Вы находитесь на странице: 1из 237

GENTICA HUMANA

Conceptos, Mecanismos y Aplicaciones de la Gentica en el


campo de la Biomedicina

Texto Multimedia













Francisco Javier Novo Villaverde
Departamento de Gentica
UNIVERSIDAD DE NAVARRA









PRLOGO

La generalizacin del uso de Internet y de los ordenadores domsticos permite concebir libros de texto cada
vez ms interactivos, con tutoriales multimedia y enlaces a los abundantsimos sitios educativos disponibles
en la Red. Esto es especialmente til en una materia como la Gentica, en la que la percepcin grfica de
los procesos es imprescindible para la adecuada comprensin de los conceptos y mecanismos implicados.
Este libro de texto es fruto de mi reflexin acerca del modo de impartir la docencia de Gentica a alumnos
de disciplinas biomdicas que se enfrentan por primera vez con el apasionante mundo de los genes. Durante
aos he venido impartiendo la asignatura de Gentica Humana a alumnos de las licenciaturas de Biologa y
Bioqumica de la Universidad de Navarra, y esto me ha permitido preparar poco a poco un manual detallado
y abundante material grfico que han constituido el esqueleto del presente texto. Sobre este esqueleto
inicial he aadido nuevos captulos y gran cantidad de material multimedia que han dado como resultado
este texto de "Gentica Humana: conceptos, mecanismos y aplicaciones de la Gentica en el campo de la
Biomedicina".

Quizs lo que ms llame la atencin sobre este texto es que se presenta en un formato novedoso: slo se
incluyen algunas tablas e ilustraciones que ayudan a mantener la fluidez de la lectura, pero todos los
materiales grficos se han incluido en un CD que contiene todas las figuras a las que se hace referencia en
el texto. El CD est compuesto por una serie de pginas web que se pueden visualizar con cualquier
navegador, y que van guiando al alumno paso a paso a travs de tutoriales propios o de enlaces a videos o
figuras de especial inters para comprender algn concepto. Por tanto, el mayor aprovechamiento se
conseguir si el alumno va estudiando el texto y siguiendo al mismo tiempo, con calma, las figuras del CD.
Este mtodo permitir, o al menos eso espero, una comprensin rpida de los conceptos y mecanismos, ya
que ste es el enfoque que he pretendido dar al texto. En mi opinin, ninguna figura "esttica" puede suplir
la informacin aportada por un video una animacin comentada, y por ello la mayora de los tutoriales
estn grabados con una voz en off" que explica lo que se est viendo. Esto supone que el alumno debe
utilizar un ordenador con tarjeta de sonido y altavoces (o auriculares); para los enlaces externos necesita
tambin conexin a Internet. Confo en que la mayora de los hogares cuentan hoy en da con esta
tecnologa. Una ventaja (no despreciable) de esta estructura es que permite abaratar significativamente el
coste final del producto, al no requerir figuras a color dentro del propio texto; espero que esto ayude
tambin a conseguir una amplia difusin del libro.

Sin duda, algunos de los que han ledo las lneas precedentes (en especial, colegas en la docencia
universitaria de Gentica) habrn pensado que este libro de texto supone una especie de "autotexto" que
podra hacer innecesarias las clases tericas. Nada ms lejos de mi intencin. De todas formas, al elaborar
este mtodo he tenido en mente las directrices sobre el nuevo Espacio Europeo de Educacin Superior,
y en especial el sistema de transferencia de crditos europeos (ECTS) de reciente implantacin en la Unin
Europea. Este sistema est basado en la cantidad de trabajo que a juicio del profesor debe invertir un
alumno para la adecuada comprensin y aprendizaje de la materia respectiva, y por eso el concepto de
crdito incluye tambin las horas de trabajo personal del alumno. El presente libro, que exige al alumno una
inversin sustancial de tiempo mientras "navega" por las figuras al tiempo que estudia el texto, se adapta
especialmente bien a este nuevo concepto. En cualquier caso, como es lgico, las clases presenciales siguen
siendo un pilar bsico de la docencia universitaria, puesto que en ellas el alumno recibe una visin diferente
de los mismos conceptos que se exponen en el libro, puede adems aclarar las dudas que le hayan surgido
(si ha leido el captulo correspondiente antes de la clase, como es aconsejable) y puede tambin fijar los
conceptos clave que poco a poco le irn ayudando a "pensar" como un genetista.

Como he dicho, el principal destinatario de este texto es el alumno que cursa una asignatura general de
Gentica en una licenciatura biomdica (Medicina, Farmacia), y que se enfrenta por primera vez con esta
materia. De todas formas, tambin puede ser til para alumnos de la licenciatura de Biologa que ya hayan
cursado una asignatura de Gentica General (y, quizs, Ingeniera Gentica) y se enfrentan con una
asignatura ms especfica de Gentica Humana, especialmente los captulos incluidos en los bloques B, D y
E. En este caso, los captulos correspondientes al bloque A y al bloque C ya habrn sido estudiados con
mucho ms detalle en esas otras asignaturas, pero lo presentado aqu puede servir como resumen que
ayude a recordar los conceptos fundamentales. Lgicamente, espero que este texto tambin resulte til a
mdicos y otros profesionales del mundo biomdico que quieran ponerse al da, o que necesiten un
compendio claro, actualizado y moderno de los conceptos, mecanismos y aplicaciones que ofrece la
Gentica en el siglo XXI.

INDICE DE CAPTULOS

A. INTRODUCCIN

Captulo 1. El flujo de la informacin gentica.
Los cidos Nucleicos. Visin general de la expresin gnica. Transcripcin. Regulacin
de la transcripcin en eucariotas. Procesamiento del ARN mensajero: maduracin y
ayuste (splicing). Traduccin y cdigo gentico en eucariotas.

Captulo 2. El ADN en el ncleo de la clula eucariota.
La cromatina durante el ciclo celular. Replicacin de la cromatina en interfase.
Formacin y segregacin de los cromosomas durante la mitosis. Gametognesis y
meiosis. Recombinacin a nivel molecular.

Captulo 3. Tcnicas bsicas de gentica molecular.
Tecnologa del ADN recombinante: mtodos y usos ms frecuentes. Enzimas de
restriccin. Amplificacin in vitro de ADN (PCR). Secuenciacin. Tcnicas bsicas de
hibridacin de cidos nucleicos. Microarrays.


B. EL GENOMA HUMANO

Captulo 4. La geografa del genoma humano.
Historia y desarrollo del Proyecto Genoma Humano. Estructura del genoma humano y
variacin inter-individual. El ADN repetitivo. El genoma mitocondrial.

Captulo 5. El genoma humano en accin.
La secuencia influye en el estado funcional de la cromatina. Modificaciones
epigenticas y su importancia en la regulacin del estado funcional de la cromatina.
Relacin entre secuencia, estructura y funcin de la cromatina: territorios
cromosmicos.

Captulo 6. Origen de la variacin gentica en humanos.
Variacin en el ADN: polimorfismos y mutaciones. Mecanismos de reparacin del ADN
en humanos. Enfermedades causadas por alteraciones en los mecanismos de
reparacin.


C. LA TRANSMISIN DE LOS CARACTERES HEREDITARIOS

Captulo 7. Gentica mendeliana.
Planteamiento experimental de Mendel. Monohibridismo: primera ley de Mendel.
Cruzamiento de prueba. Dihibridismo: segunda ley de Mendel. Redescubrimiento del
trabajo de Mendel. Teora cromosmica de la herencia.

Captulo 8. Herencia relacionada con el sexo.
Cada sexo tiene distinta constitucin cromosmica. Los genes situados en el
cromosoma X muestran un modo especial de herencia. Determinacin del sexo y
compensacin de dosis: hiptesis de Lyon. Estructura de los cromosomas sexuales
humanos.

Captulo 9. Modificaciones de las proporciones mendelianas.
Modo de estimar si se cumplen las proporciones mendelianas esperadas. Causas por
las que se obtienen desviaciones de las proporciones mendelianas para un carcter:
dominancia incompleta, codominancia y alelos mltiples. Alelos letales. Interaccin
gnica: epistasia.

Captulo 10. Gentica de los caracteres cuantitativos.
Gentica de los caracteres cuantitativos: experimentos de Johannsen, Nilsson-Ehle y
East. Modelo poligenes-ambiente y enfermedades multifactoriales. Heredabilidad en
sentido amplio y en sentido restringido. Clculo de la heredabilidad en Gentica
humana.

Captulo 11. Ligamiento gentico en humanos.
El concepto de ligamiento: fraccin de recombinacin y distancia gentica.
Informatividad de los marcadores utilizados en estudios de ligamiento. El clculo del
LOD score. Ligamiento no paramtrico y su utilizacin en gentica humana.

Captulo 12. Los genes en las poblaciones. Evolucin.
El equilibrio de Hardy-Weinberg. Cambios en las condiciones que mantienen el
equilibrio. Aplicaciones en Gentica Humana. Formacin de la Teora Sinttica de la
evolucin. Explicacin actual del proceso evolutivo.


D. PATOLOGA GENTICA

Captulo 13. Citogentica
El estudio de los cromosomas humanos. El fenmeno de no disyuncin meitica y sus
implicaciones. Anomalas del nmero de los cromosomas. Anomalas estructurales de
los cromosomas.

Captulo 14. La Mutacin como causa de enfermedad.
Caractersticas generales de las mutaciones. Mutaciones simples: tipos y
nomenclatura. Potencial patognico de las mutaciones en el ADN codificante y en el
ADN no-codificante intragnico e intergnico.

Captulo 15. Potencial patognico de las secuencias repetidas.
Mutaciones en secuencias que estn repetidas en tndem. Expansin de
trinucletidos: neuropatas por expansiones de CAG y enfermedades por expansin de
otros trinucletidos. Otras enfermedades por expansin de secuencias repetidas.
Mutaciones debidas a repeticiones dispersas. Desrdenes genmicos.

Captulo 16. Efectos fenotpicos de las mutaciones.
Prdida de funcin: fenotipos recesivos y fenotipos dominantes por haploinsuficiencia.
Fenotipos dominantes por ganancia de funcin. Alteraciones de la impronta genmica.
Mutaciones que afectan a la morfognesis.

Captulo 17. Diagnstico de enfermedades genticas.
Estrategias generales de diagnstico de enfermedades genticas. Mtodos de
deteccin de mutaciones. Aplicacin del ligamiento gentico al diagnstico: el proceso
de diagnstico indirecto de enfermedades genticas.

Captulo 18. Gentica Clnica.
Gentica clnica y consejo gentico. Enfermedades de herencia autosmica y de
herencia ligada al cromosoma X. Aplicacin del teorema de Bayes al clculo de riesgos
genticos. Enfermedades por alteracin del ADN mitocondrial. Diagnstico prenatal.



E. NUEVAS HERRAMIENTAS DE LA GENTICA MODERNA

Captulo 19. Terapia Gnica.
Componentes de un sistema de terapia gnica y vas de administracin. Naturaleza del
cido nucleico teraputico. Tipos de vectores y su utilizacin en distintas estrategias

de transferencia gnica. Aplicaciones clnicas de la terapia gnica en el momento
actual.

Captulo 20. Bioinformtica del genoma humano.
Bases de datos de utilidad en Gentica Humana: bases de datos de secuencias y bases
de datos relacionadas con enfermedades. Bsquedas en bases de datos con BLAST.
Navegadores del Genoma Humano.





CAPTULO 1: EL FLUJO DE LA INFORMACIN GENTICA 1

A. INTRODUCCIN

Se incluyen en esta seccin tres temas que servirn para repasar los aspectos
fundamentales de la estructura de los cidos nucleicos y la biologa molecular del gen,
as como la estructura bsica de la cromatina y sus cambios durante el ciclo celular.


Captulo 1. El flujo de la informacin gentica.
Los cidos Nucleicos. Visin general de la expresin gnica. Transcripcin.
Regulacin de la transcripcin en eucariotas. Procesamiento del ARN
mensajero: maduracin y ayuste (splicing). Traduccin y cdigo gentico en
eucariotas.


Los cidos Nucleicos

La informacin gentica se transmite a travs de unas molculas llamadas cidos nucleicos, polmeros
formados por unidades denominadas nucletidos. Un nucletido es una molcula formada por una
pentosa, una base nitrogenada y un grupo fosfato. Al conjunto formado por la pentosa y la base
nitrogenada se le denomina nuclesido. Por tanto, un nucletido es el ster fosfato de un nuclesido.
Dependiendo de la naturaleza de la pentosa, se distinguen dos tipos de cidos nucleicos: el cido
ribonucleico (ARN) lleva D-ribosa, y el cido desoxi-ribonucleico (ADN) contiene 2-desoxi-D-ribosa. Las
bases nitrogenadas que forman parte de los cidos nucleicos pueden ser monocclicas (pirimidinas) o
bicclicas (purinas). Las bases que intervienen en la formacin del ADN se denominan Adenina (A),
Citosina (C), Guanina (G) y Timina (T). El ARN contiene las tres primeras y Uracilo (U) en vez de Timina.

Fue Friedrich Miescher el primero en identificar, en 1869, un material que llam nuclena. Estudios
posteriores fueron caracterizando progresivamente la naturaleza qumica de esta sustancia, as como su
importancia biolgica. Despus de bastante controversia, Avery, MacLeod y McCarthy demostraron en
1944 que la introduccin de ADN purificado en bacterias hace que stas cambien su fenotipo y es, por tanto,
la molcula transmisora de la informacin gentica. En 1953, Rosalind Franklin, Maurice Wilkins, James
Watson y Francis Crick describieron la estructura tridimensional del ADN.

La Figura 1.1 contiene enlaces a los artculos originales de estos autores.

El ADN y el ARN son cadenas de polinucletidos. Como los nucletidos tienen direccionalidad debido a la
posicin del grupo fosfato en el carbono 5' y del grupo hidroxilo en el carbono 3' de la pentosa, las
molculas de ADN y ARN tambin tienen una polaridad concreta que viene definida por la direccin 5'
3'. El ADN es una molcula formada por dos cadenas antiparalelas, es decir, con polaridad contraria.
Cada cadena est formada por un esqueleto desoxi-ribosa-fosfato, en el que alternan molculas de desoxi-
ribosa unidas a los grupos fosfato mediante enlaces fosfo-dister. De este esqueleto "protruyen" las bases
nitrogenadas, unidas a la pentosa mediante enlaces glucosdicos. Adems, la molcula de ADN est formada
por dos cadenas complementarias, lo que significa que la secuencia de bases nitrogenadas de una cadena es
2 GENTICA HUMANA
complementaria a la de la otra cadena. Esto se debe al hecho de que las bases nitrogenadas forman slo
dos tipos de parejas: Citosina se empareja con Guanina y Adenina se empareja con Timina. Erwin
Chargaff fue el primero en demostrar en 1950 que el ADN de doble cadena tiene relaciones equimolares de
purinas y pirimidinas, siendo la cantidad total de desoxi-adenina (dA) igual a la de desoxi-timina (dT), y la
de desoxi-guanina (dG) igual a la de desoxi-citosina (dC). Por tanto, una conclusin derivada de esto es que
siempre se emparejan una purina con una pirimidina del mismo modo, siendo los pares dA con dT y dG
con dC. Watson y Crick, en su modelo de doble hlice, establecieron el modo exacto en que se forman los
enlaces en cada par de bases, con tres puentes de hidrgeno en un par dGdC y dos puentes de
hidrgeno en un par dAdT. Aunque hay muchos ms tipos posibles de enlaces entre cada uno de estos
nucletidos, los enlaces tipo Watson-Crick tienen una propiedad importante: ocupan el mismo espacio
dentro de la doble cadena y pueden intercambiarse sin distorsionar la molcula. Finalmente, el hecho de
que slo se formen dos tipos de pares de bases explica que las dos cadenas sean complementarias, ya
que la secuencia de bases de una puede convertirse fcilmente en la secuencia de bases de la otra cadena
sustituyendo cada base por su complementaria.

La Figura 1.2 contiene un enlace a animaciones en las que se explica la
estructura de los cidos nucleicos y de la doble hlice.

Por tanto, en la molcula completa de ADN, las cadenas polinucleotdicas se mantienen unidas entre s
gracias a los puentes de hidrgeno que se forman entre bases pertenecientes a cada una de las cadenas.
Adems, esta doble hebra no es lineal (como una escalera de mano), sino que adopta una configuracin
helicoidal en la que las bases nitrogenadas ocupan el interior y se disponen perpendicularmente a las
cadenas laterales. Este fenmeno se denomina "apilamiento" de las bases (base stacking) y es muy
importante para mantener la estabilidad global de la doble hlice. Existen distintos tipos de configuraciones
que puede adoptar la doble hlice dependiendo de las condiciones del medio, pero la ms relevante desde el
punto de vista biolgico es la forma B, ya que es la ms frecuente en condiciones fisiolgicas. En esta
configuracin, la hlice es dextrgira, con un dimetro de 2 nm, tiene 10 pares de bases por vuelta y una
distancia de 0,34 nm entre cada par de bases. Las dos molculas de desoxi-ribosa a las que se unen cada
una de las bases del mismo par forman dos "surcos" en la superficie externa de la hlice. Adems, como
estas dos desoxi-ribosas no estn situadas simtricamente, sino que miran hacia la misma cara de la doble
hlice, los dos surcos que se forman no son iguales: uno de ellos es ms ancho (surco mayor) y otro ms
estrecho (surco menor).

La Figura 1.3 permite visualizar la forma B del ADN en tres dimensiones.


Visin general del proceso de expresin gnica

La secuencia de nucletidos de determinados fragmentos del ADN contiene informacin para la fabricacin
de protenas, que son los principales elementos estructurales y funcionales de las clulas. De hecho, la
secuencia de nucletidos determina el tipo de aminocidos y el orden en que se aaden en el proceso de
sntesis de protenas, y esa informacin est contenida de un modo codificado en la secuencia de bases del
ADN. El proceso por el que dicha informacin es descodificada y "traducida" para dar lugar a la sntesis de
protenas especficas se conoce como expresin gnica. Este proceso comprende varios pasos de
descodificacin, que en lneas generales son la transcripcin y la traduccin. En lenguaje coloquial,
transcribir significa pasar algn tipo de informacin de un medio a otro. Por ejemplo, se transcribe una
conversacin al ponerla por escrito. El primer paso en la lectura de la informacin contenida en la secuencia
CAPTULO 1: EL FLUJO DE LA INFORMACIN GENTICA 3
de nucletidos consiste en la sntesis de una cadena de ARN a partir de un segmento de ADN. Este proceso
de copia de una secuencia "molde" de ADN en un ARN se denomina transcripcin. El ARN mantiene la
informacin que estaba contenida en el ADN precisamente porque lleva la misma secuencia de nucletidos
(con la excepcin de las timinas, que son sustituidas por uracilos). Esta cadena de ARN puede intervenir
directamente en algn proceso celular, pero lo ms habitual es que transmita la informacin al siguiente
elemento de la cadena de descodificacin, y por eso se llama ARN mensajero (abreviado como ARNm). El
ARNm es, por tanto, la molcula que va a llevar la informacin contenida en un segmento concreto de ADN
(es decir, un gen) hasta la maquinaria de fabricacin de protenas. Como esta maquinaria est en el
citoplasma, el ARNm debe salir del ncleo celular a travs de los poros nucleares y llegar a los ribosomas.
All, mediante un proceso denominado traduccin, la informacin gentica contenida originalmente en la
secuencia de nucletidos del ADN ser finalmente traducida en una serie de instrucciones que permiten al
ribosoma sintetizar una protena concreta. En los siguientes apartados veremos con detalle cada uno de
estos procesos.

La Figura 1.4 contiene un video en el que se ve el proceso general de
expresin gnica.


La transcripcin

El proceso general de transcripcin consiste en la sntesis de una cadena de ARN por la accin de una
polimerasa de ARN, que lee la secuencia de nucletidos contenida en el ADN molde y sintetiza la nueva
cadena de ARN utilizando nucletidos libres. En este proceso, la polimerasa se desliza por la cadena molde
de ADN. La transcripcin es un proceso cclico que se repite, en el que hay varias fases esenciales: i)
determinar la regin molde de ADN que ha de ser copiada, ii) iniciar la sntesis de ARN, iii) estabilizar y
modular la elongacin del ARNm naciente, iv) terminar el proceso. En eucariotas, la molcula encargada de
la sntesis es una polimerasa de ARN dependiente de ADN, es decir una polimerasa que usa un molde
de ADN para sintetizar un ARN. Este enzima es en realidad un complejo enzimtico formado por mltiples
subunidades proteicas al que se unen tambin factores accesorios sin los cuales no puede reconocer el lugar
correcto de inicio de la sntesis. En eucariotas se distinguen 3 tipos de ARN polimerasas en funcin del tipo
de genes que transcriben. Los genes tipo I de eucariotas son los que codifican los ARN ribosomales que
veremos ms adelante, y la polimerasa encargada de transcribir estos genes es la ARN polimerasa I. La
mayora de los genes son genes tipo II, que codifican protenas y algunos ARN pequeos con funciones
concretas; su transcripcin corre a cargo de la ARN polimerasa II. Finalmente, otros ARN pequeos, algunos
ARN ribosomales y los ARN transferentes son sintetizados por la ARN polimerasa III.

El primer paso en la transcripcin es determinar en qu punto comienza. Esto viene determinado por la
existencia de unas secuencias que definen la regin del gen en la que se une el complejo enzimtico
responsable de la sntesis. Estas secuencias se llaman promotores, y son necesarios para que la
transcripcin pueda tener lugar. Un promotor consta de varios pequeos motivos de secuencia, dispersos a
lo largo de varios cientos de pares de bases, a los que se unen los distintos factores proteicos necesarios
para la transcripcin. De hecho, la ARN polimerasa no se une al promotor directamente, sino a travs de
otro complejo proteico denominado complejo de preiniciacin. Por ejemplo, una de las secuencias ms
constantes en promotores de eucariotas es la caja TATA, cuya secuencia consenso es 5'-TATATAAAT-3'; a
esta secuencia se une un factor proteico llamado "protena de unin a TATA" (en ingls TATA-binding
protein, abreviado TBP). Sobre este factor se unen otros factores accesorios y dan lugar a un factor de
transcripcin llamado TFIID. De modo similar, se forman otros factores de transcripcin, que en el fondo
4 GENTICA HUMANA
no son ms que protenas con algn dominio de unin al ADN, que reconocen especficamente las
secuencias presentes en los promotores y se unen a ellas. En el promotor eucariota tpico de genes tipo II
se forma un complejo con TFIID, TFIIA, TFIIB y TFIIF, al que se une la ARN polimerasa II. La unin
posterior de TFIIH y TFIIE aade otras actividades al complejo, como la actividad helicasa necesaria para
abrir la doble hlice y permitir el copiado de una cadena, y hace que comience la transcripcin. Por tanto, la
formacin del complejo de preiniciacin sobre promotores especficos es la forma de controlar que la ARN
polimerasa comience a sintetizar en el lugar correcto. Adems, los promotores eucariotas estn tambin
modulados por otros elementos ms lejanos del punto de inicio de la transcripcin, llamados
"potenciadores" (enhancers en ingls) "silenciadores". Estos elementos son secuencias de ADN sobre
las que se unen factores proteicos que contribuyen a estabilizar y potenciar el complejo de preiniciacin, en
el caso de los potenciadores, o a impedir la transcripcin en el caso de los silenciadores. Existen muchos
otros elementos de secuencia que forman parte de promotores y que permiten regular dnde cundo se
transcribe un gen. Muchos de estos elementos tienen una localizacin precisa respecto al inicio de la
transcripcin: por ejemplo, la caja TATA suele estar 25 nucletidos en direccin 5' al inicio de la
transcripcin (es decir, en posicin 25, ya que se considera como posicin +1 la del nucletido donde se
inicia la sntesis). Otros elementos frecuentes son la caja GC (secuencia consenso GGGCGG) o la caja
CAAT (CCAAT) en posicin 100, a las que se unen factores de transcripcin especficos.





Con la fosforilacin del extremo carboxilo-terminal de la ARN polimerasa II, comienza el
desplazamiento de la misma por la cadena molde de ADN y la sntesis del ARN naciente. En este proceso, la
polimerasa lee la secuencia de nucletidos de una de las cadenas de la doble hebra de ADN y sintetiza un
polinucletido complementario, reemplazando las timinas del ADN por uracilos. De este modo, se conserva
perfectamente la informacin que estaba contenida en el ADN. En este sentido, tiene importancia saber
cul es la hebra de la doble hlice que es utilizada como molde, y a veces existe cierta confusin sobre la
nomenclatura de las dos hebras del ADN bicatenario. Es importante recordar que los polinucletidos se
sintetizan en direccin 5'3', y lo mismo sucede con la sntesis del ARN mensajero. Por tanto, la hebra
molde se lee en sentido 3'5' (es decir, antisentido) al tiempo que la transcripcin procede en sentido
5'3'. Por eso, el convenio es llamar "hebra codificante" "hebra sentido" a la hebra de la doble
cadena de ADN que contiene exactamente la misma secuencia de nucletidos que el futuro ARNm transcrito
DOBLE CADENA DE ADN
(GEN)
5ACGtataaGATCTCGATCGAGACTAGCTAGCTAGCTAgCGATCGAGCTA-3
|||||||||||||||||||||||||||||||||||||||||||||||||
3-TGCTAGCTAGATAGCTAGCTCTGATCGATCGATCGATCGCTAGCTCGAT-5
INICIO DE LA
TRANSCRIPCIN CAJA TATA
PROMOTOR Exon 1
CAPTULO 1: EL FLUJO DE LA INFORMACIN GENTICA 5
(excepto por los uracilos). A la hebra complementaria, que es la que se utiliza como molde, se le llama
"hebra molde" "hebra antisentido".

La figura 1.5 muestra una secuencia de ADN en la que se representan las
principales secuencias implicadas en la transcripcin de un gen.

El proceso de elongacin del transcrito naciente, al menos en eucariotas, est sujeto a numerosas pausas
paradas, debido a diversos obstculos que la polimerasa se puede encontrar al avanzar por el ADN molde.
Como veremos en el siguiente captulo, la doble hlice est empaquetada en forma de cromatina, y esto
crea obstculos importantes a los procesos de transcripcin; adems, el ADN puede haber sufrido daos que
a veces impiden el paso del complejo transcripcional. Por eso, es importante la presencia de factores que
favorecen la elongacin, tales como algunos factores de transcripcin (TFIIF y TFIIS) la elongina. La
fosforilacin de la ARN polimerasa tambin favorece significativamente el proceso de elongacin. La ltima
fase del proceso de transcripcin es la terminacin de la sntesis. As como en procariotas la terminacin
est mediada por unas secuencias especficas en el ADN molde, en eucariotas la terminacin no sigue este
modelo, sobre todo en el caso de la ARN polimerasa tipo II. La sntesis habitualmente sigue hasta que se ha
sobrepasado el punto que constituir el extremo 3' del ARN mensajero, y la terminacin est ligada a los
procesos de maduracin del transcrito que se describen a continuacin.

La figura 1.6 contiene un enlace a un video que muestra esquemticamente
el proceso de transcripcin.


Regulacin de la transcripcin en eucariotas

As como los mecanismos que regulan la expresin gnica son bastante bien conocidos en procariotas, y se
han identificado distintos tipos de ARN polimerasas y de factores de transcripcin implicados en el inicio de
la transcripcin, el panorama en eucariotas es mucho ms complejo. Slo en los ltimos aos ha comenzado
a conocerse con cierto detalle el modo en que se regula la intensidad de la expresin gnica, su restriccin a
determinados tejidos y su variacin en respuesta a estmulos extracelulares. Aunque esta regulacin se
puede dar a varios niveles de complejidad, en este apartado estudiaremos nicamente el nivel basal, que es
el compuesto por las secuencias promotoras, potenciadoras y silenciadoras del inicio de la transcripcin y
los factores proteicos que se unen a ellas. El complejo basal de iniciacin es una maquinaria molecular
gigante, con distintas actividades, cuyo ensamblaje es necesario para la transcripcin correcta tanto de
genes constitutivos como de genes que se expresan slo en determinados tejidos.

Hasta hace unos 10 aos, se conocan 6 factores generales de iniciacin de la transcripcin de genes
clase II en eucariotas, llamados TFIIA, TFIIB, TFIID, TFIIE, TFIIF y TFIIH. stos, junto con la ARN
polimerasa II, son suficientes para iniciar la transcripcin de algunos genes in vitro, es decir, en el tubo de
ensayo. Pronto se vio que algunos de estos factores generales eran en realidad complejos formados por
varios componentes, y se identificaron un total de 23 protenas adems de las 12 subunidades de la ARN
polimerasa II; con esto, se propuso un modelo por el que todos estos factores se ensamblan durante la
iniciacin de la transcripcin. Los progresos de los ltimos aos han revelado que en realidad el
transcriptosoma es un complejo mucho mayor de lo que se crea, con muchos otros componentes proteicos
que llevan a cabo otras funciones, como la remodelacin de la cromatina la reparacin del ADN. La
regulacin de la expresin gnica se ejerce, a este nivel basal, mediante la regulacin del ensamblaje de la
maquinaria proteica necesaria para la transcripcin, y en este sentido se ha estudiado especialmente el
6 GENTICA HUMANA
papel de los potenciadores y los activadores. Los potenciadores ("enhancers" en ingls) son pequeos
elementos de secuencia del ADN a los cuales se unen unos factores proteicos llamados activadores, y
dicha unin estimula la transcripcin. Dado que distintos genes tienen distintos elementos potenciadores y
que no todas las clulas poseen los mismos activadores, este sistema permite cierta especificidad en la
respuesta a estmulos fisiolgicos que recibe las clulas de distintos tejidos. Adems, los activadores son
protenas modulares, es decir, poseen distintos dominios de unin a potenciadores diferentes, lo cual
regula la afinidad y especificidad de las interacciones con los elementos de ADN.

El modo en que la unin de los activadores a los potenciadores es capaz de promover la trancripcin, ha
sido estudiado con profundidad en los ltimos aos. Estos estudios han permitido aislar otro complejo
proteico llamado mediador, constituido tambin por varias subunidades, que interacciona con los
activadores y con la ARN polimerasa II y as transduce las seales proporcionadas por los potenciadores al
promotor basal de la transcripcin. Se han identificado varios mediadores en humanos, como TRAP, DRIP y
otros; adems de ayudar a estabilizar el complejo de iniciacin gracias a las interacciones con los
activadores y los factores generales de transcripcin, los mediadores tambin pueden regular directamente
la actividad de la ARN polimerasa II.

La figura 1.7 muestra el ensamblaje del complejo basal de transcripcin por
la accin de activadores y mediadores.


Maduracin del ARN mensajero

En los genes transcritos por la ARN polimerasa tipo II, que en su inmensa mayora son genes codificantes
de protenas, el ARN mensajero primitivo debe ser procesado para mejorar su estabilidad y para eliminar las
regiones que no son codificantes. Adems, en algunos casos es sometido a un proceso de correccin de
errores o "edicin".

En primer lugar, el ARN naciente es estabilizado mediante la adicin de distintos grupos en sus extremos
5' y 3', ya que los extremos libres de la molcula de ARN son los ms vulnerables a la degradacin por unas
enzimas llamadas exonucleasas. El extremo 5' es modificado mediante la adicin del capuchn caperuza
("cap" en ingls), que consiste en la adicin al primer nucletido del ARN de una guanina modificada.
Podemos representar el extremo 5' de un ARN recin transcrito por 5'-pppNpN-3', siendo cada p un grupo
fosfato y N un nucletido cualquiera (como es habitual, el primer nucletido de la cadena tiene 3 grupos
fosfato unidos al carbono 5' de la ribosa). La caperuza consiste en una guanina metilada en posicin 7,
que se une por su carbono 5' al primer grupo fosfato de la cadena. Por tanto, el enlace entre la 7-metil-
guanina y el primer nucletido es atpico, ya que es un enlace 5' 5' en vez del enlace 5' 3' habitual. El
otro tipo de modificacin del ARN mensajero tiene lugar en el extremo 3' del mismo, y consiste en el corte
por un punto concreto y la posterior adicin de una cola de poli-adeninas. Es importante recordar que dicha
cola no se aade al extremo final del transcrito primario, sino que previamente tiene lugar un corte interno.
El punto de corte viene definido por la presencia de una seal de poli-adenilacin en el ARNm (cuya
secuencia consenso es 5'-AAUAAA-3') y un tracto rico en guaninas y uracilos (tracto GU) localizado unos
30-40 nucletidos por debajo de la seal de poli-adenilacin (es decir, en direccin 3'). El proceso est
mediado por unos factores proteicos que se unen a cada una de estas seales, cortan al ARN mensajero
unos 20 nucletidos por debajo de la seal de poli-adenilacin, y comienzan a aadir adeninas. La formacin
de esta cola poli(A) es muy importante para mantener la estabilidad del ARNm y asegurar que ste pueda
seguir siendo procesado y llegue a traducirse correctamente.
CAPTULO 1: EL FLUJO DE LA INFORMACIN GENTICA 7

La figura 1.8 contiene un enlace a un video educativo que muestra
esquemticamente la adicin de la caperuza y la formacin de la cola poli(A).

Un ltimo tipo de modificacin que pueden sufrir algunos ARNm es la correccin "edicin". La edicin del
ARN es un mecanismo de modificacin co- post-transcripcional mediante el cual se cambian uno varios
nucletidos de un ARNm, con el resultado de que la secuencia del mensajero es ligeramente distinta de la
que vena codificada en la secuencia genmica. Este fenmeno, bastante comn en otras especies pero ms
raro en humanos, permite generar diversos ARNm a partir de un mismo gen. Por ejemplo, la
apolipoprotena ApoB48, que se produce en el intestino para entrar a formar parte de los quilomicrones, se
origina por efeco de un cambio CU en el que una citosina se des-amina para dar lugar a un uracilo; este
cambio crea un codn de parada en el ARNm de la ApoB100 y se produce una protena ms corta de lo que
sera esperado segn la secuencia inicial. Un mecanismo similar est implicado en el origen de
enfermedades como la neurofibromatosis tipo I el tumor de Wilms, debidas a alteraciones en los genes
NF1 y WT1, respectivamente.

La figura 1.9 muestra esquemticamente la edicin del ARN que da lugar a la
ApoB48.


El ayuste (splicing) y su regulacin

Los ARN mensajeros de eucariotas tienen una caracterstica muy importante: no son codificantes en su
totalidad, desde el principio al fin, sino que las regiones codificantes estn interrumpidas por otras regiones
no-codificantes. Es decir, no todos los nucletidos del ARN mensajero son ledos para sintetizar protenas,
sino que existen regiones codificantes llamada exones que alternan con otras regiones no-codificantes
llamadas intrones. Debido a esta configuracin, el siguiente paso en la maduracin de un ARNm consiste
en eliminar los intrones y pegar los exones para formar un mensajero maduro que pueda ser traducido
desde el principio hasta el fin y sin interrupciones. Este proceso de corte y eliminacin de intrones con
empalme de los exones se denomina en ingls splicing, trmino natico que corresponde al castellano
ayuste: la unin de dos cabos por sus chicotes. El ayuste es un proceso complejo, porque hay que tener en
cuenta que el nmero de exones e intrones de un gen puede ser muy grande, y requiere una maquinaria
proteica bastante sofisticada. En primer lugar, es importante definir el punto exacto que delimita la frontera
entre un exn y un intrn, para que la maquinaria encargada del ayuste pueda actuar. Estos puntos vienen
determinados por secuencias especficas del ARNm. Por ejemplo, los intrones de eucariotas comienzan en la
prctica totalidad de los casos por los nucletidos Guanina-Uracilo (secuencia 5' de ayuste, GU) y terminan
en AdeninaGuanina (secuencia 3' de ayuste, AG). Estas secuencias se localizan dentro de unas regiones
ms amplias que cumplen un consenso de secuencia concreto. Por ejemplo, la secuencia de ayuste 5' est
formada por el consenso 5'-AG|GU[A/G]AGU-3' (la barra vertical indica el sitio de corte donde termina el
exn precedente y comienza el intrn; [A/G] significa que en esa posicin puede haber una A una G). Por
su parte, la secuencia de ayuste 3' se ajusta al consenso 5'-NCAG|G-3' (siendo N cualquier nucletido).
Adems, es importante la presencia de una adenina 20-40 nucletidos por arriba (es decir, en direccin 5')
de la secuencia 3' de ayuste. Esta adenina se encuentra en la secuencia consenso 5'-CU[A/G]A[C/U]-3' (es
la adenina en negrita y subrayada), es decir, precedida por A G y seguida por C U, y se denomina
punto de ramificacin (en ingls, "branch point"). Entre el punto de ramificacin y la secuencia de ayuste
3' se encuentra un tracto rico en pirimidinas, es decir, formado casi exclusivamente por timinas
8 GENTICA HUMANA
citosinas. Finalmente, se han identificado pequeos elementos de secuencia en exones en intrones que
actan como potenciadores silenciadores del proceso de ayuste, y que tienen gran importancia en la
modulacin y regulacin fina del proceso.

La figura 1.10 muestra esquemticamente las distintas secuencias que son
importantes en el proceso de ayuste.





El proceso de ayuste implica varias reacciones enzimticas que realizan cortes endonucleolticos y unin
de extremos libres. El primer paso del proceso es el corte en el sitio de ayuste 5', justo por delante de la
guanina del GU inicial del intrn. Este extremo libre se une a la Adenina del punto de ramificacin mediante
un enlace fosfo-dister 5'-2', creando una estructura en lazo. Finalmente, se corta la secuencia de ayuste
3' por detrs de la guanina del sitio AG, lo que resulta en la liberacin del intrn; los extremos libres de los
dos exones flanqueantes son entonces religados. Las molculas que llevan a cabo estos procesos son unas
ribonucleoprotenas nucleares pequeas (RNPnp), formadas por un ARN nuclear pequeo (ARNnp) y
varias subunidades proteicas. Aunque hay varios tipos de ARNnp, los que participan en el proceso de ayuste
se llaman U1, U2, U4, U5 y U6, y adems dan su nombre a las correspondientes RNPnp. La RNPnp U1 se
une a la secuencia de ayuste 5' por complementariedad de bases, ya que uno de sus extremos es
complementario a la secuencia consenso que rodea a la GU del extremo 5' del intrn.

Las otras ribonucleoprotenas implicadas actan en los siguientes pasos del proceso. La RNPnp U2 se une
al punto de ramificacin y esto hace ambas RNP entren en contacto y facilita la formacin del lazo. A
continuacin, un complejo formado por la RNPnp U4/6 y la RNPnp U5 se une a la regin de ayuste 3' y
estabiliza la formacin de todo el complejo, llamado ayusteosoma (spliceosome en ingls), y lleva a cabo
el corte 3' y la unin de los exones.

Exon 1 Exon 2
Intron 1
GUC CAUUCA

ARNnp U1
CAG GUAAGU

UGAC...[C/T] [C/T][C/T][C/T] [C/T] [C/T]UG G
CAPTULO 1: EL FLUJO DE LA INFORMACIN GENTICA 9
La figura 1.11 contiene un enlace a un video educativo que muestra
esquemticamente el proceso de ayuste.

Como se puede suponer, en un genoma eucariota hay miles de sitios que cumplen el consenso de secuencia
necesario para funcionar como sitios de ayuste, pero sin embargo slo unos pocos participan en el
procesamiento normal de los genes. De hecho, uno de los temas ms interesantes en la regulacin del
ayuste es cmo se definen exactamente los lmites de exones e intrones, de modo que la maquinaria
de ayuste los reconozca como tales. Aunque todava quedan incgnitas por resolver, hoy en da sabemos
que hay otros elementos que cooperan para estabilizar el ayusteosoma y permitir que se lleve a cabo el
proceso. Entre estos elementos destacan la protenas SR (llamadas as por ser ricas en los aminocidos
Serina y Arginina), que interaccionan con distintos componentes del ayusteosoma y se unen a secuencias
moduladoras como son los potenciadores exnicos del ayuste. Todas estas interacciones tienen lugar
antes de la unin de las RNPnp U4/6 y RNPnp U5, y son muy importantes para definir los lmites de exones
e intrones y para regular el ayuste alternativo, que es el fenmeno por el cual un mismo gen puede sufrir
distintos patrones de ayuste dependiendo del tejido del tipo celular en que se lleva a cabo. El ayuste
alternativo es un fenmeno muy comn en humanos, y hace que los ARNm resultantes de los distintos tipos
de ayuste sean diferentes y por tanto tengan la capacidad de codificar protenas distintas, lo que aade un
nivel ms de complejidad en la funcin del genoma.

La figura 1.12 muestra esquemticamente los complejos que intervienen en
la definicin de los exones e intrones, as como el fenmeno de ayuste
alternativo.


Traduccin y cdigo gentico en eucariotas

El paso final en el proceso de la expresin gnica es la fabricacin de una protena a partir de la informacin
contenida en la secuencia del ARNm. Conceptualmente, este proceso es parecido a la interpretacin de unas
instrucciones escritas en un idioma, siguiendo un cdigo de interpretacin concreto. Por eso, el proceso se
denomina traduccin. Si queremos traducir un lenguaje, en primer lugar necesitamos conocer el
diccionario para entender el significado de las palabras. En este caso, el diccionario se conoce como cdigo
gentico, que es la correspondencia entre la informacin contenida en el ARNm y el tipo de aminocido que
se aade a la protena durante su sntesis. En el ARNm, las instrucciones estn compuestas por palabras
de tres letras, es decir, cada tres nucletidos forman una palabra que instruye a la maquinaria de sntesis
proteica a aadir un aminocido concreto. Estas palabras de tres letras se denominan codones. Es fcil
calcular el nmero posible de palabras de tres letras que se pueden formar con un alfabeto de cuatro letras
(A, C, G y T): 4
3
, es decir 64 palabras distintas. Sin embargo, slo hay 20 aminocidos esenciales en las
protenas, por lo que en teora slo seran necesarios 20 codones. Teniendo en cuenta las palabras palabras
necesarias para la instruccin de iniciar la transcripcin (AUG) y de terminarla (UAG, UAA, UGA), todava
tenemos la posibilidad de codificar un mismo aminocido con varios codones distintos. Para indicar este
fenmeno se dice que el cdigo gentico es degenerado, en el sentido de que varias palabras a veces
codifican el mismo aminiocido. Por ejemplo, algunos aminocidos como la leucina estn codificados por 6
codones diferentes.

La Figura 1.13 muestra el cdigo gentico, con la tabla de equivalencias entre
los distintos aminocidos y los codones que los codifican.
10 GENTICA HUMANA

El hecho de que el cdigo gentico utilice palabras de tres letras implica que cualquier secuencia annima,
cuyo significado no conocemos, podra dar lugar al menos a tres protenas distintas dependiendo del punto
de inicio de la traduccin. En efecto, cualquier secuencia (supongamos la secuencia 5'-
ACGACTGCGTACACGTC-3', por ejemplo) puede dividirse en bloques de tres palabras que configurarn
instrucciones distintas si comenzamos a contar desde el primer nucletido (ACG, ACT, GCG, etc en nuestro
ejemplo), desde el segundo (CGA, CTG, CGT, etc) desde el tercero (GAC, TGC, GTA, etc). Como puede
observarse, las protenas codificadas en cada caso tienen una secuencia de aminocidos diferente. Cada una
de estas posible formas de leer una secuencia codificante se denomina marco de lectura, y siempre
existen tres marcos de lectura posibles (en secuencias de una sola hebra) porque el cuarto marco de lectura
es idntico al primero, el quinto al segundo, etc. Esto plantea el problema de cmo reconoce la clula cul
es el marco de lectura que debe usar para sintetizar la protena correcta. Esto se soluciona de dos formas:
en primer lugar, por la existencia de un codn de inicio (AUG, que codifica para el aminocido metionina),
y en segundo lugar porque slo uno de los tres marcos de lectura (llamado por eso "abierto") da lugar a una
protena de longitud adecuada, ya que en los otros dos marcos de lectura aparecen codones de parada y las
protenas codificadas resultaran muy cortas y sin funcionalidad. En eucariotas, el codn de inicio est
incluido en una secuencia consenso definida por Marilyn Kozak, que es 5'-C[A/G]CCAUGG-3'. El marco de
lectura abierto quedar definido, por tanto, cuando el codn de inicio vaya seguido por un nmero suficiente
de codones codificantes hasta llegar a un codn de parada. Es importante tener en cuenta que la traduccin
no comienza al principio del ARNm, y tampoco termina al final del mensajero. De hecho, en el gen y en el
ARNm se pueden definir dos regiones no-traducidas, una en direccin 5' al inicio de la traduccin y otra
desde el codn de parada hasta el final, que flanquean la regin codificante (el marco de lectura abierto). La
regin no traducida 5' (RNT-5', en ingls UnTranslated Region 5'-UTR) se extiende desde el inicio del
ARNm (la caperuza) hasta el inicio de la traduccin (codn de iniciacin); la RNT-3' (en ingls 3'-UTR) se
extiende desde el codn de parada hasta el inicio de la cola poli(A).

La Figura 1.14 muestra una secuencia de ADN con los distintos marcos de
lectura posibles en el ARNm, sealando adems las regiones no traducidas.



La maquinaria que lleva a cabo la traduccin est constituida bsicamente por dos elementos: los ribosomas
y los ARN de transferencia. El ribosoma es una partcula compleja formada por subunidades de naturaleza
ribonucleoproteica. En eucariotas, el ribosoma consta de una subunidad pequea (coeficiente de
70 80 90 100 110 120
----:----|----:----|----:----|----:----|----:----|----:----|
atgTGGTTTTCTGTCCACTTCCCCTatgCAGGTGTCCAACGGATGTGTGAGTAAAATTCT
M W F S V H F P Y A G V Q R M C E * N S
C G F L S T S P M Q V S N G C V S K I L
V V F C P L P L C R C P T D V * V K F W
130 140 150 160 170 180
----:----|----:----|----:----|----:----|----:----|----:----|
GGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAAACCGAG
G Q V L R D W L H Q T Q G N R W * * T E
G R Y Y E T G S I R P R A I G G S K P R
A G I T R L A P S D P G Q S V V V N R E
CAPTULO 1: EL FLUJO DE LA INFORMACIN GENTICA 11
sedimentacin 40S) formada por un ARN y unas 30 protenas, y otra subunidad grande (60S) formada por 3
ARN y unas 50 protenas. Los ARN transferentes (ARNt) son pequeas molculas de ARN que llevan en
uno de sus extremos un aminocido, y actan como los adaptadores que leen la informacin de cada codn
y la transforman en un aminocido especfico. Aunque se representan habitualmente con forma de trbol,
en realidad estn doblados en forma de L. Las dos regiones ms importantes de un ARNt son el anticodn y
el extremo 3', que termina en los nucletidos 5'-CCA-3' y lleva el aminocido correspondiente. El anticodn
est formado por los tres nucletidos que se emparejan con el codn por complementariedad, ya que la
secuencia del codn y la del anticodn son complementarias (ambas en direccin 5' 3'). Este
emparejamiento no necesita ser siempre perfecto, sino que en ocasiones se permite un cierto "tambaleo"
cuando uno de los tres nucletidos no forma un emparejamiento perfecto tipo Watson-Crick; precisamente,
esto es lo que permite que varios codones sean ledos por un mismo anticodn.

La Figura 1.15 muestra un ARNt, sealando el anticodn unido al codn.

El proceso de traduccin comienza con la fase de iniciacin, mediante la unin de la subunidad pequea
del ribosoma a la caperuza del ARNm maduro que proviene del proceso de ayuste. A continuacin, la misma
subunidad ribosomal se desplaza por el ARNm hasta encontrar el codn de iniciacin apropiado, momento
en que se unen el ARNt
Met
(el ARN transferente que lleva el aminocido Metionina) y la subunidad ribosomal
grande. El bolsillo del ribosoma donde est unido este primer ARNt se llama sitio A (aminoacil). En este
proceso participan tambin varios factores de iniciacin (eIF1 a eIF6, del ingls eukaryotic initiation factor).
La segunda fase de la traduccin se llama elongacin, y consiste en un proceso cclico por el que el
ribosoma se desplaza tres nucletidos y el ARNt que ocupaba el sitio A pasa a ocupar otra regin del
ribosoma llamada sitio P (peptidil). Gracias a este movimiento, el siguiente codn del ARNm queda dentro
del sitio A, a donde acude otro ARNt con un anticodn complementario al nuevo codn. A continuacin, la
cadena peptdica que "cuelga" del ARNt que ocupa el sitio P es transferida al aminocido del ARNt que ocupa
el sitio A, con lo que la cadena polipeptdica se alarga en un aminocido. Estos procesos estn ayudados y
catalizados por los propios ARN ribosomales y por dos factores de elongacin (eEF1 y eEF2, del ingls
eukaryotic elongation factor). La terminacin de la traduccin tiene lugar cuando alguno de los tres
codones de parada ocupa el sitio A, porque en vez de unirse un ARNt acude un factor de terminacin (eRF1
y eRF3 en eucariotas, del ingls eukaryotic release factor).

La Figura 1.16 contiene un enlace a un video que muestra el proceso de
traduccin.

La traduccin completa el proceso de expresin gnica. Aunque actualmente se est reconociendo el papel
de los ARN no codificantes, que se transcriben y son procesados pero no se traducen en protenas, el
aforismo "un gen, una protena" sigue siendo vlido en la mayora de los casos. Igualmente, el "dogma
central de la biologa molecular" (es decir, la va ADN ARN Protena) no siempre se cumple, porque
algunos virus y otros organismos tienen un genoma con ARN que se retro-transcribe a ADN. En cualquier
caso, las nociones y mecanismos que se han repasado en este captulo constituyen el punto bsico de
arranque para comprender la naturaleza molecular de los genes y su funcin como portadores de
informacin biolgica.


12 GENTICA HUMANA
CAPTULO 2: EL ADN EN EL NCLEO 13
Captulo 2. El ADN en el ncleo de la clula eucariota.
La cromatina durante el ciclo celular. Replicacin de la cromatina en
interfase. Formacin y segregacin de los cromosomas durante la mitosis.
Gametognesis y meiosis. Recombinacin a nivel molecular.


La cromatina durante el ciclo celular

En las clulas somticas que tienen ncleo, la molcula de ADN est presente en una forma peculiar llamada
originalmente cromatina. Por la estructura de la doble hlice del ADN, sabemos que la distancia entre
nucletidos es de 0,34 nm; si el genoma humano haploide tiene 3x10
9
pares de bases, la longitud total
del genoma en forma de doble hlice lineal sera algo superior a 1 metro, y adems cada ncleo contiene
dos copias del genoma. Todo este material debe entrar en el ncleo de una clula eucariota, cuyo dimetro
medio es de 5 m. Esto significa que el ADN ha de adoptar un alto grado de empaquetamiento para poder
alojarse dentro del ncleo. Este empaquetamiento se lleva a cabo mediante la unin de la doble hlice con
varios tipos de protenas para dar lugar a una estructura que es, precisamente, la cromatina.

Las clulas eucariotas, al proliferar, siguen una serie de etapas en las que se llevan a cabo los procesos
necesarios para dar lugar a dos clulas hijas: duplicar los componentes celulares, segregarlos espacialmente
y dividir la clula de modo que las dos clulas resultantes lleven todos los ingredientes necesarios para su
correcto funcionamiento. Estas etapas deben completarse en orden, de un modo altamente regulado, y
constituyen lo que se llama ciclo celular. En cada ciclo celular se distinguen por tanto varias fases: la
interfase (etapa en la que la clula duplica su contenido), la mitosis (etapa en la que los componentes se
separan a polos opuestos de la clula) y citoquinesis (separacin fsica de las dos clulas hijas).
Probablemente sea la cromatina el componente celular en el que es ms importante la duplicacin y
segregacin correctas, ya que esto va a asegurar que la informacin gentica se transmita sin alteraciones.
Por tanto, es importante saber cmo se comporta la cromatina en las distintas etapas del ciclo celular.

