Академический Документы
Профессиональный Документы
Культура Документы
A thesis submitted by
to
Doctor of Philosophy
July, 2005
University of Warwick
Coventry, UK
i
Dedicated to the girl who sang the blues.
ii
Table of contents
Title Page i
Table of contents iii
List of Figures iv
List of Tables vi
Abbreviations viii
Acknowledgements xi
Declaration xii
Publications xiii
Abstract xiv
Chapter 1: Introduction 1
Bibliography 164
Appendices 181
iii
List of Figures
Chapter 1
Figure 1.1 Global methyl bromide budget 5
Figure 1.2 Metabolism of C1 compounds by aerobic methylotrophic 10
bacteria
Figure 1.3 Pathway of CH3Cl degradation in Methylobacterium 14
chloromethanicum CM4
Figure 1.4 Comparison of cmu gene clusters sequenced to date 22
Figure 1.5 Maximum likelihood tree of 16S rRNA sequences isolated 24
strains of CH3X utilisers
Figure 1.6 Location of sampling station L4 in the English Channel 31
Figure 1.7 Arabian Sea AMBITION cruise track 33
Chapter 3
Figure 3.1 Diagrammatic representation of the Electron Capture 62
Detector (ECD)
Figure 3.2 Purge apparatus for GC ECD ‘system two’ 64
Figure 3.3 Gas purifier system for the carrier, make-up, sparge and 66
Nafion counter flow gases of GC ‘system two’
Figure 3.4 Diagram of GC ECD System two 68
Figure 3.5 L4 CH3Br measurements 73
Figure 3.6 Phytoplankton abundance and CH3Br concentration at L4 74
Figure 3.7 Pigment concentrations during the AMBITION cruise 78
Chapter 4
Figure 4.1 Chemical equation for complete oxidation of CH3Br 85
Figure 4.2 Oxidation of CH3Br by four enrichments 91
Chapter 5
Figure 5.1 a α subunit of methanol dehydrogenase with coordinated 102
PQQ and Ca2+
Figure 5.1b β subunit of methanol dehydrogenase. 102
Figure 5.1c α2β2 structure of methanol dehydrogenase. 102
Figure 5.2 Alignments mxaF sequences used for PCR primer design 108
Figure 5.3 mxaF PCR of a range of environmental samples 112
Figure 5.4 Phylogenetic analysis of mxaF sequences of strains used in 115
PCR primer design
Chapter 6
Figure 6.1 Pathway of CH3Cl degradation in Methylobacterium 120
chloromethanicum CM4 (as figure 1.3)
Figure 6.2 Comparison of cmu gene clusters sequenced to date (as 122
Figure 1.4)
Figure 6.3 Example EcoRI/DdeI RFLP digest of cmuA clones from 125
enrichment L4.1
Figure 6.4 cmuAF802/cmuAR1609 PCR products from CH3Br 126
enrichments
Figure 6.5 Phylogenetic analysis of all cmuA sequences; parsimony 131
analysis and clade assignment
Figure 6.6 Phylogenetic analysis of selected cmuA sequences; 132
maximum-likelihood analysis
Figure 6.7 BsiYI TRFLP pattern of clone PMLSW6 (AJ810829) 139
Chapter 7
Figure 7.1 Alignment of cmuA sequences with primer cmuAF802 146
iv
Figure 7.2 Alignment of cmuA sequences with primer cmuAR1609 147
Figure 7.3 Alignment of cmuA sequences with primer cmuAR1244 147
Figure 7.4 3D-views of a four helix bundle corrinoid-binding domain 148
with bound cobalamine
Figure 7.5 Alignment of cmuA sequences with primer cmuAR1352 149
Figure 7.6 Autoradiograph of L. methylohalidivorans Southern 151
analysis
Figure 7.7 L. methylohalidivorans MB2 restriction digested DNA 151
samples prior to Southern hybridisation analysis
Appendices
Figure A.2 Physicochemical data from the Arabian Sea AMBITION 182
cruise
Figure A.3 Productivity data from the Arabian Sea AMBITION cruise 184
Figure A.4 Microorganism abundance data from the Arabian Sea 186
AMBITION cruise
Figure C.1 Excel spreadsheet for Henry’s Law calculations 199
v
List of Tables
Chapter 2
Table 2.1 Bacterial and algal strains used in this study 37
Table 2.2 Genomic DNA extracts used in this study 38
Table 2.3 Cruise enrichment carbon sources 45
Table 2.4 Selected media concentrations of CH3X in various culture 46
formats
Table 2.5 PCR Primers used in this study 52
Chapter 3
Table 3.1 Detection limits of a selection of common detectors used in 61
gas chromatography
Table 3.2 Marine phytoplankton demonstrated to produce CH3Br in 76
laboratory cultures
Table 3.3 Linking pigment presence with classes of phytoplankton 77
Chapter 4
Table 4.1 Cruise enrichment carbon sources 86
Table 4.2 Turbidity estimation of Arabian Sea cruise enrichments 87
Table 4.3 Arabian Sea enrichments positive for CH3X utilisation 88
Table 4.4 Total CH3X consumed by enrichments 90
Table 4.5 Emiliania huxleyi culture axenicity 92
Table 4.6 Strains isolated from CH3Br enrichments of Arabian Sea 95
samples
Table 4.7 Amounts of substrate used in O2 electrode studies 96
Table 4.8 Substrate affinity and maximum oxidation rate of H. 97
chloromethanicum CM2 with CH3X
Chapter 5
Table 5.1 mxaF sequences used for PCR primer development 106
Table 5.2 mxaF PCR primers used in this study 107
Table 5.3 Expected product sizes for each of the combinations of 110
primer and results of the first trials
Table 5.4 Genomic DNA samples used for testing efficacy of primer 113
pairs
Chapter 6
Table 6.1 OTUs from library 25, the cmuA clone library from 126
enrichment 249
Table 6.2 OTUs from library 27, the cmuA clone library from 127
enrichment PE2
Table 6.3 OTUs from library 9, the cmuA clone library from 128
enrichment PE2, amplified with primers
cmuAF229/cmuAR1609
Table 6.4 Effective sample volumes for 1 µl volumes of SAP sample 129
DNA extracts
Table 6.5 OTU assignment of cmuA sequences from SAP sample 130
clone libraries
Table 6.6 TRF sizes of known cmuA sequences 137
Table 6.7 Absorption and emission maxima of fluorophores for 139
TRFLP analysis
Table 6.8 AMBITION samples analysed by cmuA PCR 140
Table 6.9 Celtic Sea samples 141
vi
Appendices
Table A.1 Location of casts used for data analyses of the Arabian Sea 181
AMBITION cruise
Table B.1 List of Arabian Sea AMBTION cruise DNA samples 187
Table B.2 List of Arabian Sea AMBTION enrichments 191
Table D.1 Clade affiliation of cmuA TRFs based on in silico analysis 120
of database cmuA sequences
vii
Abbreviations
A adenine
ATP adenosine-5’-triphosphate
bp base pair
C cytosine
CFC chlorofluorocarbon
CoM coenzyme M
Da Dalton
DMA dimethylamine
viii
EDTA ethylenediaminetetraacetic acid
G guanine
GC gas chromatography
H4F tetrahydrofolate
H4MPT tetrahyhdromethanopterin
ID identity
kb kilobase
kDa kiloDalton
LB Luria Bertani
extract
MMA monomethylamine
OD optical density
ix
pptv parts per trillion by volume
T thymine
TE Tris-EDTA
TMA trimethylamine
Tris Tris-(hydroxymethyl)-aminoethane
analysis
U uracil
uv ultraviolet
x
Acknowledgements
My first thanks must go to my three supervisors, Prof. Colin Murrell, Dr. Ian
McDonald and Dr. Phil Nightingale who were fantastic supervisors and an excellent
team despite being geographically as far-flung as you can be. Thank you very much
for your help, advice and patience.
I have worked with a large number of people in Warwick, Plymouth and the middle of
the Arabian Sea and I would like to thank everyone I have ever asked for advice,
equipment or support, there was not a single occasion when any of these were refused
without good reason.
At Warwick special thanks must go to the methyl halide team, now sadly disbanded;
Hendrik Schäfer, a fantastic friend and unofficially supervisor number four, Elena
Borodina, my coordinated dancing partner, and Karen Warner, whose selectively
embarrassing taste in music matched my own. Stefan Radajewski and Johannes
Scholten were endless sources of knowledge on molecular biology and
thermodynamics respectively that I hope I have learnt from. I would also like to
thank Gez Chapman for all his help and Julie, Moh, Ju-Ling, Marc, Simon, Matt, Jo,
Hanif, Andi, and everyone else in Micro I for making it a fantastic place to work .
Thank you to Helen Bird, and the ladies of the Molecular Biology Service for help
and advice, particularly with TRFLP.
At PML the Biogas and Tracer Group were extremely welcoming and patient, if I can
tell one end of a spanner from the other it’s down to you . Particular thanks to
Malcolm Liddicoat for his help and advice, John Wood for egg custard tarts, and to
Dr. Laura Goldson for laughing at my jokes. I would also like to thank Norman
Reville and the crews of RVS Squilla, RVS Sepia and RVS Plymouth Quest for getting
me to L4 and back in one piece, and for making the experience enjoyable.
The AMBITION cruise was a baptism of fire at the very beginning of my PhD; I
would like to thank the Captain and crew of RRS Charles Darwin and all the
participants. I would especially like to thank Dr. Malcolm Woodward, Dr. Andy
Rees, Dr. Glen Tarran and Denise Cummings who took me under their wing from the
start, and Dr. Nick Fuller, Dr. Clare Bird and Dr. Karen Orcutt who made it all the
more fun. I have never consumed so much gin and hope never to again.
I would also like to thank my Mum, Dad and brother for many things, but in particular
for taking me Wembury beach, letting me poke about in rock pools for hours, and for
being interested in every unremarkable shell, stone or bit of seaweed I ever showed
you. Who’d have thought someone would pay you to do it?
xi
Declaration
The work present in this thesis is original work conducted by myself unless stated
otherwise, under the supervision of Prof. Colin Murrell and Dr. Ian McDonald at the
University of Warwick and Dr. Phil Nightingale at Plymouth Marine Laboratory. The
measurements of methyl bromide at L4 in Chapter 3 were carried out by Malcolm
Liddicoat, Plymouth Marine Laboratory. All sources of information have been
acknowledged by reference. None of this work has been used in any previous
application for a degree.
xii
Publications
Borodina, E., Cox, M. J., McDonald, I. R., and Murrell, J. C. (2005) Use of DNA-
stable isotope probing and functional gene probes to investigate the diversity of
1328.
McDonald, I. R., Kampfer, P., Topp, E., Warner, K. L., Cox, M. J., Connell
Hancock, T. L., Miller, L. G., Larkin, M. J., Ducrocq, V., Coulter, C., Harper, D.
B., Murrell, J. C. & Oremland, R. S. (2005) Aminobacter ciceronei sp. nov. and
1832.
xiii
Abstract
Methyl bromide is a potent ozone-depleting atmospheric trace gas with both natural
and anthropogenic sources, and a complex natural cycle. The sources and sinks of
methyl bromide are numerous and are currently unbalanced. The oceans are both a
source and a sink of methyl bromide, but believed to be a net sink. Chemical
degradation rates of methyl bromide in the oceans are too slow to account for the
observed loss of this methyl halide and degradation is thought to be due to oxidation
by marine bacteria. A number of bacteria have been isolated that are able to use
methyl halides, including methyl bromide, as sole source of carbon and energy.
Methyl bromide enrichments of seawater samples from the Arabian Sea and from L4,
a sampling station in the English Channel off the coast of Plymouth demonstrated
oxidation of methyl bromide. Measurements of methyl bromide by GC ECD at L4
suggested rapid biological removal of methyl bromide dissolved in the water column.
Isolation of methyl bromide-utilising bacteria was attempted and amplification of
marine bacterial cmuA sequences achieved from a number of enrichments. These
were cloned and sequenced and their diversity analysed, resulting in the identification
of three clades of marine cmuA sequences. DNA extracted from large volumes of
Arabian Sea seawater from a cruise track that covered 11 sampling stations mainly
along the 67 oE meridian was also PCR amplified using cmuA specific PCR primers.
PCR products were cloned, dereplicated and sequenced and phylogenetic analysis
assigned the sequences to the same three clades of cmuA identified from the
enrichments. A shift from one clade to another could be seen between the
oligotrophic station one and the more eutrophic stations four and nine of the Arabian
Sea cruise track. A rapid microbial assemblage fingerprinting technique was
developed for use with cmuA. A further functional genetic marker, mxaF, encoding
the large subunit of the methanol dehydrogenase of methylotrophs and methanotrophs
was redesigned in order to take into account new full-length sequences of this gene,
and the PCR primers were validated using DNA templates from a range of
methylotrophs and methanotrophs. The marine methyl bromide-utilising bacterium
Leisingera methylohalidivorans MB2 had not yet been shown to possess the cmu
pathway of methyl halide-utilisation and this was attempted using Southern
hybridisation analysis.
This study has demonstrated the diversity of cmuA sequences and the potential for
organisms possessing these genes to form an important part of the oceanic sink of
atmospheric methyl bromide. It has also laid firm foundations for further
investigation of these bacteria through the development of GC ECD and molecular
microbiological techniques.
xiv
Chapter 1
Introduction
1
1 Ozone depletion and the methyl halides
composed of a halogen atom covalently bonded to the methyl group CH3. Methyl
bromide (CH3Br) and methyl chloride (CH3Cl) are gases under standard conditions,
and methyl iodide is a volatile liquid. All three compounds exhibit varying degrees of
toxicity, but CH3Br in particular has been used to good effect as a fumigant in
agriculture in order to control insect, nematode and other pests in a wide range of
economically important crops. It has found use for pre-plant soil fumigation, post-
harvest protection and in quarantine procedures (Ragsdale & Vick, 2001; Yagi et al.,
1995) and its efficacy for these purposes was confirmed as long ago as 1949 (Goodey,
1949).
CH3Br and CH3Cl are present in the atmosphere as trace gases at levels of ~10 and
600 pptv (parts per trillion by volume), respectively (Khalil & Rasmussen, 1999;
Khalil et al., 1993). Although only present in trace amounts, these CH3Xs have a
atmospheric burden of chlorine and CH3Br is the largest carrier of bromine to the
stratosphere (Butler, 2000). Once in the stratosphere, reactions with hydroxyl radicals
and photolysis release the reactive halogen species Br and Cl allowing them to
catalyse in cyclic reactions with ozone (O3), which ultimately result in the destruction
of this compound (Yung et al., 1980). It has also been demonstrated that they
is 50-60 times more effective at ozone destruction than chlorine on a per atom basis
2
(Butler, 2000) and as such has been assigned a high Ozone-Depleting Potential of
0.65 (Mellouki et al., 1992). As such, in 1992 under the Copenhagen amendment,
CH3Br has come under the auspices of the ‘Montreal Protocol on Substances that
Deplete the Ozone Layer’, which aims to freeze emissions of ozone-depleting gases at
(http://www.undp.org/seed/eap/montreal/montreal.htm).
how effective bans on usage of these compounds are. With entirely anthropogenically
atmospheric decline in response to the protocol (Walker et al., 2000). With CH3Br
the case is complicated by the fact that there are natural sources and sinks of the
Merlet, 2001; Mano & Andreae, 1994), car exhausts (Baker et al., 1998), as well as
soil fumigants (Yates et al., 1998). Natural sources of CH3Br include the oceans,
phytoplankton (Saemundsdottir & Matrai, 1998; Scarratt & Moore, 1998); and
terrestrial sources include higher plants (Saini et al., 1995, Rhew et al., 2003;
Yokouchi et al., 2002), fungi (Field et al., 1995; Manley, 2002), coastal salt marshes,
rice paddies and wetlands (Rhew et al., 2000), (Redeker et al., 2002), and (Varner et
al., 1999), degradation of organic matter (Keppler et al., 2000) and even
degradation in soils (Yates et al., 2003) and also the oceans, which are both a source
3
and sink of CH3Br (Butler, 1994; Tokarczyk et al., 2003), but overall seem to be a net
sink (Groszko & Moore, 1998; Lobert et al., 1995). Atmospheric chemistry requires
that the total amount of CH3Br produced equals the total amount degraded, minus the
standing stocks of CH3Br. Currently atmospheric budgets for CH3Br are unbalanced,
in (Ennis, 1998) sources for only 60 % of the sinks could be accounted for, the
missing sinks totalling 83 Gg/yr of CH3Br. Fig 1.1 displays current estimates of
4
Atmosphere
Missing
source 86 •OH
hv
83 CH3Br
Oceanic fumigation
production
Oceans
Biomass 41
burning 77
56 Soils
Leaded 42
petrol
2 Gg/yr 5 Gg/yr
Fig 1.1. Global CH3Br budget. Values are the amount of CH3Br in Gg/yr. Yellow arrows indicate sources of CH3Br and blue arrows indicate
sinks. There are missing sources which contribute 83 Gg/yr . These are known to be terrestrial and believed to be plant based (based on a figure
by Rob Rhew, pers. comm.)
5
The global oceans are an interesting case as they are both a source and a sink of
CH3Br (Anbar et al., 1996). CH3Br can be broken down chemically in seawater by
hydrolysis and nucleophilic substitution with Cl- (Elliott & Rowland, 1995; Gentile et
al., 1989). There have been conflicting reports concerning the oceans as a sink for
atmosphere and therefore a strong source of CH3Br (Khalil et al., 1993; Singh &
Kanakidou, 1993). However, more recent work has shown that most oceans are
undersaturated in CH3Br with respect to the atmosphere (Lobert et al., 1997; Lobert et
al., 1995; Tokarczyk & Saltzman, 2001; Tokarczyk et al., 2003). An exception is the
North Atlantic during algal blooms (Baker et al., 1999). Coastal waters are also often
supersaturated (Baker et al., 1999), with one study demonstrating that the sea was
saturated with CH3Br for over three months of the year and that greatest saturation
1999). Upwelling regions are near equilibrium with respect to atmosphere (Lobert et
al., 1997). The ocean is now thought to be a global net sink of atmospheric CH3Br of
(King & Saltzman, 1997) determined chemical and biological loss rates for CH3Br
surface ocean waters and demonstrated that biological loss rates were significant in
comparison to chemical loss rates and that biological pathways existed for the
removal of CH3Br from these waters. Both autoclaved and 0.2 µm filtered seawater
samples failed to demonstrate the high rates of CH3Br degradation seen in unamended
samples. Examination of the CH3Br loss rates associated with individual size
fractions of the marine biomass resulted in the discovery that loss of CH3Br was
associated with that fraction that encompassed the bacterial size range. #
6
The oceanic lifetime and fate of CH3Br is an important parameter in global models
Methylotrophic bacteria are capable of gaining all their carbon and energy needs from
organisms include methane, methanol, methylated amines (e.g. mono-, di-, and
McDonald, 2000). Both aerobic and anaerobic prokaryotes can make use of
methylotrophic substrates for growth, and aerobic methylotrophs include both Gram
those that can use methane as sole source of carbon and energy (methanotrophs) and
those that cannot. The CH3X-utilising bacteria that have been isolated so far are all
carbon cycling as methane is the most abundant organic gas in the atmosphere
7
1.3.2 Methanotrophy
are two forms of this enzyme, a particulate form and a soluble form. Methanotrophs
have been isolated with either one or both of these enzymes, but possession of the
soluble form is a less common trait (Colby et al., 1977; Dedysh et al., 2000). The
methanotrophs have membranes running around the periphery of the cell. The two
types differ from one another in their biochemistry as Type I methanotrophs and other
cellular carbon from one carbon compounds and channelling all their assimilatory and
enzymes are involved in this process, including the methane monooxygenases and
cellular biomass by the serine or RuMP cycles. If present, the ribulose bisphosphate
8
cycle (Calvin-Benson-Bassham cycle) can also be used to assimilate cellular carbon
from CO2. A summary of aerobic methylotrophy pathways can be seen for a variety
9
Fig. 1.2. Metabolism of C1 compounds by aerobic methylotrophic bacteria adapted from (Lidstrom, 2001). Numbering refers to the enzymes for
each step: 1, methane monooxygenase; 2, methanol dehydrogenase; 3, formaldehyde dehydrogenase; 4, formate dehydrogenase; 5,
dichloromethane dehalogenases; 6, methyl halide methyltransferase/corrinoid binding protein; 7, methanesulfonic acid monooxygenase; 8,
methylated sulphur dehydrogenases or oxidases; 9, methylated amine dehydrogenases; 10, methylamine oxidase.
10
At least four pathways have been identified for the oxidation of formaldehyde, one
being cyclic and three linear. The cyclic pathway involves a dissimilatory RuMP
cycle and 6-phosphogluconate dehydrogenase (Anthony, 1982), and the first of the
disproportionate acetate, formate and selected other C1 compounds to CO2 and CH4,
or reduce them to CH4 using H2. Methanogens reduce the methyl group carrier
methyl coenzyme M (McoM) to methane and oxidised coenzyme M using the enzyme
phosphorylation of ADP to ATP, and thus energy production. Methyl groups can be
methanogenesis and aerobic methylotrophy (Ferry, 1999; Sauer et al., 1997). When
and corrinoid-binding proteins transfer the methyl group directly from these
11
methyl halide utilisation (see below), which is similarly reminiscent of the strictly
and anerobically by bacteria using a variety of means. Many of these have significant
anthropogenic sources and investigation into their bacterial degradation is often from
the halogen atom and formation of a double bond. This has been
dehalogenation and have been found in a wide range of bacteria and acting
1998).
12
electron acceptors. This process is important in the biodegradation of
CH3Cl as sole energy source, producing acetate (Fetzner, 1998). The aerobic
The first CH3X-utiliser was Hyphomicrobium sp. MC1, isolated by Leisinger and
colleagues in 1986, which was shown to degrade CH3Cl aerobically (Hartmans et al.,
1986). At the time this reaction was suggested to occur via a monooxygenase
reaction rather than a dehalogenation. The strain has subsequently been lost and so
was revealed that in fact two distinct strains had been isolated, which were designated
and two major polypeptides, of 67 kDa and 35 kDa were discovered to be induced
during growth on CH3Cl. Cells grown on CH3Cl were also shown to be capable of
13
oxidising CH3Br and CH3I (Vannelli et al., 1998). Transposon mutagenesis was used
in order to identify the genes responsible for CH3Cl degradation and mutants that
would still grow on other methylotrophic compounds. This information was coupled
with physiological, biochemical and genetic evidence, and a pathway was suggested
CH3Cl
CoI
1
HCl
CH3 CoIII
H4folate
2
CH3 H4folate
3
2 H+
Carbon
CH2 H4folate assimilation via
serine cycle
4
2 H+
CH H4folate
H2 O
5
CHO H4folate
H2 O
6
H4folate
HCOOH
7 2 H+
CO2
14
The first step in this pathway is the transferral of the methyl group of CH3Cl to the
Cobalt atom of a corrinoid group. A single 67 kDa enzyme, CmuA carries out this
step involves the methyltransferase CmuB (35 kDa), which transfers the methyl group
progressively oxidised to formate and CO2, with carbon assimilation via the serine
cycle at the level of methylene tetrahydrofolate. CmuA and CmuB were purified and
were able to catalyse the transfer of the methyl group of CH3Cl to tetrahydrofolate in
Sequence analysis of the genes involved indicated that they were present on two
clusters on the M. chloromethanicum CM4 genome (see Fig 1.4, later). CmuC and
FolD were also shown to be essential for growth on CH3Cl, but the function of the
CH3Cl and that it was not required as an addition to the growth medium as it was
synthesised by the cells. Presence of cobalt in the growth medium was an obligate
chloromethanicum CM4 (Doronina et al., 1996) and along with this strain it is one of
15
shown to be present in H. chloromethanicum CM2 with a 67 kDa CmuA and 35 kDa
CmuB being expressed during growth on CH3Br and CH3Cl (McAnulla et al., 2001b).
A single gene cluster containing the cmuA, cmuB, cmuC and folD genes known to be
essential for growth on CH3Cl was cloned and sequenced. CmuA from H.
amino acid level (McDonald et al., 2002). A number of other ORFs were present on
this cluster, including paaE encoding a putative reductase and hutI encoding an
cmuC or hutI was shown to negate the ability to use CH3Cl as sole carbon and energy
the cmuB, cmuC, cmuA, fmdB, paaE, hutI and metF genes were co-expressed and co-
CH3Cl inducible and not repressed by the presence of the alternative growth substrate
methanol. CH3Cl- transposon mutants were also unable to use CH3Br as sole carbon
energy source, indicating that the same pathway was being used to utilise both
A number of other Hyphomicrobium spp. have been isolated that are capable of
growth on CH3Cl and CH3Br. (McAnulla et al., 2001a) enriched for and isolated six
Hyphomicrobium strains: S-3 was isolated from the Severn estuary, S-4 from
16
Warwick soil, MAR-1 from the North Sea, SAC-1 and SAN-1 and PMC from the
same woodland site. Strains S-3, S-4 and MAR-1 were phylogenetically very similar
sequences analysis grouped together close to, but separate from strain CM2. PMC
was more distantly related. (Borodina et al., 2005) isolated seven further
The number of Hyphomicrobium spp. that have been isolated on CH3Xs may indicate
that these bacteria form a significant sink for CH3Cl and CH3Br in soils, although this
may also be due to enrichment conditions favouring these organisms to the detriment
of environmentally more significant organisms. It is not known how active they are
CH3Cl DNA Stable Isotope Probing (Radajewski et al., 2000) to the same soil
demonstrated by analyses of 16S rRNA and functional gene (cmuA) amplification and
Two Aminobacter sp. that are capable of growth on both CH3Cl and CH3Br have been
isolated and have had their cmu (chloromethane-utilising) gene clusters characterised.
