note: these notes are complete for chs 1,2, and 10 -15, and most of 15;Ch 15 is not on the

exam, but I lecture on it prior to Exam I. Genetics: Introduction to the course WELCOME to genetics! This is a course that some of you have been anticipating, and many have been fearing. It is both a body of knowledge itself, and a way of studying other subjects. As such, it has a GREAT deal of application to other subjects such as evolution, ecology, cell biology, developmental biology, and cancer. Today, were going to cover the main parts of the course, then get right into an overview of genetics. I. What is genetics? Organisms can be described in many ways: By their shapes and parts, by their activities; by their reproduction. For all these things, there is a need for information: Information that told you, when you were embryo how to grow and change, so that you became a baby, then a child, then an adult. Information that resulted in some cells becoming muscle, some skin, some bone cells. Information that allows you to respond to your environment; and information that allows you to reproduce. That information has to: 1) exist- its origins are outside the scope of this course, for the most part; 2) be expressed properly: The right information, expressed at the right time and place. 3) be stored properly: We take pains to keep our information from being damaged, although it does happen. 4) It must be Transmitted in order to make new cells and organisms. This is very much like a CD or DVD; both store information; and neither does you any good unless you can express it properly- for that you need a CD or DVD player. And the information in a CD can be reproduced- copied. The study of biological information, its form, how it is expressed, stored, repaired, and transmitted, is the science of genetics. Its usually called the study of heredity, but when you think about it, heredity has to do with information. While we will spend much time on the key information molecule, DNA, well also talk about cases in which the information required for formation of an organism is not actually found in the DNA- well discuss that later in the semester. II. Four ways we study genetics: We can usually study genetics in four different ways; however, these ways often overlap! Transmission Genetics: How are traits transmitted from one generation to another? (AKA MENDELIAN Genetics); describing an allele as dominant or recessive, a gene as sexlinked, would be describing how it is transmitted.

Molecular Genetics: What are genes made up of? How are they duplicated? How is the information in the genes expressed? How are genes turned on and off? Where are genes located? Population Genetics: How do genes vary in a population? What causes this variation within populations? How are populations affected by their genes, and vice versa? Cytogenetics: This area has to do with the relationship between the chromosome and traits that are exhibited. Generally involves changes that can be observed under the microscope to chromosomes. It also is involved in the location of genes. Most books, and most instructors, start with the transmission genetics, and then move on to the molecular genetics, and this is the approach I used to take. However, Ive been teaching the molecular parts first. My thinking on this is that these parts of genetics are harder, and youre fresher and more ready to learn in September than in November; so were going to again learn about DNA before we learn about Mendel. However, well get a review of Mendelian genetics in lab as we do our fruit fly exercise.

Introduction: Chapters 1 & 2 I. A brief history: A. Prehistory: People have known for years organisms reproduced after their own kind. They also knew that certain desirous traits were passed down from parents to offspring, and people made use of that knowledge. They would save their best seed for new crops, and would use breeding to develop new breeds of plants and animals. Often, however, people thought of genes as if they were liquids, that blended, rather than discrete particles, that maintained their identity. B. Mendel: Laws of Segregation and Independent Assortment. Mendel and those who rediscovered him showed that genes were inherited as if they were "particles" that stayed intact, not "fluids" that blended. Gregor Mendel: Monk in Czech Republic Worked with true-breeding peas. Published his results, but no one paid any attention until others did the same, 35 yrs later. Those three were Carl Correns, Hugo DeVries, and Eric Von Tschermak. Well come back to Mendel later. C. Thomas Hunt Morgan et al: Genes are on chromosomes; genes near each other on the chromosome are linked. We now take this for granted, but it took some work to establish this as a fact. Morgan and his coworkers were the first to actually establish this fact. D. Oswald Avery, et al: DNA is the genetic material. They worked with bacteria to show that the transforming material was DNA. E. Watson, Crick, Franklin, Wilkins: Structure of DNA. Watson and Crick used other peoples data to figure out a way that DNA could exist in a form that could contain information, and be its own template for replication. F. Recent: Recombinant DNA allows the manipulation of genes. Since the 1950's, we've discovered a tremendous amount about how genes work, as well as discovering how to manipulate them. Specifically, Herbert Boyer/Stanley Cohen discovered how to manipulate genes in 1973. G. More recent: DNA sequencing, especially the ability to sequence entire genomes, has changed much of biology and genetics. Fred Sanger developed the basic method of sequencing DNA that we use today, and J. Craig Venter developed methods for large-scale sequencing.

Chapter 2: GENETICS NOTES Mitosis and Meiosis This chapter reviews cell structure, and then reviews mitosis and meiosis. I. Cell structure: Please review the Fig. 2.1 and 2.2; the prokaryote/eukaryote difference is especially important. II. Chromosomes- the highly coiled, visible forms of the genetic material. During most of the cell cycle, the chromosomes are substantially uncoiled, and not distinguishable as separate chromosomes. The coiled form only appears during mitosis. Species have a variety of numbers of chromosomes (Table 2.1). We use the term chromatin to refer to the chromosomal material. Chromatin consists of both DNA and protein (mostly a particular type called histones), and well discuss its structure later. A. Gross structure: Chromosomes can be examined by karyotyping- picture of all the chromosomes arranged by number. Typically, they have two chromatids when visible, because the chromosome has already replicated. Youll get a chance to produce metaphase chromosome preparations in cell biology.

parts: centromere: meta, submeta, acro, telocentric (Fig 2-3, 2-4) telomeres p and q arms, numbering: secondary constrictions- rDNA/nucleolus Diploid and haploid organisms, haploid cells, and homologous chromosomes: We are diploid4

we have two sets of chromosomes, one from Mom, one from Dad. This works because our chromosomes come in pairs; they are called homologous chromosomessimilar, but not identical. One of each pair came from mom, one from dad. We arise from a fusion of two haploid gametes-sex cells- that result in a new person, with a full set of chromosomes. Our Genes- the bits of DNA that code for the proteins (usually) that result in a trait, are found on the chromosomes. The genes at a particular location on a chromosome can be identical, but dont have to be. Different forms of the same gene can be on homologous chromosomes; they are called alleles- two different forms of the same gene. We often think of there being two alleles, but there can be many, or in some cases only one type. Any given person will have, at most two different alleles. The place where the gene is found on the chromosome is the locus B. MITOSIS: The cell cycle: M, G1,S, G2; the cell has already duplicated its DNA in S phase. We know about these, b/c 1) we can see mitosis under the microscope, and 2) we can radioactively label cells that are replicating their DNA, and autoradiograph them- they, and only they, have radioactive nuclei, which indicates S phase. Other, similar studies show that theres a gap before and after S phase, during which growth occurs.