La Figura 2.1 muestra las distintas fases del ciclo celular de una clula
eucariota y los cambios que sufre la cromatina.

Durante la interfase, que es la etapa ms larga del ciclo, la cromatina est sujeta a un grado de
empaquetamiento de unas 2000 veces, es decir, lo que en su estado natural ocupara un tamao de
2000 m se reduce a un tamao de 1 m. Esto se consigue por la unin de la doble hebra de ADN con unas
protenas bsicas llamadas histonas, cuyos grupos positivos interaccionan con los grupos negativos del
esqueleto fosfato del ADN. Hay 5 tipos principales de histonas, llamadas H1, H2A, H2B, H3 y H4, que se
asocian entre s para formar un octmero: dos molculas de H3 junto con dos molculas de H4 forman un
tetrmero, y dos dmeros H2A/H2B forman otro tetrmero; ambos tetrmeros se asocian para formar un
ncleo proteico (octmero) alrededor del cual se enrolla la molcula de ADN. En concreto, 146 pares de
bases de ADN dan 1,65 vueltas alrededor del octmero, y sobre este complejo se une la histona H1.
Esta estructura, de unos 10 nm de dimetro, es lo que se conoce con el nombre de nucleosoma, y es la
unidad bsica de organizacin de la cromatina. Los nucleosomas estn unidos entre s por el filamento de
ADN que se va enrrollando a su alrededor, como bolas en una cuerda, y esto da lugar a la fibra de
cromatina de 10 nm. En esta estructura, unos 200 pares de bases ocupan 10 nm, lo que significa un grado
de empaquetamiento de unas 6 veces respecto al tamao lineal que ocupara un fragmento de ADN de
esa longitud (200 X 0,34 nm = 64 nm).
14 GENTICA HUMANA

La Figura 2.2 muestra algunos modelos tridimensionales de un nucleosoma.

En condiciones fisiolgicas, la fibra de 10 nm sufre un segundo grado de enrollamiento sobre s misma para
dar lugar a una estructura en forma de solenoide, con 6 nucleosomas por vuelta. Esta configuracin
constituye la fibra de 30 nm, en la que el grado de empaquetamiento del ADN es de unas 40 veces.
La fibra de 30 nm sufre diferentes grados de empaquetamiento durante interfase y, especialmente, en la
mitosis, en la que la cromatina alcanza su empaquetamiento mximo (unas 10.000 veces) y da lugar a las
estructuras visibles que llamamos cromosomas. Estos tipos de alto grado de enrollamiento se consiguen
porque la fibra de 30 nm forma asas que se unen por su base a una estructura proteica que sirve como
andamio. El andamio ("scaffold" en ingls) est constituido por protenas no histonas, de las que las
principales son la Sc1 (idntica a la topoisomerasa II) y la Sc2 SMC2, que pertenece a una familia de
protenas llamada SMC (Structural Maintenance of Chromosomes, en ingls). Estas protenas cumplen
tambin un papel importante en el mantenimiento de la condensacin de la cromatina (de ah que tambin
se les llame condensinas). Las asas de la fibra de 30 nm se unen al andamio mediante unas secuencias
ricas en Adeninas y Timinas llamadas SAR (Scaffold Attachment Region en ingls), que tienen gran afinidad
por las protenas del andamio. La estructura que resulta de este enrollamiento da lugar a una fibra de unos
300 nm de grosor, en la que el grado total de empaquetamiento del ADN es de unas 2.000 veces. Las SAR
son regiones importantes, dispersas por el genoma, que flanquean genes y a menudo se asocian con los
orgenes de replicacin que veremos ms adelante, por lo que se piensa que pueden jugar un papel
importante en la funcin y estructura de la cromatina. Finalmente, el empaquetamiento mximo de la
cromatina durante la mitosis se consigue al espiralizarse la fibra de 300 nm para dar lugar a una estructura
de 600 nm de grosor (una cromtide) en la que el ADN alcanza ya un grado de empaquetamiento de
10.000 veces.

La Figura 2.3 muestra los distintos grados de empaquetamiento de la
cromatina.




Replicacin de la cromatina en interfase

La interfase se subdivide en tres fases, de las que la ms importante es la fase de sntesis (fase S). En esta
fase tiene lugar la duplicacin de los componentes celulares, incluyendo la cromatina. La fase S viene
Doble hlice (2 nm)
Fibra de 30 nm
Nucleosoma
Fibra de 10 nm
Solenoide
CAPTULO 2: EL ADN EN EL NCLEO 15
precedida y seguida por dos breves fases G (de "gap", hueco hiato), fase G1 y fase G2 respectivamente.
Uno de los principales procesos que tienen lugar durante la fase S es la duplicacin del contenido total de
ADN del ncleo, que se lleva a cabo mediante la replicacin del ADN y el ensamblaje en nucleosomas
para dar lugar a la nueva cromatina. El proceso de replicacin del ADN ya haba sido sugerido por Watson y
Crick en su descripcin del ADN, al darse cuenta que la estructura de la doble hlice y la complementariedad
de bases permita un mecanismo sencillo de copia. Aunque durante algunos aos se discuti cmo podra
funcionar este mecanismo, Matthew Meselson y Franklin Stahl demostraron que el ADN se replica de
modo semi-conservativo, es decir, que cada una de las nuevas molculas lleva una cadena de la molcula
original y otra cadena nueva, sintetizada tomando como molde la cadena complementaria. Posteriormente
se fueron descubriendo los detalles del proceso, e identificando los distintos componentes que lo llevan a
cabo.

La Figura 2.4 muestra esquemticamente la replicacin semiconservativa, y
contiene un enlace a un sitio educativo que explica los experimentos de
Meselson y Stahl.

En eucariotas, la replicacin comienza en mltiples sitios de una misma molcula de ADN a la vez, llamados
orgenes de replicacin. Dada la velocidad de copia de las polimerasas, una sola molcula de ADN
polimerasa tardara varios das replicar un cromosoma completo, por lo que de hecho la replicacin de la
cromatina se lleva a cabo en varios miles de orgenes de replicacin a la vez. De todas formas, aunque
todos los orgenes funcionan durante la fase S, no todos se ponen en marcha a la vez: en algunos orgenes
la replicacin comienza al principio de la fase S (replicacin temprana) y en otros comienza hacia el final
(replicacin tarda). En cada origen de replicacin se forma una burbuja de replicacin, por accin de
unas helicasas que abren la doble hlice para permitir la unin de las enzimas que llevarn a cabo la
sntesis, que son las polimerasas de ADN. Este primer paso est sujeto a una fina regulacin, ya que un
mismo origen slo se replica una vez en cada ciclo celular. De hecho, aunque la replicacin a partir de
un origen ya haya terminado y se mismo origen pudiese volver a iniciar otro ciclo de replicacin en la
misma fase S, esto nunca sucede. Esta regulacin se lleva a cabo por la accin de varios complejos
proteicos como el ORC (del ingls Origin Recognition Complex), el complejo de protenas MCM, y la
geminina.

En cada burbuja se forman dos horquillas de replicacin, apuntando en direcciones contrarias. Como los
eventos que tienen lugar en cada horquilla son idnticos, basta estudiar lo que sucede en una de ellas. En
primer lugar, una protena de unin a ADN mono-catenario, llamada RPA (Replication Protein A, en ingls)
se une a las cadenas que han sido separadas por las helicasas, y esto ayuda a mantener la burbuja de
replicacin abierta. A continuacin, a cada una de las cadenas se une una enzima llamada primasa, que es
una ARN polimerasa dependiente de ADN (es decir, sintetiza ARN tomando como molde ADN). La primasa
sintetiza un pequeo ARN que acta como cebador (primer, en ingls, de ah su nombre) para iniciar la
sntesis de ADN. Las polimerasas de ADN dependientes de ADN llevan a cabo la sntesis de ADN
elongando la cadena a partir del cebador de ARN generado previamente. Esta sntesis tiene lugar de modo
diferente en cada una de las cadenas, debido a la distinta orientacin que tienen. En la cadena que discurre
en sentido 3' 5', el cebador y la nueva cadena sintetizada sobre ella discurrirn en sentido 5' 3', que es
el nico modo en que pueden sintetizar ADN las polimerasas. Por tanto, en esta cadena, llamada cadena
gua (leading strand en ingls) se puede sintetizar el nuevo ADN de modo continuo. Por el contrario, la otra
cadena de la molcula original discurre en sentido 5'3', por lo que la nueva cadena sintetizada a partir de
sta (cadena retrasada, o lagging strand en ingls) debera crecer en sentido 3'5'. Como esto no es
posible, ya que las polimerasas son incapaces de sintetizar ADN de esta forma, lo que sucede es que se
16 GENTICA HUMANA
generan varios cebadores de ARN a pequeas distancias, sintetizndose el ADN a partir de cada uno de ellos
en sentido 5'3'. El resultado neto es la sntesis semi-discontnua de la cadena retrasada en sentido
3'5' gracias a la sntesis de pequeos fragmentos (cada uno de los cuales fue sintetizado en sentido
5'3'). Estos fragmentos se denominan fragmentos de Okazaki, y tienen una longitud entre 100 y 1000
nucletidos en eucariotas. A medida que la horquilla de replicacin avanza, las helicasas continan abriendo
la doble hlice (ayudadas por otras enzimas llamadas topoisomerasas, que relajan la tensin generada
por delante de la horquilla). Tras la sntesis en ambas cadenas, otras enzimas eliminan los fragmentos de
ARN que haban servido de cebadores, rellenan los huecos que quedan, y finalmente unas ligasas sellan los
ltimos enlaces fosfo-di-ster para obtener una cadena continua sin solucin de continuidad.

Figura 2.5 En estas animaciones se muestra esquemticamente el proceso de
sntesis de la cadena gua y de la cadena retrasada durante la replicacin del
ADN.

Aunque los complejos proteicos que intervienen en la replicacin del ADN en eucariotas no han sido
caracterizados con tanta profundidad como en procariotas, hoy en da se conocen bastantes detalles. De
entre las diferentes ADN polimerasas identificadas en eucariotas, la sntesis de los cebadores de ARN es
obra de la primasa, que acta junto con la ADN polimerasa o. sta, prolonga el cebador de ARN unos
pocos nucletidos. El factor C de la replicacin (RFC) desplaza la polimerasa o-primasa, una vez que se
ha formado el cebador de ARN, y trae consigo otra protena llamada PCNA (Proliferating Cell Nuclear
Antigen, en ingls), que a su vez es la responsable de reclutar la polimerasa que lleva a cabo la sntesis de
ADN. stas son la ADN polimerasa o (en la cadena retrasada) y la ADN polimerasa c (en la cadena
gua). El complejo PCNA-Polimerasa tambin incluye una endonucleasa (FEN1 en eucariotas) que es la
responsable de degradar los cebadores de ARN que seon desplazados por la polimerasa. Finalmente, la
ligasa que culmina el proceso en eucariotas es la ADN ligasa I.

La Figura 2.6 contiene un video que explica el proceso de replicacin de la
cadena retrasada, con los distintos complejos proteicos implicados.

Es importante entender que la replicacin del ADN no se refiere slo a la duplicacin de la doble cadena,
sino que implica tambin el ensamblaje de la cromatina a medida que el ADN se va replicando. De
hecho, durante la replicacin slo se altera el empaquetamiento de la cromatina en una pequea regin: se
estima que slo los dos nucleosomas por delante de la horquilla de replicacin se ven afectados por el
avance de la maquinaria replicativa, y que unos 300 nucletidos por detrs de la horquilla ya se vuelven a
ensamblar los nuevos nucleosomas para comenzar a formar las dos nuevas fibras de cromatina. Este re-
ensamblaje de la cromatina se produce en varias etapas, comenzando con la unin del tetrmero H3-H4
en primer lugar, seguida de la deposicin del tetrmero H2A/H2B; finalmente se aade la histona H1.
Lgicamente, es muy importante mantener la "memoria" acerca del estado en que estaba una regin de
cromatina, para que las fibras hijas que se producen tras la replicacin mantengan el mismo estado que
tena la fibra original. Como veremos, esto se consigue por modificaciones qumicas de algunos aminocidos
de las histonas, que se distribuyen por igual desde los nucleosomas de la fibra original a los nucleosomas de
las fibras recin formadas.

En el caso de molculas lineales de ADN, como los cromosomas, la replicacin de los extremos
terminales presenta un problema particular, puesto que el cebador de ARN localizado en el extremo de la
cadena retrasada no puede ser reemplazado por ADN (como ocurre en la replicacin normal). Por tanto, los
CAPTULO 2: EL ADN EN EL NCLEO 17
cromosomas estaran sujetos a una degradacin progresiva de sus extremos con cada divisin celular, y
esto sera letal en clulas que se dividen muchas veces a lo largo de la vida de un individuo. Para evitar
esto, los cromosomas de eucariotas tienen en sus extremos unas estructuras especiales, llamadas
telmeros, que protegen los extremos libres y evitan la erosin asociada con la replicacin. Estas
estructuras estn formadas por la repeticin una pequea secuencia que est repetida mltiples veces al
final del extremo 3' de una de las cadenas de la doble hlice, cadena que por tanto ser ms larga que la
otra. Estas repeticiones, que en humanos estn formadas por el hexanucletido TTAGGG, son aadidas por
la accin de un enzima denominada telomerasa, que consta de un componente ARN y de un componente
enzimtico con actividad polimerasa de ADN dependiente de ARN. Usando el componente ARN como molde,
la telomerasa va aadiendo nuevas repeticiones TTAGGG al extremo 3' de una de las cadenas del
cromosoma. Esto posibilita que, durante la replicacin, se sintetice el cebador de ARN sobre las repeticiones
telomricas y no se pierda material gentico propio del cromosoma. Las repeticiones que se pierden por
causa de la replicacin, son despus aadidas por accin de la telomerasa, lo que asegura la integridad de
los cromosomas durante toda la vida de la clula.

La Figura 2.7 incluye un video que ilustra el problema de la replicacin de los
extremos y la accin de la telomerasa.

Una consecuencia importante de la replicacin es que el contenido total de ADN de la clula se duplica
antes de que los cromosomas se hagan visibles y se separen en la mitosis, como veremos a
continuacin. Esto es precisamente lo que hace que cada cromosoma, durante la mitosis, est compuesto
por dos cromtides hermanas pegadas. En este sentido, es importante evitar la confusin entre el nmero
de cromosomas y el contenido total de ADN de una clula. El nmero haploide de cromosomas (nmero de
cromosomas distintos, que es caracterstico de cada especie) se representa por la letra n; una clula
somtica tiene un nmero diploide (2n) de cromosomas, ya que tiene 2 copias de cada cromosoma (n
parejas de cromosomas homlogos). Antes de entrar en la fase S, una clula somtica tiene un nmero
2n de cromosomas (aunque no se ven en su forma tpica, por estar la cromatina poco condensada) y un
contenido total de ADN correspondiente a una cromtide por cromosoma: esto se representa por la cantidad
de ADN 2C. Al final de la replicacin del ADN, esa clula sigue teniendo 2n cromosomas (todava invisibles)
pero ahora tiene un contenido de ADN igual a 4C, ya que tenemos dos cromtides por cromosoma. Tras la
mitosis, la segregacin de las cromtides hermanas tiene como resultado que cada una de las clulas hijas
lleva otra vez 2n cromosomas y un contenido de ADN igual a 2C. De este modo, se mantiene el nmero de
cromosomas y la cantidad total de ADN tras las sucesivas divisiones celulares.


Formacin y segregacin de los cromosomas durante la mitosis

La cromatina es una estructura dinmica cuyo grado de empaquetamiento es mximo durante la mitosis,
y por eso en esta fase del ciclo celular se puede ver en una forma especialmente condensada que da lugar a
los cromosomas. Como hemos visto, esta condensacin se produce porque la fibra de cromatina de 300
nm se enrolla en forma de espiral, proporcionando un grado de empaquetamiento unas 5 veces mayor al
observado durante la interfase. La mitosis es el proceso de divisin de las clulas somticas, fundamental
en la proliferacin celular que tiene lugar durante el desarrollo embrionario, el crecimiento y el
mantenimiento de los tejidos. Supone una reorganizacin drstica de todos los componentes celulares, pero
muy especialmente de los cromosomas, cuya segregacin a cada una de las clulas hijas debe ser muy
precisa y estar finamente regulada y coordinada con la separacin fsica de las nuevas clulas (citoquinesis).
Durante la mitosis, la maquinaria celular se especializa en llevar a cabo los distintos procesos que tienen
18 GENTICA HUMANA
lugar en la clula: condensacin de la cromatina, formacin del huso mittico, segregacin de los
componentes y fisin celular.

La primera fase de la mitosis (profase), comienza con la condensacin de la cromatina, la ruptura de la
envuelta nuclear y el desarrollo del huso mittico. Es importante recordar que la cromatina ha sido replicada
en la fase S de la interfase previa, por lo que cada cromosoma est ahora formado por dos cromtides
hermanas. Los microtbulos se unen a los quinetocoros, estructuras proteicas formadas sobre los
centrmeros de cada cromosoma, y comienzan a transportar a los cromosomas hacia el plano ecuatorial del
huso. En la fase siguiente (metafase) cada cromosoma est unido a microtbulos procedentes de los dos
polos de la clula, de modo que todos los cromosomas estn en el ecuador del huso mittico sometidos a
fuerzas tensionales opuestas. Los mecanismos moleculares que regulan la cohesin de cromtides
hermanas comienzan a conocerse cada vez mejor, y su implicacin en patologa humana est adquiriendo
mayor relevancia. Por ejemplo, se han identificado las protenas cromosmicas necesarias para mantener la
cohesin de cromtides hermanas, que se denominan cohesinas. En eucariotas funcionan como cohesinas
al menos cuatro miembros de la familia SMC (Structural Maintenance of Chromosomes), y en Xenopus
(sapo) se ha identificado un complejo que es necesario para la cohesin y que est formado por SMC1 y
SMC3 junto con SCC1 (Sister Chromatid Cohesion 1). La cohesin se establece en la fase S del ciclo celular,
durante la replicacin del ADN, aunque las cohesinas estaban ya presentes en la cromatina. Al replicarse el
ADN, ambas cromtides quedan unidas por las cohesinas en toda su longitud, distinguindose dos tipos de
cohesin: la cohesin en los centrmeros y la cohesin en los brazos cromosmicos. Ambos tipos
de cohesin estn mediados por cohesinas, pero los procesos que los regulan son algo diferentes. El
mantenimiento de esta cohesin durante metafase es muy importante, porque es precisamente el balance
entre las fuerzas de los microtbulos y la cohesin de ambas cromtides lo que permite el alineamiento de
los cromosomas en el plano ecuatorial: la tendencia de los microtbulos a separar las cromtides se ve
contrarrestada por la cohesin que las mantiene unidas, y gracias a esta cohesin se genera la tensin
necesaria para formar la placa metafsica. Es precisamente la prdida brusca de cohesin lo que permite la
separacin de las cromtides. Lgicamente, un componente fundamental en estos procesos es el
quinetocoro, que en definitiva es el punto de cada cromosoma donde se anclan los microtbulos. Existe en
clulas eucariotas un sistema que comprueba que todos los quinetocoros estn unidos a microtbulos y
activa un punto de control que impide la separacin de las cromtides antes de conseguir la perfecta
unin de todos los quinetocoros a sus microtbulos respectivos. La metafase va seguida por la anafase, en
la que tiene lugar la segregacin de las cromtides hermanas de cada cromosoma hacia polos opuestos de
la clula. La separacin simultnea de 46 pares de cromtides hermanas en la transicin metafase-anafase
es un momento crucial del ciclo celular, y por tanto est finamente regulado. Por ejemplo, es crtico que la
cohesin se pierda en el momento adecuado, para que cada cromtide pueda migrar a una clula hija sin
errores. En general, se observa que primero se pierde la cohesin en los centrmeros, y a medida que los
microtbulos van "tirando" de los quinetocoros se va perdiendo la cohesin en los brazos. La separacin se
lleva a cabo mediante la degradacin de las cohesinas. La ltima fase de la mitosis es la telofase, en la
que los cromosomas vuelven a descondensarse y se forma la envoltura nuclear alrededor de cada uno de
los nuevos ncleos que se han formado en cada polo de la clula. Terminada la mitosis, el proceso de
divisin celular se completar con la citoquinesis, en la que los componentes celulares se reordenan y se
reorganiza el citoesqueleto para facilitar la divisn fsica de la clula en dos clulas hijas.

La Figura 2.8 contiene un video que ilustra las principales fases de la mitosis.

Dada la importancia de la separacin de las cromtides hermanas en anafase, se ha investigado mucho en
torno a su regulacin. Se sabe que la degradacin de las cohesinas se lleva a cabo por dos mecanismos
distintos: fosforilacin (mediada por la quinasa Polo) de algunos componentes, y proteolisis de otros. Las
CAPTULO 2: EL ADN EN EL NCLEO 19
protenas implicadas en la proteolisis de la cohesinas se llaman separinas ( separasas). Se ha
comprobado que las separinas son capaces de romper el complejo cohesina porque degradan la protena
SCC1 (una cohesina) durante el comienzo de la anafase, permitiendo la separacin de las cromtides por la
fuerza que ejercen los microtbulos. Cmo se activan las separinas en el momento exacto de la anafase?
Esto se ha resuelto gracias a la identificacin de las securinas, protenas que inhiben la accin proteoltica
que ejercen las separinas sobre las cohesinas. Por tanto, durante la mitosis las securinas estn unidas a las
separinas y as inhiben su accin, de modo que el complejo cohesina permanece intacto y las cromtides
permanecen unidas. La disociacin de las cohesinas se produce por la degradacin sbita de las securinas al
comienzo de la anafase, de manera que las separinas quedan libres y pueden cortar por proteolisis el
complejo cohesina. El evento crucial, por tanto, es la degradacin de securinas, degradacin que est
mediada por un complejo proteico llamado APC (Anaphase Promoting Complex) que posee actividad
ubiquitina-protein-ligasa y promueve la degradacin de diversas protenas al comienzo de la anafase.
Lgicamente, estos procesos no deben comenzar hasta que todos los quinetocoros estn correctamente
unidos a los microtbulos del huso, pues de lo contrario la segregacin de las cromtides no sera correcta.
Por tanto, existe tambin un mecanismo de sealizacin que detecta si todos los quinetocoros han sido
correctamente unidos por microtbulos y enva una seal de activacin del APC, para que d comienzo la
prdida de cohesin.

En la Figura 2.9 se explica el mecanismo de degradacin de las cohesinas.


Gametognesis y meiosis

En organismos de reproduccin sexual, la formacin de los gametos implica un modo de divisin celular
diferente al de las clulas somticas. Los gametos debern poseer una sola copia de cada cromosoma, de
modo que el cigoto resultante de la unin del gameto masculino y del gameto femenino en la fertilizacin
sea diploide (con un cromosoma de origen paterno y otro cromosoma de origen materno en cada par
cromosmico). Para obtener un nmero haploide (n) de cromosomas en los gametos, el proceso de
formacin de los mismos (gametognesis) tiene unas caractersticas especiales. La principal peculiaridad
es la existencia de un tipo distinto divisin celular en el que una clula diploide (2n) replica su ADN una vez
(duplicando su contenido total en ADN de 2C a 4C) pero experimenta dos divisiones cromosmicas; esto
tiene como consecuencia que los gametos masculino (espermatozoide) y femenino (oocito) llevan un
nmero haploide de cromosomas (n) y un contenido total de ADN igual a C (una cromtide por
cromosoma). Este modo de divisin celular se denomina meiosis, y tiene adems otras caractersticas muy
importantes para la transmisin de la variabilidad gentica. En ambas lneas germinales, masculina o
femenina, la gametognesis comienza cuando los gonocitos experimentan una serie de divisiones mitticas
tpicas en las que las clulas van madurando hasta llegar a formar las gonias (espermatogonias u oogonias,
respectivamente) y los gametocitos primarios, que son clulas diploides (2n). A partir de este momento,
las clulas replican su ADN en la fase S y a continuacin entran en meiosis, en vez de dividirse por
mitosis.

En la Figura 2.10 se presenta un esquema de la gametognesis.





20 GENTICA HUMANA


La meiosis incluye en realidad dos distintas divisiones cromosmicas, por lo que suele separarse en dos
fases llamadas meiosis I ( primera divisin meitica) y meiosis II (segunda divisin meitica). La
meiosis I es la ms importante de las dos, y comienza con una profase larga, complicada y claramente
distinta de la profase de la mitosis. Esta profase de la meiosis I (llamada, por tanto, profase I) comienza
con la condensacin de la cromatina que, no lo olvidemos, se haba replicado en la fase S precedente.
Ambas cromtides estn ntimamente unidas formando un nico filamento, que se une por sus extremos a
la membrana nuclear. Esta primera parte de la profase I se llama leptoteno. En la siguiente etapa, llamada
cigoteno, los cromosomas homlogos se emparejan longitudinalmente con gran exactitud, de manera que
las secuencias de cada uno de los dos homlogos quedan perfectamente alineadas. La unin entre los
cromosomas de cada par se hace progresivamente ms fuerte, dando lugar a un fenmeno que se conoce
como sinapsis. La sinapsis se mantiene gracias a la formacin del complejo sinaptonmico. La profase I
contina con la siguiente etapa, paquiteno, en la que los cromosomas se condensan todava ms y cada
par de homlogos apacece como un bivalente (una estructura formada por dos cromosomas) ttrada
(por estar formada por cuatro cromtides). De todas formas, el evento ms importante de la etapa de
paquiteno es el intercambio de material gentico entre cromosomas homlogos, a travs del proceso de
recombinacin que estudiaremos ms adelante. En la siguiente etapa, la de diploteno, desaparece el
complejo sinaptonmico y los cromosomas homlogos comienzan a separarse. Recordemos que hasta este
momento la clula es diploide (2n) con contenido 4C de ADN, al tener dos cromtides por cromosoma.
Durante la separacin de los cromosomas homlogos en diploteno, las dos cromtides de cada cromosoma
permanecen todava unidas entre s. Sin embargo, debido al intercambio de material gentico precedente, la
separacin pone de manifiesto los puntos en los que se produjo un sobrecruzamiento, ya que esas regiones
forman "puentes" que mantienen unidos a los dos homlogos de cada par e impiden la separacin total.
GAMETOGNESIS
Gametocitos Primarios
Gametocitos Secundarios
Corpsculo
Polar
Primario
Gametos
Espermatozoides Ovulo
Corpsculo
Polar
Secundario
2n / 4C
n / 2C
n / C
Espermatocitos Secundarios Oocito Secundario
GAMETOGNESIS
Gametocitos Primarios
Gametocitos Secundarios
Corpsculo
Polar
Primario
Gametos
Espermatozoides Ovulo
Corpsculo
Polar
Secundario
2n / 4C
n / 2C
n / C
Espermatocitos Secundarios Oocito Secundario
CAPTULO 2: EL ADN EN EL NCLEO 21
Estos puntos se denominan quiasmas, y han de resolverse de algn modo para que la separacin de los
cromosomas pueda completarse. Por tanto, la profase I termina con una etapa corta denominada
diaquinesis, en la que la cromatina alcanza su grado mximo de condensacin y los cromosomas aparecen
ms cortos y gruesos.

Tras la profase I, los espermatocitos primarios entran ahora en metafase I, en la cual desaparece la
membrana nuclear, se forma el huso y los microtbulos traccionan por los quinetocoros. Esto hace que los
bivalentes, que llevan los cromosomas parcialmente separados (unidos nicamente por los quiasmas), se
orienten en el ecuador de la clula. Debido a esta configuracin, los cromosomas homlogos se sitan en la
placa metafsica con los centrmeros apuntando cada uno hacia uno de los polos de la clula. En la
anafase I, la traccin de los microtbulos y la activacin del Complejo Promotor de la Anafase permiten
la separacin total de cada cromosoma homlogo hacia uno de los polos, fenmeno llamado disyuncin.
Finalmente, en la telofase I se han formado ya dos grupos de cromosomas en cada polo de la clula: cada
uno de estos grupos consta de un nmero haploide (n) de cromosomas, cada uno de los cuales posee dos
cromtides (contenido total de ADN igual a 2C). La meiosis I termina con la citoquinesis, la divisin fsica
de las dos clulas hijas. Esta ltima fase es diferente en la lnea germinal masculina y femenina, porque as
como las clulas hijas del espermatocito primario son iguales, en el caso de la lnea femenina una de las dos
clulas hijas se lleva casi todo el citoplasma mientras que la otra es mucho menor. Por tanto, en la
espermatognesis cada esperamatocito primario da lugar a dos espermatocitos secundarios,
mientras en la oognesis cada oocito primario da lugar a un oocito secundario y a un corpsculo
polar de primer orden.

La segunda divisin meitica, meiosis II, es prcticamente igual a una mitosis. La nica diferencia
estriba en que la clula que se divide es haploide, mientras que en el caso de la mitosis la clula es diploide.
Por tanto, esta divisin celular va a separar las dos cromtides que componen cada cromosoma de un
gametocito secundario, para generar gametos con un nmero haploide de cromosomas (n), cada uno de los
cuales est formado por una sola cromtide (contenido total de ADN igual a C). Como decamos al principio,
esto asegura que la fecundacin da lugar a un cigoto diploide (2n) con contenido de ADN igual a 2C, al
recibir un complemento cromosmico de cada gameto. El modo en que se completa la meiosis es tambin
diferente en ambos sexos. As como la espermatognesis discurre de un modo continuo desde que se
alcanza la madurez sexual, la oognesis se detiene en profase I, de manera que un alto nmero de oocitos
primarios permanecen en un estado prolongado de diploteno, llamado dictioteno. Estos oocitos slo
proseguirn su maduracin al llegar la madurez sexual, cuando con cada ciclo menstrual un oocito culmina
la meiosis I y completa tambin la meiosis II para dar un oocito secundario (vulo) y un segundo
corpsculo polar.

La Figura 2.11 incluye un video en el que se muestran esquemticamente las
distintas fases de la meiosis.

Es importante fijarse en un hecho distintivo de la anafase de la meiosis I, que no comparten ni la
anafase de la meiosis II ni la anafase de la mitosis. Este hecho consiste en que los cromosomas homlogos
se separan pero, al mismo tiempo, las dos cromtides de cada cromosoma, por la accin de unas molculas
llamadas shugoshinas, deben permanecer unidas por los centrmeros. Esto se consigue porque las
cohesinas centromricas no son degradadas por las separasas. Las shugoshinas se unen
especficamente a los centrmeros y, por su asociacin con una fosfatasa, impiden la fosforilacin de las
cohesinas a ese nivel, lo cual a su vez impide que las cohesinas sean degradadas por las separasas.
22 GENTICA HUMANA
Despus, en la meiosis II, la ausencia de shugoshinas permite una segunda ola de activacin de separasas
que finalmente llevar a la separacin completa de las dos cromtides de cada cromosoma homlogo.

Al margen de lo dicho en relacin con la reduccin del nmero total de cromosomas en los gametos, la gran
importancia de la meiosis reside en que es uno de los principales mecanismos de creacin de variabilidad
gentica. Esto sucede a dos niveles, primero por la segregacin aleatoria de los cromosomas de cada
progenitor a los gametos, y en segundo lugar por el intercambio de material gentico que tiene lugar
durante los procesos de recombinacin. Respecto a lo primero, es fcil comprender que cada divisin
meitica producir gametos con distintas combinaciones de los cromosomas que estaban en la clula
diploide original, ya que la segregacin se produce al azar. Para entender esto es til imaginarse todos los
cromosomas de una clula diploide como la suma de dos conjuntos haploides, el paterno y el materno. As,
cada pareja de cromosomas homlogos consta de un homlogo de origen paterno y otro de origen materno.
Cuando los homlogos se separan en la meiosis, no pasan todos los de origen paterno a una de las clulas
hijas, y todos los de origen materno a la otra; por el contrario, se distribuyen aleatoriamente. Como los
homlogos pueden tener pequeas diferencias en los alelos presentes para algunos genes, el resultado es
que cada gameto lleva una combinacin nica de cromosomas de origen paterno y materno
mezclados. La variabilidad que se puede generar por este sencillo mecanismo es altsima, porque con 23
parejas de cromosomas el nmero de combinaciones posibles es igual a 2
23
, lo que es lo mismo
8.388.608. Por lo que respecta al segundo tipo de variabilidad introducida durante la meiosis, en la especie
humana se ha calculado que se producen unos 55 sobrecruzamientos por clula, porque ese es el nmero
medio de quiasmas que se observan. Esto supone una media de al menos 2 sobrecruzamientos por par
cromosmico, incluidos los cromosomas sexuales. La presencia de estos quiasmas es importante para
mantener los bivalentes unidos hasta anafase I, y asegurar que la disyuncin se produce de modo correcto.
Pero adems, es probable que el nmero total de eventos de recombinacin sea todava mayor al nmero
de quiasmas, porque no todas las recombinaciones producen un sobrecruzamiento (como se ver en el
apartado siguiente). Por tanto, el grado de intercambio de material gentico entre cromtides de
cromosomas homlogos es bastante alto, y hace que los cromosomas que finalmente llegan a un gameto
sean ligeramente distintos a los cromosomas que estaban presentes en la clula inicial. Como resultado de
esto, la variabilidad gentica generada durante la meiosis es alta, y por eso la probabilidad de que dos
individuos tengan dos descendientes genticamente idnticos es prcticamente nula. Esto es precisamente
lo que persigue la reproduccin sexual: generar descendientes distintos a sus progenitores y distintos entre
s.


Recombinacin a nivel molecular

Uno de los temas ms importantes en gentica es la caracterizacin de los mecanismos moleculares por los
que se produce intercambio de material gentico entre cromtides durante la meiosis. Distintos modelos
han intentado explicar cmo dos molculas de ADN homlogas pueden entrecruzarse e intercambiar
material gentico. El paso inicial comn a todos los modelos propuestos es el alineamiento preciso de
ambas molculas, precisamente debido a que son cadenas de ADN homlogas, es decir, pertenecientes a
cromosomas homlogos y por tanto con la misma secuencia de nucletidos. En realidad, hoy sabemos que
ambas molculas no son absolutamente idnticas, ya que pueden existir diferencias allicas en su secuencia
(por ejemplo, pequeas diferencias de un nucletido). En cualquier caso, el alineamiento de dos secuencias
homlogas es un requisito imprescindible para que se inicie el proceso de recombinacin, que se denomina
por eso recombinacin homloga. Dicho alineamiento, como es lgico, se produce durante la profase I de
la meiosis merced al complejo sinaptonmico que mantiene estrechamente unidos los cromosomas
CAPTULO 2: EL ADN EN EL NCLEO 23
homlogos en toda su longitud. Es lgico pensar que dicha configuracin permite que dos molculas de ADN
de secuencia homloga se mantengan en contacto.

Los primeros modelos de recombinacin proponan que, tras el alineamiento, ambas molculas de ADN
sufren una mella en una de sus cadenas, exactamente en la misma posicin, y esto deja dos cadenas
"libres" que se intercambian entre s y se unen a la molcula homloga por complementariedad de bases.
Dado que la generacin de dos mellas simultneas en la misma posicin es un evento muy improbable,
Meselson y Radding propusieron otro modelo en el que una sola mella en una de las dos molculas es
suficiente para iniciar el proceso de recombinacin, ya que la cadena libre puede invadir la doble hlice
homloga. Los estudios llevados a cabo en distintas especies de eucariotas en los ltimos aos han
demostrado que la recombinacin se inicia por la aparicin de una rotura completa de una de las dos
molculas homlogas, es decir, una rotura bi-catenaria (de las dos cadenas de una doble hlice). Dichas
lesiones, llamadas DSB (Double-Strand Break en ingls), se generan con cierta frecuencia en el ADN celular
en respuesta a diversas causas; parece comprobado que la creacin especfica de un DSB durante profase I
es el proceso iniciador de la recombinacin.

Segn el modelo actual de recombinacin homloga, en este proceso intervienen una serie de complejos
proteicos:
- Complejo RAD50, formado por las molclulas MRE11, RAD50 y NBS1.
- El complejo RAD52, que incluye varios componentes (RAD51, RAD52, RAD54, RAD55 y RAD57 entre
otros).
- La molcula RPA (la misma protena A de la replicacin).

Tras la creacin de un DSB, los extremos libres son procesados mediante la actividad exonucleasa del
complejo RAD50, que acta en direccin 53 y por tanto genera extremos libres ms largos en la hebra
3'. Este extremo protruyente se recubre de RPA, RAD51 y otras molculas del complejo RAD51 para
formar un filamento nucleo-proteico. Este filamento tiene la capacidad de invadir la doble hebra homloga,
abriendo en ella una burbuja, y se empareja a la cadena complementaria que discurre en direccin
antiparalela. A partir de este extremo 3' se extiende la cadena usando la hebra complementaria como
molde, al tiempo que tambin se extiende tambin el otro extremo que haba quedado libre. Tras una corta
extensin, los extremos libres se unen por accin de una ligasa y esto genera dos estructuras en las que
una hebra salta de una molcula de ADN a la molcula homloga. Dichas estructuras se denominan
estructuras de Holliday, que fue el primero en proponer su existencia. Es importante tener en cuenta que
si las dos molculas de ADN no son inicialmente idnticas en su secuencia, durante el proceso de
recombinacin se pueden formar molculas hbridas, en las que ambas cadenas no son idnticas. Dichas
molculas de ADN se llaman heteroduplex, y son muy importantes porque los desemparejamientos son
corregidos por un mecanismo de reparacin que se estudiar en otro captulo; dicha correccin hace que
una de las dos cadenas se modifique para hacerse perfectamente complementaria a la otra, en un proceso
llamado conversin gnica. Como veremos en otras partes de este texto, la conversin gnica es un
mecanismo que da lugar a varias enfermedades genticas en humanos.

Las estructuras de Holliday dan lugar unas estructuras cruciformes formadas por dos molculas de ADN,
llamadas tambin estructuras chi, que han de resolverse de algn modo para permitir la separacin de las
dos cromtides. La resolucin de las estructuras de Holliday puede hacerse segn un plano vertical o segn
un plano horizontal, y es precisamente el tipo de resolucin que se lleva a cabo lo que determina el tipo de
molculas que se generan. Por ejemplo, si las dos estructuras de Holliday se resuelven segn planos
distintos, las molculas resultantes van a dar lugar a un sobrecruzamiento (la configuracin que da lugar
a los quiasmas que se ven en la meiosis); en cambio, cuando las dos estructuras de Holliday se resuelven
24 GENTICA HUMANA
segn el mismo plano se producir recombinacin sin sobrecruzamiento. A su vez, cada una de estas
dos posibilidades puede darse con sin conversin gnica, dependiendo de la presencia de heteroduplex
y del modo en que se reparan.

La Figura 2.12 muestra esquemticamente el modelo de recombinacin
iniciado por una rotura bicatenaria en uno de los cromosomas homlogos, as
como la resolucin de las estructuras de Holliday y los posibles resultados de
los procesos de recombinacin.



Curiosamente, el modelo de recombinacin iniciado por una rotura bicatenaria en una cadena es fruto de los
estudios de reparacin de este tipo de lesiones en eucariotas. Como veremos en otro captulo, las roturas
bicatenarias son un tipo frecuente de agresin al ADN, y son reparados en clulas somticas precisamente
por un mecanismo de recombinacin homloga que tiene lugar durante la fase S del ciclo celular. En los
ltimos aos se ha visto que este mismo mecanismo explica tambin las predicciones acerca de la
recombinacin durante la meiosis, y que de hecho la maquinaria proteica responsable es bsicamente la
misma. Por tanto, hoy en da se considera como un mismo mecanismo que se ha adaptado a dos
funciones celulares importantes como la reparacin del ADN y la generacin de variabilidad
gentica durante la formacin de los gametos. Ms recientemente, se ha sugerido que la
recombinacin homloga tambin puede tener otra funcin importante: la reiniciacin de la replicacin
del ADN. A menudo, la horquilla de replicacin se para prematuramente durante la sntesis de ADN y toda la
maquinaria replicativa se desensambla; antes se pensaba que estas horquillas interrumpidas se reinician
por el ensamblaje de un nuevo complejo de replicacin en ese punto, pero cada vez hay ms datos a favor
de la hiptesis de que la replicacin se reinicia en esas horquillas por un fenmeno de recombinacin
homloga. Dicha recombinacin podra darse entre las dos cromtides hermanas idnticas (la cromtide con
la horquilla interrumpida y la que se ha originado por la replicacin hasta ese punto), que sera lo normal, o
bien puede darse entre cromtides de cromosomas homlogos, en cuyo caso se originara un fenmeno de
recombinacin homloga con posible sobrecruzamiento. De hecho, algunos autores han sugerido que,
NO sobrecruzamiento SI sobrecruzamiento
NO conversin
SI conversin
NO conversin
SI conversin
T
A G
C
G
C
G
C
T
A G
C
G
C
G
C
h/h h/h
T
G
A
C
G
C
G
C T
G
A
C
G
C
G
C
h
v
h
v
h/v h/v
T
A G
C
G
C
G
C
T
A G
C
G
C
G
C
CAPTULO 2: EL ADN EN EL NCLEO 25
originalmente, la principal funcin del mecanismo de recombinacin fue precisamente la reparacin de
horquillas de replicacin interrumpidas.

26 GENTICA HUMANA
CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 27
Captulo 3. Tcnicas bsicas de gentica molecular.
Tecnologa del ADN recombinante: mtodos y usos ms frecuentes. Enzimas
de restriccin. Amplificacin in vitro de ADN (PCR). Secuenciacin del ADN.
Tcnicas bsicas de hibridacin de cidos nucleicos. Microarrays.


Tecnologa del ADN recombinante: mtodos y usos ms frecuentes

A principios de los aos 1970 se desarrollaron una serie de tcnicas que dieron lugar a lo que se llam
"ingeniera gentica", "clonacin molecular" "tecnologa del ADN recombinante". Bsicamente, esta
tecnologa naci como respuesta a la necesidad de obtener grandes cantidades de un gen genes, o incluso
genomas completos, para poder llevar a cabo los estudios que permitiesen obtener la secuencia de
nucletidos de un gen concreto, estudiar sus mutaciones, analizar su funcin, etc. El nombre de clonacin
molecular sugiere precisamente la idea de un nmero grande de copias idnticas, y se utilizaba ya en
biologa para designar poblaciones de bacterias o clulas idnticas ("clones"). Al aplicarlo a la obtencin de
copias idnticas de un cido nucleico, se convirti en clonacin molecular. El primer experimento que
mostr la posibilidad de propagar un fragmento de ADN de eucariotas en una bacteria fue la clonacin de
fragmentos del ADN ribosomal de Xenopus laevis dentro de la bacteria E. coli. Desde entonces, la tecnologa
del ADN recombinante se ha utilizado con con xito en muchos campos, desde aplicaciones con fines
industriales (dando lugar a la Biotecnologa), hasta la deteccin de alteraciones genticas, pasando por la
modificacin gentica de organismos, la terapia gnica y un largo etctera. En este captulo recordaremos
los principios generales de las tcnicas bsicas de biologa molecular; otras tecnologas ms especficas
utilizadas en Gentica Humana, como el diagnstico molecular de alteraciones genticas la terapia gnica,
se vern con ms detalle en los captulos correspondientes.

En lneas generales, la obtencin de grandes cantidades de un fragmento especfico de ADN (es decir, de un
gran nmero de copias idnticas) se lleva a cabo en varios pasos: i) obtencin de un pequeo nmero de
copias de dicho fragmento, habitualmente mediante la digestin del ADN celular con algn enzima que corte
especficamente el genoma en el punto deseado; ii) la insercin de esas copias en un "vector de clonacin",
que es un fragmento de ADN con unas propiedades especiales que le permiten multiplicarse dentro de un
husped apropiado; iii) la propagacin del nuevo fragmento "recombinante" (es decir, el fragmento hbrido
formado por la unin del inserto y el vector) dentro del husped, obteniendo un gran nmero de copias del
mismo. Esta metodologa puede tambin aplicarse a genomas completos, de forma que es posible cortar un
genoma en pequeos fragmentos y clonar cada uno de esos fragmentos por separado; la coleccin completa
de clones que representan un genoma se denomina genoteca ( biblioteca genmica). Aunque las
genotecas pueden representar genomas completos, tambin es habitual crear genotecas de fragmentos
genmicos (un cromosoma, por ejemplo, o una regin cromosmica de inters) cuando no sea posible
clonar ese fragmento debido a su gran tamao. Tambin es posible construir genotecas especializadas, en
las que los fragmentos insertados en los vectores tienen una naturaleza especfica; por ejemplo, son muy
comunes las genotecas de ADNc, en las que cada clon lleva un ADN complementario (una copia en ADN de
un ARN mensajero).

Figura 3.1 Estrategia general de clonacin molecular de un fragmento de ADN
en un vector para su propagacin en bacterias.

28 GENTICA HUMANA
Por tanto, en toda estrategia de clonacin molecular son necesarios tres elementos bsicos: un inserto, un
vector y un husped. Como hemos dicho, el inserto es el fragmento de ADN que queremos obtener en
grandes cantidades, para despus proceder a estudiarlo. Por lo que respecta al husped, lo ms habitual es
que se trate de alguna cepa de la bacteria Escherichia coli, especialmente modificada para permitir el
crecimiento de vectores con gran eficacia y fidelidad. Respecto a los vectores de clonacin, existe una gran
variedad de posibilidades, cada una con caractersticas distintas que los hacen adecuados para aplicaciones
concretas. Los primeros vectores utilizados fueron los plsmidos, que son elementos bacterianos
extracromosmicos, circulares, que se replican dentro de la bacteria husped con independencia de la
replicacin del cromosoma bacteriano. Los plsmidos utilizados en clonacin molecular son variaciones de
plsmidos nativos, que han sido modificados con el objeto de conseguir que se repliquen con mayor eficacia
(hasta cientos de copias por bacteria). Adems, tambin se ha creado en ellos una regin que se puede
cortar fcilmente con enzimas de restriccin (ver ms adelante) para introducir en ella el fragmento de ADN
de inters (es decir, el inserto). Tambin se ha introducido en ellos el gen de resistencia a algn antibitico,
que permita seleccionar las bacterias que llevan el plsmido dentro: cuando al cultivo en el que crecen las
bacterias se aade el antibitico, slo crecern aquellas que tienen el plsmido y expresan los genes del
mismo. Los plsmidos tienen una capacidad limitada, ya que permiten albergar insertos de unas 5-10
kilobases de tamao, como mximo. La necesidad de clonar fragmentos de mayor tamao hizo que se
desarrollasen otros tipos de vectores derivados del genoma del fago lambda, un virus bacterifago que
infecta bacterias introduciendo en ellas el genoma viral. Modificando el genoma nativo del fago lambda, se
han creado diversos vectores de clonacin con una capacidad mayor que la de los plsmidos (permiten
albergar insertos de tamaos en torno a las 15 kilobases), que tambin se replican en bacterias con gran
eficacia. La necesidad de clonar fragmentos todava mayores llev a desarrollar otros tipos de vectores. Por
ejemplo, los csmidos son vectores artificiales con caractersticas de plsmidos y de fagos, y tienen una
capacidad de unas 40 kilobases. Posteriormente aparecieron vectores derivados de los cromosomas de
levaduras, incluyendo secuencias necesarias para la replicacin y la estabilidad de los brazos cromosmicos.
Estos vectores se denominan Cromosomas Artificiales de Levaduras (en ingls YAC, Yeast Artificial
Chromosome), crecen dentro de levaduras y tienen una gran capacidad porque pueden albergar insertos de
hasta 2 megabases (2x10
6
pares de bases). Como veremos ms adelante, los vectores tipo YAC fueron muy
importantes para crear los primeros mapas del genoma humano, pero tienen algunos inconvenientes en su
manejo ya que los insertos a veces sufren alteraciones a medida que se multiplican dentro de las levaduras.
Por tanto, se desarrollaron otros vectores con menos capacidad pero mucho ms estables y de manejo ms
fcil, como son los vectores derivados del fago P1 o del mismo cromosoma bacteriano. Estos vectores se
denominan, respectivamente PAC (del ingls, P1-phage Artificial Chromosome) y BAC (Bacterial Artificial
Chromosome); crecen tambin dentro de bacterias y son capaces de albergar insertos de tamaos entre
100-150 kilobases. Aunque existen muchos otros tipos de vectores que se utilizan en tcnicas de clonacin
molecular, estos son los ms usados en Gentica humana, y aparecern en otros Captulos de este texto.

El proceso general de clonacin molecular se desarrolla en varios pasos. En primer lugar, es necesario
preparar el inserto y el vector de modo adecuado. Esto supone cortarlos de modo que los extremos libres
del inserto puedan unirse a los extremos del vector. De hecho, como los vectores suelen ser circulares es
necesario abrirlos en un lugar especfico en el que introducir el inserto. Todos estos cortes se llevan a cabo
con unas enzimas especiales llamada enzimas de restriccin, cuya caracterstica principal es
precisamente la capacidad de cortar el ADN en regiones especficas. Debido a la importancia de las enzimas
de restriccin en ingeniera gentica, les dedicaremos el siguiente apartado de este captulo; por ahora, es
suficiente comprender que constituyen las "tijeras" moleculares que nos permiten realizar cortes especficos
en el inserto y en el vector para que ambos tengan extremos compatibles que se puedan unir. El siguiente
paso es, precisamente, la unin de inserto y vector para formar la molcula "recombinante" o hbrida. Esta
unin la realiza un enzima denominada ADN ligasa, habitualmente procedente del fago T4. Este enzima
CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 29
tiene la capacidad de catalizar la formacin de enlaces fosfo-di-ster entre el grupo 5' fosfato y el grupo 3'
hidroxilo de dos cadenas nucleotdicas yuxtapuestas, y por tanto puede unir dos molculas de ADN
bicatenario cuyos extremos sean compatibles. Tras la reaccin de ligacin se obtiene una molcula circular
de ADN conteniendo el inserto dentro del vector, y capaz de replicarse dentro de un husped apropiado
merced a las secuencias especficas del vector. Por tanto, el siguiente paso del proceso de clonacin
molecular consiste en la introduccin de la molcula recombinante en el husped, habitualmente E. coli.
Este proceso se denomina transformacin, y puede hacerse por mtodos qumicos o fsicos. El mtodo
qumico ms empleado es el "golpe de calor" en una solucin de cloruro de calcio, tras el cual las bacterias
son capaces de permitir el acceso de molculas de ADN a su interior. Este proceso es muy ineficaz, ya que
slo una bacteria de cada 500 cada 1000 incorporar la molcula de ADN recombinante con xito; sin
embargo, las bacterias se multiplican varios rdenes de magnitud cuando crecen en cultivo, por lo que en
teora basta que la transformacin sea eficaz en tan slo unas pocas bacterias para que podamos crecerlas
en condiciones de seleccin (utilizando antibiticos especficos dependiendo del tipo de vector que usemos)
y obtener una poblacin en la que todas las bacterias contienen la molcula de ADN recombinante. Los
mtodos fsicos son ms eficaces que los qumicos, y se basan en la apertura de poros en la pared
bacteriana mediante la aplicacin de un shock elctrico, por lo que la tcnica se denomina
electroporacin. Al final del proceso, por tanto, contamos con una poblacin bacteriana compuesta por
millones de bacterias, cada una de las cuales lleva varios cientos de copias de una molcula recombinante
que contiene un fragmento especfico de ADN (el inserto original). Utilizando mtodos sencillos de
extraccin de ADN de las bacterias, es posible obtener preparaciones muy puras que contienen millones de
copias del fragmento, y esto nos permite llevar a cabo cualquier tipo de anlisis o de estudios funcionales.

La Figura 3.2 incluye enlaces a animaciones que muestran el proceso de
transformacin y la obtencin de alto nmero de copias de molculas
recombinantes.



