo celular transcurre en la etapa de interfase durante la cual la clula duplica su tamao y el contenido cromosmico, la interfase puede durar horas, das o semanas segn el tipo de clula.

Interfase en clula de cebolla Interfase en clula animal Grfica Ilustraciones comparativas de interfase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission. En la etapa de interfase la clula esta ocupada en la actividad metablica preparndose para la mitosis. Los cromosomas no se observan fcilmente en el ncleo, aunque una mancha oscura el nucleolo puede ser visible. Durante la interfase se sintetiza el ARN mensajero y ribosomal; se replica el ADN; la clula animal puede contener un par de centrolos los cuales forman el huso acromtico.

Aunque la mitosis es un proceso dinmico, secuencial y continuo por razones prcticas para facilitar el anlisis y la experimentacin se divide en cuatro fases o etapas: profase, metafase, anafase y telofase. Durante la mitosis hay variacin en el ncleo de la clula, los cromosomas duplicados se separan y se producen dos ncleos cada uno con una copia fiel de cada cromosoma


La mitosis a menudo se acompaa de citocinesis, proceso durante el cual la clula divide su citoplasma produciendo dos clulas hijas con iguales organelos. La fase mittica (mitosis y citocinesis) generalmente dura 30 minutos.

La clula parece ms esfrica y el citoplasma ms viscoso. Al comienzo de la profase los cordones de cromatina se enrollan lentamente y se condensan, aparecen los cromosomas.

Profase en clula de cebolla Profase en clula animal Grfica Ilustraciones comparativas de profase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission. En esta fase los cromosomas estn agrupados por parejas llamndose a cada uno de los dos que conforman el par, cromosoma homlogo (tienen igual longitud, igual posicin del centrmero e iguales genes), y cada cromosoma del par est a su vez constituido por dos cromtidas unidas por el centrmero. En las clulas de la mayora de los organismos, exceptuando las plantas superiores se ven dos pares de centrolos a un lado del ncleo, fuera de la envoltura nuclear. Durante la profase los pares de centrolos empiezan a alejarse el uno del otro, y a medida que stos se separan aparecen entre ambos pares de centrolos las fibras del huso acromtico, consistentes en microtbulos y otras protenas. Los nuclolos dejan de ser visibles. La envoltura nuclear se disgrega. Al terminar la profase, los cromosomas se han condensado por completo, los pares de centrolos estn en extremos opuestos de la clula. El huso se ha formado por completo.

En etapa de metafase cada cromosoma se une a dos fibras del huso, provenientes cada una de un polo, y se alinean en el plano ecuatorial, es decir, en el centro de la clula


Metafase en clula de cebolla

Metafase en clula animal

Grfica Ilustraciones comparativas de metafase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.


Anafase en clula de cebolla

Anafase en clula animal

Grfica Ilustraciones comparativas de anafase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.

Mientras se ha ido formando el huso acromtico, los cromosomas se han dividido en dos mitades o cromtidas, las dos cromtidas se separan, arrastradas por los filamentos tractores del huso acromtico y se dirigen a los dos polos de la clula, convertidos ya en cromosomas hijos.


Telofase en clula de cebolla

Telofase en clula animal

Grfica Ilustraciones comparativas de telofase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.


Los cromosomas se sitan en cada polo, las fibras del huso se dispersan por el citoplasma, se inicia la formacin de las envolturas nucleares que rodearn a los dos ncleos hijos. Los cromosomas se tornan difusos, pues se empiezan a desenrollar. Aparece un nucleolo en cada polo, se inicia la citocinesis (divisin del citoplasma por la mitad), se forman dos clulas hijas. Citocinesis Etapa de la divisin celular que consiste en la divisin del citoplasma. El proceso visible de la citocinesis suele empezar en la telofase de la mitosis y por lo general divide la clula en dos partes ms o menos iguales.a citocinesis difiere en ciertos aspectos en clulas animales y vegetales. En las clulas animales, durante la telofase, la membrana celular empieza a estrecharse en la zona donde estaba el ecuador del huso. Al principio se forma en la superficie una depresin, que poco a poco se va profundizando para convertirse en un surco hasta que la conexin entre las clulas hijas queda reducida a un hilo fino, que no tarda en romperse para as separar las dos clulas hijas. En las clulas vegetales, este proceso es un tanto diferente, puesto que estas clulas presentan externamente a la membrana plasmtica, una pared bastante rgida. En este caso, la citocinesis se produce por la formacin de un tabique entre los dos nuevos ncleos, este tabique va creciendo desde el centro hacia la periferia de la clula, hasta que sus membranas hacen contacto con la membrana plasmtica, con la que posteriormente se fusionan completndose la divisin celular. Meiosis La meiosis se realiza siempre en las clulas sexuales o gametos, a diferencia de la mitosis que se realiza en las clulas somticas. Las clulas sexuales o gametos a diferencia de las clulas somticas que contienen doble juego de cromosomas, slo contienen un juego de cromosomas (n) o nmero haploide. La meiosis es la divisin celular por la cual se obtienen cuatro clulas hijas (gametos) con la mitad de los juegos cromosmicos que tena la clula madre o germinativa, conservando toda la informacin gentica de los progenitores. El proceso de meiosis ocurre en dos fases meiosis l meiosis II, cada una de las cuales consta de las mismas etapas que la mitosis con algunas diferencias en la profase I. En la clula germinativa existen dos juegos de cromosomas o material gentico, uno de origen paterno y otro de origen materno. En la Profase I, cada par de cromosomas se aparea con su homlogo, formando lo que se denomina una ttrada, es decir cuatro cromtidas y dos centrmeros.


Este apareamiento es una caracterstica propia de la meiosis y tiene importancia porque ocurre el entrecruzamiento de cromtidas (no hermanas) de origen materno y paterno o recombinacin gentica que permite la variabilidad La meiosis ocurre mediante dos mitosis consecutivas: La primera divisin de la clula germinativa es reduccional y el resultado es la formacin de dos clulas hijas cada una con un nmero "n" cromosomas. La segunda divisin es una divisin mittica normal al final se obtienen cuatro gametos haploides a partir de la clula madre diploide. Interfase

Clula animal en Interfase en meiosis I Grfica Fuente: diseado por Carmen Eugenia Pia L

La clula sexual se prepara para la divisin hay replicacin del ADN. En las clulas animales se pueden observar dos centrosomas cada uno conteniendo un par de centrolos. Desde los centrosomas se extienden los microtbulos que son sitios de formacin del huso acromtico. En las clulas vegetales no hay centrosomas. Profase I

Grfica Profase I a Fuente: diseado por Carmen Eugenia Pia L


Es la fase ms larga y compleja de la meiosis. Durante la profase I se presenta compactacin y acortamiento de los cromosomas, los cromosomas homlogos duplicados durante la interfase, se disponen uno al lado del otro.

Grfica Profase I b Fuente: diseado por Carmen Eugenia Pia L Ocurre un proceso de apareamiento para formar parejas (diploides = 2n) o pares de cromosomas, un par materno y el otro par paterno. Ambos pares de cromosomas llevan el mismo tipo de genes y codifican un mismo tipo de informacin, aunque en uno de los alelos sta puede ser de carcter dominante y en el otro puede ser recesiva. Ejemplo un alelo A dominante para la informacin color de los ojos en el par cromosmico paterno y un alelo a recesivo para la misma informacin en el par cromosmico materno. A travs del microscopio se puede observar cada cromosoma formado por dos cromtidas y un centrmero.

Grfica Esquema con representacin de cromosomas con alelos para un carcter Fuente: diseado por Carmen Eugenia Pia L


Grfica Esquema con representacin de ntrecruzamiento de cromosomas no hermanos Fuente: diseado por Carmen Eugenia Pia L

Las cromtidas no hermanas (una procedente del padre y otra de la madre) se enrollan una alrededor de la otra, formando una regin denominada quiasma en donde se puede presentar entrecruzamiento de cromosomas homlogos. Durante el entrecruzamiento un fragmento de una cromtida puede separarse e intercambiarse por otro fragmento de su correspondiente homlogo, con el consecuente intercambio de genes. Esta recombinacin gentica entre los cromosomas, permite la variabilidad y de esta manera mejorar las caractersticas de la descendencia. Este apareamiento que se realiza a lo largo del cromosoma, alelo por alelo, en toda su extensin, se denomina sinapsis.

Grfica Esquema con representacin de Grfica profase I c formacin de ttradas cromosomas no hermanos en en la prfase l sinapsis Fuente: diseados por Carmen Eugenia Pia L


El resultado del proceso de sinapsis son las ttradas o pares bivalentes, es decir que cada par de cromosomas est formados por 4 cromtidas y dos centrmeros. Al final de la profase I el nucleolo y la membrana nuclear han desaparecido y en el citoplasma se forma el huso acromtico.

Metafase l

Grfica metafase I Fuente: diseado por Carmen Eugenia Pia L Desaparecen la membrana nuclear y el nucleolo. Las ttradas se alinean en el plano ecuatorial. La alineacin es al azar. Esto quiere decir que hay un 50% de posibilidad de que las clulas hijas reciban el homlogo del padre o de la madre por cada cromosoma.

Grfica anafase I a

Grfica anafase I a Grfica anafase Ib Fuente: diseados por Carmen Eugenia Pia L


Anafase l
Las ttradas se separan y los cromosomas se desplazan hacia los polos opuestos, el huso acromtico desaparece, se forman cromosomas hijos haploides con dos cromtidas cada uno. Telofase I y Citocinesis I

Grfica telofase I Fuente: diseados por Carmen Eugenia Pia L

Grfica Citocinesis I Fuente: diseados por Carmen Eugenia Pia L Ocurre la primera divisin meitica. Se forman ncleos hijos alrededor de los cromosomas que se encuentran en los polos, el citoplasma se divide en dos (citocinesis) para formar las dos clulas hijas con nmero haploide de cromosomas

Meiosis II Cada clula resultante de la primera divisin realizar la segunda divisin meitica. El


nmero de cromosomas es haploide y la cromatina de cada cromosoma sufri recombinacin gentica. Intercinesis La fase de intercinesis o preparacin de la clula es muy rpida. No hay duplicacin del ADN por lo tanto no hay duplicacin de cromosomas. Profase II

Grficas profase II Fuente: diseados por Carmen Eugenia Pia L Empiezan a desaparecer la membrana nuclear y el nucleolo, se vuelve a formar el huso acromtico, los cromosomas se condensan ms, y su nmero es haploide. Metafase II La membrana nuclear y el nucleolo desaparecen. Los cromosomas dobles se alinean en el plano ecuatorial, los centrmeros se encuentran asociados a las fibras de polos opuestos

Grficas metafase II Fuente: diseados por Carmen Eugenia Pia L


Anafase II

Grficas anafase II Fuente: diseados por Carmen Eugenia Pia L Las cromtidas se separan, se forman dos cromosomas hijos, los cromosomas hijos emigran hacia los polos

Telofase II y Citocinesis

Grfica telofase II Fuente: diseados por Carmen Eugenia Pia L Se forman cuatro ncleos rodeados de membrana nuclear y con nmero de cromosomas haploides, las clulas se dividen por segunda vez por medio de la citocinesis.


Grfica citocinesis II Fuente: diseados por Carmen Eugenia Pia L

Divisin Directa o Amitosis Amitosis Es un tipo de reproduccin asexual que se da en los animales unicelulares. En este tipo de reproduccin el organismo se divide en dos y cada clula resultante tiene las mismas caractersticas genticas de la clula madre. Hay tres tipos de amitosis: fisin binaria o biparticin, gemacin y esporulacin. Fisin binaria o Biparticin Es un tipo de reproduccin celular por medio de la cual una clula se divide en dos partes iguales estas se separan de la madre formando un ncleo propio y transformndose en otros organismos mas pequeos pero genticamente idnticos a la madre. Es caracterstico de organismos procariotas como las bacterias Gemacin


En este tipo de reproduccin se forma una protuberancia o yema en la pared de la clula madre. Estas pequeas protuberancias crecen llevndose a la vez una parte del ncleo y del citoplasma de la clula madre. Finalmente se desprenden y forman nuevos organismos. Ej.: la levadura Esporulacin Es el tercer tipo de amitosis y se da cuando el ncleo de una clula se divide en muchas partes pequeas. Estas se cubren con citoplasma formando esporas que pueden permanecer latentes cuando se presentan condiciones adversas. Cuando las condiciones son adecuadas o para su desarrollo, se dividen formando nuevas organismos con la misma informacin gentica. Capitulo 3 Sistemas Orgnicos Tejidos, rganos y sistemas La clula es el nivel de organizacin bsico de los seres vivos que interesa a la biologa. En la naturaleza los tomos estn organizados en molculas y estas en clulas. Las clulas forman tejidos y estos rganos, que a su vez se renen en sistemas, como el digestivo o el circulatorio entre otros. Un organismo vivo est formado por varios sistemas anatmico fisiolgicos ntimamente unidos entre s. Tejidos animales Los tejidos son grupos de clulas con un origen comn, que cumplen una funcin especfica dentro de un organismo. La ciencia que estudia los tejidos se denomina Histologa. En los animales se encuentran bsicamente cuatro tipos de tejidos: Epitelial, Conectivo, Nervioso Muscular.

Tejido epitelial El tejido epitelial segn su funcin puede ser: tejido de revestimiento y tejido glandular, aunque puede tener funcin mixta.


Tejido epitelial de revestimiento

Epitelio simple cbico

Epitelio cilindrico simple

Epitelio seudoestratificado ciliado


Se encuentra cubriendo la piel, u rganos internos como: el sistema digestivo, urinario, respiratorio y los vasos sanguneos. Tiene funcin sensitiva, protectora contra daos mecnicos, de defensa al impedir la entrada de microorganismos, y en el intestino tiene funcin de absorcin. Tejido epitelial glandular

Glndula mucosa de Glndula serosa del Glndula sebcea del la glndula mamaria pncreas odo http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citologa.htm

Especializado en secretar sustancias a la sangre o al exterior del organismo se encuentra en las glndulas endocrinas y exocrinas. Tejido conectivo Puede ser de tres tipos: conjuntivo, cartilaginoso, y seo. Tejido conjuntivo


Tejido conjuntivo esfago

Tejido conjuntivo elastico en arteria

http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citologa.htm Forma la dermis de la piel, se encuentra en las submucosas de rganos como pulmones, corazn, rganos digestivos, en la parte interna de los vasos sanguneos, en los tendones, en el tejido adiposo donde almacena grasa. Sus funciones son: sostn, defensa, proteccin, reparacin, transporte de metabolitos, rellenar los espacios entre tejidos u rganos. Tejido cartilaginoso

Tejido conjuntivo cartilaginosos en trquea http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citologa.htm Es un tejido de sostn y soporte, se encuentra en el esqueleto de embriones en el tabique nasal, laringe, trquea, bronquios, en los discos intervertebrales, en los meniscos de la rodilla. Es menos resistente y rgido que el seo. Tejido seo Tejido seo forma los huesos del cuerpo, tiene funciones de sostn, mecnica, y proteccin de rganos blandos. Es bastante rgido y resistente.


Tejido nervioso

Tomado de: http://www.joseacortes.com/galeriaimag/index.htm.joseacortes.com/galeriaimag/inde x.htm Se encuentra formando todo el sistema nervioso (encfalo, mdula espinal, nervios), est formado por dos tipos de clulas: neuronas y clulas de glia. Las principales funciones del tejido nervioso son: Detectar, transmitir, analizar y dar respuesta a las variaciones internas y externas. Coordinar el funcionamiento de todas las funciones del organismo. Servir de sostn, nutricin y defensa del tejido nervioso funcin a cargo de las clulas de glia. Las neuronas o clulas nerviosas reciben informacin del exterior, se comunican entre si a travs de sinapsis, deciden y actan. Las sinapsis pueden producir mensajes excitatorios o inhibitorios. Las clulas de glia forman el tejido de sostn del sistema nervioso y son de tres tipos: astroglia, oligondendroglia cuya funcin es sostener y nutrir el sistema nervioso, adems de formar la barrera hematoenceflica al adherirse a vasos sanguneos y microgla encargadas de fagocitar los elementos nocivos para el sistema nervioso. Tejido muscular Hay tres tipos de tejido muscular: liso, esqueltico o estriado y cardiaco.


Tejido muscular liso

Tejido muscular liso Tomado de: http://www.joseacortes.com/galeriaimag/index.htm Se encuentra en los vasos sanguneos, en las paredes del sistema digestivo, en la vejiga urinaria, en el tero y en el sistema respiratorio. Sus contracciones son lentas e involuntarias. Tejido muscular estriado

Tejido muscular estriado Tomado de: http://www.joseacortes.com/galeriaimag/index.htm Se encuentra cubriendo los huesos del esqueleto, y en los esfnteres. Sus contracciones son rpidas y permiten el movimiento de las diferentes partes del cuerpo.


Tejido muscular cardiaco

Tejido cardiaco Tomado de: http://www.joseacortes.com/galeriaimag/index.htm Es una variacin del estriado, se encuentra en el corazn, permite mantener el latido cardiaco, sus contracciones son rpidas e involuntarias. Tejidos Vegetales Las clulas vegetales se agrupan, al igual que las de los animales, formando tejidos. Las plantas vasculares, adaptadas a la vida terrestre y area presentan tejidos diferenciados. Los tipos de tejidos vegetales son: Meristemtico, protector, parenquimtico, conductor y de sostn

Tejidos meristemticos Son tejidos formados por clulas embrionarias con gran capacidad de divisin mittica, permiten el crecimiento de las plantas. Pueden ser de dos tipos: primario y secundario.


Tejido meristemtico en mitosis de cebolla Tomado de: http://www.joseacortes.com/galeriaimag/index.htm Tejido meristemtico primario se encuentran en la raz, tallo, yemas (botones). Son responsables del crecimiento longitudinal de la planta Tejido meristemtico secundario se encuentra en toda la planta y es responsable de su crecimiento en grosor. Tejidos protectores

Tejido epidermal de bulbo de Tejido epidermal con estomas Tomado de: cebolla http://www.joseacortes.com/
Fuente:Carmen Eugenia Pia galeriaimag/ index.htm

Tienen como funcin proteger a la planta de la desecacin y de factores externos que puedan agredirla. Pueden estar localizados en la epidermis, corcho y endodermis de races, tallos y hojas. Las clulas epidrmicas forman una capa continua sobre la superficie del cuerpo de la planta. Su forma frecuentemente es tubular.


Tejidos parenquimticos Tienen como funcin la produccin y almacenamiento de alimento, la reserva de aire y agua, se divide en: cloroflico, de almacenamiento, aerfero y acufero. La forma de sus clulas puede ser polidrica, estrellada o alargada. Tejido parenquimtico cloroflico o clornquima se encuentra en las hojas y tallos verdes; tiene como funcin realizar la fotosntesis por lo que presenta muchos cloroplastos.

Tejido epidermal y parenquimtico en hoja de Elodea 40X Fuente:Carmen Eugenia Pia

Tejido epidermal y parenquimtico en hoja de Elodea 100X Fuente:Carmen Eugenia Pia

Tejido parenquimtico de almacenamiento tiene como funcin almacenar almidones como en la papa, lpidos, protenas. Se encuentra en races, bulbos, tallos subterrneos como tubrculos y rizomas y en las semillas.

Tejido parenquimtico en corte de papa 40X Fuente:Carmen Eugenia Pia

Tejido parenquimtico aerfero se localiza en las plantas acuticas tiene como funcin almacenar agua permitindole a la planta flotar y realizar el intercambio gaseoso. Tejido parenquimtico acufero se presenta en plantas que viven en ambientes secos y necesitan de un tejido que almacene grandes reservas de agua. Es el caso de los cactus.


Tejidos conductores Tienen como funcin el transporte de agua y sustancias minerales. Se divide en dos tipos: Xilema y Floema.

Xilema Tomado de: http://www.joseacortes.com/galeriaimag/index.htm Xilema est formado por clulas muertas y endurecidas por lignina tiene como funcin conducir el agua y los minerales del suelo, desde la raz hasta las hojas, adems de servir de sostn a la planta. El crecimiento de los rboles se debe a la formacin de nuevos canales de xilema que cada ao van formando un anillo de crecimiento en el tronco. Al realizar un corte transversal de un tronco y observar los anillos se puede calcular la edad del rbol. Floema est formado por clulas vivas ubicadas en la parte externa del xilema, tienen como funcin conducir el alimento (azcares y protenas) desde las hojas hacia el resto de la planta. Tejido de sostn El tejido de sostn como su nombre lo indica permite a la planta mantenerse erguida. Hay dos tipos de tejido de sostn: colnquima y esclernquima.



Tomado de: http://www.joseacortes.com/galeriaimag/index.htm Colnquima est formado por clulas vivas. Se encuentra en tallos y hojas de plantas jovnes y herbceas. Esclernquima est formado por clulas muertas. Se encuentra en plantas leosas y adultas, ntimamente relacionado con el parnquima Profundizacin prctica observacin al microscopio de tejidos vegetales

Organos y sistemas de los Seres Vivos

Todos los sistemas, digestivo, circulatorio, respiratorio, excretor, nervioso, endocrino, reproductivo, urinario, muscular y seo interactan para mantener en ptimo funcionamiento el organismo y ninguno de ellos funcionara aisladamente. Por razones prcticas explicativas se analiza a continuacin cada sistema. Sistema digestivo del hombre Todos los seres vivos, deben tomar del medio exterior los alimentos necesarios para obtener la energa requerida para realizar sus funciones y mantenerse con vida. Para poder utilizar los alimentos y convertirlos en energa el organismo realiza la funcin de la nutricin. Existen dos tipos de nutricin: auttrofa cuando los organismos producen su propio alimento como en el caso de las plantas y hetertrofa cuando el organismo necesita alimentarse de sustancias orgnicas ya elaboradas por las plantas o de otros organismos hetertrofos. Estas sustancias reciben el nombre de nutrientes y el conjunto de procesos que se llevan a cabo para obtenerlas y utilizarlas se llama nutricin. La nutricin comprende siete procesos: ingestin, digestin, absorcin, circulacin, respiracin, asimilacin y secrecin. La ingestin es la toma de alimentos del medio, la digestin consiste en transformar los alimentos ingeridos en molculas ms pequeas: los nutrientes, que pueden ser fcilmente absorbidos y distribuidos por todo el organismo. Podemos diferenciar dos tipos de digestion: la digestion mcanica, llevada a cabo por los dientes y por los movimientos peristlticos, que son movimientos musculares involuntarios que se originan para transportar el bolo alimenticio del esfago al estmago, y la digestin qumica, que es llevada a cabo por las enzimas y los jugos gastricos, que aceleran las reacciones qumicas del metabolismo y transforman las macromoleculas de los alimentos en moleculas ms simples.


El proceso de nutricin se realiza a travs de los rganos que conforman el sistema digestivo. El sistema digestivo esta formado por un tubo largo y musculoso que comienza en la boca y termina en el ano.

Representacin de la boca Fuente: Diseo Carmen Eugenia Pia L.

Representacin del sistema digestivo Fuente: Diseo Carmen Eugenia Pia L.


Representacin de los esfnteres cardias y piloro Fuente: Diseo Carmen Eugenia Pia L.

Tabla Estructura y funcin del sistema digestivo de los mamferos

rgano Funcin

Aprehensin e ingestin del alimento, mezcla con la Boca compuesta de: saliva y trituracin fsica de los alimentos, labios, cavidad bucal, desdoblamiento parcial de carbohidratos por accin de la lengua, dientes, enzima amilasa salival, formacin y deglucin del bolo glndulas salivares alimenticio hacia la faringe. Faringe rgano comn para los sistemas digestivo y respiratorio Comunicacin de la cavidad bucal con el esfago durante la deglucin con mecanismos de oclusin de los orificios que comunican con el sistema respiratorio. Transporte del bolo alimenticio del esfago al estmago a travs del cardias (primer esfnter que los comunica) mediante movimientos peristlticos. Mezcla del bolo alimenticio con la enzima pepsina y con el cido clorhdrico este ltimo cumple accin bactericida y proporciona el pH cido adecuado para accin de la pepsina sobre las protenas para convertirlas en peptonas (digestin), formacin del quimo y paso de ste a travs del ploro (segundo esfnter) al intestino delgado. Mezcla del quimo con: sales biliares provenientes del hgado, bicarbonato de sodio secretado por el pncreas para neutralizar la acidez del quimo y proporcionar el pH adecuado para la accin de las enzimas pancreticas e intestinales. jugo pancretico proveniente del pncreas y jugo intestinal (entrico).



Intestino delgado formado por tres partes: Duodeno, yeyuno e leon con sus microvellosidades

El jugo pancretico e intestinal contienen diferentes tipos de enzimas que continan con el proceso digestivo El jugo entrico contiene la lipasa entrica, la amilasa entrica y peptidasas, enzimas que continan realizando el proceso digestivo es decir, convirtiendo las macromolculas en molculas de fcil absorcin por las vellosidades del intestino delgado. El intestino delgado presenta tres tipos de movimientos: * oscilatorios o pendulares que permiten la mezcla del


quimo con las enzimas de los jugos enterico y pancretico y con la bilis. * segmentarios dividen el quimo en fracciones ms pequeas * Peristlticos o evacuantes permiten que el quimo avance de la parte anterior hacia la parte posterior. Hay tambin movimientos antiperistlticos que devuelven el quimo en sentido contario. Todos estos movimientos tienen como finalidad favorecer la digestn y absorcin de los nutrientes. En las paredes del intestino se lleva a cabo la absorcin que es el paso de los nutrientes (azcares simples, cidos grasos, glicerina, aminocidos, y vitaminas; parte del agua y algunas sales minerales), por difusin al torrente sanguneo y a la linfa para ser distribuidos por todas las clulas y tejidos. Reabsorcin de agua y minerales, Formacin de heces formado por el colon y Almacenamiento de heces el recto Glndulas anexas Hgado Pncreas Productor de bilis Secreta bicarbonato de sodio y jugo pancretico. El jugo pancretico contiene: la lipasa pancretica que acta desdoblando las grasas previamente emulsificadas por las sales biliares almacenadas en la vescula biliar, las proteasas como el tripsingeno que acta sobre las peptonas convirtindolas en pptidos y aminocidos , la amilasa pancretica que acta sobre los azcares degradndolos a fructuosa, glucosa o galactosa. Organo de almacenamiento de la bilis. Intestino grueso

Vescula biliar

Animacin Sistema digestivo Sistema Circulatorio


Grfica Representacin del sistema circulatorio Fuente: Diseo Carmen Eugenia Pia L El sistema circulatorio comprende el corazn que hace las veces de bomba impelente y el sistema vascular (arterias y venas) por donde circula la sangre El sistema cardiovascular contiene la sangre y es el encargado de transportar nutrientes y oxgeno a los tejidos y rganos y de recoger bixido de carbono y sustancias de desecho productos del metabolismo y llevarlas a los sistemas excretores. Este sistema transportador de lquido conserva la homeostasia interna del organismo. Tabla: Estructura y funcin del sistema circulatorio de los mamferos Estructura a) Sangre con sus componentes: Es un tejido formado por una parte slida: las clulas sanguneas de tres tipos: Eritrocitos o glbulos rojos, leucocitos o glbulos blancos, y las plaquetas y por una parte lquida el plasma. Funcin Complementacin

Respiracin El 55% de la sangre es un Vinculacin con lquido amarillo denominado sistema respiratorio plasma, el otro 45% son los Defensa, componentes celulares Nutricin, vinculacin con sistema digestivo. En el plasma se encuentran Excrecin de proteinas como la albumina productos del cuya funcin es mantener la metabolismo a rganos presin smotica de la samgre; de excrecin el fribringeno y la protrombina vinculacin con que participan en la coagulacin sistemas excretores de la sangre y algunas Regulacin de pH globulinas que defienden el Regulacin de organismo de agentes extraos. presin osmtica Transporte de La cantidad de sangre que hormonas vinculacin circula por el cuerpo es con sistema endocrino aproximadamente 1/12 del peso Regulacin de


presin sangunea. coprporal Ejemplo, en un adulto de aproximadamente 60 kilos de peso circulan 5 litros de sangre Eritrocitos o glbulos rojos *Transporte de * Su forma es biconcava los que oxgeno y nutrientes a les proporciona una mayor todos los tejidos del superficie de intercambio de organismo. oxgeno por dixido de carbono en los tejidos. *Recoger bixido de carbono y sustancias * Contienen la hemoglobina una de desecho proteina que contiene hierro y les da la coloracin roja y es la encargada de recoger el oxgeno de los pulmones donde se encuentra en alta concentracin para luego liberarlo en los tejidos. * Carecen de ncleo en el torrente sanguneo. Constituyen el 40-45 % de la sangre * En el hombre la cantidad vara entre 5 a 5,5 y en la mujer 4,5 a 5 millones por cc3 de sangre Leucocitos o glbulos blancos Defender el organismo El nmero de leucocitos es de infecciones mucho menor que el de ocasionadas por la eritrocitos entrada de microorganismos Su cantidad vara entre 4.600 a patgenos, alergenos, 6.000 por cc3 de sangre mediante el proceso de fagocitosis Son de cinco tipos: Eosinfilos, Basfilos, Neutrfilos con grnulos en el citoplasma y con un solo ncleo lbulado por lo que se les denomina polinucleados; Linfocitos y Monocitos carecen de grnulos en sus citoplasma poseen un ncleo nico no lbulados.

Fuente: Carmen Eugenia Pia

Fuente: Carmen Eugenia Pia



Intervienen en la coagulacin de la sangre

* Son fragmentos celulares, su

nmero esta comprendido entre 200.000 a 300.000 po rcc3 de sangre

Fuente: Carmen Eugenia Pia


Grfica Representacin del corazn Fuente: Diseo Carmen Eugenia Pia L Estructura b) Corazn: un rgano muscular hueco (miocardio) con cuatro cavidades: dos superiores las aurculas y dos inferiores los ventrculos cuenta adems con dos vlvulas: la tricspide que comunica la aurcula derecha con el ventrculo Funcin Complementacin

Bombear la sangre a todo el El ventrculo izquierdo es cuerpo. ms grande que el derecho pues es el que bombea la sangre a todo El corazn funciona ritmicamente para impulsar el cuerpo, mientras que el derecho slo bombea la sangre a todo el cuerpo la sangre a los durante la fase de pulmones. contraccin o sistole y para su llenado en la fase de relajacin o distole La funcin de las


derecho y la bicspide que comunica la aurcula izquierda con el ventrculo izquierdo

vlvulas es impedir el retroceso de la sangre El corazn expulsa 5 litros de sangre por minuto

Principales Venas y Arterias

Grfica Representacin de los principales vasos del corazn Fuente: Diseo Carmen Eugenia Pia L

Estructura c) Sistema vascular formado por : Arterias Son tubos muy gruesos y elsticos; disminuyen su calibre a medida que se alejan del corazn, dando lugar a arteriolas, y luego a capilares.

Funcin Conducir sangre a los tejidos Transportar la sangre oxigenada que sale del corazn. La nica arteria que conduce sangre pobre en oxgeno y rica en


Parten del corazn hacia los rganos y tejidos del organismo. Las principales son: la aorta que sale del ventrculo izquierdo emitiendo


Su luz es menor que la de las venas.

bixido de carbono es la pulmonar.

ramas hacia todo el organismo y las pulmonares que salen del ventrculo derecho hacia los pulmones. Las principales son: la vena cava inferior y la vena cava superior que traen sangre a la aurcula derecha del corazn y las venas pulmonares que transportan sangre de los pulmones al corazn..

Venas Son tubos de mayor dimetro que las arterias, menos elsticas y la mayora poseen vlvulas que impiden el retroceso de la sangre. Comienzan con vasos pequeos (capilares) y van aumentando su tamao en sentido de la circulacin hasta formar grandes vasos. Acompaan a las arterias en su recorrido hasta desembocar en la aurcula derecha del corazn. Capilares Son vasos de calibre muy fino distribuidos en todos los rganos del cuerpo.

Conductora, retorna la sangre desoxigenada al corazn. Las nicas venas que transportan sangre oxigenada son las pulmonares. Comienza con vasos pequeos y va aumentando su tamao en sentido de la circulacin

Intercambio de sustancias en los tejidos Aportan nutrientes Recogen desechos

Circulacin sangunea La circulacin es un circuito cerrado, se inicia en el corazn y termina en el corazn. La circulacin se divide en circulacin menor de corazn a pulmones y circulacin mayor de corazn a todos los tejidos y retorno al corazn.

Funcionamiento del corazn


1. La sangre rica en bixido de carbono y pobre en oxgeno procedente de todo el cuerpo (circulacin general) llega a la aurcula derecha por las venas cava superior e inferior.

2. La aurcula derecha se contrae (sstole), se abre la vlvula tricspide y la sangre desciende al ventrculo derecho.

3. Luego el ventrculo derecho se contrae, la vlvula tricspide se cierra, se abre la vlvula pulmonar y la sangre va por la arteria pulmonar (que se ramifica en dos ramas derecha e izquierda) hacia el pulmn correspondiente donde es oxigenada.

4. En los capilares de los pulmones el bixido de carbono es cambiado por el oxgeno del aire alveolar. (Circulacin menor o pulmonar). La sangre oxigenada circula por vasos cada vez mayores que se renen en las venas pulmonares.


5. Luego la sangre rica en oxgeno por las venas pulmonares (las nicas venas que transportan sangre oxigenada) regresa a la aurcula izquierda del corazn. Esta aurcula se contrae y la sangre pasa a travs de la vlvula bicspide al ventrculo izquierdo.

6. El ventrculo izquierdo se contrae y a travs de la arteria aorta y sus ramificaciones enva la sangre oxigenada a todas las clulas y tejidos.

Animacin sobre el ciclo cardiaco http://www-medlib.med.utah.edu/kw/ pharm/ hyper_heart1.html http://www.guidant.es/ Patient/ Heart-BVBasics/heart_intro.aspx

Complementacin Contiene aspectos bsicos tericos,

El mecanismo de contraccin del corazn es el siguiente: primero se contraen las dos aurculas y de forma sincrnica, es decir al mismo tiempo , perodo llamado Sstole Auricular, luego se contraen los dos ventrculos igualmente de manera sincrnica (Sstole Ventricular), y despus, el corazn completo tiene una relajacin (Distole o reposo general), hasta que se produce la nueva Sstole Auricular. El funcionamiento del corazn es autnomoo involuntario, regido por

imgenes y animaciones sobre el corazn, la circulacin, enfermedades http://www.nlm.nih.gov/medlineplus/ spanish/tutorials/ echocardiogramspanish/ ct1791s1.html


el sistema nervioso autnomo o vegetativo Grficas: Representacin del funcionamiento del corazn Fuente: Diseo Carmen Eugenia Pia L

Circulacin portal

Grfica Representacin del funcionamiento del corazn Fuente: Diseo Carmen Eugenia Pia L Los nutrientes que el organismo requiere pasan a travs de las vellosidades del intestino delgado (segmento duodenal) a la vena porta que los transporta hasta el hgado donde ste los detoxifica y enva por la vena heptica al torrente sanguneo. Coagulacin sangunea Adaptado de: http://www.canal-h.net/webs/sgonzalez002/Fisiologia/HEMOSTAS.htm HEMOSTASIS La hemostasis es el conjunto de mecanismos con los que se controla la prdida de sangre del organismo. Estos mecanismos se desencadenan cuando hay un traumatismo o cuando hay pequeas lesiones de forma espontnea en el organismo. Son fundamentales para la vida. Si se eliminan estos mecanismos, se ocasiona la muerte en pocas horas. MECANISMO DE LA HEMOSTASIS


Estos mecanismos estn interrelacionados entre ellos. Adems, existe un tiempo determinado para cada uno e ellos. Siguen un orden preestablecido. Vasoconstriccin: Cuando hay un traumatismo o una pequea lesin, se produce una vasoconstriccin de forma natural o por reflejos, estimulacin de las terminaciones simpticas que inervan la pared vascular. El objetivo es producir una contraccin para que haya una disminucin del flujo de sangre. El endotelio de los vasos sanguneos segrega factores relajantes derivados del endotelio, que si est intacto, mantiene la estructura relajada. Cuando hay un traumatismo, desaparecen estos factores relajantes y se produce una contraccin. Estos factores relajantes derivados del endotelio son el xido ntrico (NO). A nivel vascular, el NO mantiene relajado ciertas estructuras vasculares. Cuando hay un traumatismo leve las plaquetas se adhieren o agregan entre s y liberan tromboxano A2 que produce una potente vasoconstriccin. Formacin del tapn plaquetario: las plaquetas, con forma ms o menos redonda, cuando se encuentran en la sangre, tienen unos receptores en su membrana, de forma que, cuando detectan que en un vaso falta el endotelio y aparece el colgeno, las plaquetas forman la adhesin plaquetaria. Los receptores de la membrana de las plaquetas son receptores para residuos de aminocidos del colgeno, de manera que hacen que las plaquetas se anclen contra el colgeno y se comience la adhesin plaquetaria (plaquetas adheridas al colgeno y que se vuelven mucho ms planas). A nivel de la clula, se produce el incremento de calcio entre el reconocimiento entre colgeno y receptor. Cuando se incrementa el nivel de Ca2+ a nivel de la plaqueta, se produce la liberacin de sustancias (tromboxanos A2 que producen vasoconstriccin; ADP que favorece la adhesin de las plaquetas; es un feed-back negativo; los tromboxanos A2 tambin favorecen la adhesin plaquetaria; factor de crecimiento plaquetario que induce la mitosis en las clulas endoteliales; factor plaquetario 3, que sirve para favorecer la coagulacin sangunea.) La mitosis de las clulas endoteliales es el primer mecanismo de reparacin. Las plaquetas se unen slo en la zona lesionada, porque en la zona sana hay prostaglandinas I2 que son fuertemente antiagregantes.

Coagulacin sangunea La coagulacin es la modificacin del estado fsico de la sangre, que pasa de un estado lquido a otro de gel. Esta transformacin se debe a que el fibringeno (protena plasmtica) se transforma en una red de fibrina, que refuerza el trombo plaquetario o tapn hemosttico, para interrumpir de forma definitiva la hemorragia.


Mecanismo de coagulacin. Este proceso necesita una serie de reacciones en varias protenas plasmticas, para transformarlas de un estado inactivo a otro activo, que a su vez, ayudar a que otra reaccin del mismo tipo se d con otra protena. Estas protenas plasmticas se denominan "Factores de coagulacin", de los cuales hay 12 que se denominan con nmeros romanos, ms otros factores que no tienen asignado numeral y que son los factores contacto. Los factores de coagulacin Son un grupo de protenas responsables de activar el proceso de coagulacin. Hay identificados 13 factores ( I, II, ..., XIII). Factor I (fibringeno) Factor II (protrombina) Factor III (factor tisular) Factor IV (calcio) Factor V (giobulina aceleradora) Factor VII (proconvertina) Factor VIII (factor antihemoflico) Factor IX (componente de tromboplastina en plasma) Factor X (factor de Stuart) Factor XI (antecedente de tromboplastina en plasma) Factor XII (factor de Hageman) Factor XIII (factor estabilizador de la fibrina

Va Extrnseca de coagulacin La va extrnseca se inicia cuando la sangre hace contacto con el tejido lesionado, que a su vez libera la tromboplastina tisular, que en presencia del factor VII y de iones de calcio, actan sobre el factor X para formar factor X activado. El factor X activado, y en presencia de iones de calcio, libera el activador de la protrombina que favorece el paso de la protrombina (protena del plasma que se produce en le hgado en presencia de vitamina K) en trombina (enzima de accin proteoltica), la cual a su vez acta sobre las molculas de fibringeno (otra protena presente en el plasma sanguneo y producida en el hgado) para formar monmeros de fibrina que al unirse entre ellas se polimerizan en largos hilos de fibrina que forman el retculo del cogulo. Para que el cogulo no se desintegre las plaquetas liberan el factor estabilizador de la fibrina. La Va intrnseca de coagulacin Comienza con la activacin del factor XII producida por el contacto con una superficie lesionada, esto es, sin endotelio.


Esta activacin, que requiere de enzimas, activa al factor XI, y ste activado activa a su vez al factor IX. El factor IX activado, junto con el factor VII activado, calcio, tromboplastina y otras sustancias, entre las que est el factor VIII, activan al factor X, punto de encuentro de la va comn. En la va comn, los factores X y V activados, en presencia de calcio y fosfolpidos plaquetarios trasforman la protombina en trombina, que hace que el fibringeno pase a ser fibrina, que es estabilizada con el factor XIII. En todas las reacciones de la cascada de la coagulacin hay adems otras sustancias que activan o inhiben las reacciones. El aumento o el dficit de los factores de la cascada, de las plaquetas o de los mltiples activadores o inhibidores de la coagulacin pueden crear serios problemas, como pueden ser el que nuestro organismo no pueda responder favorablemente a las lesiones que sufren nuestros vasos, y podamos morir desangrados, siendo otro problema todo lo contrario, esto es, que el organismo cree trombos plaquetarios que obstruyen los vasos y que a su vez puedan desprenderse y causar obstrucciones a distancia. Cascada de coagulacin. Secuencia de reacciones que involucran varias protenas conocidas como factores de coagulacin. Los factores de coagulacin actan en cascada, es decir, uno activa al siguiente; si se es deficitario de un factor, no se produce la coagulacin o se retrasa mucho. Sistema Linftico El sistema linftico es una red microscpica de capilares que se encuentran por todos los tejidos, transcurriendo entre los vasos arteriales y venosos. Su funcin es mantener el equilibrio entre los lquidos, devolviendo el exceso de lquido intersticial (aproximadamente unos 3 litros) a la circulacin general. Est formado por: la linfa que es un lquido claro de composicin parecida a la sangre contiene glbulos blancos; su funcin es transportar los lpidos digeridos desde las vellosidades del intestino delgado hacia el torrente sanguneo. los vasos linfticos o conductos por donde circula la linfa, los capilares linfticos. los ganglios linfticos que son pequeas estructuras en forma de rin con gran cantidad de glbulos blancos cuya funcin es filtrar la linfa , destruir y eliminar de ella las sustancias txicas y los microorganismos infecciosos antes de su circulacin por el torrente sanguneo.