Theres a WHOLE lot we could say about the cell cycle, but well save most of it for our study of cancer later in the course, and in cell biology. BACK TO MITOSIS: Prophase: Chromosomes coil, become visible, centrioles divide, migrate to opposite sides; cytoskeleton rearranges- the microtubules become spindle fibers, nuclear membrane disintegrates, nucleoli disappear (have to, b/c the chromosomes are coiling).
5

Prometaphase: nuclear membrane has disappeared, chromosomes migrate to the equatorial plane/metaphase plate. Prometaphase applies to the period when the chromosomes are moving. They are moving, of course, b/c they have attached to spindle fibers, which are pulling them around. We can talk about kinetochore spindle fibers, polar spindle fibers, and astral spindle fiber. Metaphase: chromosomes are lined up at the metaphase plate, centromeres are connected to spindle fibers @ both sides through the kinetochore structure. Anaphase- the spindle fibers pull the sister chromatids apart, and the two cells also move farther apart- all of this due to the action of the spindle fibers and associated proteins. Anaphase doesnt happen until ALL chromosomes are hooked up to spindle fibers. Once separated the chromatids are now daughter chromosomes. The separation is called disjunction. Telophase: Essentially a reversal of the previous steps- nuclear membrane forms, chromosomes uncoil, nucleoli form. Included in telophase is cytokinesis- forming two cells. It happens in a variety of ways, including the formation of a cell plate in plants, and a constriction in the middle in animal cells. Cytokinesis:
Bad picture! You cant see the chromosomes in interphase!

C. MEIOSIS: . The basic purpose is to produce sex cells, with half the chromosome number, and exacely one of each pair of homologous chromosomes. This is where segregation and independent assortment actually occur. Overall Flow: Chromosome # and DNA content: the chromosome # is halved, while the amount of DNA is of that of a cell prior to meiosis.
6

Stages:- prior to meiosis, the cell has undergone S phase, so the chromosomes have doubled, and are consist of two chromatids. This is key in understanding the fact that we produce FOUR cells in meiosis. PROPHASE I (2-11) Leptotene- The chromosomes are coiling, as in mitotic prophase. Zygotene- The paired chromosomes are called bivalents- = to the haploid number of chromosomes. They essentially seek regions of homology, which makes for some interesting pairing when there have been rearrangements in the chromosomes. Pachytene- Thick strands- the homologs are visible; recombination takes place, but isnt visible. The paired chromosomes consist of four chromatids, two sets of sister chromatids. They are called tetrads. Diplotene- the pair of sister chromatids begins to separate, yet held together at chiasma- places where the chromosomes have undergone recombination. Diakinesis- final stage of prophase I- the chromosomes pull farther apart, except where theyre joined at chiasmata, which move towards the telomeres- terminalization. Metaphase I- The tetrads line up along an equatorial plane. Anaphase I homologues separate from each other, producing dyads. This separation of chromosomes from one another is also called disjunction. Telophase I- This varies; some organisms re-form the nuclear membrane, others go right into prophase II. Meiosis II Prophase, metaphase, anaphase, telophase II: By the end of telophase I we have two haploid cells, but each chromosome still consists of two chromatids. Meiosis II essentially takes the two cells with chromosomes consisting of sister chromatids and produces FOUR cells with single chromosomes. Differences between sperm and eggs: Eggs and sperm are different from each other. Sperm are basically mobile chromosome packages- the male contributes only his half chromosome set. The mother, on the other hand produces the egg- the actual cell that becomes the person or organism. Typically, only one egg is produced- half the genetic material is discarded at each meiotic step in the form of polar bodies. The other difference is that there can be enormous time gaps between prophase I and ovum formation. In women, their eggs hang around in prophase I. Ovulation stimulates completion of Meiosis I, and what is fertilized is actually an egg that hasnt completed Meiosis; Meiosis II is
7

completed after fertilization.

From Stem cells

Segregation and Independent assortment!

NOTES for CHs 1& 2 stop here Chapter 10: DNA Structure and Analysis In this part, we are switching to MOLECULAR GENETICS. We will be discussing the details of the CENTRAL DOGMA OF MOLECULAR GENETICS: DNA makes DNA (replication)
8

DNA makes (carries the information to make) RNA (transcription); RNA makes (carries the information to make) PROTEIN (translation) which contributes to a particular TRAIT Fig. 10-1 How do we know questions (p. 206)- we cover most of these, except for the question about eukaryotes having DNA as their genetic material. That one may be extra credit. Convincing you that DNA is the genetic material Early- DNA=boring- just a scaffold for the more interesting proteins- a repeating A-T-C-G structure. Then, Chargaff- A=T, G=C, but the amounts of each type could vary quite a bit. I. DNA as the genetic material: Avery, and Hershey/Chase,: Avery showed that what Griffith found, transformation of rough Streptococcus ---->smooth, was caused by DNA. Fig 10-2,3 The smooth phenotype was due to the presence of a capsule- made Strep pneumoniae resistant to phagocytosis.

Smooth bacteria recovered- IIR cells had gained a capsule

Isolated DNA transforms; inactivated by

2. Hershey/Chase: by labeling the DNA w/ 32P, and Protein with 35S, showed that only the DNA entered the cell in a T2 infection. Fig. 10-4,5

II. Structure of DNA: Linear, double-stranded chains of deoxynucleotides: deoxynucleotides: PO4, deoxyribose, and nitrogenous base: Adenine, thymine, cytosine, guanine; A-T, G=C; A,G are purines-short name, long structure; T,C, uracil are pyrimidines. PO4 attached to the 5' C of deoxyribose; links to the 3'C of next molecule. found initially as triphosphates prior to incorporation. The chains have polarity because of the linkage- a 5' and 3' end to each molecule.
10

11

The two chains are complementary, and antiparallel.: 5' ATGACCTTAGG3' 3' TACTGGAATCC5' The helix is right-handed- your right hand when held upright, traces the curve; it has a major and minor groove, which become important in DNA-protein interactions. There are 10 bp per turn.

Features that make DNA suitable as genetic material: a. Strands are complementary: thus, each strand is the template, holds the information, for the other strand; the pattern for replication is built-in. b. The bases allow for a three-base code: there are 64 possible combinations of three bases,
12

more than enough to code for all the amino acids. c. The structure allows for both faithful duplication, and for mutations that will then be perpetuated. Structure of RNA: Ribose and uracil, not deoxyribose and thymine. usually single stranded can fold, to produce secondary structure Three main types, but there are others: rRNA, mRNA, tRNA III. Neat things you can do with DNA, and what it means: A. Denaturation and renaturation: DNA can be denatured- rendered SS- by heat or NaOH treatment. HOWEVER: upon heating to 68C, it will renature- find its complementary bases and reform DS DNA. B. hybridization: Because DNA can renature, you can prepare probes: labeled DNA that will hybridize to unlabeled target DNA, either in solution, or when the target is immobilized to paper. A probe will find its complementary DNA rapidly, even in the midst of a vast excess of nontarget DNA. One application: FISH (10-15). C. Determining its size Gel electrophoresis: small DNA fragments migrate faster than large; rate is an inverse log function. Fig 10-19

Pulsed field gel electrophoresis: variation of electrophoresis that can separate large fragments of DNA. Electron microscopy: Opening figure of Ch. 11
13