GENOTECA
ADN GENMICO
30 GENTICA HUMANA
Enzimas de restriccin

En los aos 1950 se descubri que algunos bacterifagos (virus que infectan y destruyen bacterias) podan
infectar algn tipo concreto de bacterias pero no otros, debido a que algunas bacterias eran capaces de
digerir el ADN del fago y por tanto impedan su crecimiento. Como el fago ve "restringido" el rango de
huspedes que puede infectar, a dicho sistema se le llam sistema de restriccin. Posteriormente se
descubri que dicha restriccin se lleva a cabo gracias a unas enzimas del tipo endonucleasas, que
digieren el ADN de doble cadena tras el reconocimiento y unin a secuencias especficas en el genoma
invasor. Por tanto, dichas enzimas reciben el nombre genrico de enzimas de restriccin. Las enzimas
de restriccin tienen gran importancia para la supervivencia de las bacterias, y por ello son muy abundantes
y aparecen en todos los gneros de bacterias que se han estudiado. El descubrimiento de las primeras
enzimas de restriccin de tipo II en los aos 1970 fue clave para el desarrollo de las tecnologas del ADN
recombinante.

Las enzimas de restriccin se clasifican en 3 tipos: tipo I, tipo II y tipo III. Las enzimas de tipo I y las de
tipo III son complejos multiproteicos que reconocen secuencias especficas de ADN asimtricas, y
digieren al ADN en otra regin inespecfica alejada de la secuencia de reconocimiento, bastante alejadas en
el caso de las tipo I (desde 50 hasta varios miles de pares de bases) o menos alejadas en el caso de las tipo
III (unos 25 pares de bases). De todas formas, las enzimas de restriccin de inters en ingeniera gentica
son las de tipo II, que estn codificadas por un nico gen bacteriano y que suelen actuar en forma de
dmeros. Su caracterstica principal es que el corte endonucleoltico tiene lugar dentro de la misma
secuencia de reconocimiento por la que se unen al ADN, llamadas tambin "dianas" "sitios" de restriccin.
Hoy en da se conocen ms de 3000 endonucleasas de restriccin de tipo II, que reconocen ms de 200
dianas distintas. Las enzimas que reconocen la misma diana pero proceden de bacterias distintas se
denominan isosquizmeros; es importante conocer su existencia para no confundir endonucleasas que
tienen la misma secuencia de reconocimiento. En este sentido, es importante conocer la nomenclatura de
estas enzimas, que depende del nombre de la cepa bacteriana de la que se aislan. Por ejemplo, las enzimas
de restriccin purificadas a partir de Escherichia coli se denominan "EcoXX": las tres primeras letras (en
cursiva) designan la especie, y uno ms caracteres en mayscula (letras numeros romanos, nunca en
cursiva) designan la cepa o distinguen varias enzimas de una misma bacteria. Por lo general, las dianas de
reconocimiento de las enzimas tipo II tienen una longitud de 4 a 8 pares de bases. Lgicamente, el nmero
de posibles sitios de corte para una endonucleasa de restriccin vara inversamente a la longitud de la
diana de reconocimiento, ya que por azar es ms fcil encontrar secuencias de cuatro nucletidos que de
ocho, por poner un ejemplo. Esto es importante a la hora de predecir si un enzima concreto presentar
muchas pocas dianas en un fragmento de ADN. Una caracterstica importante de las enzimas de tipo II es
que las secuencias de reconocimiento son idnticas cuando se leen en direccin 5' 3' en cada una de las
dos cadenas de la doble hlice. Es decir, las dianas de reconocimiento de las enzimas tipo II son
secuencias palindrmicas. Existen algunas excepciones a esta regla general, sobre todo cuando las
dianas de reconocimiento tienen alguna posicin degenerada, es decir, que puede ser ocupada por dos
ms nucletidos indistintamente. Finalmente, una caracterstica comn a la mayora de las enzimas tipo II
es que cortan la cadena de ADN dentro de la secuencia de reconocimiento. Dependiendo del sitio
exacto donde corten, los extremos libres generados por el corte pueden ser de varios tipos. En primer lugar,
si la secuencia de reconocimiento est constituida por un nmero par de nucletidos y el corte se produce
exactamente en el centro, los extremos sern "romos", es decir, las dos cadenas de la molcula de ADN
tendrn la misma longitud. En cambio, en otras enzimas el punto de corte est desplazado respecto del eje
de simetra de la secuencia de reconocimiento; dada la naturaleza palindrmica de dicha secuencia, esto
genera extremos libres en los que una de las dos cadenas de la doble hlice es ms larga que la otra, que
se denominan extremos cohesivos. En las enzimas que generan extremos cohesivos, se distinguen
CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 31
adems dos tipos segn cul de las dos cadenas de la molcula de ADN es ms larga, la cadena 5' la 3';
as se habla de extremos cohesivos con "salientes" 5' 3', respectivamente. El tipo de extremos que genera
cada enzima es un factor importante en los experimentos de clonacin molecular, porque las ligasan slo
pueden unir extremos que sean compatibles, y adems los extremos cohesivos habitualmente son ligados
con mucha mejor eficacia que los extremos romos.

En la Figura 3.3 se muestran ejemplos de dianas de restriccin con extremos
romos y cohesivos, as como una animacin del proceso de corte.





Tcnicas bsicas de hibridacin de cidos nucleicos

El desarrollo del concepto de hibridacin entre molculas de cidos nucleicos ha tenido gran importancia en
el desarrollo de la ingeniera gentica, como veremos al hablar de algunas tcnicas concretas en otros
apartados de este Captulo. En sentido general, hibridacin se refiere al proceso por el que dos cadenas de
cidos nucleicos que son complementarias se unen para dar una molcula bicatenaria. Las cadenas
originales pueden ser de ADN de ARN, de modo que la hibridacin puede ser ADN-ADN ADN-ARN (es
ms infrecuente trabajar con dobles cadenas de ARN). La hibridacin es un proceso con una cintica que se
puede estudiar por las curvas de desnaturalizacin del ADN. Cuando una doble hlice se desnaturaliza
hasta la separacin completa de ambas cadenas y se retiran las condiciones desnaturalizantes, las cadenas
vuelven a reasociarse buscando las regiones complementarias: a mayor nmero de nucletidos
complementarios, la renaturalizacin es ms rpida (y la desnaturalizacin ms difcil). Como hemos visto,
la desnaturalizacin se realiza habitualmente por calor; si medimos el porcentaje de molculas
desnaturalizadas a medida que aumentan la temperatura, obtenemos una curva sigmoidea que permite
calcular la temperatura a la cual el 50% de las molculas estn desnaturalizadas. Dicha
temperatura se conoce como temperatura de fusin, abreviada Tm (de "melting" en ingls). Un fragmento

TCGACAGCTGACGCATGTATAGCTAGCGATCTAGC
AluI NlaIII Sau3AI
AGCTGTCGACTGCGTACATATCGATCGCTAGATCG
|||||||||||||||||||||||||||||||||||
5
5
GACAG CTGAC
CTGTC GACTG
||||| |||||
Extremos romos
5
5
ACGCATG TAT
TGC GTACATA
||| |||
Extremos cohesivos
(salientes 3)
5
5
AGC GATCTAG
TCGCTAG ATC
||| |||
Extremos cohesivos
(salientes 5)
32 GENTICA HUMANA
de ADN tendr una Tm caracterstica que depender de su tamao y de la composicin de bases: como los
pares entre citosina y guanina forman tres puentes de hidrgeno frente a los 2 que forman los pares
adenina-timina, un fragmento con muchos pares G:C ser ms estable y ms difcil de desnaturalizar, por lo
que su Tm ser ms alta que la de un fragmento rico en pares A:T.

Estas propiedades de desnaturalizacin e hibridacin de dobles hlices de ADN han sido explotadas para
desarrollar mtodos de laboratorio que permitan identificar la naturaleza de fragmentos de cidos nucleicos
en mezclas complejas. Por ejemplo, la digestin de ADN celular total con un enzima de restriccin produce
miles de fragmentos de distintos tamaos en el tubo de reaccin; en esas circunstancias, es posible
identificar cul de esos fragmentos es portador de una secuencia especfica utilizando tcnicas de
hibridacin. Para ello, se aade a la mezcla otro pequeo fragmento de ADN que represente la regin que
queremos identificar, se desnaturalizan todos los fragmentos y se dejan hibridar libremente. La mayor parte
de las cadenas complementarias se reasociarn para reconstruir los fragmentos originales; en cambio, la
presencia de pequeas cadenas que son perfectamente complementarias con una regin de un fragmento
grande permitir la formacin de hbridos entre la cadena pequea y la correspondiente cadena larga
complementaria. De hecho, esta reaccin se ve favorecida respecto de la reasociacin de cadenas largas
entre s, precisamente porque los fragmentos pequeos hibridan ms rpidamente. Por tanto, un pequeo
fragmento de ADN es capaz de identificar los fragmentos de una mezcla compleja que contienen secuencias
complementarias al mismo. Por este motivo, estos pequeos fragmentos se denominan sondas ("probe" en
ingls), y suelen estar constitudas por molculas de ADN de varios cientos de pares de bases. De todas
formas, en un tubo de ensayo no se ven las molculas de ADN, por lo que una sonda de ADN no ser de
gran utilidad si no es fcilmente detectable. Por este motivo, las sondas utilizadas en biologa molecular
llevan algn tipo de marcaje que permita detectar su presencia: marcaje con algn istopo radioactivo, con
un fluorocromo o con una molcula con actividad enzimtica detectable por alguna reaccin qumica. La
utilizacin de sondas de ADN marcadas ha sido uno de los pilares bsicos de la ingeniera gentica en los
ltimos decenios, y su utilizacin sigue estando muy extendida; de hecho, algunas de las tecnologas ms
recientes, como los microarrays de ADN, se basan todava en la hibridacin de sondas con fragmentos
"diana".

La Figura 3.4 muestra el proceso de hibridacin de una sonda sobre una
molcula complementaria de ADN.

Aunque los fenmenos de hibridacin se dan en solucin, la utilizacin ms habitual de sondas de ADN es la
deteccin de fragmentos de cidos nucleicos que han sido previamente inmovilizados sobre un soporte
slido. El ejemplo ms sencillo es la deteccin de un fragmento especfico de ADN celular que ha sido
digerido con un enzima de restriccin. La separacin de los fragmentos generados por la digestin puede
hacerse fcilmente mediante electroforesis en gel de agarosa o de acrilamida, sustancias porosas en la que
la velocidad de migracin electrofortica vara en funcin del tamao de los fragmentos. Una vez que los
fragmentos han sido separados, el uso de una sonda marcada nos permitir detectar el fragmento o
fragmentos que contienen la secuencia de la sonda, ya que sta hibridar especficamente en esas regiones.
Para llevar a cabo de modo sencillo la reaccin de hibridacin entre la sonda y los fragmentos digeridos que
se han separado en el gel, Edwin Southern ide un mtodo sencillo para transferir todos los fragmentos
del gel a un soporte slido de nitrocelulosa o de nylon, ms resistente y fcilmente manejable que un gel.
La transferencia crea una rplica del gel en el soporte slido (llamado filtro, por utilizarse inicialmente papel
de filtro), ya que mantiene la posicin relativa que tenan los fragmentos en el gel. Tomando nombre de su
creador, la transferencia de fragmentos de ADN de un gel a un filtro se denomina transferencia southern;
cuando los fragmentos son de ARN, en vez de ADN, las condiciones en que se realiza la transferencia
CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 33
cambian un poco, y se denomina transferencia northern (juego de palabras con "Southern", que significa
"sureo"; "northern" es "norteo"). Posteriormente, esta tcnica tambin se aplic a las protenas, tomando
entonces el nombre de transferencia western ("occidental").

La Figura 3.5 ilustra el proceso de electroforesis en gel de agarosa, as como
la transferencia de fragmentos a una membrana rgida.

Los mtodos de transferencia de cidos nucleicos a soporte slido junto con la hibridacin con sondas
marcadas han sido y siguen siendo muy utilizados en biologa molecular. Estos mismos principios se han
combinado tambin con las tcnicas clsicas de citogentica para el estudio de cromosomas, dando lugar a
las tcnicas de citogentica molecular que veremos en un captulo posterior. Otras aplicaciones de estas
tcnicas al diagnstico de alteraciones genticas en Gentica humana sern abordadas en los captulos
correspondientes.


Amplificacin in vitro de ADN (PCR)

Aunque las tcnicas de clonacin molecular proporcionan altas cantidades de un fragmento de ADN, son
tcnicas laboriosas, con incubaciones largas: un experimento tpico de clonaje lleva unos dos das. Hacia
finales de los aos 1980 se describi una metodologa nueva que permita amplificar selectivamente una
regin concreta de ADN, de modo que partiendo de cantidades iniciales pequesimas (tericamente, una
sola copia del fragmento) podran obtenerse varios miles de millones de copias. El mtodo se desarrolla en
un periodo de pocas horas y no incluye ningn paso de digestin, ligacin ni transformacin, sino que se
basa en la accin cclica de una polimerasa de ADN que amplifica selectivamente la regin de inters y
ninguna otra. Por este motivo, el mtodo se conoce como reaccin en cadena de la polimerasa
(abreviado PCR, en ingls Polymerase Chain Reaction).

El punto central de la tcnica de PCR es la sntesis de ADN desde un punto concreto, repetida durante un
nmero elevado de veces (ciclos). Por tanto, hay dos elementos esenciales de la tcnica: i) conseguir que la
amplificacin se limite exclusivamente a la regin genmica de inters, y ii) utilizar algn tipo de
polimerasa que permita repetir el proceso de sntesis de ADN muchas veces. Por lo que respecta al primer
punto, la tcnica utiliza algo que ya era conocido, como es la capacidad de las polimerasas de ADN de
catalizar la sntesis de ADN a partir del extremo 3' libre de un oligonucletido que est unido a una cadena
complementaria ms larga, la cual acta como molde de la sntesis. Este proceso, habitual en la replicacin
del ADN celular, puede reproducirse en el laboratorio utilizando pequeas molculas de ADN
complementarias a una regin concreta de una doble cadena ms larga. Como es sabido, una de las formas
de desnaturalizar el ADN (es decir, separar las dos cadenas de una doble hlice) es mediante calor; como
veremos en el siguiente apartado, la temperatura necesaria para alcanzar dicha desnaturalizacin depende
de la secuencia de la molcula, pero a partir de los 92-94 C la prctica totalidad de las molculas estarn
desnaturalizadas. Si se desnaturaliza una molcula de ADN, obtendremos dos cadenas libres; al dejar
enfriar la preparacin, ambas molculas vuelven a unirse por complementariedad de bases hasta que el
ADN se re-naturaliza por completo. Este proceso es lento, por lo que si la re-naturalizacin se lleva a cabo
en presencia de pequeos oligonucletidos cuya secuencia es complementaria a alguna porcin de la
molcula larga original, estas pequeas molculas se unirn rpidamente a la regin complementaria de la
molcula larga antes de que sta llegue a re-naturalizarse. El resultado es que cada una de las cadenas
originales se mantiene monocatenaria excepto en la regin en que se ha unido el oligonucletido. En esa
regin, una polimerasa de ADN puede sintetizar a partir del extremo 3' libre de la molcula pequea,
34 GENTICA HUMANA
usando como molde la secuencia de la molcula grande. Por este motivo, las molculas cortas que inician la
sntesis de ADN se llaman cebadores (primers en ingls). Si utilizamos dos cebadores, cada uno de ellos
complementario a cada una de las dos cadenas de la molcula original de ADN, habr dos procesos de
sntesis simultneos en direcciones opuestas, y al final tendremos dos cadenas bicatenarias de ADN con la
misma secuencia que la molcula original. Es fcil ver que, precisamente, es la posicin de los cebadores la
que determina cul regin de la molcula larga se va a amplificar, ya que slo la secuencia que queda
comprendida entre los dos cebadores va a ser amplificada.

El video de la Figura 3.6 muestra la desnaturalizacin, unin y extensin de
un cebador sobre una regin especfica de ADN.

Los elementos necesarios para llevar a cabo una reaccin de PCR, por tanto, son el ADN molde original que
se quiere amplificar, los cebadores, la polimerasa de ADN y nucletidos libres que se incorporan a la cadena
naciente durante la sntesis. Por lo que respecta al ADN molde, una de las grandes ventajas de la PCR es
que puede utilizarse ADN relativamente impuro, e incluso es posible usar clulas o bacterias completas,
sangre impregnada en papel de filtro, etc. En cualquier caso, la pureza del ADN molde asegura un buen
funcionamiento de la reaccin. Adems, las cantidades necesarias son pequeas, no deben superar los 100-
200 ng por reaccin; se estima que con estas cantidades de ADN genmico total se puede amplificar un gen
que est en una sola copia en el genoma. Los cebadores son oligonucletidos sintticos monocatenarios,
con un grupo hidroxilo 3' a partir del que se sintetiza la nueva cadena de polinucletidos. La caracterstica
ms crucial de un cebador es su especificidad, es decir, que slo se pueda unir a una regin concreta del
ADN molde. Esto va a asegurar que slo se amplifique la regin de inters; por el contrario, si los cebadores
se unen inespecficamente en zonas distintas a la deseada, la PCR produce resultados difcilmente
interpretables. Esto es especialmente importante cuando el ADN molde representa un genoma completo, o
fragmentos cromosmicos grandes. Para asegurar este parmetro, se utilizan cebadores con una tamao
mnimo de 17 nucletidos, ya que se estima que esta longitud es suficiente para reconocer una sola
secuencia en un genoma eucariota. En efecto, la probabilidad de encontrar por azar una secuencia de 17
nucletidos es 4
17
= 1,7 x 10
10
. Como los genomas de mamferos tienen en torno a 3 x 10
9
nucletidos, esto
supone que un cebador de 17 nucletidos en teora puede identificar una secuencia nica dentro de un
genoma de ese tamao. Evidentemente, pueden utilizarse cebadores ms largos, dependiendo de otros
factores que se comentarn ms adelante, pero los cebadores utilizados en reacciones de PCR tpicas estn
en un rango de tamaos entre los 17 y 25 nucletidos. La polimerasa de ADN utilizada es la responsable
de la extensin de la nueva cadena de ADN a partir de un cebador. El tipo de polimerasa utilizado viene
determinado por las caractersticas de la propia reaccin de PCR. Como la reaccin ha de someterse a
numerosos ciclos de desnaturalizacin-renaturalizacin, la actividad enzimtica de la polimerasa se destruye
con cada etapa de calentamiento para desnaturalizar el ADN, por lo que sera necesario aadirla
nuevamente al comienzo de cada ciclo. Esta dificultad se ha superado por el descubrimiento de polimerasas
de ADN que son termoestables, es decir, pueden soportar elevadas temperaturas durante largo tiempo sin
perder su actividad. Las bacterias que viven en aguas termales, como la especie Thermus aquaticus,
sobreviven en temperaturas cercanas a los 100 C y contienen polimerasas termoestables. De ah que la
polimerasa ms frecuentemente utilizada en las reacciones de PCR se denomine polimerasa Taq, para
indicar su origen. La polimerasa Taq requiere la presencia de in magnesio como cofactor, por lo que todas
las soluciones utilizadas deben llevar este elemento. La temperatura ptima de polimerizacin de la Taq es
de 72 C: a esa temperatura se incorporan unos 100 nucletidos por segundo. Adems, la Taq carece de la
actividad exonucleasa 3' 5' que tienen otras polimerasas. Finalmente, los nucletidos libres, necesarios
para sintetizar las nuevas cadenas, tienen una buena resistencia al calor y su vida media es de ms de 40
ciclos de calentamiento. Como se trata de sintetizar ADN, se utilizan desoxi-nucletidos trifosfato (dATP,
CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 35
dCTP, dGTP y dTTP), que pueden incorporarse al extremo 3' de una cadena creciente por su grupo fosfato
5'.

Teniendo en cuenta todo lo dicho hasta el momento, podemos esquematizar una reaccin de PCR como un
proceso cclico, repetitivo, en el que cada uno de los ciclos est constituido por 3 fases: desnaturalizacin,
hibridacin y extensin. La fase de desnaturalizacin, como su nombre indica, consiste en someter la
reaccin a una temperatura de 94 C durante 1 minuto, para asegurar que todas las molculas de ADN
molde se han desnaturalizado y estn en estado monocatenario. Realmente, la desnaturalizacin es
prcticamente instantnea cuando toda la mezcla alcanza esa temperatura, pero la inercia trmica hace que
haya que mantener la temperatura de desnaturalizacin durante unos segundos. No es bueno prolongarla
demasiado, porque esto daa el ADN molde y reduce la actividad de la Taq. La siguiente fase de cada ciclo
debe permitir la hibridacin de los cebadores con sus secuencias complementarias en el ADN molde, y por
eso se llama fase de hibridacin. En este sentido, "hibridar" es formar una molcula bicatenaria de ADN a
partir de la unin de dos molculas monocatenarias que tienen secuencias complementarias. Para llevar
esto a cabo, es necesario disminuir la temperatura de la reaccin, de modo que los cebadores se unan a sus
dianas pero las cadenas largas de la molcula original no lleguen a reasociarse entre s. La temperatura a la
que se realiza la hibridacin depende de la secuencia de los cebadores, pero suele estar entre 55C y 65C,
y se mantiene en torno a 1 minuto. La ltima etapa de un ciclo tpico se denomina fase de extensin,
porque en ella la polimerasa extiende los dos cebadores tomando como molde las secuencias de las cadenas
originales, incorporando los desoxi-nucletidos que estn presentes en la mezcla de reaccin. Por la
temperatura ptima de la polimerasa, esta fase se realiza a 72C, durante un tiempo variable dependiendo
de la longitud del fragmento amplificado (entre 30 segundos y 2 minutos, en condiciones estndar). Una
reaccin tpica de PCR consta de 30-35 ciclos como el descrito. Adems, suele ir precedida por un breve
periodo de desnaturalizacin de unos 3 a 5 minutos, para asegurar que todo el ADN est desnaturalizado
antes del primer ciclo, y una fase final de extensin (unos 5 a 10 minutos a 72C) para extender todas las
molculas que hayan quedado incompletas. Es fcil ver que, tericamente, en cada ciclo se duplica el
nmero de molculas de ADN de la regin especfica que queremos amplificar; por tanto, el nmero de
molculas presentes en un ciclo dado es de 2
n
, siendo n el nmero de ciclo. Por ejemplo, si partimos de una
sola molcula inicial de ADN, tras 10 ciclos tendremos 1.024 copias, tras 20 ciclos tendremos 1.048.576
copias, y tras 30 ciclos tendremos 1.073.741.824 de copias de la molcula original. De todas formas, no
todas las molculas sern idnticas, porque en cada ciclo se generan molculas que llevan cadenas largas
que sobrepasan el lmite de uno de los cebadores. Estas molculas aumentan en progresin aritmtica (se
crean dos con cada ciclo), mientras que los fragmentos especficos comprendidos por los dos cebadores
aumentan exponencialmente a partir del tercer ciclo. Por ejemplo, en una PCR de 35 ciclos tendremos
34.359.738.368 copias (2
35
), de las que 70 corresponden a molculas largas y el resto corresponden al
fragmento de inters. Este aumento exponencial se observa tambin experimentalmente, cuando se
cuantifica la cantidad de ADN total despus de cada ciclo; tras una fase inicial ms lenta, tiene lugar una
fase de aumento exponencial (una lnea recta cuando se representa en escala logartmica), y una fase final
(a partir del ciclo 32-35, ms o menos) en la que se alcanza una meseta y la amplificacin se detiene por
agotamiento de los reactivos y prdida de actividad de la polimerasa.

La Figura 3.7 lleva a una animacin que muestra los primeros ciclos de una
PCR y permite calcular el nmero de molculas que se generan por ciclo.

Lgicamente, la realizacin de una reaccin de PCR requiere un equipamiento apropiado que permita llevar
a cabo los ciclos de modo automtico. Inicialmente, se utilizaban baos separados, cada uno a una
temperatura distinta (desnaturalizacin, hibridacin y extensin) y los investigadores deban pasar los tubos
36 GENTICA HUMANA
de reaccin de un bao a otro a los tiempos apropiados. Pronto se desarrollaron mquinas que tienen una
placa metlica, con capacidad para un alto nmero de tubos, cuya temperatura puede variarse con gran
rapidez y precisin, estando todo el proceso controlado por un microprocesador. Estas mquinas, llamadas
termocicladores ( cicladores trmicos), permiten programar las condiciones de tiempo, temperatura,
nmero de ciclos, etc, de modo que el operador slo tiene que introducir los tubos y esperar al final de la
reaccin, que suele durar en torno a los 60-90 minutos con los termocicladores modernos.

Las aplicaciones de la tcnica de PCR han sido mltiples desde su aparicin; a lo largo de este libro veremos
su uso en la deteccin de alteraciones genticas que causan enfermedades. La descripcin de los posibles
usos en diferentes estrategias de anlisis gentico y en biotecnologa, est ms all del objetivo de este
apartado, en el que se ha pretendido nicamente introducir en esta tcnica a aquellos que no la conocen. En
cualquier caso, es importante resear una de las variantes ms utilizadas, como es la amplificacin de
fragmentos de ARN mensajero. En este caso, en vez de utilizar ADN como molde para la amplificacin, se
usa una molcula de ADN que es copia de un ARNm, obtenida por un proceso que se llama
retrotranscripcin: gracias a la actividad transcriptasa reversa de la polimerasa de algunos virus (una
ADN polimerasa dependiente de ARN), se puede sintetizar una molcula de ADN complementaria a una
molcula de ARN. Por tanto, si queremos amplificar selectivamente un ARNm, es preciso obtener primero un
ADN complementario (llamado ADNc) haciendo una retrotranscripcin del ARNm, y despus ese ADNc ya se
puede amplificar por PCR como cualquier otro fragmento de ADN. Por este motivo, esta variante de la
tcnica se llama RT-PCR (retrotranscripcin-PCR). Es una tcnica muy utilizada y de gran inters cuando se
quiere trabajar con las secuencias de los genes ya procesados, prescindiendo de los intrones, y supuso un
gran avance porque hasta su aparicin era muy difcil estudiar ARN mensajeros.


Secuenciacin del ADN

Desde el descubrimiento de la estructura del ADN y del cdigo gentico, una de las herramientas ms
importantes para identificar genes y predecir su funcin ha sido la determinacin de la secuencia de
nucletidos que constituye cada gen. En las ltimas dcadas, la tecnologa de secuenciacin del ADN ha sido
determinante para poder llevar a cabo los distintos "proyectos genoma", cuya finalidad es obtener la
secuencia completa de nucletidos del genoma completo de una especie. Hoy en da, adems, un aspecto
crucial de la investigacin gentica es la determinacin de pequeas variaciones interindividuales, lo que
requiere la secuenciacin de una misma regin en distintos individuos. Por tanto, los mtodos actuales de
determinacin de la secuencia de nucletidos de un fragmento de ADN son muy variados, y los desarrollos
tecnolgicos recientes han dado lugar a un gran abanico de tcnicas diseadas para responder a distintas
necesidades. De todas formas, todas las tecnologas son de algn modo tributarias del mtodo original
ideado por Fred Sanger y Alan Coulson a finales de los aos 1970. Este mtodo se conoce como el
mtodo de "terminacin de cadenas" "di-desoxi", porque se basa en la interrupcin del proceso de
extensin de un cebador, dando lugar a cadenas de todas las posibles longitudes, puesto que cada una ha
sido interrumpida en una posicin distinta; la separacin de las cadenas de distintos tamaos y la deteccin
de cul nucletido llevan en su extremo 3' nos permite deducir la secuencia de la molcula original.

El primer elemento de toda reaccin de secuenciacin es, lgicamente, el fragmento de ADN cuya
secuencia queremos leer; precisamente, este fragmento sirve como molde para la sntesis de ADN a partir
de un cebador especfico que se une a l por complementariedad de bases, y esto es lo que nos va a
permitir deducir la secuencia de nucletidos del fragmento. Aunque inicialmente era necesario convertir el
fragmento de ADN a su forma monocatenaria, clonndolo un tipo especial de vectores, hoy en da puede
utilizarse ADN de doble cadena, bien sea en forma de plsmidos (cuyo inserto queremos secuenciar) o como
CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 37
productos de PCR. Al igual que en el caso de la PCR, otro elemento necesario es el cebador que va a iniciar
la sntesis de ADN desde el punto donde queremos empezar a leer la secuencia del fragmento original.
Ntese que aqu slo vamos a utilizar un cebador (en vez de dos, como en la PCR) ya que no queremos
amplificar una regin, sino simplemente sintetizar nuevas cadenas de ADN a partir de un punto concreto.
Como toda reaccin de sntesis de ADN, tambin es necesaria la presencia de una polimerasa de ADN que
tenga buena procesividad y fidelidad (es decir, que no introduzca errores en la nueva cadena). El punto
clave de este mtodo de secuenciacin est en los nucletidos libres presentes en la reaccin, que se van
a ir incorporando a la nueva cadena sintetizada por la polimerasa a partir del extremo 3' del cebador;
adems de 2'-desoxi-nucletidos tpicos en su forma tri-fosfato, este mtodo incorpora a la mezcla de
reaccin unos nucletidos especiales que actan como "terminadores" de la sntesis. Los terminadores son
nucletidos modificados qumicamente que carecen adems del grupo hidroxilo 3' por el que crece la
cadena, de ah su nombre de di-desoxi-NTP (abreviado como ddNTP), ya que corresponden a la forma
2',3'-di-desoxi de cada nucletido tri-fosfato.

La Figura 3.8 contiene enlaces a animaciones y videos que ilustran el mtodo
original de secuenciacin de Sanger.

La reaccin de secuenciacin, una vez que tenemos los distintos componentes mezclados en cantidades
adecuadas, procede del siguiente modo. En primer lugar, el fragmento a secuenciar se desnaturaliza para
separar las dos cadenas y permitir que el cebador acceda a su regin complementaria especfica. Tras
permitir la hibridacin del cebador con la cadena molde respectiva, la polimerasa comienza a extender el
cebador incorporando nucletidos complementarios a los de la cadena molde. Como en la reaccin estn
presentes desoxi-NTPs y didesoxi-NTPs, en cada posicin es posible incorporar uno u otro. En el caso de
incorporar un dNTP, la cadena seguir extendindose normalmente, ya que el nuevo nucletido proporciona
el grupo hidroxilo 3' necesario para formar un nuevo enlace fosfo-di-ster con el grupo fostato de un nuevo
nucletido; en cambio, si el nucletido incorporado es un ddNTP, la sntesis de la cadena terminar
en esa posicin, ya que no existe el grupo hidroxilo 3' necesario para continuar la elongacin.
Lgicamente, esto suceder para cada posicin, de modo que mientras la sntesis avanza (porque se han
incorporado dNTPs) en cada nueva posicin existe la posibilidad de que la cadena se termine en ese punto.
Al final, tendremos una coleccin de fragmentos de todos los posibles tamaos, con una diferencia de
longitud de 1 nucletido; cada fragmento estar terminado por el nucletido complementario al que estaba
en la cadena molde original en esa posicin. Cuando la reaccin de secuenciacin ha sido completada, slo
nos resta separar de alguna forma todos los fragmentos de los distintos tamaos y ver en qu nucletido
est terminado cada uno de ellos, de modo que as podremos reconstruir la secuencia original. Los mtodos
para separar los fragmentos y leer el nucletido terminal han cambiado bastante desde la descripcin
original del mtodo. Hoy en da, lo ms habitual es utilizar terminadores marcados con algn fluorocromo
especfico: se trata de ddNTPs que llevan unido un grupo qumico que produce fluorescencia cuando es
excitado por una luz de una determinada longitud de onda. Como cada terminador lleva un fluorocromo
distinto, es fcil saber en qu nucletido termin una cadena concreta, dependiendo del tipo de
fluorescencia que produzca. Para la separacin de los fragmentos se utilizan tcnicas de electroforesis
capilar, en la que la mezcla de reaccin va pasando por unos finos capilares que contienen una matriz
porosa capaz de resolver fragmentos de ADN que se diferencian en tamaos de tan slo un nucletido. De
este modo, cuando la reaccin de secuenciacin ya completada pasa por el capilar, los fragmentos ms
pequeos pasan ms facilmente y salen del capilar antes que los fragmentos mayores, que tienen ms
dificultad para atravesar los poros y por eso quedan retenidos temporalmente. El resultado es que todos los
fragmentos de la mezcla de reaccin van saliendo del capilar ordenados por tamaos, comenzando por el
ms corto, con diferencias de tamao un solo nucletido. A la salida del capilar se sita una fuente de luz
38 GENTICA HUMANA
(habitualmente un lser) que excita los fluorocromos y produce un tipo de fluorescencia especfico de cada
ddNTP, lo cual es detectado por un dispositivo especial. As, viendo el orden en que van apareciendo los
cuatro distintos colores correspondientes a los cuatro nucletidos, podemos saber la secuencia de la cadena
que se ha sintetizado, que ser exactamente la secuencia complementaria a la cadena molde original.

El video de la Figura 3.9 muestra con detalle el mtodo moderno de
secuenciacin con terminadores fluorescentes y separacin de los fragmentos
mediante electroforesis capilar.

Aunque en la actualidad se estn desarrollando metodologas nuevas ms rpidas y baratas, en dispositivos
miniaturizados que permiten determinar la secuencia de un fragmento en segundos, el mtodo de
secuenciacin de Sanger ha tenido una influencia crucial en el desarrollo de la biologa molecular y la
gentica moderna.


Microarrays

La cuantificacin del nivel de expresin de un gen, la intensidad con la que se transcribe, puede medirse
utilizando las tcnicas explicadas en los apartados precedentes. Inicialmente se utilizaba la tcnica de
Northern blot, en la que la intensidad de la seal obtenida es proporcional a la cantidad de ARNm presente
en la muestra. Ms recientemente se han desarrollado tcnicas de PCR cuantitativa que consiguen
cuantificar la cantidad de ARNm presente en la muestra: utilizando ADNc (ADN complementario) como
molde, se puede realizar RT-PCR cuantitativa para determinar la abundancia relativa del ARNm y comparar
varios tejidos o condiciones experimentales. Con la llegada de los grandes proyectos de secuenciacin, se
plante la posibilidad de determinar la expresin gnica a nivel genmico, es decir, analizar el perfil de
expresin de todos los genes de un genoma en distintas situaciones, para as identificar los genes
implicados en distintos procesos fisiolgicos o en el desarrollo de enfermedades. La cuantificacin de la
expresin de miles de genes es impractible por los mtidos tradicionales, por lo que se desarroll una
metodologa nueva que permitiese hacer este tipo de experimentos a bajo coste y en poco tiempo. Dicha
tecnologa se conoce como la tecnologa de microarrays, tambin llamados a veces "chips" de ADN, porque
se basa en la utilizacin de unos dispositivos slidos miniaturizados en los que se puede medir la expresin
de miles de genes a la vez.

Aunque existen distintos tipos de microarrays en funcin de la tecnologa de fabricacin, el fundamento de
todos ellos es la hibridacin de una mezcla de dos clases de ADNc, marcados con fluorocromos distintos,
sobre una fase slida que contiene miles de sondas inmobilizadas, cada una de ellas especfica para
un gen distinto. Por tanto, a diferencia de los experimentos tradicionales de hibridacin sobre filtros, en los
que el ADN est fijado sobre la fase slida y la sonda est presente en la solucin de hibridacin, en la
tecnologa de microarrays son las sondas las que estn inmobilizadas sobre el soporte slido, y son los ADNc
los que "buscan" las sondas complementarias a su secuencia e hibridan con ellas. De modo general, un
microarray es un portaobjetos de vidrio al que se han adherido, por mtodos fsicos o qumicos, sondas de
ADN en posiciones fijas y ordenadas, cada una ocupando un punto "spot". Cada punto contiene entre 10
7
-
10
8
molculas de una sonda concreta, que puede ser de distintos tamaos y que debera reconocer
especficamente un solo gen del genoma.

CAPTULO 3: TCNICAS BSICAS DE GENTICA MOLECULAR 39
La Figura 3.10 muestra ejemplos de varios tipos de microarrays, cmo se
fabrican y una imagen de hibridacin.

Aunque los microarrays fueron originalmente diseados para realizar estudios de expresin gnica a escala
genmica, tambin se pueden utilizar para detectar pequeas deleciones o duplicaciones en un genoma. En
este caso se habla de microarrays genmicos, en los que las sondas son fragmentos de un genoma. Por
ejemplo, un microarray genmico humano tendr varios miles de sondas que representan todo el genoma
humano ordenado en los distintos puntos del array; la hibridacin se realiza con una mezcla de dos ADN
genmicos, con la finalidad de detectar regiones genmicas que estn en distinto nmero de copias en uno
de los genomas respecto al otro.

En cualquier caso, la metologa experimental es similar en los distintos tipos de microarrays. En primer
lugar es necesario obtener los ADN que se van a hibridar sobre el microarray (ADNc si se van a hacer
estudios de expresin gnica o ADN genmico total si se trata de microarrays genmicos). Cada uno de las
dos muestras que se van a comparar es marcada con un fluorocromo distinto, habitualmente uno que da
fluorescencia verde y otro con fluorescencia roja. A continuacin se realiza la reaccin de hibridacin y se
detecta la fluorescencia que emite cada punto del microarray. Dependiendo de la intensidad de la
fluorescencia de cada color en cada punto, es posible deducir si el gen representado por esa sonda se
expresa o no en las muestras. Lgicamente, un experimento con microarrays genera cantidades masivas de
datos, al tratarse de miles de puntos analizados simultneamente; por ello, las herramientas de anlisis de
imagen y de procesamiento de los datos con bastante sofisticadas. Gracias a esto, los estudios de
microarrays estn permitiendo avanzar en el diagnstico de enfermedades, ya que permiten detectar
"firmas" de expresin especficas para enfermedades concretas. Estas "firmas" son patrones
caractersticos formados por los genes que tienen su expresin ms alterada en un proceso concreto; al
detectar el subgrupo de genes que se alteran con mayor intensidad, podemos utilizar esa informacin para
diagnosticar si un individuo sufre ese mismo proceso. En algunos casos, la utilizacin de estas "firmas"
moleculares ha ayudado a distinguir procesos que antes se agrupaban juntos, identificando enfermos que
tienen distintas posibilidades de respuesta a tratamientos, distinta supervivencia, etc.

La Figura 3.11 nos lleva a unas animaciones que muestran cmo se lleva a
cabo y se interpreta un experimento con microarrays.

Actualmente se estn generando bases de datos que archivan los resultados de mltiples estudios de
microarrays, con lo que es posible acceder a esos datos y elaborarlos para obtener informacin sobre los
niveles de expresin de un gen en distintos tipos celulares y en distintas condiciones experimentales. El
anlisis de estos datos permitir establecer cmo varan los patrones de expresin gnica de un genoma en
distintos procesos metablicos y fisiolgicos, as como tambin en diversas situaciones patolgicas. As
podremos identificar las variaciones tpicas de los distintos tipos de cncer, de enfermedades
cardiovasculares, neurodegenerativas, etc; esto, a su vez, permitir identificar nuevas dianas teraputicas
para restablecer esos patrones de expresin alterados.
40 GENTICA HUMANA
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 41

B. EL GENOMA HUMANO

En tres temas se cubre la organizacin general del genoma humano y la relacin entre
estructura y funcin, adems de prestar atencin a las bases moleculares del cambio
gentico y a los mecanismos correctores de los errores introducidos en la secuencia.


CAPTULO 4. LA GEOGRAFA DEL GENOMA HUMANO
Historia y desarrollo del Proyecto Genoma Humano. Estructura del Genoma
Humano. El ADN repetitivo. El genoma mitocondrial.


Historia y desarrollo del Proyecto Genoma Humano

En 1986, el Departamento de Energa de los Estados Unidos lider la Iniciativa del Genoma Humano,
tras varios aos de contactos y reuniones, y puso en marcha el mayor proyecto biomdico de la historia con
el objetivo final de conseguir la secuencia completa del genoma humano en el ao 2005. El Proyecto
Genoma Humano comenz oficialmente en Estados Unidos en octubre de 1990, siguiendo un plan a cinco
aos para desarrollar las herramientas que permitiesen conseguir esa meta. Estas herramientas eran
principalmente la construccin de mapas genticos (de ligamiento) y de mapas fsicos (de clones) de
todo el genoma humano, al tiempo que se desarrollaba la tecnologa necesaria para realizar secuenciacin a
gran escala. La estrategia general consisti en construir mapas genticos y fsicos e integrarlos, para
aumentar cada vez ms en resolucin desde el cromosoma hasta la secuencia de ADN.

Los mapas genticos describen la organizacin cromosmica de caracteres (un rasgo fenotpico, una
enfermedad) o de marcadores genticos, mediante estudios de ligamiento gentico.

El concepto de ligamiento gentico y la forma en que se cuantifica son objeto
del Captulo 11. Si el lector no est familiarizado con la construccin de
mapas de ligamiento, se aconseja estudiar el Captulo 11 antes de seguir
leyendo.


La Figura 4.1 explica cmo son los mapas fsicos y los mapas de ligamiento
gentico, y su utilizacin en el Proyecto Genoma Humano.


Los primeros xitos de mapeo gentico en humanos fueron los que consiguieron asociar un carcter a un
cromosoma, como por ejemplo el ligamiento del daltonismo al cromosoma X, o ligamiento del grupo
sanguneo Duffy al cromosoma 1. Este ltimo fue el primer rasgo hereditario mapeado a un autosoma (en
1968) gracias a que, en una familia concreta, se observ que este rasgo se heredaba junto con un
heteromorfismo del cromosoma 1. Esto puso de manifiesto la utilidad de contar con marcadores de ADN
que estuviesen distribuidos por todo el genoma, fuesen fciles de estudiar en un nmero alto de individuos
42 GENTICA HUMANA
y tuviesen una posicin cromosmica conocida, ya que as se podran realizar estudios de ligamiento
gentico en familias que padecen una determinada enfermedad gentica para determinar si esa enfermedad
est en ligamiento con alguno de estos marcadores, lo que facilitara la identificacin del gen responsable.



Los tipos de marcadores ms utilizados en estudios de ligamiento en Gentica Humana son:

- Polimorfismos de Longitud de Fragmentos de Restriccin (en ingls, las siglas son RFLP). Un RFLP es
un polimorfismo originado por un cambio de un nucletido que crea o destruye una diana de
restriccin, de manera que encontraremos alelos con esa diana y alelos sin ella. Por tanto, un RFLP es
por definicin un marcador biallico (slo hay dos alelos posibles). La presencia o ausencia de esa
diana hace que los fragmentos originados por la digestin del ADN con esa enzima de restriccin sean
de distinto tamao. En general, un polimorfismo tipo RFLP puede detectarse de dos modos: a) digerir
directamente el ADN genmico, separar los fragmentos en un gel, hacer un Southern blot e hibridarlo
con una sonda especfica para detectar cada uno de los fragmentos polimrficos; b) amplificar la regin
del polimorfismo mediante PCR y digerir directamente el producto de PCR para separar los fragmentos
en un gel.

- Los marcadores tipo VNTR (acrnimo ingls de Nmero Variable de Repeticiones en Tndem") son
polimorfismos originados por pequeas secuencias de ADN que estn repetidos en tndem. El nmero
de repeticiones es diferente en los distintos individuos de la poblacin, por lo que en principio pueden
existir ms de dos alelos distintos para cada marcador (aunque cada individuo slo lleve dos alelos,
en la poblacin general pueden existir ms). Los marcadores en los que la secuencia repetida es corta
(2 a 4 nucletidos) se denominan tambin microsatlites STR (Short Tandem Repeats",
Repeticiones Cortas en Tandem), y estn homogneamente distribuidos por todo el genoma. Los
marcadores en los que la secuencia repetida es ms larga (decenas a cientos de nucletidos) se
denominan minisatlites, y han sido muy importantes en los estudios de gentica forense ya que
permiten establecer una huella gentica nica para cada individuo. Los minisatlites son ms
abundantes hacia las regiones telomricas de los cromosomas, y debido a su tamao en principio
deben detectarse mediante Southern blot e hibridacin. En cambio, los marcadores de tipo microsatlite

STS 8 STS 6 STS 4
STS 2 STS 7 STS 5
STS 3 STS 1
MAPA FSICO
8 marcadores tipo STS cuya posicin
es conocida
MAPA GENTICO DE LIGAMIENTO
4 marcadores posicionados por
estudios de ligamiento
Distancia en centimorgans (cM)
Distancia fsica en pares de bases
(bp)
DS16C4 DS16B3 DS16A2 DS16A1
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 43
pueden detectarse mediante PCR y estn distribuidos uniformemente por el genoma, por lo que su
anlisis es ms rpido y sencillo y proporcionan mayor informacin.

- Los SNP (pronunciado snip) son polimorfismos de un solo nucletido (Single Nucleotide
Polymorphisms) en los que el simple cambio de un nucletido en una secuencia genmica da lugar a
distintos alelos. Lgicamente, para cada posicin slo puede haber cuatro alelos como mximo (A, C, G
T), aunque lo habitual es que un SNP tenga dos alelos en la poblacin general. Se estima que, como
promedio, hay al menos un SNP cada 500-1.000 pares de bases, de los cuales un porcentaje
importante son polimorfismos codificantes (es decir, cambian un aminocido en la protena codificada
por el gen) y constituyen la principal fuente de variabilidad gentica inter-individual, puesto que dos
individuos cualesquiera tienen alrededor de un 0,1% de sus nucletidos distintos. La gran ventaja de
los SNP sobre los dems tipos de marcadores, adems de ser tan abundantes y estar muy
uniformemente distribuidos por todo el genoma humano, es la posibilidad de analizarlos mediante
mtodos automatizables a gran escala, como los microarrays, de manera que se pueden determinar
cientos miles de SNPs a la vez en un mismo experimento.

La Figura 4.2 ilustra los tipos de marcadores ms utilizados en la
construccin de mapas de ligamiento gentico en humanos.

El objetivo inicial del PROYECTO GENOMA era crear un mapa gentico (de ligamiento) con marcadores
distribuidos por todo el genoma con una distancia media de 1 cM entre marcadores. Los mapas genticos
se basaron en un primer mapa publicado en 1987, hecho con 393 marcadores tipo RFLP agrupados en 23
grupos de ligamiento, con una distancia media entre marcadores superior a 10 cM. El primer mapa gentico
de todo el genoma fue el realizado por un centro de investigacin francs llamado Gnthon en 1992, e
inclua 803 marcadores tipo microsatlite.

Los mapas fsicos, en cambio, reconstruyen la estructura de un segmento de ADN, determinando los tipos
y orden relativo de las distintas secuencias que lo componen, sus tamaos, y las distancias entre ellas. Para
la construccin de mapas fsicos se utiliza un tipo de marcador distinto, que veremos ms adelante.
Lgicamente, el mapa fsico de mayor resolucin posible es la secuencia completa de ese segmento
(resolucin de 1 nucletido), pero tambin es posible realizar mapas de menor resolucin (un ejemplo,
mapas de restriccin). El tipo de marcador utilizado en la creacin de mapas fsicos se denomin STS
(Sequence-Tagged Site = Sitio Etiquetado por su Secuencia). Un STS es un pequeo fragmento de ADN
(unos pocos cientos de pares de bases) de secuencia y localizacin genmica conocidas, fcilmente
amplificable mediante PCR. Durante aos se haban identificado un buen nmero de marcadores STS,
mediante la secuenciacin parcial de clones previamente mapeados por otros mtodos. Adems, los
microsatlites utilizados en la creacin de mapas de ligamiento tambin pueden convertirse fcilmente en
STS, leyendo la secuencia que flanquea las repeticiones del microsatlite. Gracias a esto, hoy contamos con
una lista ordenada de STS que estn distribuidos por todo el genoma humano, cuya secuencia y condiciones
de amplificacin mediante PCR son fcilmente accesibles a todo investigador. El PROYECTO GENOMA se
propuso inicialmente conseguir mapas de marcadores tipo STS distribuidos por todo el genoma y con una
distancia media entre marcadores en torno a 0.1 Mb (es decir, 100kb).

Utilizando estos marcadores STS, se pudieron construir mapas fsicos, es decir mapas compuestos por
clones de bibliotecas genmicas, capaces de albergar insertos de gran tamao. Existen distintos vectores de
este tipo, entre los que destacan los vectores tipo YAC (Yeast Artificial Chromosome), PAC (P1-phage
Artificial chromosome) y BAC (Bacterial Artificial Chromosome). Cada uno de estos vectores de clonacin
44 GENTICA HUMANA
tiene caractersticas especficas, ventajas e inconvenientes. En concreto, los YAC son los vectores que
permiten albergar un mayor tamao de inserto (hasta 2 Megabases), pero son bastante inestables (tienden
a perder fragmentos del inserto cuando se replican) y tienen un porcentaje relativamente alto de clones
quimricos (es decir, clones en los que el inserto est en realidad formado por dos fragmentos procedentes
de cromosomas distintos). Los PACs y BACs, en cambio, slo permiten clonar insertos de unas 100 a 150
kilobases de tamao (por lo que son necesarios muchos ms clones para cubrir completamente un
segmento genmico determinado), pero en cambio son muy estables y el porcentaje de quimerismo es muy
pequeo. Aunque los YACs han sido el vector principalmente utilizado al principio de los aos 90, hoy en da
han sido desplazados por PACs y BACs.

La Figura 4.3 explica la utilizacin de marcadores STS para crear un contig de
clones que cubran una regin del genoma.





Los primeros mapas fsicos del genoma humano estaban compuestos por contigs de YACs que cubran
parcialmente el genoma humano, siendo el mejor ejemplo el mapa creado tambin por Gnthon en
1993. Este mapa supuso un avance enorme porque aunque no cubra muchas regiones genmicas
sirvi como punto de partida para elaborar mapas ms completos con vectores ms fiables y manejables,
como BACs y PACs.

El PROYECTO GENOMA hizo una revisin de sus objetivos en 1993, teniendo en cuenta los progresos
realizados en los 3 aos anteriores, y estableci nuevas metas para los siguientes 5 aos (1993-1998). En
resumen, estos nuevos objetivos fueron:

- conseguir un mapa gentico con resolucin de 2 a 5 cM entre marcadores.
- conseguir un mapa fsico con STS espaciados regularmente cada 0.1 Mb (lo que significaba identificar y
localizar la posicin de como mnimo unos 30.000 STS).
GGAGACTACGGAGATTACCTACGGGACTACAGAAGGAGACTACGGAGAGTACCTACGGGACTGTCT
DS16C4 DS16B3 DS16A2 DS16A1
STS 8 STS 6 STS 4
STS 2 STS 7 STS 5
STS 3 STS 1
CONTIG: conjunto de clones solapantes
que cubren una regin del genoma
La secuenciacin de cada clon permite reconstruir
la secuencia original de esa regin genmica
GGAGACTACGGAGATTACCTACGGGACTACAGAAGGAGACTACGGAGAGTACCTACGGGACTGTCT
DS16C4 DS16B3 DS16A2 DS16A1 DS16C4 DS16B3 DS16A2 DS16A1
STS 8 STS 6 STS 4
STS 2 STS 7 STS 5
STS 3 STS 1 STS 8 STS 6 STS 4
STS 2 STS 7 STS 5
STS 3 STS 1
CONTIG: conjunto de clones solapantes
que cubren una regin del genoma
La secuenciacin de cada clon permite reconstruir
la secuencia original de esa regin genmica
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 45
- desarrollar nuevas tecnologas para la identificacin de genes a partir de ADN genmico.
- desarrollar nuevas tecnologas de secuenciacin y completar 80 Mb de secuencia confirmada para
todos los organismos que estaban siendo secuenciados por los distintos proyectos.
- Potenciar la genmica comparada: completar las secuencias de E. coli, S. cerevisiae y C. elegans, y
comenzar los proyectos de secuenciacin de los genomas de Drosophila y de ratn.