Sistema Respiratorio del hombre


La respiracin implica un intercambio de gases con el medio ambiente. Durante la respiracin se realiza el transporte de oxgeno de la atmsfera a las clulas y a la inversa transporte de bixido de carbono de las clulas a la atmsfera. Para realizar esta funcin el organismo cuenta con los pulmones y con unos conductos por los que circula el aire inspirado y expirado.

Grfica: Aparato Respiratorio Modificado de http://www.emc.maricopa.edu/faculty/ farabee/BIOBK/humrespsys_1.gif Los conductos o pasos del aire son: Las ventanas o fosas nasales por donde penetra el aire inspirado. La cavidad nasal cuya funcin es filtrar, humedecer y calentar el aire inspirado. Para este fin su mucosa cuenta con una gran cantidad de vasos sanguneos. La faringe permite el paso del aire a la laringe.

La laringe su funcin es regular el paso del aire en la respiracin, impedir la entrada de cuerpos extraos a la trquea y es el rgano principal de la fonacin o de los sonidos. La trquea es un tubo formado por anillos cartilaginosos que se bifurcan en bronquios. En su interior la trquea y los bronquios cuentan con una serie de cilios que le permiten realizar su funcin de llevar secreciones o cuerpos extraos a la cavidad bucal impidiendo su entrada a los pulmones. Los bronquios se ramifican en bronquolos de dimetro ms reducido. Los bronquolos terminan en pequeos saquitos denominados alvolos los cuales se







Los pulmones se encuentran dentro de la caja torcica su interior est formado por un tejido esponjoso. Los pulmones son los rganos terminales donde se efecta el intercambio gaseoso. El diafragma y la caja torcica tambin se incluyen en las estructuras que toman parte de la respiracin.

Mecanismos de la Respiracin La respiracin se realiza con dos mecanismos bsicos de expansin y contraccin de los pulmones por accin de: El diafragma que se contrae movindose hacia arriba acortando la caja torcica o se relaja desplazndose hacia abajo alargando la caja torcica. Las costillas que aumentan o disminuyen el dimetro de la caja torcica.

Durante la inspiracin el diafragma se contrae, la caja torcica se eleva , su dimetro aumenta, los pulmones se distienden y el aire entra a los alvolos. Animacin sobre inspiracin expiracin: http://www.juntadeandalucia.es/averroes/recursos_informaticos/concurso99/002/respi ra.htm

Intercambio de gases en los pulmones

Grfica: Representacin del alvolo pulmonar rodeado de capilares Fuente: Diseo Carmen Eugenia Pia L Debido a la diferencia de concentracin de gases entre el exterior y el interior de los alvolos, el oxgeno del aire pasa por difusin de los alvolos a los capilares


sanguneos que rodean a los alvolos, luego el oxgeno penetra en los glbulos rojos o hemates para ser transportado con el torrente sanguneo a todas las clulas y tejidos.

Grfica: Representacin del intercambio de gases en el alvolo pulmonar Fuente: Diseo Carmen Eugenia Pia L El bixido de carbono se traslada en sentido opuesto desde los tejidos a los capilares y de ah a los alvolos. El mecanismo de la respiracin es un acto reflejo casi por entero.

Animacin del proceso respiratorio Sistema excretor del hombre

La excrecin tiene como funcin mantener constante el volumen de los lquidos corporales, la concentracin de los electrlitos y el equilibrio cido - bsico independientemente de las variaciones en la ingesta. La homeostasis de los lquidos corporales se conserva sobre todo por la accin de los riones y est controlada por diversos mecanismos fisiolgicos todos ellos interrelacionados. El sistema excretor en los mamiferos est formado por:


Grfica Representacin del sistema renal Fuente: Diseo Carmen Eugenia Pia L Estructura Dos riones formados por millares de nefronas que son la unidad estructural y funcional del rin Dos Urteres o tubos La Vejiga urinaria La Uretra Funciones del Sistema Renal Filtracin de la sangre y eliminacin de sustancias de desecho resultantes del metabolismo celular. La sangre oxigenada le lleva al rin nutrientes y oxgeno y la desoxigenada le trae del hgado la urea que se elimina con la orina. Controlar el equilibrio hdrico a travs de la orina. Controlar el equilibrio electroltico (sodio, potasio, calcio, fsforo, cloro entre otros). Controlar el equilibrio cido bsico ( pH) Controlar la presin arterial por medio de la hormona renina que tiene accin hipertensora. Funcin Producir la orina que es un producto de desecho txico Conducir la orina del rin a la vejiga. Almacenar la orina. Excretar la orina de la vejiga al exterior

La Nefrona


Grfica No 30 La Nefrona Tomada de http://iris.cnice.mecd.es/biosfera/profesor/galeria_imagenes/images/circul6-6.jpg La nefrona esta formada por un paquete o red capilar que recibe el nombre de glomrulo, envuelve a este sistema glomerular una cpsula de Bowman. La unin funcional entre la cpsula de Bowman y el glomrulo recibe el nombre de tubo de Malpighi y es el lugar donde ocurre la primera filtracin del plasma sanguneo que contiene sustancias de desecho, adems de sustancias como glucosa, sales minerales y agua que an son tiles al organismo. En la cpsula de Bowman se forma la orina primaria. La cpsula de Bowman se contina con un tubo renal contorneado proximal, de l se origina el asa de Henle. Esta asa se contina con otros tubos contorneados distales. En los tbulos contorneados ocurre el segundo filtrado con la consecuente resorcin de agua, glucosa y sales al torrente sanguneo y secrecin de sustancias de desecho. Los tubos contorneados distales van drenando a tbulos colectores para formar los clices los cuales drenan en la pelvis renal. Los tbulos colectores reciben la orina formada en las nefronas. La pelvis renal comunica con los urteres que llegan a la vejiga. Sistema Reproductor Los seres vivos tienen capacidad de dar origen a otros seres vivos. En los seres eucariticos pluricelulares la reproduccin implica la participacin de gametos o clulas sexuales masculina y femenina las cuales se fusionan para originar un cigoto. Los rganos del aparato reproductivo masculino y femenino son los encargados de la produccin de gametos


Aparato reproductor masculino del hombre

Grfica Aparato Reproductor masculino Tomado de http://www.arrakis.es/~lluengo/reproduccion.html

Tabla Estructura y funcin del sistema reproductor masculino

Funcin Produccin de espermatozoides o clulas sexuales masculinas Produccin de la hormona testosterona que determina los caracteres masculinos. Testculos contenidos enEl escroto mantiene la temperatura adecuada para los el escroto espermatozoides (unos tres grados por debajo de la temperatura del cuerpo) El parnquima testicular est formado por lbulos donde se encuentran los tbulos seminiferos lugar donde se forman los espermatozoides. Epiddimo Almacenamiento y maduracin de los espermatozoides y Conducto alargado y conduccin de los espermatozoides hacia los conductos flexuoso, adherido al deferentes testiculo Conductos eferentes Transportar los espermatozoides desde los tubos semniferos hasta el epididimo Conductos deferentes Almacenamiento de los espermatozoides hasta el momento de la eyaculacin Glndulas accesorias rgano


Produccin de lquido viscoso denominado semen, que se mezcla con los espermatozoides y sirve para transprtalos. Secrecin de lquido lechoso que da olor caracterstico al * Prstata semen * Glndulas de Cooper Secrecin de lquido que mantiene lubricada la uretra y el pene Pene rgano copulador * Vesculas seminales

Aparato Reproductor Femenino de mamferos

Grfica Aparato reproductor femenino Tomado de: http://www.arrakis.es/~lluengo/reproduccion.html

Tabla Estructura y funcin del sistema reproductor femenino de mamferos

rgano Dos ovarios Funcin Formacin del los vulos o clulas sexuales femeninas

Produccin de estrgenos hormonas que dan los caracteres sexuales femeninos Dos trompas de Estos conductos comunican con el tero a donde transportan Falopio los vulos. En el primer tercio de las trompas ocurre la fecundacin tero Recibir el vulo fecundado, albergar y alimentar el embrin. En el caso de no haber fecundacin su mucosa interna llamada endometrio se desprende produciendo la menstruacin. Durante el parto se contrae para expulsar el feto. Cuello uterino Comunica la vagina con el tero Recibir el lquido seminal con los espermatozoides. Vagina Expulsa el feto durante el parto rganos genitales


externos: Vulva Cltoris Fecundacin

constituida por los labios mayores y menores rgano de excitacin

Consiste en la fusin de los ncleos de los gametos o clulas sexuales masculina y femenina, es decir la unin del vulo y del espermatozoide para formar el cigoto. La fecundacin ocurre en las trompas de Falopio y a medida que el cigoto desciende por las trompas hacia el tero tienen lugar las divisiones celulares que dan comienzo al proceso embrionario o formacin del embrin. Sistema Nervioso Sistema Nervioso El sistema nervioso coordina y preside el funcionamiento de todos los rganos y sistemas de los seres vivos. La funcin final del sistema nervioso es la conducta. El sistema nervioso percibe estmulos e informa sobre lo que ocurre en el entorno para que los comportamientos o conductas logren adaptarse y de esta amaner actuar de manera til. Fisiolgicamente el sistema nervioso se divide en sistema nervioso central, voluntario y sistema nervioso autnomo o involuntario. Las funciones del sistema nervioso central son: Poner en relacin al organismo con el medio exterior en que vive. Recibir informacin, coordinar y producir respuestas conscientes - funcin sensitiva. Producir movimientos musculares - funcin motora. Proporcionar integridad al organismo - funcin integradora.

Las funciones del sistema nervioso autnomo son: Inervar vsceras de los aparatos: respiratorio, circulatorio, digestivo, urinario, glandular, reproductor. Coordinar las funciones de todos los sistemas. Mantener la homeostasis. Presidir la vida interior


Grfica Sistema Nervioso Central Tomado de: http://personales.ya.com/erfac/snc.gif

Grfica Encfalo Fuente: Diseo Carmen Eugenia Pia L

Tabla: Estructura y funcin del Sistema Nervioso Central

El sistema nervioso central est formado por: rgano Encfalo que comprende: Cerebro rgano que permite utilizar todos los sentidos, en l se encuentran los centros del lenguaje de la escritura, de las Funcin


imgenes auditivas, de la olfacin, tacto, dolor, gusto, las zonas motoras; en el cerebro es donde todas las emociones toman forma: los pensamientos, la actividad imaginativa y el recuerdo. Cerebelo con el Hipotlamo Interviene en el mantenimiento de la posicin y el equilibrio del cuerpo, coordina los movimientos, mantiene el tono muscular. El hipotlamo controla todas las funciones vegetativas o internas del cuerpo como: presin arterial, actividad sexual, equilibrio de lquidos corporales, alimentacin, actividad digestiva, secrecin de glndulas endocrinas, regulacin de la temperatura, reacciones de defensa. Mdula oblonga o Bulbo raqudeo Mdula espinal Tiene el control de las funciones de los centros de la respiracin, cardiaco, vasoconstrictor , respiratorio y del vmito Conduce informacin desde los nervios perifricos que vienen de diferentes partes del cuerpo hacia el encfalo o desde el encfalo al resto del cuerpo.

Las prolongaciones o Transportan los impulsos al sistema nervioso central y llevan nervios craneales y informacin al exterior. espinales. Son motores y sensitivos y vienen de los rganos de los sentidos



Grfica La Neurona Tomado de: http://mensual.prensa.com/mensual/contenido/2002/03/03/hoy/revista/468858.html La neurona o clula nerviosa es la unidad estructural y funcional del sistema nervioso. Su funcin es la trasmisin de informacin entre las diferentes partes del cuerpo. La mayora de neuronas se encuentran en el crebro y en la mdula espinal, otras se encuentran el sistema nervioso perifrico. La neurona consta de: Cuerpo con ncleo, citoplasma y organelos. Prolongaciones que son extensiones protoplasmticas y son de dos tipos: dendritas y axn.

Las dendritas son aferentes o sensitivas. Conectan una neurona con otra y conducen impulsos de rganos (articulaciones, msculos, tendones, huesos etc.) hacia el cuerpo de la clula nerviosa El axn que es eferente o motor. Conduce impulsos del cuerpo de la clula nerviosa hacia los botones terminales rganos o tejidos. En la terminacin de los axones se encuentran los botones terminales En el hombre se encuentran entre cien y mil billones de neuronas


Conduccin dentro de la neurona Cuando una neurona se encuentra en estado de reposo su interior tiene una carga elctrica ligeramente negativa con respecto al exterior. Esto ocurre porque dentro de la clula hay una cantidad importante de iones negativos debido a que la bomba de sodio impulsa hacia afuera de la fibra nerviosa los iones de NA+. Esta carga se denomina potencial de reposo. Cuando se estimula una neurona la permeabilidad de la membrana cambia permitiendo la entrada de iones positivos de Na+ al interior de la clula, desapareciendo el potencial de reposo y generando un potencial de accin que viaja a lo largo de la neurona hasta los botones terminales. Cuando el potencial de accin llega a los botones terminales se liberan sustancias qumicas o neurotrasmisores al espacio potsinptico (espacio entre la unin de dos neuronas) Estos cambios en el potencial de membrana duran una pequea fraccin de segundos, seguidos inmediatamente al estado de reposo. El establecimiento del estado de reposo depende casi totalmente de la salida por difusin de iones de K+ al exterior. Receptores Sensoriales En el ser humano y animales superiores los estmulos del exterior son captados a travs de receptores sensoriales u rganos de los sentidos. Los rganos de los sentidos son cinco: vista, odo, olfato gusto y tacto. El sistema sensorial est formado por un receptor, una neurona aferente sensitiva y el centro sensitivo en la corteza cerebral. Para que haya percepcin y respuesta motora de un estmulo se requiere de un receptor, una neurona aferente, un centro coordinador y decodificador de la informacin, una neurona eferente o motor Sistema Sensorial Adaptado de: http://www.uc.cl/sw_educ/neurociencias/html/frame04.html


Los sistemas sensoriales son conjuntos de rganos (rganos de los sentidos)altamente especializados que permiten a los organismos captar una amplia gama de seales provenientes del medio ambiente. Ello es fundamental para que dichos organismos puedan adaptarse a ese medio. Pero, para los organismos es igualmente fundamental recoger informacin desde su medio interno con lo cual logran regular eficazmente su homeostasis. Para estos fines existen sistemas de detectores con una organizacin morfofuncional diferente y que podemos llamar receptores sensitivos. Los receptores estn ligados a sistemas sensoriales/sensitivos capaces de transformar la energa de los estmulos en lenguaje de informacin que manejan los organismos (seales qumicas, potenciales locales y propagados). Es decir, son capaces de transducir informacin. En cada sistema sensorial o sensitivo es fundamental la clula receptora. Es ella la clula transductora, es decir, la que es capaz de traducir la energa del estmulo en seales reconocibles y manejables (procesamiento de la informacin) por el organismo. Esas seales son transportadas por vas nerviosas especficas (haces de axones) para cada modalidad sensorial hasta los centros nerviosos. En estos, la llegada de esa informacin provoca la sensacin y su posterior anlisis, por esos centros nerviosos, llevar a la percepcin. La sensacin y la percepcin son entonces, procesos ntimamente ligados a la funcin de los receptores Los receptores sensoriales son clulas, especialmente nerviosas, altamente especializadas, encargadas de reconocer y convertir en forma especfica diferentes formas de energa presentes en el medio ambiente o en el medio interno de un organismo en seales bioelctricas que son transportados a centros nerviosos especficos. Segn el tipo de estmulo que excita las clulas sensoriales, se pueden clasificar los receptores en grandes grupos:


receptores receptores receptores receptores

mecnicos qumicos trmicos luminosos

El siguiente link http://www.natureduca.com/anat_funcrelac_sentidos1.php encuentra una descripcin muy didctica de los Organo de la Visin Audicin, Olfato y Tacto se recomienda aprovechar este material. Organo de la Visin El sentido de la vista se sita en los ojos. En los animales superiores es par, ubicado en el interior de los huesos de la cara, en las cavidades orbitarias que presenta la parte anterior de la cabeza. Est constituido por el globo ocular y otros rganos anexos. Bsicamente es una cmara cerrada con la parte anterior transparente para permitir la entrada de la luz, y una zona interna sensible donde convergen los rayos luminosos para formar la imagen. El globo ocular est compuesto por tres membranas concntricas cuya parte ms externa es la esclertica o blanco del ojo, consistente en un tejido opaco, fibroso y duro, salvo en su zona anterior que es transparente y convexa formando la crnea, y su zona posterior que est perforada para dar salida al nervio ptico. La parte intermedia del globo ocular, desde la esclertica hasta la retina, es un tapizado muy vascularizado llamado coroides, que finaliza por delante mediante un anillo multiciliar blanquecino (anillo circular) en la unin entre la esclertica y la crnea. Tras la crnea se sita una cmara acuosa transparente (humor acuoso), en medio de la cual se halla el iris; ste es un diafragma musculoso, contrctil y opaco, en cuyo centro est la pupila o nia, la cual regula la cantidad de luz que penetra en el ojo variando su dimetro, funcin que es llevada a cabo mediante la contraccin o dilatacin de sus msculos circulares y radiales. Detrs del iris est el cristalino, un cuerpo lenticular, transparente y biconvexo cuya misin es hacer converger los rayos luminosos de manera que formen imgenes en la retina; la prdida de transparencia del cristalino da lugar a una enfermedad conocida vulgarmente como cataratas. La capa ms interna del globo ocular es la retina, constituida por diez capas superpuestas que acoge variados elementos nerviosos y de sostn; sus clulas (conos, bastoncillos, neuronas bipolares y multipolares) se prolongan y agrupan para constituir el nervio ptico, el cual parte de un punto llamado ciego, debido a que en l no se produce ninguna visin. Las clulas de la retina contienen una materia pigmentaria altamente sensible a las impresiones luminosas que recibe, y que producen la sensacin visual; la zona de mayor agudeza visual es la posterior, llamada fvea, mcula o mancha amarilla. Los conos de la retina se relacionan con esa agudeza visual, mientras que los bastoncillos tienen que ver con las condiciones de escasa iluminacin. Todo el resto del globo ocular est ocupado por el llamado humor o cuerpo vtreo


rganos anexos Los rganos anexos del globo ocular estn constituidos por las glndulas lacrimales, rbitas, cejas, prpados, pestaas y seis msculos. Las glndulas lacrimales se sitan en la parte ms externa de la cavidad orbitaria, en su regin antero-superior. Existen dos por cada ojo: una principal o superior y otra accesoria o inferior, cada una de ellas comunicada con el ngulo ms externo del ojo y las fosas nasales mediante un conducto lacrimal. Estas glndulas son las encargadas de segregar las lgrimas, un lquido ligeramente alcalino, lubricante y limpiador de la superficie ocular Los prpados, superior e inferior, son repliegues cutneos movibles, unas lminas fibrosas tapizadas exteriormente por la piel, e interiormente por mucosa y la conjuntiva, una membrana transparente que recubre tambin la crnea. Los prpados poseen unas glndulas que segregan grasa llamadas de Meibomio, en referencia al mdico anatomista alemn Heinrich Meibom (1638-1700) que las descubri y estudi. En el borde de los prpados se encuentran las pestaas, unos pelillos tamizadores de la luz, que limpian el ojo y las ya citadas glndulas de Meibomio. Tambin se encuentran los seis msculos motores del ojo, los cuales permiten su movimiento y sujecin: los cuatro rectos (interno, externo, superior e inferior), y dos oblicuos (pequeo y grande). Los msculos del ojo se controlan por pares de nervios craneales (motor ocular comn, pattico y motor ocular externo).


Mecanismo de la visin La visin es un proceso fisiolgico, resultado de varios fenmenos sucesivos, que nos permite revelar la presencia de los cuerpos, con identificacin de su forma, color y dimensiones. En ese proceso intervienen el ojo y la zona de la corteza cerebral encargada de interpretar las sensaciones luminosas que se proyectan sobre la retina de aqul. La visin es pues una actividad que implica la necesidad de luz; sin ella no existe visin. El mecanismo de la visin se produce de forma similar al utilizado para obtener la imagen en una cmara fotogrfica. As como en la cmara existe una pelcula sensible a la luz que se sita detrs del objetivo, en donde se materializa la impresin de la imagen captada, en el ojo esa funcin la realiza la retina, donde las clulas receptoras son estimuladas para despus conducir los impulsos nerviosos que generan hacia el cerebro. En la cmara se regula la cantidad de luz que penetra en el interior mediante un diafragma mecnico; de manera homloga el ojo utiliza el iris como diafragma, contrayendo o relajando los msculos que lo gobiernan. En ambos ejemplos, tanto la imagen formada en la retina como en la pelcula se proyecta invertida, es decir, si visualizamos un rbol ste se proyecta con la copa hacia abajo y la base hacia arriba, sin embargo, en el ojo humano esa caracterstica es interpretada correctamente tras ser enviada por el nervio ptico hasta el lbulo de la corteza cerebral correspondiente. Por su parte, la mayora de cmaras permiten ajustar el enfoque del objeto que se desea impresionar; en el ojo esa funcin la llevan a cabo los msculos ciliares del cristalino, que acomodan el ojo para enfocar los objetos segn la distancia a que se encuentren. Odo En los animales superiores el odo es el rgano sensorial de la audicin, tambin acoge otro sentido, el del equilibrio, que se encuentra en los canales semicirculares del odo interno. Es par, y se halla situado a uno y otro lado de la cabeza. Consta de tres partes: odo externo (oreja y conducto auditivo), odo medio (caja del tmpano), y odo interno (laberinto).


El odo externo comprende el pabelln u oreja y el conducto auditivo. El pabelln consiste en una lmina replegada e internamente cartilaginosa, cuya misin es conducir las ondas sonoras hacia el conducto auditivo. ste es un tubo de unos 3 cm. de longitud, de cartlago al principioy seo en su parte final, en la membrana del tmpano. Este conducto acoge las glndulas sebceas y ceruminosas segregadoras del cerumen. El odo medio comienza en la caja del tmpano, una cavidad del hueso temporal que a travs de dos orificios o ventanas (la oval y la redonda) comunican con el odo interno por su parte posterior. La faringe tambin se comunica con el odo a travs de un orificio existente en el canal de la trompa de Eustaquio, de esta forma la presin interior y exterior quedan equilibradas. En el odo medio se distingue una cadena de cuatro huesecillos movibles y conectados entre s, que se sitan entre el tmpano y la ventana oval. Son el martillo, yunque, lenticular y estribo. Su funcin es transmitir las ondas sonoras El odo interno se sita detrs de la caja del tmpano. Comprende el laberinto, caracol o coclea y canales semicirculares. Caracol El caracol o coclea consiste en una cavidad en la que reside el llamado rgano de Corti, en alusin a su descubridor, el anatomista italiano Alfonso Corti (1822-1876). Es un rgano arrollado en espiral, sea en su parte externa y membranosa en la interna; entre ambas partes se encuentra un lquido llamado perilinfa, y en el interior de la membranosa se halla otro lquido llamado endolinfa. En el caracol residen las terminaciones ciliadas de las clulas sensitivas del odo. Laberinto El laberinto est constituido por un conjunto de cavidades situadas en el interior del peasco del hueso temporal, por dentro de la caja del tmpano. Su parte externa es sea y en su interior se halla el laberinto membranoso formado por el utrculo (saco


del que parten los tres canales semicirculares) y sculo (bolsa que comunica con el caracol). stos y los canales contienen endolinfa, en ellos reside el sentido del equilibrio. Mediante los movimientos de la endolinfa las clulas sensoriales de los canales envan impulsos al cerebro, informando sobre la posicin de la cabeza, permitiendo as mantener el equilibrio. Cuando el nivel de la endolinfa se altera por cualquier motivo, se produce entonces una prdida de orientacin dando lugar a mareos.

El Olfato El olfato es un sentido quimiorreceptor, como el del gusto, que se estimula mediante las sustancias voltiles que se desprenden de los cuerpos, o las que se encuentran en estado gaseoso, permitiendo as percibir los olores. Est constituido por el nervio olfatorio y sus terminaciones nerviosas, las cuales se diseminan por la parte superior de la mucosa pituitaria, que tapiza las fosas nasales. Los impulsos nerviosos se transmiten a travs de las terminaciones nerviosas hasta el bulbo raqudeo, y desde ste hacia la corteza cerebral olfatoria. El sentido del olfato es fcilmente fatigable, ya que tras un corto periodo de tiempo sometido a la percepcin de un olor de nivel estable, ste deja de percibirse por adaptacin de los receptores olfatorios El Gusto El gusto es un sentido quimiorreceptor, como el del olfato, que se localiza en la boca. Las sensaciones del gusto son percibidas en aquellas sustancias lquidas o disueltas, mediante receptores gustativos de tipo qumico, los cuales se agrupan en los llamados botones gustativos u olivas, que se sitan en los laterales de las papilas linguales. Los impulsos nerviosos de estas sensaciones son transmitidos por los nervios craneales (lingual y glosofarngeo) al bulbo raqudeo y a la corteza cerebral. El Tacto El sentido del tacto se localiza en la piel. Se trata de una forma exteroceptiva de sensibilidad, que permite detectar y localizar sobre la superficie cutnea el estmulo por diferencia de presin que produce un objeto, e incluso determinar su textura. El tacto reside fundamentalmente en las terminaciones nerviosas y corpsculos tctiles, que se localizan en la epidermis y en el espesor de la dermis. La abundancia de corpsculos tctiles se relacionan directamente con la mayor o menor agudeza tctil. El tacto tambin permite transmitir sensaciones trmicas y dolorosas, pero a travs de otros puntos sensibles distintos y en localizaciones diferentes de los citados puntos tctiles.

Profundizacin sugerida para estudiantes de Psicologa y Regencia en Farmacia: Curso sobre estructura, desarrollo, funciones del sistema nervioso de la Pontificia Universidad Catlica de Chile http://www.uc.cl/sw_educ/neurociencias/


Sistema Msculo Esqueltico El sistema msculo-esqueltico tiene como funcin el movimiento de los animales y el hombre. La estructura funcional del sistema esqueltico est formada por los huesos los cuales forman el sistema esqueltico axial que comprende crneo y caja torcica; y el apendicular formado por las extremidades. Los huesos se unen a travs de las articulaciones, que son mviles e inmviles. El sistema muscular recubre el sistema esqueltico, y est conformado por msculos estriados voluntarios. El sistema muscular se caracteriza por la contractibilidad, la excitabilidad y elasticidad. La contraccin muscular est determinada por dos protenas la actina y la miosina. Profundizacin Curso sobre el sistema seo de la Universidad Estatal de California, Chico, sugerido para estudiantes de todos los programas http://www1.universia.net/CatalogaXXI/pub/ir.asp? IdURL=84322&IDC=10010&IDP=ES&IDI=1 Sistema Endocrino Esta conformado por un conjunto de glndulas de secrecin interna de hormonas, las cuales son mensajeros qumicos que producen efectos fisiolgicos en el organismo, como respuesta coordinada ante los mensajes del sistema nervioso. El sistema endocrino tiene como funcin regular las actividades internas de los seres vivos a travs de sus relaciones con el sistema nervioso el cual ha tomado el nombre de sistema neuroendocrino a travs de un proceso de retroalimentacin. La regulacin del sistema endocrino se hace a travs de protenas especializadas denominadas hormonas, las cuales son producidas por glndulas especficas como la hipfisis, tiroides, suprarrenales, pncreas y gnadas. Las hormonas regulan muchos procesos biolgicos como el crecimiento, metabolismo, reproduccin y funcionamiento de los diferentes rganos. Canalizacin del efecto hormonal Las hormonas se transportan por va sangunea y entregan su mensaje a determinados conjuntos de clulas que tengan receptores qumicos especficos en sus membranas.


Tipos de hormonas y su accin La accin de las hormonas se ejerce mediante mecanismos bioqumicos, en dependencia de su naturaleza especfica, como se explica a continuacin: a) Hormonas esteroideas: Son mensajeros qumicos de naturaleza lipdica apta para atravesar las membranas celulares hasta localizar receptores proteicos en el citoplasma. El efecto se desencadena en el ncleo celular al inducir la actividad de snteis proteica mediante la desinhibicin de ciertos genes, que logran la transcripcin de mensajes de ARNm. b) Hormonas proteicas: no atraviesan la membrana celular pero transmiten su mensaje qumico desde la superficie de dicha membrana mediante un receptor de AMPc que s llega al ncleo celular y activa enzimas desencadenantes de efectos metablicos. El ciclo de retroalimentacin hormonal La primera etapa de los procesos de retroalimentacin hormonal comienza en el hipotlamo, glndula que secreta neurohormonas que emigran a la hipfisis, donde desencadenan la produccin de hormonas trpicas (tireotropa, corticotropa, gonadotropa), encargadas de llevar los mensajes a las diversas glndulas del organismo para inducir la secrecin de las hormonas de accin directa sobre el cuerpo, como son la tiroxina, los corticosteroides y las hormonas sexuales, las cuales al alcanzar ciertos niveles retroalimentan a la hipfisis y al hipotlamo para que cesen su accin estimulante y equilibren su interaccin con la glndula ya accionada. Glndulas y funciones hormonales En el siguiente cuadro se presenta un resumen de las diversas glndulas que conforman el cuerpo humano, las hormonas que secretan y sus respectivas funciones: Glndula Hipfisis Adenohipfisis (lbulo anterior) Funcin Estimulan a las glndulas En la tiroides, controla la secrecin de tiroxina Regula las hormonas ACTH o adrenocorticotropa suprarrenales. FSH o folculo estimulante Induce secrecin de estrgenos en los ovarios y maduracin de espermatozoides en los testculos Induce secrecin de progesterona por el cuerpo LH o luteotropina lteo y de testosterona por los testculos. No trpicas: Actan directamente sobre Hormona que secreta Trpicas: TSTH o tireotropa


las clulas Controla el crecimiento de STH o somatotropina huesos y cartlagos. Induce la secrecin de leche PRL o prolactina en las glndulas mamarias. MSH o estimulante de los Induce la sntesis de melanina. Lbulo medio melonforos Neurohipfisis Oxitocina Estimula las contracciones del (lbulo tero en el parto y la secrecin posterior) lctea ante la succin de la glndula mamaria. Estimula la reabsorcin de Vasopresina o ADH agua (antidiuresis) por las nefronas. Regula el metabolismo y el Tiroxina desarrollo. Tiroides Induce la transferencia del Calcitonina calcio de la sangre a los huesos. Induce la absorcin intestinal Paratiroides Parathormona del calcio de la sangre (accin contraria a la calcitonina). Induce la absorcin de la Insulina u hormona glucosa de la sangre en las hipoglucemiante (en clulas clulas del hgado y del tejido alfa) muscular, para su Pncreas transformacin en glucgeno. (en los islotes de Estimula la concentracin de Langerhans). Glucagn u hormona glucosa en la sangre por hiperglucemiante (en clulas descomposicin del glucgeno beta). del hgado (accin antagnica de la insulina). Glndulas Sus 3 capas segregan En la corteza: suprarrenales hormonas. Mineralocorticoides: (en Formacin de glcidos y parte ms externa) grasas a partir de los aldosterona aminocidos. Incrementa resistencia antiestrs. Decrece linfocitos y eosinfilos. Glucocorticoides (en la parte Formacin de glcidos y media): cortisona grasas a partir de los aminocidos. Incrementa resistencia antiestrs. Decrece linfocitos y eosinfilos. Andrgenocorticoides (en la Controla la aparicin de


parte ms interna): hormonas masculinas y femeninas. En la mdula:

caracteres sexuales la pubertad.


Influyen en el metabolismo de los glcidos. Vasodilatacin e incremento Adrenalina gasto cardiaco. Vasoconstriccin y disminucin Noradrenalina gasto cardiaco. Andrgenos: testosterona Produccin espermatozoides y caracteres masculinos Regulacin menstrual y Estrgenos caracteres femeninos. Progesterona Es la hormona del embarazo.

Ubicacin de las glndulas del sistema endocrino humano

Grfica Glndulas endocrinas Fuente: Diseo Carmen Eugenia Pia L



Las plantas son organismos que contienen pigmento verde o clorofila, esencial para realizar el proceso de fotosntesis a partir del cual producen alimento y liberan energa, mecanismo conocido como nutricin auttrofa. Antes de referirse a los rganos de las plantas, es necesario conocer la diferenciacin entre plantas vasculares y no vasculares, aspecto que incide en las caractersticas de algunos rganos de las mismas. Las plantas no vasculares no poseen tejidos conductores, no poseen races verdaderas en su lugar tiene rizoides a travs de los cuales absorben agua y nutrientes del suelo, no tienen tallos ni hojas verdaderas. Un ejemplo de estas plantas son los musgos de gran importancia en la naturaleza por ser reservorios de agua y por contribuir en los procesos de meteorizacin. Las plantas vasculares tienen tejidos conductores, races, tallo y hojas verdaderas como es el caso de los helechos. Algunas, las gimnospermas adems poseen flores y semillas desnudas, es decir, la semilla no se desarrolla dentro de un fruto, como es el caso de los pinos, otras las angiospermas adems poseen frutos. Las angiospermas se dividen en monocotiledneas y dicotiledneas. A continuacin se resumirn las principales diferencias entre plantas monocotiledneas y plantas dicotiledneas:

Tabla: Principales diferencias entre plantas monocotiledneas y dicotiledneas.

Monocotiledneas Pertenecen a este grupo los pastos, los lirios, la caa, el maz y las palmas Tienen un solo cotiledn Dicotiledneas Pertenecen a este grupo el resto de plantas superiores Poseen dos cotiledones


Tienen hojas estrechas, largas y con nervadura paralela

Tienen hojas anchas con nervadura ramificada

Su raz es fibrosa, no posee raz principal

Poseen raz principal y races secundarias.

Organizacin externa de las plantas Los rganos vegetativos

Son aquellos rganos de la planta que sirven para mantener la vida individual de la planta y son: raz, tallo y hoja.

La raz

Fuente: Material grfico cedido po-la A.C. Nitella Flexilis publicado en url www.sobrado-es.com


La principal funcin de la raz es la absorcin del agua y sales minerales del suelo y la fijacin de la planta al mismo sustrato. Adems contribuye a evitar la erosin al mantener aglutinadas sus partculas. Las partes de la raz son la cofia que se encuentra en la punta de la raz cubriendo el pice, sus clulas efectan la absorcin de nutrientes, por encima de la cofia se encuentra una zona en donde las clulas estn en constante reproduccin, es la zona de crecimiento apical o meristemtico inmediatamente despus se halla la regin de alargamiento. A continuacin se encuentra la zona de maduracin en donde las clulas alargadas se diferencian y convierten en tejidos, esta regin est provista de pelos radiculares cuya funcin es la de incrementar la superficie de absorcin La raz principal es la primera en brotar y penetrar en la tierra, luego brotan las races secundarias laterales hasta desarrollar el sistema radicula. Si la raz principal sobrepasa en tamaos las races laterales, este sistema se llama pivotante. Este sistema es caracterstico en muchas plantas dicotiledneas, por ejemplo en todos los rboles y arbustos de clima medio

Fuente: Diseo Carmen Eugenia Pia L Las plantas monocotiledneas carecen de raz principal, por ejemplo del tallo de maz brota un gran nmero de races que le sirven de sostn al tallo. Estas races que brotan del tallo y en algunas plantas de la hoja, se denominan races adventicias.

Fuente. Material grfico cedido po-la A.C. Nitella Flexilis publicado na url www.sobradoes.com


El sistema radicular formado por races finas y ramificadas carente de raz principal se denomina fibroso y es caracterstico de todas las plantas monocotiledneas, pero a veces se forma en las dicotiledneas de produccin vegetativa. Las races que crecen de tubrculos, de pecolos de hojas o de pedazos de tallo, poseen sistema radicular adventicio

Modificaciones de la raz
En sistemas pivotantes como la zanahoria o en la remolacha, en la raz principal se almacenan nutrientes, este sistema de raz pivotante se denomina napiforme. En sistemas radiculares fibrosos tambin se presentan modificaciones, como sucede con la arracacha, la yuca que forman races carnosas tuberosas.

Fuente: Diseo Carmen Eugenia Pia L

El Tallo
El tallo es el rgano que conecta la raz y las hojas entre s. Las funciones primordiales del tallo son soporte y conduccin del agua y sales minerales a las hojas y de sustancias elaboradas de la hoja a la raz. Algunas plantas se reproducen por medio del tallo (reproduccin vegetativa), en muchas plantas los tallos acumulan sustancias alimenticias. El tallo y las races de una planta trabajan conjuntamente, desempeando funciones diferentes pero estrechamente relacionadas, los tejidos que constituyen las races y los tallos son similares, aunque los rganos en s tienen diferencias estructurales importantes.


Los tallos, lo mismo que las races, crecen de formas y tamaos muy diferentes, unos son troncos de los rboles gigantes que se elevan cientos de metros en los bosques, algunos solo viven algunas semanas, pero otros duran siglos. Existen muchos tipos de tallos con caracteres externos e internos diferentes: Tallo leoso. Posee una consistencia dura, entre ellos se cuentan rboles, arbustos y bejucos leosos. Tallo herbceo: De consistencia maciza o hueca, son erguidos, los claveles, la hierbabuena y otras plantas de jardn. Tallo de monocotiledneas: De consistencia maciza o hueca, son erguidos y cilndricos como el de la guadua, el maz, los pastos y las palmas. Tallos modificados: Son tallos que poseen forma y funcin excepcional. Entre ellos el cladodio, los rizomas y los zarcillos. Cladodio: tallos aparentemente sin hojas, por ello realiza la funcin de fotosntesis y transpiracin. Son suculentos, ejemplo: cactus. Estoln: En la fresa, frambuesa, ahuyama, calabaza, el estoln es un tallo con entrenudos finos y largos con hojas en forma de escama. Se encuentra en la superficie del suelo y es til en la reproduccin vegetativa. Bulbo: Es un tallo subterrneo corto y grueso y envuelto en varias hojas. Su funcin es el almacenamiento de sustancias alimenticias y la conservacin y la proteccin de las yemas en tiempos muy fros o muy calientes y secos. Este bulbo es til en la reproduccin vegetativa. Ejemplo: Cebolla. Rizoma: Tallo subterrneo como en el lirio, es grueso y carnoso, horizontalmente sobre la superficie del suelo, til n la reproduccin vegetativa. crece

Zarcillo: Como en la uva, sirve ms como medio de soporte del tallo a otros elementos. Como frjol, badea, pepino.

Estructura del tallo

Al observar un tallo podemos encontrar las siguientes estructuras:


Nudos: Pequeos puntos donde se adhieren las hojas.

Entrenudos: espacio entre nudo y nudo. Yema apical o Terminal: Yema que se localiza al final del crecimiento longitudinal del tallo. Yemas laterales: Se localizan en el ngulo formado por el pecolo de la hoja y la continuacin del tallo. Cicatrices de escamas: Indican donde estuvo ubicada la yema Terminal. Sirven para detectar la edad de la ramita. Ramas: Formaciones laterales del tallo, dan mejor extensin a la planta y facilitan una mejor utilizacin de la luz para la fotosntesis.

La hoja


Su principal funcin es la fotosntesis y la transpiracin, adems sirve de proteccin a las yemas laterales. Las principales partes de la hoja son: el limbo o lmina, el pecolo y en algunas las estpulas. Las hojas poseen las ms diversas estructuras morfolgicas especialmente en su limbo, que puede ser de diferentes tamaos y formas La forma de las hojas vara ampliamente, dependiendo de la forma del limbo, base, pice y tipo de borde, por lo que solo se presentan las ms comunes.

Segn su forma
Oval. Cordada en forma de corazn. Deltoidea. Acicular (en forma de aguja). Linear (larga y angosta). Lobulada (en forma de varios lbulos). Compuesta (formada de foliolos). Lanceolada. Arrionada. Espatulada. Elptica.

Reticular: Los nervios presentan ramificaciones Paralela: Los nervios van paralelos de un lado a otro. en forma de red.

Borde Entero: Liso sin hendiduras.

Dentado: Hendiduras. Aserrado. Borde.

La disposicin de sus hojas Alterna.

Opuestas. Verticiladas.

Imagenes forma de las hojas Modificaciones de la hoja

Algunas de ellas son:


Suculentas. Gruesas y carnosas retienen agua, ejemplo: aloe o sbila, algunas plantas desrticas poseen tallos suculentos y sus hojas estn formadas por espinas que protegen la prdida de agua de la planta y actan como rgano de defensa. Ejemplo: cctus.

rganos reproductores de la planta La Flor

Tomado de: http://www.juntadeandalucia.es/averroes/concurso2004/ver/09/partes.htm Las flores son rganos reproductores de las plantas superiores, de la cual resultan las semillas, portadoras de los caracteres genticos para la siguiente generacin.

