Geology, Geography, Diet, and Climate Change: How Natural Environments Influenced Hominid Brain Growth Steve J.

Hartwick Abstract: Around 50 million years ago, the geologic forces of plate tectonics began pushing East Africa upwards. As this happened, the once dominate African jungles in the region began to recede, and in time, East Africa became a sprawling grassland. A change of this magnitude would have been the evolutionary catalyst needed to fuel a new lineage of unique adaptations for animals living in the East African savanna. This paper is written with the intention of explaining how these adaptations to changes in temperature, terrain, and diet worked together to produce the most intelligent animal on the planet.

Introduction Ever since Charles Darwin introduced the theory of evolution in 1859, scientists and naturalists have sought to explain what natural occurrences could have led to our species becoming the intellectual global force that we are today. In 2004, Dr. Hansell Stedman published an article detailing how a mutation in one of the genes encoding the myosin heavy chain in the chewing muscles of humans could have been the driving force in archaic hominid cranial expansion. While I believe the mutation to this particular gene (which I will detail later) was important, my intention is to demonstrate how several evolutionary adaptations worked together to promote brain growth and intelligence in our lineage. I hypothesize that no single factor is responsible for human brain expansion, but that our intelligence is the culmination of many separate adaptations evolving together simultaneously. The remainder of this paper is a compilation of facts in support of the previous statement. Before I can detail the evolutionary changes that led to a hairless, upright, and brainy primate, I feel that I must first give a brief synopsis of how the evolutionary process actually works. There is a general misconception of evolution within America, and by briefly addressing this issue first, the remainder of the article should read much more smoothly to those unfamiliar with the scientific

principal of evolution. I've been asked by several people how I can believe in evolution when no species has ever been seen giving birth to a brand new species in nature. The mountains of evolutionary evidence aside, this question stems from a complete misunderstanding of how natural selection operates. No biologist in the world believes that new species are created by sudden, or dramatic genetic changes as extreme as new creatures simply being born into existence. In actuality, evolution is fueled by genetic and geographic separation of the same, once interbreeding population. Naturally occurring tectonic pressure, coupled with global climate change cycles, are responsible for the vast majority of the variety of life we now enjoy. Over the roughly 3.8 billion years that life has existed on earth, the geologic forces of plate tectonics have pushed up mountain ranges, pulled apart continents, and formed numerous other natural boundaries. As a result, populations gradually become separated over time, and are no longer able to interbreed. A change in environment, combined with genetic isolation from the parent group, is the spark natural selection needs to foster new adaptations. Those individuals with genes making them better suited to their new environments are more likely to survive to pass on their genetic data, while the other less fit individuals will typically be removed from the population via natural selection. Given what we now know from the fields of genetics and molecular biology, genes within populations will mutate at a relatively consistent rate. These genetic mutations, coupled with genetic isolation from the parent group, will over time be substantial enough to prevent the two groups from producing fertile offspring with one another, and speciation will have occurred. We have witnessed small (but significant) genetic and physical changes in organisms over the span of just 40 years1 imagine what nature could do in 3.8 to 4 billion.
1 In 1971, a group of biologists uprooted five adult pairs of Italian wall lizards from their home island of Pod Kopiste with the intention of testing how rapidly animals can evolve to new environments/diets. The animals were observed in a controlled environment, and by 2004, had produced descendants with considerable physical and genetic differences to the initial group. One group had even developed a genetic mutation which altered their digestive anatomy by adding entirely new structures called cecal valves (Vervust et al., 2010).

Discussion Most simply stated, evolution is adaptation to changing environments. The individuals best suited for survival have a much higher probability of passing on their genes, while the more unsuccessful individuals will likely die before reproducing2. The common ancestor we shared with our closest evolutionary cousins, the chimpanzees, was undoubtedly more apelike than human. Something occurred in the distant past that (A) prevented the two previously interbreeding populations from mating, and (B) consequentially fueled one particular branch to change significantly.