14

DNA Replication NOTE: Chapter 11 has a number of good how do we know questions (box, p. 232); we will not deal with these for the most part. They may show up as extra credit questions on the exam, however. I. Replication is: SEMICONSERVATIVE BIDIRECTIONAL SEMIDISCONTINUOUS A. Semiconservative: Fig. 11.3, 11.4 Proven by Messelsohn-Stahl experiment: Heavy (15N) DNA-----> HL, then LL, with a fixed amount of HL remaining. Separation is by CsCl density gradient centrifugaton. (Also Taylor, Woods, Hughes)

B. BIDIRECTIONAL: Figs 11-6; Low H thymidine pulse is followed by high H thymidine pulse; results after
3 3

autoradiography is a set of symmetrical dark bands. Bacterial spores- germinate, resulting in synchronous initiation of DNA replication pulse with low H thymidine pulse high H thymidine pulse autoradiography. The results show symmetrical lines of thymidine incorporation into the DNA: (See Q. 32 in your text)
3 3

C. Semidiscontinuous: Fig. 11.11 One strand is made continuously, one strand discontinuously II. Process of replication: AS WITH ALL MACROMOLECULAR SYNTHESIS: INITIATION, ELONGATION, TERMINATION. Cool video of the process- an animation: http://www.wehi.edu.au/education/wehi-tv/dna/replication.html The process of DNA replication is driven by 1) antiparallel nature of DNA 2) the nature of DNA polymerases: a) ONLY elongate from a 3'-OH, i.e., only replicate in a 5'-3'direction; DO NOT initiate, ONLY elongate. Bacterial DNA polymerases are VERY fast: 1000 bp/sec! + pppdG3'OH 5'---------------T3'OH 3'---------------ACGGATCGAGAG-----------------5' 5'---------------TG3'OH +pppdC3'OH 3'---------------ACGGATCGAGAG-----------------5'

5'---------------TGC3'OH + pppdC3'OH 3'---------------ACGGATCGAGAG-----------------5' etc.

A. INITIATION: BEGINS at a particular location, the originsignaled by the cell. Prokaryotes have a single origin, eukaryotes have many. Replication is initiated by an increase in cell mass, triggered by signals received from the cell. Initiation proteins open up the helix at the origin. Key protein: Dna A. Fig. 11-9. A region replicated by a single origin is a replicon. Bacteria usually have one, euk. have many hundreds of replicons.

Because the DNA pol III is unable to initiate, replication begins with an RNA PRIMER made by PRIMASE. DNA pol III can then elongate off the primer. 11-10, 11 B. ELONGATION: once synthesis has begun, it usually proceeds bidirectionally. Because synthesis is always 5'-3', synthesis tends to be CONTINUOUS on one strand of a replication fork, and DISCONTINUOUS on the other strand of the fork. Primase, with the help of the mobile promoter & helicase, the DNA BC complex, moves down the lagging strand, laying down primer for DNA pol to use. Lagging strand synthesis produces short fragments of 1-2K bases, called Okazaki fragments. (Fig 11-11) To finish the process, DNA Pol I then removes the RNA primers, replacing them with DNA. This STILL leaves nicks in the DNA, which are sealed by LIGASE. C. HOW WE KNOW THIS: Labeling experiments with replicating viruses; if you label replicating DNA with a short pulse of radioactivity, you will label short (Okazaki) fragments, and longer continuous strand fragments, that can be separated by an alkaline sucrose density gradient D. Other players: Helicase: again, the DnaBC complex helps primase get started, and also separates the strands to allow replication; DNA gyrase: Introduces negative supercoils, acting to allow the DNA to swivel, preventing overwinding of the helix. Theres also a single-stranded binding protein (SSBP) that, well, binds single stranded DNA- keeping it SS as needed.

E. Completing the job: the problem of ends. Fig. 11-16, 17: circles do not present a problem for termination; two circles are made. Linear DNA does present a problem, b/c of the gap left by the lack of primer at the 5' end of the new DNA. In Eukaryotes, the problem is solved by TELOMERASE.

Telomerase gets involved in cancer- apparently normal cells that cant divide have low or no telomerase. A cancerous cell has high levels. Other forms of replication: rolling circle; Some viruses replicate from a nick in the DNA; the new DNA unwinds one parental strand, that then replicates by lagging strand synthesis. This produces a CONCATEMER of DNA that is then processed.

Proofreading: fidelity of replication is enhanced by proofreading. If the wrong base is put in, the mismatch is removed before replication continues. This enhances the accuracy of replication. + pppdG3'OH 5'--------------AC3'OH 3'--------------TACGGATCGAGAG-----------------5' Oops! MISMATCH!!!! 3-5 exonuclease activity removes mismatch

5'-------------AC3'OH 3'-------------TACGGATCGAGAG-----------------5' + pppdT3'OH 5'------------- A3'OH + pdC3OH 3'--------------TAGGATCGAGAG-----------------5' Replication continues

Recombination: What, Why and how What: breaking and rejoining two pieces of DNA AAAAAAAAAAAAAAAAAAAAAAAA -> BBBBBBBBBBBBBBBBBBBBBBBBBB AAAAAAAAAABBBBBBBBBBBBBBB BBBBBBBBBBBAAAAAAAAAAAAAA Or sometimes an insertion: AAAAAAAAAAAAAAAAAAAAAAAA + BBBBBB -> AAAAAAAAAA BBBBBB AAAAAAAAAAAAAA Why: 1) promotes genetic exchange (so- why should an organism want this??) 2) Repair: Rec- mutants in bacteria are UV sensitive, die easily, dont mutagenize well- the major reason for a cell. Three types: 1. Site specific: 2 regions of short homology:
~ 20 bp of homology

=======-----==================== =======--------------------------------------------------============= 2. Illegitimate: Transposons can insert anywhere;

3. Homologous recombination: the main type. HOW of homologous: fig 11-18 Enzymes of recombination: recA: Causes synapsis of DNA, and displacement loop formation. recBCD: helicase, exonuclease, endonuclease that cuts at specific sites. SS DNA is highly recombinogenic!

Gene Conversion and Mismatch Repair Def: One allele is converted to another. Thought to occur during heteroduplex formation in recombination, followed by mismatch repair. Fig. 11-19. ============== A============== -> at heteroduplex: ============== a==============
A a

============== A============== ============== A==============

a a

Repair converts one allele to another: ============== A============== ============== A==============

A a

Chapter 13- the Genetic Code and Transcription.

Review: the central dogma of molecular biology/genetics: DNA---->RNA----->Protein. We've seen how DNA is replicated. This chapter discusses the code, and transcription. For some reason, it discusses the code first, then transcription, which I dont understand (the order of presentation, that is!). Well cover these in a more typical fashion. Well leave Chapter 12 for later.

Prokaryotic & Eukaryotic Transcription: DNA---->RNA I. What: making an RNA copy of one strand of DNA: 3'ATAGCCTAGCCGTTAG5' (template, anticoding, antisense strand) 5'TATCGGATCGGCAATC3' (partner, coding, sense strand) |transcription | 5'UAUCGGAUCGGCAAUC3' II. Importance: A. Link to Translation; B. Gene regulation: genes are turned on and off mainly by transcription.