Morfologa de la flor
Al observar una flor vemos que consta de cuatro partes o verticilios florales unidos al extremo modificado del tallo o receptculo

El cliz
El primer verticilio de la flor formado por los spalos, cuya funcin es la proteccin de la yema floral, y los verticilios internos. Existen dos tipos de cliz: dialispalo que presenta spalos libres y gamospalo.


Formada por los ptalos de variados colores, su funcin es atraer a los insectos tiles en la polinizacin. Al igual que el cliz la corola puede ser dialiptala es decir con los ptalos separados o gamoptala con los ptalos soldados. La simetra de la flor puede ser de dos tipos: Radical o actinomorfa cuando los ptalos son de igual tamao y de distribucin uniforme que permiten que la flor sea dividida en cuatro (4) o ms porciones equivalente y bilateral o zigomorfa cuando los ptalos son de tamao desigual y con una distribucin equidistante entre ellos, lo cual permite dividir la flor en dos partes iguales. El receptculo, el cliz y la corola, juntos forman el perianto o envoltura protectora de la flor.

Formado por los estambres y constituyen el aparato sexual masculino. El estambre consta de un tallo o filamento, que lleva en su pice una antena en donde se desarrollan los granos de polen. En el androceo, los estambres pueden estar libres (dalistmono) o soldados (gamostmono). Los estambres pueden ser todos iguales (isostmono), agruparse de dos en dos (didinamos) o en grupo de cuatro y otro de dos (tetradnamos).

Formado por varios pistilos que constituyen el aparto sexual femenino de la flor El pistilo o carpelo consta de tres partes: El ovario, el estilo y el estigma, que es rugoso y esponjoso con el fin de atrapar el polen. Los carpelos pueden presentarse separados o estar soldados entre s parcial o totalmente. El ovario contiene los vulos, cada vulo contiene un saco embrionario, dentro del cual crece la ovoclula. La posicin del ovario puede ser superada por encima de la insercin de los dems verticilios florales como en el nabo, tomate, ciruela, durazno, o infera por debajo de esta insercin.


Plantas monicas y diicas

Las plantas pueden ser diicas cunado poseen flores de un solo sexo, femeninas o masculinas unisexuales, ejemplo: papayo, joroba o fresno el inchi. Cuando la misma planta posee flores femeninas y masculinas, ejemplo: maz y nogal, se denomina monoica.

Frmula floral
Permite resumir las caractersticas de una flor, para tal fin se utilizan smbolos, letras y nmeros, los cuales se describen con una determinada secuencia as: 1. Simetra: La cual puede ser actinomorfa simbolizada con un asterisco zigomorfa representada con una flecha invertida 2. Sexo: Si la flor es unisexual se representa su sexo as: , o

3. Cliz: Se presenta con la letra C seguida del nmero de spalos. En el caso de que los spalos sean soldados (gamospalos) el nmero de spalos se encierra en un parntesis, ejemplo: C(5). 4. Corola: Se simboliza con la letra K seguida del nmero de ptalos. Si los ptalos son unidos o soldados (gamoptala) el nmero de ptalos se encierra en un parntesis K(5) si los ptalos son libres el nmero de ptalos va sin parntesis K5. 5. Androceo: Se representa por la letra A seguida del nmero de estambres, si son libres se representa sin parntesis A5 si los estambres son soldados el nmero de estos va dentro de un parntesis A(5). Pueden representarse de acuerdo a su agrupacin A2+2. 6. Gineceo: Se representa con la letra G indicando la posicin del ovario con una raya pequea as: si es inferior la raya va debajo de la letra (G) si es superior la raya va encima de la letra (G). Seguida del nmero de carpelos o pistilos, el cual va sin parntesis si son libres o dentro de un parntesis si los carpelos son soldados G(5).



Inflorescencia En la mayora de las plantas no se forma una sola flor en el pice del tallo o en la axila de una hoja, sino que en una rama o planta se desarrollan arreglos de pequeas flores, denominadas inflorescencias. Las inflorescencias pueden clasificarse en Racemosas, cimosas y compuestas. 1. Racemosas: Tienen crecimiento centrpeto y pueden ser: - Racimo: Presenta un eje principal alargado y flores pediceladas en toda su extensin. - Umbela: De un punto del pednculo parten pedicelos como radios. - Corimbo: Tiene un eje principal a lo largo del cual salen pedicelos permitiendo a las flores estar en un mismo nivel. - Espiga: Del pednculo o eje salen flores ssiles. - Captulo o cabezuela: De un eje ensanchado salen flores ssiles. 2. Cimosas: Su crecimiento es centrfugo, definido y pueden ser: - Monocasio: Formado por una flor principal terminal y otra lateral secundaria. - Helicoidea: Con un eje prolongado y flores a ambos lados. - Dicasio: Con una flor lateral y dos secundarias laterales. - Escorpioidea: Con flores a un solo lado y eje curvado o enmallado. Las inflorescencias tambin pueden formarse por la modificacin o la combinacin de dos inflorescencias simples. Ejemplo: racimo de racimos, racimos de espigas, umbela de captulos.


El fruto y la semilla
Despus del proceso de fecundacin, el ovario maduro con o sin partes asociadas se convierte en fruto. La pared del ovario junto con las partes asociadas (si se tienen) se convierte en pericarpio o partes protectoras que rodean la semilla. Al madurar el pericarpio puede contener sustancias de reserva que constituyen la pulpa en frutos carnosos. En otros frutos el pericarpio es seco. La semilla es el vulo maduro, y contiene el embrin y las sustancias alimenticias necesarias para su desarrollo y crecimiento.En las ginospermas la semilla se desarrolla en la superficie de las escamas de los conos, en las angiospermas la semilla se desarrolla dentro de la pared protectora del ovario. Las sustancias alimenticias se encuentran en el endosperma o en el mismo embrin en las dicotiledneas, en monocotiledneas se ubica en el albumen.

Clasificacin de frutos segn Fuller y otros (Botnica, Editorial

Interamericana) 1. Frutos simples: El fruto simple consta de un solo ovario madurado. Las clases principales de frutos simples son: a) Frutos carnosos: Pericarpio blando y carnoso en el momento de la madurez. Las semillas escapan de los frutos carnosos como resultado de la descomposicin de los tejidos carnosos. Baya: Pericarpio totalmente carnoso, ejemplo: Uva, banano, tomate, papaya, sanda, guayaba, naranja, pepino, pimentn. Drupa: el exocarpio es una capa delgada, el mesocarpio es grueso y carnoso, el endocarpio es duro y ptreo, ejemplo: melocotn, coco, aceituna, cereza, albaricoque. b) Frutos secos: Pericarpio seco, quebradizo y duro en la madurez, contiene varias semillas. Frutos deshiscentes: Se abren en forma natural para liberar las semillas, ejemplo: arveja, frjol, habichuela, magnolia, lirio, tulipn, violeta. Frutos indehiscentes: No se abren al llegar la madurez contienen una o dos semillas. Frutos agregados: Es un racimo de varios ovarios madurados, producidos por una sola flor y llevados en el mismo receptculo. Ejemplo: frambuesa y zarzamora. Frutos mltiples: Racimos de muchos ovarios madurados producidos por varias flores amontonadas en la misma inflorescencia, ejemplo: mora y pia, higuera.


Frutos accesorios: Frutos que constan de uno o ms ovarios madurados, con tejidos de otras partes florales, como el cliz o el receptculo. En un fruto accesorio, estos tejidos complementarios estn a menudo muy desarrollados, hasta constituir la parte principal de la estructura designada popularmente fruto, entre los frutos accesorios familiares figuran las fresas. en la que los frutos individuales son aquenios, llevados a un receptculo suculento, rojo, dulce, extensamente desarrollado. Otro tipo de fruto accesorio es el pomo ejemplificado por manzanas y peras, en que los ovarios maduros estn rodeados de tejido de receptculo y cliz agrandado, en los que estn almacenadas grandes cantidades de alimento y agua. En la tabla siguiente se resume la funcin que realiza cada uno de los rganos que conforman la planta rgano Raz Funcin Fijacin de la planta al suelo Absorcin de agua y minerales del suelo En algunas plantas son rganos de almacenamiento como en la zanahoria y la yuca Conecta la raz y las hojas Conduce agua y sales minerales de la raz a las hojas Conduce sustancias elaboradas de las hojas a la raz En algunas plantas son rganos de almacenamiento como en la papa y la cebolla cabezona Puede servir para la reproduccin vegetativa de algunas plantas. Fotosntesis o produccin de alimento Respiracin de la planta a travs de estomas Transpiracin Formacin de semillas Reproduccin sexual de la planta Almacenamiento como en el brcoli, el coliflor Guardar y proteger las semillas Almacenamiento de sustancias alimenticias Contener el embrin de la nueva planta Reservar sustancias alimenticias para el desarrollo y crecimiento del embrin




Fruto Semilla


Capitulo 4 Microorganismos
INTRODUCCION La microbiologa estudia los microorganismos u organismos unicelulares generalmente microscpicos que se dividen en: virus; bacterias; protozoos, algunas algas y hongos. Segn el objeto de estudio o de interaccin entre el hombre y los microorganismos se pueden sealar mltiples clasificaciones para casos especficos de la microbiologa. Por ejemplo: bacteriologa, microbiologa agrcola, microbiologa de alimentos, microbiologa ambiental, protozoologa, micologa, virologa, entre otras. El objeto material de la microbiologa viene delimitado por el tamao de los seres que investiga, lo que supone que abarca una enorme heterogeneidad de tipos estructurales, funcionales y taxonmicos: desde partculas no celulares como los virus, viroides y priones, hasta organismos celulares tan diferentes como las bacterias, los protozoos y parte de las algas y de los hongos, los cuales segn la clasificacin de Whittaker conforman reinos distintos a plantas y animales. Los Virus Caractersticas Los virus son organismos submicroscpicos, de forma variable pueden ser alargados, icosadricos (polgono de 20 lados), algunos como los bacterifagos que atacan a las bacterias, tienen forma ms compleja su estructura presenta cabeza y cola Los virus contienen solamente un tipo de cido nucleico que puede ser: ADN (cido desoxirribonucleico) o ARN (cido ribonucleico), rodeado de una cubierta de protena denominada cpsida la cual tiene funcin protectora.

Microfotografa de Adenovirus Tomada de http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookDiversity_1.html http://web.uct.ac.za/depts/mmi/stannard/linda.html


Algunos tipos de virus poseen tambin una envoltura, constituida por lpidos y protenas, que tiene su origen en la membrana de la clula infectada y envuelve la cpsida, es el caso del virus de inmunodeficiencia humana. A esta estructura completa se la denomina partcula vrica o virin. Los virus no tienen organizacin celular, ni pueden realizar sus procesos metablicos de manera independiente, por lo que se les sita en el lmite entre lo vivo y lo no vivo. Para su replicacin necesitan intracelulares obligados. de clulas vivas constituyndose en parsitos

Los virus pueden actuar de dos formas distintas: Como agentes infecciosos productores de enfermedades en el hombre, las plantas y los animales. Se reproducen en el interior de las clulas que infectan de donde obtienen todo el material y los mecanismos requeridos para su replicacin. Como agentes genticos que modifican el material hereditario de las clulas que infectan, al unirse a su material gentico y causar variabilidad gentica. Los virus que infectan a las bacterias se denominan bacterifagos

Grfica: Representacin esquemtica de un virus bacterifago Fuente: Carmen Eugenia Pia


Grfica Representacin esquemtica de bacterifago infectando una bacteria Fuente: Carmen Eugenia Pia

Mecanismo de replicacin de los virus El proceso se inicia con la adhesin del virus a la clula El virus penetra dentro de la clula e inyecta en ella su cido nucleico (material gentico). El ADN de la clula fabrica las protenas vricas y el cido nucleico viral se replica en la clula que parsita utilizando las enzimas, el material y los mecanismos de la clula que hospeda. Cuando hay suficiente cantidad de cido nucleico viral este se ensambla con la protena vrica y abandona la clula. Clasificacin de los virus Los virus no se clasifican en ninguno de los 5 reinos propuestos por Whittaker debido a que no tienen organizacin celular, y utilizan los procesos anablicos de las clulas hospedadoras para su replicacin. Tampoco se ubican en ninguno de los 3 dominios El ICTV (Comit Internacional de Taxonoma de Virus) propuso un sistema universal de clasificacin viral. El sistema utiliza una serie de taxones como se indica a continuacin: Orden (-virales). Familia (-viridae) Subfamilia (-virinae) Genero (-virus) Especie ( ). Los virus se agrupan en familias y subfamilias cuyo nombre se ha latinizado; por ejemplo, los virus herpes se agrupan en la familia Herpesviridae. Las subfamilias tienen el sufijo nae, Ej: Herpesvirinae. El otro tipo de agrupacin es el gnero, que no se nombra en forma latinizada, por ejemplo, herpesvirus. Por ejemplo, el virus Ebola de Kikwit se clasifica como: Orden: Mononegavirales Familia: Filoviridae Gnero: Filovirus Especie: virus Ebola Zaire











a) Tipo y naturaleza del genoma. (AND; ARN) b) Morfologa de la partcula vrica o virion: simetra de la nucleocpsula, presencia de envoltura. c) Mecanismo de replicacin Hospedero Otro sistema de clasificacin se basa en la capacidad de infectar determinadas clulas husped y de acuerdo con ello se subdividen en tres clases principales: virus animales, virus bacterianos o bacterifagos y virus de las plantas Origen de los virus Existen 2 hiptesis sobre el origen de los virus: http://omega.ilce.edu.mx:3000/sites/ciencia/volumen2/ciencia3/071/htm/sec_2.htm 1. Una teora propone que los virus son consecuencia de la degeneracin de microorganismos (bacterias, protozoarios y hongos) que alguna vez fueron parsitos obligatorios de otras clulas, a tal grado que se convirtieron en parsitos intracelulares y perdieron paulatinamente todos los componentes necesarios para desarrollar un ciclo de vida libre independiente de la clula hospedera. Sin embargo, el hecho de que la organizacin de los virus es de tipo no celular, es un importante argumento en contra de esta teora, ya que las cpsides virales son anlogas, desde el punto de vista morfogentico, a los organelos celulares constituidos por subunidades de protena, tales como flagelos y filamentos que forman el citoesqueleto, y no son parecidas a las membranas celulares. Por otra parte, las envolturas de los virus no muestran similitudes arquitectnicas con las membranas celulares o en caso de poseer dicha arquitectura es debido a que la envoltura viral fue adquirida como consecuencia de la protrusin o brote de la partcula viral a travs de la membrana celular. 2. La otra teora propone que los virus son el equivalente a genes vagabundos. Por ejemplo, es probable que algunos fragmentos de cido nucleico hayan sido transferidos en forma fortuita a una clula perteneciente a una especie diferente a la que pertenecen dichos fragmentos, los cuales en lugar de haber sido degradados (como ocurre generalmente), por causas desconocidas podran sobrevivir y multiplicarse en la nueva clula hospedera. Enfermedades virales Los virus son causantes de enfermedades infecciosas en el hombre como son : la viruela, la gripe, la hepatitis, las paperas, la rabia, la poliomielitis, el SIDA, el sarampin , la encefalitis, la rubola, el herpes, la fiebre amarilla sta ltima transmitida por un vector; en los animales originan el moquillo, la rabia, la influenza, la


encefalitis, el clera; y en las plantas enfermedades como el virus del mosaico del tabaco y el virus del mosaico amarillo del nabo entre otras. Los mecanismos de trasmisin son diversos algunos por va respiratoria cuando la persona enferma estornuda o tose; otros a travs de picaduras de insectos es el caso de la fiebre amarilla; o por mordedura de animales enfermos como en el caso de la rabia; los que causan trastornos digestivos por va oral-fecal y por inoculacin con jeringas u objetos infectados, por transfusin de sangre contaminada, por relaciones sexuales sin proteccin y por ltimo a travs de la madre al hijo durante el embarazo o en el momento del parto. En el caso de las plantas la trasmisin se hace por insectos o nematodos. Los medios para prevenir la infeccin viral son las vacunas que causan inmunidad, evitar el contacto con personas infectadas, esterilizacin de objetos, uso de jeringas desechables. Importancia biolgica de los virus Los virus sirven para adelantar investigaciones biolgicas relacionadas con su mecanismo de replicacin y as poder encontrar mecanismos para controlar su multiplicacin. Los virus permiten la elaboracin de vacunas, fueron de los primeros modelos para el estudio del funcionamiento del genoma, los bilogos utilizan los virus para estudiar el mecanismo de control de la informacin gentica y extrapolarlo a organismos ms complejos Algunos virus atacan bacterias e insectos perjudiciales ayudando a mantener el equilibrio ecolgico. Los virus sirven como mediadores en el intercambio gentico entre individuos de una misma o diferentes especies proporcionando variabilidad de los organismos y por ende disminuyen la susceptibilidad a ser infectados. Por ejemplo, las bacterias que han sido infectadas por virus bacterifagos- pueden realizar funciones que en otras condiciones no podra realizar . Algunos virus se utilizan en medicina para introducir informacin a clulas animales que presenten defectos genticos o adquiridos y as lograr que funcionen normalmente. Viroides Son molculas de ARN circular (300-400 nucleotidos) que carecen de cubierta viral o cpsida, son de tamao menor que los virus. Se encuentran en clulas vegetales donde causan enfermedades. Debido a que los viroides no codifican para ninguna protena deben necesariamente reclutar protenas y vas metablicas de la clula hospedera para completar su ciclo infeccioso. Se les considera como la etapa primitiva de los virus. Se cree que los viroides podran proceder evolutivamente de los intrones.


Caractersticas 1. Bajo peso molecular 2. No tienen cpsula proteica 3. Se multiplican en forma autnoma 4. Parsitos obligados 5. Infecciosos Priones Son protenas que se multiplican en la clula hospedadora donde generan graves alteraciones. Todas las enfermedades ocasionadas por priones son neurolgicas, por ejemplo el sndrome de las vacas locas. A continuacin se presenta una ampliacin tomada de: http://enfenix.webcindario.com/biologia/microbio/priones.phtml Los priones son agentes patgenos formados por una protena (protena del prin o PPr) Los priones, o las enfermedades producidas por priones, tienen un comportamiento sorprendente, por un lado se transmiten verticalmente, como cualquier enfermedad hereditaria tpica, mientras que por otro lado se comportan de manera infectiva, transmitindose horizontalmente, mediante contagios que pueden darse entre individuos de distintas especies. Protenas del Prion Los priones son agentes patgenos formados por una protena (protena del prin o PPr) Los priones, o las enfermedades producidas por priones, tienen un comportamiento sorprendente, por un lado se transmiten verticalmente, como cualquier enfermedad hereditaria tpica, mientras que por otro lado se comportan de manera infectiva, transmitindose horizontalmente, mediante contagios que pueden darse entre individuos de distintas especies. La protena del prin (PrP) normal, tiene una secuencia de aminocidos, (estructura primaria) idntica a la protena del prin patgena. La diferencia entre las dos recae en la estructuras secundaria y terciaria


Protena de Prion Normal

Protena de Prion patgeno

Protena patgena infectando una normal

Interaccin de protena normal con protena patgena

Estructura terciaria de la protena del prin

Estructura secundaria del Prion

La protena normal es muy rica en hlices alfa , la protena patgena lo es en lminas beta . Este cambio de configuracin es crucial, ya que las protenas con lminas beta son muy resistentes a las enzimas proteolticas, al calor y no se disuelven en agua.


Pero sobre todo, la protena alterada tiene una caracterstica nica: interacciona con una molcula de protena normal, le cambia la conformacin y la hace capaz de convertir las estructuras de ms protenas normales. Ah radica al parecer, el poder infectivo de los priones Esquema explicativo poder infectivo de los Priones

Puede ocurrir que la protena patgena infecte individuos que producen protena normal (a), como ha ocurrido por ejemplo al consumir las vacas piensos elaborados a partir de ovejas enfermas. En este caso la protena patgena origina un cambio conformacional de la protena normal (b), transformando las hlices alfa de su estructura proteica en lminas beta. Las nuevas protenas patgenas inducen el cambio en otras normales, lo cual produce un efecto de "cascada".


Profundizacin sugerida para estudiantes de Regencia de Farmacia, Zootecnia, e Ingeniera de Alimentos. Curso sobre Virologa de la Universidad de Rochester: http://www.medynet.com/usuarios/nnuneza/virologia/indexviral.html http://www.virology.net/ Journal sobre virologa

Nuevas investigaciones confirman el origen vrico de la obesidad El 30% de los casos pueden deberse a infecciones y una vacuna puede prevenir hasta el 15% del sobrepeso Nuevas investigaciones confirman que el 30% de los casos de obesidad son debidos a infecciones vricas y que una vacuna puede reducir el crecimiento de la enfermedad en un 15%. Lo que en 1997 se descubri en animales y el ao pasado en humanos, se confirma plenamente ahora: el adenovirus Ad-36 desempea un papel crucial en la obesidad humana, originando hasta 20 kilos de ms en las personas infestadas. En consecuencia, de la misma forma que se previenen enfermedades como la rubola o la polio, una proteccin similar aplicada en la infancia evitara que los nios desarrollasen el sobrepeso en la edad adulta. Por Marta Morales.

Cierto tipo de obesidad, derivada de un virus, podra evitarse por medio de vacunas, segn el equipo mdico que lleva investigando la posible relacin de la obesidad con un tipo de virus y que ha informado del estado de sus conocimientos en el congreso de la NAASO norteamericana, una asociacin lder en investigacin cientfica sobre la obesidad, celebrado la pasada semana en Vancouver. El investigador Nikhil V. Dhurandhar, del Centro de Investigaciones Biomdicas de Pennington, Lousiana, Estados Unidos, afirm en Vancouver que el exceso de peso est relacionado, en ciertos casos, con infecciones virales. Explicando el estado actual de sus investigaciones, que ya fueron objeto de un estudio publicado recientemente por el International Journal of Obesity, Dhurandhar seal que se ha comprobado que el adenovirus 36 (Ad-36) estaba presente seis veces ms en los obesos que en las personas de peso normal. Hasta ahora se han identificado al menos 40 subtipos de adenovirus que pueden provocar problemas respiratorios e infecciones gastrointestinales. Segn el profesor Dhurandhar, sus investigaciones demuestran que el Ad-36 desempea un papel crucial en la obesidad humana. 30% de la poblacin infestada En el estudio publicado en el International Journal of Obesity, que analiz a 502 personas, demostr que el 30 por ciento de ellas presentaban anticuerpos del virus Ad-


36, mientras que los mismos anticuerpos estaban presentes nicamente en el 5 por ciento de las personas no obesas. El estudio revel asimismo que los obesos infestados con el Ad-36 pesan una media de 20 kilos ms que las dems personas investigadas. Estos obesos se distinguen adems de los otros en que, paradjicamente, tienen una tasa ms baja de colesterol y de triglicridos. Los investigadores consideran que el Ad-36 afecta al metabolismo de las clulas adiposas en crecimiento, favoreciendo la acumulacin de grasa y su rpido crecimiento. Eso significa que una persona infestada por el virus engorda mucho ms que otra persona que coma la misma cantidad y tipo de alimentos. Dhurandhar considera que el exceso de peso est relacionado, en ciertos casos, con infecciones virales. En consecuencia, de la misma forma que se previenen enfermedades como la rubola o la polio, seala que una proteccin similar aplicada en la infancia evitara que los nios desarrollasen el sobrepeso en la edad adulta. Dhurandhar est especializado en la investigacin de las relaciones entre los virus y la obesidad, y ha desarrollado su propia teora acerca de lo que ha bautizado como el virus de la obesidad, perteneciente al grupo de los llamados adenovirus. Virus identificado Los adenovirus son virus de tamao mediano, de los que existen 49 tipos agrupados en seis subgneros (de la A a la F). Generalmente estables contra agentes qumicos o fsicos, los adenovirus pueden sobrevivir durante un tiempo prolongado fuera del cuerpo. Sus efectos ms comunes en el organismo humano son las enfermedades respiratorias, pero tambin producen gastroenteritis, conjuntivitis, cistitis y sarpullidos. Uno de estos adenovirus es capaz adems de producir obesidad. Las investigaciones de Dhurandhar han demostrado que existe una relacin entre la grasa que genera el cuerpo y la presencia de los anticuerpos del AD-36 en la sangre. Investigaciones previas ya haban demostrado que ratones y monos a los que se les haba inyectado dicho virus ganaban peso rpidamente. Hasta ahora se saba que la obesidad est relacionada con mltiples factores. Aunque a menudo vaya asociada a un consumo excesivo de alimentos o a un tipo de vida sedentaria, el caso es que tambin existen otras causas, como la herencia gentica, el contacto con los contaminantes o la ingesta de medicamentos. Evitar graves riesgos Los riesgos que para la salud entraa la obesidad son mltiples. Adems de la muerte, el sobrepeso propicia un gran nmero de enfermedades crnicas como la diabetes, la hipertensin, el exceso de colesterol en la sangre, los infartos cerebrales, los problemas cardiacos (varios estudios han demostrado que por cada kilogramo de sobrepeso aumenta en un 1% el riesgo de muerte por enfermedades coronarias), el cncer (principalmente de colon en hombres y mujeres, de recto y de prstata en


hombres, y de tero y pecho en mujeres). Otras enfermedades derivadas del exceso de peso seran la artritis y los problemas respiratorios. El Dr. Dhurandhar comenz a interesarse en los casos virales de la obesidad en los aos 80, mientras trabajaba como mdico en Bombay, en la India. All pudo constatar que ciertos agentes patgenos provocan un rpido aumento del peso en algunos animales despus de ser infestados con el Ad-36. La NAASO norteamericana ofrece en su web la posibilidad de calcular la masa corporal. Por su parte, la empresa Obetech ofrece la posibilidad de descubrir si una persona est infestada por el Ad-36. La obesidad mata cada ao en Estados Unidos a 300.000 personas y los descubridores del origen vrico de la obesidad consideran que el AD-36 tiene infectada al 20% de la poblacin norteamericana. Una vacuna podra prevenir el 15% de los casos de obesidad, segn sus estimaciones. Ciruga peligrosa La divulgacin de los avances en esta investigacin coinciden con la publicacin de otros estudios en Estados Unidos que desvelan que los riesgos de morir como consecencia de la ciruga aplicada a la reduccin de peso son mayores de lo que se pensaba, incluso entre las personas con sobrepeso que estn entre los 30 y 40 aos de edad. Hasta ahora se pensaba que la tasa de mortalidad en esta categora de edad, la ms susceptible de sufrir una ciruga para reducir el sobrepeso, era del uno por ciento. Sin embargo, un nuevo estudio revela que entre los 35 y los 45 aos de edad, la muerte se lleva al 5 por ciento de los hombres y al 3 por ciento de las mujeres que han sufrido este tipo de intervenciones quirrgicas. Los porcentajes de mortandad se elevan en los pacientes que tienen entre 45 y 54 aos de edad. La posible vacuna contra la obesidad y el descubrimiento de los riesgos quirrgicos, pueden provocar un giro en los comportamientos asociados a esta enfermedad. El nmero de estadounidenses que recurrieron a la ciruga para reducir su peso se multiplic por cinco entre 1998 y 2002. Segn un estudio de la Agencia para la Investigacin y Calidad de la Sanidad (AHRQ), mientras que en 1998 slo 13.386 estadounidenses recurrieron a la ciruga baritrica, en 2002 la cifra ascendi hasta los 71.733, debido en gran parte a un aumento del 900 por ciento en las operaciones en pacientes con edades entre los 55 y 64 aos. mircoles 19 Octubre 2005 Marta Morales Written by Marta Morales on mircoles 19 Octubre 2005


Profundizacin: http://www.medynet.com/usuarios/nnuneza/virologia/indexviral.html http://www.virology.net/

Las Arqueobacterias y Bacterias

Introduccin Carl Woese mediante la secuenciacin de la molcula de ARNr, comprob que los procariotas pertenecientes al reino Mnera se dividan en 2 grupos o dominios: al primero de ellos lo llam Eubacteria o Bacterias verdaderas y comprende las bacterias ms comunes que habitan en el cuerpo de los seres vivos, suelo, aire y agua e incluye las Cianobacterias o algas verdeazules, con capacidad de realizar fotosntesis. Poseen adems de la clorofila un pigmento azul llamado ficocianina. Las cianobacterias se utilizan como indicadoras de polucin orgnica. Las bacterias o eubacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Son procariotas, unicelulares de organizacin muy sencilla. Se estima que existen unas 1700 especies El segundo grupo lo llam Arqueobacteria o Arquea e incluye las bacterias que pueden crecer en condiciones extremas como los hielos antrticos psicrfilas, o en aguas muy hirvientes son las arqueas llamadas termfilas extremas, o las que habitan en medios anaerobios, con pH muy cido, las bacterias productoras de gas metano y las que se desarrollan en medios salinos o sea las halobacterias. Algunas arqueas son habitantes del intestino del hombre y animales

Caractersticas de las Arqueas Forma de las Arqueas Presentan formas similares a la de las bacterias verdaderas: esfricas, individuales o en grupo, bacilares, filamentosas, lobuladas Estructura de Arquea Pared Celular semejante a la pared celular de las bacterias gram negativas. Formada por formada por lpidos, protena o glicoprotena a diferencia de la pared celular de peptidoglucano de las eubacterias. La pared presenta simetra hexagonal y adquiere diferentes morfologas como respuesta a los diferentes ambientes en los cuales se desarrolla. Membrana Plasmtica puede presentar invaginaciones o mesosomas parecidos a los de las bacterias gram positivas. Carecen de cidos grasos y en su lugar tienen cadenas laterales compuestas de unidades repetitivas de isopreno unidas por enlaces ter al glicerol que constituyen el glicerolditer cuando se distribuyen a manera de bicapa y el gliceroltetrater cuando es a manera de monocapa, este ltimo arreglo es muy estable


a temperaturas altas por lo tanto, no es una sorpresa que se encuentre principalmente en las arqueas termoacidfilas. Protoplasma (citoplasma), separado en cromoplasma (perifrico y pigmentado) y centroplasma (central, granuloso e incoloro). Los pigmentos que se encuentran en el citoplasma son: clorofila a, c, carotenoides, phycoxantina, ficocianina C, de color azul, ficocianobilina, ficoeritrina C, de color rojo, ficoeritrobilina entre otros. Nucleoplasma contiene el ADN puede aparecer en forma de pequeos grnulos, pueden aparecer granos de volutina, cianoficina y ribosomas. El ARN y enzimas de arqueobacterias son diferentes al de las bacterias verdaderas. Las arquebacterias presentan adems mecanismos de defensa contra las condiciones extremas que podran afectarlas. Por ejemplo ellas fabrican una variedad de molculas y enzimas protectoras. Las arqueas que viven en medio ambiente altamente cidos, poseen en su superficie celular unas molculas cuya funcin es ponerse en contacto con el cido para evitar tomado de: http://www.latinoseguridad.com/ que penetre en la clula y as evitar que el ADN LatinoSeguridad/Fenat/Arqueas.shtml se destruya. Las arqueas halfilas toman del exterior sustancias como el cloruro de potasio para equilibrar el interior de la clula y evitar que el agua salada penetre y destruya la clula. Se pueden encontrar en algunos tipos de alimentos en los que se han utilizado altas concentraciones de sal (salmueras) para su preservacin como es el caso de pescados y carnes, en donde se reconoce su presencia porque forman manchas rojas. Las arqueas obtienen energa a partir de compuestos como hidrgeno, dixido de carbono y azufre. Algunas lo hacen a partir de la energa solar a travs de la bacteriorodopsina, un pigmento que reacciona con la luz y permite que la arqueobacteria fabrique el ATP. Eubacterias - Las cianobacterias Las cianobacterias conocidas comnmente como algas verde-azuladas por su color verde-azulado (a veces rojizo, pardo o negro). Se caracterizan por que son procariotas (sin ncleo verdadero), auttrofos (fundamentalmente). Unicelulares, tamao entre 1 m hasta varios micrmetros.


La reproduccin en las cianobacteriaas puede ser asexual, por biparticin, o por fragmentacin de filamentos Algunas experiencias parecen confirmar que existen fenmenos que implican la recombinacin de material gentico, al igual que en las bacterias. Los gneros Oscillatoria, Spirulina y Rivularia presentan movimiento

Importancia biolgica de cianobacterias http://www.eez.csic.es/~olivares/ciencia/fijacion/cianobacterias.htm Las cianobacterias son organismos antiguos que se caracterizan por conjugar el proceso de la fotosntesis oxignica con una estructura celular tpicamente bacteriana. Al ser responsables de la primera acumulacin de oxgeno en la atmsfera, las cianobacterias han tenido una enorme relevancia en la evolucin de nuestro planeta y de la vida en l. En la actualidad presentan una amplia distribucin ecolgica, encontrndose en ambientes muy variados, tanto terrestres como martimos, e incluso en los ms extremos, siendo la fotoautotrofia, con fijacin de CO 2 a travs del ciclo de Calvin, su principal forma de vida, y contribuyendo de manera importante a la productividad primaria global de la Tierra. En relacin con esto, es tambin relevante el hecho de que muchas cianobacterias sean capaces de fijar el nitrgeno atmosfrico, siendo, a su vez, capaces de hacerlo en condiciones de aerobiosis (de hecho, ciertas cianobacterias representan los mayores fijadores en amplias zonas ocenicas contribuyendo de forma importante a la cantidad total de nitrgeno fijado en vida libre). Cianobacterias y fijacin de nitrgeno

La existencia conjunta de la fotosntesis y de la fijacin de nitrgeno ha requerido el diseo de estrategias que hagan posible el funcionamiento de ambos procesos antagnicos desde el punto de vista de sus requerimientos ambientales. Entre tales estrategias la separacin en el tiempo o en el espacio de ambas funciones permite el desarrollo normal de la clula en condiciones de bajos niveles de nitrgeno combinado. En este sentido, merece particular mencin la capacidad de algunas especies filamentosas de desarrollar unas clulas llamadas heterocistos, enormemente especializadas en la fijacin del nitrgeno en ambientes aerbicos. Los heterocistos son clulas especializadas, distribuidas a lo largo o al final del filamento (cianobacterias multicelulares filamentosas), los cuales tienen conexiones intercelulares con las clulas vegetativas adyacentes, de tal manera que existe un continuo movimiento de los productos de la fijacin de nitrgeno desde los heterocistos hacia las clulas vegetativas y de los productos fotosintticos desde las clulas vegetativas hacia los heterocistos (Todar, 2004).


Las bases moleculares del proceso de diferenciacin de los heterocistos y el establecimiento del patrn de distribucin de los mismos en el filamento cianobacteriano constituyen uno de los campos ms activos en el estudio actual de las cianobacterias y, asimismo, representa un modelo simple de establecimiento de patrones espaciales de diferenciacin cuyo estudio puede abordarse con la gran variedad de herramientas desarrolladas para el anlisis gentico-molecular de las cianobacterias, que incluyen la construccin de especies y la disponiblidad de la secuencia completa de los genomas de varias de ellas. Muchas cianobacterias, por ejemplo, Anabaena azolla juegan un papel importante en el desarrollo de cultivos como el arroz. Anabaena azollae , en simbiosis con helechos , proporciona hasta 50 kg de nitrgeno/ha siendo la utilizacin de este sistema fijador general en muchas regiones del sudeste asitico. (Con la contribucin de Antonia Herrero, Instituto de Biologa Vegetal y Fotosntesis, CSIC.) Las Bacterias o eubacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Son procariotas, unicelulares de organizacin muy sencilla.


Grfica Representacin esquemtica de una bacteria fuente: Carmen Eugenia Pia Lpez

El tamao microscpico de las bacterias est determinado genticamente, y depende de la cepa, de las condiciones ambientales (nutrientes, sales, temperatura, tensin superficial). La unidad de medida bacteriana es el micrmetro, que equivale a 1/1000 milmetros (10-3 mm) = 1 micrmetro). Para darse una idea de su tamao se calcula que en un centmetro cbico cabe alrededor de un milln de billones de bacilos de tamao medio. El rango en el tamao de las bacterias es muy variado, existen bacterias como las nanobacterias de aproximadamente un 0.05 m m, o bacterias de un tamao mayor


como Epulopiscium , un comensal del intestino del pez cirujano que mide 0.5 mm. Algunos micoplasmas tienen tamaos que oscilan entre 0.2 a 0.3 micrmetros (mm) de dimetro Escherichia coli habitante natural en el intestino humano mide aproximadamente 0.5 m m de ancho por 2 m m de largo. Las bacterias difieren en la forma, las hay esfricas u ovales llamadas cocos, alargadas cilndricas en forma de bastn se les denomina bacilos, en forma de espiral o helicoidal, los espirilos, en forma de coma las llamadas vibrios y algunas en forma cuadrada con lados y esquinas en ngulo recto. La forma de la bacteria puede ser modificada por las condiciones ambientales. Composicin Las bacterias estn constituidas por un 70% de agua y un 30% de materia seca, de esta materia seca el 70% corresponde a protenas, el 3% a ADN, el 12% a ARN, el 5% a azucares, el 6% lpidos y el 4% a minerales Estructura de las bacterias: Dentro de este grupo se encuentra la pared celular, los flagelos, esporas, fimbrias o pelos y cpsula. Estas estructuras no siempre se encuentran en todas las bacterias, por lo tanto se consideran variables, razn por la cual se estima que no son esenciales. La clula bacteriana consta de: * Pared celular: es una estructura rgida, se encuentra rodeando la membrana citoplasmtica de casi todas las bacterias, posee una gran rigidez lo cual le confiere gran resistencia. Se considera esencial para el desarrollo y divisin bacteriana; cumple con dos funciones importantes: mantener la forma de la clula y evitar que la clula colapse debido a las diferencias de presin osmtica por el constante intercambio de fluidos. El grosor de la pared de las bacterias oscila entre de 10 y 80 nanmetros. La pared celular constituye una porcin apreciable del peso seco total de la clula; dependiendo de la especie y de las condiciones de cultivo puede representar del 10 al 40 por ciento del peso seco del organismo. En las eubacterias la pared celular contiene peptidoglucano, compuesto que no se encuentra en las clulas eucariotas. En las bacterias gram- positivas se halla inmerso en una matriz aninica de polmeros azucarados, mientras que en las bacterias gramnegativas est rodeada por una membrana externa, e inmersa en un espacio periplsmico. El prefijo gram proviene de la tcnica de coloracin que se utiliza para la diferenciacin primaria del tipo de bacteria. Adems de los compuestos anteriores, se encuentran el cido diaminopimlico y cido teicoico * Membrana plasmtica la cual presenta invaginaciones, que son los mesosomas que contienen enzimas que participan en la duplicacin del ADN, en la membrana plasmtica se localizan tambin enzimas que intervienen en la produccin de energa (ATP), funcin que en la clula eucaritica cumple la mitocondria. * Los mesosomas son repliegues y extensiones de la membrana citoplasmtica, intervienen en procesos metablicos y de reproduccin de la clula bacteriana. * Citoplasma el cual presenta un aspecto viscoso, en l se encuentran: materiales de reserva , ARN, ribosomas, un nucleoide ubicado en su zona central donde se encuentra la mayor parte del ADN bacteriano en algunas bacterias se encuentran dispersos por el


citoplasma fragmentos circulares de ADN con informacin gentica llamados plsmidos y pigmentos fotosintticos en el caso de bacterias fotosintticas. En el citoplasma se realizan los procesos metablicos de la clula bacteriana * Ribosomas son organelos con apariencia de grnulos, algunos se hallan dispersos en el citoplasma bacteriano y otros s e agrupan en cadena y se les denomina polirribosomas; estn compuestos por cido ribonucleico - ARN (60%) y protena (40%). Su funcin es la sntesis de protena. *Los cuerpos de inclusin o grnulos son materiales de reserva como lpidos, hierro, azufre que se almacenan en el citoplasma, en los perodos de suficiente aporte nutricional para ser utilizados en pocas de inanicin *Las vesculas se encuentran en ciertas bacterias que habitan en lagos estas vesculas les sirven para flotar, contrarrestando la atraccin gravitatoria, y as lograr el ptimo de luz * La regin nuclear esta localizada centralmente en la clula, se compone principalmente de ADN aunque tambin puede encontrarse ARN y protenas asociadas a ste. El ADN esta dispuesto en un cromosoma largo y circular, algunas veces llamado nucleoide, genforo o cuerpo cromatnico. * Los plsmidos son pequeas molculas circulares de ADN extracromosmico, se encuentran en la regin nuclear de algunas bacterias. Las molculas de ADN plsmico a pesar de encontrarse fuera del cromosoma, toman una conformacin de doble hlice al igual que el ADN de los cromosomas. Los plsmidos se replican de manera independiente al cromosoma y contienen informacin gentica para la bacteria complementaria a la contenida en el nucleoide y que le es til para su supervivencia en condiciones desfavorables. Por ejemplo el cdigo que hace resistentes a las bacterias a los antibiticos, la capacidad de apareamiento, la resistencia y la tolerancia a los materiales txicos. Los plsmidos son muy utilizados en ingeniera gentica ya que por su tamao resulta fcil manipularlos; se pueden aislar, introducir en ellos informacin e introducirlos en otras clulas bacterianas viables en las cuales se expresa la informacin que ellos portan. * Flagelos presentes en la mayora de bacterias, generalmente son rgidos, implantados en la membrana celular mediante un corpsculo basal. Las bacterias que poseen flagelos tienen movilidad, o sea, el movimiento de traslacin de un punto a otro en forma rpida y de zig zag permitindoles responder a estmulos por ejemplo: qumicos cuando las bacterias son atradas a determinados compuestos como la glucosa, la galactosa y se denomina quimiotactismo positivo o por el contrario son repelidas de algunos compuestos como los antibiticos, quimiotactismo negativo, luminosos es el caso de las bacterias fotosintticas que tienen fototactismo positivo a los rayos luminosos. Los flagelos permiten a la mayora de bacterias la movilidad en medios lquidos, una excepcin son las bacterias deslizantes que se mueven por flexin de la pared celular. La movilidad debe distinguirse del movimiento pasivo de las bacterias en una sola direccin como consecuencia de las corrientes en la preparacin, o del movimiento


Browniano que es la constante vibracin de las bacterias en un punto fijo comportamiento que se presenta por estar suspendidas en medio lquido y por su pequeo tamao * Fimbrias o pili muy numerosos y cortos, se encuentran relacionadas con diversas funciones como la de adherencia a las superficies de tejidos, sitios de adsorcin para virus bacterianos y adems pueden servir como pelos sexuales para el paso de ADN de una clula a otra, no tienen funcin de motilidad * Cpsula es una estructura de material viscoso que rodea la pared celular de muchas bacterias que se encuentran en su ambiente natural. La cpsula no cumple ninguna funcin metablica pero sirve de proteccin, cuando una bacteria encapsulada invade a un husped, la cpsula evita que los mecanismos de defensa del husped destruyan la bacteria, permite la adhesin de bacterias hermanas para la formacin de colonias, igualmente permite a las bacterias adherirse a sus sustratos. * Endosporas Son estructuras generalmente de forma esfrica que se forman en ciertas bacterias gram positivas como respuesta a condiciones ambientales adversas (poca humedad, temperaturas extremas, agentes qumicos y fsicos etc.). Cuando las condiciones ambientales vuelven a ser favorables la endospora se transforma de nuevo a la forma vegetativa. Ciertas formas filamentosas pueden producir la endospora en el extremo del filamento y aparecen de manera libre, en otras bacterias como Clostridium se pueden observar en el interior de las bacterias a las que deforman de una manera caracterstica, lo que sirve para su identificacin

Reproduccin Generalmente las bacterias se reproducen asexualmente por fisin binaria o biparticin, unas pocas por gemacin, algunas especies de bacterias filamentosas se reproducen por esporas que se forman en los extremos de los filamentos. Durante la biparticin la clula bacteriana origina dos clulas iguales o clones. Este mecanismo de divisin celular es ms rpido y menos organizado que la mitosis y la meiosis. El resultado de la fisin binaria son dos clulas hijas por cada clula madre, as, una clula se divide en dos, dos en cuatro y cuatro en ocho y as sucesivamente La sntesis de la pared, el crecimiento bacteriano y la duplicacin del ADN regulan la divisin celular. La bacteria da lugar a dos clulas hijas. La divisin empieza en el centro de la bacteria por una invaginacin de la membrana citoplasmtica que da origen a la formacin de un septo o tabique transversal. La separacin de las dos clulas va acompaada de la segregacin en cada una de ellas de uno de los dos genomas que proviene de la duplicacin del ADN materno El proceso de divisin ocurre en tres fases principales: Elongacin o alargamiento de la clula y duplicacin del material gentico o ADN, separacin de ADN dentro de las clulas hijas formadas y la citocinesis o separacin celular.