They have recently been designated Aminobacter ciceronei IMB1 and Aminobacter
lissarensis CC495 (McDonald et al., In Press). A. ciceronei IMB1 was isolated from
soil that had previously been fumigated with CH3Br (Connell-Hancock et al., 1998;
Miller et al., 1997) and A. lissarensis CC495 was isolated from pristine woodland soil
(Coulter et al., 1999). A. ciceronei IMB1 was able to utilise CH3Cl, CH3Br, and CH3I
as sole carbon and energy sources and CH3Cl and CH3I demonstrated competitive
17
inhibition with CH3Br, suggesting that a common enzyme system was responsible for
utilisation of all three CH3Xs (Schaefer & Oremland, 1999). Growth on all three
CH3Xs was also demonstrated to be inducible and cells grown on CH3Br were
capable of oxidising CH3Cl and vice versa. In addition, this organism was
environment (Goodwin et al., 2001). A cmu cluster has been cloned and sequenced
from this organism (Woodall et al., 2001) and contained cmuC, cmuA, paaE, hutI and
metF genes, cmuB was not identified in this strain (see Fig. 1.4). Again, these results
A. lissarensis CC495 was only able to grow on CH3Cl or CH3Br as sole carbon and
energy source when vitamin B12 was supplied in the medium (Coulter et al., 1999),
ciceronei IMB1 (Studer et al., 1999). Growth on CH3Cl and CH3Br was
expressed when cells were grown on CH3Cl , but not when grown with methylamine.
%), and A. ciceronei IMB1 (81.3 %) (McDonald et al., 2002). Southern hybridisation
IMB1 allowed the cloning and sequencing of a cmu cluster from A. lissarensis CC495
18
(Warner, 2003; Warner et al., In Press). Similar to H. chloromethanicum CM2 and A.
ciceronei IMB1 genes were arranged in single cluster: cmuB, cmuC, cmuA, paaE and
hutI and shared high identities with the corresponding genes from A. ciceronei IMB1.
It is likely that a pathway similar to that elucidated by (Vannelli et al., 1999) is also in
Prior to the start of this investigation, despite the fact marine systems have been
shown to possess significant capacity for biological CH3Br degradation, only two
marine bacteria capable of utilising CH3Br as sole source of carbon and energy had
et al., 2002) and strain LIS 3 (Hoeft et al., 2000). L. methylohalidivorans MB2 was
isolated from a CH3Br-degrading seawater enrichment that had been sourced from a
tide-pool of the coast of California (Goodwin et al., 1998). It was able to utilise
CH3Br, CH3Cl, and CH3I as sole sources of carbon and energy and this trait was
but have yet to meet with success (Warner, 2003). Southern hybridisation analyses
marine broth with and without CH3Br failed to reveal any differences in expressed
19
Strain LIS 3 was isolated from a CH3Br and dimethyl sulfide enrichment of Long
CH3Br via a methyltransferase mechanism (Hoeft et al., 2000). This isolate has yet to
be characterised further and so the details of this mechanism also remain unknown.
During the course of this investigation (Schaefer et al., 2005) enriched Plymouth and
Scottish coastal seawater with CH3Br and isolated 13 strains of marine CH3Br-
clades, two were found to make use of the cmu pathway and representatives of each of
these (strains 179 and 198) had their cmu clusters successfully cloned and sequenced.
Sequence analysis indicated the presence of cmuA, fmdB, paaE, hutI and metF in the
fragment of strain 179 cmu cluster, and of cmuC, cmuA, fmdB, paaE, and hutI in
strain 198. A metF sequence could not be identified in strain 198. SDS PAGE
analysis of CH3Br grown cells of strains 179 and 198 compared with glycine betaine
grown cells demonstrated inducible expression of 67 kDa proteins and their identity
was confirmed by mass spectrometry analysis. This indicated that the cmu pathway
of CH3X degradation was present, not only in terrestrial environments, but also in
marine environments. The conservation of structure of all the cmu clusters sequenced
strains) did not demonstrate the presence of a 67 kDa protein that was inducibly
expressed when grown on CH3Br. Those proteins that did demonstrate differential
20
expression between CH3Br grown and glycine betaine grown cells could not be
21
I
cobU cobD metF cmuB cmuC cobC
str. CM4 I
I
cobU folC folD purU cmuA
str. CC495
cmuB cmuC cmuA fmdB paaE hutI
str. IMB-1
cmuC cmuA fmdB paaE hutI metF
str. CM2 //
cmuB cmuC cmuA fmdB paaE hutI metF
str. 198
cmuC cmuA fmdB paaE hutI nrdF nrdA
str. 179
cmuA fmdB paaE hutI metF
2 kb
Fig 1.4. Comparison of cmu gene clusters sequenced to date. Genes involved in the metabolism of CH3X are in blue with cmuA in red. Genes
not directly involved are in green. Organisms are referred to by their strain names.
22
1.5.5 Phylogeny of CH3X-utilising bacteria
All CH3X-utilising bacteria isolated and characterised so far have been members of
most similar to the Nocardiodes was isolated, but unfortunately the strain was lost
(McAnulla, 2000). Despite the fact they are all within the α-Proteobacteria, the
CH3X-utilising strains are distributed throughout this clade (see Fig 1.5). CH3X-
utilisation is a monophyletic trait in that it has thus far only been found within the α-
best demonstrated by A. ciceronei strains IMB1, ER2 and C147 (McDonald et al., In
Press). These three strains are all members of the same species, but only A. ciceronei
IMB1 is capable of utilising CH3X as sole carbon and energy sources, strains ER2 and
C147 cannot grow on these compounds and have not been discovered to possess a
cmuA gene.
23
Fig 1.5. Maximum likelihood tree of near full-length 16S rRNA sequences of a selection of the isolated strains of CH3X utilisers, indicating
their distribution throughout the α-Proteobacteria. Terrestrial isolates are indicated in red, with marine isolates highlighted in blue. The 16S
rRNA sequence of Erythrobacter longus was used to root the tree
24
1.6 Molecular ecology
organisms are exceedingly useful tools for determining the ecology of particular
bacterial species. However, the limitation of these approaches is that many organisms
culturing techniques (Rappe et al., 2002), but molecular ecology techniques can
Molecular ecology makes use of analyses of individual bacteria and, more commonly,
populations of bacteria at the molecular level in order to gain information about the
environment. A wide range of techniques are available and some of the most
polymerase chain reaction and specific primers can allow determination of whether a
particular functional gene is present in a given sample, and the diversity of the
organisms bearing those genes can be assessed. The 16S rRNA gene is often targeted
conserved between all bacteria. Universal bacterial primers have been designed for
the 16S rRNA gene, which amplify various regions. Ligation of these amplimers into
25
plasmid vectors and transformation into bacterial hosts creates a library of sequences
2005) for example) and divided into operational taxonomic units (OTUs).
order to establish the identity and relatedness of the cloned genes to one another.
With the CH3X-utilising bacteria phylogenetic analyses are hampered by the fact that
CH3X degradation is not a monophyletic trait. In this and similar cases functional
genetic markers can be used in order to assess the diversity of bacteria that are
capable of carrying out a particular process associated with the targeted gene in the
environment. Examples of genes that have been used as functional genetic markers
include the pmoA and mmoX genes, which encode the catalytic subunits methane
monooxygenases and have been used as markers of methanotrophy, and mxaF, which
encodes the large subunit of methanol dehydrogenase and has been used as a
1997).
With CH3X-utilising bacteria cmuA, the gene encoding the first step in the
26
1.6.2 Microbial assemblage finger-printing techniques
Clone library analysis can be time-consuming and the cost of sequencing large
microbial assemblage can be prohibitive. These factors limit the number of clones
that can be analysed and may result in libraries that severely underestimate the
gradient gel electrophoresis (DGGE, Diez et al., 2001; Freitag & Prosser, 2003) and
2003; Moeseneder et al., 1999; Osborn et al., 2000) have been developed that allow
assemblages. Both techniques are again based on PCR amplification of DNA using
the primers have been modified, in the case of DGGE by addition of a GC-rich
DGGE PCR products are run on acrylamide gels that contain an increasing
concentration of denaturant from the top to the bottom of the gel. PCR products
denature at positions in the gel that correspond to their sequence, but are held together
electrophoretic movement at different positions in the gel, thus, after staining and
the sequence diversity amplified from the particular DNA sample. The intensity of
sequence type in the sample and excision and sequencing of bands can allow their
identification.
27
TRFLP PCR products are digested with carefully selected restriction enzymes which
are chosen for their ability to discriminate between different sequence variations of
the same gene. These digested products are resolved by DNA sequencing. Only the
visualised as it is the only fragment that remains attached to the fluorophore. The size
fingerprint. The relative fluorescence of each TRF can be used as an indicator of the
microbial assemblages
The molecular ecological techniques discussed so far allow the identity and diversity
fluoresce and they can then be visualised using fluorescent microscopy (Davenport et
al., 2000). DNA probes are designed for specific sequences of 16S rRNA and
labelled with fluorophores. These are then hybridised with microbial assemblages
fixed to slides and permeablised in order to allow entry of the fluorescent probe to the
cell, where it hybridises to the cognate sequence of 16S rRNA. By using a variety of
probes that hybridise with various taxonomic groups together with a variety of
fluorophores the diversity within a microbial assemblage can be resolved at the level
of individual organisms.
28
One of the drawbacks of FISH has been that it has only been possible to design probes
for ribosomal RNA as these are expressed at high copy numbers in bacteria. Recently
a mRNA FISH technique has been developed that allows simultaneous hybridisation
of probes to mRNA and rRNA and therefore the detection of functional gene
environmental function they perform, but cannot elucidate this further. Similarly
examination of functional diversity is useful, but can only give clues to the identity of
the organisms performing the function in the environment if the functional trait is
techniques that can link the functional diversity of a microbial assemblage with the
organisms that have been fed with radiolabelled substrates and subsequent FISH
analysis, identifying the organisms in the sample that have been utilising the substrate
(MAR-FISH, Lee et al., 1999). DNA Stable Isotope Probing (SIP, Radajewski et al.,
2000) and the complementary RNA SIP (Manefield et al., 2002) again make use of
labelled substrates, in this case, heavy isotopes such as 13C, which are pulse fed to the
subject assemblage. The heavy isotope is incorporated into the biomass of that
portion of the microbial assemblage that is actively utilising the substrate in question.
DNA or RNA from the total population can be extracted and separated by density
29
gradient centrifugation, as nucleic acids from the active portion of the assemblage are
heavier than that of the non-active portion. These nucleic acids can then be subjected
to the other molecular techniques mentioned in order to identify the active population,
Two main sampling sites were used during this investigation, L4, a sampling station
off the coast of Plymouth which could be visited up to weekly, and the Arabian Sea as
NERC thematic cruise for the Marine and Freshwater Microbial Biodiversity thematic
programme.
1.7.1 Station L4
Station L4 has been visited weekly by scientists based at Plymouth Marine Laboratory
and the Marine Biological Association of the UK since 1988 (see Fig 1.6). Research
vessels RVS Squilla, RVS Sepia and RVS Plymouth Quest bring back weekly water
samples from this station for laboratory analysis and conduct in situ depth profiles of
for zooplankton identification and abundance from this sampling site extend back to
1988 and from 1992 physical, chemical and biological measurements have been taken
including phytoplankton identity and abundance. The datasets are freely available
30
Fig 1.6. Location of sampling station L4 in the English Channel.
L4 is located 10 nautical miles South of Plymouth and is subject to weak seasonal
stratification. Phytoplankton composition is characterised by spring diatom and
summer dinoflagellate blooms (information from www.pml.ac.uk/L4/Location.htm).
The Arabian Sea has been used as a sampling site by a large number of investigators,
including the global programs JGOFS (Joint Global Ocean Flux Study) and WOCE
(World Ocean Circulation Experiment). The Arabian Sea and Indian Ocean are often
selected for analysis because, despite being one of the smallest ocean basins, they
upwelling and oxygen deplete environments (Burkhill et al., 1993). In 2001 from the
30th August to 29th September, RRS Charles Darwin research cruise CD132
completed a transect (see Fig. 1.7.) of the Arabian Sea in order to characterise the
31
microbial diversity present. 11 stations were sampled along the 5 500 km transect,
mainly following the 67o E meridian. The cruise was collaborative with participants
and nitrogen-fixing bacteria. Data are available from the BODC (Biological
Oceanography Data Centre) and the cruise report contains full details of
measurements taken. Some data are included in Appendix A, and a list of samples
32
Fig 1.7. AMBITION cruise track. The track is marked in red, with sampling stations
indicated in yellow.
33
1.8 Aims
Given the importance of marine systems in CH3Br cycling, and the potentially
significant role of bacteria as a sink of CH3X in the marine environment the aims of
• Correlation of the presence and concentration of CH3Br with the presence and
The studentship was funded by NERC and tied to a larger thematic program, Marine
and Freshwater Microbial Biodiversity. Funding was also provided on the project for
a PDRA, Dr. Hendrik Schäfer. The principal and co-investigators were Prof. Colin
Murrell and Dr. Ian McDonald at the University of Warwick and Dr. Phil Nightingale
34
Chapter 2
35
2 Chapter 2: Materials and Methods
The bacterial and algal strains used in this study are given in Table 2.1.
36
Strain Characteristics Source Reference
Escherichia coli strain Cloning host strain Invitrogen TOPO TA
TOP10 Corporation cloning Kit
Emiliania huxleyi 92A MeX Producer Dr. Declan
Schroeder
Emiliania huxleyi 373 MeX Producer Dr. Declan
Schroeder
Emiliania huxleyi 373 MeX Producer Dr. Declan
UEA Schroeder
Emiliania huxleyi 379 MeX Producer Dr. Declan
Schroeder
Emiliania huxleyi 1516 MeX Producer Dr. Declan
Schroeder
Emiliania huxleyi 1516 MeX Producer Dr. Declan
CCMP Schroeder
Table 2.1. Bacterial and algal strains used; available references are indicated.
Genomic DNA samples used in this study are recorded in Table 2.2.
37
Strain Characteristics Source Reference
Methylobacterium strain Possesses a Methanol Dr. Paolo (De Marco et
PM1 dehydrogenase de Marco al., 2004)
Methylophilus strain ECd4 Possesses a Methanol Dr. Paolo (De Marco et
dehydrogenase de Marco al., 2004)
Ralstonia strain EHg5 Methylotroph with no Dr. Paolo (De Marco et
Methanol de Marco al., 2004)
dehydrogenase
Rhodococcus strain RD6.2 Methylotroph without Dr. Paolo (De Marco et
Methanol de Marco al., 2004)
dehydrogenase
Arthrobacter strain Methylotroph without Dr. Paolo (De Marco et
SK1.18 Methanol de Marco al., 2004)
dehydrogenase
TOPO Vector Cloning Plasmid Invitrogen TOPO TA
Corporation cloning Kit
Table 2.2. Genomic DNA extracts used; available references are included.
2.3 Media
Liquid media were prepared as described below. The corresponding agars were
prepared by the addition of 1.5 % (w/v) Bacto agar (Difco) to the respective liquid
media prior to autoclaving. All media were autoclaved at 121 oC for 15 min.
38
2.3.1 MAMS (Marine Ammonium Mineral Salts)
MAMS medium was used for growth of Leisingera methylohalidivorans strain MB2
and also for enrichments and was adapted from Thompson et al., 1995; the SL-10
Amount (per L)
NaCl 20.0 g
100 x MS Solution
MgSO4.7H2O 10 g
FeSO4.7H2O 0.02 g
39
100 x Phosphates Stock Solution
KH2PO4 3.6
K2HPO4 23.4
Amount (mg/L)
Thiamine HCl 10
Nicotinic acid 20
Pyridoxine HCl 20
Riboflavin 20
Biotin 1
Folic acid 4
MAMSTY (Marine Ammonium Mineral Salts with Tryptone and Yeast Extract)
This is a complex medium based on MAMS with the addition of 1.0 g/L yeast extract
This was made as described by Whittenbury et al., 1970 as a base for the marine
methylotroph growth medium described below. The other stock components, except
the vitamin solution described below can also be found in (Whittenbury et al., 1970).
40
2.3.3 Marine Methylotroph Growth Medium
Amount (per L)
10 x ANMS 10.0 mL
NaCl 35.0 g
After autoclaving, add phosphates and vitamins aseptically. ANMS is used at 0.1 x
above strength.
This was used for the growth of Methylobacterium extorquens strain AM1 as
described by Bourque et al., 1995 except that 5.37 g/L of Na2HPO4.12H2O was used
source.
2.3.6 C2 Medium
Colby & Zatman, 1973. A stock solution of 10 % (w/v) TMA (trimethylamine) was
41
2.3.7 Luria-Bertani Medium
This was routinely used for the growth of Escherichia coli and prepared as described
This medium was used for the culture of all Emiliania huxleyi strains. The recipe
used was that of the Provasoli-Guillard National Centre for Culture of Marine
It was made using aged and filter-sterilised and aged seawater from the English
Channel.
All strains except E.coli were routinely grown in 25 mL of media in 125-mL serum
vials. Those that were grown on a MeX substrate were closed with blue Teflon
coated butyl rubber stoppers and crimp sealed. All cultures were grown with orbital
2.5 Microscopy
A Zeiss Axioskop (Germany) microscope with phase contrast and oil immersion was
the source of the sample and the availability of equipment at the time of sampling.
42
2.6.1 Arabian Sea samples
Water samples were taken using a SeaBird rosette sampler equipped within 24 x 30-L
Niskin bottles and CTD (conductivity, temperature and depth) devices. The exact
configuration of the system can be found in the AMBITION Cruise report available
from the Biological Oceanographic Data Centre website at the following URL:
their integral taps and a short length of Tygon tubing into 2 L polycarbonate bottles
rinsed three times with seawater sample. Water was treated in one of two ways. It
using Nalgene filter housings and transferred to cryovials. These were subsequently
flash frozen in liquid nitrogen and stored at –80 oC. Alternatively water was filtered
through 0.2 µm Sterivex filter cartridges, which were sealed at either end with
At the end of the Cruise, the samples were packed in copious quantities of dry ice in
polystyrene boxes for the transfer from Oman to the UK. After no more than four
days in dry ice, they were transferred back to –80 oC where they remained until DNA
was extracted. Dry ice remained in the boxes when they were opened, indicating the
polycarbonate screw-cap bottles. Surface water samples were collected in the same
type of bottles using the non-toxic seawater supply pump of the vessels RVS Squilla
and RVS Sepia. When larger volumes of surface water samples were required, 20 L
43
carboys (Nalgene) were filled from the non-toxic supply and sub-sampled back at the
laboratory.
These samples were provided by Dr. Gary Smerdon of Plymouth Marine Laboratory
and were taken during a cruise aboard RRS Discovery (D261) in the Celtic Sea from
During the AMBITION Cruise alongside the filtering of water for DNA extraction
2 L of water were filtered through 47 mm, 0.2 µm Supor filters and the filtrate was
then resuspended in ~3 mL of sample water. This was repeated for both the 5 m
depth sample and the chlorophyll maximum sample, the depth of which was
determined by the CTD profile at each station. At station 6 an extra set of samples
were taken from the deep cast of 2501 m. An extra set at was also taken at 250 m at
station 8, together with a final extra set at station 11 at the salinity maximum. See
enrichment vials containing 5 ml of 0.1 x ANMS with 3.5 % (w/v) NaCl, ANMS trace
elements and the following 200 x vitamin solution, used at 1 x final concentration.
Amount (mg/L)
Folic Acid 4
Cyanocobalamine 200
44
Seven different carbon sources were used, either individually, or in combination with
Twelve different enrichment conditions were used on the cruise with the carbon
For the sake of practicality, gaseous carbon sources were added to the pre-sealed
crimp-top vials as a percentage of the headspace volume of the vial. Henry’s Law
was then used in order to calculate the concentration of the substrate in the aqueous
phase. The concentrations found with the most commonly used enrichment volume
formats for CH3Br and CH3Cl can be found in Table 2.4, below.
45
Gas Temp. [Headspace] Headspace Medium [Medium]
o
( C) (%) Volume (mL) Volume (mL) (µM)
CH3Br 20 0.2 100 25 176.9
CH3Br 30 0.2 100 25 148.6
CH3Br 20 0.2 300 700 128.0
CH3Br 20 0.1 19 5 85.9
CH3Cl 20 2 100 25 1574.8
CH3Cl 30 2 100 25 1173.8
CH3Cl 20 2 300 700 1176.8
CH3Cl 20 2 19 5 1536.5
Table 2.4. Selected concentrations of CH3X depending on the culture format
employed.
Headspace concentrations of 0.2 % (v/v) and 2 % (v/v) for CH3Br and CH3Cl
respectively were found to be the highest that did not exhibit toxicity as determined
2.8 O2 Electrode
2 mL electrode chamber was used and the change in potential (oxygen consumption)
and air saturated de-ionised water were used to calibrate the electrode. The method
followed was that of Thompson et al., 1995. Gaseous substrates and substrates or
inhibitors with only limited water solubility were added as µl volumes of saturated
Three gas chromatographic (GC) systems were used during the project, a GC with
flame ionisation detection (GC FID) and two GCs with electron capture detection
(GC ECD). The GC FID system was based at the University of Warwick in the
46
Department of Biological Sciences, and the GC ECD in the Biogas and Tracer Group
2.9.1 GC FID
This GC system (‘system one’) was used to determine the presence or absence of
CH3X in the headspace of cultures and enrichments. 100 µl of headspace gas was
injected manually into a GCD Gas chromatograph (PYE Unicam Ltd., Cambridge,
Ltd., Deeside, UK). Oxygen-free N2 was used as the carrier gas at a flow rate of 30
mL min-1 and the oven temperature was 200 oC. The flame ionisation detector
generated peaks in potential and these were integrated by a 3390A Integrator (Hewlett
Packard, Berkshire, UK). The gas chromatograph was calibrated with known
retention times were 1.10 min and 1.65 min for CH3Cl and CH3Br respectively.
The GC-ECD system (‘system two’) based at PML was initially designed around a
Shimadzu 8A gas chromatograph with custom built air purifiers and purge and trap
apparatus. The carrier gas was ECD grade He, with N2 as make-up and sparge gases.
After identification of an electronic problem with this system, the GC was changed to
a system previously used for the detection of fluorocarbons “system three” (Haine et
al., 1995). Both systems were partially automated. For further details of the design
47
2.10 General Purpose Buffers and Solutions
loading buffer (with Ficoll and Bromophenol Blue) were prepared and used as
This method was used for the preparation of nucleic acids from environmental
samples concentrated on 0.2 µm Supor filters. The polyethersulfone from which these
filters are made is phenol-soluble, thus all the cells from the filter are released during
this procedure. The method used was that of Schaefer & Muyzer, 2001; briefly filters
are rinsed with ice-cold buffer and then cells are lysed by the addition of SDS and hot
purification and DNA is precipitated using sodium acetate. DNA was resuspended in
50 µl or 100 µl of sterile deionised water, by mixing overnight at 0-5 oC and then split
into two equal aliquots. A working stock was kept at –20 oC and a reserve stock was
As the Sterivex filters are completely enclosed inside a cartridge casing, DNA
extraction was carried out using the method of Somerville et al., 1989. SDS,
48
agarose gel electrophoresis, presumably due to adherence of the filtered biomass to
Depending upon the separation required 1-2 % agarose gels were prepared and run in
1 x TBE buffer. Small gels were run using a Flowgen minigel systems (Flowgen
Instruments Ltd., Sittingbourne, UK). Larger gels for Southern hybridisation were
Cambridge, UK). RFLP analysis was performed on 2 % agarose gels on the same
systems. For minigels, 0.5 µg/ml ethidium bromide was included during the casting
of the gels; for the larger gels, staining was carried out after electrophoresis by
soaking in 1 x TBE with 0.5 µg/mL ethidium bromide with gentle orbital shaking for
60 min. Destaining was carried out for 30 min in 1 x TBE. DNA was visualised by
camera (CU5 Land Camera) loaded with Polaroid 665 black and white film.
particularly for the larger gels, a Gel Documentation system was used.
This was carried out by two methods, depending upon the accuracy of measurement
ng. After ethidium bromide staining, the intensity of this band was compared to the
intensity of the DNA to be quantified and an estimate of DNA concentration was then
calculated.
49
For applications when more accuracy was required, or to compare the amount of
(Nanodrop) was used to give concentrations of DNA. This system had the advantage
of being able to indicate the purity of the DNA sample, since protein concentration
would also be determined. This service was provided by the University of Warwick
After electrophoresis, gel fragments were excised using an ethanol cleaned scalpel
blade and the DNA extracted using the QIAquick gel extraction kit (Qiagen)
A range of enzymes from different suppliers was used and these are indicated in the
volumes and those for TRFLP analyses were carried out in 100 µL reaction volumes.