III. Main player(s): RNA polymerases: enzymes that cause transcription. components: (prokaryote- eukaryotes MUCH more complicated) core: ,, --------,,; holoenzyme Core: non-specific binding to DNA and transcription of nicked DNA. Core + (holoenzyme): specific transcription from promoters Process: fig 13.8: Initiation, Elongation, termination Initiation: Loose binding to DNA (not at promoter) Binding to promoter (closed promoter); helix is unwound tight binding to promoter (open promoter- the DNA is opened!) Note that open is tighter than closed! First base added, complementary to the anticoding strand. Many promoters have been sequenced: -35 -10 -1|1 ======TTGACa=========TAtAaT====AorG======= upstream (purine) downstream

Promoter strength: strong and weak promoters, up and down mutations.

There is control over amount of a protein by the strength of the promoter. This isnt the only control, however! Elongation: more bases added to the chain, using the anticoding strand as the template. Goes @ 50 nucleotides/sec. Termination: Termination signals- poly U + hairpin loop: 5'TACGAATTCGTATTTTTTTTTTT3' 3'ATGCTTAAGCATAAAAAAAAA5' transcript forms a hairpin: ---------- -------5'UACGAAUUCGUAUUUUUUUUUUU3' 3'AUGCUU|

The hairpin seems to dislodge the RNA pol; some terminators aided by protein rho. Prokaryotic transcripts are polycistronic: they can code for many proteins. This is b/c the pro. Ribosome can start in the middle of a mRNA strand. Euk. Ribosomes can only start at the 5 end of mRNA. Eukaryotic mRNA transcripts are monocistronic: code for only one protein; however, there are some interesting modifications that they can also do, that well talk about later. Replication vs transcription: replication
entire replicon replicated

Transcription
only certain genes; the ones transcribed vary with the type of cell, and environmental conditions only one strand; the transcribed strand varies

both strands

Transcription in Eukaryotes In the nucleus; three separate RNA polymerases, for the three major types of RNA- Table 13.6 I- rRNA; II- mRNA; III- 5S rRNA, tRNA A LOT more complicated at the start! Upstream regulatory sequences- TATA boxes, CAAT boxes, enhancers- cis acting elements- need to be on the same piece of DNA to have an effect. transcription factors: LOTS of stuff needs to be at the

promoter, to get things started! These are needed for the proper binding of the RNA polymerase to the promoter. More cool videos at the DNA replication site on transcription. http://www.wehi.edu.au/education/wehi-tv/dna/replication.html Processing: Caps and tails and splicing and termination.
Introns are a LOT longer!

70-250 As added

Initial product is a lot longer than the final producthnRNA/hnRNPs. This is then processed to produce the mRNA product that is transported to the cytoplasm. As it is being produced, the RNA is capped with a 7-methyl guanosine cap- protects from degradation! terminates strangely- the growing transcript is cut as its being made! the RNA pol is destabilized, and eventually falls off. the 3 end is then polyadenylated- a poly A tail- 70- 250 AAAAAs! Its also processed by splicing- see below.

Splicing: MAJOR difference between pro and euk. Process: snRNP=s (snurps) recognize the borders of an intron: Exon / intron /Exon 5'-------cAG/GUaAGU------YnNAG/G------------------3' a g Y=9 pyrimidines (C/U); lariats are formed! The process: fig 13-13: SNRNPs bind at the 5 and branch point, catalyze the splicing, resulting in 2 exons ligated and a lariatshaped intron.

This is another opportunity for error- thalassemias, muscular dystrophy are splicing errors. Proof: hybridization of DNA w/mRNA, Fig 13-10; cloning/sequencing of genomic and cDNA. Termination: Poly A tails; no real termination; RNA cut, then tail added. Polymerase is destabilized and eventually falls off. Heres a web site thats got a good illustration of splicing: http://www.web-books.com/MoBio/Free/Ch5A4.htm Caps: methyl guanosine, added 5'-5', is at the 5'end. Fig 13-9 Cap provides protection of mRNA, proper initiation of translation. Types of gene control in eukaryotes: Transcriptional control- the usual; cells respond to signals=hormones, growth factors, etc. affecting transcription factors. much more positive control. Posttranscriptional control: variable half-life;

OK, back to the start of CH 13: The overall scheme: 13-1: DNA makes RNA makes protein. The A,U,C,G code turns into an amino acid code for the protein: 4 letter code 20 AA code. As you see, the RNA is read in triplet.

Key points about the code: read as triplet codons. unambiguous: each triplet stands for only one AA however, its also degenerate: more than one codon can code for any particular AA It has start and stop signals, but no internal punctuation (commaless). (usually) non-overlapping- in theory, you could get three proteins (six, if you read it in both directions!) out of an RNA sequence, but you usually dont- some minor exceptions in bacterial viruses. code is universal, with a few exceptions. The code: fig 13-7 The code is the informational link between the RNA sequence and the protein sequence. There are 4 bases, and 20 AA's; therefore, a single base cannot code for only one AA; even two can have a maximum of 16 (4x4) 3 bases can have a maximum of 64, however. Because of this excess, the code is degenerate: a triplet can only code for one AA (unambiguous), but several codons code for the same AA. These codons pair with the anticodons on the tRNA. Does this mean that there are 61 tRNA's? No-

some tRNA's will be used for a codon that it pairs with in only 2 of 3 spaces. Look at the code: Note that, for all AA's the variation is in the last base- This has led to the theory that the first two bases are the most important, and that the last base is less important. In fact, the third base on the codon may be able to vary, and pair with the same tRNA. This is because of wobble in the base-pairing- the pairing can vary, from normal, since only 3 base pairs are involved- one variation is to have a G on the anticodon pair with a U, as well as a C; also, Inosine, similar to G, can pair with A, U, or C. So AAC and AAU (asn) could both pair with an anticodon 3'UUG5', and 3'CGI5' could pair with 3 of the ala codons: GCC, GCU, GCA; you would only need 3'CGC5' (to pair with GCG) and 3'CGI5' (to pair with the rest) as tRNAs for alanine.

Because the bases aren't held in place as rigidly as in a full helix, there is room for this sort of variation, or wobble. If inosine were used, it could pair with A, C, or U. E.G., 3'-UAI-5' would pair with all of the isoleucine codons: AUU, AUC, and AUA.

Starting and stopping: AS well see, starting is at AUG, or methionine. Bacteria have a modified met- N-formyl met- that they use; we use a regular met to start things off. Stopping: this uses stop codons, that do not code for any AA. Now, on to Ch. 14: Translation and proteins. Were going to cover some of the basics of translation, and then some of the results, in terms of proteins and their modifications. The key players: the mRNA, the ribosome, and the tRNA. Weve just looked at the mRNA, so lets look at the other two:

Ribosome: The death star of enzymes. 21/2 million m.w. of a prokaryote! 14-1: Bacterial: 50S (23S rRNA 5S rRNA + 31 proteins) + 30S (16SrRNA + 21 proteins)= 70S ribosome. eukaryotic: 60S (28S rRNA + 5& 5.8SrRNA + 49 proteins) + 40S (18S rRNA + 33 proteins)= 80S ribosome. rRNAs: are mostly on one transcript thats processed, not spliced. They are found in multiple copies, up to 500 in a frog, and more in frog eggs- you need multiple copies to make all the copies needed in a typical cell (10K in a bacterial cell, over 10 million in one of your liver cells!). Like the cool picture at the start of CH 13- we make massive amounts of rRNA! Most of the segments are on a single transcript, which are then processed into smaller pieces. Assembly: they are assembled in the nucleolus. The rRNAs are made there, the proteins imported, and they are assembled.