Cuando en 1998 se revisaron los avances realizados en esos cinco aos, con el fin de disear un nuevo plan
quinquenal, los resultados haban sido realmente prometedores: en Septiembre de 1994 se public un
mapa gentico de todo el genoma humano integrado por 4.000 marcadores tipo microsatlite y 1.800
marcadores tipo RFLP, con una distancia media entre marcadores de 0.7 cM. Esto superaba en ms de 3
aos el objetivo propuesto inicialmente. Por su parte, Gnthon public en 1995 otro mapa fsico de YACs
que estaba formado por 255 contigs (con un tamao medio de 10 Mb cada contig) y cubra el 75% del
genoma humano. Durante esos aos se continuaron desarrollando nuevos marcadores tipo STS, hasta llegar
en 1998 a un mapa que contena 52.000 STS (casi el doble de los inicialmente propuestos).

Por lo que respecta a la secuenciacin, en octubre de 1998 se haba obtenido un total de 180 Mb de
secuencia del genoma humano (6% del total), adems de 111 Mb de secuencia de otros organismos, muy
por encima de lo previsto en el plan 1993-1998. Adems, se haba completado la secuencia de E. coli y de
S. cerevisiae, ste ltimo el primer organismo eucariota en ser secuenciado totalmente. Esto fue posible
gracias a importantes avances en la tecnologa de secuenciacin, que se hizo progresivamente ms rpida,
fiable y barata. Posteriormente, en diciembre de 1998, se complet la secuencia de C. elegans, el primer
organismo multicelular secuenciado en su totalidad con un genoma de unas 97 Mb.

Por tanto, en 1998 el PROYECTO GENOMA se fij un nuevo plan de objetivos hasta el ao 2003, en el
que se incluan 6 metas concretas:

1. Completar la secuencia del genoma humano para 2003 (ao que coincida con el 50 aniversario del
descubrimiento de la doble hlice por Watson y Crick), creando un primer borrador de trabajo en el
2001. Este objetivo se aceler enormemente por la competencia de la empresa privada Celera
Genomics (tambin iniciativa de Craig Venter), que se propuso secuenciar todo el genoma humano,
utilizando una estrategia distinta al consorcio internacional del PROYECTO GENOMA, con el fin de
obtener la propiedad intelectual y poder explotar esa informacin con fines comerciales. A pesar de los
problemas suscitados inicialmente por la fuerte competencia entre ambos proyectos, el 26 de junio de
2000 se produjo el anuncio oficial de que se haba alcanzado un primer borrador del 87% de la
secuencia del genoma humano. Este primer borrador fue publicado el 15 de Febrero de 2001 en las
revistas Nature (el mapa del Consorcio Internacional) y Science (el mapa de Celera Genomics).

La Figura 4.4 muestra el proceso general de utilizado por el Consorcio
Internacional para la secuenciacin del Genoma Humano.

2. Continuar el desarrollo y la innovacin de las tecnologas de secuenciacin. Como ya se ha comentado,
ste ha sido un factor determinante en el avance del PROYECTO GENOMA.

3. Estudiar la variacin en el genoma humano. Como hemos visto, los SNP se encuentran en el genoma
humano a razn de 1 por cada kilobase, como promedio, y representan las diferencias genticas entre
individuos de una misma especie. Como se ver en el Captulo 11, la creacin de mapas densos de SNP
permitir llevar a cabo estudios de asociacin para detectar los genes que estn implicados en
46 GENTICA HUMANA
enfermedades complejas, debidas a alteraciones en muchos genes siendo la contribucin de cada gen
a la enfermedad pequea y, por tanto, difciles de detectar por otros mtodos de ligamiento
paramtrico.

4. Desarrollar tecnologa para la genmica funcional, es decir, identificar todos los genes y determinar
cul es la funcin de cada gen. La gran revolucin en las estrategias de identificacin de regiones
codificantes (es decir, genes) comenz con la idea de Craig Venter de secuenciar al azar y a gran escala
fragmentos de ADNc de bibliotecas obtenidas a partir de diversos tejidos. Estos fragmentos de secuencia
se denominaron "Etiquetas de Secuencia Expresada" (EST, Expressed Sequence Tags), ya que en
el fondo cada una representa un fragmento de un ARNm (una secuencia expresada en un tejido
concreto). En pocos aos, la base de datos de EST creci de manera exponencial, con cientos de miles
de secuencias expresadas procedentes de distintas bibliotecas de ADNc. Como algunos de estos EST
proceden de un mismo ARNm, se cre una coleccin no redundante llamada UNIGENE que agrupa los
EST por familias, siemdo cada familia representativa de un nico ARNm. Poco despus comenzaron
tambin proyectos internacionales para mapear secuencias de UNIGENE, de manera que en 1994 se
public un primer mapa con la localizacin de 16.000 EST correspondientes a genes distintos, y en
1998 se public un segundo mapa de 41.664 EST, que representaban 30.181 genes distintos. Cuando
se conozca el catlogo completo de genes de nuestro genoma, ser necesario estudiar la expresin de
cada gen en distintos tejidos y en distintas situaciones fisiolgicas y patolgicas, en respuesta a distintos
factores ambientales, etc. Lgicamente, esto ser el objeto de la investigacin biomdica de buena parte
del siglo XXI.

5. Genmica Comparada. El anlisis comparado de los genomas de varias especies es de gran utilidad
para identificar mecanismos biolgicos conservados durante la evolucin (por lo que son especialmente
importantes), estructura y funcin de genes ortlogos, etc. Aunque el plan para 1998-2003 se propuso
conseguir la secuencia completa del genoma de Drosophila para el ao 2002, esta meta se cumpli en
abril del ao 2000 gracias a la colaboracin de laboratorios y Universidades con Celera Genomics,
descifrando unas 120 Mb de secuencia que comprenden la prctica totalidad de la eucromatina de este
insecto. El nuevo gran reto ahora es conseguir la secuencia completa del genoma de otras especies de
mamferos: el primer borrador completo del genoma de ratn se obtuvo en 2002 y el del genoma de
chimpanc en 2005.

6. Implicaciones ticas, legales y sociales del PROYECTO GENOMA. Es importante tener consciencia de
la influencia que va a tener el Proyecto Genoma y sus aplicaciones sobre los individuos y las sociedades.
Cuestiones como el diagnstico de enfermedades que no tienen tratamiento, la extensin de una
mentalidad eugensica que lleve a la discriminacin por razn de deficiencias genticas, el diagnstico
prenatal de alteraciones genticas que confieren predisposicin a sufrir enfermedades que se
manifestarn en la edad adulta, la deteccin de rasgos psicolgicos con base gentica, la
confidencialidad de la informacin gentica de los individuos (y la posible discriminacin laboral) sern
una constante en los debates sociales de este siglo, y es importante llevar a cabo una labor de
divulgacin seria para que la sociedad pueda discutir de modo sosegado y bien fundamentado las bases
ticas sobre las que sostener las aplicaciones biomdicas de la biotecnologa en los aos que se
avecinan.

7. Desarrollo de herramientas bioinformticas (bases de datos y herramientas de anlisis de datos) que
puedan ser compartidas por la comunidad cientfica. Ser especialmente importante el desarrollo de
herramientas informticas que permitan identificar exones y predecir la estructura de genes en grandes
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 47
secuencias genmicas, as como plataformas de genmica funcional para el anlisis de la expresin de
miles de genes a la vez.

8. Formacin en genmica: favorecer que cientficos y acadmicos se dediquen a la investigacin
genmica y a divulgar y aumentar el conocimiento pblico de los distintos aspectos del PROYECTO
GENOMA.

Finalmente, la primera versin esencialmente completa del genoma humano fue anunciada
oficialmente el 14 de abril de 2003, cubriendo un total de 3.069 Mb (92.3% del total estimado del
genoma humano) con un 99.99% de fiabilidad en cada posicin secuenciada. El anlisis de la secuencia
publicada permite hacerse una idea bastante aproximada de la estructura de nuestro genoma, su
composicin y algunas de sus caractersticas funcionales, como se explica a continuacin.


Estructura del genoma humano y variacin inter-individual

El genoma humano nuclear tiene un tamao aproximado de 3.200 Mb (megabases), es decir tres mil
doscientos millones de pares de bases. Esta cifra total incluye unas 2.950 Mb de eucromatina y unas 250 Mb
de heterocromatina (formada, como veremos, por ADN satlite). Esta cifra se refiere al genoma haploide,
de manera que las clulas somticas (diploides) contienen el doble.

La Figura 4.5 muestra una visin general de los distintos tipos de secuencias
que constituyen el genoma humano.

Una primera clasificacin del genoma humano distingue, por un lado, los genes y secuencias relacionadas
con genes (exones, intrones, regiones no traducidas que contienen elementos reguladores, etc), y por otro
todo el ADN que est entre los genes, llamado ADN extragnico o de relleno y que no codifica ninguna
protena ni contiene ningn elemento funcional. Curiosamente, la mayor parte del genoma humano (un
70%) est formada por este ltimo, de forma que slo un 30% del genoma humano incluye secuencias
relacionadas con genes. Lo ms sorprendente es que de este 30% slo un 5% est constitudo por ADN
codificante (exones), siendo el resto ADN no-codificante asociado a genes. Por tanto, resulta que slo un
1,5-2% del total del genoma humano es ADN codificante. El ADN extragnico est formado, sobre
todo, por los componentes repetitivos del genoma humano que se explicarn ms adelante, aunque tambin
hay secuencias nicas o en bajo nmero de copia.

Desde la publicacin del primer borrador del Genoma Humano en febrero de 2001, podemos dar unos
valores promedio estimados a partir de los datos publicados:

Se estima que el genoma humano contiene en torno a los 20.000 - 25.000 genes.
Alrededor de un 50% del genoma humano est constituido por ADN repetitivo.
Se puede estimar la densidad media de genes es de 1 gen cada 100 kb, aunque existen regiones ricas
en genes (algunas zonas del cromosoma 19, por ejemplo) y otras regiones que son muy pobres en
genes (como el cromosoma Y). Por tanto, se puede deducir una frecuencia media de 10 genes por
cada Mb de secuencia.
El tamao promedio de un gen humano es de 20-30 kb, aunque hay grandes diferencias de unos
genes a otros.
48 GENTICA HUMANA
El nmero de exones que forman un gen es muy variable (desde genes que tienen un solo exn hasta
algunos genes con 100 exones ms), pero podemos establecer un valor promedio de 7-8 exones por
gen.
El tamao medio de un exn es de 150 nucletidos. Por lo que respecta a los intrones, en cambio,
existe una enorme variabilidad de tamaos, y no es infrecuente encontrar en casi todos los genes
algn intrn de gran tamao.
El tamao medio de un ARNm es de 1,8-2,2 kb incluyendo las regiones no-traducidas flanqueantes. La
longitud media de una regin codificante es de 1,4 kb.

Una de las caractersticas ms evidentes del borrador de nuestro genoma es su heterogeneidad. En
efecto, la secuencia no es uniforme, sino que muchas de sus caractersticas (riqueza en C+G frente a A+T,
riqueza en genes, etc) se distribuyen heterogneamente, con regiones de gran abundancia flanqueadas por
regiones en que esos parmetros son ms escasos. As por ejemplo, el contenido medio de G+C del
genoma humano es del 41%, menor de lo tericamente esperado. Adems, si el genoma se divide en
"ventanas" de 20 kb se observan regiones con valores muy alejados del promedio, con una dispersin 15
veces mayor de lo que sera esperable si la distribucin fuese uniforme. La distribucin de %G+C de estas
ventanas no se ajusta a una distribucin normal, sino que est desviada hacia valores bajos.

Adems, se ha comprobado que los genes tienden a concentrarse en las ventanas ms ricas en G+C.
Esto se conoca ya de antiguo, y de hecho se haba acuado el trmino isocoro para designar las regiones
genmicas que son homogneas en cuanto al contenido en G+C y que pueden separarse mediante
gradientes de densidad. Se distinguen isocoros L e isocoros H, segn su contenido en G+C sea bajo
(Low) alto (High), y dentro de cada isocoro hay varios subgrupos. La tabla que se presenta a continuacin
resume algunas caractersticas importantes de los distintos isocoros:


Isocoro %
GC
% del
genoma
Contenido
Genes %
Mb ADN Densidad
de genes
L1 38 30 48 1,860 1 cada 130 kb
L2 41 32
H1 44 19 27 870 1 cada 100 kb
H2 49 10
H3 53 9 25 270 1 cada 35 kb


Como puede apreciarse, existe una relacin directa entre el contenido de una regin genmica en
nucletidos G+C y su riqueza en genes. Es decir, hay en el genoma humano unas regiones con mayor
riqueza de genes, regiones que a su vez son las que tienen un mayor porcentaje de nucletidos G+C.

Otro hallazgo inesperado en nuestro genoma ha sido la presencia de mayor nmero de duplicaciones del
que se haba estimado hasta entonces. De hecho, el anlisis muestra alrededor de un 5% de duplicaciones
segmentarias, definidas como dos ms segmentos cromosmicos >1 kb con >90% de identidad de
secuencia; dicho nivel de homologa corresponde a una antigedad de unos 40 millones de aos. Las
duplicaciones intracromosmicas (las copias estn en el mismo cromosoma) tienen un tamao medio de
unas 100 kb, mientras que las duplicaciones intercromosmicas (entre cromosomas distintos) son ms
pequeas (10-50 kb). Las duplicaciones segmentarias son ms frecuentes en regiones centromricas y
cerca de los telmeros (donde pueden llegar a constituir un 25% de la secuencia). Los centrmeros, en
concreto, estn flanqueados por regiones ricas en duplicaciones intercromosmicas procedentes de regiones
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 49
eucromticas de otros cromosomas, que se han ido transponiendo a zonas pericentromricas a una
velocidad de 6-7 eventos por milln de aos durante la evolucin de primates. Las duplicaciones
intracromosmicas pueden dar lugar a alteraciones genmicas, como veremos ms adelante.

La Figura 4.6 muestra esquemticamente los tipos de duplicaciones
segmentarias.

El anlisis de la secuencia tambin ha mostrado la alta cantidad de pseudogenes que hay en el genoma
humano. Como su nombre indica, los pseudogenes son versiones incorrectas de genes, que contienen
diversos tipos de mutaciones y habitualmente no se transcriben. Se dividen en pseudogenes no
procesados y pseudogenes procesados. Los primeros son copias de un gen, habitualmente originadas por
duplicacin del gen original y posteriores mutaciones que hacen que la copia pierda su capacidad
codificante. Contienen exones e intrones, pero que carecen de promotor y habitualmente tienen codones de
parada prematuros. En cambio, los pseudogenes procesados son copias del ARN mensajero de un gen, que
se ha retrotranscrito e insertado en otra posicin del genoma (de ah que se denominen tambin
retropseudogenes). No tienen intrones, y tampoco tienen capacidad codificante por la ausencia de promotor
y por la presencia de codones de parada. Se han identificado unos 11.000 pseudogenes en el genoma
humano, de los que la mayor parte (unos 8.000) son pseudogenes procesados. En total, se estima que el
nmero de pseudogenes en nuestro genoma puede llegar a unos 20.000. De todas formas, todos los
pseudogenes detectados se originan a partir de tan slo unos 2.500 genes funcionales, de modo que la
mayor parte de los genes no tienen ningn pseudogen en el genoma.

La Figura 4.7 muestra la estructura de los distintos tipos de pseudogenes.

Recientemente se han encontrado 481 segmentos >200 pares de bases totalmente conservados (100% de
identidad sin gaps) en rergiones ortlogas de humano, rata y ratn, y la gran mayora estn tambin
conservados en pollo y perro (95 and 99% de identidad, respectivamente). Muchas tambin estn
conservadas en pez. Estos "elementos ultraconservados" se solapan con exones de genes implicados en
el procesamiento de ARN, y tambin son abundantes en intrones de genes relacionados con el desarrollo o
con la regulacin de la transcripcin. Junto con las ms de 5000 secuencias >100 nucletidos que estn
totalmente conservadas en los 3 mamferos secuenciados, estos fragmentos constituyen una nueva clase de
elementos genticos cuya funcin est por determinar, pero el hecho de que estn ms conservados que las
protenas indica que deben jugar algn papel importante.

Tambin es importante dedicar unas lneas a describir la presencia de genes que dan lugar a microARN.
Como es sabido, el estudio del mecanismo de interferencia de ARN ha llevado a la identificacin de ARN
interferentes endgenos en los genomas de eucariotas, incluido el genoma humano. Estos ARN se
denominan microARN (miARN) y se transcriben a partir de genes con un promotor de ARN-polimerasa II.
Estos genes tienen un segmento palindrmico, de modo que el ARNm primario forma un pri-miARN que
contiene una horquilla de ARN bicatenario; este pri-miARNm es procesado dentro del ncleo de la clula por
una ARNasa tipo III llamada DROSHA y esto da lugar a un pre-miARN, una ARN bicatenario con forma de
horquilla de unos 70 nucletidos de tamao. El pre-miARN sale del ncleo y es procesado en el citoplasma
por Dicer, originando un miARN de unos 22 nucletidos. ste entra a formar parte del complejo RISC
(denominado miRISC para los miARN) y regula la expresin de genes diana mediante degradacin de sus
mensajeros o por represin de la traduccin. Actualmente se han identificado ms de 300 genes de
miARN en el genoma humano, y se calcula que puede haber en torno a 500. La mayora de estos genes
se localizan en intrones de genes codificantes, y adems estn bastante conservados en primates. Dado
50 GENTICA HUMANA
que cada uno de estos miARN puede regular la expresin de varios genes diana, se estima que hasta un 20-
30% de todos los genes del genoma humano pueden estar regulados por miARN, lo que les
confiere una extraordinaria importancia.

La secuenciacin del genoma humano ha permitido tambin estudiar la variacin gentica inter-
individual, es decir, las diferencias genticas que estn en la base de las diferencias fenotpicas entre
individuos. Esto tiene gran relevancia mdica, porque muchas de estas variantes pueden ser tambin causa
de la distinta susceptibilidad a desarrollar enfermedades o la diferente respuesta a frmacos que tienen
personas distintas. Uno de los tipos ms importantes de variabilidad gentica es el constituido por los
cambios en un nucletido de la secuencia, conocidos como hemos visto con el nombre de SNP. Uno
de los objetivos del PROYECTO GENOMA HUMANO era el estudio de la diversidad gentica, y esto ha
cristalizado en otro proyecto internacional denominado Proyecto HapMap que se propone precisamente
identificar los SNP ms frecuentes en el genoma humano en individuos de diferentes grupos tnicos. En
octubre de 2005, el Proyecto Hapmap public un primer mapa que contiene 1.007.329 SNP con una
distancia media entre ellos de 5 kb, con una frecuencia del alelo ms frecuente igual superior al 5% (es
decir, presentes en al menos el 5% de la poblacin). Todos estos SNP fueron genotipados en 269
individuos de cuatro grupos raciales: 90 de raza yoruba, de Nigeria; 90 caucasianos de Utah; 45 de
raza han, de China; y 44 japoneses. La segunda fase de este Proyecto se propone genotipar otros 5
millones de SNP. La inspeccin de estos mapas permite hacerse una idea de la variacin en el genoma,
tanto entre individuos como entre distintos grupos raciales. Adems, estos datos han permitido comprobar
que esta variacin se agrupa en bloques, de modo que todos los SNP de un mismo bloque se heredan
juntos. En un captulo posterior veremos la importancia de estos bloques para estudiar la asociacin de SNP
concretos con la susceptibilidad a padecer enfermedades.

La Figura 4.8 muestra la estructura de los haplotipos formados por los alelos
de varios SNP cercanos.

Otro tipo de variacin que se ha descubierto al analizar la secuencia del genoma humano es la originada por
diferencias en el nmero de copias de grandes segmentos genmicos. Al analizar genomas de
distintos individuos, se ha visto que existen unas 200-300 regiones genmicas de tamao grande (entre
10 y 50 kilobases) cuyo nmero de copias en el genoma es diferente de unos individuos a otros. Este tipo
de variaciones, llamadas LCV (Large-scale Copy number Variations) CNP (Copy Number Polymorphisms)
pueden ser deleciones repeticiones en tandem. Una caracterstica de todas estas regiones es que estn
flanqueadas por duplicaciones segmentarias, y esto hace pensar que la variacin en el nmero de
copias es el resultado de reordenaciones entre esos elementos flanqueantes. Aunque su papel biolgico
todava no est claro, los CNP pueden tener importancia en la variacin gentica inter-individual
que explica las diferencias en la predisposicin a desarrollar enfermedades.

Finalmente, se ha catalogado tambin otro tipo de variacin consistente en polimorfismos de
insercin/delecin pequeos (de tamaos entre 1 nucletido a 10 kb). Se han detectado varios cientos
de miles, y se estima que en total hay alrededor de 1,5 millones de estos polimorfimos en el genoma
humano. Aunque se distribuyen por todo el genoma, se ha visto que en algunas regiones son especialmente
frecuentes. Muchos de ellos estn dentro de genes, y pueden causar alteraciones cuando afectan al
promotor o a la regin codificante (exones).


El ADN Repetitivo
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 51

Como hemos visto al principio de este Captulo, hasta un 50% del Genoma Humano est constituido por
ADN repetitivo, antiguamente conocido como "ADN basura". Por su importancia, a continuacin
estudiamos con mayor detalle su composicin y los distintos tipos de secuencias que lo forman. Ya se ha
mencionado que podemos encontrar ADN repetitivo tanto en el ADN codificante (en los genes y secuencias
relacionadas) como en el ADN no-codificante, pero la mayor parte se encuentra en el ADN no-codificante.
Quizs el nico ejemplo de ADN repetitivo codificante que merece la pena resear es el correspondiente al
ADN ribosomal, que se concentra en los brazos cortos de los cromosomas acrocntricos (13, 14, 15, 21 y
22) y est formado por tres genes que dan lugar a los tres ARN ribosomales de 5,8S, de 18S y de 28S. Los
tres genes estn juntos formando un bloque que mide unas 13 kilobases. Estos bloques se encuentran
repetidos unas 50 veces, separados entre s por un espaciador intergnico que mide unas 30 kilobases. En
conjunto, el ADN ribosomal ocupa un tamao de unas 2 Megabases.

En el ADN no-codificante, tanto intragnico (es decir, intrones y otras regiones no-codificantes
relacionadas con genes) como extragnico, podemos encontrar diversos tipos de elementos repetidos. En
general, se trata de una secuencia de ADN que se repite en el genoma cientos o miles de veces. Estas
repeticiones pueden encontrarse en tndem (es decir, seguidas una detrs de otra) o dispersas.

El ADN repetido en tandem se divide en varios grupos segn el tamao total que origina la repeticin:

El genoma humano contiene en total unas 250 Mb de ADN satlite (llamado as porque al separar el
ADN genmico en gradientes de densidad aparece como 3 bandas "satlites" de la banda principal). El
ADN satlite est formado por la repeticin de una secuencia de ADN miles de veces en tandem, es
decir unas copias pegadas a otras. Esto da lugar a regiones repetidas con tamaos que van desde 100
kb hasta varias megabases. Por ejemplo, el ADN Satlite 1 es una secuencia de 42 nucletidos,
mientras que en el Satlite 2 la secuencia repetida es (ATTCCATTCG) y en el Satlite 3 se repite el
pentmero (ATTCC). Un tipo de ADN satlite muy importante es el ADN alfoide Satlite alfa, en el
que la secuencia repetida tiene un tamao de 171 nucletidos, y que forma parte del ADN de los
centrmeros de los cromosomas humanos. Otros tipos de ADN satlite son el Satlite beta (repeticin
de 68 nucletidos) y el Satlite gamma (repeticin de 220 nucletidos), que tambin se encuentran
en la cromatina centromrica de varios cromosomas.

El ADN de tipo Minisatlite est formado por secuencias de 6 - 25 nucletidos que se repiten en
tndem hasta dar un tamao total entre 100 nucletidos y 20 kb. Un ejemplo de ADN Minisatlite es la
repeticin que forma los telmeros de los cromosomas humanos, en los que el hexanucletido
(TTAGGG) se repite miles de veces en tndem dando lugar a bloques de 5 - 20 kb de tamao. Algunas
repeticiones de este tipo son polimrficas, y dan lugar a los marcadores de tipo VNTR que hemos
mencionado en un apartado anterior.

El ADN de tipo Microsatlite est formado por secuencias de 2, 3 4 nucletidos que se repiten hasta
dar bloques con un tamao total habitualmente no superior a 150 nucletidos. Hay repeticiones de este
tipo por todo el genoma humano, y muchas de ellas son muy tiles como marcadores genticos porque
el nmero de repeticiones vara entre individuos. Ejemplos de ADN microsatlite son los dinucletidos
(CA), las repeticiones de trinucletidos (CAG).

El ADN repetido disperso est formado por secuencias que se repiten miles de veces en el genoma
humano, pero no en tndem sino de manera dispersa. Este tipo de repeticiones constituyen un 45% de todo
el genoma humano, y se clasifican en funcin del tamao de la unidad repetida:
52 GENTICA HUMANA

- Los SINE (Short Interspersed Nuclear Elements, elementos nucleares dispersos cortos) suponen un
13% del genoma humano. Son secuencias cortas repetidas miles de veces en el genoma humano de
forma dispersa. El principal SINE es la familia de elementos Alu, que es especfica de primates y
constituye un 10% de nuestro genoma. Un elemento Alu est formado por una secuencia de 250 - 280
nucletidos, con unas 1.500.000 copias por genoma y una repeticin cada 4 kb como promedio. Es un
elemento relativamente rico en guaninas+citosinas (56% de contenido en CG, mientras que el
contenido promedio del genoma humano es del 41%). Se localiza predominantemente en la bandas R
de los cromosomas humanos. Est flanqueado por pequeas repeticiones directas (en la misma
orientacin). Su estructura es la de un dmero no idntico, ya que el segundo monmero es 30
nucletidos mayor que el primero. Contiene colas poli-A al final de cada monmero, y se transcribe por
la ARN polimerasa III a partir de un promotor interno, pero no codifica ninguna protena. Acta
como un retrotransposn, ya que puede copiarse e insertarse en otras regiones del genoma.

- Los LINE (Long Interspersed Nuclear Elements, o elementos nucleares dispersos largos) constituyen un
20% del genoma humano. Son secuencias con un tamao de varias kilobases, agrupados en distintas
familias. El principal LINE es el llamado LINE-1 L1, formado por una secuencia de unas 6 kb repetida
unas 800,000 veces en el genoma (aunque muchos de estos elementos no estn completos, sino
truncados y les falta la parte 5), llegando a constituir alrededor de un 15% del genoma. Estos
elementos, al contrario que los SINE, no son ricos en guaninas+citosinas (tienen un 42% de
citosinas+guaninas, que es cercano al contenido promedio del genoma humano) y se localizan
predominantemente en las bandas G de los cromosomas. Un elemento L1 codifica dos protenas: una
ARN-binding protein en el marco de lectura ORF1 y una protena con actividad endonucleasa y
retrotranscriptasa en el marco de lectura ORF2. Est flanqueado por unas pequeas repeticiones
directas (en la misma orientacin) y termina en una cola poli-A. Los elementos LINE son
retrotransposones, puesto que pueden copiarse a s mismos a travs de un intermediario ARN y
transponerse a otras localizaciones genmicas. Segn el modelo ms aceptado, el elemento se
transcribe por la ARN polimerasa II a partir de un promotor interno, sus productos proteicos se unen a
la cola poli-A de su propio ARN mensajero y el complejo se inserta en el ADN genmico por la accin
combinada de la endonucleasa (que corta dentro de regiones ricas en AT que llevan la secuencia
LINE
transcripcin
traduccin
Unin de las
protenas a su
propio ARNm
ARNm
Rotura
endonucleoltica
Retrotranscripcin
Reparacin
Nuevo LINE (copia en
otra localizacin)
LINE
transcripcin
traduccin
Unin de las
protenas a su
propio ARNm
ARNm
Rotura
endonucleoltica
Retrotranscripcin
Reparacin
Nuevo LINE (copia en
otra localizacin)
CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 53
TTTTA) y de la retrotranscriptasa. Las protenas codificadas por los LINE son utilizadas tambin para la
retrotransposicin de elementos SINE y de pseudogenes procesados, por lo que pueden jugar un
importante papel como elemento modificador del genoma. De hecho se ha visto que la secuencia
propia de los L1 tiene la propiedad de inhibir la transcripcin, de ah que los niveles de ARNm y
protenas codificadas por los L1 en las clulas sea muy bajo. Lo ms interesante es que tambin
pueden modificar la transcripcin de los genes en cuyos intrones hay abundancia de estos
elementos: un 80% de los genes humanos tienen L1 en sus intrones, y la densidad en L1 correlaciona
negativamente con los niveles de expresin de estos genes. Por tanto, su papel tanto en la evolucin de
genomas como en la regulacin gnica le confieren una gran importancia. Se acab el mito del "ADN
basura".

La Figura 4.9 ilustra el mecanismo de retrotransposicin de los LINE.

- Los HERV (retrovirus endgenos humanos), representan copias de los retrovirus humanos que se han
ido integrando en el genoma humano en el curso de la evolucin y con frecuencia son el origen de
proto-oncogenes celulares. Habitualmente representan copias truncadas del genoma de estos virus, y
constituyen alrededor de un 8% del genoma (hay unas 450.000 copias). Como habitualmente
conservan alguna de las repeticiones terminales largas de estos genomas, se denominan tambin
repeticiones tipo LTR (Long Terminal Repeat).

- Nuestro genoma tambin contiene unas 300.000 copias de elementos repetidos originados por
transposones ADN, lo que supone un 3% del total del genoma. Estos elementos contienen el gen
(habitualmente truncado) de la transposasa, flanqueado por repeticiones invertidas. De entre las
distintas familias que existen cabe destacar el tipo MER1 MER2 y los elementos mariner (Hsmar2),
responsables de algunas reordenaciones cromosmicas importantes en patologa humana.

La Figura 4.10 muestra la estructura de los distintos tipos de repeticiones
dispersas del genoma humano.

Es importante hacer algn comentario sobre la movilidad de los retroelementos dispersos. Tanto los LINE
como los Alu que estn completos pueden, en teora, copiarse e insertarse en otra posicin del genoma a
travs de un intermediario ARNm. De hecho, esto sucede habitualmente, aunque por fortuna con muy baja
frecuencia. Se calcula que 1 de cada 100-200 nuevos nacimientos lleva una insercin nueva de un Alu o de
un L1, que pueden ser causa de enfermedades por diversos mecanismos. Esta tasa de nuevas inserciones
es mucho ms baja que en otros mamferos. Por lo que respecta a los L1, se calcula que existen
actualmente unos 5000 elementos completos en el genoma humano, de los cuales unos 90 son activos
(capaces de retrotransposicin). El potencial patognico de estos elementos viene dado por la propia
capacidad de insertarse aleatoriamente en el genoma (e interrumpir genes), por la desregulacin de la
expresin de genes cercanos (por los elementos promotores de los LINE y SINE), pero sobre todo por
recombinacin ilegtima entre copias de Alu o L1 que estn en localizaciones cromosmicas distintas.
Curiosamente, los elementos Alu causan este tipo de recombinacin con ms frecuencia que los L1,
especialmente en algunos genes que sufren duplicaciones o deleciones por recombinacin entre secuencias
Alu.

Para finalizar, es interesante tener una visin de conjunto de la localizacin de los distintos tipos de
elementos repetidos en el genoma humano, representados sobre un cariotipo convencional. Como ya se ha
dicho, el ADN ribosomal se localiza en el brazo corto de los cromosomas acrocntricos. El satlite alfa
54 GENTICA HUMANA
puede verse en todos los centrmeros. El satlite beta, en cambio, est en localizacin pericentromrica
en los cromosomas acrocntricos y en la constriccin secundaria del cromosoma 1. El satlite gamma es
pericentromrico en los cromosomas 8 y X. El satlite 1 est en los centrmeros de los cromosomas 3 y 4,
adems de encontrarse tambin en el brazo corto de los cromosomas acrocntricos (distal al ADN
ribosomal). El satlite 2 es pericentromrico en los cromosomas 2 y 10, adems de formar la constriccin
secundaria de los cromosomas 1 y 16. Finalmente, el satlite 3 est en la constriccin secundaria de los
cromosomas 9 e Y, as como en el brazo corto de los cromosomas acrocntricos (proximal al ADN
ribosomal). Los elementos dispersos se encuentran distribuidos por todo el genoma, siendo los LINE ms
abundantes en bandas G y los elementos SINE ms abundantes en bandas R (bandas G claras);
microsatlites y minisatlites tambin estn dispersos, aunque stos ltimos tienden a concentrarse en
torno a los telmeros.

En la Figura 4.11 se ven dos ejemplos de la distribucin de elementos
repetidos de tipo satlite en cromosomas humanos.


El genoma mitocondrial

La mitocondria es un orgnulo de probable origen endosimbintico que se ha adaptado a su nicho
intracelular: para aumentar su tasa de replicacin y asegurar la transmisin a las clulas hijas despus de
cada divisin mittica, el genoma de las mitocondrias de mamferos se ha ido reduciendo de tamao hasta
alcanzar las 16.569 pb en el caso del genoma mitocondrial humano. Las mitocondrias son las verdaderas
centrales trmicas de nuestro organismo ya que en ellas tiene lugar la fosforilacin oxidativa (OXPHOS),
es decir, la respiracin celular acoplada a la produccin de energa en forma de ATP. El funcionamiento del
sistema OXPHOS tiene, adems, importancia mdica por la generacin de especies reactivas de O2
(Reactive Oxygen Species, ROS) y por la regulacin de la muerte celular programada o apoptosis. Las
protenas incluidas en el OXPHOS se localizan dentro de la membrana mitocondrial interna, e incluyen:
(1) Componentes de la cadena transportadora de electrones (Cadena respiratoria mitocondrial, CRM); (2)
ATPasa de membrana; (3) Translocador de nucletidos de Adenina (ANT).

El ADNmt humano es una molcula circular de 16.569 pares de bases. El nmero de molculas de
ADNmt por clula vara entre unos pocos cientos en los espermatozoides a unas 200.000 copias en el
oocito, pero en la mayor parte de los tejidos el rango est comprendido entre unas 1.000 y 10.000
copias por clula, con 2 - 10 molculas de ADN por mitocondria. Este genoma contiene informacin para
37 genes:
- Genes que codifican las 2 subunidades 12S y 16S del ARNr (ARN ribosomal) de la matriz
mitocondrial.
- Los genes para los 22 ARNt (ARN transferente), requeridos para la sntesis de protenas mitocondriales
en la misma matriz mitocondrial.
- Genes que codifican 13 polipptidos que forman parte de los complejos multienzimticos del sistema
OXPHOS. En concreto, en el genoma mitocondrial se codifican 7 subunidades del Complejo I, 1
subunidad del Complejo III, 3 subunidades del Complejo IV, y 2 subunidades de la ATPasa (Complejo
V).

CAPTULO 4: GEOGRAFA DEL GENOMA HUMANO 55
Es importante no perder de vista que el resto de las subunidades polipeptdicas de estos complejos, as
como el Complejo II completo, estn codificados en el genoma nuclear, de manera que no todas las
enfermedades mitocondriales estn necesariamente causadas por alteraciones en el ADN mitocondrial.

La Figura 4.12 muestra los complejos proteicos de la membrana de la
mitocondria que estn codificados por genes del propio genoma mitocondrial.

La caracterstica estructural ms sorprendente del ADNmt es que los genes se encuentran situados uno a
continuacin del otro, sin apenas intrones ni regiones no codificantes entre los genes. Al contrario que el
genoma nuclear, en el que las regiones no codificantes son mayoritarias, el ADN mitocondrial slo posee
un 3% de secuencias no codificantes. Veintiocho de los genes mitocondriales (2 ARNr, 14 ARNt y 12
polipptidos) se encuentran en una de las cadenas (cadena H pesada), mientras que los 9 genes restantes
(1 polipptido y 8 ARNt) estn en la cadena complementaria (cadena L ligera). La nica zona del ADNmt
que no codifica ningn gen es la regin del bucle de desplazamiento (bucle-D), localizada alrededor del
origen de replicacin de la cadena H. Esta regin contiene tambin los promotores de la transcripcin y los
elementos reguladores de la expresin gnica. Otra de las peculiaridades de la organizacin gentica del
ADNmt es que los genes de los ARNt se distribuyen entre los genes de los ARNr y los codificantes
de protenas; esta disposicin tiene consecuencias muy importantes para el procesamiento del ARN. Para
la replicacin del ADNmt hacen falta dos orgenes diferentes, uno para cada cadena (OH y OL). Ambos
orgenes de replicacin estn muy separados, haciendo que el proceso sea unidireccional y asimtrico. La
sntesis del ADN se inicia en OH y es realizada por una polimerasa especfica de la mitocondria, la DNApol ,
que alarga un ARN iniciador fruto del procesamiento de un transcrito primario que se sintetiza a partir del
promotor L. La replicacin contina de modo unidireccional hasta alcanzar OL, momento en el cual comienza
la sntesis de la segunda cadena del ADN, alargando tambin un pequeo iniciador de ARN.

La Figura 4.13 muestra la estructura del ADN mitocondrial.

En la transcripcin del ADNmt intervienen una polimerasa de ARN, al menos un factor de transcripcin
implicado en la iniciacin (mtTFA), y uno de terminacin (mTERF). Las dos cadenas del ADNmt se
transcriben completamente a partir de tres puntos de iniciacin diferentes, dos para la cadena pesada
(H1 y H2) y uno para la cadena ligera (L), originando tres molculas policistrnicas que se procesan
posteriormente por cortes endonucleolticos precisos en los extremos 5 y 3 de las secuencias de los ARNt,
para dar lugar a los ARNr, ARNt y ARNm maduros. De esta forma los ARNt, situados entre los genes de los
ARNr y ARNm, actan como seales de reconocimiento para los enzimas de procesamiento. En particular, la
cadena H se transcribe mediante dos unidades de transcripcin solapadas en la regin de los ARNr: la
primera de estas unidades comienza delante del gen para el ARNt
Phe
(lugar de iniciacin H1), termina en el
extremo 3 del gen para el ARNr 16S y es responsable de la sntesis de los ARNr 12S y 16S, del ARNt
Phe
y
del ARNt
Val
. El factor de terminacin (mTERF) se une a una secuencia situada en el gen del ARNt
Leu
y
provoca la terminacin de esta unidad. La segunda unidad de transcripcin comienza cerca del extremo 5
del gen del ARNr 12S (lugar de iniciacin H2) y transcribe la casi totalidad de la cadena pesada; el
procesamiento de este ARN policistrnico origina los ARNm de 12 pptidos y los otros 12 ARNt codificados
en esta cadena. La transcripcin de la cadena ligera comienza cerca del extremo 5 del ARN 7S (en el
bucle-D) y da lugar al iniciador de la replicacin de la cadena pesada, 8 ARNt y 1 pptido (ND6).

La sntesis de las protenas mitocondriales tiene lugar en ribosomas especficos de la mitocondria,
cuyos componentes estn codificados en el ADNmt (ARNr 12S y 16S) y en el genoma nuclear (84 protenas
ribosomales). En este sistema de traduccin se sintetizan las trece protenas codificadas en el ADNmt
56 GENTICA HUMANA
utilizando un cdigo gentico que difiere ligeramente del cdigo gentico universal. As, UGA
codifica el aminocido triptfano (Trp) en vez de ser un codn de terminacin, y los codones AUA y AUU se
utilizan tambin como codones de iniciacin.

La biognesis de la mitocondria depende de la expresin coordinada de los genomas mitocondrial y
nuclear, pero hasta ahora se conoce muy poco acerca de los mecanismos que regulan la interaccin de
ambos sistemas genticos. La expresin del ADNmt parece estar regulada por el factor de iniciacin de la
transcripcin mtTFA, codificado en el genoma nuclear. Este factor podra ser el responsable tanto de los
niveles de ARN como del nmero de copias de ADNmt, ya que la replicacin depende de la sntesis de un
iniciador de ARN a partir del promotor de la cadena ligera. La regulacin de la relacin entre los ARNr y los
ARNm mitocondriales se realiza fundamentalmente mediante la seleccin del lugar de iniciacin de la
transcripcin de la cadena pesada, que a su vez est relacionada con el factor mtTERF (que causa
terminacin de la transcripcin despus de la sntesis de los ARNr) y con el procesamiento de los ARN
primarios. Asimismo, la actividad transcripcional puede estar regulada por estmulos hormonales,
especialmente por hormonas tiroideas que actan tanto de un modo indirecto (por activacin de genes
nucleares) como directamente sobre el propio ADNmt.

CAPTULO 5: EL GENOMA HUMANO EN ACCIN 57
CAPTULO 5. EL GENOMA HUMANO EN ACCIN
La secuencia influye en el estado funcional de la cromatina. Modificaciones
epigenticas y su importancia en la regulacin del estado funcional de la
cromatina. Relacin entre secuencia, estructura y funcin de la cromatina:
territorios cromosmicos.


La secuencia influye en el estado funcional de la cromatina

Como ya se ha dicho, el grado de empaquetamiento no es uniforme a lo largo de todo el genoma. De hecho,
en el ncleo en interfase siempre se distingui una cromatina denominada eucromatina, poco condensada,
y otra llamada heterocromatina, con un mayor grado de condensacin. Hoy sabemos que estas categoras
morfolgicas tienen un correlato funcional, ya que la eucromatina es transcripcionalmente ms activa
mientras que los genes incluidos en heterocromatina tienen un bajo nivel de expresin. La heterocromatina,
a su vez, puede ser de dos tipos: constitutiva, que nunca se transcribe y se localiza en los centrmeros y
en la constriccin secundaria de algunos cromosomas; facultativa, que en el fondo es un tipo de
eucromatina que se heterocromatiniza en situaciones concretas, como es el caso del cromosoma X inactivo
en las mujeres. Adems de estas dos grandes categoras de cromatina, es importante comprender que
dentro de las regiones eucromticas la cromatina tampoco es totalmente homognea, como queda
reflejado, por ejemplo, en su distinta repuesta a varias tinciones. Este comportamiento es precisamente la
base del patrn de bandas caracterstico de cada cromosoma y que permite la creacin del cariotipo
convencional. Como veremos en un captulo posterior, la tincin con un colorante llamado Giemsa produce
unas bandas oscuras (bandas G) separadas por bandas claras (bandas R). La tincin con otra sustancia
llamada Quinacrina (que se une especficamente a regiones ricas en adeninas y timinas) produce un patrn
de bandas similar a las bandas G, mientras que la tincin con Cromomicina-A (que se une
preferentemente a regiones ricas en guaninas y citosinas) genera un patrn similar a las bandas R. Por
tanto, las peculiaridades morfolgicas de la cromatina son debidas, al menos en parte, a diferencias en la
secuencia de nucletidos del genoma; el modelo del andamio (scaffold) que vimos en el Captulo 2 permite
explicar esta relacin, ya que las bandas G representan regiones con un mayor grado de empaquetamiento
del ADN, lo que implica una mayor densidad de las regiones de unin al andamio (llamadas SAR). Como las
SAR son relativamente ricas en adenina y timina, esto explica que estas regiones genmicas se tian ms
intensamente por Quinacrina y Giemsa, mientras las bandas R, ms ricas en guanina y citosina, tienen un
menor grado de empaquetamiento, menor densidad de SAR y se tien dbilmente por estos colorantes. Por
tanto, las distintas bandas del cariotipo reflejan no slo diferencias en la condensacin de la cromatina, sino
tambin diferencias en su composicin: ya hemos visto que el genoma humano tiene un contenido medio
en G+C del 41%, pero que esto no se distribuye de manera uniforme por todo el genoma.

A su vez, las diferencias en condensacin y en composicin de las distintas regiones de cromatina se
correlacionan con otra variable importante: la riqueza en genes y su actividad transcripcional. Por
ejemplo, se estima que un 80% de los genes se localizan en bandas R (las ms ricas en nucletidos G+C),
que son las menos condensadas. Tambin se ha observado que, en general, las bandas R son de replicacin
temprana, mientras que las bandas G son de replicacin ms tarda. Como se recordar del Captulo 2, la
replicacin del ADN en eucariotas comienza en muchos orgenes de replicacin durante la fase S del ciclo
celular, pero no todos los orgenes de replicacin comienzan a funcionar a la vez: hay unos orgenes que
siempre comienzan al principio de la fase S (replicacin temprana) y otros que van comenzando a
funcionar ms tarde (replicacin tarda). Asimismo, se sabe que los genes constitutivos (housekeeping en
58 GENTICA HUMANA
ingls), que son los que se expresan en todos los tejidos, se replican temprano; por el contrario, los genes
que estn en regiones heterocromticas (el cromosoma X inactivo, por ejemplo) son de replicacin ms
tarda. Parece por tanto que regiones con alta densidad de genes, ricas en C+G y descondensadas se
replican antes que regiones silenciadas con baja densidad de genes.

Otro aspecto que diferencia los distintos tipos de bandas es la acetilacin de las histonas. Como se ver
a continuacin, se ha podido comprobar que la acetilacin de las histonas que forman los nucleosomas lleva
a la formacin de una cromatina ms abierta, que permite mejor el acceso de factores de transcripcin y la
expresin de los genes contenidos en esas regiones. Esto se debe a que las colas amino-terminales de
las histonas interaccionan con ms fuerza entre s y con el ADN cuando los grupos psilon-amino de las
lisinas estn en su forma des-acetilada; la acetilacin relaja esas interacciones y descondensa parcialmente
la fibra de 30 nm y la unin del ADN con los nucleososmas. Curiosamente, se ha comprobado que las
histonas de las bandas G estn menos acetiladas que las histonas de las bandas R. Esto ayudara tambin a
explicar la menor condensacin de la cromatina en las bandas R, y nos proporciona un mecanismo para
entender por qu las bandas R se replican antes y son ms activas transcripcionalmente: por un
lado, no necesitan descondensarse para que se lleve a cabo la replicacin, y por otro constituyen unos
dominios en los que el ADN es ms accesible a los factores de transcripcin.

Figura 5.1 La acetilacin de colas amino-terminales de las histonas influye en
la condensacin de la cromatina.

En resumen, es importante darse cuenta de que los mecanismos bsicos de regulacin de la expresin
gnica estudiados en el Captulo 1 estn sometidos a un nivel superior de regulacin, dependiente de la
situacin de un gen dentro del genoma y del estado funcional de la cromatina en que se encuentra, que a su
vez est influido por el tipo de secuencias que la componen. Generalizando, podemos resumir las principales
caractersticas de los dos estados de cromatina ms frecuentes, representados por los dos tipos principales
de bandas citogenticas (banda G, oscuras, y bandas R, claras):

Bandas G Bandas R
Densidad en genes Baja Alta
Porcentaje de G+C Bajo Alto
Replicacin Tarda Temprana
Composicin Ricas en A+T Ricas en G+C
Acetilacin Histonas Baja Alta
Repeticiones predominantes LINE SINE



Modificaciones epigenticas y su importancia en la regulacin del estado
funcional de la cromatina

Es muy importante comprender que los aspectos estructurales y funcionales se integran en un modelo
"dinmico", segn el cual una regin de cromatina estar en un estado ms o menos favorable a la
expresin gnica dependiendo del tipo de secuencias que la forman y tambin de las modificaciones
epigenticas a ese nivel. Por modificaciones epigenticas se entienden todos aquellos cambios que sufre
la cromatina pero que no afectan a la secuencia de nucletidos: por eso no son modificaciones "genticas",
sino que estn "por encima" (que es lo que significa epi en griego). En los ltimos aos se ha comprobado
CAPTULO 5: EL GENOMA HUMANO EN ACCIN 59
experimentalmente la gran importancia que tienen los mecanismos que regulan la actividad de la cromatina
mediante cambios epigenticos. Para entender esto, es importante recordar que la actividad transcripcional
basal en eucariotas es esencialmente restrictiva, en el sentido de que los promotores estn en estado
inactivo hasta que se ponen en marcha por la accin de los elementos llamados activadores y el
ensamblaje del complejo basal de transcripcin. Para que estos factores proteicos se unan a sus dianas en
el ADN es necesario que la cromatina de esa regin est relativamente descondensada, para exponer ms
fcilmente la doble hlice y permitir el acceso de factores proteicos. De hecho, los genes que son
transcripcionalmente activos se asocian habitualmente con sitios hipersensibles a DNAsa I, regiones
cortas (unos pocos cientos de pares de bases) formadas por ADN que no est asociado a nucleosomas,
precisamente porque se encuentra unido a factores de transcripcin.

La Figura 5.2 ilustra esquemticamente la distinta accesibilidad a una regin
de cromatina dependiendo del grado de condensacin.

Los nucleosomas son, por tanto, un elemento fundamental para mantener este estado basal restrictivo, al
impedir el acceso de la maquinaria transcripcional a los promotores. La represin transcripcional mediada
por nucleosomas se debe tanto a las interacciones directas del octmero de histonas con el ADN, como a las
interacciones que se originan entre nucleosomas vecinos para dar lugar a la fibra de cromatina. Como
hemos visto ms arriba, las colas N-terminales de las histonas de los nucleosomas quedan libres hacia
fuera, y son las regiones ms susceptibles de ser modificadas qumicamente para variar su carga y alterar
las interacciones, tanto entre histonas y ADN como entre nucleosomas vecinos. Por tanto, si conseguimos
relajar alguna de estas interacciones conseguiremos favorecer la transcripcin de los genes que estn
incluidos en esas regiones. Esta relajacin se puede conseguir gracias a que las colas N-terminales de las
histonas tienen una serie de aminocidos (lisinas y serinas, principalmente) que pueden sufrir
modificaciones covalentes del tipo acetilacin, metilacin fosforilacin, y que van a ser cruciales
en la regulacin de estos fenmenos. A su vez, estos cambios se coordinan con otras modificaciones
epigenticas que sufre la propia cadena de ADN en forma de metilacin de algunos nucletidos concretos, y
en su conjunto ambos procesos constituyen un importante mecanismo de regulacin de la actividad
transcripcional. A continuacin veremos por separado las modificaciones epigenticas que sufre la
cromatina, por una parte, y el ADN por otra.

A. Modificacin de la cromatina. Para superar la represin basal debida a la presencia de nucleosomas y
facilitar la expresin de un gen, los activadores de la transcripcin pueden potenciar la actividad
transcripcional alterando, en primer lugar, la propia estructura de la cromatina: aunque el activador no se
una directamente al promotor de un gen, puede reclutar distintas actividades modificadoras de la
cromatina cuya accin sea conferir a esa regin un estado que facilite la transcripcin. Estas actividades
pueden ser de varios tipos:

- complejos proteicos implicados en el remodelamiento nucleosomal: son capaces de mover los
nucleosomas de su posicin para dejar expuesta una regin promotora y permitir la expresin gnica.
Este tipo de actividad est mediada por complejos multiproteicos con actividad ATPasa, de los cuales el
primero en ser aislado fue el complejo SWI/SNF (primero se identific en levaduras, despus en
humanos). Este complejo desestabiliza el nucleosoma al romper los contactos del ADN con el octmero,
que queda libre para moverse y asociarse con una regin vecina de la molcula de ADN. Todos los
remodeladotes de nucleosomas pertenecen a la familia SNF2 de ATPasas, y pueden dividirse en 7
subgrupos dependiendo de los dominios proteicos que contienen.

60 GENTICA HUMANA
En la Figura 5.3 se ilustra el movimiento de nucleosomas por la accin de
remodeladotes de la cromatina.