2.16 PCR
PCR reaction mixtures were 2.5 mM MgCl2, 200 µM each dNTP, 10-25 pmol of each
Invitrogen Taq DNA Polymerase buffer and 2.5 U of Taq DNA Polymerase
50
(Invitrogen, Paisley, UK) in a total volume of 50 µL, made up with sterile deionised
water. Thermal cycling was carried out on a Hybaid Touchdown thermal cycler with
initial denaturation at 95 oC for 5 min, whereupon the Taq DNA Polymerase was
added as a hot start. This was followed by 35 cycles of 1 min at 95 oC, 1 min at the
primers’ annealing temperature (see table 2.5), and 1 min at 72 oC, followed by final
Table 2.5 lists the primers used for both the PCR and in sequencing reactions together
51
Primer Sequence Annealing Reference
(5’-3’) temperatur
e
CmuAF802 TTCAACGGCGAYATGTATCCYGG 55 oC* (Miller et
al., 2004)
o
CmuAR1609 TCTCGATGAACTGCTCRGGCT 55 C* (Miller et
al., 2004)
o
CmuAF229 CTTTTYACKCCRGTGGAATGCGT 55 C (Warner,
2003)
CmuAR824 CCRGGATACATRTCGCCGTTGAA N/A* This thesis
cmuAR1244 TABTCCATKATBGCYTCGAC 55 oC Dr. Hendrik
Schäfer
cmuAF1225 GTCGARGCVATMATGGAVTA 55 oC This thesis
o
cmuAR1352 TCRCCVACGAYYTTCATSCC 55 C This thesis
o
27F AGAGTTTGATCMTGGCTCAG 60 C* (Lane,
1991)
o
1492R TACGGYTACCTTGTTACGACTT 60 C* (Lane,
1991)
341F CCTACGGGAGGCAGCAG N/A* (Muyzer et
al., 1993)
M13F GTAAAACGACGGCCA N/A* Invitrogen
Corporation
M13R CAGGAAACAGCTATGA N/A* Invitrogen
Corporation
o
mxaF1003 GCGGCACCAACTGGGGCTGGT 55 C (McDonald
& Murrell,
1997)
mxaR1561 GGGCAGCATGAAGGGCTCCC 55 oC (McDonald
& Murrell,
1997)
o
mxaR1555 CATGAABGGCTCCCARTCCAT 55 C This thesis
Table 2.5. PCR Primers used. An * indicates that the primer has been used
successfully in sequencing reactions. Primer pairs used in the PCR are as follows:
cmuAF802/cmuAR1609, cmuAF229/cmuAR1609, cmuAF1225/cmuAR1352 for cmuA
amplification; 27F/1492R for 16S rRNA amplification; MxaF1003/MxaR1561 and
MxaF1003/MxaR1555 for mxaF amplification.
Southern blotting (Sambrook & Russell, 2001) was used to transfer DNA onto Nylon
Hybond-N membranes (Amersham, Little Chalfont, UK). DNA was fixed to the
produced by PCR amplification of the desired segment of the target gene. The DNA
52
fragments were subsequently radiolabelled by the random priming method of
Feinburg & Vogelstein, 1983, with 50 ng of PCR product being labelled with 50 µCi
1983 using the buffers of Sambrook & Russell, 2001in a Hybaid oven (Hybaid Ltd.,
Middlesex, UK) with washing stringencies as described by Oakley & Murrell, 1988.
Removal of bound probe from membranes before reuse with other hybridisation
probes was achieved by boiling in 0.1 % (w/v) SDS for at least 10 min.
Fuji nif RX medical X-ray film was used for all microautoradiographs. Radioactive
membranes were exposed to this film in light-tight autoradiography cassettes with two
Cloning of PCR products was performed using the TOPO TA cloning kit (Invitrogen)
using the manufacturer’s chemical transformation method and plated according to the
clones each were produced and kept at 0-5 oC for short-term storage. For long-term
from a stock of 100 mg/mL (filter sterilized and stored at –20 oC) and incubated at
53
37oC and 200 rpm shaking in an orbital shaker overnight. The cells were centrifuged
80oC.
For dereplication of the clone libraries, all clones were inoculated into 10 mL LB
broth using sterile wooden toothpicks as for the construction of glycerol stocks. After
growth of the overnight culture, 2 mL was taken for use in the alkaline lysis mini-prep
procedure of Sambrook & Russell, 2001. Plasmid DNA then was resuspended in
50 µl of sterile deionised water and was then subjected to restriction fragment length
Restriction digests were performed on plasmid DNAin order to dereplicate the clone
Double digests of plasmid DNA were with EcoRI, in order to liberate the cloned
insert from the vector, and another enzyme (in the case of cmuA either RsaI or DdeI).
0.25 U of each enzyme was used. Buffers were used according to the manufacturer’s
guidelines and the volume was made up to 10 µl with sterile Milli Q water. 2 µl of
100 µg/mL RNase (Promega) was added to reaction mixes in order to prevent RNA
buffer was then added to each of the reaction mixtures and the entire volume was
loaded onto agarose mini-gels for electrophoresis. Gels were then stained with
ethidium bromide (EtBr) in order to enable visualisation of the DNA fragments. For
large clone libraries, 500 mL gels cast with 72 wells were used and these gave better
54
resolution of RFLP patterns than the mini-gels. Operational Taxonomic Units
(OTUs) contained within the clone libraries were defined as groups of clones
containing plasmid with unique restriction enzyme patterns. The identity of OTUs
Biology Services Laboratory using the BigDye dyedeoxyterminator ready reaction kit
Analysis of 16S rRNA gene sequences was carried out by using the BLAST program
aligned with the highest scoring hits using the fast-aligner included with the ARB
software (Ludwig et al., 2004) and the same software was used to produce
phylogenetic trees using the 16S rRNA database provided with the software.
Functional gene sequences were analysed using BLAST to check their identity and
then imported directly into “in-house” ARB databases set up for the relevant gene of
interest.
Bootstrapping was carried out with at least 100 replicates in neighbour-joining and
DNAPars analyses and the trees produced by each algorithm compared to ensure the
55
PHYLIP independently of ARB due to a known issue with ARBs implementation of
this algorithm. Trees were rooted with an appropriate relative in each case.
analysis
The method used was that of Moeseneder et al., 1999 with certain modifications. The
primer and prevent it from interfering with peak detection. Primers were used as for
PCR reactions at 25 pmol per reaction. The PCR reactions were not precipitated prior
to gel extraction as described in the Moeseneder et al., 1999 method, but gels were
cast with wells large enough to take the entire volume of the reaction. This avoided
any potential loss of PCR product during the precipitation. Restriction enzymes
BsiYI (Roche), HaeIII (Helena biosciences) and HpaII (Helena biosciences) were
found to give the best discrimination between OTUs in either the forward, reverse or
both terminal restriction fragment lengths (TRFs); this was determined by analysis of
enrichments, using ARB sequence alignments (see also Chapter 6 and Appendix D).
Definition of an OTU was dependent upon the level of analysis. It was defined either
the three TRFs for each gene sequence. Amounts of product were determined on a
per sample basis by the University of Warwick Central Molecular Biology Services
Laboratory and samples were run with ROX 500 ladder in de-ionised HiDi formamide
56
using Genemapper v.3.0 (Applied Biosystems, Warrington, UK). Genemapper
57
Chapter 3
58
3 Chapter 3: Measurement of Methyl Bromide
3.1 Introduction
One of the aims of this project was to couple the molecular analysis of CH3X
many other investigators have demonstrated (e.g. Nightingale et al., 1995; Cicerone et
phase along a narrow tube, known as the column, which is coated with a liquid
stationary phase. The components of the sample are retarded at different rates
depending upon their partition into the liquid phase and can be identified by their
maximise the sensitivity of the system and different column types and compositions to
maximise separation of the compound of interest from the others in the sample.
3.1.1 GC columns
There are many different types of column used in gas chromatography, depending on
the compounds you wish to differentiate, the composition of the sample and the
solvent used. Factors important in the separation of the sample include the length of
the column, the internal diameter of the column, the nature of the liquid phase, the
carrier gas used, and the composition of any support included for the liquid phase.
59
Packed columns are commonly glass or stainless steel tubes which are packed with a
porous support material such as diatomaceous earth. The packing can be coated with
the liquid phase for the separation. The nature of the column means that they tend to
be shorter and have a wider internal diameter, which can limit the separation.
Capillary columns, with internal diameters of 0.18 to 0.53 mm are made from fused
silica and are coated with a polyamide polymer. This means they can be much longer
as they are more flexible and can be coiled, with lengths of 100 m being possible.
The liquid phase can coat or be chemically bonded to the inside of the column.
Some columns, such as PLOT columns (Porous Layer Open Tubular) do not have a
liquid phase at all and rely on separation between the carrier gas and a solid phase
3.1.2 GC detectors
Once the sample components have been separated from one another they must be
detected. There is a large range of different types of detector and they vary in their
table 3.1.
There were two detector types used in this study, a flame-ionisation detector (FID)
and two electron capture detectors (ECD). The FID is much less sensitive to CH3Br,
but it is simpler to run. It was used to demonstrate the presence or absence of the
enrichments and culture of CH3Br utilisers. With the improved sensitivity of the ECD
60
to halogenated compounds it is possible to measure the parts per trillion by volume
The ECD was invented by James Lovelock in 1959 (Lovelock, 2000; Lovelock,
1963). He used it to make measurements of compounds such as methyl iodide and the
enabled measurements of pesticides to pptv levels with such data informing Rachel
Carson’s book The Silent Spring in 1962 and empowering the environmental
movement.
The detector consists of a source of β-particles, normally 63Ni and two electrodes in a
sealed chamber. Make-up gas molecules, such as N2, are supplied constantly and
collide with the β-particles, ionising them and providing a stable electron cloud within
61
the detector (Fig 3.1). A constant current is maintained across this cloud by the
electrodes. As electronegative compounds from the column enter the detector, they
absorb electrons from this cloud and disturb the current. The detector’s electronics
compensate for this, maintaining the current, and the level of the perturbation is
equivalent to the concentration of the compound entering the detector. The fact that
the compound in order for it to be measured must disturb the electron cloud, lends the
hydrocarbons do not and cannot be detected at all. Oxygen strongly affects the signal
due to its high electronegativity and as such the make-up gas and carrier gas (which is
chemically inert and carries the sample to the detector) must be free of oxygen. It
also reduces the lifetime of the 63Ni β-emitter by oxidising it. Oxygen and water can
Fig 3.1. Diagrammatic representation of the Electron Capture Detector. The cathode
is the casing of the detector.
mixing with ambient air can alter the amounts of CH3Br present in the sample
especially if the sample is under- or over- saturated with respect to the ambient air.
Samples should be collected in gas tight vessels preferably of brown glass to prevent
62
photolysis. Vessels should also be completely filled, avoiding the presence of both
headspace and bubbles in order to prevent exchange of the dissolved gases with the
gaseous phase.
For the study at L4 sub-samples were taken from Niskin bottles, which can be
winched to the desired depth and fired and sealed remotely, in 300 mL darkened BOD
allowing the sample to over-flow before capping and avoiding contamination sources
Samples for gas chromatographic analysis are normally gaseous, or easily volatilised.
Measurements of trace gases in seawater have their own inherent difficulties. Firstly
the levels of CH3Br present can be very low. At L4 the lowest concentration was
0.23 pmol dm-3 (8 % saturation with respect to atmosphere), and thus samples require
from the seawater sample, as water adversely affects the ECD and seawater is also
Purge and trap methods offer the perfect solution to this (e.g. Krysell & Nightingale,
1994). The apparatus in Fig. 3.2 displays the major components of a purge and trap
system. The seawater sample is passed into the sparge tower from a gas-tight glass
syringe (1, syringe not shown). A purified gas, inert with respect to the compound
you are analysing, is bubbled through the seawater sample for enough time to strip the
dissolved gasses from it (A). Water is removed from this gas stream by a rage of
means that can include chemical driers, such as magnesium perchlorate (4), or by
63
physical means, such as condensation (3) or counter-current exchangers (5). Finally
the gas is passed through a collecting loop that is held above liquid nitrogen (not
shown). The gas of interest freezes and concentrates in the loop. Once the sample
has finished sparging a valve is thrown which enables carrier gas to pass through the
4 B
Fig 3.4.
4 Diagram of
GC ECD
System Fi
3 two. Solid g
black lines 3.
Fig.23.2. Purge apparatus for GC ECD system two. Numbering refers to items
indicate 1/8 in 4.the
text: 1. Sample inlet, 2. Sparge tower, 3. Condensation tube, 4. Magnesium
“ Swagelok Di
perchlorate drying tube, 5. Nafion counter current exchange drier, 6. Bubble flow ag
stainless
meter. Gas flow direction is indicated: A. Sparge gas inlet, B. Sparge gas containing
steel ra
sample outlet, C. Counter-current gas inlet. 5 tubing, m
except in of
the case of G
loop, which is rapidly heated, driving the concentrated sample ontothe the column in C a
1 A cryofocussi E
single pulse. Both ECD systems (systems two and three) employedng this
loopmethodologyC
which is D
for analysis of CH3Br from seawater samples. 1/16 “ S
Swagelok ys
stainless te
3.1.6 Advantages of automation steel m
tubing. tw
It was decided that the GC systems used for CH3Br measurement should The area be in o.
the dashed S
automated as far as possible. This has several advantages, including boxtheisfact
the that itol
water id
facilitates operation of the system during ship-based fieldwork. Undersampleany bl
purging ac
circumstances it can be difficult to throw the valves in time in the correct
tower andsequencek
drying li
and in a reproducible way, this is rendered more difficult when the apparatus.
system is at sea. ne
C s
Automation of the system using computer- or integrator-driven programming allows in
di
the reduction or removal of much of the variability between samples ca
te
1/
64 8
“
S
3.2 System one
This system had flame ionisation detection of CH3Br and was also able to detect
CH3Cl. It was fitted with a Porapak Q packed column. It was used to monitor the
disappearance of CH3Br from enrichment cultures and was calibrated by using a range
septum. See methods section for further details. Owing to the nucleophilic attack by
chloride ions in the media and seawater of enrichments, CH3Br became gradually
substituted to CH3Cl and degradation of the two methyl halides could only be
separated when consumption rates by the enrichment exceeded the substitution rate.
Enrichments were considered to have consumed all the CH3Br when both CH3Br and
65
3.3 System two
The core of this system was a Shimadzu GC 14A ECD gas chromatograph with an HP
Spectraphysics integrator. A gas purifier system was built using swagelok connectors
and water and O2 strippers (Supelco, UK) in order to purify the carrier (He), make-up,
sparge and Nafion counter-flow (all N2) gases (see Fig. 3.3)
Fig 3.3. Gas purifier system for removing water, oxygen and other contaminating
molecules (such as hydrocarbons) from the carrier, make-up, sparge and Nafion
counter flow gases prior to entering the GC system two.
The system was initially designed to be fully automated, with a system of solenoid
and 6-port valco valves for taking in, sparging and removing the seawater sample,
cryotrapping and release of the sample to the GC column and the switching of sample
stream between the main column and a pre-column (see Fig 3.4). All tubing was 1/8”
or 1/16” stainless steel and the valves that came into direct contact with seawater were
Hastalloy C rather than stainless steel as this has greater long-term resistance to the
66
corrosive effects of seawater. The presence of a pre-column in the system allowed the
sample to be diverted once the CH3Br peak had been detected, preventing other
compounds present in the sample from entering the main column and speeding up the
analysis time as there was no need to wait for these other compounds to leave the
main column before starting another sample. Flow rates for the carrier and make-up
gases ranged between 1-5 and 30-40 ml min-1 respectively as the system was being
tested for measurement of CH3Br and the GC oven was run isothermally at 60oC (the
CH3Br was detectable using the system, but seemed to be extremely variable in the
seawater samples from L4 used to test it. It was unknown at the time whether this
natural variability. It was also discovered by using pure CH3Br diluted in laboratory
air as a standard that there seemed to be a fault with the electronics of the GC, which
resulted in the signal output remaining off-scale despite the actual signal being
transient, a fault known as ‘latch-up’. Owing to this problem and attention being
67
68
3.4 System three
Rather than starting from scratch system three was based on a system previously used
for the detection of chlorofluorocarbons (Haine et al., 1995) and the testing and
validation of the system for measurement of CH3Br was started by Malcolm Liddicoat
at PML, continued by myself; the system was finally used to measure natural
capillary column with 8 µm film from J&W Scientific, which had been found to give
better separation than the HP PLOT Q column used on system two (Malcolm
Liddicoat pers. comm.). The gas purifier set-up was not required for this GC as the
gases were supplied in BIP cylinders (Built-in purifier) by Air Products (UK). The
flow rate of the N2 make-up gas was 30 ml min–1 and the He carrier gas was
5 ml min-1. The sensitivity of the ECD changed whilst the system was in use as the
detector was ageing and the 63Ni source becoming attenuated, by both natural
radioactive decay and the oxidation of the 63Ni. This resulted in the make-up gas
sensitivity. A gravimetric standard of 500 ppm CH3Br (BOC, UK) was measured
200 mL seawater samples were sparged for 20 min with BIP N2 at 110-120 ml min-1,
which had been demonstrated to remove CH3Br from the sample to a level below the
detection limits of the system (Malcolm Liddicoat pers. comm.). The gas stream was
69
dried using two magnesium perchlorate drying tubes and cryotrapped on a 1/16”
stainless steel loop held above liquid N2 and maintained at –150oC for the 20 min
sparge time. After 20 min valves were thrown automatically and simultaneously the
liquid nitrogen removed and replaced with boiling water to drive the gas sample onto
the column.
3.5 L4 results
Samples were taken from station L4 for CH3Br measurement from 10th July 2003 to
23rd November 2004, with a hiatus from March to August 2004, as the GC was
required for a cruise. Data were corrected for cryofocussing loop volume (50 µl to
1000 µl), and calibrated against a 500 ppb standard, which corrected for natural drift
of the detector. The detector was changed on the 6th October 2003 and the standard
runs, which were carried out at least once with each batch of samples and usually two
or three times, allowed continuation of the data set. Contaminated samples and those
Saturations of CH3Br in the water column seem to vary quite strongly and rapidly and
the 13th October 2003 saturations of 164.0 % were measured at 50 m, and became
progressively less saturated until 47.3 % was measured at 10 m depth. The following
week (21st October 2003) levels in the water column were fairly uniform with large
respectively.
70
This suggests that CH3Br was being actively produced and rapidly degraded. The
peaks in CH3Br supersaturations occurred in August and September of both 2003 and
2004 and it is a shame that there is gap in the data between March and August 2004 as
Comparison of the CH3Br data with the available data from L4 on phytoplankton
abundance (2003 only) indicated that the peak in CH3Br correlated with peaks in the
producers such as Emiliania huxleyi (Fig 3.6). Pearson correlation analysis indicated
that CH3Br abundance was significantly positively correlated with both E. huxleyi and
lags behind the peaks in phytoplankton abundance, this agrees with observations that
elevated levels of CH3Br at L4 as the phytoplankton reach their stationary phase and
that the bacteria are responsible for the rapid switch from supersaturated to
undersaturated that can be seen. It is also possible that the CH3Br utilising bacteria
phytoplankton, and degrade CH3Br alongside these other carbon and energy sources.
The data gives a tantalising glimpse of this possibility, but as there is no molecular or
bacterial evidence that correlates with this data set it is impossible to test this
hypothesis.
71
Enrichments from L4 were inoculated from samples collected on the 18th April 2002,
20th June 2002 and 30th July 2002, and cmuA PCR products detected from all three
enrichments, indicating the presence of bacteria capable of utilising CH3X at all these
times. If patterns of previous years are followed it is likely that the July, and possibly
June samples were taken during a period of supersaturation of CH3Br with respect to
72
Fig 3.5. L4 CH3Br measurements. Data is expressed as % saturation with respect to
atmosphere and the solubility of CH3Br was calculated using the method of (De
Bruyn & Saltzman, 1997). The first sample data point was 02/07/2003. The data
shown in red are CH3Br measurements irrespective of the depth of sampling. Those
in pink are water column means. The gap prior to day 200 of sampling is present as
although sampling had begun, data was discarded due to poor calibrations.
73
Fig 3.6. Phytoplankton abundance and CH3Br concentration at L4. ‘Picos’ refers to
picoeukaryotes, CH3Br data are the water column means and also averaged when
there was more than one reading per week. L4 data from the L4 plankton monitoring
programme, Plymouth Marine Laboratory, available from http://www.pml.ac.uk/L4/.
74
3.6 Potential proxies for CH3Br measurement
CH3Br measurements were not taken on the AMBITION cruise, as the GCD ECD
system two which was available at the time was not operational. It is possible to
hypothesise the presence of CH3Br at the sampling stations from other measurements
3.6.1 Pigments
A large number of different macro- (Laturnus, 1995; Laturnus et al., 1998) and micro-
algal (Saemundsdottir & Matrai, 1998; Scarratt & Moore, 1998) species have been
Certain marine phytoplankton are known to have characteristic pigments which can
the presence of these groups in the samples. Table 3.3 indicates groups of organisms
and the chlorophylls, carotenoids and biliproteins that can be linked with them.
75
Class Organism Culture Study
collection ID
Diatom Chaetoceros diversum (Saemundsdottir
& Matrai, 1998)
Chaetoceros atlanticus (Saemundsdottir
& Matrai, 1998)
Chaetoceros calcitrans CCMP315 (Scarratt &
Moore, 1998)
Dinophyte Amphidinium carterae (Saemundsdottir
& Matrai, 1998)
Prorocentrum micans (Saemundsdottir
& Matrai, 1998)
Prorocentrum sp. CCMP703 (Scarratt &
Moore, 1998)
Prorocentrum tricornatum (Scarratt &
Moore, 1998)
Prasinophyte Pynococcus provasolii (Saemundsdottir
& Matrai, 1998)
Prymnesiophyte Phaeocystis sp. (Saemundsdottir
& Matrai, 1998)
Phaeocystis sp. (Stefels & Van (Scarratt &
Boekel, 1993) Moore, 1998)
Haptophyte Emiliania huxleyi CCMP373 (Scarratt &
Moore, 1998)
Cyanobacteria Synechococcus sp. CCMP1334 (Scarratt &
Moore, 1998)
Rhodophyta Porphyridium sp. UTEX190 (Scarratt &
Moore, 1998)
Table 3.2. Marine phytoplankton demonstrated to produce CH3Br in laboratory
cultures. CCMP is the Provasoli-Guillard National Centre for Culture of Marine
Phytoplankton, Maine, US. UTEX is the University of Texas Culture Collection of
Algae.
76
Pigment Class Pigment (abbreviation) Phytoplankton Group
Chlorophylls Chlorophyll a (Chla) All photosynthetic micro-
algae, except
prochlorophytes.
Divinyl chlorophyll a (DvChla) Prochlorophytes.
Chlorophyll b (Chlb) Green: chlorophytes,
prasinophytes,
euglenophytes.
Divinyl chlorophyll b (DvChlb) Prochlorophytes.
Carotenoids Peridinin (Per) Dinoflagellates.
19’-Butanoyloxyfucoxanthin (But) Some prymnesiophytes
one chrysophyte, several
dinoflagellates.
Fucoxanthin (Fuc) Diatoms,
prymnesiophytes,
chrysophytes,
raphidophytes and several
dinoflagellates.
19’-Hexanoyloxyfucoxanthin (Hex) Prymnesiophytes and
several dinoflagellates
Violaxanthin (Vio) Green algae: chlorophytes,
prasinophytes,
eustigmatophytes.
Diadinoxanthin (Ddx) Diatoms, dinoflagellates,
prymnesiophytes,
chrysophytes,
raphidophytes,
euglenophytes.
Alloxanthin (Allo) Cryptophytes.
Zeaxanthin (Zea) Cyanophytes,
prochlorophytes,
rhodophytes, chlorophytes,
eustigmatophytes.
Lutein (Lut) Green algae: chlorophytes,
prasinophytes.
Table 3.3. Linking pigment presence with classes of phytoplankton (Baker et al.,
1999; Schluter & Mohlenberg, 2003; Wright et al., 1991)
77
In terms of using pigments as markers of the presence of classes of phytoplankton
whose members have been demonstrated to produce CH3Br in laboratory culture, the
pigments of interest are fucoxanthin and diadinoxanthin (diatoms, that were actually
78
Fig 3.7. Pigment concentrations during the AMBITION cruise in ng L-1. Please note
the changing scales of different pigments. Maximum pigment levels were 106.04 ng
L-1 Alloxanthin (stn 11), 1013.69 ng L-1 19’-Butanoyloxyfucoxanthin (stn 10), 157.41
ng L-1 Diadinoxanthin (stn 10), 2165.26 ng L-1 Fucoxanthin (stn 9), 376.68 ng L-1 19’-
Hexanoyloxyfucoxanthin (stn 8), 3367.1 ng L-1 Chlorophyll a, 14.83 ng L-1 Lutein
(stn 10), 279.35 ng L-1 Peridinin (stn 9), and 42.6 ng L-1 Violaxanthin (stn 10). In all
cases the maximum pigment levels were at the chlorophyll maximum for that station
based on fluorimetry measurements (RRS Charles Darwin 132 Cruise report, ).