El proceso se inicia con la duplicacin del ADN, luego la pared celular y la membrana plasmtica forman un tabique que divide la clula bacteriana en dos como se ve en el siguiente esquema:

Grfica Representacin reproduccin de una bacteria fuente: Carmen Eugenia Pia Lpez Sinembargo en algunos ocurren intercambios genticos como resultado de conjugacin, transformacin, transduccin e intercambio de plsmidos.

Intercambio gentico en bacterias Sinembargo en algunas bacterias ocurren intercambios genticos (intercambio de genes) como resultado de tres mecanismos: transformacin, conjugacin, transduccin e intercambio de plsmidos. Transformacin: Consiste en el intercambio gentico producido cuando una bacteria es capaz de captar fragmentos de ADN, de otra bacteria que se encuentran dispersos en el medio donde vive. Animacin sobre proceso de conjugacin


Conjugacin: En este proceso, una bacteria donadora F+ transmite a travs de un puente o pili, un fragmento de ADN, a otra bacteria receptora F-. La bacteria que se llama F+ posee un plsmido, adems del cromosoma bacteriano. Transduccin: En este caso la transferencia de ADN de una bacteria a otra, se realiza a travs de un virus bacterifago, que se comporta como un vector intermediario entre las dos bacterias. Nutricin Las bacterias pueden ser auttrofas o hetertrofas. Las auttrofas utilizan la luz del sol y el bixido de carbono o compuestos inorgnicos, por ejemplo, el azufre para fabricar su alimento. Las hetertrofas (por absorcin) pueden utilizar fuente de carbono orgnico para su alimentacin. Las bacterias pueden vivir como parsitos afectando los organismos donde habitan, como simbiontes formando parte de la flora bacteriana normal de la piel, cavidades y tracto digestivo del hombre y de los animales y saprofitas la gran mayora, ayudando a la descomposicin de la materia orgnica muerta. Profundizacin: http://www.fortunecity.com/victorian/rodin/667/biologia/microbio.html

Clasificacin de las Bacterias En la siguiente tabla se resumen algunos de los aspectos fundamentales en la clasificacin de las bacterias


Por forma Por ordenamiento


Por composicin de la pared celular que reacciona a la tincin de gram Gram negativas no retienen el cristal violeta conservan el colorante rojo por ejemplo safranina son susceptibles a las cefalosporinas Diplococo en parejas Gram positivas absorben y conservan el colorante cristal violeta son susceptibles a la penicilina y estreptomicina

Coco nico

Diplocococo en parejas

Coco (esfrico)

Estreptococo en cadena

Estafilococo en racimo de uvas

Sarcina grupo de ocho cocos Tetracoco Grupo de cuatro cocos


En forma de espiral



En forma de bastn

Otro aspecto a tener en cuenta en la clasificacin de bacterias es la necesidad de oxgeno para poder vivir, las bacterias que requieren de oxgeno para cumplir sus procesos vitales se denominan aerobias, mientras que las que viven en ausencia de oxgeno se llaman anaerobias. Nutricin Las bacterias pueden ser auttrofas o hetertrofas. Las auttrofas utilizan la luz del sol y el bixido de carbono o compuestos inorgnicos, por ejemplo, el azufre para fabricar su alimento. Las hetertrofas (por absorcin) pueden utilizar fuente de carbono orgnico para su alimentacin. Las bacterias pueden vivir como parsitos afectando los organismos donde habitan, como simbiontes formando parte de la flora bacteriana normal de la piel, cavidades y tracto digestivo del hombre y de los animales y saprofitas la gran mayora, ayudando a la descomposicin de la materia orgnica muerta. Utilidad de las bacterias Las bacterias son tiles: Para fijar el nitrgeno atmosfrico que es tomado por las plantas y luego trasferido a los animales. En la descomposicin la materia orgnica muerta ayudando de esta manera a la fertilizacin del suelo. En la produccin de algunos antibiticos. En la produccin de determinadas enzimas. En la elaboracin de productos lcteos como: queso, yogur , mantequilla En la produccin de vinagre. En la produccin de encurtidos. En la depuracin de aguas residuales. En el curtido de cueros.


La Echerichia coli ha sido manipulada genticamente para producir insulina

Enfermedades de origen bacteriano Las bacterias pueden ocasionar enfermedades, entre las bacterias ms perjudiciales tenemos: La causante del ttano en caso de heridas contaminadas con Clostridium tetani, bacteria que afecta el sistema nervioso causando rigidez muscular y la muerte La que ocasiona la gangrena gaseosa o putrefaccin de tejidos, rganos especialmente de las extremidades del hombre y de los animales siendo necesaria su amputacin. La bacteria contaminante es un Clostridium que penetra en heridas o puede ser trasmitida por la ingestin de aguas contaminadas. El bacilo de Koch o Mycobacterium tuberculosis que causa la tuberculosis cuando la persona enferma tose y en su esputo se libera el bacilo. El bacilo Salmonella typhi causante del tifo a travs de alimentos contaminados con excretas. El bacilo Corynebacterium diphtheriae que produce una infeccin del sistema respiratorio, la difteria, que adems lesiona el corazn y el sistema nervioso ocasionando la muerte. La espiroqueta Treponema pallidum. trasmisin sexual denominada sfilis. que produce una enfermedad de

La Brucella, bacteria que causa la brucelosis por contacto con ganado infectado, leche o carne contaminada y en la mujer provoca el aborto espontneo.

Profundizacin: http://www.ugr.es/~eianez/Microbiologia/programa.htm

Los Protozoos

Caractersticas y clasificacin


Son organismos microscpicos unicelulares, eucariticos, se encuentran en su mayora en medios acuticos, en el suelo hmedo aunque algunos son endoparsitos y otros ectoparsitos. La mayora son hetertrofos, sin embargo algunos son auttrofos. Se reproducen por divisin binaria (la clula se divide en dos) tienen capacidad de locomocin o desplazamiento. Segn la forma como se desplazan los protozoos se clasifican en: sacordinos, ciliados, flagelados y esporozoos.

Se desplazan por medio de pseudpodos (falsos pies), que son prolongaciones de la clula que les sirven adems para capturar el alimento, englobarlo y formar una vacuola digestiva, donde el alimento es digerido por accin de enzimas.


Grfica Entamoeba histoltica, Tomada de: http://hpd.botanic.hr/bio/odgovori/odgovor315.htm Son representantes de este filo: - La ameba causante de infeccin del intestino o del hgado (amebiasis) por la ingestin de aguas o alimentos contaminados con heces. - La Entamoeba histoltica, que produce la disentera, enfermedad propia de los pases tropicales y que produce unas diarreas muy intensas. - Los foraminferos componentes del plancton (con un caparazn por cuyos orificios salen los pseudpodos) Ciliados

Grfica Paramecium Tomada de Biodidac http://http://personal.telefonica.terra.es/web/ayma/atlas_p.htm#Paramecium %20caudatum


Se desplazan y capturan el alimento por medio de cilios, filamentos cortos, vibrtiles y numerosos que rodean su cuerpo. Se caracterizan por ser los nicos organismos con dos ncleos uno para la reproduccin y otro relacionado con la alimentacin. Ejemplos de este filo son: el Paramecio, la Vorticela, el Balantidium coli parsito del intestino del hombre causante de inflamacin del intestino.

Para moverse utilizan unos filamentos largos y poco numerosos, llamados flagelos. Muchos son de vida libre y otros son parsitos, como el Tripanosoma, que produce la enfermedad del sueo. El tripanosoma es transportado por la saliva de la mosca tsts, que contagia al picar a otros seres vivos.

Grfica No: 46 Tripanosomas en sangre Tomada de Biodidac. http://www.irabia.org/web/ciencias/microbiologia/microbios/protozoo.htm


Grfica. Plasmodio falciparum Tomada de: http://www.cdc.gov/malaria/spotlights/index_100504.htm


Carecen de rganos de locomocin son parsitos de clulas del hombre y de los animales Se reproducen por divisin mltiple, formando numerosas esporas. Un representante es el Plasmodio, que produce la malaria, tambin llamada paludismo. El Plasmodium hembra infecta los glbulos rojos causndoles su ruptura. El vector que transmite la infeccin es el mosquito Anopheles que al picar a la persona le inyecta con su saliva el esporozoito. Importancia Biolgica Los protozoos tienen importancia en las cadenas alimentarias como componentes del plancton Profundizacin: http://www.alaquairum.com/generalidades_protozoos.htm

Principales caractersticas Son organismos auttrofos, todas poseen clorofila y algunas poseen otros pigmentos que pueden enmascarar la clorofila, son eucariticas con pared celular, habitan en medio acutico, ambientes hmedos y pertenecen al reino de los Protistos. La mayora de algas son unicelulares como las algas doradas o diatomeas, otras como las algas verdes y las rojas son multicelulares. Pueden vivir solitarias o en colonias. Ejemplo de algas verdes tenemos: el volvox, y la spirogyra. Su reproduccin puede ser sexual y asexual: por fisin binaria o por produccin esporas.

Grfica 48. Alga Closterium Tomada de http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos


Grfica 48. Alga Spirogyra Tomada de http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos Importancia biolgica Representan un importante eslabn en la cadena alimentaria, formando parte del plancton (productores primarios). Son productoras de oxgeno tiles en la elaboracin de frmacos Las algas rojas son importantes en la formacin de arrecifes de coral pues viven en simbiosis con los corales brindndoles carbonato de calcio y suministrndoles el color rojo brillante Algunos grupos de algas rojas se utilizan en la produccin de Agar que es un medio de cultivo microbiolgico. Las algas marinas son una importante fuente alimenticia.

Caractersticas Los hongos son organismos unicelulares como las levaduras o pluricelulares como los hongos filamentosos. Los hongos presentan pared celular compuesta de quitina que es un polisacrido estructural que tambin se encuentra en el exoesqueleto de los artrpodos. Habitan en ambientes hmedos y oscuros por ejemplo sobre el suelo, las frutas el pan, el queso, las plantas.


Grfica hongo del tomate Tomada de: http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos Su tipo de nutricin es la hetertrofa, algunos son parsitos de organismos vivos como plantas, animales y el hombre, a quienes pueden ocasionar enfermedades, otros son saprfitos es decir se alimentan de materia orgnica en descomposicin y hay hongos que crecen en simbiosis con las races de algunas plantas formando las micorrizas. Los hongos pluricelulares forman una serie de filamentos denominados hifas; el conjunto de hifas forman un micelio. Existen tres tipos de hongos: Las setas formadas por un pie y una sombrilla como el champin, las levaduras que son unicelulares y los mohos que presentan un aspecto de pelusa. Reproduccin Las levaduras se reproducen por gemacin consistente en que a la clula madre le sale un botn o gema que poco a poco se va desprendiendo de ella dando origen a una levadura hija idntica a la madre. Los hongos filamentosos como el moho del pan, se reproducen de forma asexual, por esporas que al caer en el sustrato adecuado dan origen a nuevas hifas, en este tipo de reproduccin el ncleo de la clula madre se divide en varios ncleos, cada uno toma una parte del citoplasma de la clula madre que luego se rodea de una membrana celular, la clula madre se rompe y se liberan varias clulas hijas. Otro tipo de reproduccin asexual presente en los hongos es por fragmentacin del micelio. La reproduccin sexual es otra forma de reproduccin de los hongos.


Enfermedades causadas por hongos

En los animales los hongos pueden producir enfermedades graves en la piel y en los rganos, por ejemplo: El hongo Aspergillus afecta los pulmones y el sistema nervioso Las Micotoxinas son toxinas producidas por hongos txicos genticos (Aspergillus, Penicillium, Fusarium) que se desarrollan en los productos agrcolas. Candida albicans afecta a las aves causndoles la muerte, en el hombre afecta las mucosas de la boca, garganta y tracto genitourinario. Muchos hongos causan enfermedades en la piel del hombre y los animales. Algunas setas causan envenenamiento. Los hongos que contaminan los alimentos producen sustancias txicas que al ser consumidas por el hombre o los animales les causan enfermedades letales como la micotoxicosis. Las aflatoxinas producidas por ciertos hongos contaminantes de cereales y concentrados tambin causan enfermedades e inclusive la muerte. Muchos hongos causan enfermedades en la piel, uas y cuero cabelludo, por ejemplo la tia. Muchas enfermedades de las plantas son debidas a la presencia de hongos. Por ejemplo la roya. Importancia biolgica Los hongos no solamente causan enfermedades, sino que tambin son utilizados en procesos industriales por ejemplo: Del hongo Penicillium notatum se obtiene el antibitico penicilina Las levaduras se utilizan para la produccin de cerveza Algunos hongos son utilizados en la elaboracin de queso Roquefort y en la maduracin del queso Camembert Las enzimas de algunos hongos producen fermentacin alcohlica en los jugos de frutas proceso que se utiliza por ejemplo, para la elaboracin de vino a partir de jugo de uva. Algunos son comestibles como el champin. Profundizacin: http://www.ual.es/GruposInv/myco-ual/clados.htm


Capitulo 5 Sistemtica
Introduccin Debido a la gran diversidad de organismos en la naturaleza, los bilogos vieron la necesidad de utilizar un sistema de clasificacin que permitiera agruparlos por sus caractersticas macroscpicas y microscpicas comunes, por su similitud en las etapas de desarrollo, por su parecido en la composicin bioqumica, por su semejanza gentica, con el fin de estudiarlos y as entender su origen, su evolucin y las relaciones de parentesco entre s. La taxonoma o, mejor dicho, los taxnomos, son los que se encargan de poner algo de orden a la inmensidad de la vida, intentando averiguar las relaciones filogenticas existentes entre los distintos organismos. Para conseguir esto se han ido creando una serie de categoras artificiales que no son sino simples entelequias mentales producto, una vez ms de nuestra mente compartimentalizadora, que busca esquemas lgicos que le permitan reducir la enorme diversidad existente a algo ms sencillo y, por ello, medianamente comprensible. Podemos hacer una excepcin a esto con la especie, que parece ser algo "natural", aunque sobre ello volveremos ms adelante


Taxonoma La taxonoma es una divisin de la sistemtica relacionada con la clasificacin de los organismos segn especializaciones. La Taxonoma proporciona los mtodos, principios y reglas para la clasificacin de los organismos vivos en taxones (grupos) a los que se les asigna un nombre y se los ubica dentro de categoras jerarquizadas. Las categoras consisten en grupos o niveles dentro de grupos en la que el grupo mayor abarca al menor. El agrupamiento de los organismos se basa en las semejanzas y diferencias tanto naturales (estructurales) como filogenticas (relaciones de parentesco o afinidades con otros organismos ya desaparecidos). La taxonoma proporciona informacin directa e inferida sobre la estructura del cuerpo y la historia evolutiva de los organismos respectivamente.


Las semejanzas estructurales de los organismos vivientes se conocen bien en su mayor parte. Pero los estudios de la historia evolutiva, para muchos de categora superior inclusive es incompleta. Frente a esta dificultad taxonmica, se ha intentado establecer sistemas de clasificacin alternativa, que muestren el grado actual de evolucin. Sistemas de clasificacin De Robert Whittaker (1969)

Grfica tomada de http://www.euita.upv.es/varios/biologia/images/Figuras_tema18/tema18_figura8.jpg El esquema filogentico presentado por Whittaker clasifica a los organismos vivientes en 5 reinos: Mnera, Protista, Hongos, Plantas y Animal. Esta clasificacin est basada en el tipo de organizacin celular: procariote y eucariote; en la forma de nutricin: auttrofa por fotosntesis o hetertrofa por absorcin; en la morfologa y bioqumica de los organismos sin incluir anlisis moleculares sin dar implicaciones evolutivas. Algunas caractersticas de estos reinos Mnera microorganismos procariticos (sin membrana nuclear), unicelulares, con tipo de nutricin por absorcin o fotosinttica, con reproduccin asexual, rara vez sexual, con locomocin por medio de flagelos o inmviles. Se encuentran en todos los medios. Pertenecen a este reino las bacterias y las cianobacterias.


Protistas microorganismos unicelulares, eucariticos (con membrana nuclear, mitocondrias y otros organelos) su tipo de nutricin es la absorcin, la ingestin, y la fotosntesis, pueden ser inmviles o desplazarse por medio de flagelos, su reproduccin se puede realizar por procesos asexuales o por procesos sexuales. Pertenecen a este reino los protozoos y las algas. Fungi (hongos) organismos eucariticos, en su mayora multicelulares, multinucleares, su nutricin es por absorcin, son inmviles, su reproduccin incluye ciclos asexuales y sexuales. Son representantes de este reino los hongos o mohos pluricelulares y las levaduras unicelulares. Plantae (plantas) organismos eucariticos, multicelulares, la mayora fotosintticos aunque algunos son simultneamente absortivos, inmviles con reproduccin sexual y asexual. Pertenecen a este reino, segn Witthaker, los vegetales superiores, las algas rojas, las algas pardas (Nota: actualmente se debe tener en cuenta que las algas se clasifican ms estrictamente como protistas), los helechos, los musgos. Algunas plantas, al evolucionar, aunque mantienen su condicin fotosinttica han adquirido una condicin semiparsita, por la cual parte de su nutricin la consiguen por absorcin a partir de otras plantas que perforan para absorberles ciertos nutrientes. Un ejemplo de este caso es el murdago. Algunas plantas insectvoras, adems de su condicin fotosinttica, tambin adquieren condicin complementariamente absortiva al tomar nutrientes absorbidos de los insectos que cazan. Animalia (animal) Organismos eucariticos, multicelulares, su nutricin es la ingestin y la digestin, reproduccin predominantemente sexual, pertenecen a este reino los animales invertebrados (artrpodos, no artrpodos) y vertebrados (mamferos, aves, reptiles, anfibios y peces). De Lynn Margulis (1985) A partir de la clasificacin de Whittaker surge la de Lynn Margulis-Schwartz basada en anlisis moleculares. Lynn Margulis desarrolla la Teora endosimbitica, su sistema de clasificacin presenta implicaciones evolutivas, es ms filogentico y tiene la ventaja de hacer grupos ms homogneos. Cambia el reino protistas por de PROTOCTISTAS, en el que incluye a protozoos, todas las algas (excepto cianofceas) y a los hongos inferiores. Su sistema de clasificacin comprende 5 reinos y 2 subreinos asi: Reino Prokaryotae o Monera Subreino: Archaebacteria Subreino: Eubacteria Reino Protoctista Reino Plantae Reino Fungi Reino Animalia


De Carl Woese (1990)

Grfica tomada de http://www.euita.upv.es/varios/biologia/images/Figuras_tema18/tema18_figura8.jpg Los trabajos de Carl Woese secuenciando cidos nucleicos descubri que dentro del grupo de los procariotas se haban incluidos organismos que, a nivel molecular, eran bastante divergentes, en 1990 planten la necesidad de separar todos los seres vivos en tres grandes dominios (categora por encima del reino): Eubacteria (o bacteria verdadera), Arqueobacteria o Archaea (que significa antiguo) y Eucarya. Los dos ltimos dominios (Archaea y Eucarya) estn ms prximos filogenticamente (siendo grupos hermanos, segn la terminologa cladista). Las arqueobacterias se diferencian de las eubacterias por la composicin de sus paredes celulares, su metabolismo y habitat. http://www.danival.org/100%20biolomar/4000notasbio/clas/clas_3_dominios.html Los Archaea son clulas Procariotas. Al contrario de Bacteria y Eucarya, tienen membranas compuestas de cadenas de carbono ramificadas unidas al glicerol por uniones de ter y tienen una pared celular que no contiene peptidoglicano. Mientras que no son sensibles a algunos antibiticos que afectan a las Bacterias, son sensibles a algunos antibiticos que afectan a los Eucarya. Los Archae tienen rRNA y regiones del tRNA claramente diferentes de Bacterias y Eucarya. Viven a menudo en ambientes extremos e incluyen a los metangenos, halfilos extremos, y termoacidfilos.


Bacteria (Eubacteria) Las Bacterias son clulas Prokariotas. Como los Eukarya, tienen membranas compuestas de cadenas de carbono rectas unidas al glicerol por uniones ster. Tienen una pared celular conteniendo peptidoglicano, son sensibles a los antibiticos antibacterianos tradicionales, y tienen rRNA y regiones del tRNA claramente diferentes de Archaea y Eukarya. Incluyen a mycoplasmas, cyanobacteria, bacterias Grampositivas, y bacterias Gram-negativas. Eukarya (Eukaryota) Los Eukarya (escrito tambin Eucaria) son Eukariotas. Como las Bacterias, tienen membranas compuestas de cadenas de carbono rectas unidas al glicerol por uniones ster. Si tienen pared celular, no contiene ningn peptidoglicano. No son sensibles a los antibiticos antibacterianos tradicionales y tienen rRNA y regiones del tRNA claramente diferente de Bacterias y Archaea. Incluyen a protistas, hongos, plantas, y animales. Los reinos "clsicos" no son ms que unas pequeas ramitas del gran rbol de la vida, aunque son las ramitas que mejor conocemos. Por ejemplo, el reino Animalia, es una de las ramas del dominio Eucarya. Categoras taxonmicas supraespecficas Las clasificaciones de los organismos son jerrquicas. Linneo trat de clasificar las especies conocidas en su tiempo (1753) para esto agrupo a los organismos en categoras. La clasificacin Linneana se bas en la premisa que la especie era la menor unidad de clasificacin y que cada categora o taxn se encuentra comprendida en una categora superior. Las categoras taxonmicas bsicas o taxones son 8, cuando se requiere mayor precisin se recurre a otras categoras secundarias como: subespecie, superfamilia, infraorden Los taxones anteriormente mencionados y ordenados del ms amplio al menos amplio (en negrita las principales), son: Reino Filo Superclase Clase Subclase Superorden Orden Suborden Infraorden


Superfamilia Familia Subfamilia Tribu Subtribu Gnero Subgnero Especie Subespecie Como se puede comprobar en este esquema de categoras enlazadas, un gnero sera un conjunto de especies relacionadas por criterios de parentesco; una familia sera un conjunto de gneros relacionados, un orden un conjunto de familias, una clase un conjunto de rdenes y un filo un conjunto de clases, todo esto guiado por nuestros conocimientos en evolucin, ya que se pretende que la clasificacin se asemeje lo ms posible a la filogenia de los distintos organismos. La especie es la nica unidad que existe en la naturaleza, las dems categoras son creadas artificialmente. La unidad bsica para clasificar los seres vivos es la especie.

Grfica Categoras supraespecficas Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm


Grfica Categoras supraespecficas Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm Clave taxonmica Para facilitar la determinacin y ubicacin taxonmica de los seres vivos los taxnomos utilizan una serie de claves, una de las ms utilizadas es la dicotmica en la cual las caractersticas tenidas en cuenta tienen 2 opciones de seleccin. Por ejemplo: a) ausencia de pelo b) presencia de pelo; a) esqueleto seo b) esqueleto cartilaginoso; a) poseen exoesqueleto, b) Cuerpo blando El concepto de especie A uno le podra parecer que, ya que todo bilogo, sea cual sea su campo de estudio, debe trabajar de algn modo con especies, se debera tener claro en todo momento que cosa es una especie. Sin embargo esto dista mucho de ser as. Se han ido dando, a lo largo de la historia, numerosos conceptos de especie, todos ellos vlidos en el momento en el que fueron enunciados, pero que han ido quedando desfasados por paso del tiempo o estn actualmente en discusin. A continuacin se enumeran una serie de definiciones para dicho concepto (las tres ltimas tomadas en parte de Casares, (1998), que reflejan el pensamiento que en cada momento se tena, no slo sobre lo que era una especie, sino tambin sobre la vida en general. El concepto morfolgico de especie fue el que se us hasta que la evolucin y se convirti en el paradigma cientfico en el que se basa la Biologa actual.


Este concepto postula que las especies se pueden definir con base en unos caracteres taxonmicos tipo, que representan la esencia de cada especie; por tanto, basta con tomar un ser vivo, describirlo tal y como se nos presenta, y todos los que concuerden con esa descripcin sern de su misma especie, siendo de distintas especies aquellos que difieran. En este contexto, la variacin intraespecfica no es ms que un distractor antes de llegar a la esencia de la especie. Por desgracia, este criterio, que debera haber sido ya totalmente relegado a la Historia de la Ciencia, sigue vigente en los trabajos de algunos taxnomos (algo que ellos negaran rotundamente), que ante la mnima diferencia con el ejemplar tipo, describen nuevas subespecies y/o especies, con lo cual slo consiguen enredar las relaciones interespecficas y dificultar el estudio de los distintos grupos. El concepto nominal de especie, que tuvo en Darwin a uno de sus mximos defensores, postula que no existen las especies, solo los individuos concretos, y que la especie no es ms que una abstraccin hecha "para entendernos", contingente al momento actual y carente de significado en el tiempo. Sin embargo, a la hora de enfrentarse a la prctica cotidiana, los nominalistas describen especies no slo en el momento actual (algo que concordara con su concepto de especie) sino tambin en el registro fsil, algo no coherente con ese concepto. Actualmente este concepto parece descartado. El concepto biolgico de especie; enunciado por Mayr en 1963, que la define como el "conjunto de poblaciones que real y potencialmente pueden reproducirse entre s, pero que estn aisladas de otros grupos similares", est basado en el "aislamiento" entre especies, algo muy aceptado en teora pero con numerossimas excepciones en la prctica. Presenta adems problemas con especies de distribucin espacial o temporal amplia, y con organismos de reproduccin asexual. El concepto de reconocimiento de especie, enunciado por Paterson en 1985, que la define como el "conjunto de individuos y poblaciones que comparten un mismo sistema de fertilizacin", es decir, de reconocimiento entre individuos de distinto sexo y de compatibilidad entre los genes aportados por cada uno. Bastante similar al anterior, presenta los mismos inconvenientes. El concepto evolutivo de especie, que la define como el conjunto de poblaciones que comparten un destino evolutivo comn a lo largo del tiempo. Consigue soslayar los problemas de las definiciones anteriores, pero presenta uno nuevo: qu se entiende por destino evolutivo comn a la hora de considerar organismos vivos? Convencin prctica Para efectos prcticos se puede adoptar convencionalmente la siguiente definicin tomada de Nelson G. (2000) Una especie es una poblacin con aislamiento reproductivo, que se reconoce por caracteres morfolgicos particulares y que ocupa un rea geogrfica definida.


Como de una forma ms o menos implcita insinubamos antes, cualquier tipo de estudio en Biologa, debe tener una cierta base taxonmica. Si no sabemos el nombre de los animales o de las plantas con que trabajamos, nos resultar bastante difcil sacar algo en claro de nuestros estudios. Una vez que agrupamos a los organismos por especies, se nos presenta el problema de qu nombre ponerle a cada especie, para poder hacer referencia a ella ms adelante. Al principio se intent dar nombres vulgares a todas las especies, o se las intent describir abreviadamente mediante una frase que resaltara sus caractersticas ms conspicuas. Tras varios intentos de varios autores, se acab aceptando el sistema binomial de Linneo, establecido en su obra Systema Naturae, cuya dcima edicin (1758) sirve como punto de partida. Este sistema asigna a cada especie un nombre compuesto de dos palabras. La primera palabra corresponde al nombre cientfico del gnero y se escribe la primera letra con mayscula y en cursiva , mientras que la segunda palabra es el epteto especfico y corresponde a la especie, la cual se escribe tambin en minsculas y en cursiva, por ejemplo, el nombre cientfico para el hombre es: Homo sapiens. El nombre cientfico esta escrito en latn para permitir la comunicacin universal. Si se escribe a mano en cursiva, entonces el nombre cientfico se subraya. En el caso de que todo el texto circundante est escrito en cursiva, el nombre cientfico se escribe normal. Generalmente la comunidad acadmica dedicada al estudio de determinado reino de especies biolgicas utilizan algunos protocolos particulares para el proceso de nomenclatura. Por ejemplo, en el caso de que haya subespecie, sta se escribe a continuacin de la especie, tambin en cursiva y sin ninguna palabra intercalada, hecho este que diferencia el Cdigo Internacional de Nomenclatura Zoolgica (CINZ) del Cdigo Internacional de Nomenclatura Botnica, en el que aparece la abreviatura subsp. intercalada. Segn el CINZ, no tienen validez los txones infrasubespecficos. Por ejemplo, el nombre cientfico del pez Aphyosemion bivittatum hollyi, el primer nombre corresponde al gnero, el segundo a la especie y el tercero a la subespecie Tras el nombre del taxn especfico se incluye el nombre del autor y el ao en que fue descrito por primera vez, Por ejemplo, Poecilia reticulata Peters, 1859. Si la planta o animal ha cambiado de nombre se pone entre parntesis el nombre anterior en letra no cursiva, pero el nombre del autor que lo describi sigue vigente .


En el ejemplo anterior, el pez fue denominado por Peters. Lebistes (gnero) entonces se escribe Poecilia reticulata (Lebistes), Peters, 1859. Los nombres cientficos revelan datos interesantes, no slo sobre la especie en cuestin, sino tambin sobre el cientfico que la describi. As abundan los nombres cientficos referidos a personajes de la mitologa grecorromana, sobre todo en Lepidpteros. Por ejemplo, dentro de la familia de los Papilinidos, nos encontramos con Iphiclides podalirius y Papilio machaon, dos bellas mariposas cuya similitud nos recuerda Linneo al ponerles los nombres de dos mdicos homricos. El estudio de estos nombres cientficos nos puede proporcionar, como mnimo, unos ratos muy interesantes. En el mundo de los insectos las clasificaciones de especies nuevas son difciles y, muchas veces extenuantes, de lo que dan fe Stroudia difficilis, Paravespa gestroi problemtica y Bombus perplexus. Estaran tambin los nombres puestos por entomlogos sin ninguna imaginacin como Coeleumenes secundus, Leptochilus tertius, Eudynerus nonus (sinonimizado con E. octavus, para desesperacin de los matemticos). Naturalmente en la Entomologa tambin existe el peloteo, la egolatra y el autobombo, del que podra dar fe el lepidptero Cartwrightia carwrighti cuyo autor, un tal Carwright, justific la semejanza con su nombre alegando que haba dedicado el nombre genrico a su padre y el especfico a su hermano. Pero sin duda alguna el caso ms alarmante sera el protagonizado por Embrick Strand; en una revista dirigida por l mismo, y dentro de unos tomos dedicados al editor de la revista, que casualmente tambin era l, apareci un artculo firmado por un tal Jan Obenberger en el que se describan 92 nuevas especies de colepteros, de las cuales 50 llevaban en alguna parte de su nombre cientfico un apelativo a Strand, ya usando su nombre, su apellido, ambos o una derivacin de ellos. Pero no todos los entomlogos han de ser eglatras, sin imaginacin o expresar sus frustraciones a la hora de clasificar insectos; tambin hay sitio para el amor. Un ejemplo de esto seran las araas Ochisme y Marichisme (Kirkaldy), aunque desde luego, ignoramos el romanticismo que pueda despertar una araa. La construccin de rboles filogenticos Uno de los objetivos de la sistemtica es la filogenia o sea la clasificacin de las especies teniendo en cuenta sus relaciones de parentesco. La construccin de rboles filogenticos, representa hiptesis evolutivas y trata de definir grupos monofilticos (ancestro y descendientes)


Para construirlos, se deben tener datos que provienen de las caractersticas usadas en la clasificacin. Mtodos de clasificacin Existen muchos mtodos de clasificacin, segn la manera en que evalan ciertos caracteres, entre ellos a. El tradicional o evolucionista, b. La fentica o taxonoma numrica y c. La cladstica o filogentica a. El tradicional o evolucionista Los criterios usados en la sistemtica tradicional enfatizan en tanto el antecesor comn (monofilsis), como en el peso de la divergencia entre grupos Los organismos se agrupan en especies teniendo en cuenta: La utilizacin del concepto biolgico de especie, basado en propiedades biolgicas (la comunidad reproductiva) La utilizacin de caracteres morfolgicos y no morfolgicos y la necesidad de valorar adecuadamente (con mtodos estadsticos si es necesario) la variabilidad. La necesidad de ponderar similitud morfolgica y parentesco filogentico en caso de conflicto Sin embargo si tomamos como ejemplo la agrupacin lagartos, cocodrilos, y aves como se observa en la grfica

Grfica Determinacin de grupo monofiltico por ancestro comn Tomada de:


http://www.ciencias.uma.es/departamentos/bioanimal/sfonline/sistematicafilogenetica /tema_1.htm Por su parecido entre s (caracteres morfolgicos) los lagartos y cocodrilos se agrupan en un taxn Reptiles segn la clasificacin tradicional. Pero si tenemos como criterio el parentesco filogentico, es decir, la proximidad de los ancestrales comunes, aves y cocodrilos son ramas derivadas de un linaje comn ( lnea naranja ) y por lo tanto, comparten un mayor grado de parentesco y se agrupan en un taxn que se ha denominado "Arcosaurios", desde el punto de vista de la clasificacin cladista. En conclusin al tomar en cuenta ambos criterios: similitud de caracteres morfolgicos y parentesco filogentico, como lo hace la clasificacin tradicional o evolucionista, puede presentarse conflicto en la agrupacin y se requiere tomar el sistema de clasificacin ms apropiado para ponderar el peso de los caracteres. b. Fentica o taxonoma numrica Agrupa a los organismos estrictamente por el nmero de caracteres que tienen en comn (similitud morfolgica) y los cuantifica en ndices de similitud o de distancia. Dichos ndices reflejan el parecido global entre los taxones. Estos procedimientos se basan en el uso de matrices en las que se incluyen valores numricos de determinados atributos de las unidades a agrupar, unidades llamadas OTUs (de operative taxonomical unity) que pueden ser individuos, muestras de poblaciones o especies, etc. Los atributos pueden ser medidas, proporciones, recuentos semicuantitativos (por ejemplo: 0=ausencia, 1=presencia). o caracteres

La idea es que cuanto ms similares sean dos OTUs, menor ser la diferencia global entre los valores de sus atributos. De esta forma se pueden definir ndices de distancia fentica, como por ejemplo la media cuadrtica de las diferencias entre cada par de atributos. En el caso de identidad total entre dos OTUs dicho ndice valdra 0, y ser mayor cuanto ms disimilares sean los OTUs.


c. Cladstica y Cladogramas



La cladstica es un tipo de sistemtica desarrollada por Willi Hennig, tratando de conseguir un mtodo mas objetivo de clasificar organismos En sistemtica filogentica o cladistica se agrupan los organismos en los taxones exclusivamente en funcin de su grado de parentesco filogentico, es decir, en funcin del orden relativo de sus ancestrales comunes. Dado que los taxones estn compuestos por organismos emparentados (descendientes por tanto de un ancestral comn a todos ellos) todos los taxones, todas las unidades de clasificacin, debern ser estrictamente monofilticos. Una agrupacin no monofiltica, no formada por todos y cada uno de los descendientes de un ancestral comn, no puede ser constituida como taxn

Grfica: Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm En la grfica anterior, el criterio o carcter huevo con amnios se usa para unir al grupo de aves, reptiles y mamferos que por compartir este carcter primitivo se deduce que tienen un antecesor comn. La caracterstica presencia de plumas y el pelo para separar aves y reptiles de mamferos en el caso de clasificacin tradicional, no es un factor en las hiptesis cladsticas, o cladograma, dado que son caracteres nicos en un taxn del grupo. Una de las aplicaciones ms interesantes de la cladstica es la cuestin de los pandas. En un principio se pens que el oso menor era un oso, pero por sus caracteres cercanos a los mapaches hizo que se los colocara cercanos a ellos. El panda menor vive en la misma regin de China que el panda gigante pero tiene grandes similaridades con los mapaches, mientras que los estudios de hibridizacin de ADN sugieren que el panda gigante esta en el clado de los osos y el panda menor en el clado de los mapaches. Ambos comparten un antecesor comn, como lo indica los caracteres derivados o evolutivos que comparten, adems de los otros caracteres derivados de la evolucin convergente (adaptaciones a su nica fuente de energa: el bamb).


Grfica Divergencia de antecesor comn Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm La grfica muestra esta divergencia del antecesor comn, e intenta adems mostrar el tiempo al cual ocurri esa divergencia. Un interesante y ameno relato respecto al tema de s las aves se originan o no de los dinosaurios se encuentra en Investigacin y Ciencia, El origen de las aves y su vuelo, K. Padian y L.M Chiappe, 1998. Profundizacin:Curso intercativo de sistemtica http://www.ciencias.uma.es/departamentos/bioanimal/sfonline/sistematicafilogenetica /indice.htm


UNIDAD 2. GENTICA Capitulo 1 La informacin Gentica

Introduccion El trmino gentica, introducido por Bateson en 1.906, se refiere al estudio de la transmisin de la informacin de caracteres entre padres e hijos a travs de los cromosomas, mediante unidades hereditarias denominadas genes. Los caracteres son fsicos, comportamentales y fisiolgicos. Es as como todas las caractersticas que identifican a un organismo han sido heredadas, es decir, provienen de la informacin gentica contenida en los gametos masculino, el espermatozoide, y femenino, el vulo. Cromosomas En el proceso de divisin celular que se desarrolla en el ncleo de la clula, a partir de la cromatina se forman los cromosomas que son un par de estructuras longitudinales llamadas cromtidas unidas en un punto denominado centrmero. Diferenciacin de especies por nmero de cromosomas Cada especie tiene un nmero caracterstico de cromosomas en clulas somticas (o sea las de todo el cuerpo excepto las clulas sexuales). Ejemplo: el hombre posee 46 cromosomas en las clulas somticas, en el perro el nmero de cromosomas se eleva a 78, en el mosquito son 6, en el ciruelo 48, en el chimpanc 48, en el gato 38 y en la papa 48. Composicin qumica bsica de los cromosomas Incluye los siguientes elementos: cido desoxirribonucleico o ADN que es una doble cadena compuesta de: un azcar pentosa, la desoxirribosa; una base nitrogenada (adenina unida con timina, o citosina unida con guanina) y un grupo fosfato que une los azcares con las bases nitrogenadas conformando nucletidos. Tres nucletidos conforman un codn. Se requiere un promedio de mil codones para conformar un gen o sea la unidad responsable por la herencia de una determinada caracterstica del organismo. Histona que es una protena que al unirse con el ADN forma las nucleoprotenas, que configuran casi hasta el 90% de los cromosomas.