Transfer RNA: tRNA is shaped like a cloverleaf when hydrogen bonded, and like an r or L (or a foot!) when fully folded. (14-3,4,5) They have about 70 bases, many of which are modified after being made- the modifications are necessary to its function. Important parts: 1) the anticodon: this region is the part that interfaces with the mRNA; we've discussed its wobble possibilities already. 2) the 3' end and acceptor stem: the AA is attached by the COOH group to the 3'end which is always 5'-CCA-3'. There's a special enzyme, aminoacyl-tRNA synthetase, that does this(13-5). It costs one ATP (used to charge the COOH, making a hi-energy bond), and results in a charged tRNA. There is a single aminoacyl-tRNA synthetase for each amino acid. The specificity of each is in its ability to recognize certain sequences in the acceptor stem. These enzymes are important: a mutation in one of these would cause a global change in the genetic code! It would be like a global find and replace in a document.

COOH of amino acid joined to 3OH of tRNA- ester linkage

Translation: Figs 14-6,7. Once again, you have initiation, elongation, and termination: Initiation: In prokaryotes, there is a sequence at the 5' end that is untranslated, and allows binding of the ribosome- ribosome binding site.

Eukaryotes, there is a "cap"- a reversed, methylated guanosine- that indicates that an mRNA is supposed to be translated, and also a small region in front of the 1st AUG. There is no punctuation in the code, so the start and end are critical; initiation always begins with an AUG-methionine-codon. In prokaryotes, the 1st one is an N-formyl-Methionyl-tRNA. An initiation complex forms, with the small subunit, the tRNA-fMet, and 3 initiation factors, all on the mRNA. The small subunit in Prokaryotes recognizes the ribosome binding site- 3-6 bases complementary to the 3' end of the 16S portion of the rRNA of the small subunit (see above). Elongation: the ribosome has a A,P, and E sites; the tRNA-met is in the P (peptidyl) site. the next tRNA-aa then comes in (aided by an elongation factor) to the A (amino) site.. The ribosome then catalyzes the transfer of the methionine from the tRNA to the amino group of the next aa; the ester bond is broken, and a new peptide bond formed. The uncharged tRNA stops briefly at the E (exit) site, before leaving. This is the heart of what the ribosome does. The ribosome then moves- the tRNA holding the dipeptide is shifted to the P site, and a new aa-tRNA can move in, allowing the process to continue. The stop codons cause termination, using release factors. The Klug/Cummings web site has a good animation www.prenhall.com/klug Another good animation, on a bunch of stuff:
http://vcell.ndsu.nodak.edu/animations/home.htm

Protein function and heredity: DNA RNA Protein trait (or contribute to the trait). Mutations in the DNA can result in changes in the protein, often with bad consequences. Proteins are usually enzymes, which do things. When they undergo mutation, then they can cease to function, and disease can result. We have thousands of different enzymes doing things. In some cases, a loss of function would kill us; in other cases, it causes disease. Some reminders of things youve had in the past: Amino acids, peptide bonds, amino and carboxy termini, primary, secondary, tertiary, quaternary structure of a protein. While we say that the primary structure drives all the other features, two proteins can look a LOT alike, and still be quite different- below are two proteins that only share 15-20% homology, and they are impressively similar.

Your book gives several examples; lots of history that makes a good read, but we dont have time for. Fig. 14-10, and 14: A mutation in a gene, affects the amino acid sequence of a protein, reducing or eliminating its function, resulting in a mutant trait. Alkaptonuria, Albinism, Phenylketonuria, and sickle cell anemia are all the result of mutation.

MUTATIONS: Translation allows for many of the classes of mutations to be produced. all are "point" mutations, affecting one or only a few bases. These are in the category of base substitutions. Fig. 15-4:

Substitutions: Synonymous: changing a codon for 1 AA for a codon for the same AA. E.g.- UUU-UUC- both code for phe. Non-synonymous: MISSENSE: A single base change changes one AA to another in a protein. e.g.: the sickle cell anemia story: one base change one AA change- glutamine to valine- big change! purine-purine AT GC; These can vary; some do nothing, some small changes, others can inactivate an enzyme. NONSENSE: Changing a sense to a nonsense codon results in premature termination Frameshift: adding or subtracting one or two bases alters the reading frame for the rest of the protein. These are almost always serious. In practice, they result in stop codons showing up and stopping translation.

MUTATIONS UNMUTATED-WILD-TYPE 5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA MET-ARG-ASP-TYR-GLU-GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP synonymous substitution (actually very common) G 5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCC-TGC-TTA-AAT-CCT-AAC-TGA MET-ARG-ASP-TYR-GLU-GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP missense- with change- non-synonymous substitution C 5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-GCC-TGC-TTA-AAT-CCT-AAC-TGA MET-ARG-HIS- TYR-GLU-GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP Frameshift SER-ARG LEU ARG ARG ILE SER LEU T | | | | | | | | | 5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA MET-ARG-ASP-TYR-GLU- GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP Nonsense STOP T 5'TTTTATAAATG-CGA-GAC-TAC-GAA-GAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA MET-ARG-ASP-TYR-GLU- GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP

(Added material- not testable at this point) Nonsense suppressed by a suppressor tRNA: ACCtrp | ACUtrp 5'TTTTATAAATG-TGA-GAC-TAC-GAA-UAA-TTT-CCT-TGC-TTA-AAT-CCT-AAC-TGA MET-TRP-ASP-TYR-GLU- GLU-PHE-PRO-CYS- LEU ASN- PRO-ASN-STP

REVERSION: a second mutation can correct the effects of the first. This is especially true for frameshifts, in which adding or removing 1 or two bases can restore the original reading frame, with few or no changes to the original sequence. Suppressor mutation: if a sense tRNA is mutated to code for a nonsense codon, the mutated tRNA can fill in for the nonsense codon, allowing synthesis to continue. The resulting protein is often changed by a single AA, which may or may not make a difference. Suppressor mutations will often correct several nonsense mutations, since they can fill in any stop codon with an AA. They aren't lethal because often real stop codons occur in pairs.

END OF NOTES FOR EXAM I.