79
At every station pigments characteristic of clades whose members have been
with increasing concentrations and hence abundance towards the northerly eutrophic
waters. There are important caveats however; not all members of the phytoplankton
clades shown to produce CH3Br are capable of CH3Br production; it is not known
what the physiological state of the phytoplankton was at the time of sampling as
pigments are not generally restricted to particular groups that have been shown to be
CH3Br producers (Saemundsdottir & Matrai, 1998; Scarratt & Moore, 1998).
Sea surface temperature has been correlated with saturation and undersaturation
anomalies of CH3Br (King et al., 2002). The variability in SST has been shown to
biological production and degradation. Data from six cruises was fitted to two
quadratic equations for spring and summer, and autumn and winter. The equations
reproduce the saturation anomaly for CH3Br on a global scale, but fail to reproduce
Wingenter et al., 2004) and it is likely that this was the case in the eutrophic northern
cruise stations where phytoplankton production was abundant (see Appendix C). A
80
further limitation is that this method only indicates saturation anomaly with respect to
3.7 Discussion
The difficulty with which a GC system was constructed that was capable of
measuring the extremely low CH3Br concentrations in seawater samples left us unable
to precisely correlate the presence and abundance of CH3Br with the molecular
ecological data of the presence and diversity of cmuA and hence the presence of
bacteria capable of using CH3X as sole carbon and energy sources. Methyl bromide
measurements were taken at L4 and demonstrated that levels varied from extremely
supersaturated (highest value 214.6 % saturation or 4.70 pmol/l, September 2003) and
that this showed some consistency with season and the abundance of phytoplankton.
The problems with GC system two and its apparent measurement of highly variable
CH3Br levels may have been due to natural variations in the levels of the compound,
as demonstrated by the measurements with system three noted above. It still remains
that there were also electronic problems with this system, which justifies the
Potential proxies for the direct measurement of CH3Br were investigated in order to
gain an appreciation of the levels of the compound during the AMBITION cruise, but
81
In future now that the system three GC is capable of sensitive and calibrated
validate the methodology above and estimate the abundance of CH3Br using the
extremely interesting to investigate how many bacteria capable of utilising CH3Br are
such as real-time PCR, to see whether this correlates with the observed super-and
82
Chapter 4
CH3Br-utilising bacteria
83
4 Chapter 4: Enrichment and Isolation of CH3Br-Utilising Bacteria
4.1 Introduction
Marine systems are both an important source and sink of CH3Br to and from the
atmosphere (Baker et al., 1999; Tokarczyk et al., 2003). Marine sources of CH3Br
include both micro- and macro-algae (Scarratt & Moore, 1998) and (Laturnus et al.,
1998). Marine sinks are less well understood and believed to be biological and
associated with plankton within the bacterial size range (King & Saltzman, 1997).
When this study was initiated only a single marine strain capable of utilising CH3Br
as sole carbon and energy source had been isolated; Leisingera methylohalidivorans
MB2, isolated from a marine tide-pool in California (see Chapters 1 and 7 for more
information on this strain). No open-ocean strains had been isolated. Hoeft et al.,
CH3Br-degrading organisms. They obtained 4 isolates from Long Island Sound one
of which (strain LIS 3) seemed to be able to utilise CH3Br as sole source of carbon
and energy. However they concluded that degradation of CH3Br was a co-metabolic
(Aylward & Findlay, 1986) complete oxidation of CH3Br could provide –723.8 kJ/mol
of energy (Fig 4.1). Using the method of (Heijnen & Van Dijken, 1992), which takes
into account physiological values and a range of electron acceptors, the predicted
84
CH3Br + 1.5O2 CO2 + H2O + Br- + H+
Fig. 4.1. Chemical equation for complete oxidation of CH3Br. Standard Gibbs free
energy values of formation are included beneath each species.
The aim of this section of work was to enrich for and isolate bacteria capable of
utilising CH3Br as sole carbon and energy source, particularly from the Arabian Sea,
in order to demonstrate the presence of these organisms and to gain insights into their
85
4.2 Arabian Sea enrichments
During the NERC Thematic Cruise, AMBITION (Cruise CD132, aboard RRS Charles
Darwin), a large number of samples were taken for DNA extraction and molecular
up with a range of carbon sources from all stations in order to enrich any of these
Enrichments were set up in batches of twelve with the carbon sources as listed in
Table 4.1 (see Chapter 2 for more details). At each station 2 L of surface water and
water from the depth of the chlorophyll maximum was filtered and resuspended in 3
mL of water from the same sample. 100 µl of this was added to each vial of the set of
86
Enrichments were screened after 2 to 8 weeks (depending on whether they were
collected towards the beginning or end of the cruise), by scoring turbidity by eye (as
there was only a small amount of enrichment available it was desirable to retain all of
the sample rather than using a destructive method of biomass measurement, Table
4.2) and by gas chromatography to assess the presence or absence of CH3Br and
CH3Cl.
87
The vials selected for initial maintenance were those in Table 4.3. CH3Br was added
to the headspace at 0.2 % (vol/vol), which had been found to be the highest level
tolerated without inhibition of growth in other enrichments (Schaefer et al., 2005) and
when growing CH3Br utilising strains. They were then left for a further two weeks, at
which point they were subcultured at 1 % inoculum size into larger 125 ml vials with
Enrichments on CH3Cl were supplied with 2.0 % CH3Cl as this compound is less
toxic and some CH3X-utilising bacteria have demonstrated higher substrate affinities
The remaining enrichments were split into groups based on whether they displayed
turbidity and on whether they had been exposed to CH3X. Those with CH3X were
monitored for depletion of CH3X in headspace, only four further enrichments were
observed where this was the case, 165, 189, 249 and 273; all four originally enriched
with 10 mM formate and 0.5 % (vol/vol) headspace CH3Br and originating from
Turbid enrichments that had been enriched with substrates other than CH3X were
pooled to form a general methylotrophic pre-enrichment and then given only 0.2 %
CH3Br. The rationale was that providing a less toxic growth substrate initially would
88
allow proliferation of CH3X utilisers that were also capable of growth on other C1
growth substrates and that when supplied with CH3Br they would utilise this more
rapidly than in the case of CH3X only enrichments. 0.1 ml of each turbid enrichment
from conditions 4, 6, 8, and 10 was added to 25 ml of 0.1 x marine ANMS with 0.2 %
phytoplankton.
The nine subcultured enrichments, together with the pooled enrichment were
examined periodically for utilisation of headspace CH3X. With media containing Cl-
CH3Cl (Elliott & Rowland, 1993) and therefore enrichments were not considered to
be depleted of CH3X until both compounds were below the detection limit of the GC-
FID. At this point another pulse of the appropriate CH3X was added to the vial after
removing the same volume of headspace in order to keep the pressure inside the vial
constant.
The pooled enrichment stopped oxidising CH3Br after one pulse of 0.2 % (vol/vol)
encourage oxidation. This enrichment was labelled PE2 (Pooled Enrichment 2). This
also occurred with the enrichments in table 4.3 above and they were also subcultured.
PE2 actively degraded CH3Br whereas the other subcultured enrichments failed to
oxidise any more CH3Br, either in the subculture or the original enrichment. The
oxidising pulses of the compound for varying amounts of time (see table 4.4)
89
Enrichment Station Number of 0.2 % Total amount CH3Br
CH3Br pulses consumer (µmoles)
165 7 5 223.2
165.2 7 2 89.2
PE2 Pooled 13 580.4
189 8 2 89.2
249 10 5 223.2
273 11 6 267.9
Table 4.4. Total CH3X consumed by enrichments.
Oxidation of CH3Br by enrichment cultures can be seen in Fig 4.2. The data have
been adjusted against the chemical control (also shown), which indicates the chemical
degradation rate of CH3Br when incubated with autoclaved media, due to nucleophilic
substitution and hydrolysis. A standard curve was unavailable for this data set and so
averages of the CH3Br peak area for all other standard runs of five different
concentrations (1 %, 0.5 %, 0.2 %, 0.05 % and 0.01 %) of CH3Br were taken and a
headspace concentration calculated from the polynomial regression. The R2 value for
90
Fig 4.2. Oxidation of CH3Br by four enrichments. Rates were calculated for the
fastest initial portion of the graph, between 18/10/2002 and 29/10/2002. The
chemical loss rate was 0.18 µM CH3Br/day. Oxidation rates were 11.32, 10.03, 8.18
and 4.32 µM CH3Br/day for enrichments 165, 189, 249 and 273 respectively, after
adjusting for the chemical control.
4.3 L4 enrichments
The enrichment strategy with L4 samples was different to that of the Arabian Sea
samples. Arabian Sea samples were transferred to media, partly in order to avoid the
complications of setting up vials at sea with a wide range of substrates, two of which
(CH3Br and CH3Cl) were quite toxic. The enrichments were also very small in
seal vials were used and filled with 300 ml of surface seawater samples on three
occasions, 18th April (L4.1), 20th June (L4.2), and 30th July (L4.3) 2002. Again they
were incubated at room temperature in the dark and monitored for depletion of 0.2 %
CH3Br by GC-FID. L4.1 consumed 5 pulses of 0.2 % (vol/vol) headspace CH3Br and
L4.2 and L4.3 consumed 3 pulses each, corresponding to 312.5 µmoles and
91
4.4 Non-axenic phytoplankton enrichments
(Schafer et al., 2002) demonstrated that stable relationships existed between uni-algal
diatom cultures and the co-cultured bacteria and that distinct satellite bacteria
assemblages could be found with the algal cultures. Also, axenic and non-axenic
culture conditions (Scarratt & Moore, 1998) and it was hypothesized that it would be
CH3Br as a carbon and energy source. Six cultures of the coccolithophore Emiliania
huxleyi were obtained from the culture collection of Dr. Declan Schroeder (Marine
Biological Association, UK) and flow cytometry was used to confirm whether or not
Strain Axenic/Non-Axenic
E. huxleyi 92A Non-axenic
E. huxleyi 373 Very poor growth, many bacterial sized
particles on flow cytometry
E. huxleyi 373 UEA Axenic
E. huxleyi 379 Very poor growth, many bacterial sized
particles on flow cytometry
E. huxleyi 1516 Non-axenic
E. huxleyi 1516 CCMP Non-axenic
Table 4.5. E. huxleyi culture axenicity. Strain designations refer to those of the
MBA, UK culture collection.
E. huxleyi strain 1516 CCMP was used as this culture was non-axenic and grew most
readily. Two approaches were used. In approach one, the strain was grown in a 1 L
crimp-seal vial with sterile needles attached to 0.2 µm sterile acrodisc (Pall-Gelman)
filters attached to allow gas exchange. Once the culture had grown the venting
(vol/vol). This was then monitored for depletion of CH3Br. In approach two a
stationary phase culture of E. huxleyi 1516 CCMP was filtered through a 1.2 µm
92
47 mm cellulose nitrate membrane filter in order to remove the phytoplankton cells.
crimp-seal vial and given 0.2 % (vol/vol) headspace CH3Br. This vial was also
CH3Br over a period of 6 months. This approach has subsequently been successfully
The isolation strategy used was identical to that of Schaefer et al., 2005 (see also
enrichments were plated in duplicate onto MAMS plates at three different dilutions
(10-2, 10-3 and 10-4) and incubated in anaerobic gas jars (Becton Dickinson) with a
CH3Br atmosphere. Once growth was observed, the colonies on one of each pair of
plates was washed into 5 ml of MAMS and assayed for the utilisation of 0.2 %
(vol/vol) headspace CH3Br. When an assay proved positive for CH3Br utilisation
colonies were picked from the corresponding sister plate, streaked to purity and
maintained for further analysis. Washings from the enrichments 165 at 10-2 and 10-3
dilutions, and the pooled enrichment subculture (PE2) at 10-2 proved positive.
15 colonies were picked from the three plates selected above based on differing
colony morphology within each plate. Between plates there was much duplication of
colony morphology with the same morphologies being seen on all three plates.
Strains were streaked to purity over 4-6 weeks and were generally small and slow
growing. Two strains became contaminated with fungi and were lost and MJC 3, 4
93
and 13 were extremely slow-growing and resistant to subculture. Direct PCR of the
biomass (see Chapter 2, Materials and Methods) of single colonies of the remaining
strains were used to generate 16S rRNA gene and cmuA PCR products using primer
were run on 1 % agarose gels and gel extracted prior to direct sequencing in the case
of 16S rRNA gene PCR products, using primers f27, r1492 (both (Lane, 1991), and
341F (Muyzer et al., 1993), and cloning and sequencing in the case of cmuA PCR
A single strain, MJC10 gave a cmuA PCR product and the sequence grouped
phylogenetically with an uncultured marine clade from the Arabian Sea. This strain
isolate). MJC10 and the other two isolates identified as Microbacterium were grown
in 125 ml crimp-seal vials on both MAMS and MAMSTY media and supplied with
0.2 % and 0.1 % (vol/vol) CH3Br in the headspace. No utilisation of CH3Br was
cmuA from these cultures proved impossible. It is possible that the MJC10 cmuA
PCR product was contamination, but there are indications that this was not the case.
The sequence of the product was not identical to any of the CH3X-utilising strains, or
any of the sequenced clones. Also, the negative control of the PCR reaction did not
the culture was not pure and that a cmuA-possessing culture was present along with
94
Strain Source Colony morphology 16S rRNA BLASTN result cmuA BLASTN result/
MJC1 PE2 10-2 Flat, white, adherent and 100 % (1392/1392) AJ244697 Negative
radially lobed. Flavobacterium V4.MO.31
MJC5 PE2 10-2 Small, irregular opaque and 99 % (1340/1344) Y17227 Faint PCR product of expected size
yellow. Microbacterium oxydans
MJC6 165 10-2 ‘Fried-egg’ morphology, 99 % (601/604) AJ244697 Negative
translucent with yellow centre Flavobacterium V4.MO.31
MJC8 165 10-2 Tiny pinprick colonies, reddish 99 % (1333/1336) AJ244716 Non-specific amplification (confirmed
brown. Erythrobacter-like V4.BO.03 by sequencing and BLASTN analysis)
MJC10 165 10-2 Small, irregular opaque and 99 % (1011/1012) Y17237 85 % (601/701) AY934439 Uncultured
yellow. Microbacterium schleiferi soil clone. 90 % ID/93 % Sim.
AAY46974 Uncultured soil clone.
MJC11 165 10-2 Tiny pinprick colonies, reddish 99 % (1338/1339) AJ244716 Negative
brown. Erythrobacter-like V4.BO.03
-3
MJC12 165 10 Flat, white, adherent and 99 % (1349/1355) Y17237 Negative
radially lobed. Microbacterium schleiferi
MJC14 165 10-3 Tiny irregular and white. 99 % (760/764) AJ294340 Negative
Erythrobacter citreus HY-6
MJC15 165 10-3 Tiny irregular and white. 99 % (1340/1341) AJ244716 Negative
Erythrobacter-like V4.BO.03
Table 4.6. Strains isolated from CH3Br enrichments of Arabian Sea samples
95
4.5 Oxygen electrode studies of H. chloromethanicum strain CM2
examine the substrate affinities and reaction velocity for CH3Cl, CH3Br, and CH3I.
Oxidation rates were calculated for the substrate concentrations given in Table 4.7,
with Km and Vmax values calculated from double reciprocal Lineweaver-Burk plots
in Table 4.8. The data should be viewed only as an indication of relative rates as it is
based on a single replicate. The upper concentrations of substrate used for CH3Br and
CH3I were the highest that did not demonstrate inhibition, either by no oxidation, or a
slowing of the oxidation rate compared with a lower concentration. Substrates were
water and concentrations back calculated using the solubility of the compound, and
the smallest volume of these solutions that could accurately be added to the electrode
It is interesting to note that the order of the upper limits in concentration of the CH3X
components, and the methylation of DNA by these compounds has been shown to be
the mechanism of carcinogenicity in murine models, with the more weakly bonded
CH3Br and CH3I being more toxic (Bolt & Gansewendt, 1993).
96
Substrate Km (µM) Vmax (nmole O2/min/mg
dry weight
CH3Cl 80.97 37.58
CH3Br 124.42 45.19
CH3I 300.73 39.05
Table 4.8. Substrate affinity and maximum oxidation rate of H. chloromethanicum
CM2 with CH3X.
4.6 Discussion
Of all the enrichments that were set up, from all locations, those from the Arabian Sea
that were enriched initially with formate were the most active. It is interesting to note
that formate dehydrogenase catalyses the final step in the methyl halide degradation
pathway, and perhaps enriching for the presence of this enzyme and the ability to
degrade formate also increased the proportion of the population capable of utilising
CH3Br through the CmuA pathway. However, not all the characterised CH3X
A general trend in turbidity can be observed from Table 4.3, with increased turbidity
in enrichments from more Northerly stations. These waters were more productive
(for example, Station 9 had an all depth average 3H Leucine uptake of 762 pmol/l/h
and Station 1, 47 pmol/l/h) and there may therefore have been a greater number of
alternative substrates present other than those added during the enrichment procedure.
Increased biomass addition would also impact the amount of DOC (dissolved organic
carbon) available in these enrichments; as bacterial and algal cells lyse and release
labile substrates. Enrichments that actively degraded CH3X also came from stations 7
97
to 11. This could also be due to the fact that a greater inoculum density would
to be stably maintained in the enrichment. It is also likely that the greater abundance
Enrichments were also screened for the presence of cmuA by the PCR. A number of
utilising CH3X as sole carbon and energy source has been previously isolated, strain
SAC4, from forest soil, which shared 98 % 16S rRNA identity with Nocardiodes
simplex. All other isolates have been members of the α proteobacteria. It might be
possible to test the hypothesis that the cmuA sequence amplified belonged to a low
technique such as 16S rRNA TRFLP or DGGE, although the sensitivity of the
might also identify a contaminating organism at low abundance. The sequence itself
was identified of being a common clade of cmuA sequences that do not yet have a
cultured representative.
98
Generally speaking, enrichments with CH3Br from a wide range of different marine
to utilise CH3Br was strongly dependent on its aqueous phase concentration, with
dependent on the Henry’s law constant used, the temperature and the volume of
are orders of magnitude less than 300 µM (see Chapter 3) and inhibition is unlikely to
occur. It would have been interesting to investigate further the amount of biomass
produced from CH3Br in enrichments and compare these to the predicted biomass
Since this work a number of novel marine CH3X-utilising strains have been isolated
(Schaefer et al., 2005) from marine enrichments originating from L4 seawater and
Scottish coastal water, belonging to three clades, although none of them are members
of the clades found in these enrichments (see Chapter 6 for more detail).
99
Chapter 5
Methanol Dehydrogenase as a
100
5 Chapter 5: Methanol Dehydrogenase as a Functional Genetic Marker
5.1 Introduction
negative methylotrophs and methanotrophs that have been studied (McDonald &
methylotrophic yeasts (such as Pichia pastoris, Cregg et al., 1989). The oxidation of
oxidation pathway and oxidises the methanol produced by either the soluble or
The X-ray structure has been determined for the MDH from Methylobacterium
extorquens (Ghosh et al., 1995) and Methylophilus methylotrophus W3A1 (Xia et al.,
1996). It has an α2β2 tetrameric structure, with each α subunit containing one PQQ
molecule and one Ca2+ ion. The α subunit is approximately 66 kDa in size and the β
8.5 kDa. The α subunit has a propeller fold making up a superbarrel of eight radially
arranged β-sheets (see Fig 5.1 a). The β subunit forms a long α-helix (see Fig 5.1 b).
in the process, (Zhang & Lidstrom, 2003) over 5 gene clusters. Two of these encode
101
the MDH structural genes mxaF and mxaI, which respectively encode the α and β
proteins. A third gene, mxaG encodes a specific cytochrome cL, which is the primary
electron acceptor for MDH. The mxa genes are present in Methylobacterium
Lidstrom, 2003). The arrangement of the genes in the cluster is also conserved in
Fig 5.1. a. α subunit of MDH with coordinated PQQ and Ca2+. b. β subunit of
MDH. c. α2β2 structure of MDH. Structures downloaded from
http://www.ncbi.nlm.nih.gov and redrawn with Cn3D 4.1 available free from
http://ncbi.nih.gov/Structure/CN3D/cn3d.shtml.
There are a large number of genes involved in methanol oxidation and hence a large
number of candidates with the potential to be used as a functional genetic marker for
102
methanol oxidation. The best studied of these, and that which has been applied most
construct phylogenetic analyses of the gene. The phylogeny of mxaF follows that of
16S rRNA phylogeny within those organisms that possess one and has been used as a
primers cover several important regions of the mxaF gene encoding key functions in
the protein, including Asn 287, Asp 327, Arg 357 and Asn 420, which are part of the
active site and the tryptophan docking motifs W4 and W5 which are involved in
planar stabilisation of the structure (Ghosh et al., 1995). The primers have been
applied widely and used to assess the diversity of methylotrophs and methanotrophs
in a wide range of environments including rice plant roots (Horz et al., 2001),
methane seeps (Inagaki et al., 2004), deep-sea sediment (Wang et al., 2004),
One noticeable exception to the extensive use that has been made of the primers in
other environments is the paucity of information from pelagic marine systems. There
103
2002; Waechter-Brulla et al., 1993; Chang et al., 2002; Lidstrom, 1988; Sieburth et
al., 1987), but relatively little information in comparison with environments such as
freshwater and soil, on mxaF diversity. A study looking for type II marine
methanotrophs, Rockne & Strand, 2003 focussed on using 16S rRNA gene PCR
primers rather than the available mxaF primers, which would have been suitable for
the purpose.
Since the original primer design (McDonald & Murrell, 1997) a number of further
complete mxaF sequences have been submitted to the database. This includes that of
project run by the University of Bergen and The Institute for Genomic Research.
Owing to the limited number of sequences used in the original primer design and the
fact that none of them belonged to the γ proteobacteria it was decided that they would
be capable of growth on methanol as sole carbon and energy source and also to
possess a MDH. It was proposed that analysis of mxaF sequences in methyl halide
104
5.2 Sequence availability
It was decided, as was the case in the original study (McDonald & Murrell, 1997) to
use only alignments of complete mxaF sequences available at the time rather than
partial sequences in the database, most of which had been produced using the
the fact that any part of the sequence can be used to design primers, rather than just
that portion already covered by the current primer pair. Disregarding sequences
amplified by the original pair avoided the tendency to develop primers that merely
amplified a subset of known sequences. The complete mxaF sequences used for
primer design are listed in Table 5.1. The sequence of the Methylococcus capsulatus
(Bath) genome had recently become available and the accession number in table 5.1
refers to it. Live Bruseth of the University of Bergen, Norway made available the
mxaF sequence of M. capsulatus (Bath) used for the alignments prior to release of the
genome sequence. This was obtained after new primers had been designed and so
they were re-designed slightly to take the new sequence and alignments into account.
105
Genbank Organism Taxonomic Reference
Accession affiliation
AF220674 Methylobacterium α-Proteobacteria (Sy et al.,
nodulans ORS2060 2001)
M17339 Paracoccus α-Proteobacteria (Harms et al.,
denitrificans 1987)
M31108 Methylobacterium α-Proteobacteria (Anderson et
extorquens AM1 al., 1990)
M22629 Methylobacterium α-Proteobacteria (Machlin &
organophilum XX Hanson, 1988)
U41040 Methylophilus β-Proteobacteria (Xia et al.,
methylotrophus W3A1 1996)
AF184915 Methylovorus sp. SS1 β-Proteobacteria (Bulygina et
al., 1993)
AB004097 Hyphomicrobium α-Proteobacteria (Tanaka et al.,
methylovorum GM2 1997)
AE017282* Methylococcus γ-Proteobacteria (Ward et al.,
capsulatus BATH 2004)
Table 5.1. mxaF sequences used for primer development.
The alignments were constructed using the MegAlign package from the DNAStar
suite of programs. From this candidate primers were designed by hand, looking
length for phylogenetic analysis, whilst also covering the aforementioned conserved
regions. This also allowed comparison of sequences produced using the new pair
with the substantial number in the Genbank database produced with the original
primer set. Potential forward and reverse primers that were designed are listed in
Table 5.2 along with the sequences of the original primer pair and in the alignments of
Fig 5.2. Phylogenetic analysis of the sequences used in primer design can be seen in
Fig. 5.4.
106
Primer Sequence 5’-3’ Reference
mxaF1003 GCGGCACCAACTGGGGCTGGT (McDonald & Murrell,
1997)
mxaF1013 YTGGGGYTGGTAYGCCTAYGA This thesis
mxaF1080 TGGAACGARACCATGCGTCC This thesis
mxaF1101 GGCGACAACAAGTGGACSATG This thesis
mxaR1561 GGGCAGCATGAAGGGCTCCC (McDonald & Murrell,
1997)
mxaR1476 CCCTGGTTGTGRWARCCCAT This thesis
mxaR1555 CATGAABGGCTCCCARTCCAT This thesis
mxaR1590 GCRCCAACRAAGAACTGGCC This thesis
mxaR1590V GCRCCVACRAAGAACTGVCC This thesis
Table 5.2. mxaF primers used in this study. A further forward primer mxaF909 was
also designed, but this was rejected after receipt of the Methylococcus capsulatus
(Bath) mxaF sequence as it had significant mismatches. Primer numbering is based,
as in McDonald & Murrell, 1997, on that of Methylobacterium organophilum XX.