- complejos implicados en la acetilacin de histonas: el factor Gcn5 de levadura fue el primer activador
transcripcional con actividad acetilasa de histonas descubierto, en 1996. Posteriormente se vio que
otros co-activadores de la transcripcin de mamferos tambin posean actividad acetil-transferasa,
factores tales como p300, CBP (CREB-BP) y P/CAF, de ah que hoy en conozcan en conjunto con el
nombre de HAT (Histone AcetylTransferase). stos actan como factores de transcripcin integradores
de diversas vas de transduccin de seales implicadas en el control del ciclo celular y de los procesos
de diferenciacin, reparacin y apoptosis. Otros activadores transcripcionales con actividad HAT son el
factor de transcripcin TAFII250 (que forma parte del complejo TFIID), SRC-1 y ACTR (coactivadores
de receptores nucleares). Al igual que la acetilacin de las histonas conduce a la activacin
transcripcional, la des-acetilacin de las histonas crea una estructura cromatnica ms condensada
que favorece el silenciamiento de la transcripcin de los genes incluidos en la esa regin genmica. En
este sentido, se ha comprobado que los factores HDAC1 y HDAC2 (Histone De-Acetylase), cuya
funcin es des-acetilar las histonas, estn presentes en el complejo Sin3-NcoR, un co-represor
transcripcional que regula la expresin de genes importantes en el ciclo celular y en el desarrollo
embrionario. En conjunto, acetilasas y des-acetilasas actan sobre los mismos aminocidos de las colas
amino-terminales de las histonas H3 y H4, especialmente las lisinas 9, 14, 18 y 23 de la histona H3
y las lisinas 5, 8, 12 y 16 de la histona H4. En la figura 5.1 ya se ha visto el posible mecanismo por
el que la des-acetilacin de las histonas favorece la compactacin de nucleosomas vecinos e impide la
transcripcin en esa regin. De hecho, se ha comprobado que la des-acetilacin de la lisina 16 en la
histona H4 provoca la condensacin de la fibra de 10 nm, mientras que la acetilacin de este residuo
impide la formacin de la fibra de 30 nm y permite la interaccin con co-activadores de la transcripcin.

- otras modificaciones muy importantes son la fosforilacin de la histona H3 en la serina 10 y la
metilacin de las lisinas 4, 9, 27, 36 y 79 en la histona H3 y de la lisina 20 de la histona H4,
metilacin catalizada por unos complejos proteicos que tienen actividad metil-transferasa. Se ha
comprobado que estas modificaciones actan en coordinacin con la acetilacin, estableciendo lo que
ahora se conoce como el "Cdigo de Histonas". Segn este cdigo, una regin se comportar como
eucromatina como heterocromatina dependiendo de las modificaciones epigenticas de las histonas
que conforman los nucleosomas de la regin; las regiones limtrofes, en las que se da una transicin de
un tipo de cromatina al otro, muestran caractersticas propias de ambos tipos de cromatina, y son
capaces de unir complejos proteicos llamados aisladores (en ingls "insulator"), que forman una
especie de barrera fsica e impiden que un tipo de cromatina se extienda ms all del lmite de la regin
e invada la regin vecina. De modo general, el cdigo de histonas establece que una regin de
eucromatina se caracteriza por tener la lisina 4 de la histona H3 metilada (con uno, dos o tres grupos
metilo), y las lisinas 9 y 14 de la misma histona acetiladas. Se ha comprobado que esta configuracin
tiene la propiedad de unirse a un dominio proteico llamado "bromodominio", que est presente en
muchos activadores de la transcripcin. Una regin con estas caractersticas puede
heterocromatinizarse si sufre una cascada de alteraciones: la prdida de la metilacin de la lisina 4, la
desacetilacin progresiva de las lisinas 9 y 14, y finalmente la metilacin de la lisina 9 constituyen una
marca de heterocromatina, a la que se unen protenas que contienen un dominio de silenciamiento
llamado "cromodominio" que recluta factores de silenciamiento como la protena HP1 (protena de
heterocromatina-1). Estas interacciones estn influidas tambin por la fosforilacin de la serina 10 de la
histona H3; por ejemplo, dicha fosforilacin generada por la quinasa Aurora B inhibe la unin de HP1
con la lisina 9 metilada durante la mitosis.
CAPTULO 5: EL GENOMA HUMANO EN ACCIN 61

La Figura 5.4 ilustra el concepto del Cdigo de histonas y su utilidad para
definir distintas regiones de cromatina.


B. La metilacin del ADN juega un papel fundamental en el mantenimiento del silenciamiento
transcripcional. El ADN de vertebrados se metila en el carbono 5 de las citosinas que estn en el
dinucletido CpG (la "p" indica el grupo fosfato que une una citosina con una guanina, en direccin 5' 3').
Curiosamente, la abundancia de este dinucletido en el genoma de vertebrados es slo un 25% de lo
esperado, es decir, el porcentaje normalizado de este dinucletido es de 0,25. En efecto, si el
contenido en C+G del genoma es del 41%, la probabilidad esperada de encontrar un dinucletido CpG es
(0,205 x 0,205) = 0,042 (o sea, 4,2%); en cambio, la frecuencia observada de este dinucletido est en
torno al 1% en el genoma humano, de ah que el porcentaje normalizado sea 1/4 = 0,25. Adems, los
dinucletidos CpG no estn distribuidos homogneamente a lo largo del genoma, sino que son ms
abundantes en los genes, tanto en los exones como, sobre todo, alrededor del inicio de la transcripcin.
Pues bien, los dinucletidos CpG que tienen metilada la citosina son los que estn distribuidos a lo
largo de la secuencia de genes. Por el contrario, los dinucletidos CpG que no estn metilados
que tienden a concentrarse en regiones que se denominan islas CpG. Aunque estas islas se han
definido tradicionalmente como las regiones de un tamao igual o superior a 500 pb, con un contenido total
de G+C superior a 55% y con un cociente de dinucletidos CpG observados frente a esperados superior a
0,6 (criterios de Takai-Jones), hoy en da se pueden definir por su porcentaje normalizado de CpG. De
hecho, el anlisis de todos los promotores del genoma humano identifica dos tipos de genes: los que
tienen un promotor con un porcentaje normalizado de CpG en torno al 0,61 y los que tienen un promotor
con un porcentaje normalizado de CpG en torno al 0,23. Los primeros constituyen un 70% de todos los
promotores, y corresponden a los genes constitutivos domsticos ("housekeeping" en ingls). Por el
contrario, los promotores con bajo porcentaje normalizado de CpG constituyen un 30% del total de los
promotores, y corresponden a los genes que se expresan en tejidos especficos. Los promotores que
contienen una isla CpG estn habitualmente hipometilados en la lnea germinal, lo cual les protege frente a
las transiciones CT que sufren las citosinas metiladas.

En la Figura 5.5 se representa la distribucin de dinucletidos CpG a lo largo
de un gen, mostrando el concepto de isla CpG.

Chromo
Bromo
Ac
T-K-Q-T-A-R-K-S-T-G-G-K-A
9
14
Me
P
4
Me
Ac
Chromo Chromo
Bromo Bromo
Ac Ac
T-K-Q-T-A-R-K-S-T-G-G-K-A
9
14
Me Me
PP
4
Me Me
Ac Ac
62 GENTICA HUMANA
La metilacin del ADN est catalizada por unas metil-transferasas especficas de las citosinas que forman
parte de dinucletidos CpG, y se conocen bsicamente dos tipos de estas metil-transferasas de ADN. Las
DNMT3A y DNMT3B son responsables de la metilacin de novo, es decir, la metilacin de dinucletidos
CpG que no estaban previamente metilados. En cambio, la DNMT1 (ADN-metil-transferasa-1) es
responsable de mantener la metilacin durante la replicacin. En efecto, dado que en la doble cadena de
ADN un dinucletido CpG tiene realmente dos citosinas metilables (ya que existe un CpG en cada una de las
cadenas de la doble hlice), un sitio totalmente metilado tendr realmente dos citosinas metiladas. Tras la
replicacin del ADN, ambas dobles hlices conservarn una cadena con el CpG metilado (la proveniente de
la molcula original), mientras que la cadena de nueva sntesis estar sin metilar. Esto genera dinucletidos
CpG hemi-metilados, es decir, metilados en una de las citosinas pero no en la otra; la DNMT1 tiene la
funcin de re-metilar precisamente estos dinucletidos para restablecer el estado inicial de metilacin
completa que tena la molcula original.

La Figura 5.6 muestra el proceso de re-metilacin de dinucletidos CpG que
han quedado hemi-metilados tras la replicacin.

Numerosos estudios han mostrado el significado biolgico de la metilacin del ADN: 1) es un importante
mecanismo epigentico de silenciamiento gnico a nivel transcripcional, y permite mantener el
silenciamiento de ciertos genes durante los procesos de diferenciacin celular; 2) la metilacin es un
mecanismo de defensa frente a elementos mviles del genoma, cuyos promotores estn
habitualmente silenciados por metilacin; y 3) la metilacin es un mecanismo estabilizador de la
cromatina, especialmente de la heterocromatina pericentromrica, ya que la des-metilacin de este tipo de
cromatina conduce a la aparicin de reordenamientos cromosmicos severos.

Los mecanismos moleculares por los que la metilacin conduce al silenciamiento transcripcional pueden ser
mltiples:

- impidiendo la unin de factores de transcripcin al promotor. Por ejemplo, algunos factores de
transcripcin generales como Sp1, CREB, E2F NF-kB se unen a dominios que contienen CpG, y
esta unin disminuye cuando estos dominios estn metilados. Sin embargo, ste mecanismo no se
puede aplicar de modo general a todos los genes.

- mediante la unin especfica de represores transcripcionales al ADN metilado. Existen varias protenas
de unin a los dinucletidos CpG metilados, denominadas genricamente MeCP ("Methyl-Cytosine
binding Protein") MDB ("Methyl Binding Domain"), que forman parte de complejos con actividad
represora de la transcripcin. Por ejemplo, MeCP-2 es una protena que contiene un dominio de unin
a dinucletidos CpG metilados, as como otro dominio por el que se une a un represor transcripcional
llamado Sin3. Curiosamente, Sin3 reprime la transcripcin a travs de su unin con HDAC2 (que,
como ya hemos visto, des-acetila las lisinas de la histona H3). De esta manera, la represin
transcripcional debida a la metilacin de los dinucletidos CpG se produce gracias a la asociacin
entre metilacin del ADN y acetilacin de la cromatina, ya que el dominio de represin
transcripcional de MeCP-2 es capaz de reclutar el complejo Sin3-NCoR-HDAC2 y as iniciar un foco de
cromatina hipoacetilada en una regin especfica del genoma. Esto explica que las regiones en las que
el ADN est metilado sean capaces de silenciar genes cercanos (aunque stos no tengan sus
dinucletidos CpG metilados), al englobarlos en una regin genmica silenciada por des-acetilacin.

CAPTULO 5: EL GENOMA HUMANO EN ACCIN 63
El video incluido en la Figura 5.7 ilustra la interaccin entre metilacin del
ADN y modificacin de las histonas.

Una propiedad muy importante del silenciamiento por metilacin es que es reversible: se ha comprobado
que los promotores que han sido silenciados por metilacin pueden reactivarse si se des-metila esa regin.
Un mecanismo posible para explicar esta reactivacin es la prdida de la metilacin durante la
replicacin: esto sucedera si ciertos factores de transcripcin activadores nucleares consiguieran unirse
a sus promotores inmediatamente despus de la replicacin y antes de que acte la DNMT1 de
mantenimiento en los sitios hemi-metilados. Una vez que se estabiliza el complejo basal de transcripcin
sobre esa regin, ste atraera algunos componentes con actividad HAT, que a su vez actuaran
manteniendo la cromatina abierta y permitiendo la transcripcin. Esto, adems, impedira la accin de la
DNMT1 y terminara por eliminar la metilacin en esa regin tras varios ciclos de replicacin. Este
mecanismo se conoce como des-metilacin pasiva. Otro mecanismo alternativo para explicar la re-
expresin de genes silenciados por metilacin, sobre todo en clulas diferenciadas que ya no se replican, es
la desmetilacin activa, aunque todava no se ha aislado de modo concluyente ninguna des-metilasa de
ADN.

En resumen, la metilacin del ADN constituye un importantsimo mecanismo epigentico de regulacin de la
expresin gnica, debido a su interaccin con los mecanismos que modifican la estructura de la cromatina.
El mantenimiento de los patrones de metilacin explica tambin que las modificaciones epigenticas sean
heredadas establemente tras la replicacin del ADN. Adems, como ya se ha mencionado, la metilacin
tiene importantes implicaciones biolgicas, y por tanto la alteracin de los procesos normales de
metilacin de la cromatina puede perturbar procesos fisiolgicos importantes. En primer lugar, por ser un
mecanismo fundamental en el silenciamiento de retrovirus endgenos, transposones y ADN satlite, las
alteraciones en la metilacin de estos elementos puede provocar numerosas anomalas genticas.
Adems, la metilacin es la base molecular de los fenmenos de impronta genmica (imprinting) que se
estudiarn ms adelante, y es un mecanismo fundamental en la regulacin de la expresin gnica durante
el desarrollo embrionario. De hecho, el embrin sufre una onda de des-metilacin genmica global en la
fase de mrula de 8 clulas, seguida por la re-metilacin gradual que vuelve a fijar los patrones de
metilacin en la fase de blastocisto. Tambin la inactivacin del cromosoma X en mujeres es un
proceso bsicamente controlado por procesos de metilacin, acetilacin y silenciamiento. Por tanto, cada
vez est ms claro que la des-regulacin de las modificaciones epigenticas de la cromatina est en la base
de algunas enfermedades humanas. El caso ms claro es el de una enfermedad neurolgica hereditaria
llamada Sndrome de Rett, en el que se han identificado mutaciones en el gen que codifica la protena de
unin a metil-citosinas MECP2. Probablemente, esto origine un exceso de ruido transcripcional por falta de
silenciamiento global de muchos genes, con efectos ms marcados en el cerebro que en otros rganos. Por
otra parte, el papel de la metilacin en cncer tambin est cobrando cada vez ms importancia, ya que
se ha visto que muchos tipos de tumores tienen alteraciones importantes en los procesos de metilacin de
la cromatina:

- la desaminacin de citosinas metiladas (debida habitualmente a la accin de una citidn-
desaminasa, bien por desaminacin hidroltica espontnea) provoca un cambio de Citosina por
Timina, haciendo que los dinucletidos CpG metilados sean puntos calientes (hotspots) para la
generacin de mutaciones de este tipo. De hecho, se ha estimado que el 30% de las mutaciones
encontradas en tumores en el gen TP53 (que codifica la protena p53, un supresor tumoral importante)
son transiciones CT que tienen lugar dentro de dinucletidos CpG.

64 GENTICA HUMANA
- se ha comprobado que durante el proceso de iniciacin tumoral hay una hipometilacin global del
genoma de la clula pre-maligna, lo que provoca un aumento en la inestabilidad genmica y la
aparicin de anomalas cromosmicas. Por ejemplo, los ratones en los que el gen DNMT1 ha sido
inactivado muestran una elevada tasa de deleciones o duplicaciones de regiones cromosmicas.
Adems, algunos oncogenes concretos se sobreexpresan en algunos tumores por des-metilacin de sus
promotores (por ejemplo el oncogn BCL2). Del mismo modo, se ha identificado una enfermedad
(Sndrome ICF, siglas de Inmunodeficiencia, inestabilidad Centromrica y defectos Faciales) en la que
los pacientes tienen mutaciones en el gen DNMT3B, que codifica una metil-transferasa que metila
especficamente los satlites centromricos 2 y 3; la desmetilacin de esas regiones de heterocromatina
provoca fusiones entre cromosomas. En conjunto, estos datos sugieren que la metilacin es un
mecanismo muy importante para mantener la estabilidad del genoma.

- al mismo tiempo, la hipermetilacin puntual de algunos genes supresores tumorales, con el
consiguiente silenciamiento y prdida de funcin, es un mecanismo muy frecuente de generacin de
distintos tipos de cncer. Por ejemplo, el gen RB1 est frecuentemente metilado en un tipo de tumores
llamados retinoblastomas espordicos. Tambin es frecuente la hipermetilacin (y silenciamiento) del
gen supresor tumoral p16 en varios tipos de tumores; la hipermetilacin del gen VHL (Von Hippel-
Lindau) en 20% de los carcinomas de clulas renales espordicos; la inactivacin, por hipermetilacin,
del gen de reparacin de desemparejamientos hMLH1 en tumores de colon espordicos que muestran
inestabilidad de microsatlites. En conjunto, se estima que en tejido tumoral hasta un 10% de las islas
CpG estn metiladas, en contraste con clulas normales en las que este porcentaje es mucho ms bajo.

- por su parte, algunos complejos con actividad modificadora de la cromatina se han asociado
tambin con el desarrollo de cncer. Por ejemplo, el gen AIB1, que tiene actividad acetilasa de
histonas, est amplificado en cncer de mama y por tanto se expresa a niveles ms altos de lo normal.
Por otro lado, el co-activador transcripcional CBP, que tambin funciona como una acetilasa de
histonas, est fusionado con el gen MOZ con el gen MLL en pacientes con leucemia mieloide aguda;
esta fusin hace que la actividad acetilasa est aumentada en determinadas clulas de la mdula sea
y esto desencadena la leucemia. Adems, otro co-activador transcripcional con actividad acetilasa de
histonas (la protena p300) est mutado en cncer colorrectal y delecionado en el 80% de los
glioblastomas, un tipo de tumor cerebral. Lo mismo puede decirse de los complejos con actividad des-
acetilasa de histonas (HDAC): ya hemos visto que la supresin de Myc y la unin de Rb con el factor
de transcripcin E2F dependen en gran medida de su unin con complejos que tienen actividad des-
acetilasa. Adems, se ha demostrado que algunas oncoproteinas virales como HPV E7 el antgeno
T de SV40 inactivan el gen RB1 al impedir su unin con complejos que tienen actividad HDAC.
Finalmente, las translocaciones asociadas con la leucemia promieloctica producen fusiones entre
factores de transcripcin que interaccionan con diversas acetilasas y des-acetilasas de histonas, con
complejos remodeladores de la cromatina y con protenas que tienen actividad metil-transferasa de
histonas.
CAPTULO 5: EL GENOMA HUMANO EN ACCIN 65
La Figura 5.8 muestra la regulacin de la transcripcin de un gen que
responde al cido retinoico, mostrando la importancia de los complejos
modificadores de la cromatina y su alteracin en un tipo de leucemia.

Considerando todos los ejemplos citados en los prrafos anteriores, podemos concluir que los procesos que
regulan la metilacin de la cromatina estn implicados en la iniciacin y progresin tumoral; esto, adems,
abre nuevas posibilidades teraputicas en muchos tipos de cncer, ya que el estado de metilacin es
potencialmente modificable mediante frmacos.


Relacin entre secuencia, estructura y funcin de la cromatina: territorios
cromosmicos

Al ocuparnos de los mecanismos que regulan la funcin del genoma a nivel global, es importante tener en
cuenta el nivel superior de organizacin de un genoma dentro del ncleo. En los ltimos aos se ha puesto
en evidencia que distintas regiones de la fibra de cromatina tienden a ocupar posiciones concretas
en el ncleo, dependiendo de la secuencia subyacente, del estado transcripcional de los genes de esa
regin y de sus modificaciones epigenticas, del tiempo de replicacin del ADN implicado, etc. Por tanto,
cada vez est ms claro que si queremos tener una imagen completa de cmo se regula la funcin del
genoma, no podemos ignorar aspectos estructurales tales como la composicin en nucletidos o la posicin
dentro del ncleo.

Uno de los aspectos ms intrigantes de la biologa genmica de los ltimos aos es la organizacin espacial
de la cromatina dentro del ncleo de la clula eucariota, dando lugar a lo que se han denominado
"territorios cromosmicos". Este concepto ha venido a completar la imagen del ncleo eucariota como
una estructura compartimentalizada, en la que distintas regiones contienen maquinarias especficas que
llevan a cabo funciones concretas. Esta nocin debe integrarse con la presencia de dominios cromatnicos
definidos y ms o menos estables a lo largo de la vida de una clula. Diversos estudios han mostrado de
Ac
Ac
Translocacin con
Protena de fusin
PML/RARa
Gen que responde
al cido Retinoico
R
X
R
Ausencia de ligando
Desacetilacin
(Represin)
Unin del ligando
(cido retinoico)
Acetilacin
(Transcripcin)
Forma anmala
del receptor
Impide unin del
ligando
R
A
R
HDAC
NCOR
Sin3
R
X
R
HAT
R
A
R
R
X
R
PML/RAR
HDAC
NCOR
Sin3
HDAC
NCOR
Sin3
Ac
Ac
Ac Ac
Ac Ac
Translocacin con
Protena de fusin
PML/RARa
Gen que responde
al cido Retinoico
R
X
R
Ausencia de ligando
Desacetilacin
(Represin)
Unin del ligando
(cido retinoico)
Acetilacin
(Transcripcin)
Forma anmala
del receptor
Impide unin del
ligando
R
A
R
R
A
R
HDAC
NCOR
Sin3
HDAC
NCOR
Sin3
R
X
R
R
X
R
HAT HAT
R
A
R
R
A
R
R
X
R
R
X
R
PML/RAR PML/RAR
HDAC
NCOR
Sin3
HDAC
NCOR
Sin3
HDAC
NCOR
Sin3
HDAC
NCOR
Sin3
Ac Ac
Ac Ac
66 GENTICA HUMANA
forma convincente que la cromatina correspondiente a cada uno de los cromosomas tiende a ocupar unas
posiciones concretas en el ncleo en interfase, y que esas posiciones tienden a mantenerse durante el ciclo
celular. Por ejemplo, la posicin de un cromosoma concreto dentro del ncleo est relacionada con el
tamao del cromosoma y con su riqueza en genes, que como hemos visto se correlaciona tambin con
la secuencia de nucletidos subyacente. En general, se considera que los cromosomas pequeos tienden a
localizarse hacia el interior del ncleo; igualmente, cromosomas ricos en genes tienden a ocupar posiciones
centrales. Tambin existen datos que muestran que las regiones pobres en genes y en secuencias Alu se
asocian con la periferia del ncleo, dejando la cromatina rica en genes en el interior. De todas formas,
todava se desconoce cmo se establecen estos territorios y cmo se mantienen tras la mitosis.

En la Figura 5.9 se ilustra el concepto de territorio cromosmico.

La replicacin del ADN y la transcripcin gnica son dos procesos que tienen lugar dentro del ncleo y que
exigen una remodelacin importante de la fibra de cromatina para permitir el acceso de las maquinarias
proteicas que los llevan a cabo. Adems, se ha visto que ambos procesos no tienen lugar al azar, en
cualquier lugar del ncleo, sino en compartimentos especializados a los que acuden las fibras de cromatina
que estn en la vecindad. Se habla as de "fbricas de replicacin" de "fabricas de transcripcin",
regiones nucleares ocupadas por regiones genmicas que se replican o transcriben simultneamente aunque
pertenezcan a territorios cromosmicos distintos. Lgicamente, las asas de cromatina que ocupan una
fbrica determinada tendrn una configuracin similar, en cuanto al grado de condensacin de la cromatina,
la secuencia de nucletidos, la riqueza en genes, etc; esto explica que el genoma se organice como un
mosaico de regiones que comparten caractersticas similares, ya que esas regiones podran interaccionar
dentro del ncleo al situarse en una misma fbrica de replicacin o de transcripcin. Por ejemplo, se ha
visto que en el genoma humano existen unas regiones llamadas RIDGES (Regions of IncreaseD Gene
Expression, en ingls) en las que son ms abundantes los genes que se transcriben activamente, y son
regiones ricas en G+C, pobres en repeticiones tipo LINE y con densidad gnica alta. Junto a stas, se
observan tambin regiones con poca densidad en genes, bajo nivel transcripcional y relativamente pobres
en G+C, que se llaman por tanto anti-RIDGES. Pues bien, los genes presentes en RIDGES tienden a
localizarse, dentro del ncleo, en torno a las fbricas de transcripcin. Lo mismo sucede con los genes de
replicacin temprana, que se asocian significativamente con las fbricas de replicacin nucleares. Por tanto,
los modelos actuales postulan que los genes que son replicados o transcritos residen en regiones
cromatnicas relativamente descondensadas, las cuales salen de sus propios territorios cromosmicos
hacia fbricas de replicacin o transcripcin vecinas. En esas fbricas, por tanto, pueden interaccionar
regiones alejadas de un mismo cromosoma, o incluso asas de cromatina de territorios cromosmicos
distintos; esto permite explicar, en el caso de la transcripcin, la accin de potenciadores de la expresin
que actan a larga distancia incluso en trans.

Como es lgico, en todas estas interacciones son importantes las modificaciones epigenticas de la
cromatina y del ADN que hemos estudiado en este Captulo, que en el fondo constituyen la base molecular
que permite los fenmemos de condensacin y descondensacin necesarios para la replicacin, transcripcin
y desplazamiento fsico de las asas de cromatina. Conjugando todos estos elementos, obtenemos una visin
dinmica de la cromatina nuclear en la que que la estructura del ncleo se integra con la funcin y
secuencia del genoma. Esta visin es mucho ms rica que los modelos anteriores, que no tenan en cuenta
todos estos factores, y adems permite explicar mucho mejor la regulacin fina de la expresin gnica
durante el desarrollo embrionario la diferenciacin celular. La otra cara de la moneda es que se trata de
procesos tremendamente complicados y, por ello, potencialmente frgiles, de modo que pequeas
perturbaciones en estos mecanismos pueden dar lugar a alteraciones genticas y enfermedades humanas.
En este sentido, el cncer es un ejemplo tpico de proceso complejo de des-regulacin de la
CAPTULO 5: EL GENOMA HUMANO EN ACCIN 67
diferenciacin celular, en el que se observan importantes alteraciones epigenticas y una fuerte
desorganizacin de la estructura nuclear.

68 GENTICA HUMANA
CAPTULO 6: ORIGEN DE LA VARIACIN GENTICA EN HUMANOS 69
CAPTULO 6: ORIGEN DE LA VARIACIN GENTICA EN HUMANOS
Variacin en el ADN: polimorfismos y mutaciones. Mecanismos de reparacin
del ADN en humanos. Enfermedades causadas por alteraciones en los
mecanismos de reparacin.


Variacin en el ADN: polimorfismos y mutaciones

La variacin observable en los individuos se debe en gran medida a la variacin gentica, sobre la que se
aade la variacin producida por la influencia del ambiente. La variacin gentica se debe a la presencia de
cambios genticos heredables (de una clula a sus clulas hijas), que adems son transmitidos a la
siguiente generacin si afectan a la lnea germinal (pero no son transmitidos si solamente afectan a clulas
somticas). Como es sabido, un gen localizado en un locus puede presentarse en formas diferentes
debidas a variaciones en la secuencia. Cada forma alternativa se denomina alelo, y el porcentaje de
individuos de la poblacin general que presenta cada alelo se denomina frecuencia allica. Cuando un locus
se presenta, al menos, en dos formas allicas y la frecuencia allica del alelo ms raro es del 1% o mayor,
ese locus se llama locus polimrfico, y esa variacin se denomina polimorfismo. La variacin inter-
individual garantiza la adaptacin de una especie a condiciones ambientales cambiantes, a expensas de
producir algunos individuos con mutaciones ms graves, que desencadenan una enfermedad.

En humanos, la variacin entre individuos se genera principalmente durante el proceso de reproduccin
sexual (por recombinacin meitica). Adems, durante la vida de un individuo se van introduciendo muchas
nuevas mutaciones en el genoma de sus clulas, aunque slo un pequeo porcentaje de estos cambios
afectan a las clulas germinales y quedan fijados en el genoma de la especie. La tasa de nuevas
mutaciones es resultado del equilibrio entre mutacin y reparacin de las mutaciones. En efecto, en cada
divisin celular se incorporan 6x10
9
nucletidos, y se estima que se producen unas 10
17
divisiones celulares
durante la vida media de un individuo: por tanto, un sistema sin errores debera tener una exactitud de
6x10
26
, lo que es virtualmente imposible. De hecho, se sabe que la ADN polimerasa produce un error cada
10
4
nucletidos incorporados, aunque est dotada de un sistema de edicin que mejora esta tasa
hasta 10
7
. Adems, los sistemas de deteccin y reparacin de errores consiguen que, al final, la replicacin
del ADN celular slo origine un error cada 10
10
nucletidos. De hecho, se estima que en una clula
somtica aparecen unas 10
-7
mutaciones por gen por divisin, es decir, 1 mutacin por cada 300 divisiones
celulares (asumiendo un total de 30.000 genes). Esta es una tasa extremadamente baja (insuficiente para
explicar todas las mutaciones que se producen en cncer, por ejemplo), lo que implica la existencia de
sistemas celulares de reparacin del ADN que se ocupan de reparar la inmensa mayora de las mutaciones
introducidas en el genoma, contribuyendo a mantener una fidelidad alta. Adems, muchas de estas
mutaciones sern silenciosas porque no afectan a ADN codificante; otras, las ms dainas, sufrirn una
fuerte presin selectiva y su frecuencia allica ser muy baja. Como se ve, la presencia de polimorfismos y
mutaciones en las poblaciones humanas es resultado del juego entre mutacin-reparacin-seleccin.


Mecanismos de reparacin del ADN en humanos. Enfermedades causadas por
alteraciones en los mecanismos de reparacin

A. Reparacin de desemparejamientos entre nucletidos normales.
70 GENTICA HUMANA
Los mecanismos de reparacin mencionados actan reparando tipos especficos de dao al ADN. Los
desemparejamientos entre bases normales pueden originarse por la tautomera de las bases (la forma
imina de Citosina empareja con Adenina, o la forma enlica de Timina empareja con Guanina), por
desaminacin de citosinas metiladas (las citosinas metiladas de los dinucletidos CpG se desaminan a
Timina), y principalmente por los errores de la ADN polimerasa durante la replicacin del ADN. Tambin
se producen desemparejamientos durante la formacin de heteroduplexes en los procesos de
recombinacin. Adems, el deslizamiento de la cadena nueva sobre la cadena molde durante la replicacin
tambin puede producir bucles de insercin/delecin (IDLs=bucles de insercin/delecin). Todos estos
tipos de desemparejamiento se corrigen por el sistema MMR (mismatch repair), cuyos componentes
conocidos en humanos son hMLH1, hMSH2, hMSH3, hMSH6, hPMS1, hMLH3 y hPMS2 (homlogos de MutS y
MutL de E. coli). Estas subunidades actan como heterodmeros hMSH2/hMSH6, que reconocen tanto los
bucles (loops) de inserciones/deleciones de 1 a 8 nucletidos como los desemparejamientos simples de una
base; o bien actan como heterodmeros hMSH2/hMSH3, que reconoce slo bucles. Cada uno de estos
dmeros, a su vez, acta junto con los homlogos de MutL, que son hMLH1/hPMS2 y hMLH1/hPMS1
(recientemente se ha descrito tambin hMLH1/hMLH3). En concreto, los heterodmeros hMSH2/hMSH6 junto
con hMLH1/hPMS2 reparan los desemparejamientos simples, mientras que cualquiera de los dos complejos
(hMSH2/hMSH3 hMSH2/hMSH6) en combinacin con hMLH1/hPMS2 son capaces de reparar stem-loops
(tallo-bucle) producidos por IDLs, como se muestra en la figura.

La Figura 6.1 muestra algunos ejemplos de desemparejamientos entre
nucletidos normales y el funcionamiento del sistema de reparacin de
desemparejamientos MMR.

En E. coli, este sistema acta unindose al desemparejamiento y a una base metilada adyacente, corta la
cadena no metilada (recin sintetizada) hasta una distancia de 1-2 kb del mismatch, una endonucleasa
corta los nucletidos contenidos en el asa, y la polimerasa rellena el hueco. En mamferos el mecanismo no
est todava totalmente explicado, pero se ha encontrado una protena (MBD4 MED1) que se une a metil-
citosinas, tiene actividad N-glicosilasa y forma complejos con MLH1, adems de modular el sistema de MMR.

Cuando hay defectos en este proceso de reparacin aparecen errores durante la replicacin del ADN, errores
que se pueden ver al analizar secuencias repetidas cortas tipo Microsatlite. Por tanto, los defectos en el
sistema de reparacin de desemparejamientos dan lugar al fenmeno conocido como Inestabilidad de
Microsatlites (MIN= Microstallite INstability) o "fenotipo mutador". Se conocen algunas enfermedades
debidas a mutaciones en componentes de estos sistemas de reparacin. Por ejemplo, 90% de los pacientes
con cncer colo-rectal no-polipsico hereditario (HNPCC Sndrome de Lynch) tienen mutaciones en uno de
los genes hMSH2, hMLH1, hPMS1, hPMS2 o hMSH6, de forma los individuos que han heredado una mutacin
en uno de los alelos tienen una alta probabilidad de sufrir una segunda mutacin en el otro alelo en alguna
de sus clulas somticas, por lo que el riesgo global de desarrollar este tipo de cncer es del 80-85% (o del
75% a los 55 aos) en estos sujetos. Estos tumores muestran inestabilidad de microsatlites, pero adems
la inestabilidad tambin afecta a genes que tienen repeticiones en sus secuencias codificantes (BAX,
TGFBRII). Son las mutaciones en estos genes las que a menudo llevan al desarrollo de neoplasias.
Curiosamente, los pacientes homocigotos para mutaciones en MLH1 (dos mutaciones en la lnea germinal)
desarrollan en la infancia neoplasias hematolgicas adems de otros tumores (neurofibromatosis,
meduloblastoma), lo que sugiere la existencia de genes implicados en la hematopoyesis y en el control del
crecimiento celular que son dianas del sistema MMR.

B. Reparacin de nucletidos daados.
CAPTULO 6: ORIGEN DE LA VARIACIN GENTICA EN HUMANOS 71
Otros sistemas detectan la presencia de bases anormales tales como, por ejemplo, los uracilos que
aparecen por la des-aminacin de una citosina. En general, estas modificaciones estn debidas a la
accin de mutgenos (benzopirenos del tabaco, agentes alquilantes, diversos agentes qumicos de la dieta,
el dao causado por especies reactivas de oxgeno, as como las alteraciones debidas a la radiacin
ultravioleta. Los procesos qumicos que con mayor frecuencia provocan mutaciones son 1) las oxidaciones
por radicales libres, especialmente la formacin de 8-oxoguanina, que se empareja con T en vez de C (se
calcula que se forman unas 10.000 al da en cada clula) y 2) las reacciones hidrolticas, ya que la
molcula de ADN sufre una hidrlisis espontnea lenta que hace que se pierdan unas 10.000 purinas al da
en un genoma humano, con la consiguiente creacin de otros tantos sitios apurnicos. Tambin la
radiacin UV produce sitios apurnicos, pero sobre todo provoca dmeros de pirimidinas.

La Figura 6.2 muestra la estructura de algunos nucletidos anormales y la
formacin de lesiones por accin de la luz ultravioleta.

En general, todas estas lesiones son graves, ya que impiden la replicacin correcta del ADN y, a la larga,
llevan a la muerte celular. Podemos generalizar diciendo que las lesiones del ADN producidas por la
presencia de nucletidos anormales se corrigen por cuatro mecanismos: reversin directa, BER (Base
Excision Repair), NER (Nucleotide Excision Repair) por polimerasas capaces de pasar por encima de la
lesin.

Figura 6.3 Visin general de los mecanismos de reparacin de lesiones que
incluyen nucletidos daados.

A continuacin se ve con ms detalle cada uno de estos mecanismos:

1. Al contrario que otras especies, la reversin directa por enzimas fotoreactivadoras no existe en
humanos. Nuestro nico recurso en este sentido consiste en un enzima llamado MGMT (metil-guanina
metil-transferasa), que puede eliminar el metilo introducido por agentes alquilantes en la guanina (el cual
dara lugar a transiciones GA, pues la O
6
-metilguanina se empareja con Timina).

2. La reparacin por escisin de bases (BER) elimina las bases que han sufrido ataques hidrolticos (des-
aminacin, por ejemplo) por ROS o la 8-oxo-guanina producida por el tabaco. El paso crtico en este tipo de
reparacin es la rotura del enlace N-glicosdico que une la base al esqueleto desoxi-ribosa-fosfato,
catalizado por ADN glicosilasas (especficas para determinados tipos de lesin: UDG, OGG, etc).
Posteriormente, el sitio AP (apurnico apirimidnico) es roto por una AP endonucleasa que cataliza la
incisin del enlace fosfodiester en posicin 5 al sitio AP. La escisin del azcar se completa con la
eliminacin del residuo desoxi-ribosa-fosfato por la accin de una desoxi-ribosa-fosfodiesterasa que
corta el otro enlace fosfodister. Finalmente, se rellena el hueco mediante la accin de ADN pol | y una
ADN ligasa. Este mecanismo de reparacin parece necesario para la viabilidad, ya que el ratn knock-out
para ADN pol | es letal embrionario. Un proceso paralelo es crucial en la diversificacin de los genes de
las inmunoglobulinas, ya que los linfocitos B expresan un enzima llamado AID (Activation-Induced
Deaminase) que desamina citosinas y las convierte en uracilos; dichos uracilos crean sitios AP que pueden
ser procesados por un complejo llamado RAD50 (que veremos ms adelante) que tienen una actividad liasa
que rompe el esqueleto desoxi-ribosa-fosfato y rompe el ADN. Dichas roturas son necesarias para que los
genes de la inmunoglobulinas se reordenen y puedan dar lugar a la diversidad necesaria para una adecuada
respuesta inmune.

72 GENTICA HUMANA
El video de la Figura 6.4 muestra el funcionamiento del sistema de reparacin
por escisin de bases (BER).

3. La reparacin por escisin de nucletidos (NER) elimina fotoproductos producidos por UV y otros aductos
que confieren estructuras anormales a la cadena de ADN. El mecanismo de actuacin de este sistema de
reparacin no est totalmente claro, pero se sabe que requiere la formacin de un complejo entre XPC
(protena que es esencial para NER) y RPA (protena de unin a ADN monocatenario) con la regin
lesionada. Sobre este foco tambin se unen XPA y el complejo TFIIH (que contiene, entre otras, las
protenas XPB (ERCC3) y XPD (ERCC2), ambas con actividad helicasa necesaria para llevar a cabo NER). El
paso clave es la creacin de dos incisiones, flanqueando la lesin, en la cadena de ADN que est daada:
una incisin tiene lugar 3 a 9 bases en direccin 3 de la lesin y la otra incisin se produce 16 a 25
bases en direccin 5 de la lesin, comprendiendo unas 25-30 bases en total. En mamferos, la incisin 3
la lleva a cabo una nucleasa llamada XPG, y la incisin 5 la realiza el heterodmero XPF/ERCC1. Tras las
incisiones y eliminacin de la regin daada, tiene lugar la resntesis de esa regin mediante la accin de un
holoenzima que contiene PCNA y DNApol o o c.

La Figura 6.5 incluye un video que muestra esquemticamente el
funcionamiento del sistema de reparacin por escisin de nucletidos (NER).

Un aspecto especialmente interesante es la relacin del NER con la transcripcin, a travs de la presencia de
XPB y XPD en TFIIH (que es uno de los factores de transcripcin generales), dando lugar al concepto de
Reparacin acoplada a la transcripcin (TCR=Transcription-Coupled Repair). De hecho, se ha comprobado
que el dao por UV se repara con ms eficacia y ms rpido en la cadena que se transcribe y en genes
transcripcionalmente activos. Tambin se ha visto que ciertos tipos de dao oxidativo puede repararse por
TCR incluso cuando el NER no funciona. Adems de los citados XPB y XPD, otras dos protenas con actividad
helicasa (CSA y CSB) son responsables de TCR, y tambin se ha implicado a hMLH1 en TCR. Las
mutaciones que destruyen el sistema TCR dan lugar a una enfermedad llamada Sndrome de Cockayne.
Las mutaciones en genes que codifican otras protenas asociadas con NER dan lugar a varias enfermedades
(Xeroderma pigmentosum, Tricotiodistrofia), que en su conjunto cursan con fotosensibilidad e
inestabilidad cromosmica, y aumento del riesgo de aparicion de melanoma (un tipo de cncer de piel).
Finalmente, algunos pacientes tienen una variante de Xeroderma Pigmentosum sin defectos en NER
(llamada XP variante, XP-V), que est debida a mutaciones en el gen humano homlogo del gen RAD30
de levadura. Este gen codifica la polimerasa eta (Polq), que puede replicar el ADN correctamente incluso en
la presencia de dmeros de pirimidinas.

4. Respecto al ltimo mecanismo de reparacin de nucletidos daados (es decir, las polimerasas capaces
de "saltarse" la lesin), recientemente se ha visto que Pol , (polimerasa zeta) Pol q (polimerasa eta)
son capaces de sintetizar ADN frente a dmeros TT. Sin embargo, as como Pol q suele introducir dos
Adeninas, Pol , introduce bases incorrectas y por tanto es un mecanismo de reparacin de baja fidelidad.

C. Reparacin de roturas de la doble hebra del ADN.
La creacin de roturas bicatenarias del ADN (DSB=Double-Strand Breaks) es un paso necesario para la
recombinacin homloga en meiosis y mitosis, y para la reordenacin V(D)J de genes de las
inmunoglobulinas y receptores de clulas T. Adems, este tipo de roturas aparecen durante la replicacin
del ADN y tambin son causadas por diferentes agentes genotxicos: radiacin ionizante (rayos X), ROS
originados por el metabolismo celular. Los DSB se reparan por dos vas principales, en diferentes fases del
ciclo celular: Fusin no homloga de extremos (NHEJ), que funciona sobre todo en G1/S (antes de la
CAPTULO 6: ORIGEN DE LA VARIACIN GENTICA EN HUMANOS 73
replicacin del ADN) y Recombinacin homloga (HR), que tericamente actuara en S/G2, cuando ya
hay dos cromtides hermanas (de manera que se utiliza la doble hebra homloga como molde para la
reparacin).

La Figura 6.6 muestra las posibilidades de respuesta celular a la aparicin de
roturas bicatenarias en el ADN (DSB) y sus efectos.

1. Recombinacin Homloga: como ya hemos comentado en el Captulo 2, la maquinaria responsable del
mecanismo molecular de recombinacin meitica se utiliza tambin para reparar DSB a partir de una
cromtide hermana. El mecanismo general es bien conocido, e incluye el procesamiento de los extremos
mediante una exonucleasa 53 para dejar extensiones 3 libres, invasin de la doble hebra homloga por
parte del filamento de ADN monocatenario recubierto de protenas, sntesis de nuevo ADN usando la cadena
homloga como molde, ligacin y resolucin de la recombinacin. Da lugar a conversin gnica con sin
sobrecruzamiento, segn sea la resolucin de las estructuras de Holliday).

RAD51 (homlogo del gen RecA, que en E. coli es fundamental en la respuesta SOS) forma filamentos
sobre el extremo monocatenario de ADN que resulta de la digestin de los extremos libres, y es
necesario para que se pueda realizar la invasin de la cadena libre a la doble cadena homloga. RAD51 es
indetectable en G1 y se expresa en S/G2. Los ratones RAD51
-/-
son letales embrionarios y sus clulas
muestran inestabilidad cromosmica. Una lnea celular de pollo, en la que RAD51 est bajo el control de un
promotor represible, muestra inestabilidad cromosmica y muerte celular cuando se reprime la expresin de
RAD51, lo que refuerza la necesidad de este gen para la viabilidad celular. Hay otros genes implicados en
reparacin de DSB que tienen cierta homologa con RAD51 y que podran modular la accin de ste. Por
ejemplo, se ha visto que la ausencia del gen XRCC2 (20% de homologa con Rad51) disminuye la eficacia de
la recombinacin homloga en la reparacin de DSB, pero no es letal; lo mismo podra suceder con RAD55 o
RAD57. Por otra parte, se ha comprobado en levadura que la protena RPA altera la eficacia con la que se
forman los filamentos de RAD51.

RAD52 parece actuar como el portero del mecanismo de recombinacin homloga. Esta protena
interacciona con RPA y con RAD51, favoreciendo la formacin del filamento de RAD51 en presencia de RPA.
Como el ratn RAD52
-/-
no es letal (slo se observa una ligara disminucin en la eficacia de recombinacin
homloga), se postula la existencia de genes homlogos de RAD52 complementen la ausencia de ste.
La expresin del complejo RAD50 no vara durante el ciclo celular, por lo que debe regularse post-
traduccionalmente (mediante fosforilacin o por compartimentalizacin en el ncleo). Este complejo tiene
actividad 53 exonucleasa, y parece transducir seales de dao de ADN hacia la parada del ciclo
celular. Experimentos de irradiacin en bandas han mostrado, mediante anticuerpos monoclonales contra
un componente de este complejo, que RAD50 se asocia a los DSB muy pronto tras la irradiacin. En
humanos, los pacientes con el llamado "Sndrome de Roturas de Nimega" tienen mutaciones en un
componente de este complejo llamado NBS1, muestran sensibilidad a radiacin ionizante e inestabilidad
cromosmica, y las clulas de estos pacientes no son capaces de formar focos despus de la irradiacin con
rayos X ultrablandos; por tanto, lo ms probable es que la protena NBS1 sea responsable de dirigir el
complejo RAD50 a los lugares de dao del ADN.

Una observacin muy interesante es la implicacin de BRCA1 y BRCA2 (genes mutados en ciertos tipos de
cncer de mama familiar) con la reparacin de DSB, ya que se ha visto que las protenas codificadas por
estos genes interaccionan con RAD51, bien directamente (BRCA2) o de manera indirecta (BRCA1). ambas
son protenas nucleares que se expresan en S/G2, funcionan como activadores transcripcionales, y los
74 GENTICA HUMANA
ratones knock out de ambas son letales embrionarios. En cambio, un ratn que lleva una copia de BRCA2
truncada (BRCA2
tr/tr
) sufre linfomas del timo, alta inestabilidad cromosmica y estimulacin de la va de
sealizacin de p53. BRCA1 se fosforila tras dao al ADN, y se ha descrito la asociacin de BRCA1 con el
complejo RAD50 en el momento del ciclo celular en que BRCA1 est fosforilado (S/G2). Por otra parte, en
estudios de colocalizacin tras irradiacin similares a los descritos arriba, se ha visto que BRCA1 est
presente en focos nucleares que contienen RAD50 en unas clulas o en focos que contienen
RAD51 en otras clulas, pero no hay clulas en las que se asocie con ambos a la vez. Una hiptesis
atractiva es que durante la reparacin de DSB por recombinacin homloga BRCA1 coopera con RAD50 en
el procesamiento de los extremos del ADN daado y que, mediante la interaccin entre BRCA1 y BRCA2
(que se asocia fsicamente a RAD51), facilita el acoplamiento con los procesos de recombinacin mediados
por RAD51.

La Figura 6.7 ilustra la presencia de focos de reparacin en clulas que han
sido previamente irradiadas para generar roturas bicatenarias (DSB) en el
ADN.

2. Fusin no homloga de extremos (NHEJ): El proceso general de reparacin es similar pero sin
recombinacin, ya que en este caso no existe una doble cadena homloga: simplemente se fusionan los
extremos libres. Tras la generacin del DSB, los extremos libres tambin son procesados por una nucleasa;
posteriormente se procede a la unin de los mismos y a la ligacin, perdindose siempre algunas bases en
la regin de unin.

Este mecanismo tiene lugar fisiolgicamente en linfocitos, donde es responsable de la reordenacin de
segmentos V(D)J de los genes de inmunoglobulinas. Un componente principal de este sistema es el
complejo ADN-PK (DNAPK), una serina/treonina kinasa nuclear que consta de una subunidad cataltica
(DNAPKcs) y de un heterodmero de unin a ADN llamado KU (que a su vez se compone de KU70 y KU80).
El complejo ADN-PK se asocia a los extremos rotos, ayuda al alineamiento de los extremos y facilita su
ligacin. Este sistema de reparacin es importante, sobre todo en clulas del sistema inmune, y de hecho
las mutaciones en el gen que codifica la DNAPKcs provocan la enfermedad llamada Inmunodeficiencia
Combinada Severa (SCID). Adems, el complejo ADN-PK fosforila y activa una nucleasa llamada Artemis,
que es la responsable de llevar a cabo el procesamiento de los extremos libres para que se puedan religar.
Este ltimo paso, la unin de los extremos ya procesados, es realizado por una ligasa (ADN ligasa IV) que
acta junto con XRCC4, una fosfoproteina nuclear que tambin es sustrato de ADN-PK in vitro.

El video de la Figura 6.8 muestra, paso a paso, el funcionamiento del sistema
de reparacin por fusin de extremos (NHEJ).

Es muy interesante la asociacin que se ha encontrado en levaduras entre Ku70 y protenas silenciadoras de
la transcripcin de telmeros (Sir2, Sir3 y Sir4), sugiriendo la posibilidad de que Ku reclute protenas Sir
a los DSB para inducir un estado de cromatina condensada que evite la transcripcin o replicacin y facilite
el proceso de reparacin, o bien evite que los extremos libres de ADN puedan interaccionar con otras
molculas de ADN. Dado que la disrupcin de Ku o del complejo RAD50 lleva al acortamiento de telmeros
en levaduras, es lgico pensar que Ku se una al ADN telomrico e interaccione con Sir4 para inhibir la
replicacin a ese nivel.

Tradicionalmente se ha considerado que el principal mecanismo de reparacin de DSB en mamferos es la
fusin de extremos (NHEJ), ya que se ha visto que la frecuencia de recombinacin homloga en mitosis es
CAPTULO 6: ORIGEN DE LA VARIACIN GENTICA EN HUMANOS 75
muy baja. Esto es lo contrario de lo que sucede en levaduras, donde el principal mecanismo de reparacin
de DSBs es la recombinacin homloga. Actualmente, en cambio, esto est en discusin. Por un lado,
parece que la recombinacin mittica en mamferos es ms alta de lo que se crea: del orden de 10
-4
a 10
-5
;
por otro lado, los ratones incapaces de llevar a cabo NHEJ (DNAPK -/-) no son letales, mientras que los
ratones incapaces de recombinacin homloga (RAD51-/- los RAD54-/-) s son letales. Esto indica que HR
puede de alguna forma complementar la ausencia de NHEJ, pero en cambio NHEJ no puede complementar
la ausencia de HR en clulas somticas.

D. Mecanismos de reparacin presentes en mitocondrias.
Un tema reciente en patologa gentica humana es la alteracin de los mecanismos de reparacin del ADN
mitocondrial. Tradicionalmente se ha considerado que las mitocondrias de mamferos no son capaces de
llevar a cabo ningn tipo de reparacin, ya que los dmeros de pirimidinas no son reparados con eficacia.
Esto explicara adems la mayor tasa de mutaciones del ADN mitocondrial (ADNmt) respecto al ADN
nuclear. Hoy se sabe que hay ciertos tipos de dao que s pueden repararse en mitocondrias (por ejemplo,
los sitios AP originados por dao oxidativo) y en general parece que las mitocondrias de organismos
superiores son capaces de llevar a cabo BER pero no NER ni MMR. El tipo de dao que puede repararse
mediante BER va a estar limitado por la presencia de ADN glicosilasas en la mitocondria, y hasta el
momento se ha demostrado la presencia de uracil-ADN-glicosilasa (UDG) y de 8-oxo-guanina-glicosilasa
(OGG). Adems, otras glicosilasas tienen seales de localizacin mitocondrial en sus extremos N-terminal.
Una diferencia del BER que se lleva a cabo en mitocondrias con el BER nuclear es que la polimerasa
presente en mitocondrias es la ADN pol , que adems posee actividad liasa (fosfodiesterasa). Tambin
existe dentro de la mitocondria una actividad ADN ligasa, que al parecer se origina a partir del gen de la
ADN ligasa III por un codn de iniciacin alternativo que crea una seal de localizacin mitocondrial.
76 GENTICA HUMANA

C. LA TRANSMISIN DE LOS CARACTERES HEREDITARIOS

Esta Seccin incluye 6 temas en los que se tratan los aspectos fundamentales del
mendelismo y sus principales excepciones, dando paso al estudio del ligamiento
gentico, la gentica de caracteres cuantitativos y de las enfermedades
multifactoriales, as como unas nociones de gentica de poblaciones y evolucin.