Catalyst #1: Plate Tectonics Roughly 50 million years ago, the northeastern edge of the African plate began to collide with the European plate. In time, the massive amount of geologic pressure generated from this event buckled the continent of Africa. This in turn pushed East Africa upwards, subsequently creating the East African Rift Valley anywhere from 8 to 15 million years ago (Maslin et al. 2007). Based on the information we have from one of the newest, and most exciting fields in life science molecular biology we can trace the genetic split from the common ancestor we share with Chimpanzees to around 7 million years ago3 (Dawkins, 2004). This is either an incredible coincidence, or evidence of the role plate tectonics played in the evolution of our lineage. The emergence of the East African savanna is the first of several evolutionary catalysts in hominid brain growth, because it physically separated our lineage from the common ancestor we once shared with Chimpanzees, promoting rapid genetic mutations along each line. As East Africa was forced upwards, the once dominate jungles of the region would have begun to recede. This is in fact the process that created the open grasslands of the African savanna we see today. All of the animals living in this portion of the evolutionary ark if you will, would have gradually become adapted to life in a new environment. An environmental change of this magnitude
2 Generation after generation of this same process is what I will refer to as genetic fine tuning. 3 From here forward, I will use the acronym mya, in place of million years ago.

would inevitably encourage adaptations to every animal living in the region our ancestors included. It was the disappearance of the jungles, and the emergence of the savanna which influenced the second catalyst in hominid brain growth: bipedalism.

Catalyst #2: Bipedalism Once the jungles of East Africa began to disappear, there would have been a push by natural selection in favor of those individuals best suited for more efficient mobility in this new habitat. Based on the fact that our three closest genetically related relatives (chimpanzees, gorillas, and orangutans) are knuckle-walkers, we can assume that the common ancestor we share with chimpanzees exercised this same type of locomotion. Because of the jungle surroundings, knuckle-walking is a perfectly feasible way to get around for these animals. With an almost 100% plant diet, food sources are not all that far away in areas of dense vegetation there is simply no reason to cover large distances on a regular basis. However, as food sources became more and more sparse in the expanding savannas of East Africa, a more practical mode of mobility would have been necessary for our ancient ancestors. Walking upright is much more beneficial for primates in this kind of environment, because not only can you move faster from one area to the next, you can also carry items (food/babies) much further not to mention standing upright would have had immediate benefits in spotting potential predators lurking in the tall grass. As the jungles began to recede, natural selection would have favored those individuals best suited for walking upright over longer and longer distances, and after about a million years of genetic fine tuning (which gradually narrowed the pelvis, and lengthened the femur), we begin seeing the fossil evidence of increasingly dominate bipedalism. By around 3.7 mya, evolution had produced the first obligate bipedal primate with a species called Australopithecus afarensis (Relethford, 2010). I listed bipedalism as a catalyst for brain growth, because walking upright freed up the use of our hands. It is the utilization of our hands that led to the advent of tool use, and subsequently

encouraged problem solving, as well as rational and cognitive thought. Nothing significant humankind has accomplished in the history of our existence would have been possible without the full use of our hands. This was the first real step into the expansion of our most valuable organ.

Catalyst #3: Dietary Change As the jungles in East Africa began to disappear, our ancestors would have been faced with a dietary dilemma. In order to maintain a high enough calorie intake, other food sources would need to be added to our diets. There was a time in the distant past when we were total herbivores4 (hence the existence of our appendix), but as the once abundant food sources slowly disappeared over millions of years, it would have been imperative to add another high protein substance to the diet: the addition of meat was the answer. The emerging grassland environment of East Africa would have naturally driven many animals to become proficient hunters, and other animals to become more elusive prey an evolutionary arms race. It is no coincidence that we find some of the most efficient killing machines on earth living in this region. We ourselves became one of the most skillful pack hunters on the planet, although this likely didn't start until around 150,000 years ago. Prior to hunting, evidence suggests we began eating meat around 2.5 mya by scavenging the kills of other carnivores in the area (Luca et al., 2010). Given what we know from both the fossil record and molecular biology, a rapid expansion of the brain also began around 2.5 mya. While this is clearly seen in the hominid fossil record, there has been much speculation over the driving force. As I stated in the introduction, I hypothesize that there was not just one, but several factors working together. One of the biggest contributors, however, was undoubtedly the addition of meat to our diets. In 2010, Adam Pfefferle did comparative research on the differences between phosphocreatine circuit genes in cerebral cortex, cerebellum, and skeletal muscle tissue for humans, chimpanzees, and
4 Although I say total herbivores, like chimpanzees, we probably also ate a variety of bugs and grubs.