Grfica Estructura del ADN Tomada de: http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/adn.htm Funciones del ADN Almacenamiento codificado de la informacin gentica que determina las caractersticas futuras de la clula y de los organismos que se desarrollen a partir de dicha informacin. Replicacin de si mismo o sea elaboracin de una copia idntica del ADN. Sntesis de ARN Transferencia mediante el ARN (cido Ribonucleico) de la informacin gentica a las molculas que realizan la sntesis de protenas por intermedio de los aminocidos que son las unidades que forman las protenas.

Replicacin del ADN Para poder transmitir la informacin gentica codificada en el ADN este tiene que realizar una copia de s mismo antes de comenzar el proceso de divisin celular es decir durante la interfase. La replicacin se realiza en el ncleo de la clula y consiste en la separacin de las dos cadenas de polinucletidos del ADN (imaginese la apertura de una cremallera) y cada una se convierte en una matriz o plantilla para el montaje de una nueva cadena idntica de ADN a la que se haba separado.


Grfica replicacin del ADN Tomada de: http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/a dn.htm En este proceso los nucletidos de las dos cadenas que formaban el ADN, una vez separadas, atraen nucletidos complementarios previamente formados por la clula. Luego los nucletidos complementarios se unen con los de la plantilla mediante puentes de hidrgeno para formar la estructura de una nueva molcula de ADN, semejando los travesaos de una escalera en espiral. La enzima ADN polimerasa une los nucletidos complementarios que van encajando en la plantilla enlazando el grupo fosfato de uno con la molcula de azcar del siguiente. De esta manera se construye la cadena lateral complementaria de ADN. El resultado final es una nueva molcula de ADN con su estructura de doble hlice. El significado gentico de la replicacin es el de conservar la informacin gentica Animacin: http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/a dn.htm#animation Transcripcin o sntesis de ARN

n La transcripcin consiste en la sntesis de ARN tomando como molde ADN y significa el paso de la informacin contenida en el ADN hacia el ARN. La transferencia de la informacin del ADN hacia el ARN se realiza siguiendo las reglas de complementaridad de las bases nitrogenadas y es semejante al proceso de transcripcin de textos, motivo por el que ha recibido este nombre. El ARN producto de la transcripcin recibe el nombre de transcrito. En las bacterias la transcripcin y la traduccin tienen lugar en el citoplasma


bacteriano y al mismo tiempo, son simultneas. Sin embargo, en eucariontes la transcripcin tiene lugar en el ncleo y la traduccin en el citoplasma. La ARN polimerasa o enzima encargada de llevar a cabo la transcripcin toma como molde el ADN para sintetizar ARN y sigue las reglas de complementaridad, la A del ADN empareja con U del ARN, la G con C, la C con G y la T con A. Existen experimentos que demuestran que la proporcin (A+U)/G+C) del ARN es similar a la proporcin (A+T)/(G+C) del ADN.
A (de ADN) se complementa con U (de ARN) T (de ADN) se complementa con A (de ARN) G (de ADN) se complementa con C (de ARN) C (de ADN) se complementa con G (de ARN)

Las ARN polimerasas sintetizan ARN siempre en la direccin 5'P a 3'OH, decir el ARN producto de la transcripcin crece solamente en esta direccin. 2. Una secuencia del ADN, llamada promotor, le ordena a la clula comenzar a construir ARN mensajero, a partir del gen que le sigue.

Se transcribe para cada gen una de las dos hlices de ADN, (Asimetra de la transcripcin) la hlice que se toma como molde para producir el ADN se la denomina hlice codificadora o hlice con sentido y la otra hlice de ADN, la que no se transcribe, se la denomina hlice estabilizadora o hlice sin sentido. 3. Luego, cabeza y cola, se agregan al ARNm antes de dejar el ncleo.

4. El ARNm terminado puede ahora servir de molde para la correspondiente protena. Sintesis de protena


Genotipo La informacin gentica codificada que posee un organismo con relacin a un rasgo particular para transmitirla a la siguiente generacin, se conoce como genotipo. Fenotipo La apariencia o sea el aspecto externo de los individuos resultante de la herencia y su expresin durante el desarrollo en condiciones ambientales determinadas, se denomina fenotipo. Por ejemplo el color de la piel, del cabello, de los ojos, la estatura, la forma del cabello.


Los genes son pequeos segmentos de largas cadenas de ADN que determinan la herencia de una caracterstica determinada, o de un grupo de ellas. Los genes se encuentran localizados en los cromosomas en donde se disponen en lnea a lo largo de ellos. Cada gen ocupa en el cromosoma una posicin, o locus. El conjunto de genes se denomina genoma. Alelos Cada clula somtica posee dos cromosomas homlogos, esto quiere decir que para cada carcter o rasgo se cuenta con un par de genes que pueden tener la misma o diferente informacin.


De esta manera cada organismo contiene un gen de origen paterno y otro de origen materno. A este par de genes que determinan la expresin de una caracterstica o carcter particular se les llama alelos. Cuando ambos alelos son iguales se aplica el trmino homocigoto a los individuos que los poseen. En cambio, si los alelos son diferentes, el organismo es heterocigoto o hbrido. Cuando en un individuo heterocigoto slo uno de los alelos se expresa se le llama dominante y al otro que se mantiene oculto, se le conoce como recesivo. El alelo dominante para un carcter determinado se representa con una letra mayscula y su alelo recesivo para el mismo carcter, se representa con la misma letra pero minscula. Ejemplo: Para el carcter estatura alto o bajo el alelo dominante alto se representa con la letra mayscula A y el alelo recesivo bajo se representa con la letra a minscula Leyes de Mendel Despus de una serie de experimentos con arvejas verdes y amarillas, observando como se transmitan las caractersticas de los padres en varias generaciones, el botnico Gregor Mendel plante las leyes bsicas de la transmisin de la herencia. Durante sus observaciones Mendel encontr que las caractersticas o rasgos almacenados de manera codificada en los genes podan corresponder a caractersticas puras homocigotas o caractersticas hbridas heterocigotas, en este ltimo caso se trata de un par de caractersticas alternativas de las cuales una es dominante (o sea que es la que se manifiesta externamente en el organismo), y la otra es recesiva, o sea que no se manifiesta externamente, pero permanece en la dotacin gentica y puede hacerse visible en las siguientes generaciones. Con base en lo anterior Mendel formul las siguientes leyes: Ley de la Segregacin Cuando se aparean o cruzan organismos (fecundacin) que difieren en dos o ms caracteres, los factores (genes) que determinan cada carcter se distribuyen o segregan de manera independiente Ley de la Dominancia. Cuando se cruzan individuos que difieren slo en un carcter por ejemplo color de la semilla (dominante y recesivo para este determinado carcter), la primera generacin F1 ser semejante al progenitor que tiene el carcter dominante. En este caso se habla de cruces monohbridos


Ley de la distribucin independiente.

Cuando se cruzan progenitores con dos caracteres diferentes (ejemplo plantas puras es decir homocigotas con color de las semillas amarillo dominante AA y verde recesivo aa y forma de la semilla lisa dominante LL y rugosa recesiva ll), estos caracteres se trasmiten a la descendencia en forma independiente. En este caso se habla de cruces dihbridos. Esto se observa mejor mediante un cuadro de Punnet que permite visualizar las posibles combinaciones para los cruces de caracteres. Ejemplo: En los experimentos de Mendel se encontraron: plantas puras de arveja con semillas de color amarillo dominante, o sea que sus alelos eran idnticos y se pueden denominar convencionalmente AA plantas puras de arveja con semillas de color verde recesivas, las cuales denominaremos aa plantas hbridas o heterocigotas con semillas de color amarillo, Aa plantas puras de arveja con semillas lisas como caracterstica dominante, LL plantas puras de arveja con semillas rugosas como caracterstica recesiva, ll plantas hbridas o heterocigotas de arveja con semillas lisas, Ll

Aplicacin de las leyes de Mendel en la resolucin de problemas sobre cruces monohibridos Para aplicar el cuadro de punnet analicemos primero el caso del cruce de plantas homocigotas o puras de arveja con semillas amarillas dominantes AA y plantas puras con semillas verdes recesivas aa (caso de cruce monohbrido, o sea aplicado a un solo carcter en este caso color de la semilla)

Se elabora una tabla o cuadro con tres columnas y tres filas (cuadro de Punnet):


En las celdas horizontales de color negro, van los alelos o genes aportados por el padre (en este ejemplo el padre tiene un par de genes AA para el color de la semilla) pero cada gameto solo recibe un gen para ese carcter por parte del padre. Entonces se coloca un gen A por cada celda, o sea, un gen para la formacin de cada gameto en el cruce.

Esto se explica de acuerdo con la ley de la segregacin Un par de genes es segregado (separado) en la formacin de los gametos. En las celdas verticales negras se colocan los alelos o genes que aportar la madre a los gametos. De igual manera se cumple la ley de la segregacin. Entonces en cada celda se coloca un solo gen: Las celdas de color blanco corresponden a los gametos de los hijos que se formarn en el cruce donde se restablecer el nmero par de genes para cada gameto Ejemplo: Si se cruzan semillas homocigotas amarillas dominantes AA con semillas verdes homocigotas recesivas aa, o sea que tenemos el caso AA x aa En las celdas blancas se formarn los gametos resultantes del cruce o sea la combinacin o entrecruzamiento de los genes aportados por el padre y la madre para ese carcter (se combina el gen de la primera celda horizontal con el gen de la primera celda vertical). En este momento se restablece el nmero par de genes en lo gametos formados (uno de cada progenitor)


El resultado del cruce ser: Genotipo: 100 % Heterocigoto Aa Fenotipo: 100% Semilla de color amarillo. (Ser puede explicar por la ley de la dominancia: un gen del par determina la expresin fenotpica y enmascara al otro; El polen de la planta progenitora aporta a la descendencia un alelo o gen para el color de la semilla, y el vulo de la otra planta progenitora aporta el otro alelo para el color de la semilla; de los dos alelos, solamente se manifiesta aqul que es dominante (A), mientras que el recesivo (a) permanece oculto. Otro ejemplo. Si se toman semillas heterocigotas lisas Ll y se cruzan con semillas homocigotas rugosas ll. Ll x ll siguiendo el anterior procedimiento:

El resultado del cruce ser


Genotipo: 50 % Heterocigoto Ll Fenotipo: 50% semilla de forma lisa y 50% de semillas rugosas. Interpretacin de las leyes de Mendel - Ejemplos de Cruces Primera ley de Mendel o Ley de la uniformidad de la primera generacin filial (F1) o Ley de la Dominancia Cuando se aparean o cruzan organismos (fecundacin) de raza pura (homocigotos) para un determinado carcter, todos los individuos de la primera generacin son iguales. Ejemplo: Si se cruzan arvejas amarillas AA con arvejas verdes aa toda la F1 resultante del cruce ser Aa de color amarillo. Aparece aqu el concepto de Dominancia y Recesividad. Las arvejas amarillas AA son dominantes sobre las arvejas verdes aa recesivas. La primera generacin o F1 es fenotpicamente amarilla y genotipcamente heterocigota Aa
imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Codominancia: La primera ley de Mendel se cumple tambin para el caso en que un determinado gen de lugar a una herencia intermedia y no dominante, como es el caso del color de las flores del "dondiego de noche" (Mirabilis jalapa). Al cruzar las plantas de la variedad de flor blanca con plantas de la variedad de flor roja, se obtienen plantas de flores rosas. La interpretacin es la misma que en el caso anterior, solamente vara la manera de expresarse los distintos alelos
imagen tomada de http://www.biotech.bioetica.org/ap1.htm

La segunda ley de Mendel tambin llamada de la separacin o segregacin o disyuncin de los alelos


El experimento de Mendel: Mendel tom plantas procedentes de las semillas de la primera generacin del experimento anterior Aa y las poliniz entre s. Del cruce Aa x Aa obtuvo semillas amarillas y verdes en la proporcin 3:1. As pues, aunque el alelo que determina la coloracin verde de las semillas pareca haber desaparecido en la primera generacin filial, vuelve a manifestarse en esta segunada generacin. Interpretacin del experimento. Los dos alelos distintos para el color de la semilla presentes en los individuos de la primera generacin filial, no se han mezclado ni han desaparecido, simplemente ocurra que se manifestaba slo uno de los dos.
imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Cuando el individuo de fenotipo amarillo y genotipo Aa, forme los gametos, se separan los alelos, de tal forma que en cada gameto slo habr uno de los alelos y as puede explicarse los resultados obtenidos

Retrocruzamiento En el caso de los genes que manifiestan herencia dominante, no existe ninguna diferencia aparente entre los individuos heterocigticos (Aa) y los homocigticos (AA), pues ambos individuos presentaran un fenotipo amarillo. La prueba del retrocruzamiento, o simplemente cruzamiento prueba, sirve para diferenciar el individuo homo del heterocigtico. Consiste en cruzar el fenotipo dominante con la variedad homocigota recesiva (aa). Si es homocigtico, toda la descendencia ser igual, en este caso se cumple la primera Ley de Mendel. Si es heterocigtico, en la descendencia volver a aparecer el carcter recesivo en una proporcin del 50%

imagen tomada de http://www.biotech.bioetica.org/ap1.htm


Tercera ley de Mendel o de la herencia independiente de caracteres: Hace referencia al caso de que se contemplen dos caracteres distintos. Cada uno de ellos se transmite siguiendo las leyes anteriores con independencia de la presencia del otro carcter. El experimento de Mendel: Mendel cruz plantas de guisantes de semilla amarilla AA y lisa BB con plantas de semilla verde aa y rugosa bb(Homocigticas ambas para los dos caracteres Las semillas obtenidas en este cruzamiento eran todas amarillas y lisas, cumplindose as la primera ley para cada uno de los caracteres considerados, y revelndonos tambin que los alelos dominantes para esos caracteres son los que determinan el color amarillo y la forma lisa. Las plantas obtenidas y que constituyen la F1 son dihbridas (AaBb).

imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Segunda generacin filial F2 Se cruzan entre s plantas de la F1, teniendo en cuenta los gametos que formarn cada una de las plantas Los alelos de los distintos genes se transmiten con independencia unos de otros, ya que en la segunda generacin filial F2 aparecen guisantes amarillos y rugosos y otros que son verdes y lisos, combinaciones que no se haban dado ni en la generacin parental (P), ni en la filial primera (F1).

imagen tomada de http://www.biotech.bioetica.org/ap1.htm


imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Interpretacin del experimento: Los resultados de los experimentos de la tercera ley refuerzan el concepto de que los genes son independientes entre s, que no se mezclan ni desaparecen generacin trs generacin. Para esta interpretacin fue providencial la eleccin de los caracteres, pues estos resultados no se cumplen siempre, sino solamente en el caso de que los dos caracteres a estudiar estn regulados por genes que se encuentran en distintos cromosomas. No se cumple cuando los dos genes considerados se encuentran en un mismo cromosoma, es el caso de los genes ligados. Sntesis de protenas Animacin en Power Point http://www.cnice.mecd.es/eos/MaterialesEducativos/mem2001/biologia/citoplasma/or ganelas3.htm Para la sntesis de protenas se requieren: Subunidades ribosmicas pequeas y grandes


Cadena de ARN mensajero (ARNm), que es el portador de las instrucciones codificadas que especifican la secuencia de aminocidos ARN de transferencia (ARNt) Estos ARNt forman enlaces covalentes con los aminocidos, con los que forman aminoacil ARNt, mediante reacciones catalizadas por enzimas especficos. Esto significa que a cada ARNt le corresponde su propio aminocido. Cada ARNt contiene, adems, un anticodn que reconoce el codn del ARNm que corresponde al aminocido del que es portador. Todo este proceso de sntesis proteica o traduccin a partir de una molcula de RNAm, requiere que previamente se haya producido la transcripcin, mediante la cual a partir de una molcula de DNA se origina una de RNAm, que luego servir de "molde" para la sntesis de nuevas protenas. El proceso incluye las siguientes fases: Etapa 1: se fija un ARNm a la subunidad pequea. El sitio P de la subunidad ribosomal pequea queda ocupado por un ARNt de iniciacin, cuyo anticodn reconoce el codn triplete AUG, que codifica al aminocido metionina


Etapa 2: la subunidad ribosomal grande se fija a la subunidad pequea, y el ribosoma se desplaza a lo largo de la cadena de ARNm, en direccin desde 5' hasta 3', hasta que el siguiente codn queda alineado con el sitio A de la subunidad pequea Etapa 3: un nuevo aminoacil ARNt (es decir, un ARNt que lleva un aminocido) compara a su anticodn con el codn del RNAm; si concuerda, el ARNt se fijar sobre el sitio A

Etapa 4: los aminocidos en los sitios A y P forman un enlace peptdico - El ARNt del sitio P pasa su aminocido al ARNt del sitio A, que ahora tiene unidos sobre s a los dos aminocidos (proceso catalizado por la enzima peptidiltransferasa) Etapa 5: el ARNt desaminado deja libre el sito P, y el ARNm con sus dos aminocidos se mueve desde el sito A hacia el sitio P. Al mismo tiempo, el ribosoma se desplaza a lo largo de la cadena de ARNm hasta que el siguiente codn queda alineado con el sitio A de la subunidad ribosomal pequea Etapa 6: se repiten las etapas 3 a 5, con lo que se alarga la cadena polipeptdica hasta que se llega al codn de terminacin (que pueden ser tres: UAG, UAA o UGA), responsable de detener el proceso de traduccin


Etapa 7: cuando el sitio A de la unidad ribosomal pequea llega a un codn de terminacin, se fija en el sitio A un factor liberador, encargado de descargar a la cadena polipeptdica recin formada desde el sitio ARNt del sitio P hacia el citosol Etapa 8: el ARNt se libera desde el sitio P, el factor liberador se libera desde el sito A, y las subunidades ribosmicas grande y pequea se disocian del ARNm quedando libres en le citosol.

En definitiva, los ribosomas participan en la sntesis de las protenas que tendrn un destino u otro segn que sean formadas por ribosomas libres o por polirribosomas adheridos a las membranas del Retculo endoplasmtico rugoso


Capitulo 2 Biotecnologa http://www.agronort.com/informacion/abcbiotec/abcbio4.html El ADN sirve como molde para la sntesis del ARN
1. Una de las bases del ARN es diferente A (ADN) se complementa con U (ARN) T (ADN) se complementa con A (ARN) G (ADN) se complementa con C (ARN) C (ADN) se complementa con G (ARN) 2. Una secuencia del ADN, llamada promotor, le ordena a la clula comenzar a construir ARN mensajero, a partir del gen que le sigue.

3. Luego, cabeza y cola, se agregan al ARNm antes de dejar el ncleo.

4. El ARNm terminado puede ahora servir de molde para la correspondiente protena.

El Cdigo gentico Traduccin de ARN en protena

1. Cada tres bases en el ARN, forman un codn correspondiente a ciertos aminocidos.


2. La mayora de los aminocidos pueden ser codificados por mas de un codn. Aac. Aac. Cisteina Prolina Histidina Stop= UAA, UAG, UGA 3. Tambin hay codones, que ordenan a la maquinaria de la clula, detener la sntesis de la cadena proteica. 4. Todo este proceso es llevado a cabo por estructuras complejas, llamados ribosomas, junto con enzimas y molculas especiales de ARN. UGU,UGG CCU,CCC,CCA,CCG CAU,CAC codones

Construccin de una Protena: Traduccin del ARNm

1. Los ribosomas se mueven a lo largo del ARNm y van adosando los aminocidos correspondientes a cada codn. 2. Los aminocidos se unen entre si por ligaduras de pptidos.


3. La cadena proteica toma una forma tridimensional, basada en la secuencia particular de aminocidos. 4. Esta forma particular, es la que le confiere propiedades y funciones nicas. Resumen: Pasos desde ADN a Protena 1. Un gen es parte del ADN, en un cromosoma. 2. El cdigo gentico es "transcripto" en el ARN mensajero. 3. El ARNm forma una cabeza y una cola para dejar el ncleo. 4. El cdigo en el ARNm es traducido, construyendo las largas cadenas de aminocidos que forman una protena. 5. La protena se organiza en su forma funcional. Los pasos de la Ingeniera Gentica 1. Identificar un carcter deseable, pero que no pueda ser manejado por los mtodos clsicos de mejoramiento. 2. Encontrar algn organismo que lo exprese. 3. Encontrar el gen responsable del carcter deseado, en dicho organismo. 4. Combinar dicho gen con otros elementos necesarios para que este sea funcional en la planta. 5. Mover los genes a las clulas de la planta. 6. Encontrar las clulas modificadas exitosamente, y regenerarlas en plantas completamente funcionales. Posibilidades de la Biotecnologa Ejemplos Caracteres de Proteccin Resistencia a Insectos Tolerancia a Herbicidas Resistencia a Hongos Resistencia a Virus Caracteres de Calidad Demora de la maduracin Aceites modificados Protenas modificadas Alto contenido de slidos


Resistencia a Bacterias Resistencia a Nematodos

Produccin vegetal de anticuerpos, enzimas, etc. Bsqueda de fuentes para genes deseados

Bsqueda de fuentes para genes deseados

1. La bacteria de suelo, Bacillus thuringiensis (Bt), tiene genes para diversas protenas, selectivamente toxicas para ciertos insectos.

2. El actinomycete de suelo, Streptomyces tiene un gen para una enzima que desdobla la molcula del Glufosinato de Amonio (herbicida).

3. Una lnea mutante de Arabidopsis thaliana, tiene un gen para una versin de la enzima EPSPS, menos sensible al Glifosato

Herramientas Bsicas
Enzimas "para cortar y pegar" 1. Las enzimas de restriccin cortan ADN, solo en ciertas secuencias especificas.


2. Muchas dejan "extremos pegajosos", de manera que otras piezas cortadas con la misma enzima, se ligan automticamente. 3. El "extremo pegajoso" de una pieza puede hibridar con el de otra pieza, cortada por la misma enzima. 4. Otras enzimas llamadas ligasas, terminan las uniones.


1. Adems de su principal cromosoma, muchas bacterias tienen tambin pequeas piezas circulares de ADN, llamadas plsmidos. Estos tienen a menudo, genes de resistencia a antibiticos.

2. Los plsmidos son fciles de manejar en tubos de ensayo, para "cortar y pegar" nuevas piezas de ADN


3. Los plsmidos modificados, pueden ser colocados de nuevo en la bacteria, y sern copiados en cada duplicacin celular.

4. De esta forma es posible obtener un gran numero de copias del gen, tan solo incrementando la bacteria.

Capturando el Gen
Tomar la pieza de ADN buscada desde el organismo donante 1. Se extrae ADN de muchas clulas, y se corta en pequeas piezas.

2. Las piezas se mezclan con plsmidos cortados con la misma enzima, las cuales al conjugarse conforman distintos plsmidos.

3. Los plsmidos, colocados de nuevo en bacterias, son ahora distintos, y entonces pueden ser separados. 4. Ahora, cada pieza de ADN puede copiarse tanto como sea necesario.


Encontrando el Gen correcto

1. Los plsmidos usados en la bacteria (vectores clonados), tambin contienen un gen de resistencia a antibiticos, de manera que solo aquellas que tengan el nuevo plsmido recombinante, crecern en el medio de cultivo. Este gen se llama "marcador selectivo".

2. Cada clon (progenie de bacterias con la nueva secuencia de ADN), puede ser probada para saber si contiene el gen deseado. Hay diversas maneras, dependiendo del carcter en cuestin

Lo que acompaa al Gen

La construccin 1. Los genes deben "estar prendidos" para expresarse; para eso se usa el promotor.


3. Es necesario saber cuales (poco frecuentes) clulas han sido modificadas; para eso se agrega un gen marcador selectivo. 4. La combinacin terminada del gen + promotor + marcador selectivo + terminadores, se llama construccin o inserto.

Promotores: dnde se "prender" el gen?

1. Para que el ADN transcriba el gen en ARNm, debe haber un promotor delante de la secuencia.

2. Algunos promotores activan el gen en casi todas las clulas de la planta (Pr. Constitutivos).

3. Algunos solo lo hacen en las partes verdes.

4. Otros promotores solo trabajan en tejidos especficos, como polen, raz o tejidos daados.

Marcadores Selectivos


1. El tipo mas comn es el de un gen que codifica para una enzima, que desdobla algn antibitico o componente del herbicida. 2. El gen marcador tambin necesita un promotor y terminador. nptll -------------->kanamicna bar -->glufosinato de amonio

3. Normalmente la planta morira ante el qumico. Solamente sobrevivir si ha sido exitosamente modificada para poseer esta enzima.

Inserto listo para ser transferido a una planta

Transfiriendo los genes a las plantas.


Opciones de Transformacin. Mtodos

1. Agrobacterium. Uso de una bacteria como "Ingeniero Gentico Natural". La bacteria conteniendo el inserto, infecta las clulas de la planta produciendo la recombinacin gentica. 2. Acelerador de Partculas (Gene Gun). micropartculas con el inserto, sobre la clula. Un can artificial bombardea

3. Electroporacin. Uso de carga elctrica para que el ADN atraviese la membrana nuclear. La corriente, fuerza el paso de los insertos al interior del ncleo. 4. Polietilenglicol. La exposicin de las membranas al PEG, facilita el movimiento de las molculas de ADN. 5. Silicon Wiskers. Inyeccin mediante fibras microscpicas. Las fibras atraviesan las membranas, llevando los insertos.

Transformacin por Agrobacterium Fundamentos

1. El patgeno de suelo Agrobacterium tumefaciens, naturalmente inserta su ADN (plsmido Ti), en las clulas expuestas de sus huspedes, en tejidos radiculares daados. 2. Este ADN extrao se incorpora y recombina con el ADN propio de la planta husped, dividindose y creciendo al azar, como un tumor. 3. El ADN de Agrobacterium toma el control de las clulas del tumor, causando la sntesis de aminocidos inusuales que sirven de soporte nutricional a la bacteria.

Preparando un gen para una transformacin mediante Agrobacterium


1. Las secuencias del plsmido Ti, responsable de la virulencia de la bacteria, se remueven (vrgenes).

2.En otra bacteria, se ubica el gen deseable, entre las dos secuencias de borde del plsmido Ti.

3. Se integra el inserto que contiene el gen deseable, dentro del plsmido Ti, al ser incorporado nuevamente dentro del Agrobacterium. 4. Bacteria clonada, lista para transformar.

Resumen Transformacin mediante Agrobacterium

1. Armar dos construcciones; una con los genes a incorporar (gen principal y marcador), y otra con las secuencias necesarias del plsmido Ti. 2. Integrar todo esto en un solo plsmido, en Agrobacterium, y usar este clon para infectar tejido vegetal. 3. Exponer el tejido tratado al agente qumico selectivo (antibitico o herbicida). Solo las clulas exitosamente transformadas, sobrevivirn. 4. Usar mtodos de cultivo de tejidos para regenerar plantas viables de las pocas clulas sobrevivientes.

Transformacin por Acelerador de Partculas (Gene Gun)

1. Incorporar el inserto en un plsmido y hacer un gran numero de copias en una bacteria.


2. Extraer los plsmidos y cubrir con ellos pequeas partculas de tungsteno (1 micrn). 3. Disparar las partculas mediante una explosin, sobre los tejidos.

4. Exponer las clulas al agente selectivo para regenerar aquellas exitosamente transformadas.

Porque un evento de transformacin es raro y costoso? 1. En todo el proceso hay muchos pasos "poco probables" involucrados, debido a los siguientes obstculos: Tener que introducir ADN en clulas vivas. Lograr que el ADN sea insertado en forma estable, en los propios cromosomas de las clulas, haciendo viable su replicacin. Lograr que esta insercin sea funcional 2. No hay forma de controlar adonde se ubicara el ADN extrao: Podra no ser funcional, dependiendo del sitio de insercin.

Podra afectar o anular la accin de algn gen importante de la planta. Los primeros desafos Tolerancia a Glifosato Objetivo: Transformar plantas sensibles en altamente tolerantes, para su aplicacin directa. Origen: El Glifosato inhibe una enzima vegetal (EPSPS), necesaria para el crecimiento celular


Intento 1: Adicionar una nueva copia del gen para EPSPS, de petunia, con un promotor fuerte, para aumentar la concentracin de EPSPS en la planta, y lograr tolerar mayores dosis de Glifosato. Resultado 1: Aun con mas EPSPS, las plantas fueron todava muy sensibles, como para ser de inters comercial. Tolerancia a Glifosato: 2do Intento Objetivo: Generar mutantes de algn organismo fcil de cultivar, hasta hallar algn individuo tolerante a Glifosato. Intento 2: Un aislamiento de Agrobacterium resulta menos sensible, pero su EPSPS es aun funcional; se la transfiere a plantas TG. Resultado2: En soja, ambos mecanismos sumados funcionan adecuadamente, no as en maz, que requiere trabajo adicional. Tolerancia a Glifosato: 3er Intento Objetivo: Encontrar un microorganismo que produzca una enzima capaz de detoxificar la molcula de Glifosato (GOX de Achromobacter sp.). Intento 3: Juntar los efectos del gen para esta enzima con el gen mutante de EPSPS, en plantas de maz. Resultado 3: Este intento, involucrando ambos genes resulto efectivo, logrando que las plantas estn protegidas por producir EPSPS insensible al herbicida, mas la capacidad de detoxificar parte del mismo. Tecnologa Bt Objetivo: Lograr que la planta produzca su propio insecticida. Origen: Algunos insectos pueden ser controlados mediante la aplicacin de Deltaendotoxinas de Bacillus thuringiensis. Estas toxinas son altamente selectivas e inocuas para el hombre y el ambiente, pero se desdoblan rpidamente cuando estn expuestas a la luz ultravioleta. Intento 1: Poner el gen completo para la toxina-protena en la planta, con un fuerte promotor que funcione en todos los tejidos. Resultado 1: Aun con una transformacin exitosa, la planta no produca suficiente protena para protegerse a si misma. Tecnologa Bt: 2do Intento Origen: Cuando la toxina natural (potoxina) entra en el intestino del insecto, se


desdobla en la toxina activa, de cadena mas corta, por accin de las enzimas del insecto. Intento 2: Insertar un gen truncado que solo codifique para la porcin de la protena correspondiente a la toxina activa. Resultado 2: La planta produce mucho mas toxina ahora, pero seria conveniente aun mas. Tecnologa Bt: 3er Intento Origen: La planta "prefiere" usar ciertos codones para algunos aminocidos. Cuando no tiene estos codones "preferidos" produce mucha menos protena. Muchos de los codones en un gen bacterial, no son los "preferidos", por lo tanto el gen no se expresa bien en la planta. Intento 3: Realizar cambios en el ADN del gen, base por base, de manera que codifique para los mismos aminocidos, pero usando los codones "preferidos". Original TTAGCACCCTAGGCTAGCGTA Modificada TTACCACCCTACGCTAGCCTA Resultado 3: Cuando el gen es trucado y adems tiene los codones "preferidos", expresa suficiente toxina para su autoproteccin. Links http://www.agronort.com/links.html#Biotecnologa EL PROYECTO GENOMA HUMANO Aspectos cientficos USDA - Novedades, regulacin, etc... Plant Genome Information Resource Intercambio informacin s/ cultivo de tejidos - Texas A&M Regulacin (OECD, IANB, G-VIII) Biotecnologa Aplicada - conceptos elementales, tica, etc.. Recursos y herramientas de biologa molecular Portal "porque biotecnologa" de A.S.A. (Asociacin Semilleros Arg.) Checkbiotech.org - Informacin y novedades de biotecnologa National Center for Biotechnology Information


Council for Biotechnology Information Glosario de trminos de la Biotecnologa Genetic Engineering News Galera grfica de procesos relacionados a la biotecnologa Ag BioTech InfoNet Transgenic crops (Colorado State U.) agbios Agriculture & Biotechnology Strategies Inc. (Canada) AgBioForum - Economa y gerencia, en biotecnologa agrcola. Biotecnologa Agrcola y Pobreza Electronic Journal of Biotechnology - Universidad Catlica de Valparaso



El trmino ecologa lo propuso en 1869 el bilogo alemn Ernst Haeckel, para sistematizar el conocimiento referido al estudio del entorno viviente. Este trmino se origina en los vocablos griegos oikos (casa o lugar donde vivimos) y logos (estudio). Los graves problemas de contaminacin regional y planetaria, han convertido a la ecologa en una disciplina de vital importancia para descubrir y disear estrategias de manejo y de uso sostenible de los recursos de la biosfera.

Organizacin del conocimiento ecolgico

La ecologa estudia grupos de organismos en sus relaciones con el medio ambiente.


Los grupos de organismos pueden estar asociados a tres niveles de organizacin: poblaciones, comunidades y ecosistemas.

Una poblacin es un grupo de correspondiente a una sola especie. individuos de cualquier clase de organismo

Comunidad bitica
Agrupa todas las poblaciones que ocupan un rea fsica definida.



La comunidad, junto con el medio ambiente fsico no viviente comprende un ecosistema

Campos problmicos que aborda el eclogo

Al interior de las cadenas alimenticias de un ecosistema, se analiza por ejemplo: quin vive a la sombra de quin, quin devora a quin, quin desempea un papel en la propagacin y dispersin de quin, y cmo fluye la energa de un individuo al siguiente en una cadena alimenticia. El eclogo trata de definir y analizar aquellas caractersticas de las poblaciones distintas de las caractersticas de individuos y los factores que determinan la agrupacin de poblaciones en comunidades. En ocasiones el estudio ecolgico se centra en un campo de trabajo muy local y especfico, pero en otros casos se interesa por cuestiones muy generales. Un eclogo puede estar estudiando; cmo afectan las condiciones de luz y temperatura a los rboles de un robledal, mientras otro estudia cmo fluye la energa en la selva tropical; pero lo especfico de la ecologa es que siempre estudia las relaciones entre los organismos y de estos con el medio no vivo, en unidades de anlisis denominadas ecosistemas. El concepto de ecosistema es vital para comprender el funcionamiento de la naturaleza. Es un error considerar que nuestros avances tecnolgicos: coches, grandes casas, industria, etc. nos permiten vivir al margen del resto de la biosfera. El estudio de los ecosistemas, de su estructura y de su funcionamiento, nos demuestra la profundidad de estas relaciones.

Los ecosistemas como unidad de estudio

El ecosistema es el nivel de organizacin de la naturaleza que se convierte en la unidad bsica de estudio interesa a la ecologa. Dentro de los ecosistemas los organismos viven en poblaciones que se estructuran en comunidades El trmino autoecologa se refiere a estudios de organismos individuales, o de poblaciones de especies aisladas, y sus relaciones con el medio ambiente. El trmino contrastante, sinecologa, designa estudios de grupos de organismos asociados formando una unidad funcional del medio ambiente. Es decir analiza las numerosas relaciones entre comunidades y ecosistemas.


Los eclogos emplean el trmino ecosistema para indicar una unidad natural con partes vivientes (factores biticos) o inertes (factores abiticos), que interactan mutuamente para producir un sistema estable, en el cual el intercambio de sustancias entre los organismos vivos y los elementos inertes es de tipo circular. Entre los factores abiticos tenemos: el agua, el aire, el viento, la temperatura, la luz, los minerales del suelo, la presin atmosfrica; estos factores afectan y permiten la supervivencia de los seres vivos o factores biticos como los microorganismos, las plantas, los animales Un ecosistema puede ser tan grande como el ocano o un bosque, o uno de los ciclos de los elementos, o tan pequeo como un acuario que contiene peces tropicales, plantas verdes y caracoles. Para calificar una unidad como ecosistema, la unidad ha de ser un sistema estable, donde el recambio de materiales sigue un camino circular. Un ejemplo clsico de un ecosistema bastante compacto para ser investigado en detalle cuantitativo es una laguna o un estanque. La parte no viviente del lago comprende el agua, el oxgeno disuelto, el bixido de carbono, las sales inorgnicas como fosfatos y cloruros de sodio, potasio y calcio, adems de muchos compuestos orgnicos. En un lago, hay dos tipos de productores: las plantas mayores que crecen sobre la orilla o flotan en aguas poco profundas, y las plantas flotantes microscpicas, en su mayor parte algas, que se distribuyen por todo el lquido, hasta la profundidad mxima alcanzada por la luz. Estas plantas pequeas, que se designan colectivamente con el nombre de fitoplancton, no suelen ser visibles, salvo si las hay en gran cantidad, en cuyo caso comunican al agua un tinte verdoso. Suelen ser bastante ms importantes como productoras de alimentos para el lago que las plantas visibles. Los organismos consumidores son hetertrofos, por ejemplo, insectos y sus larvas, crustceos, peces y tal vez algunos bivalvos de agua dulce. Los consumidores primarios son los que ingieren plantas; los secundarios los carnvoros que se alimentan de los primarios, y as sucesivamente. Podra haber algunos consumidores terciarios que comieran a los consumidores secundarios carnvoros. El ecosistema se completa con organismos descomponedores o saprofitos como bacterias y hongos, que desdoblan los compuestos orgnicos de clulas procedentes de organismos muertos, y con sustancias inorgnicas que pueden usarse como materia prima por las plantas verdes. An en el ecosistema ms grande y ms completo puede demostrarse que est constituido por los mismos componentes: organismos productores, consumidores y desintegradores, y componentes inorgnicos.


Biocenosis y biotopo
La estructuracin de un ecosistema rene la biocenosis o conjunto, en equilibrio dinmico, de organismos vivos, y las caractersticas del bitopo o sea de la extensin fsica en que se encuentra circunscrita la unidad ecosistmica que se va a estudiar. El concepto de ecosistema an es ms amplio que el de comunidad porque un ecosistema incluye, adems de la comunidad, el ambiente no vivo, con todas las caractersticas de clima, temperatura, sustancias qumicas presentes, condiciones geolgicas, etc. La organizacin de la naturaleza en niveles superiores al de los organismos es la que interesa a la ecologa.

Hbitat y nicho ecolgico

Dos conceptos fundamentales tiles para describir las relaciones ecolgicas de los organismos son el hbitat y el nicho ecolgico. El hbitat es el lugar donde vive un organismo, su rea fsica, alguna parte especfica de la superficie de la tierra, aire, suelo y agua. Puede ser vastsimo, como el ocano, o las grandes zonas continentales, o muy pequeo, y limitado, por ejemplo, la parte inferior de un leo podrido, pero siempre es una regin bien delimitada fsicamente. En un hbitat particular pueden vivir varios animales o plantas. En cambio, el nicho ecolgico es el estado o el papel de un organismo en la comunidad o el ecosistema. Depende de las adaptaciones estructurales del organismo, de sus respuestas fisiolgicas y de su conducta. Puede ser til considerar al hbitat como la direccin de un organismo (donde vive) y al nicho ecolgico como su profesin (lo que hace biolgicamente). El nicho ecolgico no es un espacio demarcado fsicamente, sino una abstraccin que comprende todos los factores fsicos, qumicos, fisiolgicos y biticos que necesita un organismo para vivir. Para describir el nicho ecolgico de un organismo es preciso saber qu come y qu lo come a l, cules son sus lmites de movimiento y sus efectos sobre otros organismos y sobre partes no vivientes del ambiente. Una de las generalizaciones importantes de la ecologa es que dos especies no pueden ocupar el mismo nicho ecolgico. Una sola especie puede ocupar diferentes nichos en distintas regiones, en funcin de factores como el alimento disponible y el nmero de competidores. Algunos organismos, por ejemplo, los animales con distintas fases en su ciclo vital, ocupan sucesivamente nichos diferentes. Un renacuajo es un consumidor primario, que se alimenta de plantas, pero la rana adulta es un consumidor secundario y digiere insectos y otros animales.


En contraste, tortugas jvenes de ro son consumidores secundarios, comen caracoles, gusanos e insectos, mientras que las tortugas adultas son consumidores primarios y se alimentan de plantas verdes como el apio acutico.

Ejemplos de ecosistemas
La ecosfera en su conjunto es el ecosistema mayor. Abarca todo el planeta y rene a todos los seres vivos en sus relaciones con el ambiente no vivo de toda la Tierra. Pero dentro de este gran sistema hay subsistemas que son ecosistemas ms delimitados. As, por ejemplo, el ocano, un lago, un bosque, o incluso, un rbol, o una manzana que se est pudriendo son ecosistemas que poseen patrones de funcionamiento en los que podemos encontrar paralelismos fundamentales que nos permiten agruparlos en el concepto de ecosistema.

Funcionamento del ecosistema

El funcionamiento de todos los ecosistemas es parecido. Todos necesitan una fuente de energa que, fluyendo a travs de los distintos componentes del ecosistema, mantiene la vida y moviliza el agua, los minerales y otros componentes fsicos del ecosistema. La fuente primaria y principal de energa es el sol. En todos los ecosistemas existe, adems, un movimiento contino de los materiales. Los diferentes elementos qumicos pasan del suelo, del agua o del aire a los organismos y de unos seres vivos a otros, hasta que vuelven al suelo, o al agua, o al aire, cerrndose el ciclo. En el ecosistema la materia se recicla en un ciclo cerrado y la energa fluye linealmente generando organizacin en el sistema.