Captulo 7. Gentica mendeliana.
Planteamiento experimental de Mendel. Monohibridismo: primera ley de
Mendel. Cruzamiento de prueba. Dihibridismo: segunda ley de Mendel.
Redescubrimiento del trabajo de Mendel. Teora cromosmica de la herencia.

A finales del siglo XIX, las observaciones de Gregor Mendel sentaron las bases biolgicas de la herencia,
dando lugar a lo que hoy conocemos como Gentica. Es muy importante estudiar el desarrollo histrico de
las ideas en torno a la herencia, para poner en el contexto adecuado las ideas propuestas por Mendel y
comprender la gran novedad que supusieron en su momento.

Ya los antiguos haban observado que muchos caracteres pasan de padres a hijos, y se haban preguntado
cmo podra ser esto. Hipcrates fue el primero en elaborar una teora, llamada pangnesis, segn la
cual cada parte del cuerpo produce algn tipo de partcula que es recogida en lo que l denomin semen
(hoy diramos gametos) y transmitida a la descendencia. La pangnesis fue criticada por Aristteles, que la
desech por varias razones. En primer lugar, constat que en ocasiones unos individuos tienen rasgos ms
parecidos a abuelos o ancestros remotos que a sus padres, lo que no encaja bien con el hecho de que la
herencia se transmita nicamente de padres a hijos. Adems, tambin observ que a veces se transmiten
caracteres que an no se poseen en el momento de tener descendencia (como la tendencia a tener canas o
la calvicie, por ejemplo). Por otro lado, apunt el hecho fcilmente comprobable de que las mutilaciones en
animales y plantas no se heredan. Esto es algo fundamental, porque Aristteles admita como hecho cierto
la herencia de los caracteres adquiridos, algo universalmente aceptado hasta muchos siglos despus. Como
la pangnesis no poda explicar estas discrepancias, el Filsofo propuso que lo que se hereda no son los
rasgos en s mismos, sino la potencialidad de producirlos. Hoy en da esto nos parece un concepto
evidente, y se asemeja extraordinariamente a la idea de gen que actualmente tenemos, pero en su tiempo
fue una propuesta revolucionaria a la que no se le dio toda la importancia que requera. No hay que olvidar
que algunas nociones bsicas como la existencia de gametos, la meiosis o la reproduccin sexual eran
totalmente desconocidas, por lo que era difcil formular teoras que explicasen la transmisin de caracteres a
lo largo de generaciones sucesivas.

Mendel no podra haber explicado sus resultados sin comprender un concepto bsico que hoy expresaramos
diciendo que, tanto en animales como en plantas, un gameto masculino y un gameto femenino se unen para
formar un cigoto. En este sentido, un avance fundamental fue la demostracin de que las plantas superiores
tienen reproduccin sexual, siendo el polen el elemento masculino. Fue un botnico llamado Klreuter, un
siglo antes de Mendel, el que elabor y sistematiz el trabajo sobre hbridos en plantas: modos de
polinizacin, la obtencin de hbridos con caracteres intermedios entre los progenitores (aunque un
CAPTULO 7: GENTICA MENDELIANA 77
pequeo porcentaje de la descendencia expresa un rasgo que slo se encuentra en uno de los
progenitores), etc. Adems, pocos aos antes de Mendel ya se haba propuesto la idea de que un solo grano
de polen es suficiente para fecundar una planta, aunque este concepto todava sera objeto de debate
durante algn tiempo.

En 1859, Charles Darwin publica El Origen de las especies, proponiendo la evolucin de las especies
mediante un proceso de seleccin natural. Sin embargo, Darwin no pudo proponer una explicacin biolgica
coherente porque no conoca las bases biolgicas de la variacin y de la herencia. Darwin aceptaba la
pangnesis porque era la teora que mejor explicaba la herencia de caracteres adquiridos (lo cual le
ayudaba a explicar la seleccin natural) y llam gmulas a las partculas somticas que un individuo
transmite a su descendencia. En su libro The Variation in Animals and Plants under Domestication, de
1868, Darwin recoge las ideas ms prevalentes en ese momento, y reconoce la existencia de dos tipos de
variacin: variacin continua (caracteres cuantitativos) y variacin discontinua (caracteres cualitativos). Sin
embargo, consideraba que esta ltima era relativamente rara y no tena tanta importancia como la variacin
continua, que poda modificarse mediante seleccin y por tanto era ms til para explicar el concepto de
seleccin natural. Aunque parece que Darwin lleg a recibir una copia de los trabajos de Mendel publicados
2 aos antes, nunca lleg a leerlos y por tanto no pudo comprender la importancia de la variacin
discontinua.


Planteamiento experimental de Mendel

Gregor Mendel naci el 22 de julio de 1822 en Heinzendorf. Hijo de labradores, se hizo sacerdote agustino
en 1847. En 1850 suspendi el examen que le permitira ensear ciencias naturales, por lo que se march a
Viena a estudiar fsica, qumica, zoologa y botnica durante dos aos. En 1853 se traslada al monasterio de
los agustinos en Brno (en lo que hoy es la repblica Checa) y all comienza a hacer sus experimentos con
plantas. En 1865 presenta sus resultados y conclusiones en la reunin de la Sociedad de Historia Natural de
Brno, que son publicados un ao despus en las Actas de dicha Sociedad en un artculo que lleva el ttulo
de Versuche ber Pflanzenhybriden (Experimentos sobre Hbridos de Plantas). En 1868 fue nombrado
abad del monasterio, por lo que desde entonces no pudo dedicar tanto tiempo a sus experimentos. Muri el
6 de enero de 1884 a causa de una glomerulonefritis.

Fruto de sus observaciones trabajando con hbridos de plantas, Mendel lleg al convencimiento de que el
nico modo de comprender las bases biolgicas de la transmisin de caracteres hereditarios era mediante el
estudio de variaciones discontinuas, es decir, aquellos caracteres que se presentan nicamente en dos
formas alternativas. Como explica en su artculo, considera que es necesario: 1) determinar con exactitud el
nmero de las diferentes formas que aparecen en la descendencia de los hbridos; 2) agrupar estas formas
por separado en las distintas generaciones; 3) describir sus relaciones matemticas exactas. Por ejemplo,
en el artculo original de 1866 dice ...Entre los numerosos experimentos hechos hasta el momento,
ninguno ha sido realizado de manera que sea posible determinar el nmero de las diferentes
formas en que aparecen los descendientes de hbridos, o agrupar estas formas con certeza segn
generaciones separadas, o determinar exactamente sus relaciones estadsticas Gracias a esta
aproximacin metodolgica, que le supuso analizar unas 28.000 plantas, Mendel pudo observar que las
proporciones obtenidas en la descendencia de las distintas clases de hbridos se mantenan y se repetan
para varios caracteres distintos. Esto le permiti elaborar una teora que explicase cmo podran darse esas
proporciones y llevar a cabo experimentos concretos que validasen las predicciones formuladas por dicha
teora. Veamos con ms detalle la manera en que desarroll sus experimentos.

78 GENTICA HUMANA

Monohbridos: primera Ley de Mendel

Mendel escogi la planta del guisante Pisum sativum (aunque haba cultivado y estudiado tambin otras
especies) porque es fcilmente cultivable, tiene un ciclo corto y los cruzamientos son fciles de controlar.
Seleccion 7 caracteres que mostraban variacin claramente discontinua, es decir, representados cada uno
por dos formas alternativas en lneas puras. Estas lneas puras eran el resultado de autofecundar plantas
durante varias generaciones, hasta conseguir que esos caracteres se mantuviesen constantes. Los 7
caracteres fueron:

- Guisantes rugosos/lisos
- Guisantes amarillos/verdes
- Vainas en posicin axial/terminal
- Vainas hinchadas/arrugadas
- Vainas verdes/amarillas
- Flores violetas/blancas (o la envuelta de la semilla gris/blanca, respectivamente)
- Tallo de la planta alto/enano

La Figura 7.1 contiene enlaces a recursos educativos que ilustran los
conceptos bsicos del mendelismo.

En primer lugar, Mendel llev a cabo cruces monohbridos, es decir, para cada uno de los siete caracteres
por separado cruz plantas que se comportaban como variedades puras. Observ que slo una de las dos
formas alternativas estaba presente en el 100% de la F1 (la primera generacin filial), mientras
que la otra forma haba desaparecido. Curiosamente, al autofecundar individuos de la F1, observ que esa
forma desaparecida volva a aparecer en la F2. Lo ms importante, y esta fue la aportacin ms
novedosa de Mendel, estableci las proporciones en que se daba cada una de las formas en cada
generacin (en la F1 y en la F2). Por ejemplo, al analizar la forma del guisante, cruz la variedad pura que
produca guisantes rugosos con la variedad pura que produca guisantes lisos. En la F1 todas las plantas
producan guisantes lisos, pero al autofecundar estas plantas de la F1 observ que en la F2 resultante haba
5.474 guisantes lisos y 1.850 guisantes rugosos, lo que supone una relacin de 2,96:1 lisos frente a
rugosos. Al repetir esto para los siete caracteres, observ que se repeta el mismo fenmeno, siendo las
proporciones obtenidas muy parecidas y siempre en torno a una relacin 3:1, por lo que Mendel concluy
que se trataba de un fenmeno general que deba tener una explicacin coherente. Mendel razon que estos
datos numricos podran explicarse suponiendo que cada carcter est controlado por un factor que puede
presentarse en dos formas alternativas. Por ejemplo, habra un factor responsable de la forma del guisante,
con una forma que produce guisantes lisos y otra forma que produce guisantes rugosos. Adems, cada
planta debera tener dos copias de ese factor, que podran ser idnticas o distintas (por ejemplo,
podra haber plantas con dos copias de la forma que produce plantas rugosas, o con una copia de cada
forma). En las variedades puras iniciales, cada planta tendra dos copias idnticas: las plantas con guisantes
lisos tendran dos copias de la forma que produce guisantes lisos, las plantas con guisantes rugosos tendran
dos copias de la forma que produce guisantes rugosos. Con estos presupuestos, si cada planta pasa a la
descendencia slo una de sus copias, todas las plantas de la F1 tendran una copia de cada progenitor,
por lo que todas tendran una copia del factor que produce guisantes lisos y otra copia del factor que
produce guisantes rugosos. Ahora bien, si uno de los factores domina sobre el otro, todas las plantas
de esta generacin seran iguales (por ejemplo, si el factor que produce guisantes lisos domina sobre el
factor que produce guisantes rugosos, todos los guisantes de la F1 seran lisos, como de hecho suceda). As
CAPTULO 7: GENTICA MENDELIANA 79
pues, si estos factores se transmiten a la descendencia de forma totalmente aleatoria, la F2
resultante de autofecundar plantas de la F1 (que tienen dos copias distintas del factor), estara compuesta
por 25% de plantas con las dos copias idnticas e iguales a las de una de las variedades puras iniciales,
25% de plantas con dos copias idnticas iguales a las de la otra variedad pura inicial, y el 50% de plantas
con dos copias distintas (como las plantas de la F1). Como una copia domina sobre la otra, realmente
veramos 75% de las plantas con la forma de una de las variedades inciales (la que estaba presente en la
F1) y 25% de las plantas con la forma de la otra variedad inicial (la que haba desaparecido en la F1). Es
decir, veramos una proporcin 3:1 tal y como Mendel haba encontrado experimentalmente.

Como hemos visto, para que esta explicacin sea coherente han de darse varias condiciones que se han
marcado en negrita en el prrafo anterior. Estas condiciones constituyen los 3 principios que Mendel
propuso que deban cumplirse para poder explicar las proporciones encontradas, y que a veces se agrupan
en lo que se conoce como Primera Ley de Mendel: i) los factores que determinan la herencia se
encuentran en dos formas alternativas y cada individuo lleva dos copias (idnticas o distintas), de las cuales
slo una se transmite a la descendencia; ii) cada una de esas dos copias tiene la misma probabilidad de
pasar a la descendencia, es decir, se transmiten de modo totalmente aleatorio; iii) una de las formas de
cada factor domina sobre la otra, de modo que cuando las dos copias son distintas, el carcter se manifiesta
como si las dos copias fuesen iguales para la forma dominante. Lgicamente, en la nomenclatura moderna
podemos expresar estos conceptos de un modo mucho ms preciso, pero en la poca de Mendel esta
nomenclatura todava no exista. Hoy podemos decir que los factores unitarios de los que hablaba Mendel
son lo que llamamos genes; las formas distintas que puede presentar cada gen se llaman alelos (o formas
allicas); la transmisin de uno de los dos alelos a la descendencia se conoce como segregacin; los
distintos tipos de parejas que se pueden dar son los tres posibles genotipos (dos homocigotos y un
heterocigoto). Por tanto, hoy diramos que un carcter fenotpico est controlado por un gen que se
presenta en dos formas allicas alternativas, una dominante y otra recesiva. Las variedades puras iniciales
son homocigotos para cada uno de los alelos, las plantas de la F1 son todas heterogicotos y slo manifiestan
el carcter determinado por el alelo dominante; las plantas de la F2 son 25% homocigotos dominantes,
50% heterocigotos y 25% homocigotos recesivos (es decir, hay una relacin genotpica 1:2:1). Los
homocigotos dominantes y los heterocigotos son fenotpicamente idnticos, por lo que encontraremos una
relacin fenotpica 3:1 en la F2.

Para expresar esto de un modo ms grfico, hoy en da usamos una letra para indicar cada forma allica y
representamos los cruces de manera esquemtica. Por ejemplo, podemos designar el alelo que produce
guisante lisos como R y el alelo que produce guisantes rugosos como r, siendo R dominante sobre r. Las dos
variedades puras iniciales seran homocigotos, RR en el caso de las que producen guisantes lisos y rr las
que producen guisantes rugosos. El cruce inicial se puede representar como RR X rr. Si cada alelo segrega
al azar, cada alelo R puede combinarse con un alelo r, pero en la descendencia (generacin F1) todas
las plantas tendrn genotipo Rr. Como R es dominante, su fenotipo ser de guisantes lisos. Al cruzar
plantas de la F1 entre s, tendremos cruces del tipo Rr X Rr. Ahora tenemos cuatro posibles combinaciones
de alelos en la descendencia (RR, Rr, rR y rr), cada una de ellas con la misma probabilidad de producirse. Es
decir, en la F2 tendremos 25% de plantas con genotipos RR, 25% con genotipo Rr, 25% con genotipo rR y
25% con genotipo rr. Como los genotipos Rr y rR son iguales desde el punto de vista funcional
(heterocigotos, da igual el orden), tendremos un 25% de homocigotos dominantes (RR), 50% de
heterocigotos (Rr) y 25% de homocigotos recesivos (rr). Como R es dominante, los heterocigotos y
los homocigotos RR son idnticos (todos producen guisantes lisos), y por tanto el 75% de las plantas
producirn guisante lisos y el 25% rugosos. Es muy til utilizar mtodos grficos para representar los
cruzamientos, porque eso simplifica el clculo de las proporciones genotpicas en la descendencia. El mtodo
ms sencillo es quizs el de los cuadrados de Punnett (ideados por Reginald Punnett), que consisten en
80 GENTICA HUMANA
representar los alelos de un progenitor en horizontal y los del otro progenitor en vertical, formando unas
cuadrculas que se rellenan con los genotipos resultantes.

Los enlaces de la Figura 7.2 ayudan a comprender grficamente las
proporciones genotpicas y fenotpicas del cruce monohbrido.

Tambin se puede utilizar un mtodo ramificado, tanto para calcular los genotipos como los fenotipos. Por
ejemplo, en un cruce del tipo Rr X Rr estableceramos la probabilidad de cada alelo de uno de los
progenitores ( R y r, en este caso) y despus, para cada uno de ellos, establecemos la probabilidad de
cada alelo del otro progenitor. Al tratarse de sucesos independientes, las probabilidades se multiplican para
calcular la probabilidad de cada genotipo en la descendencia. As, en nuestro ejemplo, R (del primer
progenitor) puede combinarse por igual con cualquiera de los alelos del segundo progenitor (con R con
r). Por tanto, podramos representarlo esquemticamente de modo ramificado:

R = X = RR
R
r = X = Rr

R = X = rR
r
v = X = rr

Como Rr y rR son iguales, tenemos las proporciones genotpicas RR, Rr y rr, o lo que es lo
mismo 1:2:1.

Impresiona bastante seguir el razonamiento de Mendel, cmo a partir de una simple proporcin fenotpica
deduce los principios generales que la explican. De todas formas, esto no era ms que una hiptesis
plausible, por lo que Mendel se propuso disear los experimentos que pudiesen confirmar las predicciones
que se derivaban de su teora. Para ello hizo dos tios de experimentos. Por un lado, llev a cabo
cruzamientos prueba, que es un tipo de retrocruzamiento (cruzar una planta con uno de sus
progenitores). El cruzamiento prueba consiste en fecundar una planta de la F1 con el progenitor homocigoto
recesivo, es decir, con la variedad pura cuyo fenotipo desapareca en la F1. Si los postulados son ciertos,
este cruzamiento entre un heterocigoto y un homocigoto recesivo debera dar descendencia con 50% de
plantas heterocigotos y 50% homocigotos recesivos. Siguiendo con el ejemplo de la forma del guisante, si r
es el alelo recesivo y R el dominante, tendramos que todas las plantas de la F1 son Rr. Si hacemos el
cruzamiento prueba con plantas rr, tendramos un cruce Rr X rr en el que el 50% de la descendencia
ser Rr y el 50% ser rr: es decir, la mitad de los guisantes sern lisos (R domina sobre r) y la mitad
rugosos. La otra comprobacin que hizo Mendel fue autofecundar plantas de la F2. Como hemos visto,
25% de stas deberan ser RR (guisantes lisos), 50% Rr (tambin lisos) y 25% rr (rugosos). Al
autofecundar plantas rugosas (rr), todos los guisantes resultantes deberan ser tambin rugosos. En
cambio, de todas las plantas de la F2 con guisantes lisos un tercio deberan ser homocigotos y dos tercios
heterocigotos. Por eso, al autofecundar plantas con guisantes lisos, un tercio de los cruces deberan ser RR
X RR y dar descendencia con 100% de guisantes lisos en la F3; dos tercios de los cruces deberan ser del
tipo Rr X Rr y dar descendencia en las proporciones fenotpicas 3:1 tpicas de este cruce. Pues bien, en
todos los casos Mendel encontr que las proporciones encontradas experimentalmente se ajustaban
perfectamente a lo esperado, para todos los caracteres estudiados. Con esto, concluy que los principios
propuestos eran correctos y explicaban la transmisin hereditaria de la variacin discontinua.

CAPTULO 7: GENTICA MENDELIANA 81
La Figura 7.3 ilustra las pruebas utilizadas para confirmar la validez de los
postulados de la primera ley de Mendel.




Segunda Ley de Mendel: dihbridos y trihbridos

No contento con lo que haba encontrado al analizar de cada uno de los caracteres por separado, Mendel se
pregunt qu sucedera al estudiarlos conjuntamente. En primer lugar llev a cabo cruces dihbridos, es
decir, entre plantas que se comportaban como variedades puras para dos caracteres distintos a la vez. Por
ejemplo, estudi el color y la forma del guisante, obteniendo plantas con guisantes amarillos y lisos
simultneamente, y plantas con guisantes verdes y rugosos. Estas plantas podan considerarse variedades
puras para ambos caracteres, porque siempre se daban esas mismas combinaciones de forma y color. Al
cruzar plantas de ambas variedades puras, Mendel observ que en la F1 todos los guisantes eran
iguales: amarillos y lisos a la vez; es decir, manifestaban los dos caracteres dominantes. La
autofecundacin de estas plantas de la F1 dio como resultado una F2 con proporciones de 9/16 de
dobles dominantes (amarillos/lisos), 3/16 para cada uno de las dos combinaciones de un
dominante con un recesivo (3/16 amarillos/rugosos y 3/16 verdes/lisos) y 1/16 de dobles
recesivos (verdes/rugosos). Al analizar estos resultados, Mendel se dio cuenta de que ste sera
precisamente el resultado esperado si consideramos el cruce dihbrido como dos cruces
monohbridos independientes. En estas circunstancias, cada planta de la F1 producira cuatro posibles
tipos de gametos: si denominamos R/r a los alelos liso/rugoso y V/v a los alelos amarillo/verde, las plantas
de la F1 (con guisantes amarillos y lisos) seran heterocigotos para ambos caracteres con genotipo VvRr.
ALTAS ENANAS
50% Tt 25% TT 25% tt
Tt X tt TT X tt tt X tt
100% tt 100% TT
50% Tt 25% TT 25% tt
F
2
3 : 1
autofecundacin
F
3
3 : 1
ALTAS ENANAS
50% Tt 25% TT 25% tt
Tt X tt TT X tt tt X tt
100% tt 100% TT
50% Tt 25% TT 25% tt
F
2
3 : 1
autofecundacin
F
3
3 : 1
82 GENTICA HUMANA
Por tanto, cada una de estas plantas puede transmitir cuatro posibles combinaciones allicas: VR, Vr, vR y
vr. De este modo, al cruzar dos plantas de la F1 tendramos 16 posibles tipos de cruces:

VR X VR Vr X VR vR X VR vr X VR
VR X Vr Vr X Vr vR X Vr vr X Vr
VR X vR Vr X vR vR X vR vr X vR
VR X vr Vr X vr vR X vr vr X vr

Podemos calcular fcilmente los genotipos resultantes de cada cruce usando cuadrados de Punnett con el
mtodo ramificado genotpico (VR X VR tendr descendencia con genotipo VVRR, etc.). Como algunos
cruces son idnticos (por ejemplo, los dos que estn en negrita), podemos agrupar los genotipos resultantes
y obtenemos 9 posibles genotipos distintos en la descendencia, en las siguientes proporciones: 1/16
VVRR, 2/16 VVRr, 2/16 VvRR, 4/16 VvRr, 1/16 VVrr, 2/16 Vvrr, 1/16 vvRR, 2/16 vvRr y 1/16 vvrr. Debido a
la dominancia del liso y del amarillo, estos 9 genotipos dan lugar solamente a 4 fenotipos en las
siguientes proporciones: 9/16 amarillos/lisos, 3/16 amarillos/rugosos, 3/16 verdes/lisos y 1/16
verdes/rugosos. Esto lo vemos muy bien usando el mtodo ramificado fenotpico: si la probabilidad de
amarillos:verdes en la F2 es de 3:1, observaremos amarillos y verdes. Ahora bien, si de cada uno de
estos hay lisos y rugosos, al final las probabilidades de cada fenotipo se pueden calcular:

lisos = 9/16 amarillos y lisos
amarillos
rugosos = 3/16 amarillos y rugosos

lisos = 3/16 verdes y lisos
verdes
rugosos = 1/16 verdes y rugosos

Pues bien, stas fueron precisamente las proporciones que Mendel encontr al realizar estos cruces, la
proporcin fenotpica 9:3:3:1 de dobles dominantes : dominante/recesivo : recesivo/dominante : doble
recesivo. Dado que sus resultados se ajustaban al modelo terico, Mendel formul su cuarto principio --
tambin conocido hoy como la Segunda Ley-- que establece que las parejas de factores segregan no
slo al azar, sino adems de manera independiente para caracteres distintos.

La Figura 7.4 contiene un enlace que ayuda a comprender los cruces
dihbridos.

Mendel tambin quiso comprobar este postulado realizando cruzamientos prueba de las plantas de la F2
con el progenitor doble homocigoto recesivo. Por ejemplo, los 9/16 de plantas con guisantes amarillos y
lisos de la F2 son el resultado de sumar todas las plantas con cuatro genotipos distintos: VVRR (1/16), VVRr
(2/16), VvRR (2/16) y VvRr (4/16). Es decir, de todas las plantas de la F2 con guisantes amarillos y lisos,
1/9 sern VVRR, 2/9 sern VVRr, 2/9 sern VvRR y 4/9 sern VvRr. Cmo saber los genotipos de estas
plantas? Al igual que en el monohibridismo, mediante los cruzamientos prueba de cada una de ellas
con una variedad pura doble homocigota recesiva (vvrr). Mendel predijo cmo debera ser la
descendencia resultante de cada uno de estos cruces. Por ejemplo, al cruzarse los dobles homocigotos
dominantes de la F2 (VVRR) con una planta vvrr darn un 100% de descendencia de tipo doble heterocigoto
VvRr y por tanto con fenotipo amarillo y liso. Las plantas con genotipo VVRr en la F2 darn, en cambio, dos
tipos posible de gametos (VR y Vr), por lo que el cruce prueba VVRr X vvrr dar como resultado un 50% de
plantas VvRr y un 50% de plantas Vvrr (o, lo que es lo mismo, 50% con guisantes amarillos y lisos y 50%
CAPTULO 7: GENTICA MENDELIANA 83
con guisantes amarillos y rugosos). Lo mismo puede hacerse para los otros dos cruzamientos prueba, los de
plantas VvRR y VvRr y calcular las proporciones fenotpicas esperadas en la descendencia. Pues bien,
cuando Mendel hizo todos estos cruces de prueba, comprob que los resultados obtenidos coincidan
con las predicciones de su modelo, por lo que concluy que este cuarto postulado era tambin cierto.

Mendel todava fue ms lejos y demostr que estos principios se cumplan tambin al cruzar plantas que se
comportaban como variedades puras para tres factores a la vez (cruce trihbrido). El cruce de una
variedad pura triple dominante con otra triple recesiva dar como resultado 100% de triples heterocigotos
en la F1 (todos manifiestan los tres fenotipos dominantes). Para calcular la descendencia resultante de la
autofecundacin de stos, hay que tener en cuenta que cada planta producir 8 tipos posibles de
gametos. Por ejemplo, para tres genes A, B y C con alelos dominante (mayscula) o recesivo (minscula),
cada triple heterocigoto (AaBbCc) dar lugar a gametos del tipo ABC, ABc, AbC, Abc, aBC, aBc, abC, abc.
Si hacemos un cuadrado de Punnett para calcular los genotipos resultantes y sus proporciones, vemos que
el cruce AaBbCc X AaBbCc origina 64 combinaciones diferentes. Usando el mtodo ramificado genotpico
fenotpico, vemos que todas estas posibles combinaciones se pueden agrupar en 27 genotipos distintos,
que dan lugar a 8 fenotipos diferentes en proporciones 27:9:9:9:3:3:3:1. Una vez ms, lo que Mendel
encontr se corresponda exactamente con lo que debera suceder de acuerdo con sus postulados.

La Figura 7.5 muestra el diagrama ramificado genotpico de un cruzamiento
trihbrido.

Lgicamente, es fcil darse cuenta que la interpretacin de los resultados aumenta notablemente al estudiar
varios caracteres a la vez, ya que las posibles combinaciones de genotipos (y, por tanto, de fenotipos) son
mayores. En cualquier caso, hay una regla sencilla para calcular el nmero de posibles gametos, genotipos
y fenotipos que se pueden generar al estudiar cualquier nmero de genes simultneamente. Si n es el
nmero de caracteres distintos que estudiamos, cada uno de ellos controlado por un gen con dos alelos, el
nmero de gametos posible ser 2
n
, el nmero de posibles genotipos es 3
n
, y el nmero de posibles
fenotipos es tambin 2
n
. As, para tres genes tendramos 8 gametos posibles que originan 64
combinaciones agrupadas en 27 genotipos y 8 fenotipos distintos.


Redescubrimiento del trabajo de Mendel

Como hemos visto, Mendel comenz sus experimentos en 1856, ley los resultados en la reunin de la
Sociedad de Historia Natural de Brno en 1865, y el trabajo fue publicado el ao siguiente. En el perodo que
transcurre entre 1866 y el 1900, la figura ms influyente fue sin duda August Weismann, un discpulo de
Darwin. En primer lugar, Weismann crea que la pangnesis no era correcta, y dise experimentos para
probarlo. Por ejemplo, cort la cola de ratones durante 22 generaciones sucesivas, comprobando que el
tamao de la cola no disminua al nacer. Adems, teniendo en cuenta los avances cientficos de esos aos,
Weismann reconoci la existencia de clulas germinales, la importancia del ncleo y la existencia de
cromosomas. Su gran contribucin fue la elaboracin de la teora del germoplasma como material
hereditario. Frente a la creencia en las gmulas de origen somtico, Weismann propuso que la herencia se
transmite nicamente a travs de las clulas germinales y que las unidades hereditarias residen en
los cromosomas. Lgicamente, esas ideas eran bastante tericas y no tenan comprobacin experimental,
pero prepararon el camino para que a principios del siglo XX pudiesen comprenderse los trabajos de Mendel.

84 GENTICA HUMANA
Se sabe que del artculo original de Mendel se imprimieron 40 copias, aunque slo hay constancia de 3 que
fueron enviadas a sus maestros y colegas. De todas formas, la Sociedad de Historia Natural de Brno enviaba
sus Actas a unas 130 bibliotecas de toda Europa y Amrica, por lo que sus hallazgos tuvieron una difusin
adecuada. Sin embargo, llama la atencin que durante aos nunca fuesen citados, probablemente porque
no fueron comprendidos del todo. La clave para que se prestase atencin al trabajo original de Mendel fue
una referencia de Focke en 1881, que en una revisin de la literatura sobre hibridaciones en plantas cita el
artculo de Mendel (bajo el epgrafe Pisum) y dice que Mendel crey haber encontrado relaciones
numricas constantes. Esta frase llam la atencin de Karl Correns, que haba llegado
independientemente a las conclusiones mendelianas en 1899 haciendo hibridaciones en varias especies. Al
leer la alusin de Focke a las relaciones numricas constantes, Correns cit el trabajo original de Mendel y
fue probablemente fue el primero en comprender su verdadero alcance. Al mismo tiempo, en el ao 1900,
Hugo de Vries public 3 artculos en los que tambin llegaba a conclusiones parecidas, encontrando la
relacin 3:1 en varias especies distintas. En uno de esos trabajos se cita tambin el artculo de Mendel
(aunque no se citaba en la versin original francesa, se cita en la versin posterior en alemn: parece que
de Vries no haba tenido noticia del trabajo de Mendel, pero incluy la referencia al saber que Correns lo
citaba en su artculo). Tshermak tambin public dos artculos en 1900 llegando a conclusiones
mendelianas, pero con resultados ms limitados que los dos anteriores.

William Bateson era un zologo de Cambridge que ya en 1894 era consciente de la importancia de
estudiar la variacin discontinua con una aproximacin ms matemtica. En mayo de 1900 dio una
conferencia en la Royal Horticultural Society en Londres, describiendo los resultados de Mendel y su
confirmacin por De Vries, y se convirti en el defensor ms entusiasta del mendelismo. Junto a Reginald
Punnett fue desarrollando los principios de la herencia segn las leyes mendelianas. Poco a poco los
principios de Mendel se fueron confirmando en otras plantas y en animales, y as se fue introduciendo y
fijando la nomenclatura que utilizamos hoy en da. Por ejemplo, Bateson acu el trmino gentica (del
griego genetikos) al usarlo por vez primera en una carta del 18 de abril de 1905, dirigida a Adam
Sedgewick. Tambin invent los trminos homocigoto, heterocigoto alelomorfo (hoy reemplazado por
alelo). Johannsen, otro botnico del que hablaremos ms adelante, introdujo en 1909 los trminos gen,
genotipo y fenotipo.


Dnde estn los factores unitarios? La teora cromosmica de la herencia

La aceptacin de las leyes de Mendel a principios del siglo XX supuso que se iniciara la bsqueda de las
bases celulares de la herencia, es decir, dnde residen los factores que controlan los caracteres
hereditarios, cul es la naturaleza de los distintos alelos, en qu estructuras se transmiten de una
generacin a la siguiente, etc. Hacia el ao 1900, los conocimientos de Citologa en plantas y animales
permitan aventurar alguna hiptesis al respecto. Por ejemplo, se saba que el ncleo de las clulas contiene
una sustancia (cromatina) que se condensa en forma de cromosomas. Se aceptaba que cada especie tiene
un nmero fijo de cromosomas, definido por el nmero de cromosomas presente en los gametos, y que en
especies de reproduccin sexual los gametos tienen una copia de cada cromosoma, mientras que las clulas
somticas tienen dos copias. Tambin se haba observado (al menos en plantas) que la reduccin en el
nmero de cromosomas se produce en las ltimas fases de la formacin de los gametos. En esos primeros
aos del siglo, por tanto, era generalmente aceptado que el material hereditario resida en los
cromosomas, aunque la naturaleza amorfa y esttica de la cromatina no permita explicar cmo podra
ser esto. De hecho, algunas cuestiones citolgicas que entonces se crean ciertas distaban mucho de la
realidad. Por ejemplo, exista la creencia general de que los cromosomas formaban un largo filamento
continuo (el espirema) que se divida transversalmente al final de la interfase, de modo que todos
CAPTULO 7: GENTICA MENDELIANA 85
los cromosomas eran esencialmente iguales unos a otros excepto por su tamao. Aunque tambin se haba
observado la meiosis, se pensaba que en la divisin reductora los cromosomas se dividan
transversalmente, estando unidos por los extremos. En general, la mecnica de estos procesos no estaba
clara y esta falta de detalle no permita establecer las bases citolgicas de los principios mendelianos de
transmisin de la herencia. Aunque ya Correns y Cannon haban propuesto en los primeros aos del siglo
XX la hiptesis de que los genes (los factores de Mendel) residen en los cromosomas, sus modelos eran
poco claros.

El citlogo que dio mayor impulso a este campo fue sin duda Theodor Bovery, que en 1902 lleg a la
conclusin de que los cromosomas no son equivalentes, sino que son distintos unos de otros y todos
son necesarios para dar lugar a un embrin viable. En sus estudios con embriones monosprmicos y
polisprmicos de erizo de mar, pudo observar formas anormales de desarrollo embrionario cuando el
nmero de cromosomas no era el adecuado. Adems, esto le llev a formular la teora cromosmica del
cncer, que tanta influencia tendra en aos posteriores. Peor la mayor evidencia experimental de que los
procesos citolgicos permitan explicar las leyes de Mendel la produjo Walter Sutton en 1902. Sutton era
un estudiante de Medicina que dedic sus primeros aos a estudiar cromosomas de clulas somticas de
saltamontes, demostrando irrefutablemente por primera vez que los cromosomas se presentan en pares
homlogos en las clulas somticas y que los gametos tienen una sola copia, procedente de uno
de los progenitores. En un trabajo de 1903 (The chromosomes in heredity) elabora ms esta teora
mostrando que distintos pares cromosmicos se orientan al azar en el huso meitico, y as sugiri que la
divisin reduccional no era transversal sino longitudinal. Todos estos procesos permitan explicar
perfectamente lo que Mendel haba propuesto: la segregacin al azar de factores que estn en parejas, de
las que slo una copia pasa a la descendencia. De hecho, Sutton escribi en uno de sus trabajos: I may
finally call attention to the probability that the association of paternal and maternal chromosomes in pairs
and their subsequent separation during the reducing division may constitute the physical basis of the
Mendelian law of heredity. A pesar de la clarividencia de sus afirmaciones y de su evidente inters por la
ciencia, Sutton no termin su doctorado, sino que se hizo mdico y se dedic a la ciruga. En cualquier caso,
su contribucin permiti explicar la base fsica de la herencia y el comportamiento de los factores
mendelianos, dando lugar a la teora cromosmica de la herencia.

De todas formas, no todos aceptaban fcilmente que los factores mendelianos viajasen en los
cromosomas. La demostracin formal no llegara hasta aos ms tarde gracias al trabajo de Morgan,
Sturtevant, Muller y Bridges en la mosca Drosophila melanogaster. Durante aos, estos genetistas
fueron estableciendo la posicin de los genes responsables de distintos caracteres en los cromosomas de la
mosca. Vieron que algunos caracteres se comportaban como si viajasen juntos, porque no segregaban al
azar, y llamaron a este fenmeno ligamiento. Establecieron as varios grupos de ligamiento y
demostraron que coincidan con los 3 pares de autosomas que tiene la Drosophila, es decir, que los genes
se localizan en los cromosomas y se agrupan de modo lineal. En 1916 publicaron The Mechanism of
Mendelian Heredity, que se convierti en el primer tratado detallado de las leyes mendialanas, sus
excepciones y sus bases citolgicas. An as, la aceptacin no fue unnime, y mendelistas tan brillantes
como Bateson mostraban sus reservas. Por ejemplo, en una revisin sobre The Mechanism of Mendelian
Heredity que hace el propio Bateson en 1916, dice: it is inconceivable that particles of chromatin or of
any other substance, however complex, can possess those powers which must be assigned to our factors
The supposition that particles of chromatin, indistinguisable from each other and indeed almost
homogeneous under any known test, can by their material nature confer all the properties of life surpasses
the range of even the most convinced materialism. Evidentemente, en aquellos aos no se conoca la
naturaleza qumica de la cromatina y era impensable que pudiese estar compuesta por una molcula como
el ADN, tan simple en su estructura pero tan rica en su capacidad codificante y en sus funciones.
86 GENTICA HUMANA

En cualquier caso, hacia 1920 la citologa y la gentica se haban encontrado definitivamente. El
mendelismo poda ya explicarse sobre la base de la teora cromosmica, es decir: i) los dos alelos de
cada gen se localizan en la misma posicin (locus) en cromosomas homlogos, y segregan al azar a los
gametos gracias a la separacin de los cromosomas durante la meiosis; ii) genes distintos segregan de
manera independiente (4 postulado de Mendel) porque se localizan en cromosomas distintos. Adems,
estos conceptos se fueron ampliando progresivamente con las nociones de recombinacin e intercambio de
material gentico entre cromosomas homlogos, ligamiento, etc.
CAPTULO 8: HERENCIA RELACIONADA CON EL SEXO 87
Captulo 8. Herencia relacionada con el sexo.
Cada sexo tiene distinta constitucin cromosmica. Los genes situados en el
cromosoma X muestran un modo especial de herencia. Determinacin
gentica del sexo en humanos. Compensacin de dosis: hiptesis de Lyon.
Estructura de los cromosomas sexuales humanos.


Cada sexo tiene distinta constitucin cromosmica

En 1891, Hermann Henking describi un corpsculo en el ncleo de las clulas de insectos machos de la
especie Pyrrhocoris (un tipo de chinche). Dicho corpsculo se formaba durante la meiosis, y Henking lo
denomin "cuerpo X" por su naturaleza desconocida. Cuando se observ la meiosis con detenimiento, se
comprob que 22 de los 23 cromosomas de esta especie se emparejaban durante la meiosis para formar 11
parejas, pero otro cromosoma quedaba condensado y daba lugar al "cuerpo X" en uno de los polos en
algunas clulas. Al reconocerse que se trataba de un cromosoma, dicho corpsculo pas a llamarse
cromosoma X. A principios del siglo XX, en 1905, Edmund B. Wilson y una de sus estudiantes de
doctorado, Nettie M. Stevens, comprobaron que el nmero de cromosomas X difiere entre machos y
hembras. Estudiando insectos del gnero Protenor (saltamontes) y el Lygaeus turicus, observaron que cada
sexo tiene configuraciones cromosmicas distintas, y llegaron a la conclusin de que el sexo est
determinado por el nmero de cromosomas X presentes en las clulas. En Protenor comprobaron que las
hembras tienen dos ejemplares de este cromosoma (XX) y en cambio los machos slo tienen uno (XO). A
este tipo de determinacin cromosmica del sexo le llamaron modo XX/XO. En Lygaeus, en cambio,
vieron que la situacin era ligeramente distinta, ya que las hembras son XX y los machos tienen adems
de un cromosoma X otro cromosoma ms pequeo llamado cromosoma Y. A este tipo de configuracin
le llamaron modo XX/XY. Estas observaciones pusieron de manifiesto el hecho fundamental de que uno
de los sexos produce dos clases distintas de gametos: con sin cromosoma X en el caso del modo
Protenor; con cromosoma X con cromosoma Y, en el modo Lygaeus. Al sexo que produce gametos
distintos se le llama, por tanto, sexo heterogamtico. Aunque lo ms habitual es que el sexo
heterogamtico sea el masculino, como en la especie humana, esto no siempre es as. Por ejemplo, en
muchas especies de aves el sexo heterogamtico es el femenino, y siguen un modo distinto de
determinacin cromosmica del sexo, que se llama ZZ/ZW. En humanos se sigue el modo XX/XY, mientras
que en la mosca Drosophila melanogaster, a pesar de que tiene un cromosoma Y, se sigue el modo XX/XO.


Los genes situados en el cromosoma X muestran un modo especial de
herencia

Como hemos visto, en el laboratorio de Tomas H. Morgan, conocido como la "Fly Room" ("Habitacin de
las Moscas"), se establecieron los principios del mendelismo estudiando diversos caracteres y mutaciones en
Drosophila. Morgan observ en 1910 que en el caso de la mutacin white del ojo de Drosophila a veces no
se cumplan las proporciones mendelianas esperadas. Observ que el patrn de herencia de esta mutacin
dependa del sexo del progenitor que transmita la mutacin. As, el cruce entre un mutante white
macho y una hembra silvestre daba una F1 con 100% de ojos silvestres (rojo ladrillo) y una F2 con la
proporcin 3:1 (rojo:blanco), que sera la proporcin esperada si el alelo silvestre (rojo) es dominante sobre
el mutante white. En cambio, el cruce recproco, en el que la mutacin white estaba en el progenitor
88 GENTICA HUMANA
hembra, daba una F1 con una proporcin 1:1 en la que todos los machos tenan ojos blancos.
Adems, esta misma proporcin se repeta en la F2, teniendo el 50% los machos ojos blancos. Basndose
en la teora cromosmica de la herencia de Sutton y Boveri y, sobre todo, en la hiptesis propuesta por
Stevens y Wilson pocos aos antes, Morgan concluy que el gen de esta mutacin (el locus white)
estaba localizado en el cromosoma X de Drosophila. Si esto era cierto, las hembras llevaran dos
copias del gen y slo manifiestaran el fenotipo cuando ambos alelos estn mutados (es decir, la mutacin
sera recesiva y slo se manifestara en homocigosis). Los machos, en cambio, slo llevan un cromosoma X;
est situacin se describe como hemicigosis (un solo alelo, en vez de los dos que suele ser habitual en
genes autosmicos), y por eso se dice que los machos son hemicigotos para todos los genes del
cromosoma X. En estas circunstancias, los machos siempre manifestarn el fenotipo aunque sea recesivo,
ya que el nico alelo que tienen es el alelo mutante.

La Figura 8.1 ilustra los cruces entre moscas con ojos de color silvestre (rojo
ladrillo) y moscas con la mutacin white (ojos blancos). Tambin se muestra
un ejemplo de herencia ligada al cromosoma X en humanos.

Este hallazgo constituy el primer ejemplo de ligamiento de un carcter a un cromosoma concreto, y
adems fue decisivo para respaldar la teora cromosmica de la herencia. Todos los caracteres controlados
por genes situados en el cromosoma X siguen este tipo de herencia, que pas a llamarse "ligada al sexo".
Sin embargo, un nombre ms adecuado es el de "ligada al cromosoma X", ya que hay caracteres cuya
herencia est influida por el sexo sin estar controlados por genes situados en ninguno de los cromosomas
sexuales. Por ejemplo, existen rasgos controlados por genes autosmicos que slo se expresan en un sexo
por razones hormonales. Dichos caracteres, influidos o limitados por el sexo, pueden confundirse a
veces con caracteres ligados al cromosoma X. Aunque la herencia ligada al X puede ser de tipo recesivo
dominante, lo ms frecuente es la de tipo recesivo, que se caracteriza porque slo los individuos
hemicigotos (XY) manifiestan el fenotipo recesivo, ya que las hembras (XX) son habitualmente
heterocigotos. Como veremos ms adelante, la herencia ligada al X recesiva es muy importante en Gentica
Humana, y tiene unas caractersticas que permiten reconocerla y proporcionar un consejo gentico muy
valioso.


Determinacin gentica del sexo en humanos

El hallazgo de que el sexo est determinado por el tipo de cromosomas sexuales que se heredan puso en
marcha la bsqueda de los mecanismos por los que estos cromosomas influyen en la determinacin del
sexo. Estos mecanismos se fueron conociendo gracias a los trabajos de Calvin Bridges, un discpulo de
Morgan. Bridges demostr que el sexo de Drosophila viene determinado por el nmero total de cromosomas
X que estn presentes, ms exactamente por el cociente entre el nmero de cromosomas X y el
nmero de autosomas. Esta especie tiene 3 pares de autosomas y un par de cromosomas sexuales, por lo
que habitualmente el cociente X/autosomas de las moscas hembra es igual a 1 (2 copias del cromosoma
X y 2 copias de cada autosoma) y el de los machos es igual a 0,5 (1 cromosoma X y dos copias de cada
autosoma). Sin embargo, Bridges estudi el sexo de moscas con diferentes composiciones cromosmicas y
encontr que las moscas XXY son hembras normales (cociente=1), mientras que las moscas XO son
machos estriles (cociente=0,5). Esto le llev a concluir que el cromosoma Y en Drosophila no tiene
genes necesarios para la determinacin del sexo masculino, pero s genes necesarios para la fertilidad de los
machos. Esta misma conclusin se confirmaba al estudiar la progenie de moscas con 3 cromosomas X y con
un nmero variable de autosomas. Bridges observ que un cociente X/autosomas=1 produce hembras
CAPTULO 8: HERENCIA RELACIONADA CON EL SEXO 89
normales y frtiles; un cociente >1 produce metahembras infrtiles; un cociente=0.5
corresponde a machos; un cociente=0.33 produce metamachos infrtiles. Otros cocientes
intermedios producen moscas con genitales ambiguos y estriles, denominados intersex. Por tanto, la
conclusin fue que los genes que determinan el sexo en Drosophila estn en los autosomas, pero el
cromosoma X debe tener algn gen necesario para determinar el sexo femenino cuando est en doble dosis
gnica. Aunque no es el momento de explicar a fondo el proceso gentico de determinacin del sexo en
Drosophila, nos sirve para introducir esta cuestin en relacin con nuestra propia especie.

En mamferos, la determinacin del sexo tiene su origen embriolgico en la diferenciacin de la gnada
primitiva indiferencia bien hacia la gnada femenina (ovario) hacia la gnada masculina (testculo). En el
caso de que se inicie la va de diferenciacin testicular, ste rgano comienza a producir Sustancia
Inhibitoria Mlleriana (en las clulas de Sertoli) y andrgenos (en las clulas de Leydig), que determinan el
desarrollo de los caracteres sexuales secundarios. Lo fundamental, por tanto, es la diferenciacin inicial
de la gnada primitiva en los primeros momentos del desarrollo embrionario. Desde que se conoci la
implicacin del cromosoma Y en la determinacin del sexo por el modo XX/XY, se postul que el cromosoma
Y deba contener algn factor necesario para la diferenciacin de la gnada primitiva hacia testculo, y se
denomin TDF (testis-determining factor) a ese hipottico factor cuya identidad permaneci oculta durante
aos. Posteriormente se descubri ZFY ("Zinc-finger on the Y"), un gen del cromosoma Y que codifica un
factor de transcripcin del tipo dedo de zinc, y se pens que poda ser el buscado TDF. Sin embargo, la
bsqueda del gen responsable del desarrollo sexual masculino concluy en 1993, al comprobarse que
ratones hembras en los que se haba insertado en uno de los cromosomas X una copia de un gen llamado
Sry (localizado en el cromosoma Y) eran fenotpicamente machos. SRY ("Sex-determining Region on the
Y") es el gen iniciador de una cascada en la que tambin participan otros genes del cromosoma Y junto con
otros genes localizados en autosomas. Bsicamente, el proceso comienza cuando la cresta genital es
poblada por clulas del mesonefros y del saco vitelino, que aportan las clulas somticas y germinales
respectivamente. La cresta genital se desarrolla hacia la gnada indiferenciada por accin de dos factores de
transcripcin llamados WT1 ("Wilms Tumor 1") y SF1 ("Steroidogenic Factor 1"). A partir de este momento,
la diferenciacin hacia ovario o testculo ser fruto de la accin de diversos genes. Si SRY est presente
(como sucede en individuos con un cromosoma Y) la accin de ste factor de transcripcin y de otro llamado
SOX9 hace que la gnada primitiva se desarrolle hacia testculo. ste, a su vez, producir factores que
inhiben el desarrollo de los conductos de Mller, estabilizan el desarrollo de los conductos de Wolff y
promueven el desarrollo de los genitales externos masculinos. Otros genes implicados son MIS-R, el
receptor de andrgenos, INSL3 y LGR8. En ausencia de SRY, como ocurre en mujeres con dos
cromosomas X, los genes DAX1 y WNT4 promueven la diferenciacin de la gnada primitiva hacia tejido
ovrico; la ausencia del receptor andrognico y la presencia de WNT4 promueven la regresin de los
conductos de Wolff y el desarrollo de las estructuras derivadas de los conductos de Mller. Por tanto, en el
desarrollo sexual intervienen gran cantidad de genes que actan a distintos niveles de la va, y mutaciones
en cualquiera de ellos puede dar lugar a alteraciones en el desarrollo sexual y por tanto a varones con
cariotipo XX a mujeres con constitucin cromosmica XY.

En la Figura 8.2 se muestra esquemticamente la va de determinacin del
sexo en humanos.





90 GENTICA HUMANA



Compensacin de dosis: hiptesis de Lyon

La distinta dotacin cromosmica de ambos sexos supone que las mujeres (XX) tienen doble dosis gnica
de los genes presentes en el cromosoma X, respecto de los varones XY. El distinto nmero de cromosomas
X que lleva cada tipo de gameto (uno en el gameto femenino y ninguno en el masculino), plantea una
cuestin fundamental: cmo es posible que la distinta dosis de los genes contenidos en el cromosoma X no
provoque grandes problemas en varones? De hecho, mujeres con un solo cromosoma X (cariotipo 45,X0)
desarrollan el Sndrome de Turner. Por qu no sucede esto en varones, que tienen un solo cromosoma
X? Murray Barr describi en 1949 que las clulas femeninas se podan distinguir por la presencia en su
ncleo de un corpsculo de cromatina, pegado a la pared interna del ncleo, que pas a conocerse como
corpsculo de Barr. Posteriormente, se comprob que el corpsculo de Barr se ajusta a la llamada "regla
(n1)", segn la cual el nmero de corpsculos de Barr de una clula es igual al nmero de cromosomas X
que posee esa clula (n) menos 1. Estas observaciones se completaron cuando Susumu Ohno demostr en
1959 que el corpsculo de Barr corresponde a un cromosoma X condensado en forma de heterocromatina y
propuso que uno de los dos cromosomas X est inactivo en clulas somticas, de manera que slo se
expresan los genes del cromosoma X que permanece activo. En 1961 Mary Lyon formul la hiptesis de
que dicha inactivacin se lleva a cabo al azar en fases precoces del periodo embrionario, y queda
fijada una vez que se establece. Segn esta hiptesis, todas las clulas hijas procedentes de una clula en
la que se ha producido la inactivacin tendrn el mismo patrn de inactivacin que la clula original. Esta
hiptesis permita explicar la expresin de algunos rasgos ligados al cromosoma X, tales como el color del
pelaje en los gatos, en el que las gatas (que se conocen como gatas calico) muestran a veces manchas o
bandas de color negro, naranja y blanco, mientras los gatos macho son de color totalmente negro o
totalmente naranja. El proceso de inactivacin tambin explicara el patrn en mosaico de algunas
enfermedades dermatolgicas causadas por genes que estn en el cromosoma X, como la displasia
Cresta genital
(gnada
indiferenciada)
WT1
SF1
OVARIO
DAX1
WNT4
Conductos
de Mller
Genitales externos
Regresin de
conductos de Wolff
WNT4
TESTCULO
SOX9
SRY
Conductos
de Wolff
Genitales externos
Regresin de
conductos de
Mller
AR
AR
MIS-R
Clulas somticas
(mesonefros)
Clulas germinales
(saco vitelino)
Cresta genital
(gnada
indiferenciada)
WT1
SF1
OVARIO
DAX1
WNT4
Conductos
de Mller
Genitales externos
Regresin de
conductos de Wolff
WNT4
TESTCULO
SOX9
SRY
Conductos
de Wolff
Genitales externos
Regresin de
conductos de
Mller
AR
AR
MIS-R
Clulas somticas
(mesonefros)
Clulas germinales
(saco vitelino)
CAPTULO 8: HERENCIA RELACIONADA CON EL SEXO 91
ectodrmica anhidrtica (fenmeno ya descrito por Darwin en 1875). El estudio de las isoformas de
glucosa-6-fosfato deshidrogenasa en fibroblastos aislados de mujeres permiti confirmar la hiptesis de
Lyon, al observarse la presencia de una sola isoforma en las clulas de mujeres heterocigotas (que deberan
tener dos isoformas distintas). Hoy en da, el fenmeno de inactivacin temprana y aleatoria de un
cromosoma X en mujeres es universalmente aceptado, y se conoce tambin con el nombre de
"Lyonizacin" en honor a Mary Lyon. Mediante este mecanismo, las clulas somticas femeninas tienen
uno de sus cromosomas X en estado inactivado, es decir, transcripcionalmente silenciado y altamente
compactado en forma de heterocromatina. La inactivacin del X se realiza al azar mediante un mecanismo
de recuento que determina el cociente entre el nmero de cromosomas X y el nmero de autosomas. Si se
detecta ms de un cromosoma X, el proceso contina con la inactivacin, inicialmente temporal e
inestable, de todos los cromosomas X menos uno. Finalmente, el proceso termina con el silenciamiento
estable y definitivo de esos cromosomas. Aunque los mecanismos moleculares que regulan estos procesos
no se entienden completamente, se conocen las regiones cromosmicas implicadas y los genes ms
importantes en el proceso de inactivacin, como se describe a continuacin.