Mutations: Chapter 15. Mutation: Chromosomal changes: Ch. 4; but also gene mutations (this chapter) I. Types: Spontaneous : natural (even if naturally induced?) induced- artificial production, due to a mutagen. Somatic vs germ line; somatics produce cancer! Dominant autosomal: dominant mutation in a non-sex chromosome; expresses when heterozygous; overproduction or gain of function. Recessive: expressed when homozygous- usually a loss of function. X-linked recessive- recessive in females, dominant in males cause of only one X chr. Other categories: Morphological Nutritional: prototroph vs auxotroph Lethal Conditional: ts and nonsense mutations that are suppressible

These types are not necessarily mutually exclusive- eg conditional nutritional mutations. II. Finding mutants (NOTE: mutant is the organism with a mutation in its gene(s)): Geneticists LOVE to make mutants! The trick is finding them! This is a very tricky business! Some examples from the bacterial world: Bacteria: gain of function mutants can be found by selection: antibiotic resistance auxotrophprototroph ability to use a new food source: xylitol utilizers from ribitol utilizing strains. Other traits are found by screening: prototroph auxotroph With plants/animals being diploid makes things harder, since recessive mutations are masked. But, geneticists have their tricks! III. How they are produced: I. Spontaneous-infrequent. one natural cause:

A. tautomerization-fig 15-5 B. Deamination: cytosine-->uracil; adenine--->hypoxanthine, acts like a G. D. Environmental effects: sunlight, cosmic rays (?) E. Transposons- jumping genes II. Measuring mutation rates: frequency/generation- haploid organisms; Diploid: Frequency per gamete. W/ Dominant mutations, = frequency in the population/2, or frequency in the # live births/2 III. Induced mutations: A. chemicals: 1. Base analogs: increase in tautomeric shifts, 5-Br uracil 2. Alkylating agents: change H-bonding, labile bonds with the sugar; induce SOS response, which is mutagenic 3. Intercalating agents: acridine dyes- increased rate of frameshift mutations B. Radiation: 1. UV light- Thymine dimers- fig11.20; again, repair can be

mutagenic 2. gamma, X rays- DS and single-stranded breaks; often deletions. IV. Detecting mutagens: Ames test, Fig 14.12. his- ----> his+ reversions by Salmonella strains. Strains are specific for point or frameshift mutagens, and are designed to be sensitive to reversion by mutagens. DNA REPAIR Normally, DNA is the ONLY molecule repaired! All mechanisms require enzymes! I. Photoreactivation- fixed T-T dimers: II. Excision repair- (14-14, 15) Repairing the mistake;

Base excision repair, and nucleotide excision repair. Mismatch---glycosylase--AP site-----5'AP endonuclease----> ----fill in/ligate Nucleotide: cut out the damaged/mismatched bases with

endonucleases and exonucleases; fill in and ligate. Mismatch repair: mistake in replication, leaving a mismatch; parental strand is methylated, thus telling the glycosylase which base to remove.

Recombination or Post replication repair: Recombination bypasses damage w/o actual repair. Error-Prone Repair- SOS system induces an error-prone DNA repair that bypasses damage, but produces mistakes. cells w/o this system often can=t be mutagenized! they just die! Errors are BAD for you: cancer, etc. Blooms disease: ligase defect; Xeroderma pigmentosum: excision repair SOME EXTRA TERMS: site-directed mutagenesis: changing a one or a few specific bases knockout organism: transgenic organism: Mobile Genetic Elements: The short course. Definition: DNA that can move to a new location, w/o regard to sequence homology (illegitimate recombination). Movement is usually accompanied by replication. Movement is usually a rare event Included: Insertion sequences (IS's), Transposons (Tn's)

Overall- fig 14.21 the element "jumps" These jumps can be CONSERVATIVE, or REPLICATIVE (draw on board) They are found in bacteria and eukaryotes. Well studied in corn (Ac and DS elements), Drosophila (copia and P elements), and in people (Alu sequences- 500,000 copies in our DNA!) Why we need to know about them: 1. They are mutagenic; this has been of GREAT use in the study of genes in bacteria. Book has example of hemophilia caused by one of these! 2. They are the main reason bacteria are antibiotic resistantTNs carry antibiotic resistance genes, which are why they are great for making mutants, but also why they spread antibiotic resistance in people and animals.

III. Chromosomal changes A. Chromosomal Structure: duplications: Deletions Inversions

Translocations All of these events cause strange things to happen when the chromosomes pair in meiosis. Translocations, in particular, can result in duplications and deletions during meiosis. B. Chromosomal number euploid: changes in chromosome sets aneuploid: changes in chromosome numbers. Polyploidy: auto and allopolyploids Aneuploidy: trisomies and monosomies: Down's, Turner's, Klinefelter's syndromes. Down: Trisomy 21 Turners: monosomy X; XO Klinefelters: XXY XYY: Finding these: Barr body

Fundamentals of Mendelian Genetics A. Law of segregation: Two copies of each gene, only one of which is found in a gamete. Genes segregate during gamete formation. Mendel discovered these by doing monohybrid crosses. Example, p. 22. Genes are found in pairs. Different types of the same gene are alleles. the pairs segregate during meiosis, to produce gametes that have only one of the two genes. In the cross shown, the F1 generation is heterozygous. When crossed with itself, it produces 3/4 round, 1/4 wrinkled. Of the round, 2/3 are heterozygous, 1/3 homo. This is shown by a backcross or testcross with a recessive parent. Important terms: allele heterozygous homozygous

genotype phenotype How do you tell the genotype of an individual? Homozygous recessives are obvious; To determine if an individual is homo- or heterozygous for a dominant trait, do a test cross.

Probability: Product rule and sum rule: Product: Pr (RR) = Pr (R)X Pr (R)= 0.5X 0.5= 0.25 Both/and SUM: Pr(Rr or rR)= Pr(Rr) + Pr(rR)= .25 +.25; either Rr or rR

B. Independent Assortment: Genes on different chromosomes sort independently. Shown by dihybrid crosses. Example, p. 24. Each trait is inherited, in the F2 generation, in a 1:2:1 pattern. Analyze: each is a 3:1. Pr (R-)= 3/4, Pr.(Y-)= 3/4; Pr(R-Y-)= 9/16.

Pr. (R-)= 3/4, Pr. yy= 1/4, Pr (R-,yy)= 3/16 Pr (rr)= 1/4, Pr (Y-)= 3/4, Pr (rrY-) = 3/16 Pr (rr)= 1/4, Pr (yy)= 1/4, Pr (rry-) = 1/16 C. Crosses with three or more traits: use the forked-line approach. Ex. fig 2.12; ex., problem 12, p 43

C. Crosses with three or more traits: use the forked-line approach. Ex. fig 2.12; ex., problem 12, p 43

D. Goodness of fit: Use the Chi-square analysis to determine if the results can be expected on the basis of chance, if the hypothesis is correct.

What does the Chi2 value mean? It means that the probability of obtaining a value that large (or larger?) by chance.

E. Inheritance in humans: If we assume that inheritance in humans also follows Mendelian patterns, then we can determine the genotypes of parents, children, and the probable genotypes of future children. Recessive traits: Show pedigree analysis. Trait appears suddenly, in unaffected parents. 25% chance of inheritance with heterozygous parents.

Dominant traits: Trait appears in parents. 50% chance of inheritance with an affected parent.