Enfoque para el estudio del ecosistema

Al estudiar los ecosistemas interesa ms el conocimiento de las relaciones entre los elementos, que el cmo son estos elementos. Los seres vivos concretos le interesan al eclogo por la funcin que cumplen en el ecosistema, no en s mismos como le pueden interesar al zologo o al botnico. Para el estudio del ecosistema es indiferente, en cierta forma, que el depredador sea un len o un tiburn. La funcin que cumplen en el flujo de energa y en el ciclo de los materiales son similares y es lo que interesa en ecologa. Cualquier variacin en un componente del ecosistema repercutir en todos los dems componentes. Por eso son tan importantes las relaciones que se establecen para mantener ciertas dinmicas de equilibrio general a pesar de la gran complejidad de las interacciones.


Una manera simplificada de abordar el estudio de los ecosistemas consiste en analizar las relaciones alimentarias, los ciclos de la materia y los flujos de energa.

Relaciones alimentarias
La vida necesita un aporte continuo de energa que llega a la Tierra desde el Sol y pasa de unos organismos a otros a travs de la cadena trfica.

Grfica Ejemplo de cadena trfica Tomada de www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Las redes de alimentacin (reunin de todas las cadenas trficas) comienzan en los organismos productores (las plantas) que captan la energa luminosa con su actividad fotosinttica y la convierten en energa qumica almacenada en molculas orgnicas. Las plantas son devoradas por otros seres vivos que forman el nivel trfico de los consumidores primarios (herbvoros). Los herbvoros suelen ser presa, generalmente, de los carnvoros (depredadores) que son consumidores secundarios en el ecosistema. Pero las cadenas alimentarias no acaban en el depredador cumbre (Ej. felino que como todo ser vivo muere, existen necrfagos, como algunos hongos o bacterias que se


alimentan de los residuos muertos y detritos en general (organismos descomponedores o detritvoros). De esta forma se soluciona en la naturaleza el problema de los residuos. Los detritos (restos orgnicos de seres vivos) constituyen en muchas ocasiones el inicio de nuevas cadenas trficas. Por Ej., los animales de los fondos abisales se nutren de los detritos que van descendiendo de la superficie. La cadena alimentaria ms corta estara formada por los dos eslabones citados (ej. cabras alimentndose de la vegetacin). Ejemplos de cadenas alimentarias de tres eslabones seran: hierba - vaca - hombre algas - krill - ballena. Las cadenas alimentarias suelen tener, como mucho, cuatro o cinco eslabones, seis constituyen ya un caso excepcional. Ej. de cadena larga sera: plantas - insectos sapos serpientes mangosta felino. Las diferentes cadenas alimentarias no estn aisladas en el ecosistema sino que forman un entramado entre s y se suele hablar de red trfica.

Redes trficas y alimentarias

Se estima que el ndice de aprovechamiento de los recursos en los ecosistemas terrestres es como mximo del 10 %, por lo cual el nmero de eslabones en una cadena trfica, por necesidad, corto. Reflexin: qu pasa con el 90% correspondiente a la energa no aprovechada al ascender en la escala trfica? Se pierde o se aprovecha en otra forma? Sin embargo, un estudio de campo y el conocimiento ms profundo de las distintas especies nos revelar que esa cadena trfica es nicamente una hiptesis de trabajo y que, a lo sumo, expresa un tipo predominante de relacin entre varias especies de un mismo ecosistema. La realidad es que cada uno de los eslabones mantiene a su vez relaciones con otras especies pertenecientes a cadenas distintas. Es como un cable de conduccin elctrica, que al observador alejado le parecer una unidad, pero al aproximarse ver que dicho cable consta a su vez de otros cables conductores ms pequeos, que tampoco son una unidad maciza. Cada uno de estos cables conductores estar formado por pequeos filamentos de cobre y quienes conducen la electricidad son en realidad las diminutas unidades que conocemos como electrones, componentes de los tomos que constituyen el elemento cobre.


Pero hay que poner de relieve una diferencia fundamental, en el cable todas las sucesivas subunidades van en una misma direccin, pero en la cadena trfica cada eslabn comunica con otros que a menudo se sitan en direcciones distintas. La hierba no slo alimenta a la oveja, sino tambin al conejo y al ratn, que sern presa de un guila y un bho, respectivamente. La oveja no tiene al lobo como nico enemigo, aunque sea el principal. El guila intentar apoderarse de sus recentales y, si hay un lince en el territorio, competir con el lobo, que en caso de dificultad no dudar en alimentarse tambin de conejos. De este modo, la cadena original ha sacado a la luz la existencia de otras laterales y entre todas han formado una tupida maraa de relaciones nter- especficas. Esto es lo que se conoce con el nombre de red trfica. La red da una visin ms cercana a la realidad que la simple cadena. Nos muestra que cada especie mantiene relaciones de distintos tipos con otros elementos del ecosistema: la planta no crece en un nico terreno, aunque en determinados suelos prospere con especial vigor. Tampoco, en general, el herbvoro se nutre de una nica especie vegetal y l no suele ser tampoco el componente exclusivo de la dieta del carnvoro. La red trfica, contemplando un nico pero importante aspecto de las relaciones entre los organismos, nos muestra lo importante que es cada eslabn para formar el conjunto global del ecosistema. Una representacin ms realista de quien come a quien se llama red alimenticia, como se muestra a continuacin

Grfica Red alimenticia, Tomada de: http://www.jmarcano.com/nociones/trofico2.html


Pirmides biolgicas
Una representacin muy til para estudiar todo este entramado trfico son las pirmides de biomasa y energa. En ellas se ponen varios pisos con su anchura o su superficie proporcional a la magnitud representada. En el piso bajo se sitan los productores; por encima los consumidores de primer orden (herbvoros), despus los de segundo orden (carnvoros) y as sucesivamente.

Grfica Pirmide de energa de una cadena trfica acutica tomada de: www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Biomasa y energa
La biomasa es la cantidad total de materia viviente, en un momento dado, en un rea determinada o en uno de sus niveles trficos, y se expresa en gramos de carbono, de la materia seca correspondiente. Las pirmides de biomasa son muy tiles para mostrar la biomasa en un nivel trfico. El aumento de biomasa en un perodo determinado recibe el nombre de produccin de un sistema o de un rea determinada.

Pirmide de energa
Una pirmide de energa muestra la cantidad mxima de energa en la base, la cual disminuye uniformemente en cada nivel trfico. La transferencia de energa de un nivel trfico a otro no es totalmente eficiente.


Los productores gastan energa para respirar, y cada consumidor de la cadena gasta energa obteniendo el alimento, metabolizndolo y manteniendo sus actividades vitales. Los estudios muestran que la eficiencia en la transferencia de energa entre los niveles es del 10 %, es decir, que la energa almacenada en los herbvoros es solo el 10% de la almacenada en las plantas y as mismo los consumidores secundarios tienen almacenado solo un 10% de la energa almacenada en los consumidores primarios. Esto explica por qu las cadenas alimentarias no tienen ms de cuatro o cinco miembros, pues no hay suficiente energa por encima de los depredadores en la cspide de la pirmide para mantener otro nivel trfico.

Ciclos de la materia
Los elementos qumicos que forman los seres vivos (oxgeno, carbono, hidrgeno, nitrgeno, azufre y fsforo, etc.) van pasando de unos niveles trficos a otros. Las plantas los recogen del suelo o de la atmsfera y los convierten en molculas orgnicas (glcidos, lpidos, protenas y cidos nucleicos). Los animales los toman de las plantas o de otros animales. Despus los van devolviendo a la tierra, a la atmsfera o a las aguas por la respiracin, las heces o la descomposicin de los cadveres, cuando mueren. Es as como el ciclo de la materia tiene un trayecto cclico

De esta forma encontramos en todo ecosistema unos ciclos del oxgeno, del carbono, del hidrgeno, del nitrgeno.


Grfica. Ciclo energtico del ecosistema Tomada de: www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Flujo de energa
El ecosistema se mantiene en funcionamiento gracias al flujo de energa que va pasando de un nivel al siguiente. La energa fluye a travs de la cadena alimentaria slo en una direccin: va siempre desde el sol, a travs de los productores a los descomponedores. La energa entra en el ecosistema en forma de energa luminosa y sale en forma de energa calorfica que ya no puede reutilizarse para mantener otro ecosistema en funcionamiento. El ciclo de energa sigue una trayectoria lineal a diferencia de los ciclos de la materia o de los elementos qumicos.

Productividad de los ecosistemas como base para la intervencin humana sostenible

La productividad es una caracterstica de las poblaciones que sirve tambin como ndice importante para definir el funcionamiento de cualquier ecosistema. Su estudio puede hacerse a nivel de las especies, cuando interesa su aprovechamiento econmico, o de un medio en general.


Las plantas, como organismos auttrofos, tienen la capacidad de sintetizar su propia masa corporal a partir de los elementos y compuestos inorgnicos del medio, en presencia de agua como vehculo de las reacciones y con la intervencin de la luz solar como aporte energtico para stas. El resultado de esta actividad, es decir los tejidos vegetales, constituyen la productividad primaria. Ms tarde, los animales comen las plantas y aprovechan esos compuestos orgnicos para crear su propia estructura corporal, que en algunas circunstancias servir tambin de alimento a otros animales. Esta es la productividad secundaria. En ambos casos, la proporcin entre la cantidad de nutrientes ingresados y la biomasa producida nos dar la llamada productividad, que mide la eficacia con la que un organismo puede aprovechar sus recursos trficos. Esto tambin se llama ecoeficiencia Pero el conjunto de organismos y el medio fsico en el que viven forman el ecosistema, por lo que la productividad aplicada al conjunto de todos ellos nos servir para obtener un parmetro con que medir el funcionamiento de dicho ecosistema y conocer el modo en que la energa fluye por los distintos niveles de su organizacin. La productividad es uno de los parmetros ms utilizados para medir la eficacia de un ecosistema, calculndose sta en general como el cociente entre una variable de salida y otra de entrada. La productividad de los ecosistemas se mide en gramos o kilogramos por rea de superficie y por ao. El desarrollo de la productividad se puede dar en dos medios principales, las comunidades acuticas y las terrestres. El hombre nada puede hacer para aumentar la cantidad de energa luminosa incidente, y muy poco para elevar el porcentaje de eficacia de transferencia de energa, por lo que slo podr aumentar el aporte de energa de los alimentos, acortando la cadena alimenticia, es decir, consumiendo productores primarios, vegetales y no animales. En los pases superpoblados como en La India y China, los habitantes son principalmente vegetarianos porque as la cadena alimenticia es ms corta y un rea determinada de terreno puede de esta forma servir de sostn al mayor nmero de individuos.

Condiciones de las interacciones en los factores abiticos y biticos Factores abiticos

Todos los factores qumico-fsicos del ambiente son llamados factores abiticos (de a, "sin", y bio, "vida).


Los factores abiticos ms conspicuos son la precipitacin (lluvias, nevadas) y temperatura; todos sabemos que estos factores varan grandemente de un lugar a otro, pero las variaciones de estos factores pueden ser an mucho ms importantes de lo que normalmente reconocemos. No es solamente un asunto de la precipitacin total o la temperatura promedio. Por ejemplo, en algunas regiones la precipitacin, total promedio es de ms o menos 100 mm por ao distribuida uniformemente durante el ao. Esto crea un efecto ambiental muy diferente al que se encuentra en otra regin donde cae la misma cantidad de precipitacin pero solamente durante 6 meses por ao correspondientes a la estacin de lluvias, dejando a la otra mitad del ao como la estacin seca. Igualmente, un lugar donde la temperatura promedio es de 20 C y nunca alcanza el punto de congelamiento, es muy diferente de otro lugar con la misma temperatura promedio pero que tiene veranos ardientes e inviernos muy fros. De hecho, la temperatura fra extrema no temperatura de congelamiento, congelamiento ligero o varias semanas de fuerte congelamiento es ms significativa biolgicamente que la temperatura promedio. An ms, cantidades y distribuciones diferentes de precipitacin pueden combinarse con diferentes patrones de temperatura, lo que determina numerosas combinaciones para apenas estos dos factores. Pero tambin otros factores abiticos pueden estar involucrados, incluyendo tipo y profundidad de suelo, disponibilidad de nutrientes esenciales, viento, fuego, salinidad, luz, longitud del da, terreno y pH (la medida de acidez o alcalinidad de suelos y aguas). Como ilustracin, consideremos el factor terreno: en el Hemisferio Norte, el terreno de las laderas que dan hacia el norte generalmente presenta temperaturas ms fras que las que dan hacia el sur. O consideremos el tipo de suelo: un suelo arenoso, debido a que no retiene bien el agua, produce el mismo efecto que una precipitacin menor. O consideremos el viento: ya que aumenta la evaporacin, tambin puede causar el efecto de condiciones relativamente ms secas. Sin embargo, estos y otros factores pueden ejercer por ellos mismos un efecto crtico. Resumiendo, podemos ver que los factores abiticos, que se encuentran siempre presentes en diferentes intensidades, interactan unos con otros para crear una matriz de un nmero infinito de condiciones ambientales diferentes.

Factores biticos


En un ecosistema los factores biticos estn relacionados con la interaccin de organismos que contribuyen al desarrollo de biomasa y las condiciones de predominancia y equilibrio entre diversas poblaciones. Invariablemente la comunidad vegetal est compuesta por un nmero de especies que pueden competir unas con otras, pero que pueden ser de ayuda mutua. Tambin existen otros organismos en la comunidad vegetal: animales, hongos, bacterias y otros microorganismos. As que cada especie no solamente interacta con los factores abiticos, sino que est constantemente interactuando con otras especies (factores biticos) para conseguir alimento, proteccin, territorio u otros beneficios, inclusive, mientras se compite se puede ser adems fuente de alimento para un nivel trfico superior. Todas las interacciones con otras especies se clasifican como interacciones biticas positivas, negativas o neutras.

ptimos y rangos de tolerancia de las especies a factores abiticos

Veremos ahora la manera en que diferentes especies se "ajustan" a condiciones ambientales diferentes. Especies diferentes de plantas, animales o microorganismos varan grandemente en cuanto a su tolerancia (capacidad para soportar) a diferentes factores abiticos. Enfatizaremos en las plantas porque es ms fcil ilustrar los principios con ellas. A travs de observaciones de campo (observaciones de elementos tal como existen en la naturaleza en contraposicin a experimentos de laboratorio), podemos llegar a la conclusin que: especies diferentes de plantas varan grandemente en cuanto a su tolerancia a diferentes factores abiticos. Esta hiptesis ha sido examinada y verificada a travs de experimentos llamados "pruebas de estrs". Se cultivan plantas en una serie de cmaras en la que pueden controlarse todos los factores abiticos; de esta manera, el factor simple que estudiamos puede variarse de manera sistemtica mientras que todos los dems factores se mantienen constantes. Por ejemplo, mantenemos la luz, el suelo, el agua y otros factores con iguales valores en todas las cmaras, pero variamos la temperatura de una cmara a otra (para as distinguir el efecto de la temperatura de los dems factores). Los resultados muestran que, partiendo desde un valor bajo, a medida que se eleva la temperatura las plantas crecen mejor hasta alcanzar una tasa mxima de crecimiento. Sin embargo, si se sigue elevando la temperatura las plantas empiezan a mostrar estrs: no crecen bien, sufren daos, y finalmente mueren.


La temperatura a la cual se presenta la mxima tasa de crecimiento se llama temperatura ptima. La gama o rango de temperatura dentro de la cual hay crecimiento se llama el rango o gama de tolerancia (en este caso para la temperatura). A las temperaturas por debajo o por encima de las cuales las plantas no crecen se les conoce como los lmites de tolerancia. Experimentos similares han sido realizados con la mayora de los dems factores abiticos. Para cada factor abitico estudiado, los resultados siguen el mismo patrn general: hay un ptimo, que permite el mximo crecimiento, un rango de tolerancia fuera del cual hay un crecimiento menos vigoroso, y lmites por debajo o por encima de los cuales la planta, el animal o el microorganismo no puede sobrevivir. Desde luego, no todas las especies han sido examinadas para todos los factores; sin embargo, la consistencia de tales observaciones nos lleva a la conclusin de que este es un principio biolgico fundamental. Entonces podemos generalizar diciendo que cada especie tiene: un ptimo, un rango de tolerancia, un lmite de tolerancia con respecto a cada factor.

Adems del principio de los ptimos, este tipo de experimentos demuestra que las especies pueden diferir marcadamente con respecto al punto en que se presenta el ptimo y los lmites de tolerancia. Por ejemplo, lo que puede ser muy poca agua para una especie puede ser el ptimo para otra y puede ser letal para una tercera. Algunas plantas no toleran las temperaturas de congelamiento (esto es, la exposicin a 0 C o menos es fatal). Otras pueden tolerar un congelamiento ligero pero no intenso, y algunas realmente requieren varias semanas de temperaturas de congelamiento para completar sus ciclos de vida. Lo mismo puede decirse para los dems factores. Pero, mientras que los ptimos y los lmites de tolerancia pueden ser diferentes para especies diferentes, sus rangos de tolerancia pueden sobreponerse considerablemente. De esta manera, los experimentos controlados apoyan la hiptesis de que las especies difieren en su adaptacin a los diversos factores abiticos. La distribucin geogrfica de una especie puede estar determinada por el grado en el cual sus requerimientos son cumplidos por los factores abiticos presentes. Una especie puede prosperar donde encuentra condiciones ptimas; sobrevive malamente cuando las condiciones difieren de su ptimo. Pero no sobrevivir en aquellos lugares donde cualquier factor abitico tenga un valor fuera de su lmite de tolerancia para ese factor.


Relaciones entre individuos Componentes de las relaciones intra-especficas

Las relaciones intra-especficas son interacciones que se dan entre los individuos de una misma especie al tener el mismo hbitat o compartir la misma alimentacin. Estas interacciones facilitan el apareamiento, la cra, la proteccin y la alimentacin de cada individuo. A nivel unicelular tanto en organismos vegetales (fitoplancton) como en organismos animales (zooplancton) las relaciones entre individuos de una misma especie estn condicionadas por el medio comn (factores de tipo fsico y qumico) que comparten, al que vierten sus metabolitos y del que reciben los de otros organismos. Por ejemplo, la mayora de formas de algas son microscpicas unicelulares y forman parte del plancton, es decir, que tienen su hbitat generalmente en el agua, donde suelen, realizar una rpida multiplicacin que puede provocar a veces en ambientes reducidos una cantidad excesiva de residuos metablicos o un agotamiento total del oxgeno disuelto que cause su muerte. En el caso de los organismos de mayor entidad biolgica, de formas pluricelulares, cualquier relacin entre individuos de una misma especie lleva siempre un componente de cooperacin y otro de competencia, con predominio de una u otra en casos extremos. As en una colonia de plipos la cooperacin es total, mientras que animales de costumbres solitarias, como la mayora de las musaraas, apenas permiten la presencia de congneres en su territorio fuera de la poca reproductora.

La colonia
La colonia es un tipo de relacin que implica estrecha colaboracin funcional e incluso cesin de la propia individualidad. Los corales de un arrecife se especializan en diversas funciones: hay individuos provistos de rganos urticantes que defienden la colonia, mientras que otros se encargan de obtener el alimento y otros de la reproduccin. Este tipo de asociacin es muy frecuente tambin en las plantas, sobre todo en las inferiores. En los vegetales superiores, debido a la incapacidad de desplazamiento, surgen formaciones en las que el conjunto crea unas condiciones adecuadas para cada individuo, por lo que se da una cooperacin ecolgica, al tiempo que se produce competencia por el espacio, impidiendo los ejemplares de mayor tamao crecer a los plantones de sus propias semillas.



En el reino animal nos encontramos con sociedades, como las de hormigas o abejas, con una estricta divisin del trabajo. En todos estos casos, el agrupamiento sigue una tendencia instintiva automtica. A medida que se asciende en la escala zoolgica encontramos que, adems de ese componente mecnico de agrupamiento, surgen relaciones en las que el comportamiento o la etologa de la especie desempean un papel creciente Los bancos de peces son un primer ejemplo de particularidades en el comportamiento de cooperacin que asegura la supervivencia de la especie, al desplazarse en cardmenes. En las grandes colonias de muchas aves (flamencos, gaviotas, pinginos, etc.), las relaciones entre individuos estn ritualizadas para impedir una competencia perjudicial. Algo similar sucede en los rebaos de mamferos. Entre muchos carnvoros y, en grado mximo entre los primates, aparecen los grupos familiares que regulan las relaciones intra-especficas y en este caso factores como el aprendizaje de las cras, el reconocimiento de los propios individuos y otros aspectos de los que estudia la etologa pasan a ocupar un primer plano.

Componentes de las relaciones nter-especficas

Las relaciones inter-especficas son interacciones que se dan entre diferentes especies por el alimento, el territorio o la defensa o por la predominancia de una especie. Entre las especies se pueden establecer relaciones de competencia, en este caso prima el inters de cada especie por el alimento o el espacio. En muchas ocasiones, para lograr determinados fines se recurre a compromisos con otras especies que se manifiestan en asociaciones del tipo de una simbiosis.

La simbiosis se define como una cooperacin entre organismos para poder vivir o adaptarse. Esta colaboracin puede darse uno a uno (en forma directa), es decir A ayuda a B y B ayuda a A, o tambin puede ser indirecta A ayuda a B, B ayuda a C y C ayuda a A.

Un tipo de simbiosis es el mutualismo en el que ambas especies se benefician recprocamente, tal es el caso, de un abejorro que poliniza las flores de un arbusto y obtiene nctar como recompensa, o por ejemplo, el liquen resultado de la asociacin entre algas y hongos , en esta relacin el hongo absorbe agua del ambiente y el alga suministra al hongo el alimento elaborado mediante el proceso de fotosntesis,


o la asociacin Rhizobium - leguminosa en la cual la bacteria Rhizobium produce sustancias reguladoras del crecimiento que son aprovechadas por la leguminosa y la leguminosa proporciona a la bacteria un medio y nutrientes para su supervivencia.

El comensalismo es otro tipo de simbiosis en donde una especie saca provecho de otra sin que esta ltima se afecte, es el caso del pez rmora que tiene una aleta transformada en ventosa, con la que se adhiere al cuerpo del tiburn. As, la rmora se desplaza junto al tiburn y se alimenta con los restos de comida que ste deja caer. Entre otras relaciones particulares posibles, tenemos:

El parasitismo es un tipo de relacin de alimentacin en la cual el depredador es mucho ms pequeo que el husped vivo del cual obtiene su alimento causndole algn dao, por ejemplo la relacin que se establece entre la garrapata y el ganado.

La depredacin, en este tipo de relacin algunos individuos -predadores- devoran a otros presas vivas- como es el caso de los carnvoros de segundo y tercer orden que devoran presas vivas por ejemplo, la mangosta y la serpiente , o el tigre y el venado.

El amensalismo es el tipo de relacin en la que una especie inhibe el crecimiento de otra, sin afectarse ella. Por ejemplo, el hongo Penicillium produce sustancias antibiticas que inhiben el crecimiento de otros microorganismos. La importancia de estas relaciones es que establecen muchas veces los flujos de energa dentro de las redes trficas y por tanto contribuyen a la estructuracin del ecosistema. Las relaciones en las que intervienen organismos vegetales son ms estticas que aquellas propias de los animales, pero ambas son el resultado de la evolucin del medio, sobre el cual, a su vez las especies actan, incluso modificndolo, en virtud de las relaciones que mantienen entre ellas. Pero tambin es relevante la interaccin comunicativa entre las especies, como pueda ser la exhibicin de colores llamativos o la emisin de sonidos estridentes de una presa para disuadir a un depredador

Atributos de las poblaciones


Puede definirse la poblacin como un grupo de organismos de la misma especie que ocupan un rea dada. Posee caractersticas en funcin ms bien del grupo en su totalidad que de cada uno de los individuos, como: densidad de poblacin, frecuencia de nacimientos y defunciones, distribucin por edades, ritmo de dispersin, potencial bitico y forma de crecimiento. Si bien los individuos nacen y mueren, los ndices de natalidad y mortalidad no son caractersticas del individuo sino de la poblacin global. Las relaciones entre poblacin y comunidad son a menudo ms importantes para determinar la existencia y supervivencia de organismos en la naturaleza que los efectos directos de los factores fsicos en el medio ambiente. Uno de sus atributos importantes es la densidad, o sea el nmero de individuos que habitan en una unidad de superficie o de volumen. La densidad de poblacin es con frecuencia difcil de medir en funcin del nmero de individuos, pero se calcula por medidas indirectas como por ejemplo, los insectos atrapados durante una hora en una trampa. La grfica en la que se inscribe el nmero de organismos en funcin del tiempo es llamada curva de crecimiento de poblacin. Tales curvas son caractersticas de las poblaciones, no de especies aisladas, y sorprende su similitud entre las poblaciones de casi todos los organismos desde las bacterias hasta el hombre. La tasa de nacimientos o natalidad, de una poblacin es simplemente el nmero de nuevos individuos producidos por unidad de tiempo. La tasa de natalidad mxima es el mayor nmero de organismos que podran ser producidos por unidad de tiempo en condiciones ideales, cuando no hay factores limitantes. La mortalidad se refiere a los individuos que mueren por unidad de tiempo. Hay una mortalidad mnima terica, la cual es el nmero de muertes que ocurriran en condiciones ideales, consecutivas exclusivamente a las alteraciones fisiolgicas que acompaan el envejecimiento. Disponiendo en grfica el nmero de supervivientes de una poblacin contra el tiempo se obtiene la curva de supervivencia. De esas curvas puede deducirse el momento en que una especie particular es ms vulnerable. Como la mortalidad es ms variable y ms afectada por los factores ambientales que por la natalidad, estos tienen una enorme influencia en la regularizacin del nmero de individuos de una poblacin. Los eclogos emplean el trmino potencial bitico o potencial reproductor para expresar la facultad privativa de una poblacin para aumentar el nmero, cuando sea estable la proporcin de edades y ptimas las condiciones ambientales.


Cuando el ambiente no llega a ser ptimo, el ritmo de crecimiento de la poblacin es menor, y la diferencia entre la capacidad potencial de una poblacin para crecer y lo que en realidad crece es una medida de la resistencia del ambiente.

Tabla Niveles de Integracin de los materiales biolgicos en los ecosistemas

Los materiales biolgicos (protenas, lpidos, cidos nucleicos, etc.) se integran en la naturaleza en un cierto nmero de niveles de organizacin cada vez ms complejos: clula - individuo - poblacin - comunidad. La clula es la unidad biolgica funcional ms pequea y sencilla. Est compuesta por un territorio protoplasmtico, limitado por una membrana plasmtica (de lpidos y protenas), reforzada en los vegetales por una pared celular. El protoplasma est constituido por una solucin coloidal de protenas muy estructurada (citoplasma), en cuyo seno se encuentra el material gentico (ADN, ARN), organizado generalmente en un ncleo, y toda una serie de orgnulos (mitocondrias, ribosomas, plastos, etc.) que constituyen la maquinaria metablica. El individuo (organismo) es un sistema biolgico funcional que, en los casos ms simples, se reduce a una sola clula (unicelular), pero que, en principio, est compuesto por numerosas clulas, que pueden estar agrupadas en tejidos y rganos. Un individuo se caracteriza por su anatomofisiologa y su metabolismo. En un momento dado, un individuo posee una determinada biomasa que se puede expresar en peso vivo (fresco) o en peso de materia seca. La poblacin (o demo) es un sistema biolgico formado por un grupo de individuos de la misma especie que viven en un lugar determinado en un momento determinado. Aproximadamente, la especie es un conjunto de individuos semejantes que transmiten este parecido de generacin en generacin. La comunidad (o biocenosis) es un sistema biolgico que agrupa el conjunto de poblaciones habitantes de un mismo lugar determinado, en unas condiciones dadas del medio y en un momento concreto. El ecosistema, lo constituyen las relaciones e interdependencias de las comunidades integradas conjunta y sinrgicamente en su medio. La biosfera es el conjunto de los ecosistemas naturales desarrollados en el seno de los mares o en la superficie de los continentes. La noosfera representa la integracin virtual del pensamiento humano sobre la biosfera, crecientemente tecnologizada.


Grfica. Niveles de organizacin en la naturaleza Tomada de www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm







El hombre con sus prcticas ecolgicas no sostenibles ha transformado el ambiente, originando grandes desequilibrios de los ecosistemas, causando desastres ecolgicos que ponen en peligro la vida. Los recursos naturales renovables como la biodiversidad (flora y fauna) los bosques y los recursos no renovables como los yacimientos minerales, los combustibles fsiles y nucleares deben ser manejados de manera racional y sostenible para su conservacin y sus beneficios.


Algunas acciones biodiversidad






* Policultivos o diversificacin de los cultivos * Evitar la tala de bosques que pone en peligro las especies animales y causa erosin en los suelos * Prelacin al control biolgico en lugar de controles qumicos. * Uso de energas alternativas * Evitar la caza y la pesca indiscriminada * Manejo adecuado de las basuras * Reciclaje de productos no degradables * Creacin de parques naturales y reservas naturales * Conservacin en laboratorios de bancos de germoplasma de plantas, de animales y de microorganismos. * Evitar contaminar el agua con desechos procedentes de la agricultura o de la industria * Controlar el pastoreo libre * Disminuir el consumo de aerosoles o clorofluorocarbonados que destruyen la capa de ozono protectora contra las radiaciones csmicas * Reducir la contaminacin atmosfrica producida por los gases expulsados por fbricas, vehculos que permanecen en la atmsfera causando el efecto invernadero y las lluvias cidas. * Evitar el uso de detergentes no biodegradables.

Conclusin La misin del eclogo

Tanto en el medio rural como en el urbano son muchas las tareas que debe llevar a cabo el eclogo en el presente. Su misin fundamental, desde el punto de vista prctico, puede resumirse en una sola palabra, prevenir. Cualquier accin irracional que se produzca en el medio biolgico trae como consecuencia verdaderas reacciones en cadena. El consejo del eclogo debe llegar antes y no despus, porque una vez iniciado el proceso destructivo del ambiente resulta muy difcil detenerlo. La segunda misin del eclogo es conservar, que no slo implica evitar la destruccin sino favorecer, a veces artificialmente, a las poblaciones cuya existencia peligra. En sntesis: prevenir deterioros ambientales, potenciar las resiliencias de los ecosistemas y mantener buenos ndices de ecoeficiencia, con aportes tericos y tcnicos para la productividad limpia.


Pensamiento Sistmico y Desarrollo Sustentable

Tomado de: Congreso Internacional NIKAN Honorato Teissier Fuentes (*) Nota: El conocimiento de los ecosistemas habilita al estudiosos para comprender la posiscin epistemolgica del pensamiento sistmico, como un aporte de la biologa a la conceptualizacin ambiental del desarrollo sostenible, comenzando por el manejo de los agroecosistemas, que no son otra cosa que la intervencin productiva del hombre en los ecosistemas . Para reflexionar sobre este enfoque de pensamiento sistmico biolgico es interesante revisar el texto tomado de Honorato Teissier Fuentes

La Era Industrial y la Naturaleza

No cabe duda que la industrializacin aport gran parte del desarrollo humano en los ltimos doscientos aos. Sin embargo ha trado consigo una gran cantidad de aspectos negativos. La era industrial requiri del individuo, la tecnologa y las materias primas para la produccin masiva. No obstante de haber sido pensada para beneficio del hombre, sta lo volvi su esclavo, convirtindolo en un engrane ms de su mecanizacin. La forma fragmentada de pensar, que contiene al enfoque mecanicista, tambin gener una desintegracin del mundo. Las materias primas, productos de la Naturaleza, se volvieron slo la entrada para el insaciable hambre de riqueza industrial y la ambicin del poder de los gobiernos. Bajo esta visin analtica, divisionista, lineal y fragmentada hemos llegado a los niveles de deterioro del Planeta que hoy observamos. Descomponer un sistema es lo mismo que destruirlo. No slo implica la separacin de sus partes, sino la anulacin de sus propiedades: el agua, separada en oxgeno e hidrgeno deja de ser el compuesto que ayud a formar la vida en la Tierra, no es ms un sistema. El concepto de Sistema, a pesar de lo antiguo del vocablo, pues los griegos lo acuaron, como visin social es una idea reciente. Es una base que contiene la posibilidad de apreciar El Todo sin desintegrar sus partes para tratar de entenderlas o controlarlas. Plantea un conjunto de modelos mentales que se distinguen del pensamiento analtico, punto de partida del enfoque mecanicista. El pensamiento sistmico requiere percibir ms que medir. Obliga a sintetizar antes de analizar, pero adems fuerza a observar al sistema como parte interactuante con otros sistemas de su mismo nivel, y como integrante de sistemas superiores, en donde se encuentra inmerso. Implica comprender que todo tiene relacin, interna y externa, por remota o distante que sea.


Por otro lado, el Desarrollo Sustentable plantea armonizar las relaciones entre el hombre y la naturaleza. Quisiramos ver a la raza humana tomando del ro slo el agua que necesita para saciar su sed, so pena de que aquel nunca ms le d de beber. El modelo del desarrollo sustentable que se pretende alcanzar, requiere de un cambio de paradigma y no slo de las buenas intenciones. Esto es, requiere de un cambio mental en la visin del hombre. Primero porque necesitamos quitar de nuestra mente las viejas ideas de que la Naturaleza est en contra del Hombre y de que hay que "vencerla". Segundo, de que debemos dominarla y controlarla, pues sta tiene fuerzas y formas propias. Tercero, de que nos pertenece y son nuestros sus productos. Y cuarto, de que posee recursos ilimitados, slo para una ilimitada hambre de poder humano. Para ello, ser necesario comprender las relaciones, directas e indirectas que existen entre los ecosistemas naturales y los humanos, base del respeto que pretendemos lograr hacia las fuentes de la vida en la Tierra. Tambin ser indispensable sustituir nuestras formas de vida "progresistas" de manejo del entorno, en aras de las cuales destruimos todo lo que podemos. Todo esto finalmente podra acercarnos a un desarrollo en armona con la Naturaleza, un Desarrollo en la Sustentabilidad.

El pensamiento sistmico y el desarrollo sustentable

En el Pensamiento Sistmico se encuentran las caractersticas requeridas para formar una sociedad que comprenda la necesidad de respetar y cuidar los recursos naturales, de no desperdiciar la energa, de acrecentar su acervo de conocimientos y de lograr la equidad, no slo entre los pueblos del mundo, sino entre todos los seres vivos del Planeta y, de poder ver el futuro como algo promisorio para todas las generaciones venideras. Esta forma de pensar nos obliga a ver los distintos horizontes de tiempo, donde podemos ubicar nuestra vida, nuestro pas, nuestro continente y nuestro planeta. Implica ver comportamientos y sus estructuras causales, como va para inducir cambios en los sistemas. Con todo ello podemos comprender "el todo", aunque no pudiramos ver o entender sus partes. Lo haramos sin necesidad de descomponerlo. Evitaramos tener que pensar en soluciones mgicas como la de que al reducir la sobrepoblacin se acabarn los problemas, puesto que existen muchas ms relaciones sistmicas. Al llevar poco a poco esta forma de pensar a nuestra vida diaria modifica la forma de ver las cosas y genera inquietudes e incomodidad, en un principio. Es comn que se lleguen a poner en discrepancia nuestras actividades con el modelo de sustentabilidad? S. Pero ser indispensable pasar por ese enfrentamiento interior en cada uno de nosotros, para iniciar el camino del Desarrollo Sustentable. No se pueden concebir cambios en la comunidad si no hay cambios en los individuos. El Pensamiento Sistmico, como modelo mental, adems est poniendo en tela de juicio varios de los paradigmas con los que hemos vivido hasta hoy. Entre ellos el del mtodo cientfico. Ser ya tiempo de renovar estos modelos ?.


Para terminar, recordemos la expresin del Jefe Seatle, de los indios norteamericanos: El hombre no teji la trama de la vida, es slo un hilo de ella.

Dada la complejidad de los problemas ambientales, de sostenibilidad de los recursos naturales, y de la preservacin de los ecosistemas, el Pensamiento Sistmico es uno de los caminos que tenemos ms claros, al menos en el presente, para conducirnos hacia lo que sera una sociedad sustentable. Proponemos que el Pensamiento Sistmico sea utilizado como herrameinta para avanzar hacia la sustentabilidad de nuestros sistemas humanos. Honorato Teissier Fuentes Una contribucin de la Universidad Autnoma de Coahuila, al Congreso Internacional NIKAN, celebrado en Quebec,Canada. Saltillo, Coahuila, Mxico, Septiembre de 1997 Honorato_Teissier@uqac.ca

1.- Senge, Peter M., La Quinta Disciplina (Ed. Espaol), Ed. Granica, 1990. 2.- Aranda A. Armando, Los lmites del reduccionismo molecular Revista Ciencia y Desarrollo, CoNaCyT, Jun 1994, pp 18-25. 3.- Hugunin, Carol, "Its Time me to bury Darwin Revista 21st. Century, USA,. Primavera de 1995, pp 32-45. 4.- Meadows, Dennis y Donella, Ms alla de los lmites del crecimiento, Ed. El Pas Aguilar, Madrid, Espaa, 1992. 5.- Nava Roberto, Gast Juan, Armijo Roberto, El Ecosistema UAAAN, Saltillo, Coah., Mxico, 1978. 6.- Estrada Alejandro y Coates-Estrada Rosamond, Las Selvas de los Tuxtlas, Veracruz. Ciencia y Desarrollo, CoNaCyT, Mxico, May-Jun. 1994, pp 50-61. 7.- Cereijido Alejandro, Del Caos de los demonios al caos de los bilogos , Universidad de Mxico, Revista de la UNAM, Mxico, D.F. Abr. 1996, pp 3-7. 8.- Teissier F. Honorato C. El enfoque de sistemas y la ecologa, Facultad de Sistemas, U.A. de Coahuila, Mxico, 1994. pp. 1-7, Saltillo, Coah., Mxico.



La Evolucin del Pensamiento Agroecolgico

Susanna B. Hecht - Universidad de California, Los Angeles El trmino agroecologa ha llegado a significar muchas cosas. Definidas a groso modo, la agroecologa a menudo incorpora ideas sobre un enfoque de la agricultura ms ligado al medio ambiente y ms sensible socialmente; centrada no slo en la produccin sino tambin en la sostenibilidad ecolgica del sistema de produccin. A esto podra llamarse el uso "normativo" o "prescriptivo" del trmino agroecologa, porque implica un nmero de caractersticas sobre la sociedad y la produccin que van mucho ms all de los lmites del predio agrcola. En un sentido ms restringido, la agroecologa se refiere al estudio de fenmenos netamente ecolgicos dentro del campo de cultivos, tales como relaciones predador/presa, o competencia de cultivo/maleza.

Visin Ecolgica
En el corazn de la agroecologa est la idea que un campo de cultivos es un ecosistema dentro del cual los procesos ecolgicos que ocurren en otras formaciones vegetales, tales como ciclos de nutrientes, interaccin depredador/presa, competencia, comensala y cambios sucesionales, tambin se dan. La agroecologa se centra en las relaciones ecolgicas en el campo y su propsito es iluminar la forma, la dinmica y las funciones de estas relaciones. En algunos trabajos sobre agroecologa est implcita la idea que por medio del conocimiento de estos procesos y relaciones los sistemas agroecolgicos pueden ser administrados mejor, con menores impactos negativos en el medio ambiente y la sociedad, ms sostenidamente y con menor uso de insumos externos. Como resultados, un nmero de investigadores de las ciencias agrcolas y de reas afines, han comenzado a considerar el predio agrcola como un tipo especial de ecosistema -un agroecosistema- y a formalizar el anlisis del conjunto de procesos e interacciones que intervienen en un sistema de cultivos. El marco analtico subyacente le debe mucho a la teora de sistemas y a los intentos tericos y prcticos hechos para integrar los numerosos factores que afectan la agricultura (Spedding 1975, Gliessman 1982, Conway 1985, Chambers 1983, Ellen 1982, Altieri 1983, Lowrance et. al. 1984).

La Perspectiva Social
Los agroecosistemas tienen varios grados de resiliencia y de estabilidad, pero estos no estn estrictamente determinados por factores de origen bitico o ambiental.


Factores sociales, tales como el colapso en los precios del mercado o cambios en la tenencia de las tierras, pueden destruir los sistemas agrcolas tan decisivamente como una sequa, explosiones de plagas o la disminucin de los nutrientes en el suelo. Por otra parte, las decisiones que asignan energa y recursos materiales pueden aumentar la resiliencia y recuperacin de un ecosistema daado. Aunque la administracin humana de los ecosistemas con fines de produccin agrcola a menudo ha alterado en forma dramtica la estructura, la diversidad, los patrones de flujo de energa y de nutrientes, y los mecanismos de control de poblaciones biticas en los predios agrcolas, estos procesos todava funcionan y pueden ser explorados experimentalmente. La magnitud de las diferencias de la funcin ecolgica entre un ecosistema natural y uno agrcola depende en gran medida de la intensidad y frecuencia de las perturbaciones naturales y humanas que se hacen sentir en el ecosistema. El resultado de la interaccin entre caractersticas endgenas, tanto biolgicas como ambientales en el predio agrcola y de factores exgenos tanto sociales como econmicos, generan la estructura particular del agroecosistema. Por esta razn, a menudo es necesaria una perspectiva ms amplia para explicar un sistema de produccin que est en observacin.