rhesus macaques. Because creatine helps maintain homeostasis in brain and muscle tissue, it seems only logical that additions of this substance in high quantities would have had an impact on early hominid brain expansion. Couple the addition of creatine with the fact that the full use of our hands likely led to in-depth problem solving, and you have the recipe for an evolutionary explosion. In his own words, Dr. Pfefferle's initial hypothesis was this: Creatine, an essential metabolite for energy homeostasis in muscle and brain tissue, is abundant in meat and was likely ingested in higher quantities during human origins (Pfefferle et al., 2010 p. 205). Dr. Pfefferle isolated five phosphocreatine circuit proteins in particular, which help regulate creatine utilization within the high-energy demanding cells of the brain and muscles. Of these five, SLC6A85 (a creatine transporter) and CKB6 (a brain type creatine kinase) appear in much higher quantities within the human lineage. Via the study orchestrated by Dr. Pfefferle, it was shown that these substances increase the energy availability and turnover in the human brain, and are much more abundant within the human line than in any other primate studied. (205, 208). Given the fact that we are the only great ape to have such a high protein diet, this seems perfectly reasonable. When the dense vegetation began to disappear in East Africa, natural selection would have favored those individuals who were able to digest meat. Those who were able would have a much better chance of surviving to pass their meat-digesting genes to the next generation. Those who could not digest meat would likely starve to death, given the fact that there was simply no longer enough vegetation around to support a strictly plant diet7. Over time, the entire population would be capable of digesting meat, and the group would have become omnivorous. This is a perfect example of how natural selection works, and it was this very process that eventually made us omnivorous. Without this key event, our metabolically expensive brains would have never had the fuel to grow.
5 The phosphocreatine circuit begins with the active transport of creatine through a dedicated transmembrane protein, SLC6A8, into energetically expensive tissues, such as the brain and skeletal muscle. ( Pfefferle et al., 2010 p. 208) 6 Complementary to their mitochondrial counterparts, the cytosolic kinases drive the production of ATP. ( Pfefferle et al., 2010 p. 208) 7 Obviously there are still herbivores in East Africa. Here I am referring to our lineage in particular, and the diet we were accustomed to.

Catalyst #4: MYH16 As a direct result of the addition of meat, and overall change in diet (Luca et al., 2010) came one of the most fortunate genetic mutations in the history of human evolution. Around 2.4 mya8, there was a mutation in the MYH16 gene, which essentially controls the growth of the chewing muscles in the great ape family. According to Dr. Luca's article Evolutionary Adaptations to Dietary Changes, This deletion may have been associated with the gracilization of the masticatory apparatus in humans (304). Gracilization refers to the loss of dominate ape-like features to our face and skull, which were evolutionary adaptations to a change in diet9. The anatomical result of this particular mutation was the deactivation of the myosin heavy chain in the human lineage. Per Hansell Stedman: Loss of this protein iso-form is associated with marked size reductions in individual muscle fibres and entire masticatory muscles (Stedman et al., 2004, p. 415). A gross oversimplification of MYH16 mutation is this: within the great ape family, Homo sapiens are the only species lacking a sagittal crest on our skulls. This is because chimpanzees, gorillas, and orangutans have chewing muscles that anchor to the top of their heads (to their sagittal crest). In short, these animals require more chomping power, and consequently have much stronger chewing muscles. The mutation to the MYH16 gene crippled these same chewing muscles within our line, and over time, our muscles became anchored to the sides of the skull instead of the top (see figures 1 and 2). This is significant because chewing muscles that mount to the top of the skull actually encase the skull, restricting its ability to expand. Once this gene mutated, our craniums were free to expand with a brain that already had the evolutionary catalysts in place to fuel such a process. The fissures in our skulls could now become flexible to not only facilitate brain growth, but to also allow our increasingly
8 One of the most amazing aspects about the field of molecular biology is the ability to trace the evolutionary history of specific genes. Because of this field, we can actually pin dates on genetic mutations, and evolutionary splits (speciation). This new and exciting field almost completely removes the need for fossils. Not surprisingly however, the fossil record coincides directly with what is being discovered via molecular biology. In fact, the mutation in the MYH16 gene fits perfectly with the fossil record, and hominid brain growth (as well as the disappearance of the sagittal crest in our lineage). 9 These are changes that are still taking place. The best example is the fact that our jaws have become too small for all of our molars to fit hence the removal of the wisdom teeth in most individuals.

big-brained babies to fit through a narrow birth canal but just barely. The difficulty of human childbirth presents us with a classic version of evolutionary Russian roulette, which occurs as a direct result of the large brains endowed to us by the natural forces I have discussed to this point.