Binomial formula helps determine the probability of having affected offspring, once the parental genotypes is known. Pr (x type one events out of N total events)= Cpxq(N-x). E.g, the probability of having two boys out of 6 kids. Pr (boy) = 0.5, Pr (girl)= 0.5. 0.520.54 gives the probabiltiy of having one particular pattern of two boys and 4 girls, say, bbgggg. C tells how many different ways you can get 2 b and 4 G. C= N!/x!(N-x)!

EXTENSIONS AND APPLICATIONS OF MENDELIAN GENETICS This is kind of a boring chapter, but hang in there- its needed to explain the wealth of exceptions to the typical Mendelian story. First- dominant and recessive- the recessive can be thought of as an absence of a trait; the protein is missing or nonfunctional. e.g.- albinism- the color isnt there; If we think of genes making a product, then some of the variations make sense. INCOMPLETE DOMINANCE: Here the amount of a product influences the phenotype, and a heterozygote will have half the product of a homozygote: twice the gene dosage. Fig 3.1; R1R1= RED R1R2=PINK; R2R2=white. Again, R2 is not functioning, but the amount of red is influenced by gene dosage. Effect upon inheritance: 1:2:1 ratio CODOMINANCE: sometimes two proteins can both be expressed, alleles of the same gene. BLOOD: RBCs can have both A and B alleles, as well as an O allele. So people can be AB as well as A,B, and O. Effect upon inheritance: with codominant alleles, at least three genotypes: A,B, AB. LETHALS: A genetic defect that causes 100% mortality. Usually, the mortality prevents a live birth or the organism dies shortly after birth; (Obviously, the definition can affect how we view life(which is 100% fatal), and diseases such as Down syndrome or Huntingtons, which reduce life expectancy but dont kill you right away. Effect upon inheritance: 2:1 ratio, with The yello mouse story: fig3.2; manx cats, fig 3.3. CONDITIONAL LETHAL/MUTATION: sometimes a gene is inactive at a higher temperature; e.g.: TS mutations in genes; extremely important in studying essential genes; Siamese cats: TS gene for coat color expression- only in cooler areas. Cat gets darker in winter, as more extremities are cooled. PLEIOTROPY: Multiple effects of a single mutation EG: PKU; recombination defects in bacteria make it sensitive to radiation as well. PENETRANCE AND EXPRESSIVITY: PENETRANCE: Sometime, a person may have the gene, but not the trait; PENETRANCE= # showing trait/#with phenotype. e.g.: retinoblastoma- tumors of the eye; 90% penetrant; needs a second mutation, which happens most of the time, but occasionally doesnt. If a disease takes a while to develop, and someone dies young, but still reproduces, the disease may appear to skip a generation. generation.

If penetrance measures whether the gene is expressed at all, EXPRESSIVITY= LEVEL OF EXPRESSION E.G: coat color in mice; age at Huntingtons onset. Why? other genes; environmental modifiers- (a genetic predisposition to heart attacks can be modified by exercise, or worsened by a lack of it or diet). MULTIPLE ALLELES theres no reason why you cant have numerous alleles of a locus. Important examples in the HLA blood typing, with many loci having 20 or more alleles. Blood: ABO: 6 different genotypes, three different heterozygotes. total genotypes = n(n+1)/2 total heterozygotes= n(n-1)/2 Blood types are due to the presence of sugar molecules on certain RBC proteins. If you have the protein, you dont make Abs against it; you tend to make abs against those you dont have. O- universal donor- doesnt react to anyone, no surface sugars AB-universal recipient- no antibodies, since they have both sugars. HLA A= 59; HLA B= 111; thus, # A genotypes = 1711; # B genotypes=6105; total combinations=10,455,655! This is why organ transplants are often hard to match. (says nothing about frequency, however) SEX LINKED GENES: These are gene on the X chromosome; in us and most mammals, males are XY, females XX. Males are thus short one x chromosome, so recessive diseases show up much more frequently in males. ex: hemophilia, color blindness effect on inheritance: Pedigree, fig. 3.15: The trait tends to skip a generation, since its passed on by the mother. A mother carrier will produce affected sons, and carrier daughters. SEX INFLUENCED: male pattern baldness: influenced by testoterone. trait is dominant in males, recessive in females; even when homozygous, tends to be less expressed in females. MULTIPLE GENES AND EPISTASIS: Different genes can often interact; thus, the final phenotype is the result of the interactions of multiple genes=EPISTASIS. Some types: complementary gene action: Fig 3.19: two whites produce a purple.9:7 ratio of purple:white in F2

DUPLICATE GENE ACTION: 2 genes; actually, if they are incompletely dominant, you get the sort of thing seen in fig3.29. DOMINANCE OF ONE GENE OVER ANOTHER: with coat color in mice, three genes interact. Two produce a total of three types of color, if the C- is present. if the mouse is cc, theres NO color produced AT ALL. Table 3.5, p.58 GENOTYPE-PHENOTYPE RELATIONSHIPS What else affect our phenotype besides our genotype? our ENVIRONMENT, of course! These interact extensively; its the basis of the nature vs nurture debate. Newsweek just before ClintonMany traits, such a crop yield, intelligence, height, etc. are QUANTITATIVE TRAITS: traits that can be measured; vary continuously; opposite of qualitative traits, that come in major categories, e.g., round and wrinkled. Shows the influence of multiple genes, as well as environmental influences-polygenic. SEPARATING NATURE FROM NURTURE: With people, this is a hard question to answer; with model systems, its possible: simply take genetically identical individuals, and put them in different environments. The way phenotype varies with environment is the NORM OF THE REACTION. Fig 3.27; Prone to heart attack/ effects of exercise thought experiment. OR- effects of altitude on various potentillas- when ones from different altitudes are raised at the SAME altitude, this becomes a COMMON GARDEN EXPERIMENT. MEASURING THE INFLUENCE OF GENOTYPIC VARIATION ON THE TOTAL PHENOTYPIC VARIATION IN A POPULATION: HERITABILITY. VARIANCE: IN A POPULATION, youll have variation: measured by variance: Find the mean. subtract the difference between the mean and the value of each sample. square it ADD THEM UP divide it by the # of samples -1. STANDARD DEVIATION= square root of the variance. if you have a whole population, you use n, not n-1. A trait varies by a NORMAL distribution (bell curve), if 95% of the population is within 2 standard deviations of the mean.

For a given phenotype, the phenotype is the result of the genotype, and the environment, and the interactions of the environment with the genotype. The genotype will be influenced when there arent dominant traits that influence h2= VA/Vp. Estimates: using mono/dizygotic twins. h2=2(rM-rD); doubled because dizygotc twin share half their genes anyway. selective differential h2= R/S R=RESPONSE to differential breeding S=selection differential; how big is the difference between the mean and the group selected for breeding. PRACTICAL GENETICS: COUNSELING empirical recurrance risk: The risk from disease with a gentic component, but where there is not a single-gene mode of inheritance. Risk is calculated from data gathered from a large # of cases. paternity exclusion: HLA and DNA typing.: fig 3.38. for a man to be someones father, it must have been possible for him to contribute both HLA alleles to the child.