Un sistema agrcola difiere en varios aspectos fundamentales de un sistema ecolgico "natural" tanto en su estructura como en su funcin. Los agroecosistemas son ecosistemas semi-domesticados que se ubican en un gradiente entre una serie de ecosistemas que han sufrido un mnimo de impacto humano, como es el caso de las ciudades. Odum (1984) describe 4 caractersticas principales de los agroecosistemas: 1. Los agroecosistemas requieren fuentes auxiliares de energa, que pueden ser humana, animal y a combustible para aumentar la productividad de organismos especficos. 2. La diversidad puede ser muy reducida en comparacin con la de otros ecosistemas. 3. Los animales y plantas que dominan son seleccionados artificialmente y no por seleccin natural. 4. Los controles del sistema son, en su mayora, externos y no internos ya que se ejercen por medio de retroalimentacin del subsistema. El modelo de Odum se basa principalmente en la agricultura modernizada del tipo que se encuentra en los Estados Unidos. Hay, sin embargo, muchos tipos de sistemas agrcolas, especialmente en los trpicos, que no corresponden a esta definicin. Son especialmente sospechosas la cuestin de diversidad y la naturaleza de la seleccin utilizada en agriculturas complejas donde un sinnmero de plantas y animales semidomesticados y silvestres figuran en el sistema de produccin.


Conklin (1956), por ejemplo, describi agroecosistemas tradicionales en Filipinas que incluan ms de 600 especies de plantas que eran cultivadas y manejadas. Aunque esta agricultura no era tan diversa como la de algunos bosques tropicales, era definitivamente ms multiforme que muchos otros ecosistemas locales. Los sistemas agrcolas son un interaccin compleja entre procesos sociales externos e internos, y entre procesos biolgicos y ambientales. Estos pueden entenderse espacialmente a nivel de terreno agrcola, pero a menudo tambin incluyen una dimensin temporal. El grado de control externo versus control interno puede reflejar intensidad de administracin a lo largo del tiempo, el que puede ser mucho ms variable que el supuesto de Odum. En sistemas de roza, tumba y quema, por ejemplo, los controles externos tienden a disminuir en los perodos posteriores de barbecho. El modelo de agroecosistema de Odum marca un punto de partida interesante para la comprensin de la agricultura desde una perspectiva de los sistemas ecolgicos, pero no puede abarcar la diversidad y complejidad de muchos agroecosistemas que se desarrollaron en las sociedades no occidentales, especialmente en los trpicos hmedos. Ms an, la falta de atencin que el modelo pone en las determinantes sociales de la agricultura tiene como resultado un modelo con un poder explicativo limitado. Los sistemas agrcolas son artefactos humanos y las determinantes de la agricultura no terminan en los lmites de los campos. Las estrategias agrcolas no slo responden a presiones del medio ambiente, presiones biticas y del proceso de cultivo, sino que tambin reflejan estrategias humanas de subsistencia y condiciones econmicas (Ellen 1982). Factores tales como disponibilidad de mano de obra, acceso y condiciones de los crditos, subsidios, riesgos percibidos, informacin sobre precios, obligaciones de parentesco, el tamao de la familia y el acceso a otro t6ipo de sustento, son a menudo crticas para la comprensin de la lgica de un sistema de agricultura. En especial cuando se analizan las situaciones de los pequeos campesinos fuera de los Estados Unidos y Europa, el anlisis de la simple maximizacin de las cosechas en sistemas de monocultivo se hace menos til para la comprensin del comportamiento del campesino y de sus opciones agronmicas (Scott 1978 y 1986, Barlett 1984, Chambers 1983).

El Desafo Agroecolgico
Los cientficos agrcolas convencionales han estado preocupados principalmente con el efecto de las prcticas de uso de la tierra y de manejo de los animales o la vegetacin en la productividad de un cultivo dado, usando una perspectiva que enfatiza un problema objetivo, como es el de los nutrientes del suelo o los brotes de plagas. Esta forma de enfocar sistemas agrcolas ha sido determinada en parte por un dilogo limitado entre diferentes disciplinas, por la estructura de la investigacin cientfica, la que tiende a atomizar problemas de investigacin, y por un enfoque de la agricultura


orientado a lograr un producto. No cabe duda que la investigacin agrcola basada en este enfoque ha tenido xito e incrementar el rendimiento en situaciones agroecolgicamente favorables. Sin embargo, es cada vez mayor el nmero de cientficos que reconoce que este enfoque reduccionista limita las opciones agrcolas para las poblaciones rurales y en que el "enfoque objetivo" a menudo involucra consecuencias secundarias no intencionadas que frecuentemente han producido daos ecolgicos y han tenido altos costos sociales. La investigacin agroecolgica se concentra en asuntos puntuales del rea de la agricultura, pero dentro de un contexto ms amplio que incluye variables ecolgicas y sociales. En muchos casos, las premisas sobre el propsito de un sistema agrcola difieren del enfoque que enfatiza la maximizacin del rendimiento y la produccin, expuesto por la mayora de los cientficos agrcolas. Como mejor puede describirse la agroecologa es como un enfoque que integra ideas y mtodos de varios sub-campos, ms que como una disciplina especfica. La agroecologa puede ser un desafo normativo a las maneras en que varias disciplinas enfocan los problemas agrcolas. Tiene sus races en las ciencias agrcolas, en el movimiento del medio ambiente, en la ecologa (en particular en la explosin de investigaciones sobre los ecosistemas tropicales), en el anlisis de agroecosistemas indgenas y en los estudios sobre el desarrollo rural. Cada una de estas reas de investigacin tiene objetivos y metodologas muy diferentes, sin embargo, tomadas en un conjunto todas han sido influencias legtimas e importantes en el pensamiento agroecolgico.

Influencias de pensamiento agroecolgico Ciencias Agrcolas

Como Altieri (1987) lo ha sealado, el crdito de gran parte del desarrollo inicial de la agricultura ecolgica en las ciencias formales le pertenece a Klages (1928), quien sugiri que se tomaran en cuenta los factores fisiolgicos y agronmicos que influan en la distribucin y adaptacin de especies especficas de cultivos, para comprender la compleja relacin existente entre una planta de cultivo y su medio ambiente. Ms adelante, Klages (1942) expandi su definicin e incluy en ella factores histricos, tecnolgicos y socioeconmicos que determinaban qu cultivos podan producirse en una regin dada y en qu cantidad. Papadakis (1938) recalc que el manejo de cultivos debera basarse en la respuesta del cultivo al medio ambiente. La ecologa agrcola fue an ms desarrollada en los aos 60 por Tischler (1965) e integrada al curriculum de la agronoma en cursos orientados al desarrollo de una base ecolgica a la adaptacin ambiental de los cultivos. La agronoma y la ecologa de cultivos estn convergiendo cada vez ms, pero la red entre la agronoma y las otras ciencias (incluyendo las ciencias sociales) necesarias para el trabajo agroeocolgico, estn recin emergiendo.


Las obras de Azzi (1956), Wilsie (1962), Tischler (1965), Chang (1968) y Loucks (1977) representan un cambio de enfoque gradual hacia un enfoque ecosistmico de la agricultura. En particular fue Azzi (1956) quien acentu que mientras la meteorologa, la ciencia del suelo y la entomologa son disciplinas diferentes, su estudio en relacin con la respuesta potencial de plantas de cultivo converge en una ciencia agroecolgica que debera iluminar la relacin entre las plantas cultivadas y su medio ambiente. Wilsie (1962),analiz los principios de adaptacin de cultivos y su distribucin en relacin a factores del hbitat, e hizo un intento para formalizar el cuerpo de relaciones implcitas en sistemas de cultivos. Chang (1968) prosigui con la lnea propuesta por Wilsie, pero se centr en un grado an mayor en los aspectos ecofisiolgicos. Desde comienzos de los aos 70, ha habido una expansin enorme en la literatura agronmica con un enfoque agroecolgico, incluyendo obras tales como las de Dalton (1975), Netting (1974) van Dyne (1969), Spedding (1975), Cox y Atkins (1979), Richards P. (1984), Vandermeer (1981), Edens y Koenig (1981), Edens y Haynes (1982), Altieri y Letourneau (1982), Gliessman et al. (1981), Conway (1985), Hart (1979), Lowrance et al. (1984) y Bayliss-Smith (1982). A fines de la dcada del 70 y a comienzos de la del 80 un componente social cada vez mayor comenz a aparecer en la literatura agrcola, en gran parte como resultado del estudio sobre el desarrollo rural en los Estados Unidos (Buttel, 1980). La contextualizacin social unida al anlisis agronmico ha generado evaluaciones complejas de la agricultura, especialmente en el caso del desarrollo regional (Altieri y Anderson 1986, Brush 1977, Richards P. 1984 y 1986, Kurin 1983, Bartlett 1984, Hecht 1985, Blaikie 1984). Los entomlogos en sus intentos de desarrollar sistemas de manejo integrado de plagas, han hecho contribuciones valiosas al desarrollo de una perspectiva ecolgica para la proteccin de las plantas. La teora y la prctica del control biolgico de plagas se basa exclusivamente en principios ecolgicos (Huffaker y Messenger 1976). El manejo ecolgico de plagas se centra en primer lugar en enfoques que contrastan la estructura y el funcionamiento de los sistemas agrcolas con aquellas de sistemas naturales relativamente no perturbados, o sistemas agrcolas ms complejos (Southwood y Way 1970, Price y Waldbauer 1975, Levins y Wilson 1979, Risch 1981 y Risch et al. 1983). Browning y Frey (1969) han argumentado que los enfoques de manejo de plagas deberan hacer hincapi en el desarrollo de agroecosistemas que emularan la sucesin natural lo ms posible, debido a que estos sistemas ms maduros son a menudo ms estables que los sistemas consistentes en una estructura sencilla de monocultivos.

Enfoque Metodolgico
Una gran cantidad de mtodos de anlisis agroecolgico se estn desarrollando en la actualidad en todo el mundo. Se podra considerar que se utilizan principalmente cuatro enfoques metodolgicos:


1. Descripcin Analtica. Se estn realizando muchos estudios que miden y describen cuidadosamente los sistemas agrcolas y miden propiedades especficas tales como la diversidad de plantas, la acumulacin de biomasa, la retencin de nutrientes y el rendimiento. Por ejemplo, el Centro Internacional de Agroforestera (ICRAF) ha estado desarrollando una base internacional de datos de los diferentes tipos de sistemas de agroforestera y los est correlacionando con una variedad de parmetros medio ambientales para desarrollar modelos regionales de cultivos mixtos (Nair 1984, Huxley 1983). Este tipo de informacin es valiosa para ampliar nuestra comprensin de los tipos de sistemas existentes, de los componentes que habitualmente se encuentran ensamblados y en qu contexto ambiental. Este es el primer paso necesario. Los estudios representativos de este tipo de pensamiento son numerosos e incluyen a Ewel 1986, Alcorn 1984, Marten 1986, Denevent et al. 1984 y Posey 1985.

El anlisis Comparativo.
La investigacin comparativa generalmente involucra la comparacin de un monocultivo u otro sistema de cultivo con un agroecosistema tradicional de mayor complejidad. Los estudios comparativos de este tipo involucran un anlisis de la productividad de cultivos especficos, de la dinmica de las plagas o del estatus de los nutrientes en cuanto estn relacionados con factores tales como la diversidad de los campos de cultivo, la frecuencia de las malezas, la poblacin de insectos y los patrones de reciclaje de nutrientes. Varios estudios de este tipo se han llevado a cabo en Amrica Latina, Africa y Asia (Uhl y Murphy 1981, Marten 1986 y Woodmansee 1984). Dichos proyectos usan metodologas cientficas de tipo estndar para iluminar la dinmica de sistemas locales de cultivos mixtos especficos, comparndolos con los monocultivos. Estos datos a menudo son tiles pero la heterogeneidad de los sistemas locales puede oscurecer la comprensin de cmo stos funcionan.

Comparacin Experimental.
Para establecer la dinmica y para reducir el nmero de variables, muchos investigadores desarrollan una versin simplificada del sistema nativo en el cual las variables pueden ser controladas ms de cerca. Por ejemplo, el rendimiento de un cultivo mixto de maz, poroto y calabaza puede ser comparado al del cultivo simple de cada una de estas especies.

Sistemas Agrcolas Normativos.

Estos se construyen a menudo con modelos tericos especficos en mente. Un ecosistema natural puede ser ilimitado, o un sistema agrcola nativo podra ser reconstituido con mucho esfuerzo. Este enfoque est siendo evaluado en forma experimental por varios investigadores en Costa rica. Ellos estn desarrollando sistemas de cultivos que emulan las secuencias sucesionales por medio del uso de


cultivos que son botnica y morfolgicamente semejante a las plantas naturalmente ocurren en varias etapas sucesionales (Hart 1979, Ewel 1986).


An cuando la agronoma ha sido sin lugar a dudas la disciplina materna de la agroecologa, sta recibi una fuerte influencia del surgimiento del ambientalismo y de la expansin de los estudios ecolgicos. El estudio del medio ambiente fue necesario para proporcionar el marco filosfico en el cual el valor de las tecnologas alternativas y el proyecto normativo de la agroecologa pudieran apoyarse. Los estudios ecolgicos fueron crticos en la expansin de los paradigmas por medio de los cuales cuestiones agrcolas pudieran desarrollarse, y de las destrezas tcnicas para analizarlos.

Ambientalismo Importancia de este movimiento.

El movimiento ambiental de los aos 60 - 70 ha hecho una gran contribucin intelectual a la agroecologa. Debido a que los asuntos del ambientalismo coincidan con la agroecologa, ellos infundieron al discurso agroecolgico una actitud crtica de la agronoma orientada hacia la produccin, e hicieron crecer la sensibilidad hacia un gran nmero de asuntos relacionados con los recursos. La versin de los aos 60 del movimiento ambiental se origin como consecuencia de una preocupacin con los problemas de contaminacin. Estos eran analizados en funcin tanto de los fracasos tecnolgicos como de las presiones de la poblacin. La perspectiva Maltusiana gan una fuerza especial a mediados de la dcada del 60 por medio de obras tales como "La Bomba Poblacional" de Paul Ehrlich (1966) y "La Tragedia de los Comunes" de Garret Hardin (1968). Estos autores dieron como principal causa de la degradacin ambiental y del agotamiento de recursos al crecimiento de la poblacin. Este punto de vista fue tcnicamente ampliado por la publicacin de "Los Lmites del Crecimiento" del Club de Roma, el que utiliz simulaciones computarizadas de las tendencias globales dela poblacin, del uso de recursos y la contaminacin, para generar argumentos para el futuro, los que generalmente eran desastrosos. Esta posicin ha sido criticada desde perspectivas metodolgicas y epistemolgicas (Simon y Kahn 1985). Mientras que "Los Lmites del Crecimiento" desarroll un modelo generalizado de la "crisis ambiental", dos volmenes seminales posteriores contenan una relacin especial al pensamiento agroecolgico, porque en ellos se perfilaban visiones de una sociedad alternativa. Estos fueron "Ante-proyecto de la Supervivencia" (El ecologista, 1972) y "Lo Pequeo es Hermoso" (Schumacher, 1973). Estos trabajos incorporaban ideas sobre la organizacin social, la estructura econmica y valores culturales y las convertan en una visin exhaustiva ms o menos utpica.


"Ante-proyecto de la Supervivencia" argumentaba a favor de la descentralizacin de empresas de pequea envergadura y acentuaba las actividades humanas que involucraran un mnimo de disrupcin ecolgica y un mximo de conservacin de energa y materiales. El santo y sea era autosuficiencia y sustentabilidad. El libro de Schumacher acentuaba una evaluacin radical de la racionalidad econmica ("Economa Budista"), un modelo descentralizado de la sociedad humana ("dos millones de aldeas") y una tecnologa apropiada. El significado especial de "Lo Pequeo es Hermoso" era que estas ideas se ampliaron para alcanzar el Tercer Mundo. Problemas Agrcolas. Los asuntos ambientales en su relacin con la agricultura fueron claramente sealados por Carson en su libro "Primavera Silenciosa" (1964), el que planteaba interrogantes sobre los impactos secundarios de las substancias txicas, especialmente de los insecticidas, en el ambiente. Parte de la respuesta a estos problemas fue el desarrollo de enfoques de manejo de plagas para la proteccin de los cultivos, basados enteramente en su teora y prctica en los principios ecolgicos (Huffaker y Messenger 1976). El impacto txico de los productos agro-qumicos era slo una de las interrogantes ambientales, debido a que el uso excesivo de los recursos energticos tambin se estaba convirtiendo en un asunto cada vez ms importante. Era necesario evaluar los costos energticos de sistemas de produccin especficos: especialmente a comienzos de la dcada del 70 cuando los precios del petrleo se fueron a las nubes. El clsico de Pimentel y Pimentel (1979) demostr que en la agricultura americana cada kilo-calora derivado del maz se "obtena" a un enorme costo energtico de energa externa. Los sistemas de produccin norteamericanos fueron por lo tanto comparados con otros varios tipos de agricultura, los que eran de menor produccin por rea de unidad (en trminos de kilo-caloras por cada hectrea) pero mucho ms eficientes en trminos de rendimiento por unidad de energa invertida. El alto rendimiento de la agricultura moderna se obtiene a costa de numerosos gastos, los que incluyen insumos no renovables tales como el combustible de fsiles. En el Tercer Mundo esta energa a menudo es importante, y cargada a la balanza internacional de pagos, empeorando la situacin de endeudamiento de muchos pases en desarrollo. Ms an, debido a que la mayor parte de la energa no se utiliza para el cultivo de alimentos, la ganancia en la produccin no se traduce necesariamente en un mejor abastecimiento de alimentos (Crouch y de Janvry 1980, Graham 1984 y Dewey 1981). Finalmente, las consecuencias sociales de este modelo tienen impactos complejos y a menudo extremadamente negativos en la poblacin local, en especial en aquellos que tienen un acceso limitado a tierras y a crditos. Estos problemas se discuten en detalle ms adelante en este captulo. Los problemas de la toxicidad y recursos de la agricultura ensamblaron con los problemas mayores de la transferencia tecnolgica en contextos del Tercer Mundo. "La


Tecnologa Descuidada" (editada por Milton y Farvar en 1968) fue una de las primeras publicaciones que intent, en gran medida, documentar los efectos de proyectos de desarrollo y transferencia de tecnologas de zonas templadas, sobre las ecologas y las sociedades de los pases en desarrollo. Cada vez en mayor nmero, investigadores de diferentes reas comenzaron a hacer comentarios sobre la pobre "adecuacin" entre los enfoques que se dan al uso de la tierra en el Primer Mundo y la realidad del Tercer Mundo. El artculo de Janzen (1973), sobre agroecosistemas tropicales, fue la primera evaluacin ampliamente difundida de por qu los sistemas agrcolas tropicales podran comportarse de una forma diferentes a los de las zonas templadas. Este trabajo y el de Levins (1973) plantearon un desafo a los investigadores agrcolas, que los llev a repensar la ecologa de la agricultura tropical. Al mismo tiempo, el problema filosfico ms amplio planteado por el movimiento ambiental tuvo resonancia en la re-evaluacin de las metas del desarrollo agrcola en los Estados Unidos y en el Tercer Mundo, y en las bases tecnolgicas sobre las que seran llevadas a cabo. En el mundo desarrollado estas ideas slo tuvieron un impacto moderado en la estructura de la agricultura, porque la confiabilidad y disponibilidad de productos agroqumicos y energticos aplicados a la agricultura tena como resultado transformaciones pequeas en el patrn de uso de recursos en la agricultura. En situaciones en las que tanto los campesinos como la nacin estaban presionando por los recursos, donde prevalecan estructuras distributivas regresivas y donde el enfoque de las zonas templadas no era apropiado a las condiciones ambientales locales, el enfoque agroecolgico pareca de especial relevancia. La integracin de la agronoma y el ambientalismo ensambl con la agroecologa, pero los fundamentos intelectuales para una asociacin acadmica de este tipo eran an relativamente dbiles. Era necesario un enfoque terico y tcnico ms claro, especialmente en relacin con los sistemas tropicales. El desarrollo de la teora ecolgica tendra una relevancia especial en el desarrollo del pensamiento agroecolgico.

Por varias razones los ecolgos han tenido una importancia singular en la evolucin del pensamiento agroecolgico. En primer lugar, el marco conceptual de la agroecologa y su lenguaje son esencialmente ecolgicos. En segundo lugar, los sistemas agrcolas son en s mismos interesantes sujetos de investigacin, en los cuales los investigadores tienen mucho mayor habilidad para controlar, probar y manipular los componentes del sistema, en comparacin con los ecosistemas rurales. Estos pueden proporcionar condiciones de pruebas para un patrn amplio de hiptesis ecolgicas, y de hecho ya han contribuido substancialmente al cuerpo de conocimiento ecolgico (Levins 1973, Risch et al. 1983, Altieri 1987, Uhl et al. 1987).


En tercer lugar, la explosin de investigaciones sobre los sistemas tropicales ha dirigido la atencin al impacto ecolgico de la expansin de sistemas de monocultivos en zonas que se caracterizan por su diversidad y extraordinaria complejidad (Janzen 1973, Uhl 1983, Uhl y Jordan 1984, Hecht 1985). En cuarto lugar, varios eclogos han comenzado a dirigir su atencin a las dinmicas ecolgicas de los sistemas agrcolas tradicionales (Gliessmann 1982, Altieri y Farrell 1984, Anderson et al. 1987, Marten 1986, Richards 1984 y 1986).

Tres reas de inters acadmico han sido especialmente crticas en el desarrollo de los anlisis agroecolgicos: el ciclaje de nutrientes, las interacciones de plagas/plantas y la sucesin ecolgica. A modo de ilustracin esta seccin se concentrar en el ciclaje de nutrientes. A comienzos de los aos 60 el anlisis del ciclaje de nutrientes en los sistemas tropicales se convirti en un tpico de inters y fue considerado como un proceso vital del ecosistema. Varios estudios, tales como el estudio de Puerto Rico de Odum (1976), la investigacin de Nye y Greenland en 1961 y ms adelante la serie de artculos y monografas que derivaron de trabajos realizados en San Carlos, Venezuela, Catci, Costa Rica y otros lugares en Asia y Africa han sido la simiente que clarifica los mecanismos de los ciclajes de nutrientes, tanto en bosques nativos como en reas que han sido cultivadas (Jordan 1985, Uhl y Jordan 1984, Buschbacker et al. 1987, Uhl et al. 1987). Los hallazgos ecolgicos de esta investigacin sobre el ciclaje de nutrientes y que tuvieron un mayor impacto en el anlisis de la agricultura fueron: La relacin entre la diversidad y las estrategias inter-especies para captar nutrientes. La importancia de los rasgos estructurales para aumentar la captacin de nutrientes tanto abajo como encima del suelo. La dinmica de los mecanismos fisiolgicos en la retencin de nutrientes. La importancia de relaciones asociativas de plantas con micro-organismos tales como micorrizas y fijadores simbiticos de nitrgeno. La importancia de la biomasa como el lugar de almacenaje de los nutrientes.

Estos hallazgos sugeran que los modelos ecolgicos de la agricultura tropical incluiran una diversidad de especies (o al menos de cultivos) para aprovechar la variedad de absorcin de nutrientes, tanto en trminos de diferentes nutrientes como en la absorcin de nutrientes de los diferentes niveles de profundidad del suelo. La informacin producida por los estudios ecolgicos sobre el ciclaje de nutrientes tambin sugera el uso de plantas tales como las leguminosas que con facilidad forman


asociaciones simbiticas, y el uso ms extendido de plantas perennes en el sistema de produccin, como un medio para bombear nutrientes de las diferentes capas del suelo y aumentar as la capacidad total de reciclaje y almacenamiento de nutrientes en el ecosistema. No es sorprendente hallar que muchos de estos principios ya estaban siendo aplicados en numerosos sistemas agrcolas desarrollados por poblaciones locales en los trpicos. La mayor parte de la literatura ecolgica, la comparacin entre ecosistemas naturales y agroecosistemas se han basado en agroecosistemas desarrollados por ecologistas posteriormente a cierta observacin de un ecosistema local ms bien que despus de observar sistemas locales verdaderamente desarrollados. Ms an, la investigacin se centr en parmetros tales como la diversidad de semillas, acumulacin de biomasa y almacenaje de nutrientes en sucesin. Esta investigacin nos ha proporcionado cierta comprensin de algunas dinmicas de los sistemas agrcolas considerados como entidades biolgicas, pero hasta qu punto el manejo (con excepcin del llevado a cabo por algunos alumnos relativamente inexpertos) influye en estos procesos sigue siendo un rea casi enteramente inexplorada (un caso excepcionalmente sobresaliente en este aspecto es el Uhl et al. 1987). Las limitaciones del enfoque puramente ecolgico estn siendo cada vez ms superadas a medida que los investigadores comienzan a analizar los sistemas campesinos y nativos en equipos multi-disciplinarios y desde un perspectiva ms holstica (Anderson y Anderson 1983, Hecht et al. 1987, Anderson et al. 1987, Marten 1986, Denevan et al. 1984). Estos esfuerzos tienen como intencin el colocar a la agricultura en un contexto social: utilizan modelos nativos locales y explicaciones nativas del por qu se realizan ciertas actividades para el desarrollo de hiptesis que ms adelante pueden ser probadas por medio de modelos agronmicos y cientficos. Esta es un rea de investigacin floreciente con implicancias tanto tericas como aplicadas de mucha importancia, y una gran inspiracin para la teora y prctica de la agroecologa.

Sistemas nativos de produccin

Otra influencia mayor en el pensamiento agroecolgico es aquella que procede de los esfuerzos de investigacin de los antroplogos y los gegrafos dedicados a describir y analizar las prcticas agrcolas y la lgica de los pueblos nativos y campesinos. Tpicamente, estos estudios se han preocupado del uso de recursos y del manejo de toda la base de subsistencia, no solamente del predio agrcola, y se han concentrado en cmo los pueblos locales explican esta base de subsistencia, y en cmo los cambios sociales y econmicos afectan los sistemas de produccin. El anlisis cientfico del conocimiento local han sido un fuerza importante para reevaluar los supuestos de los modelos coloniales y agrcolas de desarrollo. La obra


pionera en este campo fue la de Audrey Richards (1939) sobre las prcticas de roza, tumba y quema (sistema citamene) en el Africa Bemba. El sistema citamene involucra el uso de desechos de rboles como compost en las prcticas agrcolas de los terrenos montaosos en Africa Central. Este estudio, que acenta los resultados de las tecnologas agrcolas y de las explicaciones ecolgicas de los pueblos nativos, contrasta diametralmente con aquella percepcin despreciativa de la agricultura nativa que considera las prcticas locales como desordenadas y de inferior calidad. Otra importante contribucin al estudio de sistemas de cultivo nativos fue el trabajo de Conklin (1956), el que sent las bases para la re-evaluacin de la agricultura itinerante, basado en dados etnogrficos y agronmicos sobre los Hnunoo de las Filipinas. Este trabajo seala la complejidad ecolgica y diversidad de los patrones de agricultura itinerante y la importancia de los policultivos, la rotacin de cultivos y sistemas de agroforestera, en el marco total de la produccin itinerante. Es uno de los estudios ms tempranos y ms ampliamente conocidos sobre la estructura y complejidad del cultivo de roza, tumba y quema, e incorpora mucha intuicin ecolgica. Fue de especial importancia el nfasis que Conklin puso en el conocimiento ecolgico nativo y la importancia que le asign a explotar esta rica fuente de comprensin etnocientfica. Sin embargo, l haca hincapi en que el acceso a esta informacin requera habilidades tanto etnogrficas como cientficas. Investigadores tales como Richards, P. 1984, Bremen y de Wit 1983, Watts 1983, Posey 1984, Denevan et al. 1984, Hecht y Posey 1987, Browkenshaw et al. 1979 y Conklin 1956, entre muchos otros, han estudiado los sistemas nativos de produccin y sus categoras de conocimiento sobre las condiciones ambientales y prcticas agrcolas. Este cuerpo de investigacin se centra en el punto de vista nativo de los sistemas de produccin y los analiza con los mtodos cientficos occidentales. Todos estos autores han hecho hincapi en que la organizacin social y las relaciones sociales de la produccin deberan considerarse tan de cerca como el medio ambiente y los cultivos. Este acento en la dimensin social de la produccin es una base importante para la comprensin de la lgica de produccin de sistemas agrcolas. Otro resultado importante de gran parte del trabajo sobre los sistemas nativos de produccin es la idea que se necesitan diferentes nociones de eficiencia y racionabilidad para comprender los sistemas nativos de campesinos. Por ejemplo, la eficiencia de produccin por unidad de labor invertida, ms bien que una simple relacin de rendimiento por reas es bsica para la lgica de produccin de muchos cultivadores del Tercer Mundo. Las prcticas que se centran en evitar riesgos, puede que no sean tan rendidoras a corto plazo, pero pueden ser preferibles a opciones de uso de tierras altamente productivas pero que tienen mayores riesgos. La disponibilidad de trabajo, en especial


en pocas importantes como es la de las cosechas, puede tambin influir en los tipos de sistemas agrcolas favorecidos. Este tipo de investigacin ha influido en el desarrollo de los argumentos contrarios a aquellos que atribuan el fracaso de la transferencia de tecnologa agrcola a ignorancia e indolencia. Este enfoque, con el acento en los factores humanos de los sistemas agrcolas, tambin pona ms atencin en las estrategias de los campesinos de diferentes estratos sociales, y cada vez ms en el rol de la mujer en la agricultura y el manejo de recursos (Deere 1982, Moock 1986). El anlisis etno-agrcola ha contribuido mucho a la expansin de las herramientas conceptuales y prcticas de la agroecologa. El enfoque (marco tnico) basado en la explicacin de una cultura dada ha sugerido relaciones que los marcos "tnicos" (es decir marcos externos, generalmente referidos a modelos occidentales de expansin) no capturan fcilmente, al basarse en los mtodos de la ciencia occidental. Ms an, esta investigacin ha explayado el concepto de lo que puede con provecho ser llamado agricultura, debido a que muchos grupos estn involucrados en la manipulacin de ecosistemas forestales a travs del manejo de la sucesin y la reforestacin actual (Posey 1985, Anderson et al. 1987, Alcorn 1984). An ms, la agricultura desarrollada localmente incorpora numerosos cultivos cuyo germoplasma es esencial para el "desarrollo" de programas de mejoramiento gentico como el de la yuca y porotos, y tambin incluye numerosas plantas con un potencial de uso ms amplio en ambientes difciles. Finalmente, dicho trabajo valora los logros cientficos de cientos de aos de cultivo de plantas y trabajo agronmico llevado a cabo por las poblaciones locales. El estudio de sistemas agrcolas nativos ha proporcionado gran parte de la materia prima para el desarrollo de hiptesis y sistemas de produccin alternativos para la agroecologa. Cada vez es ms amplio el estudio de la agricultura nativa realizado por equipos multidisciplinarios para documentar las prcticas y se han desarrollado categoras de clasificacin para analizar los procesos biolgicos dentro de los sistemas agrcolas y para evaluar aspectos de las fuerzas sociales que influyen en la agricultura. El estudio de sistemas nativos ha sido seminal en el desarrollo del pensamiento agroecolgico.

Estudios del desarrollo

El estudio del desarrollo rural del Tercer Mundo tambin ha sido una gran contribucin a la evolucin del pensamiento agroecolgico. El anlisis rural ha ayudado a clasificar la lgica de las estrategias locales de produccin en comunidades que estn sufriendo grandes transformaciones, a medida que las reas rurales se integran a economas regionales, nacionales y globales.


Los estudios sobre el desarrollo rural han documentado la relacin que existe entre los factores socioeconmicos y la estructura y organizacin social de la agricultura. Existen varios temas de investigacin sobre el desarrollo, que han sido de especial importancia para la agroecologa, incluyendo el impacto de las tecnologas inducidas desde afuera, el cambio de cultivos, los efectos de la expansin de mercados, las implicancias de los cambios de relaciones sociales y la transformacin en las estructuras de tenencia de tierras y de acceso a los recursos econmicos. Todos estos procesos estn ntimamente ligados. Cmo ellos afectan los agroecosistemas regionales es el resultado de complejos procesos histricos y polticos. La investigacin de la Revolucin Verde fue importante para la evolucin del pensamiento agroecolgico porque los estudios sobre el impacto de esta tecnologa fueron un instrumento que arroj luz sobre los tipos de prejuicios que predominaban ene l pensamiento agrcola y de desarrollo. Esta investigacin tambin tuvo como resultado el primer anlisis verdaderamente interdisciplinario de cuestiones de tenencia de tierras y del cambio tecnolgico en la agricultura desde un punto de vista ecolgico, social y econmico; todo esto realizado por un amplio espectro de analistas. La extraordinaria aceleracin del proceso de estratificacin social del campesino que se asocia a la Revolucin Verde indicaba inmediatamente que sta no era una tecnologa neutra en sus objetivos y resultados, sino ms bien que podra transformar dramticamente la base de la vida rural de un gran nmero de personas. Como lo hizo notar Perelman en 1977, los ms beneficiados por dichas tecnologas fueron los consumidores urbanos. La estrategia de la Revolucin Verde se desarroll cuando los problemas de la pobreza y el hambre eran considerados principalmente como problemas de produccin. Este diagnstico implic varias estrategias que se centraban en reas agrcolas en las que rpidamente podran llevarse a cabo aumentos de produccin, suelos de mejor calidad y tierras de riego entre granjeros con bienes materiales y de capital substanciales. Tuvo xito en trminos de elevar la produccin: en el fondo era parte de una poltica de apostar conscientemente al ms fuerte (Chambers y Ghildyal 1985, Pearce 1980). Es ahora generalmente reconocido que solamente el aumento agregado de la produccin de alimentos no soluciona el problema del hambre y la pobreza rural, aunque s puede reducir los costos de alimentos para los sectores urbanos (Sen 1981, Watts 1983). Las consecuencias de la Revolucin Verde en las reas rurales fueron tales que sirvieron para marginalizar a gran parte de la poblacin rural.


En primer lugar, centr sus beneficios en los grupos que eran ricos en recursos, acelerando as la diferencia entre ellos y los otros habitantes rurales, por lo que la desigualdad rural a menudo aument. En segundo lugar, socav muchas formas de acceso a la tierra y a los recursos, tales como los cultivos de mediera, el arriendo de mano de obra y el acceso a medios de riego y tierras de pastoreo. Esto redujo la diversidad de estrategias de subsistencia disponibles a las familias rurales y, por lo tanto, aument la dependencia del predio agrcola. El estrechamiento de la base gentica de la agricultura aument los riesgos porque los cultivos se hicieron ms vulnerables a plagas y enfermedades y a los caprichos del clima. En el caso de arrozales inundados o regados, la contaminacin generada por el uso de pesticidas y herbicidas a menudo min una importante fuente local de protenas: el pescado. El anlisis de la Revolucin Verde hecho desde el punto de vista de diferentes disciplinas, contribuy al primer anlisis holstico de las estrategias de desarrollo agrcola/rurales. Fue la primera evaluacin ampliamente difundida que incorpor crticas ecolgicas, tecnolgicas y sociales. Este tipo de enfoque y de anlisis ha sido el prototipo de varios estudios posteriores sobre la agroecologa, y el progenitor de la investigacin sobre sistemas de labranza. Es hoy ampliamente reconocido que las tecnologas de la Revolucin Verde pueden ser aplicadas en reas limitadas y ha habido peticiones de varios analistas del desarrollo rural en el sentido de re-dirigir la investigacin agrcola en la direccin de campesinos de bajos recursos. En el mundo existen por lo menos un billn de campesinos de recursos, ingresos y flujos de produccin muy limitados, quienes trabajan en un contexto agrcola de extrema marginalidad. Los enfoques que hacen hincapi en paquetes de tecnologas generalmente requieren de recursos a los cuales la mayora de los campesinos del mundo no tienen acceso (Tabla 2). Muchos analistas del desarrollo rural reconocen hoy las limitaciones para la agricultura de los enfoques tipo Revolucin Verde que enfatizan agricultura a gran escala, pero estos modelos agrcolas han dominado de una forma sorprendente los proyectos de desarrollo agrcola del Tercer Mundo. Mientras los resultados de las estaciones experimentales de investigacin se vean extremadamente promisorios, el bajo grado de adopcin por campesinos y de reproduccin exacta de los modelos en los campos, ha ocasionado grandes dificultades en muchos proyectos. El enfoque de transferencia de tecnologas tenda a acelerar las diferencias, exacerbando muchas situaciones polticas difciles o las tecnologas slo eran parcialmente adoptadas y en muchos casos no adoptadas del todo (Scott 1978 y 1986).


Varias eran las explicaciones para la baja transferencia de tecnologas, incluyendo la idea que los campesinos eran ignorantes y que era necesario ensearles a cultivar. Otro set de explicaciones se centr en las exigencias a nivel de granja, tales como la falta de crditos que limitaban la posibilidad de los campesinos de adoptar estas tecnologas. En el primer caso se considera que la falla est en el campesino; en el segundo se culpa a problemas de infraestructura de diferentes tipos. Nunca se critic a la tecnologa misma. Varios investigadores de terreno y practicantes del desarrollo se han sentido frustrados por estas explicaciones y un nmero cada vez mayor han sealado que las tecnologas en si requieren de una reevaluacin sustancial. Ellos han argumentado que la decisin del campesino de adoptar o no una tecnologa es la verdadera prueba de su calidad. A menudo a este enfoque se le ha llamado "el campesino primero y ltimo" o "el campesino vuele al campesino" o "la revolucin agrcola nativa". Segn dicen Rhoades y Booth (1982) "la filosofa bsica en la que se apoya este modelo es que la investigacin y el desarrollo agrcola deben comenzar y terminar en el campesino. La investigacin agrcola aplicada no puede comenzar aisladamente en un centro de experimentacin o con un comit de planificacin que est lejos del contacto con la realidad campesina. En la prctica esto significa obtener informacin acerca del campesino y comprensin de la percepcin que el campesino tiene del problema y la aceptacin de la evaluacin que el campesino hace de la solucin propuesta". Este enfoque requiere una participacin mucho mayor de parte del campesino en el diseo y la implementacin de programas de desarrollo rural (Chambers 1984, Richards P. 1984, Gow y Van Sant 1983, Midgley 1986).

Una consecuencia de esta posicin ha sido reconocer el gran conocimiento que el campesino tiene de la entomologa, botnica, suelos y agronoma, los que pueden servir como puntos de partida para la investigacin. En este caso tambin, la agroecologa ha sido identificada como una valiosa herramienta analtica asimismo como un enfoque normativo para la investigacin. La agroecologa encaja bien con los asuntos tecnolgicos que requieren prcticas agrcolas ms sensibles al medio ambiente y a menudo encuentra congruencias del desarrollo tanto ambiental como participativo con perspectivas filosficas. La diversidad de preocupaciones y de cuerpos de pensamientos que han influido en el desarrollo de la agroecologa son verdaderamente amplios. Sin embargo, esta es la extensin de los asuntos que inciden en la agricultura. Es por esta razn que ahora vemos agroeclogos con un entrenamiento mucho ms rico que el encontrado corrientemente entre los alumnos de ciencias agrarias centrados en una disciplina,


como asimismo muchos ms equipos multidisciplinarios trabajando en estos asuntos en el campo. Aunque es una disciplina en paales, y hasta el momento ha planteado ms problemas que soluciones, la agroecologa indudablemente ha ampliado el discurso agrcola. Tabla El contraste en condiciones fsicas y socioeconmicas de campesinos ricos en recursos versus aquellos pobres en recursos (Modificada de Chambers y Ghildyal 1985) Estaciones experimentales Topografa Suelos Deficiencas de nutrientes Riesgos (fuego, des- lizamientos, etc.) Irrigacin Tamao de la Unidad Enfermedades, plagas, maleza plana o terrazas profundos, pocas dificultades rara, solucionable irrelevantes frecuentemente, en completo control grande, adyacente controladas con agroqumicos, mano de obra Campesinos ricos en recursos plana o terrazas profundos, pocas dificultades ocasional pocos y controlables generalmente disponible, de fcil control Campesinos pobres en recursos ondulada o laderas delgados, no frtiles serias dificultades bastante comn comunes rara, poco confiable

grande o mediana- pequea, irregular mente adyacente no adyacente controladas con agroqumicos, mano de obra control cultural

Acceso a fertilizantes, semillas mejoradas

ilimitado confiable

alto, confiable

bajo, no confiable


alta calidad

alta calidad

semillas propias



buen acceso

poco acceso con escasez temporal



sin dificultad de obtener

mano de obra contratada

familia, escasez en temporadas crticas





Prioridad para la produccin de alimentos




BIBLIOGRAFIA Alcorn, J.B. 1984, Huastec Mayan Ethnobotany. Austin. Unv. Texas Press. Altieri, M.A. and M.K. Anderson, 1986. An ecological basis for the development of alternative agricultural system for small farmers in the Third World. Amer. J. Alter. Agric. 1:30-38. Altieri M.A. and J.G. Farrel 1984. Traditional Farming systems of south central Chile, with special emphasis on agroforestry. Agrofor. Syst. 2:3-18. Altieri, M.A. and D.K. Letourneau 1982. Vegetation management and biological control in agroecosystems. Crop Prot. 1:405-430. Altieri, M.A. 1987. Agroecology: The scientific basis of alternativo agriculture. Westview Press Boulder. Anderson, A. and S. Anderson. 1983. People and the Palm Forest. Washington. U.S. MAB Publ. Anderson, A., A. Gely, J. Strudwick, G. Sobel and M. Pinto. 1987. Un sistema agroforestal na varzea do Estuario Amaznico. Acta Amaznica (in press). Azzi, G. 1956. Agricultural Ecology. London-Constable. Bartlett, K. 1984. Agricultural Choice and Change. New York: Academic Press. Bayliss-Smith, T.P. 1982. The Ecology of Agricultural Systems. London-Cambridge Univ. Press. Blaikie, P. 1984. The Political Economy of Soil Erosion. New York: Methuen. Bremen, H. and C.T. de Witt. 1983 Rangeland productivity and exploitation in the Sahel. Science 221 (4618): 1341-1348.