Evolutionary Trade-offs: The Obstetric Dilemma According to the ancient Hebrew story of creation, women now experience pain during childbirth because Adam and Eve ate from the forbidden Tree of Knowledge. Given what we now know about human anatomy, biology, and evolution, there is a much more logical explanation. Difficulty in childbirth stems from what doctors and scientists refer to as the obstetric dilemma. This anatomical fallacy exists because our pelvises gradually narrowed to support bipedalism, while our heads got bigger in conjunction with brain expansion. This complicates childbirth enough by itself, but combine that with the fact human babies are also forced to rotate themselves as they pass through the birth canal (again, because of the narrow pelvis), and you have an especially difficult process. Based on our size, scientists speculate that we are all born two months prematurely. Although this is now unquestionably accepted within the scientific community, I was just recently informed of the topic by Professor McCullough at the University of Utah, who encouraged me to look deeper into the genetic aspect of this anatomical conundrum. As is always the case in science, speculation is useless without supporting evidence. If the obstetric dilemma is truly a result of our evolutionary heritage, we should have the genes to prove it. To test this particular hypothesis, biologists set out to look for genes within our genome which are tied to birth timing, and see if they also show evidence of rapid evolution. There have now been numerous studies done on this issue, all having the same results. These studies have discovered a handful of genes which are tied to birth timing, and also seem to influence preterm birth. In conjunction with parturition, these same genes also show obvious signs of rapid evolution. The culmination of research points to significant roles played by FSHR10, and in a study
10 Follicle-stimulating hormone receptor (Plunkett et al., 2011).

done by Dr. Plunkett et al. in 2010, a gene on human chromosome #19 is also given special attention. We identified genes showing evidence of rapid evolution along the human lineage, based on evidence from a comparative genomic screen of highly conserved noncoding elements as previously described. Among the rapidly evolving genes emerging from our noncoding screen, PLA2G4C was identified as the most statistically significant human-lineage accelerated gene that was also included in a list of preterm birth candidate genes (Plunkett et al., 2010, p. 2). After the potential gene was isolated, a comparative genomic analysis was done to test the initial results, and formulate a working hypothesis. To test the hypothesis, studies were done on preterm births in multiple genetically differentiated populations. In an attempt to avoid a miniature lesson on human genetics, I can summarize by simply saying the results confirmed the hypothesis11. This study, along with the numerous others done on this subject, converge on the same conclusion: human parturition is accelerated to facilitate birthing bigbrained babies. Modern human birth timing is another great example of genetic fine-tuning via natural selection. Females with a tendency towards long parturition periods were much more likely to die (along with their babies) during childbirth, while those with a tendency towards premature births were much more likely to survive12. In time, the genes for longer parturition were eliminated from the gene pool, and eventually 9 months became the norm. The obstetric dilemma stems from one of many flaws throughout our anatomy indicating design via natural selection. There are notable imperfections throughout our genome and anatomy because evolution is many times a game of anatomical compromise. While engineers can always go back to the drawing board, evolution has to work with what is already there13.
11 PLA2G4C encodes cytosolic phospholipase A2 gamma, which hydrolizes phospholipids from the cellular membrane to form free arachidonic acid, from which prostaglandins, including prostaglandins D, E, F, I2 (also known as prostacyclin), and thromboxane A2 are generated. Prostaglandins play an important role in parturition. Pharmacologically, prostaglandins are used to induce abortion, for cervical ripening, and labor induction (Plunkett et al., 2010, p. 5). 12 Even 9 months is dangerous. Until the C-section, childbirth was one of the leading causes of both female, and infant mortality. 13 One of countless examples: breast milk in mammals is produced by modified apocrine sweat glands (McClellan et al., 2008).

Conclusion Evolution is the unifying theory in all of life science. Without it, nothing in the anatomy or genetic makeup of any creature on earth makes any sense. With the non-random, guiding force of natural selection, evolution has fueled adaptations as strange as the duck-billed platypus14, and as complex as an eagle's eye. Adaptation to a changing environment is what also worked to produce an animal so intelligent that it has now conquered the skies, and put feet on alien worlds human beings. The odds have always been against us, and until the advent of agriculture, we were constantly on the brink of extinction. Because of our intelligence, we've now beaten the odds. Like every other animal, we too are products of our environment, and continue to evolve.