Primer mxaR1590 was tested in two versions, one with maximum redundancy
(mxaR1590V) and one with minimum redundancy.
107
108
Fig. 5.2. Alignments of designed primers against the mxaF sequences used for their
design. Sequences are referred to by their strain names except Paracoccus
denitrificans, which is designated as Pden. Reverse primers are presented as their
reverse complement and 3’ to 5’. Mismatches in any strain are in grey. With
mxaR1590/V grey indicates a mismatch in mxaR1590 only and light grey indicates a
mismatch in both primers.
109
5.4 Primer testing
Primers were initially tested in all possible combinations of pairs with a representative
primers capable of amplifying these was carried out using a wide range of different
carried out with hot start at 94oC for 5 min, followed by 30 cycles of 1 min each
denaturing at 94oC, annealing at 55oC and amplification at 72oC, a final extension step
of 10 min at 72oC was included. The PCR mixes were formulated as per the standard
Table 5.3.
Non-specific amplification could be seen with certain primer pairs and templates.
mxaF1101 demonstrated non-specific products with all reverse primers and both α
and β templates, as did mxaF1080. The original primer pair in combination produced
110
some non-specific amplification with the β template. Conversely mxaF1013 did not
show any non-specific amplification when paired with any of the reverse primers.
Taking all these factors into consideration it was decided to investigate further primer
The five candidate primer combinations were next used to amplify mxaF products
from environmental DNA samples. Two contrasting sets of samples were used, four
samples taken from soil and water in Movile cave, an enclosed cave ecosystem with a
1-2 % methane atmosphere in Romania (Hutchens et al., 2004), and six samples of
total marine DNA from Eilat, Israel. Selection of primer pairs was based on
amplification from the largest number of samples and again based on a lack of non-
on these criteria, although products were only obtained from two of the four Movile
cave samples and only faint products obtained from the Eilat marine samples (see Fig
5.3).
111
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Fig 5.3. mxaF PCR of a range of environmental samples. The two unmarked lanes
contain Invitrogen 1 kb ladder. Lanes 1-14 are respectively: Negative control;
M. capsulatus BATH; M. methylotrophus W3A1; M. extorquens AM1; Eilat marine
samples lanes 5-10; Movile cave samples 11-14.
Amplification by these primer pairs was checked with a wide range of methylotrophs
and methanotrophs and DNA samples from non-mxaF containing methylotrophs were
used in order to check specificity. Table 5.4 lists the genomic DNA used in these
tests. All were amplified with 16S rRNA primers f27 and r1492 (Lane, 1991) and the
products sequenced to check the identity of the DNA sample. The mxaF products
112
Organism Phylogenetic affiliation Known to possess mxaF
Methylosinus α-Proteobacteria Yes
trichosporium OB3b
Methylosinus sporium 5 α-Proteobacteria Yes
Methylocystis parvus α-Proteobacteria Yes
OBBP
Hyphomicrobium sp.P2* α-Proteobacteria Yes
Methylobacterium sp.P3* α-Proteobacteria Yes
Ancylobacter sp. SC5.10* α-Proteobacteria Yes
Methylobacterium sp. α-Proteobacteria Yes
PM1*
Afipia felis 25E-I† α-Proteobacteria Yes
Methylophilus sp. ECd4* β-proteobacteria Yes
Ralstonia sp. EHg5* β-proteobacteria No
Methylococcus capsulatus γ-Proteobacteria Yes
BATH
Methylomonas methanica γ-Proteobacteria Yes
S1
Methylomonas rubra γ-Proteobacteria Yes
Methylomicrobium album γ-Proteobacteria Yes
BG8
Methylomonas agile A20 γ-Proteobacteria Yes
Pseudomonassp. PM2* γ-Proteobacteria No
Flavobacterium sp. Bacteroidetes No
RD4.3*
Rhodococcus sp. RD6.2* High G+C Gram positive No
Mycobacterium High G+C Gram positive No
ratisbonense EM3*
Arthrobacter sp. SK1.18* High G+C Gram positive No
Table 5.4. Genomic DNA samples used for testing efficacy of primer pairs. All DNA
was obtained from the Warwick Culture Collection (prepared by Hanif Ali), except
for *, which were from Dr. Paulo De Marco, from the University of Porto, Portugal,
and †, which was from Dr. Azra Moosvi from King’s College, London.
agile A20, but mxaF1003/mxaR1555 gave the expected products with all mxaF-
containing organisms and no products with those that do not contain mxaF.
The only exception to this was with Pseudomonas PM2, which gave an mxaF product
despite the fact that this organism is believed to contain an ExaA (Pacheco et al.,
113
2003), a PQQ-linked ethanol dehydrogenase which can be found in Pseudomonas
aeruginosa ATCC 17933 (Groen et al., 1984) and Pseudomonas putida KT2440
(Pacheco et al., 2003). On analysis of the sequenced 16S rRNA gene PCR product
from this DNA sample it was found to be that of an Ancylobacter, indicating possible
cross contamination with DNA from another sample. The original strain was
obtained and the PCR repeated, with the same result, indicating potential
contamination of the strain at source. Only a faint product was obtained with
mxaF1003/mxaR1555 and Afipia felis 25E-I, upon re-amplification with the same
primer set it was successfully sequenced and confirmed by comparison with the
they amplified the genomic DNA samples identically, with the exception of that of
Afipia felis 25E-1. Upon comparing the mxaF sequence AY848826 with the sequence
of the primers it was noted that there are no mismatches with primer mxaR1555.
There are also no mismatches with all but the first base (5’ to 3’) of mxaR1561, which
is not covered by the sequence. It is impossible to ascertain whether there are any
mismatches with mxaF1003 as the sequence does not cover this area of the gene. In
their publication, Moosvi et al., 2005 report that they were able to amplify mxaF from
two of four methylotrophic Afipia isolates, including that of A. felis strain 25E-1 using
possible that the non-amplification in this study was due to the template quality as two
amplifications were required for primer pair mxaF1003/mxaR1555 before there was
114
A
Fig 5.4. Maximum likelihood tree of mxaF and xoxF DNA sequences using the AxML program of ARB. Positions included in the analysis
corresponded to nucleotides 922-1299 of Methylobacterium organophilum XX and the non-specific PQQ-linked alcohol dehydrogenase of
Pseudomonas aeruginosa was used as an outgroup. Bootstrap values from parsimony analysis are indicated on the tree by closed circles (>95
%) and open circles (75-95 %). Species in bold were used for primer design. A = α-Proteobacterial methanotrophs, B = α-Proteobacterial
methylotrophs, C = γ-Proteobacteria, D = β-Proteobacteria, E =xoxF sequences.
115
5.4.3 XoxF
which has a certain level of similarity with MxaF at both the protein and DNA levels.
AM1 where it is known as MxaF’ and non methanol-utilising bacteria such as the
Rhizobia (Sy et al., 2001). With the position and number of mismatches present in
possibility. In order to confirm that the primers were specific for mxaF genomic
dehydrogenases, was PCR amplified using mxaF1003 and mxaR1555. The restriction
analysis using ARB (Ludwig et al., 2004) to be able to cut xoxF sequences and not
mxaF sequences. Digestion of the PCR product from M.extorquens resulted in the
expected banding pattern for mxaF products, with no contamination from xoxF.
Recently (Dedysh et al., 2005) published primers for the amplification of mxaF from
of products from A. methylovorans was only possible with mxaF-f769 and mxaR1561,
but they report that most consistent amplification was obtained with the mxaF-f769
116
and mxaF-r1690 primer combination. The primers were designed to alignments of
The presence of new mxaF sequences that cover the mxaF1003 primer region in the
Genbank database allowed checking of this sequence to see whether it could be at all
improved upon. Few mismatches are introduced when alignments include the
The primer pair mxaF1003/mxaR1555 show promise for use in studies of diversity of
both methylotrophic and methanotrophic organisms. The main advantage over the
current primer set is that they have been designed from a phylogentically more
diverse set of mxaF sequences and should therefore be capable of picking up a wider
One of the aims of the work was to use the primers to amplify mxaF from marine
samples and carry out analyses on these such as clone libraries. Ideally it would have
been extremely useful to amplify mxaF products from a single sample using the
original primer pair and the newly developed pair, creating equal clone-libraries and
117
comparing the diversity of sequences in them using statistical methods, such as those
an improvement on the old. I was unable to complete this work within the duration of
the project, as the work with cmuA and MeBr measurements took priority. Currently
within the lab Dr. Josh Neufeld is using the new primers with marine samples and
planning to use them along with the Stable Isotope Probing technique (Radajewski et
118
Chapter 6
analysis
119
Chapter 6: Diversity of cmuA in Marine Environments and TRFLP analysis
6.1 Introduction
CmuA is a bifunctional protein with methyltransferase and corrinoid-binding domains.
sole carbon and energy source (Vannelli et al., 1998; Vannelli et al., 1999; see Fig 6.1).
CH3Cl
CoI
1.
HCl
CH3 CoIII
H4folate
2.
CH3 H4folate
3.
2 H+
Carbon
CH2 H4folate assimilation via
serine cycle
4.
2 H+
CH H4folate
H2 O
5.
CHO H4folate
H2 O
6.
H4folate
HCOOH
7.
2 H+
CO2
120
This pathway is believed to be responsible for the degradation of CH3X in other
organisms capable of growth on these compounds as sole carbon and energy sources,
CM4 it has been shown that cmuA- mutants are no longer capable of growth on either
CH3Cl or CH3Br as sole carbon and energy sources (Borodina et al., 2004). Schaefer et
al., 2005 isolated 13 marine CH3X-utilizing bacteria belonging to three distinct clades,
two of these clades, represented by strains 179 and 198, probably make use of the
CmuA methyltransferase pathway. The third clade and another marine CH3X-utilizing
organism, Leisingera methylohalidivorans strain MB2 (Schaefer et al., 2002), are likely
involving CmuA since there is no evidence for presence of cmuA/CmuA in these methyl
halide degraders.
CmuA is the most conserved of the enzymes in the pathway as demonstrated by derived
protein and DNA alignments between cmuA sequences from the organisms
demonstrated to contain the pathway (McDonald et al., 2002). The arrangement of the
most of these organisms, with the exception being M. chloromethanicum CM4 in which
the cmu cluster is split into two sub-clusters (see Fig 6.2).
All these factors make cmuA an ideal candidate for use as a functional genetic marker to
investigate the presence and diversity of methyl halide utilisers in the environment that
use this pathway. It has been used as such in two separate DNA-stable isotope probing
experiments with soil samples enriched with either 13CH3Br or 13CH3Cl (Miller et al.,
121
II
cobQ cobD metF cmuB cmuC cobC
str. CM4
I
cobU folC folD purU cmuA
str. CC495
cmuB cmuC cmuA fmdB paaE hutI
str. IMB-1
cmuC cmuA fmdB paaE hutI metF
str. CM2
//
cmuB cmuC cmuA fmdB paaE hutI metF
str. 198
cmuC cmuA fmdB paaE hutI nrdF nrdA
str. 179
cmuA fmdB paaE hutI metF
2 kb
Fig 6.2. Comparison of cmu gene clusters sequenced to date. Genes involved in the
metabolism of CH3X are in blue, with cmuA in red. Genes not directly involved are in
green. Organisms are referred to by their strain names; Methylobacterium
chloromethanicum CM4, Aminobacter lissarensis CC495, Aminobacter ciceronei IMB1
and Hyphomicrobium chloromethanicum CM2. Strains 198 and 179 are affiliated to the
Roseobacter clade of the α proteobacteria, within the Rhodobacteracaea family.
McAnulla et al., 2001 designed PCR primers for the amplification of cmuA based on
with the forward primer located in the 5’ methyltransferase domain and the reverse
arrangement, the rationale was that this would increase primer specificity and not PCR
122
binding regions of other polypeptides. The primers 929f and 1669r were used to
amplify successfully a 741 bp PCR product from the two isolates used to design the
primers, newly isolated Hyphomicrobium strains and from a soil enrichment culture.
Warner, 2003 designed new PCR primers using alignments of cmuA sequences from M.
chloromethanicum CM4 and H. chloromethanicum CM2 and the recently cloned cmuA
forward primers and four reverse primers were designed and primer pair
cmuAF802/cmuAR1609 was selected as the best candidate. Again this spanned the two
parts of the cmuA gene encoding two functional domains of CmuA. It was this primer
pair that was used in the two previous DNA-SIP studies (Borodina et al., 2005; Miller et
In order to study the diversity of cmuA in the most active marine enrichments (see
Chapter 4) 2 mL of each enrichment was centrifuged for 5 min at 13 000 rpm, the
supernatant removed and the pellet resuspended in 10 µl of sterile deionised water. This
was then boiled for 10 min in a water bath and 1 µl was used as template in PCR
reactions. PCR products were visualised on 1 % agarose (w/v) gels after EtBr staining.
Bands corresponding to the expected size of product (807 bp) were excised and the
DNA was purified using the Qiaquick Gel extraction kit (Qiagen). Clone libraries of 50
to 100 clones were constructed using the Invitrogen TOPO cloning kit. Clone libraries
were dereplicated using RFLP analysis with double digests of both EcoRI/DdeI and
EcoRI/RsaI and grouping of the clones into OTUs (operational taxonomic units) was
based on the RFLP patterns produced (Fig 6.3). OTUs were determined throughout on
123
*
Fig. 6.3. Example EcoRI/DdeI RFLP digest of cmuA clones from enrichment L4.1.The
starred lane contains Invitrogen 1 kb sizing ladder.
Representative clones from each OTU were selected for bi-directional DNA sequencing
using the M13 primers for the TOPO vector. In the case of the longer
were carried out using cmuAF802 and its reverse complement in order to get full
sequences.
primers and partly in order to try and obtain longer inserts for sequence analysis.
cmuA and provides much more information about the sequence diversity in this region.
Three 300 mL enrichments of seawater obtained from L4, a sampling station off the
coast of Plymouth, set up at different times of the year and enriched with 0.2 % CH3Br
were analysed by cmuA PCR as above. cmuA PCR products were obtained from L4.1,
L4.2 and L4.3 with cmuAF802/cmuAR1609, but not with cmuAF229/cmuAR1609 and a
clone library was produced from enrichment L4.1. This enrichment had been
established for the longest length of time (~8 months) and had had 5 pulses of CH3Br ,
equivalent to approximately 312 µmoles of CH3Br. It also gave the brightest product of
124
the three and was therefore considered the best for clone library production (see Fig
6.4).
1 2 3 4 5 6 7 8 9
Clones grouped into 2 OTUs with 73 % in OTU 1 and 27 % in OTU 2. The groupings
for this particular library are based solely on EcoRI/DdeI digests as RsaI failed to cut
any of the clones. Upon construction of phylogenetic trees, all the clones from this
cmuA library formed part of a single clade (B2 in Fig 6.5) most closely related to cmuA
sequences from Aminobacter ciceronei IMB-1 and Aminobacter strain TW23, both
isolated from woodland soils, and an uncultured soil cmuA clone, ‘chloromethane-
Enrichments from the Arabian Sea AMBITION cruise were set up from concentrated
seawater samples added to tenth strength marine ANMS (ammonium nitrate mineral
DNA from all the enrichments amplified with cmuAF802/cmuAR1609 gave cmuA PCR
products of varying band intensities and two of these were selected for clone library
analysis, library 27 from the pooled enrichment PE2, and library 25 from the Station 10
125
enrichment 249. Only DNA template from enrichment PE2 gave a cmuA PCR product
with cmuAF229/cmuAR1609 and this was also selected for clone library analysis as a
The enrichment 249 cmuA clone library gave 6 OTUs, which are summarised in Table
6.1.
According to phylogenetic analysis, the OTUs above split into three clades, OTUs 1, 2
and 6 form a novel clade of cmuA sequences, currently without a cmuA sequence from
an isolated representative. OTU 3 groups with Aminobacter ciceronei strain IMB-1 and
Aminobacter strain TW23. E25.16, the sole member of OTU 4, is consistently placed,
independently of tree calculation method, as related to, but separate from the same
Aminobacter cmuA cluster. It shares 94.6 % identity with cmuA from A. ciceronei strain
IMB1.
The cmuA Library 27 was constructed with DNA from pooled methylotrophic
enrichments that had been grown on a variety of different carbon sources and then
enriched with CH3Br. The PCR with primers cmuAF802/cmuAR1609 gave the most
intense PCR product of any of the enrichments, which is likely to reflect the increased
biomass in the enrichment due to the pre-enrichment step. Seven OTUs were apparent
126
OTU Number of % of total Sequenced representatives (Genbank
clones clones accession no.)
1 94 94.0 E27.1, (DQ090683), E27.2, (DQ090682),
E27.3, (DQ090679), E27.4 (DQ090676)
2 1 1.0 E27.22, (DQ090681)
3 1 1.0 E27.24, (DQ090680)
4 1 1.0 E27.30, (DQ090678)
5 1 1.0 E27.32, (DQ090677)
6 1 1.0 E27.45
7 1 1.0 E27.48, (DQ090675)
Table 6.2, OTUs from library 27, the cmuA clone library from enrichment PE2.
OTUs 1, 2, 3, 5, 6, and 7 form a single marine clade (A3) in cmuA phylogenetic trees.
hyphomicrobia. These form a separate clade with DNA sequence identity of 81.1 %
and 77.4 % respectively to cmuA sequences from Hyphomicrobium strain LAT3 and H.
chloromethanicum CM2 (E27.3 used for distance calculation). E27.22 (OTU 2),
E27.24 (OTU 3) and E27.48 (OTU 7) cmuA sequences consistently branch more deeply
than the other members of this clade, which could account for them being placed into
separate OTUs by RFLP analysis. E27.30 (OTU 4) cmuA sequence grouped with the
novel clade (B2) of marine cmuA sequences formed by OTUs 1 and 2 of the Station 10
Library 9 contained the longer PCR product cmuA sequences from primer pair
cmuAF229/cmuAR1609 and the same template as for library 27. The library was
dereplicated using RFLP analysis with the same restriction enzymes as for the other
libraries. With the increased length of the cmuA sequences, this provided a finer level
of discrimination than that for the other libraries, which should be borne in mind when
127
OTU Number of % of total Sequenced representatives (Genbank
clones clones accession no.)
1 58 75.3 E9.8, (DQ090668), E9.1, (DQ090674)
2 1 1.3 E9.3, (DQ090670)
3 10 14.2 E9.22, (DQ090673), E9.28, (DQ090671)
4 2 2.6 E9.27, (DQ090672)
5 1 1.3 E9.62, (DQ090669)
6 1 1.3 E9.81, (DQ090667)
7 2 2.6 E9.91, (DQ090666)
8 2 2.6 E9.92, (DQ090665)
Table 6.3. OTUs from library 9, the cmuA clone library from enrichment PE2, amplified
with primers cmuAF229/cmuAR1609.
Despite the number of OTUs produced, all the sequences clustered together in a single
clade (A3) upon phylogenetic analysis. This was the same clade in which the majority
of library 27 cmuA clones were found. It is interesting that no clones were identified
with similarity to the Aminobacter clade unlike library 27, despite the fact that the
template DNA was identical. This could be explained stochastically as only 1.0 % of
library 27 (a single clone) grouped in this clade, but coupling this with the fact that
primer pair cmuAF229/cmuAR1609 was unable to amplify cmuA products from DNA
from any of the other enrichments suggests that it is specific for this particular clade of
6.3 cmuA clone library analysis with DNA from high volumes of Arabian
Sea samples
These samples were kindly supplied by Dr. Clare Bird and Dr. Mike Wyman of the
University of Stirling, UK. The samples were taken using stand-alone pumps (SAP;
Challenger mark 2 SAP, Challenger Oceanic, UK). These pumps are automated and
pump large volumes of water for a set period of time through large (293 mm, 0.2 µm)
filters, achieving effective water sample volumes of 36 to 200 L, during this study.
DNA samples were supplied after being extracted using the following method (Mike
128
Wyman, pers. comm.). SAP filters were rinsed in 5 ml filtered seawater and the filtrate
taken up in 1 ml RNALater (Ambion) and stored at 4 oC. 0.5 ml of this was centrifuged
and DNA isolated from the resulting pellet using a Qiagen DNA extraction kit with the
DNA eluted in 100 µl sterile deionised water. 1 µl of this was used as template for PCR
amplification of cmuA, at neat and 1:10 dilutions. The effective volume of sample
03/07 20 85 70.8
04/02 20 200 166.7
05/02 15 59 49.2
06/03 10 100 83.3
07/08 220 106 88.3
08/02 20 47 39.2
09/03 20 36 30.0
Table 6.4. Effective sample volumes for 1 µl volumes of DNA extracts used as
templates in amplification of cmuA PCR products from SAP samples.
PCR products using primer pair cmuAF802/cmuAR1609 were obtained from the
samples from stations 1 (01/08), 2 (02/07), 4 (04/02) and 9 (09/03). The cmuA PCR
products from station 2 were smaller than the expected size of 807 bp and upon test
sequencing proved not to be cmuA. The PCR products were faint and proved difficult
to clone, therefore only small libraries of 50 cmuA clones were produced from each of
the remaining PCR products. Upon RFLP analysis with EcoRI/DdeI and EcoRI/RsaI
double digests, the station 9 cmuA library was shown to contain only a single OTU.
The same OTU made up 98 % of the station 4 cmuA library with a single representative
(S4.14) in OTU 2. The station 1 library contained two OTUs: 70 % OTU 1 and 30 %
OTU 2 (see Table 6.5) neither of which were similar to those cmuA sequences in the
129
Library Number % of total Sequenced representatives (Genbank
of clones clones accession no.)
1 (OTU 1) 35 70 S1.1, (DQ090703), S1.2, (DQ090702)
1 (OTU 2) 15 30 S1.4, (DQ090701), S1.5, (DQ090700),
S1.43, (DQ090705)
4 (OTU 1) 49 98 S4.3, (DQ090699), S4.4, (DQ090698),
4 (OTU 2) 1 2 S4.14, (DQ090704)
9 50 100 S9.1, (DQ090697)
Table 6.5. OTU assignment of cmuA sequences from SAP sample clone libraries.
All the cmuA sequences retrieved from DNA from stations 4 and 9 clustered with the
highly related clade of marine cmuA sequences consisting entirely of sequences from
the two pooled enrichment libraries (A3). The station 1 derived cmuA clones grouped
with the cmuA clade formed by the station 10 enrichment cmuA library (B2).
Phylogenetic trees were constructed with all available cmuA sequences. The large
number of cmuA sequences (136) combined with the length of sequence analysed (552
CM4) was towards the upper limits (150 sequences) of analysis of the ARB program
The analysis was left running for two weeks with no sign of completion, and then
aborted. Instead a parsimony tree was produced using ARB with 10 bootstraps, as
again the number of sequences involved was too large to analyse with a greater number
analysis using the Seqboot, Dnadist, Neighbour and Consense programs of PHYLIP
(Felsenstein, 1989; Felsenstein, 2004) with 100 bootstraps (Fig 6.5). Parsimony
bootstrap values over 75 % are marked on the tree. Major clades are labelled A1 to B4
130
A1
A2
A3
A4
B1
B2
B3
B4
Fig. 6.5. cmuA parsimony tree of 552 bp. See text for full details and discussion.
Sequences obtained in this study are bold and red. Isolates are bold.
131
As Maximum Likelihood analysis could not be carried out on the full data set, a
selection of cmuA sequences was analysed, representing each of the major clades (Fig.
6.6) in order to confirm the general tree topology seen in Fig. 6.5.
B2
B1
B3
B4
A3
A2
A4
A1
Fig. 6.6. cmuA Maximum-likelihood analysis performed using the same area of
sequences as Fig. 6.5. Parsimony analysis bootstrap values (100 samplings) are
indicated by closed circles (>95 %) and open circles (75-95 %).
Maximum Likelihood trees of cmuA sequences were also constructed for each of the
chloromethanicum CM4 cmuA sequence. All three trees were identical, with branching
When carrying out BLASTp (Altschul et al., 1997) analysis of CmuA sequences it was
observed that the closest non-CmuA proteins are the Mono-, Di-, and Tri-methylamine
132
methyltransferases and corresponding corrinoid-binding proteins. It was alignment with
these that allowed assignment of domains of the cmuA sequences in the above analysis.
impossible other than indicating presence of the cmuA sequence in an organism at the
organism that was scarce and carrying out only a small fraction of the environmental
CH3Br oxidation may have been favoured during the enrichment process, in this case
perhaps as the CH3Br concentrations used were orders of magnitude greater than
environmental concentrations.
Examination of the sequences gathered from the three SAP sample libraries from the
AMBITION cruise are more informative, as they are more representative of the in situ
community. Station 1 derived cmuA sequences (S1_x) all clustered together within
clade B1, whilst cmuA sequences from stations 4 (S4_x) and 9 (S9_x) formed a
bacteria seems to have occurred between stations 1 and 4. Interestingly the only
enrichment to show evidence of the presence of clade B1 sequences was 249, from
station 10 (E25_x), indicating that organisms containing similar cmuA sequences are
present in both the oligotrophic and eutrophic regions of the cruise track. It is possible
that this could be a bacterial species capable of existing under the two contrasting
highlights a lack of correlation between cmuA sequence type and phylogeny. The
sequence type of cmuA also displays no correlation between environment, with marine
sequences from the Arabian Sea sharing high identity with sequences from soil isolates.