Los procesos de inactivacin se ejecutan gracias un locus multifuncional denominado XIC, que est
localizado en Xq13 y que contiene los elementos necesarios para el recuento del nmero de cromosomas X,
para la eleccin del X que ser silenciado y para el propio mecanismo de silenciamiento. Este locus incluye
el gen XIST, un gen de 32 kb que se transcribe en un ARN de 19 kb, es procesado y poliadenilado pero no
se traduce. XIST es necesario para iniciar el silenciamiento del cromosoma X, pero no para los
mecanismos de contaje, eleccin ni para el posterior mantenimiento del estado silenciado. En XIC tambin
se encuentra el mecanismo de contaje y posiblemente un mecanismo de eleccin, que dependen del locus
XCE.

La Figura 8.3 muestra un ejemplo del fenmeno de inactivacin del X.
Tambin se incluye un esquema del locus XIC.




Todos estos procesos comienzan en los estadios iniciales del desarrollo embrionario. As, en la mrula de 4-
8 clulas se detecta expresin de XIST a bajo nivel en ambos cromosomas X, tanto en el de origen
paterno (Xp) como en el de origen materno (Xm). A partir de ese momento, XIST deja de expresarse en
uno de los cromosomas X (en el caso de embriones XX), o en el nico cromosoma X (en embriones XY). Por
tanto, la expresin inicial de XIST es transitoria y slo se estabiliza en torno a la fase de blastocisto en uno
de los dos cromosomas X (en aqul que quedar finalmente inactivado). Recientemente se ha descubierto
un gen antisentido, denominado TSIX, cuyo transcrito se solapa parcialmente con el ARN codificado por
Tsx Brx Cdx4
TsiX
Xce
XIC
Xist Tsx Brx Cdx4
TsiX
Xce
XIC
Xist
92 GENTICA HUMANA
XIST. Curiosamente, TSIX sigue un patrn de expresin similar a XIST: inicialmente se expresan ambos
alelos, pero al comienzo de la inactivacin nicamente se expresa el alelo del cromosoma X que
permanecer activo. Esto sugiere que la expresin de TSIX juega un papel importante en la expresin
transitoria de XIST y en la eleccin del cromosoma que finalmente ser inactivado. En este proceso participa
el factor CTCF, que se une a la regin de metilacin diferencial cercana a TSIX. Dicha unin slo se produce
cuando esa regin est des-metilada, y tiene dos posibles efectos: o bien impide la accin de un enhancer
sobre XIST (porque CTCF es un elemento aislador insulator); bien estimula la transcripcin de TSIX, con
el consiguiente silenciamiento de XIST.

Tras la eleccin, tiene lugar el proceso de iniciacin del silenciamiento, seguida de otros cambios que
permiten mantener el estado silenciado. En este proceso, el ARN codificado por XIST recubre todo el
cromosoma y desencadena los cambios que caracterizarn al cromosoma X inactivo: metilacin de las islas
CpG, desacetilacin de las histonas, replicacin tarda en la fase S, presencia de una histona especial
(macroH2A) en vez de H2A. Recientemente tambin se ha visto que la lisina 27 de la histona H3 est
metilada en el cromosoma X inactivo. En cambio, el ARN codificado por XIST no llega a estabilizarse en el
X que permanecer activo, y finalmente el propio gen XIST se silencia y deja de expresarse. Lgicamente,
en un embrin XY slo hay expresin baja y transitoria de XIST en el cromosoma X de origen materno, que
nunca se inactiva porque el mecanismo de contaje detecta la presencia de un solo cromosoma X.

El video de la Figura 8.4 sirve para ilustrar el proceso de inactivacin del
cromosoma X.

Mary Lyon tambin ha propuesto que la propagacin del estado inactivado a partir del XIC se ve facilitada
por la presencia de elementos distribuidos a lo largo de todo el cromosoma X y que actuaran como
"estaciones repetidoras" del proceso de inactivacin. Unos elementos que podran cumplir esta funcin son
los LINE, que son especialmente abundantes en el cromosoma X respecto a los autosomas (forman un 30%
de la secuencia de este cromosoma). Adems, al estudiar pacientes con translocaciones entre el cromosoma
X y un autosoma, se ha comprobado que la inactivacin del X se propaga a los autosomas pero slo
parcialmente, y que esta propagacin es directamente proporcional a la riqueza en LINEs de cada
autosoma. La secuenciacin del cromosoma X apoya esta hiptesis, ya que se ha comprobado que los LINE
se distribuyen a lo largo del X de manera coherente con la inactivacin: son especialmente abundantes
en las zonas que flanquean el XIC y disminuyen en abundancia en las regiones ms distales del brazo
corto, precisamente la regin donde la inactivacin es ms dbil.

Es muy importante tener claro que la inactivacin del cromosoma X no es completa, es decir, no afecta
a todos los genes del cromosoma. De hecho, se estima que slo un 65% de los genes presentes en el
cromosoma X se inactivan; un 20% de los genes se inactivan slo parcialmente (es decir, no estn
inactivados en todas las clulas) y un 15% escapan totalmente al proceso de inactivacin. Esto quiere
decir que, para esos genes, existen dos copias funcionales en mujeres XX pero slo existe una copia en
varones XY. Para evitar las diferencias de dosis gnica en estos casos, algunos de estos genes que escapan
a la inactivacin tienen un gen homlogo funcional en el cromosoma Y, lo que hace que ambos sexos tengan
la misma dosis gnica funcional. Se piensa que el fenotipo de mujeres X0 con Sndrome de Turner se
debe precisamente a la disminucin de dosis de todos o algunos de los genes que escapan la inactivacin,
ya que estas pacientes slo tienen una dosis funcional de estos genes (cuando deberan tener dos).


Estructura de los cromosomas sexuales humanos
CAPTULO 8: HERENCIA RELACIONADA CON EL SEXO 93

Lo que ahora conocemos como cromosomas X e Y, formaban una pareja de autosomas hace
aproximadamente 300 millones de aos. Los datos ms recientes apoyan la "ley de Ohno" (formulada por
Susumu Ohno en 1967), que dice que el primer paso en el proceso de creacin del dimorfismo de los
cromosomas sexuales fue la fijacin del gen responsable del desarrollo del sexo masculino en uno de los
cromosomas (el que se convertira en el futuro cromosoma Y) y su prdida en el otro cromosoma del par (el
futuro X). Despus, la limitacin progresiva de recombinacin entre ellos condujo a una evolucin separada
de ambos cromosomas: el Y perdi material rpidamente por la falta de recombinacin, sufri varias
duplicaciones y se qued con pocos genes, de los cuales un gran porcentaje tienen homlogos en el X. El
cromosoma X, en cambio, se conserv mejor gracias a la existencia de recombinacin entre las dos copias
presentes en mujeres, y fue evolucionando progresivamente desde metaterios (mamferos sin placenta,
como los marsupiales) a euterios (mamferos con placenta). Al final, en el cromosoma X actual conserva
una regin del autosoma ancestral de prototerios (mamferos que ponen huevos), adems de otra regin
aadida despus de la separacin de los metaterios. Actualmente, ambos cromosomas sexuales slo se
recombinan entre ellos en las dos pequeas regiones pseudoautosmicas que estn en los extremos de
cada brazo. La reciente secuenciacin completa del cromosoma X en el ao 2005 ha aclarado la estructura
de los cromosomas X e Y:

En el cromosoma X se pueden distinguir:

- Dos regiones pseudoautosmicas PAR1 y PAR2, por las que se recombinan los cromosomas X e Y
(al menos una recombinacin en PAR1 es necesaria en la meiosis masculina). PAR1 (en Xp e Yp)
tiene un tamao de 2,7 Mb, mientras que PAR2 (en el extremo del brazo largo de ambos
cromosomas) mide 330 kb.
- Una gran regin conservada (XCR, "X-conserved region") que ocupa la mayor parte del brazo
largo del cromosoma X. Esta es la secuencia ms antigua y representa los restos del autosoma
original de prototerios del que se originaron los cromosomas X e Y actuales. Una pequea porcin
de sta regin se encuentra transpuesta al cromosoma Y (XTR, "X-transposed region"),
calculndose que dicha transposicin tuvo lugar hace 5 millones de aos, despus de la separacin
de humanos y chimpancs.
- Una regin "aadida" (XAR, "X-added region") ms joven que XCR, al parecer incorporada al
cromosoma X a partir de otro autosoma hace unos 100 millones de aos en mamferos placentarios
(euterios). Esta regin representa la mayor parte del brazo corto del cromosoma X actual. Algunos
fragmentos de la porcin ms distal de este brazo, cercanos a la PAR1, estn tambin presentes en
el cromosoma Y, distinguindose hasta 12 bloques de homologa entre ambos cromosomas.

De los aproximadamente 1.000 genes que hay en el cromosoma X, 54 tienen un homlogo funcional en
el Y: 24 de ellos estn en PAR1, 5 en PAR2 y 25 en las regiones no-recombinantes de ambos cromosomas.
De stos 25, 15 estn en la XAR y 3 en XTR; los 7 genes restantes se localizan en la XCR y por eso se
piensa que descienden del autosoma ancestral.

La Figura 8.5 muestra la estructura de los cromosomas X e Y humanos.






94 GENTICA HUMANA




El cromosoma Y es el ms peculiar de todos los cromosomas humanos, ya que de slo 23 Megabases (de
un total estimado de 50 Mb) estn formadas por eucromatina. Por ello, este cromosoma es tambin el ms
pobre en genes. La peculiar estructura del cromosoma Y actual se debe a su comportamiento durante la
meiosis: lgicamente, no puede quedar sin emparejar durante la meiosis, y de hecho se empareja con el
cromosoma X a travs de las dos regiones pseudoatosmicas que contiene en los extremos del brazo corto
y del brazo largo, respectivamente. El resto del cromosoma Y no se recombina nunca, y por esto ha ido
acumulando mutaciones y degenerando con el tiempo. La regin eucromtica del Y comprende unas 22
Mb (el resto del cromosoma es heterocromatina) y est constituida por 3 tipos de secuencias: i) un
bloque de 3,4 Mb fruto de una transposicin procedente del X (XTR, regin transpuesta desde el X); ii) un
total de 8,6 Mb de secuencias derivadas del cromosoma X, que representan las regiones derivadas del
cromosoma ancestral; y iii) un total de 10,2 Mb de regiones palindrmicas, distribuidas en 7 bloques. En
total, en el cromosoma Y slo se han encontrado 158 unidades transcripcionales, entre las que destacan
27 genes que tienen homlogos claros en el cromosoma X. De stos, 13 estn degenerados y se han
convertido en pseudogenes; los 14 restantes son autnticos genes que se expresan en varios tejidos, con la
excepcin de SRY (que slo se expresa en clulas germinales masculinas). Todos estos genes se localizan
fundamentalmente en las regiones derivadas del X. Por el contrario, en las regiones palindrmicas hay
unos 60 genes, agrupados en 9 familias, que slo se expresan en el tejido testicular y que no tienen un
homlogo claro en el cromosoma X: estos genes parecen codificar protenas necesarias para la fertilidad
masculina. Por lo que respecta al papel de las regiones palindrmicas, parecen tener una importancia clave
en el mantenimiento de la secuencia y estructura del cromosoma Y: la recombinacin entre los brazos de
cada palndromo y la conversin de secuencias entre ellos evita la rpida degeneracin que tendra lugar por
la ausencia de recombinacin entre los cromosomas X e Y en esta regin.


XTR
X
A
R
X
C
R
XTR
PAR2
PAR1
XTR
PAR1
G
e
n
e
s


q
u
e


e
s
c
a
p
a
n


a


l
a



i
n
a
c
t
i
v
a
c
i

n
XTR
X
A
R
X
C
R
XTR
PAR2
PAR1
XTR XTR
PAR1 PAR1
G
e
n
e
s


q
u
e


e
s
c
a
p
a
n


a


l
a



i
n
a
c
t
i
v
a
c
i

n
CAPTULO 9: MODIFICACIONES DE LAS PROPORCIONES MENDELIANAS 95
Captulo 9. Modificaciones de las proporciones mendelianas.
Modo de estimar si se cumplen las proporciones mendelianas esperadas.
Desviaciones de las proporciones mendelianas para un carcter: dominancia
incompleta, codominancia, alelos mltiples, alelos letales. Interaccin gnica
y epistasia.


Ya desde el inicio de los experimentos con plantas, diversos naturalistas haban encontrado proporciones
fenotpicas en la F2 de monohbridos o dihbridos que no se correspondan con lo que cabra esperar segn
las leyes mendelianas (3:1 y 9:3:3:1, respectivamente). Como acabamos de ver, la bsqueda de las causas
de estas desviaciones permiti descubrir la herencia ligada al sexo en los caracteres controlados por genes
situados en el cromosoma X. Adems, se descubrieron fenmenos como el multialelismo o la interaccin
gnica en aquellos caracteres que estn controlados por ms de un gen. Aunque todas estas situaciones dan
lugar a proporciones fenotpicas distintas a las esperadas por las leyes de Mendel, el anlisis detallado de lo
que sucede viene a confirmar que, efectivamente, los postulados mendelianos tambin explican estas
situaciones.


Modo de estimar si se cumplen las proporciones mendelianas esperadas

Antes de pasar al estudio de estas cuestiones, es imprescindible estudiar la metodologa empleada para
poder afirmar con fiabilidad si unas proporciones fenotpicas dadas se apartan significativamente de lo
esperado segn las leyes mendelianas. Lgicamente, los porcentajes esperados nunca se cumplen
perfectamente porque el tamao de las muestras no es lo suficientemente grande. Por ejemplo, en un
cruce monbrido tpico en el que analizamos 100 plantas en la F2, esperaramos encontrar 75 con el fenotipo
dominante y 25 con el fenotipo recesivo. Sin embargo, lo ms probable es que nunca encontremos
exactamente estos nmeros, sino 74 y 26, 77 y 23, por ejemplo. En el caso de especies con generaciones
menos numerosas, como sucede en las familias humanas, las desviaciones pueden ser todava mayores
debido al pequeo nmero de individuos que se estudia. Por tanto, es imprescindible contar con un mtodo
cuantitativo que nos permita concluir con certeza estadstica si los porcentajes encontrados se ajustan a lo
esperado. El mtodo utilizado es el clculo del Chi cuadrado, un estadstico que se ajusta a una
distribucin concreta y que permite calcular la bondad del ajuste de unas proporciones a un modelo terico.
El mtodo calcula la probabilidad de que la diferencia observada entre las proporciones experimentales y las
proporciones tericas sea atribuible al azar. La hiptesis nula es que las proporciones tericas se
cumplen y la diferencia es explicable por el azar, sobre todo cuando el tamao de la muestra es
pequeo. Si el estadstico _
2
(chi cuadrado) supera un cierto valor, se puede rechazar la hiptesis nula con
una fiabilidad especfica (5%, 1%, 0,1%) y por tanto se puede afirmar que las proporciones fenotpicas
experimentales se alejan significativamente de las esperadas segn el modelo terico.

Es fcil comprender la mecnica de este razonamiento con un ejemplo. En un cruce monohbrido tpico
analizamos 1000 individuos de la F2 y encontramos 760 con el fenotipo dominante y 240 con el fenotipo
recesivo. Esto se aparta de los 750:250 que esperaramos encontrar si este carcter se heredase de forma
mendeliana, pero tenemos que comprobar si esta desviacin es atribuible al azar (de modo que si
hubisemos analizado 10.000 individuos las proporciones hubiesen sido ms cercanas al 3:1 terico), si
efectivamente este carcter no sigue las leyes de Mendel. El primer paso es el clculo del estadstico _
2
con
arreglo a la frmula _
2
= E [(O - E)
2
/ E], siendo O el nmero de casos observados y E el nmero de casos
96 GENTICA HUMANA
esperados para cada categora. En nuestro ejemplo, para el fenotipo dominante esperaramos encontrar 750
casos, pero hemos encontrado 760. As, calculamos (760750)
2
/ 750 = 0,133. Hacemos lo mismo para el
fenotipo recesivo: (240250)
2
/ 250 = 0,4. Ahora podemos obtener el sumatorio, de modo que _
2
= 0,133
+ 0,4 = 0,533. El ltimo paso es comprobar este valor en una tabla que represente los valores mximos
del _
2
a los que se puede rechazar la hiptesis nula con distintos niveles de probabilidad y para varios
grados de libertad. Si buscamos en una de estas tablas, vemos que para 1 grado de libertad se puede
rechazar la hiptesis nula, con un error del 5%, cuando el valor del _
2
es igual o superior a 3,841. Como el
valor calculado por nosotros es inferior, no podemos rechazar la hiptesis nula y, por tanto, las proporciones
experimentales no se apartan significativamente de lo esperado segn un modelo mendeliano de herencia.
En cambio, si hubisemos obtenido 780 dominantes y 220 recesivos, el _
2
resultante sera de 4,8. Como
este valor rebasa el valor de la tabla para un grado de libertad y p=0,05 (3,841) pero es inferior al valor de
la tabla para p=0,025 (5,024), podramos rechazar la hiptesis nula con un nivel de confianza del 95%
(p<0,05) y afirmar que las proporciones obtenidas no se ajustan a un modelo mendeliano de herencia. El
nmero de grados de libertad siempre es igual al nmero total de clases menos uno: como en nuestro
caso slo tenamos dos clases fenotpicas, hemos utilizado 1 grado de libertad. En el caso de un cruce
dihbrido, en el que tendremos 4 clases fenotpicas distintas en la F2, deberamos calcular el _
2
total y
buscar en la tabla el valor correspondiente para 3 grados de libertad.

La Figura 9.1 muestra el uso del _
2
para estimar si unas proporciones
fenotpicas se ajustan a las esperadas segn las leyes mendelianas.

Otra consideracin previa a los temas que vamos a tratar en este captulo hace referencia a la manera de
nombrar los diferentes alelos de cada gen. Es bastante evidente que al principio cada genetista utilizaba
distintas nomenclaturas, y se tard un tiempo en alcanzar un consenso sobre la notacin de los alelos.
Aunque hoy en da se pueden utilizar distintas formas de denominar los alelos, podemos dar unas reglas
generales. Como ya vimos al explicar los experimentos de Mendel, lo ms habitual es denominar los alelos
con la letra inicial del carcter recesivo (por ejemplo, vimos que los alelos para el color del guisante se
llamaban V y v por ser sta la inicial de "verde", que es el carcter recesivo). As, podemos utilizar una sola
letra tanto para el alelo dominante (ponindola en mayscula) como para el recesivo (en minscula). En
otros casos, se estudian mutaciones respecto a un carcter normal, y hay que establecer nombres para los
alelos que causan las mutaciones y para el alelo normal. Un buen ejemplo es el color del ojo de Drosophila,
para el que hay un alelo que causa el color normal rojo ladrillo y otros alelos mutantes que dan lugar a ojos
de distintos colores. En general, a los alelos normales se les denomina alelos "silvestres" o "salvajes",
porque son los que se encuentran en la naturaleza. Cada alelo mutante se representa por una o varias
letras que describen la mutacin (br para "brown", ojos marrones, por ejemplo) y el alelo salvaje se
representa entonces por esas mismas letras aadiendo el superndice
+
. Por ejemplo, una mosca
heterocigota para la mutacin "brown" tendra un genotipo br
+
/br. En ocasiones se eliminan las letras del
alelo silvestre, dejando nicamente el +. As, el genotipo anterior tambin podra representarse como +/br.
Dependiendo del estado dominante o recesivo del alelo mutante, ste se representa con maysculas o
minsculas, respectivamente. En los casos en que no hay dominancia en las series allicas (en las que hay
varios alelos para un mismo carcter y las relaciones de dominancia entre ellos son complejas) se suelen
utilizar superndices para designar los distintos alelos, como por ejemplo en el color del plumaje de patos
"Mallard". Para este carcter hay 3 alelos denominados M, M
R
y m
d
, siendo la dominancia: M
R
(Restricted) >
M (Mallard) > m
d
(Dusky). En el caso concreto de la Gentica Humana, las recomendaciones actuales
indican que los alelos se designen mediante un nmero o una letra, precedido por un asterisco, a
continuacin del smbolo del gen. Por ejemplo, la variante Constant Spring de la hemoglobina alfa-2 se
puede denominar HBA2*0001 (alelo 0001 del gen HBA2).
CAPTULO 9: MODIFICACIONES DE LAS PROPORCIONES MENDELIANAS 97


Modificaciones de las proporciones mendelianas al estudiar un carcter

Como hemos visto, tras los trabajos de Bateson, Morgan y muchos otros genetistas los principios
mendelianos se aceptaron como algo de aplicacin general. Sin embargo, tambin desde el principio se
reconocieron excepciones que no podan ser explicadas por estos principios, al menos aparentemente. Por
ejemplo, observaciones en plantas haban revelado casos en los que la F1 de un cruce monohbrido tena
un fenotipo intermedio entre el dominante y el recesivo de los progenitores, y ese fenotipo
intermedio estaba presente tambin en el 50% de la F2. Este era el caso del color de la flor en algunas
especies, en las que al cruzar una variedad pura de flores rosas con otra variedad pura de flores blancas se
obtena en la F1 un 100% de flores rosas (color intermedio entre el rojo y el blanco). En la F2 resultante de
la autofecundacin de flores de la F1 se obtenan 25% de flores rojas, 50% de flores rosas y 25% de flores
blancas. Es fcil darse cuenta de que estas proporciones fenotpicas de la F2 (1:2:1) coinciden con las
proporciones genotpicas esperadas, en vez de las proporciones fenotpicas 3:1 que son habituales en
este tipo de cruces. Estos resultados sugieren que no se est cumpliendo la condicin de dominancia
completa de un alelo sobre el otro, de modo que los heterocigotos muestran un fenotipo distinto (un poco
menos fuerte) que los homocigotos dominantes. La explicacin para esta dominancia dbil est en que
el carcter fenotpico obedece a efectos de dosis, es decir, el fenotipo depende de la dosis en que aparece
el alelo dominante. En el ejemplo del color de las flores, podemos imaginar que el alelo recesivo da lugar a
flores blancas (cuando se trata de plantas homocigotos recesivos) porque no produce ninguna cantidad de
pigmento rojo; el alelo que da lugar al color rojo hace que se produzca una cantidad determinada de
pigmento rojo, y por tanto la presencia de dos alelos rojos (homocigoto dominante) tendr como resultado
flores ms rojas que la presencia de un slo alelo rojo (heterocigoto rojo/blanco), en cuyo caso las flores
sern de un color rojo dbil o rosa. Este fenmeno se denomina dominancia incompleta
semidominancia, y es muy comn en caracteres fenotpicos que son el resultado de la accin de algn
enzima, ya que la actividad enzimtica total depender del nmero de alelos capaces de producir el enzima
correspondiente.

Otra circunstancia que puede modificar las proporciones fenotpicas mendelianas por relaciones anmalas
entre alelos es la co-dominancia, en la que cada uno de los alelos da lugar a un producto funcional que se
expresa con independencia del otro. En estas condiciones, el heterocigoto tendr un fenotipo distinto a
cualquiera de los dos homocigotos, que tambin sern distintos entre s. Por eso, las proporciones
fenotpicas de la F2 sern tambin del tipo 1:2:1, como en el caso anterior. Un ejemplo tpico de co-
dominancia en un carcter codificado por un gen es el grupo sanguneo MN en la especie humana. El
locus que codifica este carcter puede presentarse en dos formas allicas llamadas L
M
y L
N
, las cuales
codifican unas glicoprotenas de la membrana de los eritrocitos que dan lugar a los antgenos M y N
respectivamente. Los individuos homocigotos L
M
/L
M
tienen fenotipo M, los homocigotos L
N
/L
N
tienen
fenotipo N, y los heterocigotos L
M
/L
N
tienen fenotipo MN. Por tanto, un cruzamiento entre heterocigotos
L
M
/L
N
X L
M
/L
N
producir proporciones fenotpicas 1:2:1 (25% MM, 50% MN, 25% NN). En el fondo, se
trata de la misma situacin que veamos para la dominancia incompleta, con la diferencia de que aqu los
dos alelos producen una protena funcional y por tanto ambos son igualmente dominantes. Ponindolo
en los mismos trminos del ejemplo anterior, sera como una planta con un alelo que produce un pigmento
que genera flores de color rojo y otro alelo que produce un pigmento para el color amarillo: todas las
plantas de la F1 sern de color naranja (heterocigotos) y en la F2 se producirn 25% de flores rojas, 50%
naranjas y 25% amarillas.

98 GENTICA HUMANA
Los videos de la Figura 9.2 ilustran los conceptos de codominancia y
dominancia incompleta.




Aunque en especies diploides cada individuo slo tiene dos alelos en cada locus autosmico, esto no
quiere decir que esos dos alelos sean los dos nicos alelos posibles que se pueden encontrar en la
naturaleza para ese carcter. De hecho, para muchos rasgos fenotpicos es habitual que haya ms de dos
alelos posibles, sobre todo si se incluyen todos los alelos mutantes que se pueden encontrar. Este fenmeno
se conoce como alelismo mltiple y el conjunto de alelos se denomina serie allica. La presencia de
alelos mltiples es otro motivo por el que en ocasiones las proporciones mendelianas no se cumplen. El
ejemplo ms ilustrativo en gentica humana es el del grupo sanguneo ABO, originado por unos antgenos
de la membrana de los eritrocitos. Estos antgenos estn derivados de la sustancia H, que es una
glicoprotena de membrana que termina con los residuos N-acetil-glucosaminaGalactosaFucosa
(NacGlu-->Gal-->Fucosa). El antgeno 0, codificado por el alelo I
O
i, mantiene intacta la sustancia H;
el antgeno A, codificado por el alelo I
A
, aade un resto N-acetil-galactosamina a la Galactosa de la
sustancia H, y el antgeno B, codificado por el alelo I
B
, aade una galactosa a la galactosa de la sustancia
H. Los alelos I
A
e I
B
son codominantes entre s, pero lgicamente ambos son dominantes sobre I
O
ya
que ste no produce ningn antgeno distinto a la sustancia H. Teniendo en cuenta estas relaciones de
dominancia, esta serie allica puede dar lugar a 4 posibles fenotipos (A, B, AB y O) a partir de una
gran variedad de genotipos. Por ejemplo, el cruce entre un individuo de fenotipo A y otro de fenotipo B
puede dar lugar a distintos tipos de descendencia, dependiendo de los genotipos de los progenitores. Si el
cruce es del tipo I
A
I
A
X I
B
I
B
toda la descendencia sern heterocigotos I
A
I
B
con fenotipo (grupo
sanguneo) AB. Sin embargo, si se trata de un cruce I
A
I
O
X I
B
I
O
(en el que los progenitores tambin son
de grupo sanguneo A y B respectivamente) la descendencia tendr proporciones fenotpicas A, B,
AB y O. Estos porcentajes, a primera vista, pueden confundir y llevar a pensar que este carcter no se
hereda de forma mendeliana. El anlisis detallado de cada tipo de cruzamiento confirma que tambin se
cumplen los postulados de Mendel, aunque la presencia de ms de dos alelos distintos, con diferentes
A A
A a
a a
C
o
n
c
e
n
t
r
a
c
i

n


d
e


e
n
z
i
m
a
A A A A
A a A a
a a a a
C
o
n
c
e
n
t
r
a
c
i

n


d
e


e
n
z
i
m
a
C
o
n
c
e
n
t
r
a
c
i

n


d
e


e
n
z
i
m
a
CAPTULO 9: MODIFICACIONES DE LAS PROPORCIONES MENDELIANAS 99
relaciones de dominancia entre s, puede confundir la interpretacin de las proporciones halladas en la
descendencia.

La Figura 9.3 muestra la estructura de los grupos sanguneos ABO y las
consecuencias del alelismo mltiple.




La ltima situacin en la que no se obtienen las proporciones mendelianas esperadas cuando se estudia un
carcter fenotpico es aquella en la que uno de los alelos es letal, es decir, impide el desarrollo embrionario
de los individuos que llevan una o dos copias de ese alelo. Cuando la letalidad se produce slo en individuos
homocigotos para ese alelo, se habla de un alelo letal recesivo, mientras que si basta con la presencia de
un slo alelo para causar letalidad se habla de letal dominante. Un ejemplo tpico de alelos letales es el del
locus que controla el pelaje amarillo de ratones, estudiado por Cuenot en 1904. Al alelo que produce un
pelaje normal se le llama agouti ( agut) en referencia a un roedor de ese nombre que vive en
Sudamrica. El pelaje agut normal se debe a que cada pelo tiene pequeas bandas transversales negras y
amarillas, de modo que la apariencia final es de un pelaje castao. Adems del alelo agut normal (A) y de
su correspondiente recesivo a, existe un alelo que origina un pelaje de color comletamente amarillo (A
Y
),
que es dominante respecto al alelo agut A. Por tanto, los cruces entre un ratn agut y otro amarillo, o
entre dos ratones agut, producen las proporciones mendelianas esperadas en al descendencia. Por ejemplo,
el cruce AA X A
Y
A (ratn agut con ratn amarillo) tendr una descendencia con 50% de ratones agut y
50% amarillos. En cambio, los cruces entre ratones amarillos tienen descendencia con 1/3 de
ratones agut y 2/3 de ratones amarillos, lo cual no se corresponde con las proporciones fenotpicas
esperadas. Si el cruce fuese del tipo A
Y
A X A
Y
A, en la descendencia deberamos encontrar AA, A
Y
A
Y
y
A
Y
A, lo cual se debera traducir en amarillos y agut (proporcin 3:1 tpica). La explicacin reside
precisamente en que el alelo A
Y
es letal recesivo, y provoca la muerte embrionaria de ratones
homocigotos A
Y
A
Y
. Por eso, al descontar el 25% de ratones A
Y
A
Y
nos quedamos slo con descendencia de
Fucosa Galactosa N-Acetilglucosamina
Sustancia H
N-Acetilgalactosamina
Galactosa
Alelo I
A
(aade N-acetilgalactosamina)
Alelo I
B
(aade galactosa)
Alelo i
(no aade nada)
FENOTIPO A
FENOTIPO O
FENOTIPO B
Fucosa Galactosa N-Acetilglucosamina
Sustancia H
N-Acetilgalactosamina N-Acetilgalactosamina
Galactosa Galactosa
Alelo I
A
(aade N-acetilgalactosamina)
Alelo I
B
(aade galactosa)
Alelo i
(no aade nada)
FENOTIPO A
FENOTIPO O
FENOTIPO B
100 GENTICA HUMANA
genotipos AA A
Y
A y de ah las proporciones encontradas. El alelo amarillo (A
Y
) es, por tanto, un ejemplo de
un alelo letal, recesivo en cuanto a la letalidad pero dominante en cuanto al carcter fenotpico
que controla (el color amarillo del pelaje). En el caso de humanos es ms difcil descubrir genes con alelos
letales, porque habitualmente no tienen otro efecto fenotpico que permita reconocerlos. A veces se ven
proporciones ligeramente distintas a las esperadas, y en esos casos se sospecha que uno de los
alelos es subvital o subletal, es decir, que causa cierta mortalidad durante el desarrollo embrionario.

Al llegar al final de este apartado, es muy importante recordar que todas las posibles desviaciones de las
proporciones fenotpicas mendelianas que hemos visto hasta ahora estn causadas por problemas en los
alelos de un nico gen que controla un carcter fenotpico, bien por falta de dominancia completa, por la
existencia de mltiples alelos o por la presencia de alelos letales. Por eso las hemos agrupado bajo el
epgrafe de modificaciones del monohibridismo, porque son situaciones que surjen al analizar un nico gen.


Modificaciones del dihibridismo. Interaccin gnica y epistasia

En ocasiones, cuando se estudian dos caracteres fenotpicos tambin se obtienen proporciones distintas a
las esperadas segn los principios mendelianos, que predicen una descendencia con proporciones 9:3:3:1 al
cruzar dos individuos heterocigotos para cada uno de los caracteres. Lgicamente, las circunstancias
estudiadas en el apartado anterior tambin afectarn a estas proporciones si uno de los genes que
analizamos est sujeto a codominancia, dominancia incompleta, letalidad, etc. Por ejemplo,
podemos considerar dos caracteres distintos tales como el grupo sanguneo ABO (cuyo sistema allico ya ha
sido explicado) y el albinismo. ste ltimo es un carcter mendeliano controlado en ratones por un solo gen,
con un alelo silvestre A y un alelo recesivo a que provoca albinismo en homocigotos aa. Si cruzamos
ratones dobles heterocigotos Aa/I
A
I
B
, la descendencia no se ajustar a las proporciones tpicas 9:3:3:1,
sino que obtendremos ratones pigmentados con grupo sanguneo A, B AB, y tambin ratones albinos con
cualquiera de los tres grupos sanguneos. Las proporciones fenotpicas sern 3:6:3:1:2:1, que en el fondo
es una modificacin de la relacin 9:3:3:1. La razn de este fenmeno es que los alelos que determinan el
grupo sanguneo son co-dominantes (los alelos I
A
y I
B
) y por eso se distorsionan las proporciones
fenotpicas esperadas.

Habitualmente, las anomalas en las proporciones del dihibridismo se detectan cuando se estudia un
carcter fenotpico que est controlado por dos ms genes, debido a un fenmeno llamado interaccin
gnica. En efecto, aunque cada gen por separado se comporte de acuerdo a los principios mendelianos y
los genotipos sean los esperados, puede suceder que las proporciones fenotpicas sean aberrantes porque
ambos genes estn controlando un mismo carcter y la accin de uno enmascara los genotipos del otro. La
interaccin gnica no significa que ambos genes o sus productos interaccionen directamente, sino que
participan en una misma va o proceso biolgico (como puede ser la generacin de un pigmento en
varios pasos metablicos, por ejemplo). Si cada gen acta a distintos niveles de esa va, uno de ellos puede
afectar la expresin del otro y dar lugar a proporciones fenotpicas inesperadas en la descendencia. El
principal obstculo que nos encontramos para interpretar las proporciones es que, si nicamente estamos
analizando un carcter fenotpico, es imposible saber a priori si dicho carcter est controlado por un gen o
por varios. En efecto, en el caso de dos caracteres era fcil porque podamos agrupar la descendencia en las
cuatro posibles categoras fenotpicas que surjen al considerar dos caracteres a la vez, pero aqu estamos
observando un carcter solamente. La pista que nos indica el nmero de genes implicados es el
denominador de las proporciones fenotpicas encontradas: si stas se expresan en dieciseisavos,
podemos suponer que nos encontramos ante un carcter fenotpico controla por dos genes, si son
sesentaycuatroavos se tratar de 3 genes, etc.
CAPTULO 9: MODIFICACIONES DE LAS PROPORCIONES MENDELIANAS 101

Los efectos de la interaccin gnica pueden ser bsicamente de dos tipos: la aparicin de fenotipos
nuevos (que no estaban presentes en los progenitores) y la modificacin de las proporciones tpicas
del dihibridismo. Por lo que respecta al primero, recordemos que segn los principios mendelianos el
carcter recesivo de uno de los progenitores desaparece en la F1 y reaparece en el 25% de la F2. En
cambio, si un carcter est controlado por dos genes distintos, a veces el resultado es que en la F2
aparecen fenotipos nuevos que no estaban presentes en la F1 ni en los progenitores. Tal es el
caso, por ejemplo, del color del pimiento Capsicum annuum, que es un rasgo fenotpico determinado por
dos loci: uno de ellos determina la produccin o no de pigmento rojo, con un alelo R que produce pigmento
rojo y es dominante sobre el alelo r que no produce pigmento. El otro gen controla la degradacin de la
clorofila (de color verde), con un alelo dominante C que degrada la clorofila para dar un color amarillento
(sin pigmento), y un alelo recesivo c que no degrada la clorofila y por tanto da el color verde tpico. En
estas circunstancias, un cruce de variedades puras RRCC (de color rojo) X rrcc (de color verde) da
lugar al 100% de plantas RrCc (de color rojo) en la F1. Hasta aqu todo parecera indicar que el color del
pimiento est controlado por un solo gen. En cambio, el cruce RrCc X RrCc produce en la F2 unas
proporciones genotpicas con 9/16 R_C_ de color rojo, 3/16 R_cc de color marrn (por la presencia
simultnea del rojo y el verde), 3/16 rrC_ de color amarillento por la ausencia de pigmentos y 1/16 rrcc
de color verde. Esto va contra los principios del monohibridismo mendeliano tpico, ya que tenemos cuatro
fenotipos distintos. Aunque esto podra sugerir la presencia de alelos mltiples para un solo locus, las
proporciones encontradas para las cuatro clases fenotpicas (expresadas en dieciseisavos) sugieren que este
carcter est controlado por dos loci. Otro ejemplo de este fenmeno es el color de los ojos de la
Drosophila, en el que el tipo silvestre de color rojo ladrillo est controlado por dos genes: brown (marrn)
y scarlet (escarlata). El locus brown tiene un alelo silvestre bw
+
dominante sobre el recesivo marrn (br) y
el locus scarlet tiene un alelo silvestre st
+
dominante sobre el recesivo (st) que produce ojos de color rojo
escarlata. Las moscas con ojos de color silvestre tienen un genotipo bw
+
bw
+
/st
+
st
+
. Al cruzar una mosca
mutante con ojos de color marrn (bwbw/st
+
st
+
) con otra de ojos escarlata (bw
+
bw
+
/stst), toda la F1
es doble heterocigtica (bw
+
bw/st
+
st) y por tanto con ojos del color silvestre rojo ladrillo. En la F2
resultante del cruce entre moscas de la F1, se obtiene un nuevo fenotipo (ojos de color blanco) en 1/16
del total, y proporciones 9:3:3:1 de los fenotipos silvestre, marrn, escarlata y blanco respectivamente.
Nuevamente, la presencia de 4 clases fenotpicas expresadas en dieciseisavos nos alerta sobre la presencia
de dos loci controlando este carcter. De hecho, lo que sucede es que el locus brown controla la produccin
de un pigmento de color rojo brillante llamado drosopterina, mientras que el locus scarlet controla la
produccin de otro pigmento de color marrn llamado xantomatina. En situaciones normales, el color
silvestre es el resultado de la mezcla de ambos pigmentos. En cambio, mutaciones en el locus brown hacen
que no se produzca drosopterina y el nico pigmento del ojo sea la xantomatina (de ah el color marrn del
ojo). Las mutaciones en el locus scarlet hacen que no se produzca xantomatina, siendo el color del ojo rojo
escarlata por la presencia de drosopterina. Los dobles mutantes recesivos (1/16) del total de la F2, carecen
de ambos pigmentos y por tanto tienen ojos de color blanco.

El otro efecto de la interaccin gnica es la distorsin de las proporciones mendelianas esperadas al
analizar un carcter. Dicha distorsin puede ser debida a la presencia de dos genes que controlan dicho
carcter, de modo que uno de los genes enmascara la expresin del otro. Este fenmeno se conoce
con el nombre de epistasia y puede ser de distintos tipos, como veremos a continuacin. Al gen que
modifica la expresin del otro se le denomina gen episttico, y al gen cuya expresin es modificada se le
denomina gen hiposttico. Un buen ejemplo para entender la epistasia, utilizando los grupos sanguneos
humanos, es el llamado fenotipo Bombay. Como se recordar, los isoantgenos A y B resultan de la
adicin de N-acetil-galactosamina de galactosa, respectivamente, a la sustancia H. Por tanto, slo los
individuos que tienen sustancia H en la membrana de los eritrocitos pueden expresar antgenos A B. La
102 GENTICA HUMANA
produccin de sustancia H (la adicin de la ltima fucosa a la cadena glicosdica) est controlada por otro
locus distinto que presenta un alelo dominante H (produce sustancia H completa) y otro alelo recesivo h (no
la produce). Por tanto, los individuos homocigotos hh no producirn sustancia H y no podrn
expresar ningn isoantgeno aunque tengan alelos I
A
I
B
para el locus del sistema ABO. Este
fenmeno se encontr por primera vez en una mujer del grupo O hija de padres A y AB, lo cual es imposible
segn la herencia del sistema ABO. Esta mujer, casada con un individuo del grupo A (genotipos posibles I
a
i
I
A
I
A
) tuvo descendencia del grupo A, B y AB, lo cual tambin es impsible si ella fuese realmente del grupo
O (genotipo ii). La explicacin es que la mujer en realidad tena genotipo I
B
i y por tanto debera ser del
grupo B, pero como es homocigota para el alelo recesivo h y no produce sustancia H su fenotipo es del
grupo O. Podemos imaginar un cruce entre individuos dobles heterocigotos para el grupo ABO y para la
sustancia H, del tipo I
A
I
B
/Hh X I
A
I
B
/Hh. Segn el locus ABO, la descendencia debera ser del grupo A,
del grupo B y del grupo AB. Sin embargo, al tener en cuenta el locus H vemos que de cada una de
esas categoras sern homocigotos hh (sin sustancia H) y por tanto del grupo O. Al considerar ambos loci,
las proporciones fenotpicas sern 3/16 del grupo A, 6/16 del grupo AB, 3/16 del grupo B y 4/16 del
grupo O, lo cual se desva de las proporciones esperadas 9:3:3:1. Como vemos, la presencia de un gen
episttico (el que controla la produccin de sustancia H) enmascara la expresin del locus ABO (que en este
ejemplo es el gen hiposttico) porque ambos genes estn implicados en procesos bioqumicos que
interaccionan en un mismo carcter fenotpico. Como las proporciones fenotpicos se expresan en
dieciseisavos, esto nos alertara inmediatamente sobre la presencia de dos genes interactuando de modo
episttico aunque no supisemos nada de la existencia de la sustancia H.

La Figura 9.4 muestra un ejemplo del fenotipo Bombay.

En general, la epistasia puede ser recesiva o dominante, segn el gen episttico deba estar en
homocigosis o no, respectivamente, para enmascarar la expresin del gen hiposttico. A su vez, la epistasia
puede ser simple (uno de los genes es episttico sobre el otro) doble (ambos loci son epistsicos el uno
sobre el otro). Veamos algunos ejemplos de los tipos de epistasia ms comunes:

Epistasia simple recesiva: Ya vimos que el color del pelaje de ratones est controlado por el gen
agut, con un alelo A dominante sobre a, de forma que los ratones A- (AA Aa) son de fenotipo
agut y los ratones aa tienen pelaje negro (carecen de las pequeas bandas amarillas). Existe otro
gen que controla la presencia o no de pigmentacin, con alelo dominante C (pigmentacin) y un
alelo recesivo C
a
que impide cualquier tipo de pigmentacin. Los ratones de genotipo homocigoto
recesivo C
a
C
a
son, por tanto, albinos, mientras que los ratones C- (CC CC
a
) son del color
especificado por el locus agut. La F1 de un doble homocigoto dominante CC/AA (agut) con un
doble homocigoto recesivo aa/C
a
C
a
(albino) son todos heterocigotos dobles de pelaje agut
(genotipo Aa/CC
a
). La F2 resultante de cruzar ratones de la F1 muestra una proporcin 9:4:3
(agut:albino:negro) por epistasia de C sobre A. En este caso, hablamos de epistasia recesiva
porque el alelo C
a
es recesivo (slo C
a
C
a
modifica el fenotipo determinado por A). El ejemplo
anterior del fenotipo Bombay es tambin una epistasia de este tipo, pero al ser codominantes los
grupos sanguneos los 9/16 se descomponen en 6/16 y 3/16 (de ah las proporciones 3:6:4:3 que
veamos). La epistasia simple recesiva es muy comn entre genes que actan a distintos pasos
de una misma va metablica, y por eso es frecuente en enfermedades del metabolismo. Por
ejemplo, cuando la produccin de un pigmento se lleva a cabo en dos pasos metablicos, de modo
que el producto de la primera reaccin es el sustrato de la segunda reaccin, las mutaciones que
afectan al enzima responsable de la primera reaccin sern epistticas sobre el gen que controla el
segundo paso.

CAPTULO 9: MODIFICACIONES DE LAS PROPORCIONES MENDELIANAS 103
Epistasia simple dominante: en este caso el alelo del gen episttico es dominante, y basta con
una sola copia para que enmascare el efecto del gen hiposttico. Un ejemplo tpico es el color de
la calabaza comn, en el que intervienen un gen que controla el primer paso metablico en la
produccin de un pigmento. El alelo normal (w) permite la reaccin qumica, pero es recesivo
frente al alelo W que impide dicha reaccin. El producto de este primer paso es el sustrato de una
segunda reaccin controlada por otro gen (con alelos Y e y) que da lugar al color final de la
calabaza. Las plantas con genotipo ww para el primer gen (es decir, se lleva a cabo el primer paso
de la va) pueden ser amarillas (genotipos YY Yy para el segundo gen) verdes (genotipo yy). En
cambio, basta la presencia de un alelo W en el primer locus para que todas las plantas sean
blancas, porque no se completa la primera reaccin y no hay pigmentacin. En este tipo de
espistasia, la F2 resultante del cruce de dobles heterocigotos muestra proporciones fenotpicas
12:3:1, con 12/16 del fenotipo determinado por el alelo dominante del gen episttico.

Epistasia doble recesiva: este tipo de epistasia fue observada por primera vez Bateson y Punnett
al estudiar el color de las flores de Lathyrus odoratus (guisante oloroso). Vieron que al cruzar dos
flores blancas todas las plantas de la F1 eran prpuras y en la F2 apareca una proporcin 9:7 de
prpuras:blancas. Las proporciones en dieciseisavos confirman la presencia de dos loci P y Q que
controlan este carcter. La proporcin 9:7 se puede explicar si consideramos que ambos genes
tienen un alelo dominante (P Q) y otro recesivo (p q) y actan sobre dos pasos sucesivos en la
va metablica que genera el pigmento de las flores. Si el pigmento que da el color prpura slo se
produce cuando estn presentes al menos un alelo dominante de cada uno de los genes
implicados, la descendencia de un cruce del tipo PPqq x ppQQ (en el que ambas plantas tienen
flores blancas), ser del 100% de dobles heterocigotos PpQq en la F1 (todas con flores prpuras,
pues tienen un alelo dominante de cada par gnico). El cruce de estas plantas dar en la F2 9/16
de plantas con genotipo homocigoto recesivo para alguno de los dos genes (blancas); el resto
sern prpuras por tener genotipos con un alelo dominante para ambos genes. Se denomina doble
recesiva porque la presencia de cualquiera de los dos homocigotos recesivos para uno de los
genes es episttico sobre el otro gen.

Otros tipos de espistasia. Se conocen muchos otros ejemplos de epistasia en las que las
relaciones entre el gen episttico y el hiposttico pueden ser distintas. Por ejemplo, cuando un
fenotipo requiere la presencia de al menos un alelo dominante para cualquiera de los dos loci que
controlan un carcter, el fenotipo alternativo aparecer nicamente en individuos dobles
homocigotos, y las proporciones obtenidas en la F2 de un cruce entre dobles heterocigotos sern
15:1. Este tipo de epistasia se denomina doble dominante porque los dos alelos epistticos son
dominantes de modo recproco, y es tpica de genes que se han originado por duplicacin a partir
de un gen ancestral y controlan un mismo carcter fenotpico. Otra situacin distinta es la que
origina epistasia doble dominante/recesiva, debida a la supresin dominante de un gen sobre
el efecto del otro y que produce proporciones fenotpicas 13:3.

El video de la Figura 9.5 ilustra el concepto de epistasia.

Como conclusin a este captulo, conviene recordar que todas las desviaciones que hemos visto de las
proporciones fenotpicas esperadas segn los principios mendelianos no invalidan las conclusiones de
Mendel, sino que en el fondo las confirman. Sin embargo, estas excepciones sirven para recordarnos que
los caracteres hereditarios que estn controlados por un solo locus con dos alelos son, en
realidad, una minora. Curiosamente, los 7 caracteres descritos por Mendel en su artculo original
cumplan estos requisitos, pero la mayor parte de los rasgos genticos son ms complejosy estn sometidos
104 GENTICA HUMANA
a alguno de los fenmenos descritos (codominancia, alelismo mltiple, interaccin, etc). Como veremos ms
adelante, los rasgos de mayor importancia en Gentica Humana estn controlados por dos ms
genes, y generan muchas veces variacin fenotpica contnua. Aunque las leyes de Mendel son todava
aplicables incluso en estos casos, la interpretacin se complica tremendamente al aumentar el nmero de
loci, al aparecer alelos mutantes y al aadirse los efectos de la interaccin entre los genes y el ambiente.
CAPTULO 10: GENTICA DE LOS CARACTERES CUANTITATIVOS 105
Captulo 10. Gentica de los caracteres cuantitativos: experimentos de
Johannsen, Nilsson-Ehle y East. Modelo poligenes-ambiente y enfermedades
multifactoriales. Heredabilidad en sentido amplio y en sentido restringido.
Clculo de la heredabilidad en Gentica humana.


Gentica de los caracteres cuantitativos

Hemos visto que Mendel se centr en el estudio de caracteres cualitativos (es decir, caracteres que slo
aparecen en dos posibles formas alternativas), que generan un tipo de variacin llamada variacin
discontinua. Sin duda alguna, la gran intuicin de Mendel fue que slo el estudio de la variacin
discontinua le permitira desentraar las leyes de la herencia y los factores implicados en la misma. Sus
experiencias le haban mostrado que este tipo de caracteres eran los nicos que reaparecan en la F2
despus de haber desaparecido en la F1. Por el contrario, los caracteres cuantitativos o continuos (que
admiten muchos valores posibles y en los que los valores individuales se agrupan en torno a una media,
como el caso la altura de una planta, el peso de los frutos, etc) no mostraban este comportamiento. La
importancia de esta decisin fue extraordinaria, sobre todo teniendo en cuenta que la teora prevalente en
ese momento era contraria a esta manera de pensar. Por ejemplo, Darwin daba preferencia a los
caracteres cuantitativos respecto a los cualitativos (que consideraba de menor importancia) y aceptaba una
teora llamada pangnesis. Segn esta teora, la herencia sera el resultado de la mezcla de gmulas,
unas partculas somticas que de algn modo llegaran a la descendencia y determinaran que los caracteres
de la descendencia fuesen intermedios a lo encontrado en ambos progenitores.