Genotype-Phenotype relationships 1. Phenotype influenced by the environment as well as genes- nature and nurture. 2. Many traits are QUANTITATIVE Polygenic influenced by environment 3. Separating nature from nurture: Norm of the reaction: Similar genotypes in different environments Common garden experiment: Fig 3.27 4. Heritability: a.: variance: For a given phenotype, the phenotype is the result of the genotype, the environment, and the interactions of genotype with environment. The genotype will be influenced when there arent dominant traits that influence h2= VA/Vp. Estimates: using mono/dizygotic twins. h2=2(rM-rD); doubled because dizygotc twin share half their genes anyway. selective differential h2= R/S

R=RESPONSE to differential breeding S=selection differential; how big is the difference between the mean and the group selected for breeding. PRACTICAL GENETICS: COUNSELING empirical recurrance risk: The risk from disease with a gentic component, but where there is not a single-gene mode of inheritance. Risk is calculated from data gathered from a large # of cases. paternity exclusion: HLA and DNA typing.: fig 3.38. for a man to be someones father, it must have been possible for him to contribute both HLA alleles to the child.

Chapter 5: Genetic Linkage We now know how traits are transmitted from one generation to another; and we know something about chromosomes; It also seems that there ought to be THOUSANDS of genes; so you would expect that each chromosome would contain many genes. If this is so, you would expect some genes to be inherited together- NOT sorting independently. Lets look at a situation in which two genes sort independently: an AaBb dihybrid crossed with an aabb testcross. Youd expect = #s of the four types of offspring, based on the four types of gametes produced by the AaBb parent: AB, Ab, aB, and ab gametes, and AaBb, Aabb, aaBb, and aabb offspring. HOWEVER: if the A and B genetic loci (i.e., where the genes are located) are near each other on the same chromosome, AND IF THERE WAS NO RECOMBINATION, you would expect the AaBb individual to produce only AB gametes or ab gametes; the other possibilities wouldnt happen. So, youd expect to get AaBb and aabb individuals only. HOWEVER: we know that recombination does take place, during pachytene in prophase I. Thus, youd expect some Ab and aB gametes, but far fewer that AB and ab gametes. This is illustrated by fig. 5.3, with purple eyes and vestigial wings. The eye and wings are linked. The actual results are shown on Table 5.2. SOME TERMS: If two recessive alleles are both on the same chromosome, and the two dominant alleles are also on the other chromosome, the genes are in COUPLING. If the chromosome has one dominant and one recessive allele, the alleles are in REPULSION. If two genes are close to each other on the chromosome, youd expect to have few recombinant/non-parental offspring. The further two genes are from each other, the more recombinant offspring you would expect. In Summary: 1. Chromosomes have thousands This is what Bateson and Punnet found early on with 2 traits in sweet peas: flower color and pollen shape. They found that the traits were LINKED: PPLLX ppll: F1: PpLl: Purple, long F2: NOT 9:3:3:1. P-L-: 296

P-ll: 19 ppL-: 27 ppll: 85. X2 was astronomical- >200. The explanation was that the traits are LINKED- close to each other on the chromosome. The best way to examine is with testcrosses with a recessive parent. Fig 5-3. Some terms: parental chromosomal types (non-recombinant) non-parental chromosomal types (recombinant) Note that you get different results, depending on the nature of the parental types: Tables 5.2, and 5.3. Coupling and repulsion: when the dominant are on one chromosome and recessive on the othercoupled. vice versa= repulsion. Recombination frequency: # recombinants/total offspring. map unit: 1% recombination THE DREADED THREE POINT CROSS: When two genes are close to each other, its hard to place a third gene, relative to the first two, by recombination frequency. Here we rely on the THREE POINT CROSS: Fig 5.5, 5.6: The least frequent recombinant will be the result of a double crossover!! Work Problems. INTERFERENCE: When genes are close together, the frequency of double recombinants may be less than expected. INTERFERENCE: I= 1- observed frequ. double recombinants expected frequ. double recomb. Note that if the observed is as expected, I=0; as it gets less, I approaches 1. You can also get hot spots, regions of LOTS of recombination; so I is <0!Work problems: LINKAGE IN HUMANS: 1) Occasional result of many pedigrees of families w/lots of children- fig 5.9

2) Somatic cell hybridization: put mouse & human cells together, and select for a human gene; often done by nutritional requirements. The common chromosome retained is the one on which the gene is located (fig. 5.12) Today, because of cloning, you can often identify a gene, and using hybridization to chromosomes, locate the gene on a particular chromosome: cover, p 105.

TETRAD ANALYSIS: Neurospora This fungus mates, producing spores in a sac, or ascus; the spores reflect the order of meiosis, and actually show the results of crossover.

Rules of crossovers: If you have 2 genes, a crossover between the genes shows the order; the gene nearest the centromere has parental allele from the original chromatid, and the recombinant allele for the second gene.

Chapter 2: Fundamentals of Mendelian Genetics A. Law of segregation: Alleles segregate during gamete formation. p. 22: monohybrid cross:

Important terms: allele heterozygous homozygous

genotype phenotype How do you tell the genotype of an individual? Homozygous recessives are obvious; To determine if an individual is homo- or heterozygous for a dominant trait, do a test cross. Probability: Product rule and sum rule: Pr (RR) = Pr (R)X Pr (R)= 0.5X 0.5= 0.25 both/and Pr (Rr or rR)= [Pr(Rr)+ Pr(rR)]= .25 + .25 = .5 B. Independent Assortment: Genes on different chromosomes sort independently. Shown by dihybrid crosses. Example, p. 24. Each trait is inherited, in the F2 generation, in a 1RR:2rR:1rr pattern. Analyze: each is a 3:1. Pr (R-)= 3/4, Pr.(Y-)= 3/4; Pr(R-Y-)= 9/16. Pr. (R-)= 3/4, Pr. yy= 1/4, Pr (R-,yy)= 3/16 Pr (rr)= 1/4, Pr (Y-)= 3/4, Pr (rrY-) = 3/16 Pr (rr)= 1/4, Pr (yy)= 1/4, Pr (rry-) = 1/16

C. Crosses with three or more traits: use the forked-line approach. Ex. fig 2.12; ex., problem 12, p 43

D. Goodness of fit: Use the Chi-square analysis to determine if the results can be expected on the basis of chance, if the hypothesis is correct.

What does the Chi2 value mean?

E. Inheritance in humans: If we assume that inheritance in humans also follows Mendelian patterns, then we can determine the genotypes of parents, children, and the probable genotypes of future children. Symbols, p. 33. Recessive traits: pedigree analysis.

Dominant traits: pedigree analysis

Binomial formula helps determine the probability of having affected offspring, once the parental genotypes is known. Pr (x type one events out of N total events)= Cpxq(N-x). E.g, the probabiltiy of having two boys out of 6 kids. Pr (boy) = 0.5, Pr (girl)= 0.5. 0.520.54 gives the probabiltiy of having one particular pattern of two boys and 4 girls, say, bbgggg. C tells how many different ways you can get 2 b and 4 G. C= N!/x!(N-x)!

Instructor notes, Ch 1&2