133
6.6 Terminal restriction fragment length polymorphism analysis
6.6.1 Rationale
It seemed at this point that a wide range of different clades of cmuA sequences could be
found in the Arabian Sea DNA samples and enrichments and that it would be interesting
to investigate the location of these with respect to depth in the water column,
geographical location, and physicochemical factors. Two stations (3 and 7) had been
As there were many samples to screen for the presence of cmuA, it was decided that a
rapid technique for surveying genetic diversity should be employed. There are a
number of well-established methods that would have been appropriate in this case,
length-heterogeneity PCR (Ritchie et al., 2000). The cmuA genes that had been
sequenced to date had little heterogeneity in length, which would have left L-HPCR
missing much of the potential diversity. With DGGE there is the potential to excise and
sequence the most intense bands on the gel, giving sequence information for the most
common amplicons. However, it was believed that TRFLP would prove to be the most
suitable technique as it was rapid, straight forward to develop for a new gene and
allowed easy intercomparison of samples, since standards can be run within each
sample, unlike DGGE. The large database of marine and terrestrial cmuA sequences
that had been previously collated also facilitated the development of the TRFLP
134
6.6.2 TRFLP
TRFLP relies on the PCR amplification of a gene using primers labelled at the 5’ end
with a fluorescent marker. The labelled PCR products produced are then digested with
restriction enzymes. The terminal restriction fragment remains labelled, whilst all other
sample and running the restriction-digested products on a DNA sequencer in gene scan
mode allows sizing of the terminal restriction fragments produced. The discrimination
of clades of the gene and assessment of diversity relies on careful selection of restriction
enzymes. Splitting samples and using several different restriction enzymes can increase
primer. Another advantage of TRFLP is that the relative fluorescence of each TRF
(terminal restriction fragment) indicates the relative abundance of the particular PCR
product in the reaction (Osborn et al., 2000). This is not wholly quantitative as
abundance of a PCR amplified gene does not reflect the abundance of that particular
sequence in the original sample, but it does indicate which clades have the highest
relative abundance.
When using a capillary sequencer it has been noted that there is a bias towards smaller
fragments as they are favoured in the electrophoresis and this can lead to an over-
6.6.3 Development
The first part of the development process involved selection of restriction enzymes that
could discriminate between the clades of cmuA sequences that had been sequenced to
date (see Fig 6.5). Restriction enzymes that recognise 4 base restriction sites are
favoured in TRFLP analysis since enzymes with longer recognition sites tend not to cut
frequently enough.
135
An ARB (Ludwig et al., 1998) database was constructed with cmuA sequences edited to
include the forward and reverse primer sequences (as the primer forms part of the TRF
it needs to be included in order to predict the correct sizes of TRFs). Sequences that had
been produced with primer pairs other than cmuAF802/cmuAR1609 were either
trimmed (as in the case of the L9 clone sequences or the complete cmuA sequences such
as that of Aminobacter ciceronei strain IMB-1) to the same length as the other
sequences, or discarded (as in the case of soil clones AF307140, AF307141 and
AF307142). This left a standardised set of 137 cmuA sequences that could be
interrogated using the probe, user1 and user2 fields of the ARB Editor window. They
allow the user to input oligonucleotide sequences which are subsequently highlighted
wherever they are found in the sequence alignment. Restriction enzymes were
discarded if they did not discriminate well between clades, cut within the primer
sequence, or produced TRFs that were outside the 35-500 bp limit of sizing of the
ladder used. Restriction enzymes screened included all 4 base cutters available from
New England Biolabs (US), and Helena Biosciences (UK), excluding isoschizomers.
The restriction enzymes BsiYI, HaeIII and HpaII were selected using these criteria.
BsiYI provided good discrimination between different clades of cmuA in both the
forward and the reverse primer directions, HaeIII discriminated at the 5’ end; HpaII
discriminated at the 3’ end. Predicted TRFs for the members of the tree in fig 6.5 can
be seen for each of the enzymes in Table 6.6. Appendix D lists the sequences
136
Enzyme Recognition site TRFs (bp)
HaeIII 5’ C^CGG 34, 43, 53, 121, 145, 167, 271, 308, 479.
BsiYI 5’ CCNNNNN^NNGG 50, 126, 276 329, 346, 384, 397, 402, 461,
464,467,483, uncut.
BsiYI 3’ CCNNNNN^NNGG 114, 166, 171,282, 325, 335, 347, 391, 406, 417,
427, 764, uncut.
HpaII 3’ GG^CC 90, 110, 115, 135, 144, 156, 225, 330, 459, 481,
483, 625.
Table 6.6. TRF sizes of known cmuA sequences. Those in red are outside the sizing
range possible when using the ROX 500 ladder. Uncut PCR products will be ~802 bp
in length.
The TRFLP method was tested using three cmuA clones as standards. TOPO
(Invitrogen) cloned cmuA products of strain 179, and marine enrichment cmuA clones
PMLSW6 and PML1A4 (Schaefer et al., 2005) were used as templates in PCR reactions
with labelled primers. PCR reactions were carried out as described in Chapter 2,
Materials and methods. Several aliquots of Taq polymerase were pooled to provide a
source of Taq sufficient for a large number of reactions; it has been reported that
(Osborn et al., 2000), even when obtained from the same supplier and this measure was
resuspended in 10 mM Tris HCl pH 8.0 rather than deionised water since more acidic
137
pHs than this cause bleaching of the fluorophore. The remainder of sample preparation
was carried out as described by (Moeseneder et al., 1999) with one change, PCR
products were loaded onto a large welled 1 % (w/v) agarose gel, excised and gel
extracted, rather than being precipitated first and then run on an agarose gel. It was
found that this did not reduce the quality of TRFLP patterns produced and also reduced
losses of PCR product. Once samples were precipitated and dried, they were split into
three aliquots for digestion in 100 µl total volumes with each of the above restriction
enzymes. Digestion was overnight at 37 oC for HaeII and HpaII and overnight at 55 oC
for BsiYI, with 5U of enzyme used in each case. Once digested the samples were
HiDi formamide resuspended sample was mixed with a further 10 µl HiDi formamide
instructions, and loaded onto a 3100 Genetic Analyser (Applied Biosytems). The
analysis was carried out with 36 cm capillaries, using the POP4 polymer and the
standard run time was 45 min. The machine was set with the appropriate filter for
analysis of ABI dye set D. Data were initially collected and analysed using GeneScan
software, but this was found to be erratic in ‘calling’ the correct sizes for TRFs and so
It would have been possible to use FAM, HEX, NED and TAMRA fluorescent dyes and
to have combined the products into single sample runs; the dye-sets are complimentary
with non-overlapping emission and absorption spectra. However, it was noted that with
BsiYI samples, where the forward primer was FAM labelled and the reverse was HEX
labelled, that a certain amount of dye bleed-through was evident. Peaks were produced
in the HEX detection channel at identical places, but with less intensity, as FAM peaks.
This could potentially make resolving the exact TRF difficult, particularly in the case of
138
the BsiYI 5’ TRF 346 and BsiYI 3’ TRF 347. At this time since BsiYI 5’ TRF 346 was
uncommon and part of an exclusively terrestrial clade, this problem was believed to be a
minor one and could be resolved in future by using an alternative fluorescent dye for 3’
TRFs that has emission and absorption wavelengths further removed from those of
FAM, such as NED (see Table 6.7 for dye wavelengths). Samples were therefore kept
separate rather than multiplexed in runs for the validation of the method (see Fig 6.7 for
an example TRFLP pattern and Appendix D for a full list of the TRF assignments for
each sequence).
Fig 6.7. BsiYI TRFLP pattern of clone PMLSW6 (AJ810829). The x axis is in bp and
the y in relative fluorescent units. The red peaks are ROX 500 ladder, with FAM
labelled TRF in blue and HEX in green. Sizing analysis was performed using the
Global Southern size-calling algorithm of the Genemapper 3.0 software (Applied
Biosystems, US).
139
6.7 TRFLP on environmental samples
The samples taken for DNA extraction from the AMBITION cruise are listed in
Appendix A. Each was from 2 L of seawater filtered either though 0.2 µm sterivex
cartridge filters, or through 0.2 µm Supor 200 membrane filters. Initially a number of
sterivex samples were selected for DNA preparation using the method of Somerville et
al., 1989 and amplification of cmuA was attempted with primer pair
2 17, 18
3 (Diel) 33, 34, 35, 36, 37, 38, 39, 40, 41, 42
4 49, 50, 51, 52 ,53
5 66
6 82, 83
7 (Diel) 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99
8 114, 115
9 122, 130, 131
10 138, 140
11 154
Table 6.8. AMBITION samples analysed by cmuA PCR. Both sterivex and memebrane
filter samples are included. At least the chlorophyll maximum and surface water
samples were used at all stations except 5 and 11.
Only non-specific PCR products were observed with these samples. Further DNA
samples were extracted using the hot-phenol method of (Schaefer & Muyzer, 2001)
with the membrane filtered samples. This was the preferred method of DNA sample
preparation as the Supor 200 filters are made from Polyethersulfone and are phenol
soluble; there is no chance of bacteria remaining attached to the filter and avoiding
lysis, which is a potential hazard when using the Sterivex filters. Despite repeat
attempts at PCR with a range of template concentrations cmuA products were not
140
obtained from any of these samples, although 16S rRNA products using primer 27f and
These samples were kindly provided by Dr. Gary Smerdon of Plymouth Marine
Laboratory and were taken during a cruise aboard RRS Discovery (D261) in the Celtic
Sea from the 1st to 14th April 2002. The aim of the cruise was to follow and sample a
CH3Br (Baker et al., 1999; Wingenter et al., 2004) and as such it was hoped that
bacteria capable of degrading CH3Br would also be present. The samples taken were
500 ml of water filtered through 0.2 µm nucleopore filters (see Table 6.9). DNA was
Extracted DNA was used at a range of dilutions (neat, 1:10 and 1:100) for the PCR with
primer set cmuAF802/cmuAR1609. No cmuA PCR products were observed for any of
the samples. Amplification was checked by amplification of the 16S rRNA gene using
primers 27f/1492r, which proved positive in all cases, indicating the absence in DNA
141
6.8 Discussion and future work
Three different clades of cmuA sequences were detected during the course of this study.
One completely novel clade (A3) lacked isolated representatives, with the most closely
related sequence from isolated species being Hyphomicrobia. The Hyphomicrobia are
sediments, (Wang et al., 2004). The two other clades that were recovered were B1 and
B2. The cmuA sequences obtained from Arabian Sea DNA samples of enrichments and
seawater in clade B1 were distinct from the rest of the clade as supported by parsimony
and neighbour joining bootstrap values in phylogenetic analysis. They were most
closely related to cmuA sequences from a Rhodobacteracaea isolate, 179, isolated from
CH3Br enrichments of English Channel seawater, off the coast of Plymouth, indicating
a wide geographic spread of this clade of sequences. B1 also contains cmuA sequence
representatives previously amplified from soil communities (Borodina et al., 2005). All
L4 enrichment cmuA sequences clustered in clade B2, together with cmuA sequences
from isolates Aminobacter ciceronei IMB1 and Aminobacter sp. TW23, both isolated
from soils. This highlights the diversity and spread of the cmuA sequences. It would be
as stable-isotope probing (Radajewski et al., 2000), which has been used successfully
with both 13CH3Br and 13CH3Cl in terrestrial environments (Borodina et al., 2005;
Miller et al., 2004). An enrichment was set up with an L4 seawater sample and
13
CH3Br with this intention towards the latter stages of this investigation, although it
It was interesting to discover that cmuA could not be amplified from DNA from the
smaller volume environmental samples when it could from the larger volume samples.
142
This indicates something about the abundance of these organisms within the
environment. Effective sample volumes of the SAP samples were all greater than 30 ml
in each µl of PCR template. The cmuA PCR positive samples of stations 1, 4 and 9 had
respectively. DNA extracts from the 2 L cruise samples had effective sample volumes
present in marine systems could allow estimations of the proportion of marine CH3Br
degradation that these organisms are responsible for. It is not known how sensitive that
the cmuA PCR is in terms of numbers of gene copies capable of being detected. It
seems from these data that, independent of the limit of detection of this PCR reaction,
the cmuA containing bacteria are a small fraction of total bacterial biomass. What these
data cannot show is how active the cmuA-containing bacteria are in consumption of
marine CH3Br, so although the numbers of these organisms present may be low, their
143
Chapter 7
144
7 Leisingera methylohalidivorans MB2 and Attempts to Identify cmuA
7.1 Introduction
The cmuA gene successfully PCR amplified from marine DNA samples (Chapter 6
and Schaefer et al., 2005); however cmuA has not been amplified from the single
marine isolate capable of growth on CH3Br as sole source of carbon and energy that
was available at the start of this study, Leisingera methylohalidivorans MB2. This
strain was isolated by Dr. Kelly Goodwin from a tidal pool in California (Schaefer et
al., 2002) and was capable of growth on MeBr as sole source of carbon and energy.
Attempts to amplify cmuA PCR products from this organism had repeatedly failed
using the primers cmuAF802 and cmuAR1609. Southern hybridisation, using probes
SDS PAGE of cell-free extracts of strain MB2 grown with and without CH3Br on
Marine Broth 2216 (Difco) were inconclusive, and there were no demonstrateable
differences between the polypeptide profiles of cells grown under the two growth
conditions, suggesting: (i) that cmuA was not expressed; (ii) that the inducible system
had ceased to be expressed; (iii) that cmuA associated protein in strain MB2, which
145
would be in contrast to previous findings (Schaefer et al., 2002); (iv) that cmuA was
from L. methylohalidivorans MB2, have recently been isolated (Schäfer et al, 2005).
The strains isolated (179, 198 and 217) were all identified as members of the
juvenile oyster disease (Boettcher et al., 1999). Strain 198 clusters within the genus
Ruegeria and strain 217 is most closely related to the genus Roseovarius. The partial
cmu clusters from strains 179 and 198, but not from strain 217, were cloned and
sequenced (Schaefer et al., 2005). Alignments of the six available complete cmuA
sequences (strains CM4, CM2, IMB1, CC495, 179 and 198) with primers cmuAF802
and cmuAR1609 demonstrated significant mismatches with the cmuA sequences from
the marine isolates, particularly with the reverse primer and strain 198 whose cmuA
sequence could not be amplified with cmuAF802/ cmuAR1609 (see figs 7.1 and 7.2).
Fig 7.1. Alignment of cmuA sequences with primer cmuAF802, 5’-3’. Position
numbering is based on that of M. chloromethanicum CM4. Bases complementary to
the primer are shaded black and mismatches shaded grey.
146
Fig 7.2. Alignment of cmuA sequences with primer cmuAR1609. Position numbering
is based on that of M. chloromethanicum CM4. The primer target site is shown
alongside the reverse complement of the primer sequence. Shading as Fig 7.1.
Therefore a new reverse primer was designed based on all six complete sequences
together with the partial sequences available in the cmuA ARB database (~100
sequences) keeping both the number of redundancies and the number of mismatches
Fig 7.3. Alignment of cmuA sequences with primer cmuAR1244. Position numbering
is based on that of M. chloromethanicum CM4. The primer target site is shown
alongside the reverse complement of the primer sequence. Shading as Fig 7.1.
still not be amplified from L. methylohalidivorans MB2, but this primer provided the
basis for my attempt to obtain the cmu cluster from this organism.
The corrinoid-binding domain of the bifunctional enzyme CmuA is the most highly
147
known to be a four-helix bundle (Fig 7.4, Ludwig & Matthews, 1997) and structural
analysis of the C-terminal domain indicates that this is also the case for CmuA.
a b
Fig 7.4. 3D-views of a four helix bundle corrinoid-binding domain with bound
cobalamine. Top-down and end-on views of the binding niche are shown in a and b
respectively. α-helices are shown as large pink arrows and cobalamine in ball-and-
stick format. The bound cobalt of cobalamine is indicated Co. Structures
downloaded from the Conserved Domain Database (see text) and redrawn with Cn3D
4.1 available from http://ncbi.nih.gov/Structure/CN3D/cn3d.shtml.
There are a number of motifs present that are conserved not only within bacterial
corrinoid-binding proteins, but also archaeal and eukaryotic, for example, the vitamin
(Evans et al., 2002). BLASTp (Altschul et al., 1997) and the Conserved Domain
Database (Marchler-Bauer et al., 2005) search identifies the common motif MXXVG,
which is conserved as MKX V/I G in CmuA sequences obtained thus far. Craig
McAnulla proposed a second motif based on alignments with other corrinoid proteins
synthase of Escherichia coli (Old et al., 1990) and MtmC, a corrinoid protein
148
(LeClerc & Grahame, 1996; McAnulla, 2000). Within the proposed CmuA motif
corrinoid group, with the asparagine, glutamine and glycine residues forming a ligand
triad essential for enzyme activity in other corrinoid proteins (Ludwig & Matthews,
1997).
positioned just inside the corrinoid-binding domain of cmuA. It is a feature of all the
primer pairs so far designed that they span both domains of this uniquely structured
enzyme, in order to increase specificity of the primers. This could also be responsible
searches, the most similar proteins are the mono- di- and tri-methylamine
rather than the fusion of two functional domains, as with CmuA. It is possible that
this is also the case in L. methylohalidivorans and primers targeting only the
corrinoid-binding region might reveal whether this was the case. Primer cmuAR1352
(fig 7.5) was designed to amplify the corrinoid region when paired with the reverse
Fig 7.5. Alignment of cmuA sequences with primer cmuAR1352. Position numbering
is based on that of M. chloromethanicum strain CM4. The primer target site is shown
alongside the reverse complement of the primer sequence. Shading as Fig 7.1.
149
Primers were tested with A. ciceronei strain IMB-1 and H. chloromethanicum strain
CM2 and gave products of the expected size (128 bp) as demonstrated by gel
7.3 Results
This was cloned, sequenced and identified as cmuA by BLAST analysis, sharing 80 %
ID and with cmuA from A. lissarensis IMB1. Comparison was then made with the
rest of the cmuA database using ARB for phylogenetic analysis, which indicated that
sequenced. The cloned PCR product from L. methylohalidivorans was PCR amplified
again in order to gain enough of the PCR product for preparation of a gene probe for
Southern hybridisation analysis and to reveal the rest of the cmuA gene and cmu
any hybridisation with the cmuA probe from L. methylohalidivorans, but the probe
150
1 2 3 4 5 6 7 8 9 1011121314
On checking the sequence of the probe it was noticed that the base changes that
rendered the sequence novel were all at positions of degenerate bases in the primer
regions. Removing the primer sequences from the phylogenetic analysis indicated
that the PCR product obtained from the L. methylohalidivorans DNA was identical to
that of A. ciceronei, presumably due to low level contamination of the genomic DNA
sample.
151
7.4 Discussion
The aim of this work was to test the hypothesis that L. methylohalidivorans MB2
sequenced. Despite the fact that they did not work in the case of L.
methylohalidivorans the primer pair developed in this work will prove useful for
demonstrated with H. chloromethanicum CM2 as the positive control for this analysis.
ideal for avoiding the mismatches present in other parts of the molecule.
Since this work was carried out, further attempts have been made to identify cmuA in
bacterium, strain 179, was used in Southern hybridisation analysis and failed to obtain
became clear that Roseovarius strain 217, as with L. methylohalidivorans, did not
possess a cmuA identifiable by PCR. It also did not contain a distinct 67 kDa protein
present in SDS PAGE analysis when grown on CH3Br. It is therefore believed that
another pathway for the utilisation of methyl halides must be operating in these
organisms. Strain 217 has been accepted for genome sequencing by the Gordon and
Betty Moore Foundation and it is anticipated that this will provide some insight into
perhaps for other genes in the cmu cluster, such as cmuB, cmuC or folD
152
Chapter 8
153
8 Chapter 8: Synopsis, Discussion and Future Work
8.1 Synopsis
8.1.1 Aims
The aims of this work were to investigate marine CH3Br-utilising bacteria and can be
• Correlation of the presence and concentration of CH3Br with the presence and
Two main sampling areas were used, the Arabian Sea through the NERC Marine and
station off the Coast of Plymouth (UK). A range of approaches was used, and these
Three different gas chromatographic systems were used in order to measure CH3Br
and other cultures; a GC ECD purge and trap system for extraction and analysis of
pptv concentrations of CH3Br from seawater samples; a second GC ECD purge and
trap system. The first GC ECD system suffered from electronic problems and was
154
cycle. Rapid changes in concentrations of CH3Br from supersaturated to
undersaturated with respect to atmosphere. This suggested that the compound was
being degraded quickly, presumably by biological activity as this was more rapid than
production of CH3Br was also high further enhancing this fact. Peaks in CH3Br
marine source of CH3Br (Baker et al., 1999; Saemundsdottir & Matrai, 1998; Scarratt
compounds was set up during the AMBITION cruise. Enrichments which contained
both CH3Br and 10 mM formate were able to be maintained on CH3Br for a long
time, whereas other enrichments from Arabian seawater were less successful.
Isolation of CH3Br-utilising bacteria was attempted from the active enrichments, and
although a number of strains were isolated, including one that gave a cmuA PCR
product, none were able to oxidise CH3Br in pure culture. Further active enrichments
PCR primers for the analysis of methanol dehydrogenase large subunit (MxaF)
developed. A number of potential PCR primers for mxaF were designed to target a
155
wider diversity of Proteobacterial mxaF sequences. Full-length sequences of α-, β-,
and γ-Proteobacterial mxaF sequences were aligned in order to enable this. These
mxaF PCR primers were screened, resulting in the new reverse primer mxaR1555,
which proved, in conjunction with the original forward primer mxaF1003, to be able
Although marine environmental samples were not tested within the timescale of this
work, the mxaF PCR primers show promise for use in future studies of both
The diversity of cmuA sequences in the active enrichments from both the Arabian Sea
and L4 was assessed by clone library analysis. Sequences belonged to three clades,
one novel clade with no cultured representatives and two clades not previously
Clone libraries were also produced from cmuA PCR products amplified from DNA of
large volume seawater samples from the Arabian Sea. Phylogenetic analysis of these
cmuA sequences indicated a shift in the most common sequence types observed in
these libraries that occurs between stations one and four of the cruise. These
sequences, together with available cmuA sequences from other environments, formed
the large number of remaining DNA samples from the Arabian Sea cruise, and
samples from a Celtic Sea cruise. Although the TRFLP technique was successfully
applied to standard clones, no cmuA PCR products were obtained from any of the
remaining samples. This was related to the sample volume used, with cmuA products
156
easily obtained from CH3Br enrichments and large volume samples, but not from
those with sample volumes of 2 L or less. This presumably reflects the abundance of
sole carbon and energy source available at the beginning of this study. Although a
number of attempts had been made to reveal the presence of the CmuA pathway in
other previously identified. PCR primers were designed to the highly conserved
region encoding the corrinoid-binding region of cmuA. A 128 bp PCR product was
This failed to hybridise and on sequencing of the probe, it was discovered that
ambiguities in the primer regions of the sequence had resulted in it being mistakenly
The global CH3Br cycle has yet to be fully defined. The oceans are known to be both
a source and a sink of CH3Br, but the part that CH3Br-utilising bacteria play in this
responsible for CH3Br could have repercussions for the global cycle of this compound
involvement, not only to clarify current fluxes, but also to be able to model changes in
157
the degradation rates of CH3Br with respect to changes in bacterial community
structure.
The ultimate aim of this investigation was to couple measurements of the fluxes of
ambitious aim and although not achieved, this investigation has laid firm groundwork
CH3Br at station L4, off the coast of Plymouth, UK. Results indicated that levels of
investigate this further, there are a number of experiments that could be undertaken.
GC ECD ‘system three’ with purge and trap apparatus could be used to measure rates
Inclusion of inhibitors such as, mercuric chloride (to measure chemical loss rates) and
which is capable of co-oxidation of CH3X) would allow assignment of the total loss
useful to develop an inhibitor of CmuA for use in this experiment in order to reveal
the amount of CH3Br degradation that this pathway is responsible for. (Hoeft et al.,
158
this concentration of chloroform is much higher than the concentration of CH3Br that
would be present and may have other, undesirable, effects on the natural population
strain Oxy6 which was capable of growth on toluene whilst co-oxidising CH3Br.
off Plymouth over a full seasonal cycle would allow the determination of any seasonal
effects on CH3Br fluxes. CH3Br could also be measured during diel sampling cycles,
and over more detailed depth profiles. Critical to understanding the importance of
the number of these organisms present and their activity. The successful
amplification of cmuA from large volume DNA samples and enrichments gave an
appreciation of the low numbers of these organisms present, but development of Real
Time PCR for quantitative detection of cmuA copy number would be a major
functional genes of methylotrophic bacteria such as pmoA in soils (Kolb et al., 2003).
Coupling this with RNA extraction and Reverse Transcriptase PCR would allow for
project to attempt given the indications of low levels of cmuA present in seawater
DNA extracts.
Two separate attempts were made to elucidate the diversity of CH3Br-utilising marine
applied to marine enrichment and DNA samples from Arabian Sea and Plymouth
159
coastal seawater and a large number of marine cmuA sequences were collected.