Brokenshaw, D., D. Warren and O. Wener. 1979. Indigenous Knoeledge Systems in Development. Washington: Univ. Press of America. Browning, J.A. and K.J. Frey. 1969. Multiline curltivars as a means of disease control. Annu. Rev. Phytopathol. 7;355-382. Brush, S. 1977. Mountain, Field and Family, Philadelphia: Univ. Penn. Buschbacker, R., C. Uhl, E. Serrao. 1987. Abandoned pastures in Amazonia. II. Nutrient stocks. In: Soil and Vegetation. J. Ecol. (in press). Buttel, F.H. 1980. Agriculture, environment and social change: some emergent issues. In: The Rural Sociology of the Advanced Societies. F.H. Buttel and H. Newby, eds. New Yersey: Allenheld, Osmun and Co. Pp. 453-488. Carson, R. 1964. The Silent Spring. New York: Fawcett. Chambers, R. 1983. Rural Development: Putting the Last First. London: Longman. Chambers, R. and B.P. Ghildyal. 1985. Agricultural Research for resource-poor farmers: the farmer first and last. Agricultural Admi. 20:1-30. Chang, J.H. 1968. Climate and Agriculture. Chicago: Aldine Pub. Co. Conklin, H.C. 1956. Hananoo Agriculture. Rome: FAO Conklin, H.C. 1972. Folk Classification, a Topically Arranged Bibliography. New Have. Yale Univ. Dep. Anth. Conway, G.R. 1985. Agroecosystem analysis. Agri. Adm.20:1-30. Cox, G.W. and M.D. Atkins, 1979. Agricultural Ecology. San Francisco: W.H. Freeman and Sons. Crouch, L. and A. de Janvry. 1980. The class bias of agricultural growth. Food Policy 3-13. Dalton, G.E. 1975. Study of Agricultural Systems. London: Applied Sciences. Deere. C.D. 1982. Women and the sexual division of labor in Peru. Economic Development and Cultural Change. 30:795-811. Denevan. W., J. Tracy, and J.B. Alcorn. 1984. Indigenous agroforestry in the Peruvian Amazon: Examples of Bora Indian swidden fallows. Interciencia 96:346-357. Dewey, K. 1981. Nutritional consequences of the transformation from subsistence to commercial agriculture. Hum. Ecol. 9(2): 151-187.


Edens, T.C. and D.L.Haynes. 1982. Closed System agriculture: resource contraints, management options and design alternatives. Ann. Rev. Phytopathol. 20:363-395.

Edens, T.C. and H.E. Koenig. 1981. Agroecosystem management in a resourcelimited world. BioScience 30:697-710. Ehrlich, P. 1966. The Population Bom. New York. Ballantine. Ellen, R. 1982. Environment, Subsistence and System. New York: Cambridge Univ. Press. Ewell J.J. 1986. Designing agricultural ecosystems for the humid tropics. Ann. Rev. Ecol. And Systematics 17:245-271. Geertz, C. 1962. Agricultural Involution. Berkeley: Univ. Calif. Press. Ginzburg, C. 1983. The Night Beetles: Withcraft and Agrarian Cults in the Sixteenth and Seventeenth Centuries. London: Routledge and Kegan Paul. Gliessman, S.R. 1982. The agroecosystem: an integrative focus for the study of agriculture (un publ.man.). Gliessman, S.R., E.R. Garca and A.M. Amador. 1981. The ecological basis for the application of traditional agricultural technology in the management of tropical agroecosystems. Agro-ecosystems 7:173-185. Glover, N. And J. Beer. 1986. Nutrient cycling in two traditional central American agroforestry systems. Agrofor. Syst. 4:77-87. Gow, D. and J. Van Sant. 1983. Beyond the rethoric of participation. World Development. 11(5):427-446. Graham, D. 1984. Undermining Rural Development with Cheap Credit. Boulder: Westview Press. Hardin, G. 1968. The tragedy of the commons. Science 162:1243-1248. Hart, R.D. 1979. Agroecosistemas: conceptos bsicos. Costa Rica: CATIE. Hecht, S.B. 1985. Environment, development and politics: capital accumulation and the livestock sector in eastern Amazonia. World Development 13(6):663-684. Hecht, S.B. and D. Posey, 1987. Preliminary analysis of Kayapo soil management. Human Ecol. (in press). Hecht, S.B., A. Anderson and P. May. 1987. The subsidy from nature: palms, shifting cultivation and rural development. Human Organiz. (in press).


Huffaker, C.B. and P.S.Messenger. 1976. Theory and Practice of Biological control. New York: Academic Press. Huxley, P.A. 1983. Plant Research and Agroforestry. Nairobi: ICRAF. Irvine, D. 1987. Successional processes. In: Indigenous Land Management Among Native Amazonians. New York: New York Botanical Garden. Janzen, D.H. 1973. Tropical agroecosystems. Science 182:1212-1219. Jordan, C. 1985. Nutrient Cycling in Tropical Forests. New York: John Wiley and Sons. Klages, K.H.W. 1928. Crop ecology and ecological crop geography in the agronomic curriculum. J. An. Soc. Agron. 10:336-353. Klages, K.H.W. 1942. Ecological Crop Geography. New York: Mac Millan. Kuhn, T. 1979. The Relationship Between History and History of Science. In: Interpretive Social Science. R. Rabinow and W. Sullivan, eds. Berkeley: Univ. Calif. Press. Kurin, R. 1983. Indigenous agronomics and agricultural development ion the Indus basin. Human Organiza. 42(4):283-294. Levins, R. 1973. Fundamental and applied research in agriculture. Science 181:523524. Levins, R. and M. Wilson. 1979. Ecological theory and pest management. Ann. Rev. Entomol. 25:7-19.

Locuks, O.L. 1977. Emergence of research on agro-ecosystems. Ann. Rev. Eco.Sys. 8:173-192. Lowrance, R., B.R. Skinner and G.S. House. 1984. Agricultural Ecosystems. New York: Wiley Interscience. Marte, G.G. 1986. Traditional Agriculture in Southeast Asia: A Human Ecology Perspective. Boulder Westview Press. Merchant, C. 1980. The Death of Nature. Berkeley: Univ. Calif. Press. Midgeley, J. 1986. Community Participation, Social Development and the State. New York: Methuen. Milton, J. And T. Farvar. 1968. The Careless Technology. St. Louis: Wash.Univ.Press. Moock, J. 1986. Understanding Africa's Rural Households and Farming Systems. Boulder: Westview Press. Nair, P.K.R. 1984. Soil Productivity Aspects of Agroforestry. Nairobi: ICRAF.


Netting, R.Mc. 1974. Cultural Ecology. California: Cummings. Nye, P.H. and D.J. Greenland. 1961. The Soil under Shifting Cultivation. England: Comm.Agri.Bur. Odum, E. 1984. Roperties of agroecosystems. In: Agricultural Ecosystems. Lowrance et al. Eds. New York: Willew Intersci. Palmer, R. and N. Parsons. 1977. The Roots of Rural poverty in Central and Southers Africa. Berkeley: Univ.Calif.Press. Papadakis, J. 1938. Compendium of Crop Ecology. Buenos Aires, Argentina: Papadakis. Perelman, M. 1977. Farming for Profit in a Hungry World. New Jersey: Allanheld, Osmun and Co.Pub.Inc. Pimentel, D. and M. Pimentel, 1979. Food, Energy and Society. London: Edward Arnold. Price. P.W. and G.P. Waldbauer. 1975. Ecological aspects of pest management. I: Introduction to Insect Pest Management. R.L. Metcalf and W.H. Luckman, eds. New York: Wiley-Interscience, pp. 37-73. Rhoades, R. and R. Booth. 1982. Farmer back to farmer: a model for generating agricultural technology. Agri. Admin. 11(2):127-137. Richards, A. 1939. Land Labor and Diet in Northern Rhodesia. London: Routledge and Kegan Paul. Richards, P. 1984. Indigenous Agricultural Revolution. Boulder: Westview Press. Richards, P. 1986. Coping with hunger: Hazard and Experiment in African Rice Farming. Boulder: Westview Press. Risch, S.J. 1981. Insect herbivore abundance in tropical monocultures and polycultures: an experiment testo of two hypotheses. Ecology 62:1325-1340. Risch, S.J., D. Andow and M.A. Altieri. 1983. Agroecosystem diversity and pest control: data, tentative conclusions and new research directions. Env. Entomol. 12:625-629 Schumacher, R. 1973. Small is Beatiful. London: Abacus. Scott, J. 1978. The Moral Economy of the Peasant. Madison: Univ. Wiscon. Scott, J. 1986. Weapons of the Weak: Everyday Forms of Peasant Resistence. New Haven: Yale Press. Sen, A. 1981. Poverty and Famines. New York: Oxford Press.


Simon, J. And H. Kahn. 1985. The Resourceful Earth. New York: Oxford Press. Southwood, T.R.E. and M.J. Way. 1970. Ecological background to pest management. In: Concepts of Pest Management. R.L. Rabb and F.E. Guthrie, eds. North Carolina: North Carolina State University, pp. 6-28. Spedding, C.R.W. 1975. The Biology of Agricultural Systems. London: Academic Press. Tischler, W. 1965. Agrookologie. Jene: Eustan Fisher. Uhl, C. 1983. Nutrient uptake and nutrient-retention related characteristics of common successional species in the ypper Rio Negro region of the Amazon basin. (unpublished man). Uhl, C. and P. Murphy. 1981. A comparison of productivities and energy values between slash and burn agriculture and secondary succession in the upper Rio Negro region of the Amazon basin. Agroecosystems 7:63-83. Uhl, C. and C. Jordan. 1984. Vegetation and nutrient dynamics during the first five years of succession following forest cutting and burning in the Rio Negro region of Amazonia. Ecology 65:1476-1490. Uhl, C., R. Buschbacker and A. Serrao. 1987. Abandoned pastures in Amazonia. I. Patterns of plant succession. J.Ecol. (in press). Van Dyne, G.M. 1969. The Ecosystem Concept in Natural Resource Management. New York: Academic Press. Vandermeer, J. 1981. The interference production principle: an ecological theory for agriculture. BioScience 31:361-364. Wasserstrom, R. 1982. Land and Labor in Chiapas. Berkeley: Univ. California Press. Watts, M. 1983. Silent Violence. Berkeley: Univ. Calif. Press. Wilsie, C.P. 1962. Crop Adaptation and Distribution. San Francisco: W.H. Freeman Co. Wolf, E. 1982. Europe and the People Without History. Berkeley; Univ. California Press.


Teoras evolucionistas
El concepto sobre el origen de la vida se ha expresado histricamente desde dos grandes corrientes: la evolutiva o de transformacin de los seres vivos, controvertida por el fijismo, corriente que sostena que los seres vivos haban sido creados de forma definitiva y acabada y no presentaban cambios. Algunos de los defensores del fijismo fueron: Carl Von Linneo quien plante que las especies haban sido creadas de manera separada e independiente; y George Cuvier quien propuso la Teora creacionista, que deca, que los seres vivos eran inalterables e inmutables desde su creacin y que debido a constantes catstrofes naturales, como son los diluvios, terremotos, sequas algunas especies desaparecan y otras supervivan. Las teoras Evolucionistas explican el origen de las especies.

Teora Lamarkista
La primera teora que explica la evolucin es la Lamarkista propuesta por Jean Baptiste de Lamark basada en el desarrollo espontneo y en la herencia de los caracteres adquiridos Lamark sostena que al producirse cambios en el medio ambiente los seres vivos deban generar modificaciones (desarrollo, atrofia, o desaparicin) de sus rganos para lograr adaptarse y sobrevivir y estas modificaciones luego eran heredadas por sus descendientes. Por ejemplo, el alargamiento del cuello de las jirafas era un carcter adquirido que se explicaba por los persistentes esfuerzos adaptativos de las jirafas para alcanzar las hojas de los rboles.

Teora Darwinista
Propuesta por Charles Darwin, explica el origen de las especies por medio de la seleccin natural, la variabilidad y la supervivencia del ms apto. Darwin Plante que: Las especies cambian continuamente, con el tiempo unas se extinguen y aparecen otras nuevas. Darwin observ que las especies experimentan de manera espontnea , cambios estructurales a lo largo de generaciones suscesivas Los cambios se producen gradual y continuamente. Los organismos descienden de un antepasado nico, es decir, que los organismos semejantes estn emparentados. La evolucin es resultado de un proceso de seleccin natural. En una primera fase de la evolucin se produce variabilidad en cada generacin y en una fase posterior se


produce seleccin natural o lucha por la supervivencia, donde los ms aptos sobreviven y los ms dbiles desaparecen. Los ms aptos sobrevivirn y transmitirn a su descendencia las caractersticas de fortaleza. La teora de Darwin y su plantamiento sobre la supervivencia de los ms aptos di origen al funcionalismo que afirma que las caractersticas de los organismos vivos desarrollan funciones tiles.Darwin observ que si los cambios producen efectos favorables que permiten a los individuos reproducirse con mayor xito, estos cambios eran herdados por sus descendientes quienes a su vez pueden producir ms descendencia.

http://www.natureduca.com/bio_teorias_evol.htm Darwin afirma en su obra El origen de las especies que el hombre de hecho no produce variabilidad; lo nico que hace es exponer intencionadamente seres orgnicos a nuevas condiciones de vida, y luego la Naturaleza acta sobre la organizacin, y causa la variabilidad. Pero el hombre puede seleccionar y selecciona las variaciones que la Naturaleza le da, y de este modo las acumula de cualquier modo que desee. Adapta as animales y plantas a su propio beneficio o placer. Puede hacerlo metdicamente o puede hacerlo inconscientemente, preservando los individuos que le son ms tiles de momento, sin pensar en alterar la raza. No hay motivo aparente para que los principios que han actuado con tanta eficacia en la domesticacin no hayan actuado en la Naturaleza. Nacen ms individuos de los que pueden sobrevivir. La ventaja ms ligera en un ser, de cualquier edad o en cualquier estacin, sobre los dems seres con los cuales entra en competicin, o una adaptacin mejor, por mnima que sea, a las condiciones fsicas que le rodean, cambiar el equilibrio en su favor. En resumen, Darwin afirmaba que la evolucin es un proceso de seleccin natural en la cual, en una primera etapa se produce la mutacin, recombinacin y acontecimientos al azar (produccin de la variabilidad gentica), para en una segunda etapa quedar regulada esa variabilidad mediante la seleccin natural, y en la cual la seleccin artificial generada por el hombre no produce variabilidad.

Teora Neodarwinista
La Teora Neodarwinista o Teora Sinttica de la evolucin tiene su origen en la interpretacin de la teora Darwinista fundamentada en la gentica. Esta teora Esta teora se ha construido paulatinamente por cientficos tales como G. G. Simpson, Dobzhanski, Ernst Mayr, Thomas Henry Huxley, Dobzhansky, Alvaro Abeliuk Fischer, Sewall Wright, y otros. Segn esta teora los fenmenos evolutivos se explican bsicamente por medio de las mutaciones y la produccin de nuevas especies por reproduccin sexual, mecanismos que daran origen a las variaciones, preservadas luego por accin de la seleccin natural de los portadores de dotacin gentica ms favorable para hacer frente a las


presiones ecolgicas; estos portadores tienen una probabilidad de supervivencia y de procreacin ms alta que el resto de la poblacin.

Evolucin del hombre

Chiquitos pero muy hbiles

Los australopitcidos de hace tres y cuatro millones de aos eran bastante pequeos cuando llegaban a adultos. Medan no mas de 1.20 m y no pesaban ms de 40 kilos. Su cerebro era tambin pequeo, alrededor de 400 cm3 (la manera como se mide la capacidad del crneo es calculando el volumen; esto puede hacerse bastante fcilmente con crneos fsiles). Es decir, un australopitcido tena alrededor de 10 cm3 de cerebro por kilogramo de peso. Hace alrededor de 25 aos se encontr en la barranca de Olduvai, en frica Oriental un crneo fosilizado de hace aproximadamente 1 750 000 aos. Perteneci a un homnido que caminaba erguido y que tena un cerebro de 800 cm3 para sus 40 kilos de peso! Esto significa que comparado con los australopitcidos este homnido tena dos veces ms de capacidad craneana (el hombre actual tiene un cerebro bastante mayor, de aproximadamente 1 350 cm3, que para los 60-70 kilos de peso promedio es tambin el doble que el de los australopitcidos). Posteriormente, en 1972 se descubrieron otros restos de estos homnidos en el lago Turkana, frica, y se comprob en forma definitiva que el tamao del cerebro constitua la mayor diferencia con los australopitcidos. Adems de restos de huesos, en esos lugares tambin se han encontrado pedazos de las herramientas que construyeron estos homnidos, que, aunque de tamao pequeo, demuestran que tenan un cerebro relativamente grande. Es por esto que se les ha llamado Homo habilis, siendo, adems, de los primeros homnidos que aparecieron en el registro fsil a los que ya se les puede llamar hombres. Estos aparecieron hace dos millones de aos. Cuando los arquelogos buscan restos del pasado encuentran, adems de huesos, muchas otras cosas que les hablan de la organizacin social y los hbitos de los homnidos que vivieron entonces. En el lago Turkana, en frica, se ha descubierto uno de los sitios ms interesantes en este aspecto. Del cuidadoso anlisis de la basura dejada en un campamento usado por Homo habilis se ha podido entender el tipo de alimentacin y la utilidad que las diferentes herramientas tenan para aqullos. A partir de esta informacin se ha podido saber que sus actividades incluan la recoleccin de frutos y la caza. El hombre entonces cazaba en grupos y muy probablemente distribua la comida que, unos cazando y otros recolectando, diferentes miembros de la comunidad obtenan. As pues, la vida en comunidades donde se repartan las actividades ya exista hace dos millones de aos.

El homo erectus
Entre hace dos millones de aos y un milln de aos nuestro registro de homnidos vuelve a ser pobre. De no encontrar australopitcidos se ha concluido que se extinguieron en ese periodo de tiempo. Los nicos homnidos que quedaron desde


entonces pertenecen al gnero Homo. A su vez, el Homo habilis tambin desaparece del registro fsil, pero de hace un milln de aos se han descubierto una gran cantidad de fsiles que pertenecan a homnidos que usaban herramientas (por lo que se les considera del gnero Homo), adems de que ya conocan el fuego, puesto que en las cuevas que se han excavado hay restos calcinados y quemados de huesos, piedras y pedazos de madera. El descubrimiento de los primeros restos de estos homnidos, que son llamados Homo erectus en la actualidad, lo llev a cabo en Java un investigador holands llamado E. Dubois en 1891. En ese entonces se le llam Pitecanthropus (hombre-mono) erectus y muy pocas personas creyeron en la validez de ese descubrimiento. Se argumentaba que seguramente los restos pertenecieron a un hombre enfermo y con deformaciones. En general los restos de Homo erectus se han encontrado dentro de sedimentos de entre 800 000 y 300 000 aos. Los lugares donde se les ha hallado incluyen sobre todo Asia (China), frica (Argelia, Tanzania y Sudfrica) y Europa (Checoslovaquia y Hungra). De stos slo en Hungra y en China se han encontrado restos que comprueban que ya usaba el fuego. El tamao del crneo de Homo erectus, aunque grande (aproximadamente 1 000 cm3) no es tan grande como el del hombre actual. El uso del fuego le permiti sobrevivir en zonas en las que antes no se poda vivir por las bajas temperaturas. Esto ampli el rea de distribucin con respecto a la que tenan los australopitcidos o a los Homo habilis.

La conciencia de uno mismo

El registro fsil vuelve de nuevo a ser muy escaso entre hace 250 y 100 000 aos. En ese periodo el Homo erectus desaparece del registro fsil, pero aparece otro Homo en varias zonas de Europa, el cercano Oriente y la Unin Sovitica. En Europa se incluyen el valle de Neander, Alemania y varios sitios en Francia. En muchas de ellas se han encontrado restos que evidencian una cultura en donde ya se enterraba a los muertos! Estos tienen una antigedad de entre 100 y 40 000 aos. Eran hombres de una estatura promedio de 1.63 m y tenan una capacidad craneana aproximadamente 15% mayor que la del hombre moderno. Este hombre ha sido llamado Homo neandertalensis o tambin Homo sapiens neandertalensis. En el primer caso se le considera una especie diferente a la del hombre (Homo sapiens) mientras que en el segundo se le considera slo una subespecie de ste. Hasta donde sabemos, lo nico que lo distingue de aqul es su aparente incapacidad de utilizar smbolos para comunicarse. Un aspecto del ser humano que est ausente en los animales es la conciencia que tenemos de nuestra existencia como individuos. Esto mismo supone que tenemos conciencia de nuestra muerte y de lo que ella implica. Es quiz esto lo que ha generado en la humanidad la presencia de rituales entre los que se incluye el de enterrar a nuestros muertos.


El hombre moderno heredero de quin?

El hombre de Neandertal seguramente ya tena una conciencia similar, ya que se han hallado tumbas que incluyen, por ejemplo, hachas, huesos de otros animales, semillas y flores con las que se haca de los entierros rituales muy particulares. Por ejemplo, de la caverna de Shanidar, en Iraq, de donde se han desenterrado varios restos neandertalensis, se ha podido concluir que adems de enterrar a sus muertos ponan flores dentro de las tumbas. Esto se ha descifrado porque se han encontrado granos de polen de varias especies de plantas en grandes cantidades dentro de ellas. Los hombres, entonces, han honrado a sus muertos con flores desde hace aproximadamente 100 000 aos. El que el hombre haga rituales mortuorios no solamente se expresa enterrando a sus muertos. Los cadveres pueden ser colocados en lechos construidos de ramas y hojas en el exterior o incluso cremados. Esto puede haber sucedido pero jams lo sabremos, puesto que de estas dos costumbres, por razones obvias, no quedan restos en la actualidad.

Hay tres teoras acerca de la manera como apareci el hombre moderno y su relacin con el hombre de Neandertal. La primera propone que el hombre de Neandertal se extingui y de otra lnea de descendencia dentro del gnero Homo se origin el Homo sapiens. La segunda sugiere que el hombre de Cro-Magnon (primer fsil con las caractersticas del hombre moderno) reemplaz al hombre de Neandertal porque estaba ms adaptado al medio ambiente. La tercera, que se considera en la actualidad la ms probable, supone que la lnea de descendencia del hombre de Neandertal, que era muy diverso (Figura 20), evolucion transformndolo en lo que ahora es el hombre moderno


EVALUACIN Autoevaluacin 1 Preguntas Abiertas 1. Enumere los postulados de la teora celular 2. Las clulas pueden moverse por s mismas? Qu mecanismo utilizan? Pregunta de seleccin mltiple con nica respuesta 3. La smosis es un mecanismo de transporte de sustancias a la clula y consiste en el: a. Movimiento de sustancias a travs de la membrana, desde la solucin de mayor concentracin hacia la solucin de menor concentracin. b. Movimiento de solvente (agua) desde la parte ms concentrada hacia la menos concentrada. c. Movimiento de iones y molculas en contra del gradiente de concentracin y con consumo de energa. d. Transporte de lquidos al interior de la clula mediante movimientos citoplasmticos que engloban estas vesculas de lquido. e. Transporte de partculas slidas al interior de la clula, a travs de movimientos del borde del citoplasma y que engloban las partculas. 4. La mitsis como un proceso asexual para la reproduccin celular ocurre continuamente. Los principales pasos son interfase, profase, metafase, anafase y telofase. En la etapa de interfase de la divisin mittica sucede lo siguiente a. Aparicin de cromosomas largos y filamentosos. b. Formacin de cromtides c. Duplicacin del cido desoxirribonucleico (ADN) d. Alineamiento de cromosomas en el plano ecuatorial e. Separacin de los cromtides de cada cromosoma. Pregunta de seleccin mltiple con mltiple respuesta


En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con el siguiente cuadro Si 1 Si 2 Si 3 Si 2 Si 1 y y y y y 2 son correctas, 3 son correctas, 4 son correctas, 4 son correctas, 3 son correctas, marque marque marque marque marque a b c d e

5. Las clulas de acuerdo con su grado de complejidad en su organizacin y por su ubicacin dentro de la escala biolgica se pueden dividir en: eucariticas y procariticas, son caractersticas de las clulas ecuariticas 1. Presencia de membrana nuclear que delimita el ncleo del citoplasma. 2. Presencia de ADN en una regin nuclear diferenciada pero no delimitada por una membrana. 3. Presencia de organelos con morfologa y funcin especializada para cada uno. 4. Ausencia de membranas que separen los organelos entre s.

Completacin 6. Las clulas poseen una estructura altamente organizada, tienen capacidad de autorregulacin, de responder ante diferentes estmulos, de respiracin, de movimiento, de digestin, de reproduccin, de comunicacin. Diga cul es la principal funcin de cada uno de estos organelos:

Estructura Ribosoma Ncleo Mitocondria Lisosoma Retculo endoplasmtico


Informacin de retorno autoevaluacin1


Autoevaluacin 2 Preguntas Abiertas 1. Defina Homeostasis 2. Cul es la funcin de los ganglios linfticos? Pregunta de seleccin mltiple con nica respuesta 3. El conjunto de reacciones qumicas que ocurren al interior de las clulas y que le proporcionan a los seres vivos la materia y energa indispensable para desarrollar sus actividades vitales. Se denomina: a. Osmosis b. Respiracin c. Metabolismo d. Anabolismo e. Catabolismo. 4. El tejido que permite a la planta realizar la fotosntesis se denomina: a. Xilema. b. Parnquima c. Meristemtico d. Floema e. Colnquima Pregunta de seleccin mltiple con mltiple respuesta En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con el siguiente cuadro: Si Si Si Si Si 1 2 3 2 1 y y y y y 2 3 4 4 3 son son son son son correctas, correctas, correctas, correctas, correctas, marque marque marque marque marque a b c d e

5. Las principales funciones del tejido nervioso son: 1. Servir de sostn al organismo y permitirle el movimiento 2. Detectar, transmitir, analizar y dar respuesta a las variaciones internas y externas. 3. Coordinar el funcionamiento de las funciones del organismo. 4. Transportar y excretar metabolitos 6. Las sales biliares deben su coloracin a pigmentos como la bilirrubina. Entre las opciones dadas seleccione dnde son producidas y que funcin cumplen:


1. 2. 3. 4.

Se producen en el hgado Emulsifican las grasas Desdoblan las protenas Se producen en la vescula biliar.

Completacin 7. Los componentes del sistema circulatorio enunciados tiene como funcin: Estructura Funcin Capilares Corazn Leucocitos o glbulos blancos Glbulos rojos o eritrocitos Plaquetas Informacin de retorno autoevaluacin2 Autoevaluacin 3

Preguntas abiertas Desarrolle cuadros de Punnet para resolver los siguientes problemas y explique los resultados de genotipo y fenotipo heredados en la F1. 1. En los gatos el color negro del pelo es dominante frente al color blanco. Si se cruza una gata homocigota recesiva con un gato heterocigoto y tiene una camada de cuatro gatitos: a. Cul es el genotipo de los padres? b. Cul es el fenotipo de los padres? c. Cul es el genotipo de la descendencia en la F1? d. Cul es el fenotipo de los gatitos y en qu porcentajes? 2. Cules son las funciones del ADN? Pregunta de seleccin mltiple con nica respuesta 3. Un individuo es homocigtico para un carcter cuando a) Tiene dos alelos iguales b) Tiene dos alelos diferentes c) Tiene un alelo dominante y uno recesivo d) No tiene alelos para ese carcter informacin retorno autoevaluacin 3


Autoevaluacin 4 Preguntas Abiertas 1. Mencione cinco posibles usos de las bacterias. 2. A qu nos referimos cuando hablamos de microorganismos? Pregunta de seleccin mltiple con nica respuesta 3. Los diferentes grupos de protozoos se clasifican con base en su a. Habitat. b. Movilidad. c. Reproduccin. d. Tamao.

4. Las bacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Las bacterias se caracterizan por a. Ser procariticas, unicelulares, carentes de pared celular b. Ser eucariticas, pluricelulares, carentes de pared celular c. Ser procariticas, unicelulares, con pared celular d. Ser eucariticas, unicelulares, carentes de pared celular Pregunta de seleccin mltiple con mltiple respuesta En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con el siguiente cuadro Si Si Si Si Si 1 2 3 2 1 y y y y y 2 3 4 4 3 son son son son son correctas, correctas, correctas, correctas, correctas, marque marque marque marque marque a b c d e

5. Los virus como agentes infecciosos se caracterizan por: 1. Poseer un solo tipo de cido nucleico 2. Tener el material y mecanismo para su reproduccin.


3. Se reproducen en clulas vivas 1. Tener ARN y ADN conjuntamente. informacin de retorno autoevaluacin 4 Autoevaluacin 5 Seala si son verdaderas o falsas las siguientes afirmaciones 1. Los productores primarios en el ecosistema son los organismos autotrfos 2. El biotopo es el conjunto de los elementos no vivos que forman parte del ecosistema 3. La mayor parte de la biomasa de la biosfera se concentra en los productores primarios. 4. En el ecosistema los herbvoros son los productores primarios. 5. El factor que suele limitar la productividad del ecosistema es, casi siempre, la energa luminosa disponible. Pregunta de seleccin mltiple con nica respuesta 6. Al estudiar los ecosistemas interesa ms el conocimiento de las relaciones entre los elementos, que el cmo son estos elementos. La caracterstica ms importante de los ecosistemas es su a. Estabilidad dinmica b. Composicin qumica c. Relacin con los individuos d. Fuente de energa e. Equilibrio esttico 7. En la naturaleza el problema de desechos se soluciona por la accin de: a. Organismos auttrofos b. Organismos hetertrofos c. Condiciones climticas d. Descomponedores

8. Entre las especies se pueden establecer relaciones de competencia, aunque en muchas ocasiones, para lograr determinados fines se recurre a compromisos con otras especies que se manifiestan en asociaciones del tipo de una simbiosis. La relacin que se establece entre ciertos pjaros que se posan sobre el lomo de vacas y picotean garrapatas, beneficindose as las aves porque se


alimentan; mientras las vacas se liberan de los molestos parsitos, se denomina: a. Parasitismo b. Comensalismo c. Amensalismo d. Mutualismo e. Depredacin

9. En los ecosistemas se presentan flujos de energa, ciclos de la materia y relaciones alimentarias. El flujo de energa en el ecosistema es: a. Cclico y genera organizacin del sistema b. Lineal y genera organizacin del sistema c. Cclico y permite el reciclaje continuo d. Lineal y permite el reciclaje continuo

Preguntas abiertas 10. Cmo se relacionan los factores biticos y abiticos? 11. Por qu los seres vivos prefieren un habitat y evitan otros? Informacin de retorno autoevaluacin 5 Autoevaluacin 6 Preguntas abiertas 1. Por qu es importante la clasificacin de los organismos? 2. Cules son las 7 categoras principales en el sistema de clasificacin? 3. De las siguientes especies identifica las del mismo gnero: Avena sativa, Canis lupus, Zea maiz, Avena cayuse, Felis domestica, Viola papilonacea, Viola rostrata. 4. Diga en qu especies hay mayor afinidad : entre las especies que pertenecen al mismo filo y distinta clase o entre aquellas que pertenecen al mismo reino y distinto filo Pregunta de seleccin mltiple con nica respuesta 5. Segn el sistema de clasificacin de Whittaker a qu reino pertenecen los organismos con las siguientes caractersticas: unicelulares, eucariticos, su nutricin puede ser en algunos absortiva, ingestiva, en otros fotosinttica, pueden ser inmviles o desplazarse por medio de flagelos, su reproduccin se puede realizar por procesos asexuales o por procesos sexuales


a) Protista b) Hongos c) Plantas d) Animales e) Mnera

6. Existen muchos mtodos de clasificacin, segn la manera en que evalan ciertos caracteres. Entre ellos: el tradicional , la fentica, la cladstica. En el mtodo cladstico los organismos se agrupan en especies teniendo en cuenta: a) La similitud de carcteres morfolgicos y el parentesco filogentico b) Exclusivamente en funcin de su articulacin a grupos monofilticos. c) El nmero de carcteres que tienen en comn y su cuantificacin. d) Los caracteres morfolgicos y no morfolgicos y la variabilidad. Informacin de retorno autoevaluacin 6

Informacin de Retorno Autoevaluacin 1 Preguntas Abiertas 1. La clula es la unidad bsica estructural de todos los seres vivos, todos los organismos estn formados por clulas. La clula es la unidad funcional de todos los organismos. Todo el funcionamiento del organismo depende de las funciones que ocurren al interior de la clula, respiracin, reproduccin, digestin, crecimiento entre otras. Todas las clulas se originan por la divisin de clulas preexistentes (en otras palabras, a travs de la reproduccin). Cada clula contiene material gentico que se transmite durante este proceso. 2. La clula si puede desplazarse por s misma mediante: seudpodos, cilios o flagelos. Pregunta de seleccin mltiple con nica respuesta 3) b. 4) c. Pregunta de seleccin mltiple con mltiple respuesta 5) 1 y 3 = e Completacin 6.


Estructura Ribosoma Ncleo

Funcin Sntesis de protenas Crecimiento y reproduccin celular, almacenamiento y organizacin de los genes, transmisin de la informacin gentica. Produccin de energa -ATP- por oxidacin de los alimentos o respiracin celular Digestin celular (hidrlisis de macromolculas), destruccin de microorganismos nocivos para la clula, digestin de organelos defectuosos Transportar materiales dentro de la clula


Lisosoma Retculo endoplasmtico

Informacin de Retorno Autoevaluacin 2 Preguntas Abiertas 1. La Homeostasis es la capacidad de todos los seres vivos de mantener constante las condiciones fsicas y qumicas de su medio interno. 2. Filtrar la linfa, destruir y eliminar de ella las sustancias txicas y los microorganismos infecciosos antes de su circulacin por el torrente sanguneo. Pregunta de seleccin mltiple con nica respuesta 3.) c 4.) b Pregunta de seleccin mltiple con mltiple respuesta 5.) 2 y 3 = b 6.) 1 y 2= a Completacin 7.


Estructura Capilares Corazn

Funcin Intercambio de gases y nutrientes Bombear toda la sangre hacia el torrente sanguneo

Leucocitos o glbulos Defensa blancos Glbulos rojos o eritrocitos Plaquetas Transporte de oxgeno Participar en la coagulacin de la sangre

Informacin de retorno 3 Pregunta abierta a. El genotipo de la gata es nn por ser homocigota recesiva El genotipo del gato es Nn por ser heterocigoto b. El fenotipo de la madre ser blanco (para que este se manifieste tiene que ser homocigoto), el fenotipo del padre es negro c. La camada de cuatro gatitos ser el resultado Nn x nn

N n n Nn Nn

n nn nn

Entonces el genotipo de la descendencia es 50% heterocigoto Nn y 50% homocigoto nn d. El fenotipo de la camada es de 50% negros y 50% blancos.

2. Funciones del ADN Almacenamiento codificado de la informacin gentica que determina las caractersticas futuras de la clula y de los organismos que se desarrollen a partir de dicha informacin. Replicacin de si mismo o sea elaboracin de una copia idntica del ADN. Transferencia mediante el ARN (cido Ribonucleico) de la informacin gentica a las molculas que realizan la sntesis de protenas por intermedio de los aminocidos que son las unidades que forman las protenas.


Seleccin mltiple con nica respuesta a. Cuando tiene dos alelos iguales.

Informacin de retorno 4 Preguntas abiertas 1. Las bacterias son tiles: Para fijar nitrgeno atmosfrico que es tomado por las plantas y luego trasferido a los animales. En la descomposicin de materia orgnica muerta ayudando de esta manera a la fertilizacin del suelo En la produccin de algunos antibiticos En la produccin de determinadas enzimas En la elaboracin de productos lcteos como: queso, yogur , mantequilla En la produccin de vinagre En la depuracin de aguas residuales En el curtido de cueros La Echerichia coli ha sido manipulada genticamente para producir insulina

2. Los microorganismos son organismos unicelulares generalmente microscpicos que se dividen en: virus; bacterias; protozoos, algunas algas y hongos. Pregunta de seleccin mltiple con nica respuesta 3.) b. 4.) c. Pregunta de seleccin mltiple con mltiple respuesta 5.) 1 y 3 = e Informacin de retorno 5 Preguntas falso o verdadero 1) 2) 3) 4) 5) V F V F V


Pregunta de seleccin mltiple con nica respuesta 6.) 7.) 8.) 9.) a. d. d b.

Preguntas Abiertas 10. Los factores biticos y abiticos se interrelacionan para constituir un ecosistema, donde cada uno depende del otro, modificndose y transformndose mutuamente a travs de la actividad de los seres vivos y las condiciones ambientales para producir un sistema estable en el cual el intercambio de sustancias entre los organismos vivos y los elementos inertes es de tipo circular. 11. Porque cada especie vegetal o animal o microorganismo tienen un requerimiento ptimo para los diversos factores abiticos en el que pueden desarrollar mejor sus funciones, igualmente con los dems seres vivientes tiene interrelaciones que le permiten asegurar su alimentacin, territorio, proteccin, reproduccin La distribucin geogrfica de una especie puede estar determinada por el grado en el cual sus requerimientos son cumplidos por los factores abiticos presentes. Cada especie tiene: un ptimo, un rango de tolerancia, un lmite de tolerancia con respecto a cada factor abitico. Informacin de retorno 6 Preguntas abiertas 1. Para poder entender su origen, su evolucin y las relaciones de parentesco entre s. 1. Reino, Filo, Clase, Orden, Familia , Gnero, Especie. 3. Avena sativa, y Avena cayuse, Viola papilonacea, y Viola rostrata 4. Hay mayor afinidad entre las especies que pertenecen al mismo filo y distinta clase. Pregunta de seleccin mltiple con nica respuesta 5.) a 6.) b


GLOSARIO Glosario Disciplinar Biotipo: Poblaciones con el mismo genotipo. Estructura: En las ciencias biolgicas, la estructura se refiere a la organizacin de los seres vivos como un conjunto de clulas, organelos, rganos, y sistemas histolgicoorgnicos, como soporte fsico para la manifestacin de las actividades de la vida segn la expresin gentica heredada. Funcin: Capacidad de actuar propia de los seres vivos y de sus rganos. Diversidad: abundancia relativa de las especies presentes en regiones biogeogrficas y en nichos ecolgicos especficos. Gentica: Parte de la biologa que trata de la herencia y de lo relacionado con ella. Estudio cientfico de cmo se transmiten los caracteres fsicos, bioqumicos y de comportamiento de padres a hijos. Evolucin: Desarrollo de los organismos, por medio del cual pasan gradualmente de un estado a otro, descendencia con modificaciones, proceso por el que todos los seres vivos de la Tierra han divergido, por descendencia directa, a partir de un origen nico que existi hace ms de 3.000 millones de aos. La palabra evolucin tiene cuatro significados que suelen confundirse y deberan mantenerse separados y distintos: 1) el proceso general del cambio en poblaciones y especies, considerado un hecho cientfico establecido; 2) el progreso inevitable desde formas de vida inferiores a otras superiores, un concepto que ha quedado desacreditado; 3) la historia concreta del arbusto ramificado de la vida y el origen de grupos diversos o filogenias, interpretado a partir del registro fsil y los estudios bioqumicos, y 4) el mecanismo, o motor, de la evolucin, para el que Darwin y Wallace propusieron la seleccin natural, pero que en la actualidad est siendo estudiado y modificado por la investigacin de Richard Milner. Interacciones ecolgicas de organismos vivos: se refieren a las influencias mutuas, benficas o perjudiciales que pueden presentarse entre organismos que comparten un mismo nicho ecolgico y su impacto sobre el entorno ambiental. Genoma: conjunto de todos los genes de un organismo, de todo el patrimonio gentico almacenado en el conjunto de su ADN o de sus cromosomas. Gestin sostenible: Se entiende por gestin sostenible la que permite el crecimiento econmico, la elevacin de la calidad de vida y el bienestar social sin agotar la base de los recursos naturales renovables en que se sustenta, ni deteriorar el medio ambiente o el derecho de las generaciones futuras a utilizarlo para la satisfaccin de sus propias necesidades.


Glosario Pedaggico Competencia cognitiva o bsica: Hace referencia a la capacidad de identificar conceptos, analizarlos, reconceptualizarlos e incorporarlos a la estructura cognitiva del estudiante. Competencia metacognitiva o compleja: Se relaciona con la capacidad de reflexionar sobre el proceso de construccin conceptual. En otras palabras se refiere a conocer cmo se logra aprender y cmo se pueden cualificar las estrategias y mtodos para potenciar el conocimiento. Competencia transversal o paracognitiva: Se refiere a la capacidad de integrar los conocimientos y las experiencias en enfoques alternativos de saberes funcionales para nuevos contextos. Operaciones metacognitivas: Son operaciones mentales de las que el estudiante es consciente, se relacionan con la seleccin de procedimientos para aprender, permiten la autoevaluacin, la autorregulacin y la reflexin.