There is grandeur in this view of life, with its several powers, having been originally breathed into few forms, or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being, evolved. - Charles Darwin15

14 Mammals that lay eggs a perfect living example of how evolution can become frozen in time when populations become separated. 15 The Origin of Species, 1859

Figure 1 (Stedman et al., 2004 p. 417)

Figure 2 (Stedman et al., 2004 p. 417)

MYH16 DNA Sequence:

GAGCAGCTGAACAAGCTGATGACCACCCTCCATAGCACTGTACCCCATTTTGTC GAGCAGCTGAACAAGCTGATGACCACCCTCCATAGCACTGTACCCCATTTTGTC GAGCAGCTGAACAAGCTGATGACCACCCTCCATAGCACTGTACCCCATTTTGTC GAGCAGCTGAACAAGCTGATGACCACCCTCCATAGCACTGTACCCCATTTTGTC GAGCAGCTGAACAAGCTGATGACCACCCTCCATAGC - - TGTACCCCATTTTGTC - Wooley Monkey - Chimpanzee - Gorilla - Orangutan - Human

Bibliography Dawkins, Richard. (2004) The Ancestor's Tale. Houghton Mifflin Company, New York, NY. Maslin M, Christensen B (2007). Tectonics, orbital forcing, global climate change, and human evolution in Africa: introduction to the African paleoclimate special volume. Environmental Studies Program, Adelphi University, Garden City, NY. McClellan H, Miller S, Hartmann P (2008). Evolution of lactation: nutrition v. protection with special reference to five mammalian species. School of Biomedical, Biomolecular and Chemical Sciences, The University of Western Australia, 35 Stirling Highway,Crawley WA 6009, Australia. School of Animal Biology, The University of Western Australia, 35 Stirling Highway, Crawley WA 6009, Australia. Pfefferle A, Warner L, Wang C, William N, Babbit C, Fedrigo O, Wray G (2010). Comparative expression analysis of the phosphocreatine circuit in extant primates: Implications for human brain evolution. Biology Department, Institute for Genome Sciences, Department of Evolutionary Anthropology, Duke University, Durham, NC. Plunkett J, Doniger S, Orabona G, Morgan T, Haataja R, Hallman M, Puttonen H, Menon R, Kuczynski E, Norwitz E, Snegovskikh V, Palotie A, Peltonen L, Fellman V, DeFranco E, Chaudhari B, McGregor T, McElroy J, Oetjens M, Teramo K, Borecki I, Fay J, Muglia L (2010). PrimateSpecific evolution of noncoding element insertion into PLA2G4C and human preterm birth. Vanderbilt University, Nashville, TN. Plunkett J, Doniger S, Orabona G, Morgan T, Haataja R, Hallman M, Puttonen H, Menon R, Kuczynski E, Norwitz E, Snegovskikh V, Palotie A, Peltonen L, Fellman V, DeFranco E, Chaudhari B, McGregor T, McElroy J, Oetjens M, Teramo K, Borecki I, Fay J, Muglia L (2011). An Evolutionary Genomic Approach to Identify Genes Involved in Human Birth Timing. Vanderbilt University, Nashville, TN. Relethford, John (2010). The Human Species. McGraw-Hill, New York, NY Stedman H, Kozyak B, Nelson A, Thesier D, Su L, Low D, Bridges C, Shrager J, Minugh-Purvis N, & Mitchell M (2004). Myosin gene mutation correlates with anatomical changes in the human lineage. Department of Surgery and Cell and Developmental Biology, the Pennsylvania Muscle Institute, School of Medicine, Department of Anatomy and Cell Biology, School of Dental Medicine, University of Pennsylvania, Division of Plastic Surgery, The Childrens Hospital of Philadelphia, Philadelphia, Pennsylvania. Vervust B, Pafilis P, Valakos E, Van Damme R (2010). Anatomical and Physiological Changes Associated with a Recent Dietary Shift in the Lizard Podareis sicula. Laboratory for Functional Morphology, Department of Biology, University of Antwerp, Universiteitsplein Wilrijk, Belgium; School of Natural Resources and Environment, Dana Hall, 440 Church Street, University of Michigan, Ann Arbor, Michigan 48109-1041; Modern Greek Program, Department of Classical Studies, 2160 Angel Hall, 435 South State Street, University of Michigan, Ann Arbor, Michigan 48109-1115; Section of Human and Animal Physiology, Department of Biology, University of Athens, Panepistimioupolos, Ilissia, Greece.