Falling into three clades, these sequences indicated a diversity that is not currently
future attempts at isolating these organisms, perhaps using a wider range of media, as
only one was used in this case. Two sequences belonging to clade A3 from the
pooled Arabian Sea enrichment PE2 contained in-frame stop codons, confirmed by
resequencing. It is possible that they could have been due to PCR or cloning errors,
but also possible that they were present in an organism in this condition. It is unclear
as to whether these genes would have been expressed in the environment. A future
study could make use of the RNA Stable-Isotope Probing (Manefield et al., 2002)) in
order to gain an impression of which clades are actively responsible for 13CH3Br-
which CH3Br is being rapidly utilised prior to use of these stable-isotope techniques
as they rely on swift utilisation of heavy isotope labelled substrates in order that the
labelled carbon does not leach into the non-CH3Br utilising microbial assemblage via
labelled CH3Br to methanol and CH3Cl via hydrolysis and nucleophilic substitution
Coupling DNA/RNA SIP with metagenomic analyses such as fosmid or BAC library
production might allow the isolation of complete cmu clusters from only that portion
of the population that was actively utilising CH3Br and may also allow identification
marker genes with functional genes can allow the identification of the organism
160
responsible. Use of these simple, but powerful techniques has previously allowed the
Secondly, mxaF, the gene encoding the large subunit of methanol dehydrogenase had
PCR primers re-developed with the aim of looking at the diversity of these sequences
within marine systems. Some, but not all, CH3X-utilising bacteria (including H.
dehydrogenase and this gene could be used as a phylogenetic marker to gain insights
There are a number of indications that bacteria utilising the cmu pathway are not the
only marine bacteria capable of degrading CH3Br. Methane oxidisers (Dalton &
Stirling, 1982; Stirling & Dalton, 1980), ammonia oxidisers (Rasche et al., 1990), and
propane oxidisers (Streger et al., 1999) have also been demonstrated to co-oxidise
CH3Br and are likely to contribute to marine degradation when present in this
environment.
methylohalidivorans MB2, including this one, have failed, although a primer for the
amplification of cmuA sequences beyond the scope of the current primer set, was
designed in the process. The reason could simply be that a different pathway is being
employed in this organism to allow growth on CH3Br as sole carbon and energy
mutagenesis and the isolation of mutants unable to utilise CH3Br as sole carbon and
161
energy source. However, this would rely on the development of genetic techniques
for this organism, and attempts would be further hampered by its low biomass
During this project Schaefer et al., 2005 isolated 13 novel marine CH3Br-utilising
PAGE and protein mass spectrometry analysis to express CmuA when grown on
CH3Br and cmu clusters were subsequently cloned and sequenced from these.
However, the third clade, represented by Rhodobacteracaea strain 217, did not. This
carbon and energy source its genome was recently sequenced through funding by the
Gordon and Betty Moore Foundation. Currently the genome is awaiting annotation.
methylohalidivorans MB2.
Goodwin et al., 2005 tested the ability of toluene to inhibit CH3Br consumption by L.
methylohalidivorans MB2 and found that it did not. Toluene also did not inhibit
toluene inhibited CH3Br degradation by 29-100 % in samples from the Western and
North Atlantic, North Pacific and Southern Ocean, but failed to inhibit either of these
that the pathways represented by these two organisms contribute to total marine
CH3Br degradation. The toluene and CH3Br co-oxidising strain Oxy6 isolated by
162
these investigators was placed phylogenetically close to Erythrobacter and
Arabian Sea enrichments, MJC8 was identified by 16S rRNA sequencing to be related
to the Erythrobacter genus, and although it did not demonstrate the presence of cmuA
strain Oxy6.
What is not yet clear from any analysis carried out to date is whether CH3X are used
by marine bacteria capable of their utilisation as sole carbon and energy source, or
whether these organisms mainly make use of other available growth substrates. In
this case degradation of CH3Br might be as a top-up energy source or top-up carbon
viable energy source and it has been calculated that dissolved substrates are useful
energy sources even at the vanishingly low concentrations that CH3Br is present at in
and CH3Br (Borodina et al., 2004), even when the organism was being grown on an
During the enrichment and isolation of CH3Br-utilising bacteria, it was noticed that
the most active enrichments from the Arabian Sea were all enriched with CH3Br
catalyses the oxidation of formate to carbon dioxide is part of the cmu CH3Br
163
utilisation pathway and perhaps enrichment with formate serendipitously enriched for
this pathway.
8.3 In conclusion
During this study, a sensitive GC ECD system for measurement of seawater CH3Br
attempted. Primers targeting the gene encoding for the large subunit of methanol
dehydrogenase were redesigned and shown to be useful for amplifying mxaF from a
sequences was produced by clone library analysis from both Plymouth coastal, and
Arabian Sea seawater CH3Br enrichments and samples. These were used to develop
the TRFLP technique for use with cmuA and allow the rapid screening of these
Of the aims of this work, measurements of CH3Br in seawater were made and the
although novel isolates were not obtained. With more time the critical aim would be
164
Bibliography
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J. H., Zhang, Z., Miller,
W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Research 25, 3389-3402.
Anbar, A. D., Yung, Y. L. & Chavez, F. P. (1996). Methyl bromide: Ocean sources,
ocean sinks, and climate sensitivity. Global Biogeochemical Cycles 10, 175-190.
Anderson, D. J., Morris, C. J., Nunn, D. N., Anthony, C. & Lidstrom, M. (1990).
Nucleotide sequence of the Methylobacterium extorquens AM1 moxF and moxJ genes
involved in methanol oxidation. Gene 90, 173-176.
Andreae, M. O. & Merlet, P. (2001). Emission of trace gases and aerosols from
biomass burning. Global Biogeochemical Cycles 15, 955-966.
Aylward, G. H. & Findlay, T. J. V. (1986). SI chemical data, 2nd edn. Milton, Qld,
Australia: John Wiley & Sons.
Baker, J. M., Reeves, C. E., Nightingale, P. D., Penkett, S. A., Gibb, S. W. &
Hatton, A. D. (1999). Biological production of methyl bromide in the coastal waters
of the North Sea and open ocean of the northeast Atlantic. Marine Chemistry 64, 267-
285.
Beja, O., Aravind, L., Koonin, E. V., Suzuki, M. T., Hadd, A., Nguyen, L. P.,
Jovanovich, S., Gates, C. M., Feldman, R. A., Spudich, J. L., Spudich, E. N. &
DeLong, E. F. (2000). Bacterial rhodopsin: Evidence for a new type of phototrophy
in the sea. Science 289, 1902-1906.
Borodina, E., Cox, M. J., McDonald, I. R. & Murrell, J. C. (2005). Use of DNA-
stable isotope probing and functional gene probes to investigate the diversity of
methyl chloride-utilizing bacteria in soil. Environmental Microbiology.
Bourque, D., Pomerleau, Y. & Groleau, D. (1995). High cell density cultivation of
Methylobacterium extorquens on methanol for the production of high molecular
weight PHB. Applied Microbiology and Biotechnology 44, 367-376.
164
Bulygina, E. S., Govorukhina, N. I., Netrusov, A. I., Trotsenko, Y. A. &
Chumakov, K. M. (1993). Comparative studies on 5S RNA sequence and DNA-
DNA hybridization of obligately and restricted facultatively methylotrophic bacteria.
Systematic and Applied Microbiology 16, 85-91.
Butler, J. H. (1994). The potential role of the ocean in regulating atmospheric CH3Br.
Geophysical Research Letters 21, 185-188.
Butler, J. H. (2000). Better budgets for methyl halides. Nature 403, 260-261.
Chang, A. K. C., Lim, C. Y., Kim, S. W., You, H. J., Hahm, K. S., Yoon, S. M.,
Park, J. K. & Lee, J. S. (2002). Purification and characterization of two forms of
methanol dehydrogenases from a marine methylotroph. Journal of Basic
Microbiology 42, 238-245.
Colby, J., Stirling, D. I. & Dalton, H. (1977). The soluble methane mono-oxygenase
of Methylococcus capsulatus (Bath): Its ability to oxygenate n-alkanes, n-alkenes,
ethers and alicyclic, aromatic and heterocyclic compounds. Biochemical Journal 165,
395-402.
Coulter, C., Hamilton, J. T. G., McRoberts, W. C., Kulakov, L., Larkin, M. J. &
Harper, D. B. (1999). Halomethane : bisulfide/halide ion methyltransferase, an
unusual corrinoid enzyme of environmental significance isolated from an aerobic
methylotroph using chloromethane as the sole carbon source. Applied and
Environmental Microbiology 65, 4301-4312.
165
Dalton, H. & Stirling, D. I. (1982). Co-metabolism. Philosophical Transactions of
the Royal Society of London Series B-Biological Sciences 297, 481-495.
Dedysh, S. N., Liesack, W., Khmelemina, V. N., Suzina, N. E., Trotsenko, Y. A.,
Semrau, J. D., Bares, A. M., Panikov, N. S. & Tiedje, J. M. (2000). Methylocella
paulstris gen. nov., sp. nov., a new methane-oxidising acidophilic bacterium from
peat bogs, representing a novel subtype of serine pathway methanotrophs.
International Journal of Systematic and Evolutionary Microbiology 50, 955-969.
Dedysh, S. N., Smirnova, K. V., Khmelemina, V. N., Suzina, N. E., Liesack, W. &
Trotsenko, Y. A. (2005). Methylotrophic autotrophy in Beijerinckia mobilis. Journal
of Bacteriology 187, 3884-3888.
166
Elliott, S. & Rowland, F. S. (1995). Methyl halide hydrolysis rates in natural-waters.
Journal of Atmospheric Chemistry 20, 229-236.
Evans, J. C., Huddler, D. P., Jiracek, J., Castro, C., Millian, N. S., Garrow, T. A.
& Ludwig, M. L. (2002). Betaine-homocysteine methyltransferase: zinc in a distorted
barrel. Structure 10, 1159-1171.
Gentile, I. A., Ferraris, L. & Crespi, S. (1989). The degradation of methyl bromide
in some natural fresh waters. Influence of Temperature, pH and Light. Pesticide
Science 25, 261-272.
167
Gerritse, J., Drzyzga, O., Kloestra, G., Keijmel, M., Wiersum, L. P., Hutson, R.,
Collins, M. D. & Gottschal, J. C. (1999). Influence of different electron donors and
acceptors on dehalorespiration of tetrachloroethene by Desulfitobacterium frappieri
TCE1. Applied and Environmental Microbiology 65, 5212-5221.
Ghosh, M., Anthony, C., Harlos, K., Goodwin, M. G. & Blake, C. (1995). The
refined structure of the quinoprotein methanol dehydrogenase from Methylobacterium
extorquens at 1.94 A. Structure 3, 177-187.
Gonzalez, J. M., Covert, J. S., Whitman, W. B., Henriksen, J. R., Mayer, F.,
Scharf, B., Schmitt, R., Buchan, A., Fuhrman, J. A., Kiene, R. P. & Ann Moran,
M. (2003). Silicibacter pomeroyi sp nov and Roseovarius nubinhibens sp nov.,
dimethylsulfoniopropionate-demethylating bacteria from marine environments.
International Journal of Systematic and Evolutionary Microbiology 53, 1261-1269.
Goodey, J. B. (1949). The control of Anguillulina dipsaci on the seed of teazle and
red clover by funigation with methyl bromide. Journal of Helminthology 23, 171-174.
Groen, B., Frank Jr, J. & Duine, A. J. (1984). Quinoprotein alcohol dehydrogenase
from ethanol-grown Pseudomonas aeruginosa. Biochemical Journal 233, 921-924.
168
Haine, T. W. N., Watson, A. J. & Liddicoat, M. I. (1995). Chlorofluorocarbon-113
in the Northeast Atlantic. Journal of Geophysical Research-Oceans 100, 10745-
10753.
Inagaki, F., Tsunogai, U., Suzuki, M., Kosaka, A., Machiyama, H., Takai, K.,
Nunoura, T., Nealson, K. H. & Horikoshi, K. (2004). Characterization of C-1-
metabolizing prokaryotic communities in methane seep habitats at the Kuroshima
Knoll, southern Ryukyu arc, by analyzing pmoA, mmoX, mxaF, mcrA, and 16S rRNA
genes. Applied and Environmental Microbiology 70, 7445-7455.
Jeong, J. H., Kim, S. W., Yoon, S. M., Park, J. K. & Lee, J. S. (2002).
Characterization of the conserved region of the mxaF gene that encodes the large
subunit of methanol dehydrogenase from a marine methylotrophic bacterium.
Molecules and Cells 13, 369-376.
Keppler, F., Eiden, R., Niedan, V., Pracht, J. & Scholer, H. F. (2000).
Halocarbons produced by natural oxidation processes during degradation of organic
matter. Nature 403, 298-301.
169
Khalil, M. A. K., Rasmussen, R. A. & Gunawardena, R. (1993). Atmospheric
methyl bromide - trends and global mass balance. Journal of Geophysical Research-
Atmospheres 98, 2887-2896.
Kim, H., Rao, P. S. C. & Annable, M. D. (1999). Gaseous tracer technique for
estimating air-water interfacial areas and interface mobility. Journal of the Soil
Science Association of America 63, 1554-1560.
Kolb, S., Knief, C., Stubner, S. & Conrad, R. (2003). Quantitative detection of
methanotrophs in soil by novel pmoA- targeted real-time PCR assays. Applied and
Environmental Microbiology 69, 2423-2429.
Laturnus, F., Adams, F. C. & Wiencke, C. (1998). Methyl halides from Antarctic
macroalgae. Geophysical Research Letters 25, 773-776.
Lee, N., Nielsen, P. H., Andreasen, K. H., Juretschko, S., Nielsen, J. L., Schleifer,
K. H. & Wagner, M. (1999). Combination of fluorescent in situ hybridization and
microautoradiography - a new tool for structure-function analyses in microbial
ecology. Applied and Environmental Microbiology 65, 1289-1297.
170
Lobert, J. M., Butler, J. H., Montzka, S. A., Geller, L. S., Myers, R. C. & Elkins,
J. W. (1995). A net ink for atmospheric CH3Br in the East Pacific-Ocean. Science
267, 1002-1005.
Ludwig, W., Strunk, O., Klugbauer, S., Klugbauer, N., Weizenegger, M.,
Neumaier, J., Bachleitner, M. & Schleifer, K. H. (1998). Bacterial phylogeny based
on comparative sequence analysis. Electrophoresis 19, 554-568.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H., Yadhukumar,
Buchner, A., Lai, T., Steppi, S., Jobb, G., Forster, W., Brettske, I., Gerber, S.,
Ginhart, A. W., Gross, O., Grumann, S., Hermann, S., Jost, R., Konig, A., Liss,
T., Lussmann, R., May, M., Nonhoff, B., Reichel, B., Strehlow, R., Stamatakis,
A., Stuckmann, N., Vilbig, A., Lenke, M., Ludwig, T., Bode, A. & Schleifer, K. H.
(2004). ARB: a software environment for sequence data. Nucleic Acids Research 32,
1363-1371.
Manefield, M., Whiteley, A. S., Griffiths, R. I. & Bailey, M. J. (2002). RNA stable
isotope probing, a novel means of linking microbial community function to
Phylogeny. Applied and Environmental Microbiology 68, 5367-5373.
171
Marchler-Bauer, A., Anderson, J. B., Cherukuri, P. F., DeWeese-Scott, C., Geer,
L. Y., Gwadz, M., He, S., Hurwitz, D. I., Jackson, J. D., Ke, Z., Lanczycki, C.,
Liebert, C. A., Liu, C., Lu, F., Marchler, G. H., Mullokandov, M., Shoemaker, B.
A., Simonyan, V., Song, J. S., Thiessen, P. A., Yamashita, R. A., Yin, J. J., Zhang,
D. & Bryant, S. H. (2005). CDD: a Conserved Domain Database for protein
classification. Nucleic Acids Research 33, D192-D196.
McAnulla, C., Woodall, C. A., McDonald, I. R., Studer, A., Vuilleumier, S.,
Leisinger, T. & Murrell, J. C. (2001b). Chloromethane utilization gene cluster from
Hyphomicrobium chloromethanicum strain CM2(T) and development of functional
gene probes to detect halomethane-degrading bacteria. Applied and Environmental
Microbiology 67, 307-316.
McDonald, I. R., Kampfer, P., Topp, E., Warner, K. L., Cox, M. J., Connell
Hancock, T. L., Miller, L. G., Larkin, M. J., Ducrocq, V., Coulter, C., Harper, D.
B., Murrell, J. C. & Oremland, R. S. (In Press). Aminobacter ciceronei sp. nov.
and Aminobacter lissarensis sp. nov., isolated from various terrestrial environments.
International Journal of Systematic and Evolutionary Microbiology.
Mellouki, A., Talukdar, R. K., Schmoltner, A. M., Gierczak, T., Mills, M. J.,
Solomon, S. & Ravishankara, A. R. (1992). Atmospheric lifetimes and ozone
depletion potentials of methyl bromide (CH3Br) and dibromomethane (CH2Br2).
Geophysical Research Letters 19, 2059-2062.
172
Miller, L. G., Warner, K. L., Baesman, S. M., Oremland, R. S., McDonald, I. R.,
Radajewski, S. & Murrell, J. C. (2004). Degradation of methyl bromide and methyl
chloride in soil microcosms: Use of stable C isotope fractionation and stable isotope
probing to identify reactions and the responsible microorganisms. Geochimica et
Cosmochimica Acta 68, 3271-3283.
Moosvi, S. A., Pacheco, C. C., McDonald, I. R., De Marco, P., Pearce, D. A.,
Kelly, D. P. & Wood, A. P. (2005). Isolation and properties of methane-sulfonate
degrading Afipia felis from Antarctica and comparison with other strains of A. felis.
Environmental Microbiology 7, 22.
Old, I. G., Margarita, D., Glass, R. E. & Saint Girons, I. (1990). Nucleotide
sequence of the metH gene of Escherichia coli K-12 and comparison with that of
Salmonella typhimurium LT2. Gene 87, 15-21.
Platt, U. & Honninger, G. (2003). The role of halogen species in the troposphere.
Chemosphere 52, 325-338.
173
Radajewski, S., Ineson, P., Parekh, N. R. & Murrell, J. C. (2000). Stable-isotope
probing as a tool in microbial ecology. Nature 403, 646-649.
Ragsdale, N. & Vick, K. (2001). The U.S. Search for methyl bromide alternatives.
Pesticide Outlook December, 244-248.
Redeker, K. R., Andrews, J., Fisher, F., Sass, R. & Cicerone, R. J. (2002).
Interfield and intrafield variability of methyl halide emissions from rice paddies.
Global Biogeochemical Cycles 16, art. no.-1125.
Rhew, R. C., Miller, B. R. & Weiss, R. F. (2000). Natural methyl bromide and
methyl chloride emissions from coastal salt marshes. Nature 403, 292-295.
Riemann, L., Steward, G. F., Fandino, L. B., Campbell, L., Landry, M. R. &
Azam, F. (1999). Bacterial community composition during two consecutive NE
Monsoon periods in the Arabian Sea studied by denaturing gradient gel
electrophoresis (DGGE) of rRNA genes. Deep-Sea Research Part Ii-Topical Studies
in Oceanography 46, 1791-1811.
Ritchie, N. J., Schutter, M. E., Dick, R. P. & Myrold, D. D. (2000). Use of length
heterogeneity PCR and fatty acid methyl ester profiles to characterize microbial
communities in soil. Applied and Environmental Microbiology 66, 1668-1675.
Rose, T. M., Schultz, E. R., Henikoff, J. G., Pietrokovski, S., McCallum, C. M. &
Henikoff, S. (1998). Consensus-degenerate hybrid oligonucleotide primers for
amplification of distantly related sequences. Nucleic Acids Research 26, 1628-1635.
174
Sambrook, J. & Russell, D. (2001). Molecular cloning: a laboratory manual. Cold
Spring Harbour, New York: Cold Spring Harbor Laboratory Press.
Schäfer, H., Abbas, B., Witte, H. & Muyzer, G. (2002). Genetic diversity of
'satellite' bacteria present in cultures of marine diatoms. FEMS Microbiology Ecology
42, 25-35.
175
Stefels, J. & Van Boekel, W. H. M. (1993). Production of DMS from dissolved
DMSP in axenic cultures of the marine phytoplankton species Phaeocystis sp. Marine
Ecology-Progress Series 97, 11-18.
Stirling, D. I. & Dalton, H. (1980). Oxidation of dimethyl ether, methyl formate, and
bromomethane by Methylococcus capsulatus (Bath). Journal of General
Microbiology 116, 277-283.
Studer, A., McAnulla, C., Buchele, R., Leisinger, T. & Vuilleumier, S. (2002).
Chloromethane-induced genes define a third C-1 utilization pathway in
Methylobacterium chloromethanicum CM4. Journal of Bacteriology 184, 3476-3484.
Swanson, A. L., Blake, N. J., Dibb, J. E., Albert, M. R., Blake, D. R. & Rowland,
F. S. (2002). Photochemically induced production of CH3Br, CH3I, C2H5I, ethene, and
propene within surface snow at Summit, Greenland. Atmospheric Environment 36,
2671-2682.
Sy, A., Giraud, E., Jourand, P., Garcia, N., Willems, A., de Lajudie, P., Prin, Y.,
Neyra, M., Gillis, M., Boivin-Masson, C. & Dreyfus, B. (2001). Methylotrophic
Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes.
Journal of Bacteriology 183, 214-220.
Tanaka, Y., Yoshida, T., Watanabe, K., Izumi, Y. & Mitsunaga, T. (1997).
Cloning and analysis of methanol oxidation genes in the methylotroph
Hyphomicrobium methylovorum GM2. FEMS Microbiology Letters 154, 397-401.
176
Vannelli, T., Messmer, M., Studer, A., Vuilleumier, S. & Leisinger, T. (1999). A
corrinoid-dependent catabolic pathway for growth of a Methylobacterium strain with
chloromethane. Proceedings of the National Academy of Sciences of the United States
of America 96, 4615-4620.
Wang, P., Wang, F. P., Xu, M. X. & Xiao, X. (2004). Molecular phylogeny of
methylotrophs in a deep-sea sediment from a tropical west Pacific Warm Pool. FEMS
Microbiology Ecology 47, 77-84.
Ward, N., Larsen, O., Sakwa, J., Bruseth, L., Khouri, H., Durkin, A. S.,
Dimitrov, G., Jiang, L., Scanlan, D., Kang, K. H., Lewis, M., Nelson, K. E.,
Methe, B., Wu, M., Heidelberg, J. F., Paulsen, I. T., Fouts, D., Ravel, J., Tettelin,
H., Ren, Q., Read, T., DeBoy, R. T., Seshadri, R., Salzberg, S. L., Jensen, H. B.,
Birkeland, N. K., Nelson, W. C., Dodson, R. J., Grindhaug, S. H., Holt, I.,
Eidhammer, I., Jonasen, I., Vanaken, S., Utterback, T., Feldblyum, T. V., Fraser,
C. M., Lillehaug, J. R. & Eisen, J. A. (2004). Genomic insights into methanotrophy:
the complete genome sequence of Methylococcus capsulatus (Bath). PLoS Biology 2,
e303.
177
Widdel, F. G., Kohring, W. & Mayer, F. (1983). Studies on dissimilatory sulphate-
reducing bacteria that decompose fatty acids. III. Characterisation of the filamentous
gliding Desulfonema limicola gen. nov., sp. nov. and Desulfonema sp. nov. Archives
of Microbiology 134, 286-294.
Wingenter, O. W., Haase, K. B., Strutton, P., Friedrich, G., Meinardi, S., Blake,
D. R. & Rowland, F. S. (2004). Changing concentrations of CO, CH4, C5H8, CH3Br,
CH3I, and dimethyl sulfide during the Southern Ocean Iron Enrichment Experiments.
Proceedings of the National Academy of Sciences of the United States of America
101, 8537-8541.
Xia, Z. X., Dai, W. W., Zhang, Y. F., White, S. A., Boyd, G. D. & Mathews, F. S.
(1996). Determination of the gene sequence and the three-dimensional structure at 2.4
angstrom resolution of methanol dehydrogenase from Methylophilus W3A1. Journal
of Molecular Biology 259, 480-501.
Yagi, K., Williams, J., Wang, N. Y. & Cicerone, R. J. (1995). Atmospheric methyl
bromide (CH3Br) from agricultural soil fumigations. Science 267, 1979-1981.
Yates, S. R., Wang, D., Gan, J., Ernst, F. F. & Jury, W. A. (1998). Minimizing
methyl bromide emissions from soil fumigation. Geophysical Research Letters 25,
1633-1636.
Yaws, C., Yang, C. H. & Pan, X. (1991). Henry's law constants for 362 organic
compounds in water. Chemical Engineering Science 98.
Yokouchi, Y., Ikeda, M., Inuzuka, Y. & Yukawa, T. (2002). Strong emission of
methyl chloride from tropical plants. Nature 416, 163-165.
Yung, Y. L., Pinto, J. P., Watson, R. T. & Sander, S. P. (1980). Atmospheric ozone
perturbations in the lower stratosphere. Journal of Atmospheric Science 37, 339-353.
