Вы находитесь на странице: 1из 3

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc)

http://www.addgene.org/vector-database/2565/

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!


Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene. This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pET-28 a (+)


Source/Vendor: Alt Name: Analyze: Plasmid Type: Expression Level: Clone Method: Size: 5' Sequencing 1 Primer: 5' Sequencing 1 Primer Sequence: Tag 1: Bacterial Resistance: Notes: Catalog Number: Stable: Constitutive: Viral/Non-Viral: EMD Biosciences pET28a Sequence Bacterial Expression High Unknown 5369 T7 Fwd 5'd[TAATACGACTCACTATAGGG]3' His (Nterm and Cterm) Kanamycin Nterm thrombin cleavage site; a,b,c vary by MCS; 69864-3 Transient Constitutive Nonviral

1 of 3

2/13/2013 9:53 PM

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc)

http://www.addgene.org/vector-database/2565/

T7_terminator T7_Terminal_primer XhoI (158) NotI (166) EagI (166) HindIII (173) SalI (179) SacI (190) EcoRI (192) BamHI (198) T7_leader NheI (231) NdeI (238) Xpress_fwd_primer NcoI (296) T7_transl_en_RBS XbaI (335) lacO T7_promoter BglII (401) pBRrevBam_primer tet (300 - 563) ORF frame 2 KanR2 SmaI (4300) XmaI (4298) ClaI (4117) NruI (4083)
4474

5369 4922 448

ORF frame 1 BclI (1137) lacI ApaI (1334)


896

4027

pET-28 a (+) 5369 bp

1343

3580

1790

pBR322_origin
3132 2685 2238

ORF frame 2 EcoRV (1573) HpaI (1629)

pGEX_3_primer ROP

tet (576 - 851) FspI (2205)

Feature Name T7_terminator T7_Terminal_primer T7_leader Xpress_fwd_primer T7_transl_en_RBS lacO T7_promoter tet (300 - 563) pBRrevBam_primer lacI tet (576 - 851) ROP pGEX_3_primer pBR322_origin KanR2

Start 129 69 239 240 323 368 386 418 489 764 1914 2664 2871 3889 3995

End 1 87 207 222 307 341 368 681 470 1855 2189 2855 2849 3270 4810

ORF ORF frame 1 ORF frame 2 ORF frame 2 Enzyme Name XhoI NotI EagI HindIII SalI SacI EcoRI BamHI NheI NdeI NcoI XbaI BglII BclI ApaI EcoRV HpaI FspI NruI ClaI XmaI

Start 523 896 3995

End 1023 1855 4810 Cut 158 166 166 173 179 190 192 198 231 238 296 335 401 1137 1334 1573 1629 2205 4083 4117 4298

2 of 3

2/13/2013 9:53 PM

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc)

http://www.addgene.org/vector-database/2565/

3 of 3

2/13/2013 9:53 PM

Вам также может понравиться