178
Zhang, M. & Lidstrom, M. E. (2003). Promoters and transcripts for genes involved
in methanol oxidation in Methylobacterium extorquens AM 1. Microbiology-Sgm
149, 1033-1040.
179
Appendices
180
A AMBITION Data
Data was obtained from the Biological Oceanography Data Centre, Liverpool, which
collated the data from RRS Charles Darwin cruise CD132 participants. The data is
participants involved below and the cruise report and data CD should be consulted
for details of methods. As there were several casts per station it was necessary to
select one per station for the sake of graphical representation. The most consistent
cast was referred to as the biogeochemistry cast and was carried out at dawn on every
station; data from this cast was used to produce the graphs below unless otherwise
It is worth noting that certain measurements were not taken at either the beginning or
end of the cruise, mainly due to the nature of the equipment or methods involved that
require time to set up and pack away for transport to and from the UK. The depth of
the measurements made also varies from station to station. The maximum is usually
250-300 m although at the later stations this is considerably reduced reflecting the
shallowing water.
181
A.2 Physicochemical Data
182
183
A.3 Productivity
184
185
A.4 Microorganism abundance
186
B List of Samples from the AMBITION Cruise
187
ID Station Date Location Cast Depth Filter type Note
No. No.
42 3 09/09/01 03o48’N 67o00 E 09 63 Supor DCM
43 3 09/09/01 03o48’N 67o00 E 09 1 Supor
44 3 09/09/01 03o48’N 67o00 E 09 10 Supor
45 3 09/09/01 03o48’N 67o00 E 09 25 Supor
46 3 09/09/01 03o48’N 67o00 E 09 50 Supor
47 3 09/09/01 03o48’N 67o00 E 09 80 Supor
48 3 09/09/01 03o48’N 67o00 E 09 100 Supor
49 4 10/09/01 07o35’N 67o00 E 02 5/1 Sterivex Surface
50 4 10/09/01 07o35’N 67o00 E 02 66 Sterivex DCM
51 4 10/09/01 07o35’N 67o00 E 02 90 Sterivex
52 4 11/09/01 07o35’N 67o00 E 06 5 Supor Surface
53 4 11/09/01 07o35’N 67o00 E 06 77 Supor DCM
54 4 11/09/01 07o35’N 67o00 E 06 1 Supor
55 4 11/09/01 07o35’N 67o00 E 06 10 Supor
56 4 11/09/01 07o35’N 67o00 E 06 25 Supor
57 4 11/09/01 07o35’N 67o00 E 06 50 Supor
58 4 11/09/01 07o35’N 67o00 E 06 65 Supor
59 4 11/09/01 07o35’N 67o00 E 06 90 Supor
60 5 12/09/01 11o06’N 66o59 E 02 5 Supor
61 5 12/09/01 11o06’N 66o59 E 02 5 Supor 0.45
62 5 12/09/01 11o06’N 66o59 E 02 60 Supor
63 5 12/09/01 11o06’N 66o59 E 02 60 Supor 0.45
64 5 12/09/01 11o06’N 66o59 E 02 100 Supor
65 5 12/09/01 11o06’N 66o59 E 02 100 Supor 0.45
66 5 13/09/01 11o06’N 66o59 E 06 5 Supor Surface
67 5 13/09/01 11o06’N 66o59 E 06 36 Supor DCM
68 5 13/09/01 11o06’N 66o59 E 06 1 Supor
69 5 13/09/01 11o06’N 66o59 E 06 10 Supor
70 5 13/09/01 11o06’N 66o59 E 06 25 Supor
71 5 13/09/01 11o06’N 66o59 E 06 50 Supor
72 5 13/09/01 11o06’N 66o59 E 06 80 Supor
73 5 13/09/01 11o06’N 66o59 E 06 100 Supor
74 6 14/09/01 15o12’N 67o00 E 02 5 Sterivex Surface
75 6 14/09/01 15o12’N 67o00 E 02 35 Sterivex DCM
76 6 14/09/01 15o12’N 67o00 E 02 60 Sterivex
77 6 14/09/01 15o12’N 67o00 E 02 120 Sterivex
78 6 14/09/01 15o12’N 67o00 E 02 202 Sterivex
79 6 14/09/01 15o12’N 67o00 E 02 701 Sterivex
80 6 14/09/01 15o12’N 67o00 E 02 1600 Sterivex
81 6 14/09/01 15o12’N 67o00 E 02 2501 Sterivex
82 6 15/09/01 15o12’N 67o00 E 07 5 Supor Surface
83 6 15/09/01 15o12’N 67o00 E 07 40 Supor DCM
84 6 15/09/01 15o12’N 67o00 E 07 10 Supor
85 6 15/09/01 15o12’N 67o00 E 07 20 Supor
86 6 15/09/01 15o12’N 67o00 E 07 50 Supor
87 6 15/09/01 15o12’N 67o00 E 07 75 Supor
188
ID Station Date Location Cast Depth Filter type Note
No. No.
88 7 16/09/01 19o00’N 67o00 E 03 5 Sterivex Diel 1
89 7 16/09/01 19o00’N 67o00 E 03 47 Sterivex Diel 1
90 7 16/09/01 19o00’N 67o00 E 04 5 Sterivex Diel 2
91 7 16/09/01 19o00’N 67o00 E 04 50 Sterivex Diel 2
92 7 17/09/01 19o00’N 67o00 E 05 5 Sterivex Diel 3
93 7 17/09/01 19o00’N 67o00 E 05 50 Sterivex Diel 3
94 7 17/09/01 19o00’N 67o00 E 06 5 Sterivex Diel 4
95 7 17/09/01 19o00’N 67o00 E 06 52 Sterivex Diel 4
96 7 17/09/01 19o00’N 67o00 E 07 5 Sterivex Diel 5
97 7 17/09/01 19o00’N 67o00 E 07 50 Sterivex Diel 5
98 7 18/09/01 19o00’N 67o00 E 11 5 Supor Surface
99 7 18/09/01 19o00’N 67o00 E 11 49 Supor DCM
100 7 18/09/01 19o00’N 67o00 E 11 10 Supor
101 7 18/09/01 19o00’N 67o00 E 11 20 Supor
102 7 18/09/01 19o00’N 67o00 E 11 40 Supor
103 7 18/09/01 19o00’N 67o00 E 11 60 Supor
104 7 18/09/01 19o00’N 67o00 E 11 80 Supor
105 7 18/09/01 19o00’N 67o00 E 11 100 Supor
106 8 19/09/01 20o55’N 63o40 E 02 5 Sterivex Surface
107 8 19/09/01 20o55’N 63o40 E 02 10 Sterivex
108 8 19/09/01 20o55’N 63o40 E 02 18 Sterivex
109 8 19/09/01 20o55’N 63o40 E 02 21 Sterivex DCM
110 8 19/09/01 20o55’N 63o40 E 02 40 Sterivex
111 8 19/09/01 20o55’N 63o40 E 02 60 Sterivex
112 8 19/09/01 20o55’N 63o40 E 02 150 Sterivex
113 8 19/09/01 20o55’N 63o40 E 02 250 Sterivex
114 8 20/09/01 20o55’N 63o40 E 05 5 Supor Surface
115 8 20/09/01 20o55’N 63o40 E 05 29 Supor DCM
116 8 20/09/01 20o55’N 63o40 E 05 250 Supor
117 8 20/09/01 20o55’N 63o40 E 05 10 Supor
118 8 20/09/01 20o55’N 63o40 E 05 20 Supor
119 8 20/09/01 20o55’N 63o40 E 05 50 Supor
120 8 20/09/01 20o55’N 63o40 E 05 70 Supor
121 8 20/09/01 20o55’N 63o40 E 05 100 Supor
122 9 22/09/01 23o33’N 59o54 E 02 5 Supor CM
123 9 22/09/01 23o33’N 59o54 E 02 10 Supor
124 9 22/09/01 23o33’N 59o54 E 02 20 Supor
125 9 22/09/01 23o33’N 59o54 E 02 40 Supor
126 9 22/09/01 23o33’N 59o54 E 02 100 Supor
127 9 22/09/01 23o33’N 59o54 E 02 210 Supor
128 9 22/09/01 23o33’N 59o54 E 02 230 Supor
129 9 22/09/01 23o33’N 59o54 E 02 250 Supor CM
130 9 23/09/01 23o33’N 59o54 E 05 2.5 Supor CM
131 9 23/09/01 23o33’N 59o54 E 05 7.5 Supor
132 9 23/09/01 23o33’N 59o54 E 05 10 Supor
133 9 23/09/01 23o33’N 59o54 E 05 20 Supor
189
ID Station Date Location Cast Depth Filter type Note
No. No.
134 9 23/09/01 23o33’N 59o54 E 05 40 Supor
o o
135 9 23/09/01 23 33’N 59 54 E 05 70 Supor
136 9 23/09/01 23o33’N 59o54 E 05 90 Supor
o o
137 9 23/09/01 23 33’N 59 54 E 05 110 Supor
138 10 24/09/01 24o20’N 58o10 E 02 5 Supor
o o
139 10 24/09/01 24 20’N 58 10 E 02 20 Supor
o o
140 10 24/09/01 24 20’N 58 10 E 02 29 Supor DCM
141 10 24/09/01 24o20’N 58o10 E 02 55 Supor
142 10 24/09/01 24o20’N 58o10 E 02 60 Supor
143 10 24/09/01 24o20’N 58o10 E 02 70 Supor
o o
144 10 24/09/01 24 20’N 58 10 E 02 100 Supor
145 10 24/09/01 24o20’N 58o10 E 02 120 Supor
o o
146 10 25/09/01 24 20’N 58 10 E 06 5 Supor Surface
o o
147 10 25/09/01 24 20’N 58 10 E 06 27 Supor DCM
148 10 25/09/01 24o20’N 58o10 E 06 15 Supor
149 10 25/09/01 24o20’N 58o10 E 06 20 Supor
150 10 25/09/01 24o20’N 58o10 E 06 36 Supor
o o
151 10 25/09/01 24 20’N 58 10 E 06 55 Supor
o o
152 10 25/09/01 24 20’N 58 10 E 06 65 Supor
153 10 25/09/01 24o20’N 58o10 E 06 90 Supor
o o
154 11 26/09/01 26 00’N 56 35 E 02 5 Supor Surface
155 11 26/09/01 26o00’N 56o35 E 02 15 Supor
156 11 26/09/01 26o00’N 56o35 E 02 31 Supor CM
157 11 26/09/01 26o00’N 56o35 E 02 40 Supor
158 11 26/09/01 26o00’N 56o35 E 02 60 Supor
o o
159 11 26/09/01 26 00’N 56 35 E 02 75 Supor
160 11 26/09/01 26o00’N 56o35 E 02 80 Supor
o o
161 11 26/09/01 26 00’N 56 35 E 02 92 Supor Sal. max.
162 11 27/09/01 26o00’N 56o35 E 06 5 Supor Surface
o o
163 11 27/09/01 26 00’N 56 35 E 06 26 Supor DCM
164 11 27/09/01 26o00’N 56o35 E 06 90 Supor Sal. max.
o o
165 11 27/09/01 26 00’N 56 35 E 06 15 Supor
o o
166 11 27/09/01 26 00’N 56 35 E 06 19 Supor
167 11 27/09/01 26o00’N 56o35 E 06 40 Supor
o o
168 11 27/09/01 26 00’N 56 35 E 06 60 Supor
169 11 27/09/01 26o00’N 56o35 E 06 80 Supor
Table B.1. List of AMBTION DNA samples. Notes are as follows: Surface, The
sample was treated as the surface water sample, usually ~5 m; DCM, Deep
Chlorophyll Maximum; CM, Chlorophyll Maximum; Sal. max., Salinity maximum,
noted only in areas of high salinity; Diel, the sample was part of a diel sampling
cycle; 0.45, Indicates the use of 0.45 µm filters to sample a different size fraction.
190
B.2 List of Enrichments Set-up On the AMBITION Cruise
191
ID No. Substrate Key Station Date Cast Depth (m)
45 9 2 05/09/01 1 62
46 10 2 05/09/01 1 62
47 11 2 05/09/01 1 62
48 12 2 05/09/01 1 62
49 1 3 09/09/01 9 5
50 2 3 09/09/01 9 5
51 3 3 09/09/01 9 5
52 4 3 09/09/01 9 5
53 5 3 09/09/01 9 5
54 6 3 09/09/01 9 5
55 7 3 09/09/01 9 5
56 8 3 09/09/01 9 5
57 9 3 09/09/01 9 5
58 10 3 09/09/01 9 5
59 11 3 09/09/01 9 5
60 12 3 09/09/01 9 5
61 1 3 09/09/01 9 63
62 2 3 09/09/01 9 63
63 3 3 09/09/01 9 63
64 4 3 09/09/01 9 63
65 5 3 09/09/01 9 63
66 6 3 09/09/01 9 63
67 7 3 09/09/01 9 63
68 8 3 09/09/01 9 63
69 9 3 09/09/01 9 63
70 10 3 09/09/01 9 63
71 11 3 09/09/01 9 63
72 12 3 09/09/01 9 63
73 1 4 11/09/01 6 5
74 2 4 11/09/01 6 5
75 3 4 11/09/01 6 5
76 4 4 11/09/01 6 5
77 5 4 11/09/01 6 5
78 6 4 11/09/01 6 5
79 7 4 11/09/01 6 5
80 8 4 11/09/01 6 5
81 9 4 11/09/01 6 5
82 10 4 11/09/01 6 5
83 11 4 11/09/01 6 5
84 12 4 11/09/01 6 5
85 1 4 11/09/01 6 77
86 2 4 11/09/01 6 77
87 3 4 11/09/01 6 77
88 4 4 11/09/01 6 77
89 5 4 11/09/01 6 77
90 6 4 11/09/01 6 77
91 7 4 11/09/01 6 77
192
ID No. Substrate Key Station Date Cast Depth (m)
92 8 4 11/09/01 6 77
93 9 4 11/09/01 6 77
94 10 4 11/09/01 6 77
95 11 4 11/09/01 6 77
96 12 4 11/09/01 6 77
97 1 5 13/09/01 6 5
98 2 5 13/09/01 6 5
99 3 5 13/09/01 6 5
100 4 5 13/09/01 6 5
101 5 5 13/09/01 6 5
102 6 5 13/09/01 6 5
103 7 5 13/09/01 6 5
104 8 5 13/09/01 6 5
105 9 5 13/09/01 6 5
106 10 5 13/09/01 6 5
107 11 5 13/09/01 6 5
108 12 5 13/09/01 6 5
109 1 5 13/09/01 6 36
110 2 5 13/09/01 6 36
111 3 5 13/09/01 6 36
112 4 5 13/09/01 6 36
113 5 5 13/09/01 6 36
114 6 5 13/09/01 6 36
115 7 5 13/09/01 6 36
116 8 5 13/09/01 6 36
117 9 5 13/09/01 6 36
118 10 5 13/09/01 6 36
119 11 5 13/09/01 6 36
120 12 5 13/09/01 6 36
121 1 6 14/09/01 2 2501
122 2 6 14/09/01 2 2501
123 3 6 14/09/01 2 2501
124 4 6 14/09/01 2 2501
125 5 6 14/09/01 2 2501
126 6 6 14/09/01 2 2501
127 7 6 14/09/01 2 2501
128 8 6 14/09/01 2 2501
129 9 6 14/09/01 2 2501
130 10 6 14/09/01 2 2501
131 11 6 14/09/01 2 2501
132 12 6 14/09/01 2 2501
133 1 6 15/09/01 7 5
134 2 6 15/09/01 7 5
135 3 6 15/09/01 7 5
136 4 6 15/09/01 7 5
137 5 6 15/09/01 7 5
138 6 6 15/09/01 7 5
193
ID No. Substrate Key Station Date Cast Depth (m)
139 7 6 15/09/01 7 5
140 8 6 15/09/01 7 5
141 9 6 15/09/01 7 5
142 10 6 15/09/01 7 5
143 11 6 15/09/01 7 5
144 12 6 15/09/01 7 5
145 1 6 15/09/01 7 40
146 2 6 15/09/01 7 40
147 3 6 15/09/01 7 40
148 4 6 15/09/01 7 40
149 5 6 15/09/01 7 40
150 6 6 15/09/01 7 40
151 7 6 15/09/01 7 40
152 8 6 15/09/01 7 40
153 9 6 15/09/01 7 40
154 10 6 15/09/01 7 40
155 11 6 15/09/01 7 40
156 12 6 15/09/01 7 40
157 1 7 18/09/01 11 5
158 2 7 18/09/01 11 5
159 3 7 18/09/01 11 5
160 4 7 18/09/01 11 5
161 5 7 18/09/01 11 5
162 6 7 18/09/01 11 5
163 7 7 18/09/01 11 5
164 8 7 18/09/01 11 5
165 9 7 18/09/01 11 5
166 10 7 18/09/01 11 5
167 11 7 18/09/01 11 5
168 12 7 18/09/01 11 5
169 1 7 18/09/01 11 49
170 2 7 18/09/01 11 49
171 3 7 18/09/01 11 49
172 4 7 18/09/01 11 49
173 5 7 18/09/01 11 49
174 6 7 18/09/01 11 49
175 7 7 18/09/01 11 49
176 8 7 18/09/01 11 49
177 9 7 18/09/01 11 49
178 10 7 18/09/01 11 49
179 11 7 18/09/01 11 49
180 12 7 18/09/01 11 49
181 1 8 20/09/01 5 5
182 2 8 20/09/01 5 5
183 3 8 20/09/01 5 5
184 4 8 20/09/01 5 5
185 5 8 20/09/01 5 5
194
ID No. Substrate Key Station Date Cast Depth (m)
186 6 8 20/09/01 5 5
187 7 8 20/09/01 5 5
188 8 8 20/09/01 5 5
189 9 8 20/09/01 5 5
190 10 8 20/09/01 5 5
191 11 8 20/09/01 5 5
192 12 8 20/09/01 5 5
193 1 8 20/09/01 5 29
194 2 8 20/09/01 5 29
195 3 8 20/09/01 5 29
196 4 8 20/09/01 5 29
197 5 8 20/09/01 5 29
198 6 8 20/09/01 5 29
199 7 8 20/09/01 5 29
200 8 8 20/09/01 5 29
201 9 8 20/09/01 5 29
202 10 8 20/09/01 5 29
203 11 8 20/09/01 5 29
204 12 8 20/09/01 5 29
205 1 8 20/09/01 5 250
206 2 8 20/09/01 5 250
207 3 8 20/09/01 5 250
208 4 8 20/09/01 5 250
209 5 8 20/09/01 5 250
210 6 8 20/09/01 5 250
211 7 8 20/09/01 5 250
212 8 8 20/09/01 5 250
213 9 8 20/09/01 5 250
214 10 8 20/09/01 5 250
215 11 8 20/09/01 5 250
216 12 8 20/09/01 5 250
217 1 9 23/09/01 5 2.5
218 2 9 23/09/01 5 2.5
219 3 9 23/09/01 5 2.5
220 4 9 23/09/01 5 2.5
221 5 9 23/09/01 5 2.5
222 6 9 23/09/01 5 2.5
223 7 9 23/09/01 5 2.5
224 8 9 23/09/01 5 2.5
225 9 9 23/09/01 5 2.5
226 10 9 23/09/01 5 2.5
227 11 9 23/09/01 5 2.5
228 12 9 23/09/01 5 2.5
229 1 9 23/09/01 5 7.5
230 2 9 23/09/01 5 7.5
231 3 9 23/09/01 5 7.5
232 4 9 23/09/01 5 7.5
195
ID No. Substrate Key Station Date Cast Depth (m)
233 5 9 23/09/01 5 7.5
234 6 9 23/09/01 5 7.5
235 7 9 23/09/01 5 7.5
236 8 9 23/09/01 5 7.5
237 9 9 23/09/01 5 7.5
238 10 9 23/09/01 5 7.5
239 11 9 23/09/01 5 7.5
240 12 9 23/09/01 5 7.5
241 1 10 25/09/01 6 5
242 2 10 25/09/01 6 5
243 3 10 25/09/01 6 5
244 4 10 25/09/01 6 5
245 5 10 25/09/01 6 5
246 6 10 25/09/01 6 5
247 7 10 25/09/01 6 5
248 8 10 25/09/01 6 5
249 9 10 25/09/01 6 5
250 10 10 25/09/01 6 5
251 11 10 25/09/01 6 5
252 12 10 25/09/01 6 5
253 1 10 25/09/01 6 27
254 2 10 25/09/01 6 27
255 3 10 25/09/01 6 27
256 4 10 25/09/01 6 27
257 5 10 25/09/01 6 27
258 6 10 25/09/01 6 27
259 7 10 25/09/01 6 27
260 8 10 25/09/01 6 27
261 9 10 25/09/01 6 27
262 10 10 25/09/01 6 27
263 11 10 25/09/01 6 27
264 12 10 25/09/01 6 27
265 1 11 27/09/01 6 5
266 2 11 27/09/01 6 5
267 3 11 27/09/01 6 5
268 4 11 27/09/01 6 5
269 5 11 27/09/01 6 5
270 6 11 27/09/01 6 5
271 7 11 27/09/01 6 5
272 8 11 27/09/01 6 5
273 9 11 27/09/01 6 5
274 10 11 27/09/01 6 5
275 11 11 27/09/01 6 5
276 12 11 27/09/01 6 5
277 1 11 27/09/01 6 26
278 2 11 27/09/01 6 26
279 3 11 27/09/01 6 26
196
ID No. Substrate Key Station Date Cast Depth (m)
280 4 11 27/09/01 6 26
281 5 11 27/09/01 6 26
282 6 11 27/09/01 6 26
283 7 11 27/09/01 6 26
284 8 11 27/09/01 6 26
285 9 11 27/09/01 6 26
286 10 11 27/09/01 6 26
287 11 11 27/09/01 6 26
288 12 11 27/09/01 6 26
289 1 11 27/09/01 6 90
290 2 11 27/09/01 6 90
291 3 11 27/09/01 6 90
292 4 11 27/09/01 6 90
293 5 11 27/09/01 6 90
294 6 11 27/09/01 6 90
295 7 11 27/09/01 6 90
296 8 11 27/09/01 6 90
297 9 11 27/09/01 6 90
298 10 11 27/09/01 6 90
299 11 11 27/09/01 6 90
300 12 11 27/09/01 6 90
Table B.2. List of AMBTION enrichments. Conditions refer to those in Table 2.3 of
the Materials and methods.
197
C Henry’s Law
vials were made using Henry’s Law based on the dimensionless Henry’s Law
constants of MeBr, MeCl and methane. Henry’s law constants very with temperature
and are determined empirically and therefore can only be an approximation of the
actual concentration. They also assume that the gas in the headspace of a vial and
the gas in the aqueous phase are at equilibrium, which is not necessarily the case
with consumption or production of the gases, and that the liquid phase is pure water
Henry’s law constants for CH3Br and CH3Cl were calculated for the particular
temperature required using the Henry’s Law calculator available at the following
constant for methane was obtained from Kim et al., 1999, quoting Yaws et al., 1991.
It was only available for 25 oC and this should be borne in mind when incubation
An Excel spreadsheet was set up which had inputs (in yellow in Figure C.1) of the
headspace (mL), the volume of media (mL), the headspace concentration (% vol/vol)
and the temperature (oC). In the example below the media concentration of a 1L vial
section to the right of the table not in bold contains the sub-calculations required
prior to the final one. The gas constant is temperature dependant and therefore
198
where P is atmospheric pressure in N m-2 (101325 N m-2), V is the volume, n is the
number of moles (in this case 1), R is the universal gas constant, 8.314 when using N
199
D TRF assignment of cmuA sequences
201
DQ090678 B2 34 384 406 483 1307
DQ090693 B2 34 384 406 483 1307
DQ090691 B2 34 384 406 483 1307
DQ090696 B2 34 384 406 483 1307
DQ090692 B2 34 384 406 483 1307
DQ090695 B2 34 384 406 483 1307
A. ciceronei IMB-1 B2 34 384 406 483 1307
DQ090688 B2 34 384 406 483 1307
AY934436 A4 145 346 347 483 1321
AY934441 A4 145 464 282 483 1374
AY439212 B1 271 397 417 330 1415
AY439202 B1 271 397 417 330 1415
AY439200 B1 271 397 417 330 1415
AY934442 A4 145 384 406 483 1418
Hyphomicrobium sp. ND 167 384 427 459 1437
SAC1
AY934453 A4 145 464 347 483 1439
AY934429 A4 145 464 347 483 1439
AY934478 A4 145 464 347 483 1439
AY934454 A4 145 464 347 483 1439
AY934435 A4 145 464 347 483 1439
AY934435 A4 145 464 347 483 1439
AY934433 A4 145 464 347 483 1439
AY934481 A4 145 464 347 483 1439
AY934426 A4 145 464 347 483 1439
AY934428 A4 145 464 347 483 1439
AY934442 A4 145 464 347 483 1439
AY934480 A4 145 464 347 483 1439
AY934479 A4 145 464 347 483 1439
AY934444 A4 145 464 347 483 1439
AY934432 A4 145 464 347 483 1439
AY934439 A4 145 464 347 483 1439
AY934450 A4 145 464 347 483 1439
AY934448 A4 145 464 347 483 1439
Table D.1. Clade affiliation of cmuA TRFs based on in silico analysis of database
cmuA sequences.
202