Esto curioso que Darwin no se fijase en la importancia de la variacin discontinua, porque de hecho un
modelo de herencia basado en caracteres cualitativos favoreca ms su teora evolutiva. Probablemente fue
muy importante la influencia del pensamiento de Francis Galton, que estaba convencido de que los
caracteres cuantitativos constituyen la base de la variacin entre individuos y no entenda que stos
pudiesen ser explicados por medio de variaciones discontinuas. De hecho, Galton haba estudiado el tamao
de la planta del guisante y haba encontrado evidencias de variacin continua (una F1 con altura intermedia
a la de ambos progenitores). Estos experimentos tenan sus antecedentes en Klreuter, un botnico que
en 1766 haba hecho numerosos cruces en plantas y haba encontrado caracteres (como la altura de la
planta Nicotiana, por ejemplo) que mostraban variacin continua. No es de extraar, pues, que se generase
una fuerte controversia a principios del siglo XX entre los partidarios del mendelismo y los biometricistas
(discpulos de Galton, defensores de la variacin continua). Por desgracia, la influencia de Galton y la
aplicacin de las ideas de los biometricistas a sujetos humanos ocasionaron una de las pginas ms oscuras
de la Gentica a principios del siglo XX, ya que cristalizaron en el movimiento eugensico, que floreci en
los Estados Unidos de la mano de Charles Davenport en el laboratorio de Cold Spring Harbor. Con la idea de
mejorar la raza humana mediante apareamientos selectivos, los eugenistas pretendan eliminar de la
sociedad rasgos "negativos" como la criminalidad, el analfabetismo o la prostitucin; su presin fue
suficiente para que el gobierno de los Estados Unidos aprobase entre 1910 y 1939 legislacin
eugensica en tres reas: restriccin de la inmigracin europea; impedir matrimonios entre individuos de
razas distintas; esterilizacin de los individuos "genticamente infradotados". El auge del movimiento nazi
con la aplicacin de la "solucin final" contribuy al descrdito del movimiento eugenista americano,
llevando al cierre de su principal laboratorio en 1939. Por desgracia, muchas de las leyes aprobadas
siguieron vigentes durante aos, y la esterilizacin de los deficientes mentales continu en Estados Unidos
hasta los aos 1970; para entonces, unos 60.000 norteamericanos haban sido esterilizados sin
consentimiento propio o de los responsables legales.
106 GENTICA HUMANA

En la Figura 10.1 se puede encontrar un enlace a los archivos del movimiento
eugensico americano.

Las disputas en torno a las bases genticas de la variacin continua se resolvieron por los experimentos de
varios genetistas en las primeras dcadas del siglo XX. El primero en abordar la utilizacin de metodologa
estadstica en el estudio de la variacin continua fue el botnico dans Johannsen, que tuvo una gran
importancia en la Gentica (a l se deben los trminos gen, genotipo y fenotipo, por ejemplo). En sus
trabajos, que se extendieron de 1903 a 1909, intent estudiar el efecto de la herencia y del ambiente sobre
la variacin, siguiendo la idea inicial de Galton de nature versus nurture. Johannsen estudi sobre todo el
peso de las alubias de Phaseolus vulgaris en una cepa comercial y detect la presencia de variacin
continua, con alubias de distintos pesos que se agrupaban en torno a un valor medio. Autopolinizando
durante varias generaciones, consigui lneas puras para minimizar el efecto gentico y estudi la F1.
A pesar de tratarse de lneas puras, los pesos de las semillas de cada una de estas lneas siguen una
distribucin normal, con valores ligeramente distintos. Al plantar semillas de pesos diferentes (pero todas
procedentes de una misma lnea pura y por tanto genticamente iguales), encontr que el peso medio de la
progenie de las distintas semillas era idntico (no significativamente distinto) y coincida con la media de
pesos de la lnea pura original. Por ejemplo, en su lnea pura nmero 13 las semillas se distribuan en torno
a un peso medio de 0,45g, pero haba semillas de pesos mayores y menores a esta media, como es
lgico. Al plantar algunas de estas semillas y estudiar el peso de la alubia en la progenie, encontr que una
semilla de 0,28g produca alubias con un peso medio de 0,45g, una semilla de 0,48g produca alubias con
un peso medio de 0,43g, y una semilla de 0,58g produca plantas que daban alubias con un peso medio de
0,46g. Esto demostraba la presencia de factores genticos (responsables de que el peso medio de las
alubias sea igual a la media del peso de las semillas originales, como es de esperar en una lnea pura); pero
adems tambin demostraba la presencia de otros factores (presumiblemente ambientales) que hacen
que las semillas no sean todas idnticas, sino que el peso vare en torno a un valor medio. Adems, cada
lnea pura tena un peso medio de alubia caracterstico, con una media que se repeta en la F1 aunque se
plantasen semillas con pesos dispares. Fue, por tanto, Johannsen el primero en sugerir experimentalmente
que la variacin continua podra explicarse por una combinacin de factores genticos y ambientales.

La Figura 10.2 explica los experimentos de Johannsen.

De todas formas, esto no demostraba que los factores genticos implicados en la herencia de
caracteres continuos fuesen de tipo mendeliano. Algunos biometricistas, sobre todo el matemtico
Pearson, seguan negando la posibilidad de que los factores mendelianos pudiesen explicar la variacin
continua. Sin embargo, Bateson y Yule elaboraron en 1906 una argumentacin matemtica para explicar
que la presencia de varios factores mendelianos con dominancia incompleta puede originar la variacin
continua de los caracteres cuantitativos. De todas formas, la demostracin experimental de esto no llegara
hasta los estudios de Herman Nilsson-Ehle en 1909. Nilsson-Ehle tena varias lneas puras de trigo, en
las que estudi caracteres cuantitativos con variacin continua, tales como el color de las espigas. En sus
lneas, las espigas tenan colores que iban desde el blanco al rojo oscuro pasando por estados intermedios
(rojo claro, rojo). Cruz en primer lugar una planta de espiga blanca con una de color rojo claro y obtuvo F1
en la que todas las espigas eran de color intermedio (rosa); en la F2 obtuvo tres clases fenotpicas con
proporciones 1:2:1, siendo de plantas con espigas blancas, espigas rosas y espigas de color rojo
claro. En principio, como ya hemos visto al hablar del mendelismo, estas proporciones pueden explicarse
perfectamente mediante un modelo mendeliano de dominancia incompleta del rojo sobre el blanco. Sin
embargo, cuando cruz plantas de espigas blancas con plantas de espigas rojas (ms oscuras que el rojo
CAPTULO 10: GENTICA DE LOS CARACTERES CUANTITATIVOS 107
claro) obtuvo 5 clases de plantas: 1/16 rojas, 4/16 intermedio entre rojo y rojo claro, 6/16 rojo claro, 4/16
rosa y 1/16 blancas. Estas proporciones (1:4:6:4:1) sugieren un modelo de dos pares gnicos con
epistasia doble dominante (15:1) y dominancia incompleta (todos los rojos suman 15). De hecho, el
cruce de plantas de espiga blanca con plantas de color rojo oscuro dio lugar a 7 clases fenotpicas, con
proporciones expresadas en sesentaycuatroavos: 1/64 de plantas con espigas blancas y el resto de las
plantas con espigas de 6 clases de rojos (rojo claro, rojo y rojo oscuro ms las categoras intermedias entre
cada una de estas tres). Estas proporciones y el nmero de clases fenotpicas sugieren un modelo de
epistasis triple dominante: tres loci con dominancia incompleta (y efecto aditivo de dosis), y el resultado
fenotpico es la distribucin del color de la espiga como una variable continua. Esta fue la primera
demostracin experimental de que un carcter controlado por varios genes puede mostrar variacin
continua aunque cada uno de los genes se herede de forma mendeliana, si cada uno de ellos tiene un
pequeo efecto aditivo sobre el carcter fenotpico.

Faltaba por demostrar que la variacin debida a efectos ambientales puede ser responsable de las
diferencias observadas entre individuos con genotipos idnticos. La demostracin formal no llegara hasta
los estudios de Edward East en 1916, nuevamente con plantas. Estudiando la longitud de la corola en dos
lneas puras de Nicotiana longiflora, vio que la F1 mostraba un tamao intermedio a los fenotipos
parentales, con arreglo a una distribucin normal. En la F2, el valor medio se mantena pero la varianza se
ampliaba notablemente, aunque sin llegar a los valores extremos que se vean en las clases parentales. Esto
se explica porque las plantas de la F1 son heterocigotos para todos los genes que intervienen en el tamao
de la flor, de modo que las plantas de la F2 tendrn varias combinaciones distintas de genotipos y de ah la
mayor dispersin de los resultados. De hecho, East observ que la F3 resultante de cruces seleccionados
(entre plantas de la F2 que tenan el mismo tamao de corola) reproduca exactamente el tamao de las
plantas cruzadas, con una dispersin de tamaos debida a factores ambientales. Por ejemplo, cruz
inicialmente dos variedades puras de 40 mm y 93 mm de media, respectivamente. En la F1, el tamao
medio de corola fue de 64 mm (con valores entre 61 y 67 mm). En la F2 resultante de cruzar dos plantas de
la F1 se mantuvo el tamao medio de corola (67 mm) pero aument la dispersin (valores entre 52 y 82
mm), indicando la presencia de nuevos genotipos que estn originando tamaos distintos. Al cruzar dos
plantas de esta F2 que tenan corolas del mismo tamao (58mm), vio que la descendencia tena un tamao
medio cercano a 58 mm; al cruzar dos plantas de 70 mm obtuvo una descendencia con tamao medio
cercano 70 mm, etc. Es decir, comprob que efectivamente hay factores genticos responsables de los
distintos tamaos medios en los distintos cruces, al tiemp que los factores ambientales son los responsables
de la dispersin de valores que se observa en las plantas que tienen un mismo genotipo. Con estos
experimentos, East pudo demostrar el efecto simultneo de la variacin gentica y la variacin ambiental,
cuyos efectos combinados contribuyen a crear variacin continua.

El video de la Figura 10.3 ilustra los experimentos de H. Nilsson-Ehle y de E.
East.


108 GENTICA HUMANA



Por tanto, un par de dcadas despus del re-descubrimiento de Mendel se haba llegado a la explicacin de
cmo los principios mendelianos, que afectan a caracteres discretos (variacin discontinua) pueden dar
lugar a variacin continua de caracteres cuantitativos: cuando un carcter fenotpico est controlado por dos
ms genes y los efectos de cada gen sobre ese carcter se suman. Esto se conoce como herencia
polignica. En estos casos, es de gran inters determinar el nmero de loci que intervienen. Lo ms
habitual, es determinar el porcentaje de individuos de la F2 que tienen valores en torno a
cualquiera de los dos parentales. As, para un solo gen esto sera , para dos loci sera 1/16, para 3 loci
sera 1/64, etc. Se puede ver que esto es igual a ()
n
, donde n es el nmero de loci distintos. Por ejemplo,
ya vimos que el experimento de Nilsson-Ehle sugera 3 loci (1/64=[]
3
), mientras que en el experimento de
East ninguna de las 444 flores de la F2 tena una corola de tamao similar a la media de los progenitores,
por lo que el nmero de poligenes debe ser al menos superior a 4 ([]
4
=1/256).


Modelo poligenes-ambiente y enfermedades multifactoriales.

Hemos visto cmo se lleg a explicar la variacin continua por la accin de varios genes sobre un mismo
carcter (herencia polignica), y cmo la existencia de variacin ambiental aadida hace que las diferencias
entre las clases fenotpicas se suavicen y la variacin sea ms gradual. A la combinacin de herencia
polignica con la variacin introducida por factores ambientales se le llama herencia multifactorial, para
indicar la multiplicidad de factores que intervienen en la expresin del carcter fenotpico. En el campo de la
Gentica Humana la herencia multifactorial es de gran importancia, porque la mayora de los fenotipos y
muchas enfermedades, llamadas tambin enfermedades complejas, siguen este tipo de herencia. De
hecho, las enfermedades multifactoriales o complejas son las ms importantes desde el punto de vista
epidemiolgico, por lo que actualmente son objeto de investigacin con el fin de identificar los factores
genticos y ambientales implicados. Fruto del trabajo de estos ltimos aos, se ha detectado un alto
Lnea pura A Lnea pura B
Longitud corola (x): 40 mm 94 mm
61 64 67
52 67 82
54 72 79
F1
F2
F3
Lnea pura A Lnea pura B
Longitud corola (x): 40 mm 94 mm
61 64 67 61 64 67
52 67 82 52 67 82
54 54 72 72 79 79
F1
F2
F3
CAPTULO 10: GENTICA DE LOS CARACTERES CUANTITATIVOS 109
nmero de loci relacionados con el desarrollo de enfermedades como cncer, diabetes, hipertensin,
esquizofrenia, enfermedades neuro-degenerativas, etc.

Algunas de las enfermedades multifactoriales se manifiestan en rasgos fenotpicos claramente
cuantitativos, como por ejemplo la presin arterial o los niveles de glucosa en sangre. Como hemos visto
en el apartado anterior, se puede demostrar que los rasgos cuantitativos que se encuentran en la poblacin
mostrando una distribucin normal pueden explicarse por la interaccin varios genes (cada uno de los
cuales se heredara de forma mendeliana). Por ejemplo, podemos imaginar un modelo sencillo de dos loci
que regulan la presin sangunea, de forma que cada uno de ellos se hereda de modo mendeliano y provoca
un aumento de 20 mm de presin arterial cuando se encuentra en estado homocigoto para el alelo
dominante (mayscula), 10 mm en los heterocigotos o no provoca ningn aumento en los homocigotos para
el alelo recesivo (minscula). Representando estos valores en un grfico de barras, se puede comprobar que
1/16 de la poblacin tendr un genotipo AA/BB (aumento de 40 mm de presin arterial), 4/16 de la
poblacin tendr genotipos que provocan un aumento de 30 mm, 6/16 tendr genotipos con 20 mm, 4/16
con 10 mm y 1/16 sern genotipo aa/bb (0 mm de aumento). Como se ve, estos valores se aproximan a
una distribucin normal. Lgicamente, la presencia de ms loci hace que aparezcan ms categoras (ms
barras) y que la curva de distribucin se "suavice" cada vez ms. La variacin debida a factores ambientales
(ingesta de sal, ejercicio fsico, etc.) sobreaadidos a los factores genticos producir la curva gaussiana
tpica de muchos de estos rasgos cuantitativos.

La Figura 10.4 incluye un video que ilustra la importancia de la herencia
polignica en las enfermedades complejas.

Hay otro tipo de enfermedades que no tienen una herencia mendeliana reconocible, sino que se ajustan al
modelo de enfermedades multifactoriales, y sin embargo no se presentan como rasgos cuantitativos tpicos,
sino que originan fenotipos cualitativos. Por ejemplo, algunas malformaciones frecuentes, como el labio
leporino, forman parte de esta categora. Una explicacin bastante aceptada de estos rasgos propone que
es la predisposicin a manifestar la enfermedad o malformacin lo que tiene un origen multifactorial
(mezcla de factores genticos mendelianos y de factores ambientales). Por tanto, aunque esta
predisposicin s que se ajusta a una distribucin normal en la poblacin, la enfermedad slo se desarrolla
cuando se supera un cierto umbral de predisposicin. En estos casos se presupone que los familiares
directos de estos enfermos comparten con ellos algunos factores genticos y/o ambientales, por lo que
tendrn mayor predisposicin que la poblacin general a sufrir la misma enfermedad. Esto explica que el
riesgo de recurrencia de la enfermedad (probabilidad de que haya otro miembro afectado en una misma
familia) sea mayor en los familiares de un enfermo que en la poblacin general. Ejemplos clsicos de este
tipo de enfermedades son la estenosis pilrica, que adems muestra diferencias en cuanto al sexo (hay
ms varones que mujeres afectados por la enfermedad, lo que sugiere que el umbral de predisposicin es
ms bajo en varones), o el paladar hendido (fisura del paladar/labio leporino). Para calcular el riesgo
de recurrencia en estas enfermedades (la aparicin de otro caso en una familia en la que ya hay un
enfermo) se utilizan siempre riesgos empricos, basados en la observacin de los datos de prevalencia de la
enfermedad en la poblacin, datos que pueden variar considerablemente de una poblacin a otra. Una
propiedad a tener en cuenta es que en estos casos el riesgo es variable, al contrario de lo que ocurre en
enfermedades con herencia mendeliana simple, en las que el riesgo es fijo. As, cuando hay varios
miembros de una misma familia afectados por una enfermedad multifactorial, el riesgo de que aparezca un
nuevo caso en la misma familia es mayor que si hay un solo miembro enfermo; igualmente, cuando el
individuo enfermo es del sexo que se afecta con menor frecuencia, el riesgo tambin aumenta. Esto se
110 GENTICA HUMANA
explica porque, en estos casos, se supone que en esa familia concreta concurren ms factores genticos y/o
ambientales y su curva de predisposicin est desplazada a la derecha.

El video de la Figura 10.5 ilustra la herencia polignica de algunos rasgos
cualitativos.


Heredabilidad en sentido amplio y en sentido restringido. Clculo de la
heredabilidad en Gentica humana

La determinacin de la influencia de factores genticos en caracteres cuantitativos tiene consecuencias
importantsimas en la explotacin de especies vegetales o animales (tamaos, pesos, produccin de leche,
de huevos, de uvas, etc). La aplicacin ms importante en Gentica Humana es la posibilidad de determinar
la importancia relativa de los factores genticos y de los factores ambientales en las enfermedades
multifactoriales, por las implicaciones que esto tiene para la prevencin y tratamiento de estas dolencias.
Una forma de resolver este problema es estimar la parte de la variacin total de una variable que es debida
a factores ambientales, para de ah deducir la variacin atribuble a factores genticos. En el caso de los
caracteres cuantitativos, esto es relativamente sencillo porque pueden estudiarse con mtodos
estadsticos, analizando los parmetros que definen las variables poblacionales y sus relaciones (media,
varianza, covarianza, regresin). De todos stos, la varianza es el parmetro que mejor define la dispersin
de una variable continua en torno a la media y por tanto podemos estimar la variacin fenotpica calculando
la varianza total de ese rasgo en la poblacin. Esta varianza fenotpica total (VP) ser la suma de la
varianza debida a factores genticos (VG), ms la varianza debida a factores ambientales (VE), ms la
varianza debida a las interacciones entre genes y ambiente (VGE). A su vez, la variacin gentica viene
determinada por tres componentes: la varianza debida a efectos aditivos (VA), la varianza debida a efectos
de dominancia (VD) y la varianza debida a efectos de interaccin gnica (VI). Usando esta metodologa
podemos estimar la heredabilidad (H
2
) de un rasgo fenotpico cuantitativo. En sentido amplio, la
heredabilidad indica qu proporcin de la variacin fenotpica total VP de una variable continua es
atribuible a factores genticos. Siguiendo las definiciones precedentes, esta heredabilidad en sentido amplio
se calcula con arreglo a la frmula:
H
2
= V
G
/V
P


siendo VP=VG+VE+VGE (aunque VGE suele despreciarse). Para calcular H
2
necesitamos usar especies
puras (genotipos iguales), que nos permiten calcular la varianza ambiental VE variando las condiciones
ambientales de forma que toda la variacin sea debida al ambiente. Adems de esta dificultad de tipo
prctico, ste concepto de heredabilidad en sentido amplio es poco til porque no nos indica exactamente el
porcentaje de la variacin que es debida a factores genticos aditivos, que son los ms importantes. Por
eso, otra forma ms habitual de calcular la heredabilidad (heredabilidad en sentido estricto, h
2
) se basa
en calcular especficamente la parte de la varianza gentica que es debida a factores aditivos (VA), respecto
a la debida a diferencias en la dominancia (VD) y a efectos de interaccin (VI). Habitualmente, esta ltima
es despreciable y se considera que la varianza genotpica total es VG=VA+VD. En especies que lo permiten,
el clculo se realiza mediante experimentos de seleccin artificial, para evaluar el posible beneficio derivado
de tal seleccin. Por ejemplo, en una poblacin en la que una variable continua tiene una media M, se toma
una submuestra de individuos con una media significativamente diferente (esa diferencia se
denomina diferencial de seleccin, D), y se determina la media en la progenie de esos individuos
seleccionados. La diferencia de la media en la descendencia con la media poblacional inicial se denomina
ganancia G (o respuesta R). La heredabilidad en sentido estricto h
2
se calcula como G/D, e incluye
CAPTULO 10: GENTICA DE LOS CARACTERES CUANTITATIVOS 111
nicamente los factores genticos aditivos. Se puede comprobar que con la seleccin prolongada, la
heredabilidad va disminuyendo progresivamente, al haber cada vez menos factores genticos aditivos
que puedan seguir modificando el fenotipo.

En la Figura 10.6 se incluye un video y varias ilustraciones que muestran el
concepto de heredabilidad y su cuantificacin en gentica humana.

Lgicamente, este tipo de aproximacin experimental no es posible en el caso de la Gentica Humana. Sin
embargo, la enorme importancia socio-sanitaria de las enfermedades multifactoriales hace que sea de gran
utilidad determinar cunto influye el ambiente y cunto la herencia en la gnesis de esas enfermedades.
Para cuantificar la magnitud del componente gentico de una enfermedad, concepto anlogo a la
heredabilidad, se utilizan actualmente dos procedimientos:

- Clculo del riesgo relativo. Si calculamos el riesgo relativo de padecer la enfermedad que tienen
distintos grupos de personas relacionadas genticamente, como por ejemplo los hermanos de
individuos enfermos, y vemos que el riesgo de padecer la enfermedad en ese grupo es
significativamente mayor que en la poblacin general, podemos deducir que existen factores genticos
que determinan la aparicin de esta enfermedad. El riesgo relativo se calcula como R, en la que el
subndice R indica el grado de parentesco del grupo que estamos estudiando con los individuos
enfermos. Por ejemplo o (la "O" viene del ingls offspring, que significa "descendencia") indicara la
prevalencia de la enfermedad en los hijos e hijas de individuos enfermos; s (la "S" viene del ingls
sibs, que significa "hermanos y hermanas") sera la prevalencia de la enfermedad en los hermanos y
hermanas de individuos enfermos, etc. Calculando el cociente de cada uno de estos riesgos entre el
riesgo poblacional general podemos calcular el riesgo relativo. Un concepto similar al de riesgo relativo
es el de odds ratio (cociente del producto cruzado), que se calcula de otro modo pero nos da
prcticamente la misma informacin. La interpretacin de estos clculos es la misma: si los parientes
de los individuos enfermos tienen un riesgo significativamente aumentado de padecer la enfermedad
frente al riesgo de la poblacin general, se puede suponer que la enfermedad tiene un componente
gentico importante.

Clculo de las tasas de concordancia en parejas de gemelos. Si una enfermedad tiene un
componente gentico significativo, aparecer con mayor frecuencia en individuos con mayor parecido
gentico que en individuos genticamente ms distantes. Un modo elegante de estudiar esto en la
prctica es comparar los gemelos dicigticos (cuyo grado de identidad gentica es igual al de una
pareja cualquiera de hermanos) y los gemelos monocigticos, ya que stos son prcticamente
idnticos desde el punto de vista gentico. Este tipo de estudios, que han dado abundantes frutos en
Gentica Humana, se basan en el clculo de las tasas de concordancia, es decir, el porcentaje de
parejas de gemelos que concuerdan para un mismo rasgo fenotpico (una enfermedad, en este caso),
de manera que simplemente calculamos el porcentaje de parejas de gemelos en las que ambos
padecen la misma enfermedad. Estas parejas seran "concordantes" para esa enfermedad, mientras que
las parejas en las que un gemelo est enfermo pero el otro est sano seran parejas "discordantes".
Pues bien, si una enfermedad tiene un fuerte componente gentico, la tasa de concordancia en parejas
de gemelos monocigticos (MC) ser claramente ms alta que en parejas de gemelos dicigticos (DC),
pues aquellos comparten mayor nmero de genes que stos. Adems, este tipo de anlisis tiene la
ventaja de que corrige la influencia de los factores ambientales, ya que en la mayora de los casos
ambos hermanos gemelos tanto MC como DC han estado sometidos a las mismas influencias
ambientales. En el caso de rasgos cuantitativos (la presin arterial, por ejemplo) la estimacin de la
112 GENTICA HUMANA
concordancia puede realizarse mediante el clculo del coeficiente de correlacin intraclase (correlacin
de los valores de presin arterial de un hermano con su gemelo respectivo), de forma que un
coeficiente de correlacin R = 1 equivale al 100% de concordancia. La comparacin de concordancias
entre gemelos MC y DC se hace del mismo modo que se comparan dos coeficientes de correlacin. En el
caso de rasgos cualitativos (presencia o ausencia de una enfermedad) simplemente calculamos el
porcentaje de parejas de gemelos que concuerdan para esa enfermedad y as obtenemos la tasa de
concordancia (porcentaje de parejas concordantes respecto al total de parejas). Con estos datos
podemos estimar la heredabilidad (h), mediante la frmula h = 2 (Cmc - Cdc), en la que C es la
tasa de concordancia (Cmc en monocigticos y Cdc en dicigticos). Los valores de heredabilidad
calculados de este modo tienen un rango terico entre +1.5 (que correspondera a un rasgo
monognico autosmico recesivo, con Cmc = 1 y Cdc = 0.25) y 0 (Cmc = Cdc, en el caso de un rasgo
infludo slo por el ambiente). En general, se considera que las enfermedades con una heredabilidad en
torno a 1 (o superior) tienen un componente gentico importante.

h = 2 x (C
MC
C
DC
)
Tasa de concordancia
Gemelos MC Gemelos DC Heredabilidad
Enf. Bipolar
0,79 0,24 >1
Autismo
0,92 0
>1
Sarampin
0,95 0,87 0,16
Diabetes tipo I
0,40 0,04 0,72
Diabetes tipo II
0,50 0,37 0,26
Hipertensin
0,70 0,40 0,60
h = 2 x (C
MC
C
DC
)
Tasa de concordancia
Gemelos MC Gemelos DC Heredabilidad
Enf. Bipolar
0,79 0,24 >1
Autismo
0,92 0
>1
Sarampin
0,95 0,87 0,16
Diabetes tipo I
0,40 0,04 0,72
Diabetes tipo II
0,50 0,37 0,26
Hipertensin
0,70 0,40 0,60
CAPTULO 11: LIGAMIENTO GENTICO EN HUMANOS 113
Captulo 11. Ligamiento gentico en humanos.
El concepto de ligamiento: fraccin de recombinacin y distancia gentica.
Informatividad de los marcadores utilizados en estudios de ligamiento. El
clculo del LOD score. Ligamiento no paramtrico y su utilizacin en gentica
humana.


El concepto de ligamiento gentico: fraccin de recombinacin y distancia
gentica

Aunque algunos autores ya haban sugerido la presencia de determinados genes en cromosomas concretos,
no hubo evidencia clara de esto hasta el descubrimiento del ligamiento del locus white de Drosophila al
cromosoma X (como se ha explicado en el Captulo 8), descubrimiento hecho por Morgan en torno a 1910.
Poco despus, Morgan identific nuevos mutantes, entre ellos otro llamado rudimentary, que tambin
mostraba ligamiento al cromosoma X. Esto llev a Morgan a estudiar la segregacin simultnea de estos dos
genes: si siempre se heredan juntos, esto sugerira que estn cerca en el mismo cromosoma, ya que no ha
habido recombinacin entre ellos. En efecto, segn las leyes de la herencia mendeliana dos loci que estn
en cromosomas distintos segregarn de manera independiente, es decir, los dos alelos de cada locus se
distribuirn en los gametos de modo aleatorio. En cambio, cuando los dos loci estn en el mismo
cromosoma (se dice entonces que son sintnicos), cabe pensar que siempre se heredar la misma
combinacin de alelos y un miembro de la descendencia que herede un alelo concreto de uno de los loci
tambin heredar el alelo del otro locus que estaba en el mismo cromosoma parental. Por el contrario, si se
produce una recombinacin (con sobrecruzamiento) en algn punto intermedio entre ambos loci durante la
meiosis, los gametos llevarn combinaciones allicas que no estaban presentes en ninguno de los
progenitores, es decir, se formen gametos recombinantes. Morgan comprob que poda darse
recombinacin entre el locus white y el locus rudimentary en Drosophila, pero al estudiar otras mutaciones
(especialmente el color amarillo del cuerpo y el color blanco de los ojos) observ que nunca se detectaba
recombinacin con otros loci localizados en el mismo cromosoma, y llam ligamiento a ese fenmeno.
Alfred Sturtevant, un estudiante de Morgan, demostr que la probabilidad de que haya una recombinacin
entre dos loci depende de la distancia fsica que los separa, y por tanto la frecuencia con que aparecen
recombinantes puede utilizarse para deducir la distancia que separa dos genes que estn en el mismo
cromosoma; Sturtevant construy en una noche el primer mapa gentico de ligamiento, en el que se
representaba el orden y la distancia de cinco genes localizados en el cromosoma X de Drosophila. Poco
despus, Calvin Bridges detect los primeros casos de ligamiento entre genes localizados en autosomas, y
poco a poco se fueron describiendo distintos grupos de ligamiento. El concepto de ligamiento gentico,
por tanto, va intrnsecamente unido al de distancia fsica entre genes, que es la que origina distintas
proporciones de individuos recombinantes en la descendencia.

Cuando ambos loci estn suficientemente alejados (aunque estn en el mismo cromosoma) existe una
probabilidad tan alta de que haya un sobrecruzamiento entre ellos que segregarn de manera similar a una
segregacin independiente, produciendo gametos recombinantes en la mitad de la descendencia (50% de
gametos recombinantes y 50% de gametos no-recombinantes). En este sentido, es importante
recordar que el sobrecruzamiento tiene lugar entre dos cromtides, cada una perteneciente a un
cromosoma homlogo; las otras dos cromtides no se recombinan, de ah que un sobrecruzamiento da lugar
a cuatro gametos de los cuales dos son recombinantes y los otros dos son idnticos a los cromosomas
originales. Sin embargo, a medida que dos loci sintnicos se sitan ms cerca uno del otro, la probabilidad
114 GENTICA HUMANA
de que haya un sobrecruzamiento entre ellos es cada vez menor, y por tanto la probabilidad de
formacin de gametos recombinantes tambin va decreciendo. Puede llegarse a un punto en que los
loci estn tan juntos que nunca se d un sobrecruzamiento entre ellos, de modo que no se originarn
gametos recombinantes y no se encontrarn individuos recombinantes en la descendencia. Por tanto, la
cuantificacin del nmero de eventos de recombinacin entre dos loci nos permite estimar la distancia
gentica entre ellos: a mayor proximidad, menor probabilidad de recombinacin y por tanto el porcentaje de
individuos recombinantes ser menor.

La Figura 11.1 ilustra por qu la probabilidad de recombinacin entre dos loci
es funcin de su distancia fsica.

En Gentica Humana, la cuantificacin de la frecuencia de recombinacin se hace estudiando la segregacin
de dos secuencias de ADN en los individuos de una familia, e identificando aquellos individuos cuyo genotipo
slo pueda explicarse por una recombinacin en la meiosis de uno de los progenitores. Las secuencias que
se utilizan en estudios de ligamiento se denominan marcadores genticos, que son secuencias que se
encuentran en distintas formas (distintos alelos) en la poblacin general, ya que para detectar si ha habido
recombinacin debemos ser capaces de distinguir los distintos alelos. Adems, los estudios de ligamiento
entre marcadores sirven para establecer mapas de ligamiento en los que estos marcadores estn en un
orden determinado, separados por distancias precisas. Por tanto, los marcadores utilizados en estudios de
ligamiento son polimorfismos genticos, es decir, secuencias que se encuentran en la poblacin en varias
formas posibles. Diferentes individuos de la poblacin pueden tener, por tanto, distintos genotipos
(distintas combinaciones de alelos) para un marcador concreto. Los principales tipos de polimorfismos
genticos que se utilizan como marcadores en estudios de ligamiento han sido explicados con detalle al
hablar del genoma humano en el Captulo 4.

Para realizar mapas de ligamiento entre marcadores, es necesario ante todo genotipar cada uno de los
marcadores en todos los miembros de una varias familias. Al analizar los genotipos de cada individuo y la
segregacin de los diferentes alelos, se pueden identificar los individuos recombinantes, aquellos cuyo
genotipo slo puede explicarse por una recombinacin en uno de sus progenitores. La cantidad de
individuos recombinantes en la descendencia nos permite calcular la fraccin de recombinacin
(representada por la letra griega u), que se define como el nmero de individuos recombinantes dividido por
el nmero total de individuos en la descendencia. Adems de estudiar la distancia entre marcadores, en los
estudios de ligamiento que se realizan en Gentica Humana es frecuente buscar cul es la distancia entre un
marcador y el locus responsable de una enfermedad gentica. En estos casos, el anlisis de ligamiento nos
permitir calcular la distancia entre el marcador y el gen responsable de una enfermedad.
Utilizando esta metodologa se han identificado los genes responsables de muchas enfermedades genticas,
mediante una estrategia denominada clonaje posicional: al conocer la distancia que separa el locus
responsable de una enfermedad de varios marcadores genticos concretos, se simplifica enormemente la
tarea de identificar el gen causal.

La Figura 11.2 muestra el modo de calcular la fraccin de recombinacin
entre el locus responsable de una enfermedad autonmica dominante y un
marcador gentico.



CAPTULO 11: LIGAMIENTO GENTICO EN HUMANOS 115



La fraccin de recombinacin, calculada tal y como se ha explicado en la Figura anterior, nos permite
estimar la distancia gentica entre dos loci, distancia que se mide en centimorgans (cM): cuando entre
dos loci se detecta una fraccin de recombinacin u = 0,01 (1% de individuos recombinantes), se dice que
ambos loci estn a una distancia gentica de 1 cM. Esta distancia gentica (1 cM) equivale
aproximadamente a 1 Mb (megabase) de distancia fsica, aunque esta equivalencia vara a lo largo del
genoma y hay funciones matemticas ms exactas para convertir la distancia gentica en distancia fsica.
En cualquier caso, es importante comprender que la fraccin de recombinacin nunca podr ser mayor a
0,5 (50%), ya que ste es precisamente el porcentaje de individuos recombinantes que se producen en
ausencia de ligamiento (cuando siempre hay una recombinacin, como se ha explicado ms arriba) o en el
caso de que ambos loci estn situados en cromosomas distintos.


Informatividad de los marcadores utilizados en estudios de ligamiento

Como acabamos de explicar, para poder realizar estudios de ligamiento es necesario identificar los
individuos recombinantes para determinar la fraccin de recombinacin. Por desgracia, en ocasiones es
imposible establecer si un individuo de la descendencia es recombinante o no, bien porque el individuo que
transmite la enfermedad es homocigoto para el marcador analizado, o bien porque es heterocigoto idntico
al otro progenitor; estas situaciones dan lugar a lo que denominamos familias no-informativas o semi-
informativas, respectivamente.

La Figura 11.3 muestra algunos ejemplos de falta de informatividad de un
marcador.

Lo posibilidad de perder informatividad subraya la importancia de usar marcadores para los que todos los
rboles analizados sean informativos, lo cual depender directamente de la informatividad de los
marcadores utilizados. La informatividad de un marcador refleja la probabilidad de encontrar individuos
heterocigotos para ese marcador en la poblacin general, y es funcin del nmero de alelos posibles para
el marcador y de las frecuencias relativas de cada alelo en la poblacin. Teniendo en cuenta las
1-2 3-4
2-4 1-2
1-4 1-4 2-4 2-2 2-4 1-4
u =
1
/
6
= 0,17 = 17%
DISTANCIA GENTICA = 17 cM
1-2 3-4
2-4 1-2
1-4 1-4 2-4 2-2 2-4 1-4
1-2 3-4
2-4 1-2
1-4 1-4 2-4 2-2 2-4 1-4
u =
1
/
6
= 0,17 = 17%
DISTANCIA GENTICA = 17 cM
116 GENTICA HUMANA
caractersticas de cada tipo de marcador, es posible calcular dos parmetros que definen la informatividad
de un marcador gentico: el ndice de heterocigosidad y el PIC (contenido de informacin de un
polimorfismo, Polymorphism Information Content en ingls). Estos parmetros se calculan mediante la
siguiente frmula:



- El primer miembro (1 - E p
i

2
) es la heterocigosidad, es decir, el porcentaje de individuos de la
poblacin general que son heterocigotos para ese marcador. Ya hemos visto que si el individuo que
transmite la enfermedad es homocigoto para un marcador, esa familia no ser informativa para ese
marcador, de ah que la heterocigosidad sea una medida de la informatividad de un marcador gentico.
Como p
i
2
es la frecuencia de homocigotos para cada alelo del marcador, el sumatorio de todos los
posibles homocigotos se le resta a 1 y se obtiene as el porcentaje de heterocigotos. Como criterio
general, se puede decir que la heterocigosidad de un marcador aumenta: (a) con el nmero de alelos
que ese marcador presenta en la poblacin general; y (b) cuanto ms parecidas son las frecuencias de
los distintos alelos de ese marcador.

- El segundo miembro de la ecuacin le resta a la heterocigosidad la probabilidad de que una familia no
sea informativa debido a que ambos padres son heterocigotos idnticos (en cuyo caso, como hemos
visto antes, la mitad de la descendencia ser informativa (homocigotos) y la mitad ser no-informativa
(los heterocigotos). Como es sabido, para dos alelos i y j con frecuencias allicas p
i
y p
j
la frecuencia de
heterocigotos es 2p
i
p
j
. Por tanto, la probabilidad de que dos individuos sean heterocigotos idnticos es
2p
i
p
j
x 2p
i
p
j
= 4(p
i
2
p
j
2
)
, pero como slo se pierde informatividad en la mitad de la descendencia, en
la ecuacin se resta slo 2(p
i
2
p
j
2
)
.

Algunos ejemplos del clculo del PIC ilustrarn la informatividad de los distintos tipos de marcadores
genticos. Por ejemplo, un marcador biallico (el caso tpico sera un RFLP) con frecuencias allicas iguales
(p
1
=p
2
=0,5) tendra:

Heterocigosidad = [1 (p
1
2
+p
2
2
)] = [1 (0.5
2
+ 0.5
2
)] = 1 0.5 = 0.5
PIC = 1 (p
1
2
+p
2
2
) 2(p
1
2
x p
2
2
) = 1 (0.5
2
+ 0.5
2
) 2(0.5
2
x 0.5
2
) = 0.375

En cambio, un marcador con cuatro alelos (alelos 1, 2, 3 y 4) en el que cada alelo tiene una frecuencia p
= 0,25, presentar en principio 6 posibles combinaciones de heterocigotos, con genotipos (1-2), (1-3), (1-
4), (2-3), (2-4) y (3-4). Por tanto, para calcular todos los posibles casos de heterocigotos idnticos en la
poblacin, habr que sumar [2(p
1
2
p
2
2
)] + [2(p
1
2
p
3
2
)] + [2(p
1
2
p
4
2
)] + [2(p
2
2
p
3
2
)] + hasta
completar las seis posibles combinaciones de heterocigotos. Aplicando la frmula general:

Heterocigosidad = [1 (0,25
2
+ 0,25
2
+ 0,25
2
+ 0,25
2
)] = 0,75
PIC= 1 (0,25
2
+ 0,25
2
+ 0,25
2
+ 0,25
2
) 6 [2(0,25
2
x 0,25
2
)] = 0,703
n n-1 n
PIC = 1 - E p
i
2

- E E 2p
i
2

p
j
2
i=1 i=1 j=i+1
heterocigosidad % heterocigotos idnticos
CAPTULO 11: LIGAMIENTO GENTICO EN HUMANOS 117

Como se ve, el hecho de que un marcador tenga 4 posibles alelos en vez de 2 aumenta su informatividad
casi al doble. De hecho, un marcador con 10 alelos arrojara, aplicando la frmula anterior, un PIC de 0,891
si las frecuencias allicas son iguales. Por tanto, de los distintos marcadores que se han mencionado ms
arriba, los ms informativos son los de tipo microsatlite, seguidos por SNP y RFLP. De todas formas,
como ya se ha comentado, la posibilidad de estudiar a la vez miles de SNPs de forma automatizada (algo
que no es posible con los microsatlites), junto con su alta densidad a lo largo del genoma, hace que los
SNP sean hoy en da los marcadores de mayor utilidad en la construccin de mapas de ligamiento gentico
de todo el genoma.

Sea cual sea el tipo de marcador utilizado, los estudios de ligamiento requieren genotipar a todos los
miembros de una familia para detectar la presencia de individuos recombinantes y as poder calcular la
fraccin de recombinacin. En el ejemplo de la familia con una enfermedad autosmica dominante
presentado en la Figura 11.2, hemos podido establecer que el individuo transmisor de la enfermedad
transmita a la vez el alelo 2 del marcador, ya que ambos se localizan a poca distancia en el mismo
cromosoma. Sabemos esto porque este individuo, a su vez, hered la enfermedad de su padre, que tambin
le transmiti el alelo 2 del marcador. Cuando en un individuo que transmite una enfermedad podemos
determinar inequvocamente el origen parental tanto del alelo que causa la enfermedad como de los alelos
del marcador es decir, podemos determinar qu alelos de cada uno de los dos loci van en el mismo
cromosoma se dice que conocemos la fase de ligamiento de ese individuo. Precisamente es el hecho de
conocer la fase de ligamiento en el individuo transmisor lo que hace que todas las meiosis de este individuo
sean informativas, y nos permite determinar con certeza si los individuos de la descendencia son
recombinantes o no. Se recordar que en el caso concreto de esta familia haba un individuo recombinante
de un total de 6, lo que sugiere que ambos loci (el marcador y el gen de la enfermedad) estn en ligamiento
a una distancia que produce 1 recombinante de cada 6 individuos (fraccin de recombinacin u=1/6=0,17,
es decir a una distancia gentica de 17 cM). El principal problema es que este resultado podra haberse
dado por azar: tericamente es posible que no haya ligamiento y que una descendencia ms numerosa
nos mostrase una fraccin de recombinacin ms cercana al 50% de individuos recombinantes. Frente a
esta "hiptesis nula" (no ligamiento) tenemos una hiptesis alternativa de que existe ligamiento entre
ambos loci, a una distancia tal que origina una u = 0,17. Cmo podemos determinar cul de las dos
hiptesis es la verdadera , al menos, la que mejor explica los datos obtenidos en esta familia?


El clculo del LOD score

Para cuantificar la significacin de cada una de estas hiptesis, los estudios de ligamiento utilizan un mtodo
llamado "Estimacin de la Mxima Verosimilitud" ("verosimilitud" es la traduccin del trmino ingls
likelihood). Este mtodo consiste en estimar la verosimilitud de cada hiptesis, calculando la probabilidad de
encontrarnos con esa fraccin de recombinacin cuando se verifica esa hiptesis. Por ejemplo, para estimar
la verosimilitud de la hiptesis de ligamiento, calculamos la probabilidad de obtener 1 recombinante de cada
6 individuos en el caso de que exista ligamiento a una distancia de 17 cM; para estimar la verosimilitud de
la hiptesis nula, calculamos la probabilidad de obtener 1 recombinante de cada 6 individuos en el caso de
que no exista ligamiento, y as sucesivamente. El razonamiento matemtico para estimar estas
probabilidades se puede ilustrar con un ejemplo del lanzamiento de monedas.

La Figura 11.4 ilustra el modo de estimar la verosimilitud de una hiptesis.

118 GENTICA HUMANA
Aplicando esta forma de proceder al rbol que hemos venido estudiando, recordamos que hay 5 individuos
no-recombinantes y 1 recombinante, luego formulamos la hiptesis H1 de que la distancia entre el locus de
la enfermedad y el locus del marcador es tal que producen una frecuencia de recombinacin u=1/6. Por
tanto, bajo esta hiptesis, la probabilidad de encontrar un individuo recombinante es P(R)=1/6, y la
probabilidad de encontrar un no-recombinante es P(NR)=5/6. La verosimilitud de que esta hiptesis (H1,
u=1/6) explique nuestros datos experimentales (5 no-recombinantes y 1 recombinante) se calcula aplicando
la frmula general:




Por el contrario, la verosimilitud de la hiptesis nula para explicar nuestros datos sera:




Para calcular cuntas veces ms verosmil es nuestra hiptesis que la hiptesis nula, hallamos el cociente de
verosimilitudes (likelihood ratio). En gentica humana, para que este cociente sea significativo al 95% se
requiere que sea mayor o igual a 1000. Es fcil darse cuenta que uno de los principales problemas que
nos encontramos es el tamao pequeo de las generaciones, al contrario de los estudios de ligamiento que
se hacen en otras especies. Una forma de solventar este problema es repetir el anlisis en varias familias
distintas, y combinar los resultados obtenidos en cada una de ellas con el fin de aumentar la potencia
estadstica de los estudios de ligamiento. Para poder combinar resultados de familias distintas, Newton
Morton ide el concepto del Lod score (que podra traducirse como "puntuacin lod" y se representa por la
letra Z), que es el log
10
del cociente de verosimilitudes. Por tanto, un cociente de verosimilitudes = 1000
equivale a un lod score igual a 3 (Z=3), y ste es precisamente el valor mnimo de Z que se requiere
para poder afirmar que existe ligamiento significativo entre dos loci.

Para hallar el lod score mximo de todos los posibles, es habitual utilizar programas de ordenador que
calculan directamente el lod score que se obtiene para varias hiptesis de ligamiento y a distintos valores de
u. Adems, como los resultados de una sola familia raras veces sern significativos, necesitamos combinar
los resultados obtenidos a partir de los datos de varias familias. Para ello, se suman los lod scores (Z)
obtenidos para cada u en las distintas familias que estamos analizando, hasta identificar la fraccin de
recombinacin u a la que obtenemos el lod score mximo en el conjunto de las familias analizadas.
ste es el valor que finalmente nos permitir afirmar si existe o no ligamiento significativo entre el gen de la
enfermedad y este marcador. Adems, como la Z mxima se obtiene a una fraccin de recombinacin
concreta, podemos tambin estimar la distancia gentica ms probable entre ambos loci, expresada como
siempre en centimorgans. Por ejemplo, si la Z mxima se obtuvo a una u = 0,16, la distancia gentica
entre ambos loci estar en torno de 16 cM, con un intervalo de confianza cuyo clculo es tambin sencillo.

La Figura 11.5 incluye un video y varios grficos que explican el modo de
calcular el LOD store.

Un problema muy importante en los estudios de ligamiento es que muchas veces no podemos deducir la
fase de ligamiento en el progenitor que transmite la enfermedad, al no poder establecer con exactitud si
un alelo concreto del marcador est en el mismo cromosoma que lleva el alelo mutado o si est en el
L (H
1
) = u
R
x (1- u)
NR

L (H
0
) = u
(R + NR)

CAPTULO 11: LIGAMIENTO GENTICO EN HUMANOS 119
cromosoma homlogo. Lgicamente, esto impide establecer si un individuo de la descendencia es
recombinante o no, y por tanto complica mucho el clculo de la fraccin de recombinacin. De hecho, hay
dos posibles fases de ligamiento que tienen la misma probabilidad, y esto ha de tenerse en cuenta a la hora
de estimar la verosimilitud de cada hiptesis. As, se calcula el cociente de verosimilitudes para cada una de
las fases de ligamiento alternativas y se halla el lod score promedio de ambas:


Lgicamente, el desconocimiento de la fase de ligamiento en el individuo que transmite la enfermedad hace
que el valor final del lod score sea ms bajo, por lo que si los loci estudiados estn realmente en
ligamiento ser necesario estudiar un mayor nmero de familias para poder alcanzar el valor umbral de
Z=3.

Es muy til representar los valores que adopta el lod score Z en funcin de los distintos valores de la
fraccin de recombinacin u. Cuando se hace esto, podemos observar varios tipos posibles de curva:

- Si no se ha encontrado ningn individuo recombinante en ninguna de las familias estudiadas,
esto quiere decir que los dos loci que estamos estudiando (el locus de la enfermedad y el del
marcador) estn en ligamiento y tan cercanos entre s que no se producen sobrecruzamientos
entre ellos. El lod score es mximo a u = 0, para ir bajando hasta Z=0 para una u = 0,5.

- Cuando existe ligamiento, lo ms habitual es hallar una curva de forma parablica, con un
pico mximo de lod score a una determinada fraccin de recombinacin. En estos casos el lod
score a la fraccin de recombinacin u = 0 debe ser ( ), ya que hemos encontrado
individuos recombinantes en alguna de las familias y esto hace imposible la hiptesis de que la
fraccin de recombinacin sea cero. El intervalo de confianza de la fraccin de recombinacin
mxima se calcula trazando una horizontal una unidad de lod score por debajo de la Z
mxima, y viendo dnde corta ambas ramas de la curva. Como siempre, el lod score Z se
hace 0 para una fraccin de recombinacin u =0.5, pues en este caso el cociente de
verosimilitudes L(H
1
)/L(H
0
) = 1, y el log10 de 1 es igual a 0.

- En ocasiones, la curva alcanza valores de Z inferiores a 2. En estas circunstancias podemos
afirmar que NO existe ligamiento por debajo de una determinada fraccin de recombinacin u y
por tanto ambos loci necesariamente estn a una distancia gentica superior a la indicada por
esa fraccin de recombinacin (si es que efectivamente estn en ligamiento).

- Finalmente, hay ocasiones en que no encontramos ligamiento significativo, pero tampoco
podemos excluirlo para ninguna de las u estudiadas, puesto que no hay ningn valor de lod
score que sea superior a +3 o inferior a 2. En estos casos no podemos extraer ninguna
informacin til de los datos obtenidos de estas familias.


Ligamiento no paramtrico y su utilizacin en gentica humana

Como acabamos de ver, uno de los requisitos para poder hacer estudios de ligamiento mediante el clculo
de lod score es conocer el tipo de herencia de la enfermedad que estamos estudiando, ya que sin esta
Z (u) = log
10
[1/2 [u
R
(1- u)
NR
/ 0.5
(R+NR)
] + 1/2 [u
NR
(1- u)
R
/ 0.5
(R+NR)
]]

120 GENTICA HUMANA
informacin es imposible detectar la presencia de individuos recombinantes. De hecho, los programas de
ordenador que realizan los clculos para el anlisis de ligamiento exigen que se introduzcan varios
parmetros indicando el tipo de herencia (autosmica dominante, recesiva, etc). Por desgracia, la mayora
de las enfermedades complejas (aquellas que estn determinadas por varios genes y por factores
ambientales) no siguen un patrn hereditario mendeliano tpico, por lo que los estudios de ligamiento
clsicos que se han estudiado hasta ahora no se pueden aplicar. En estos casos hay que acudir a mtodos
de ligamiento que no requieren ajuste de la muestra a un modelo concreto de herencia, llamados por tanto
mtodos no-paramtricos o independientes de modelo. Hay bsicamente dos tipos de pruebas, las que
detectan ligamiento y las que detectan asociacin allica. Es muy importante darse cuenta de la
diferencia entre ambos conceptos: el ligamiento es un fenmeno que afecta a loci se dice, por ejemplo,
que dos loci estn en ligamiento a una distancia determinada pero el alelo del marcador que "viaja" en el
con el alelo de la enfermedad puede ser diferente en familias distintas. Poro ejemplo, en una familia
concreta podemos detectar ligamiento porque la enfermedad siempre segrega junto con al alelo A1 de un
marcador, pero en otra familia distinta (con la misma enfermedad) el alelo mutado puede viajar con el alelo
A5 de ese mismo marcador. Ambos loci (el marcador y el gen de la enfermedad) estn en ligamiento pero
en cambio no siempre se dan las mismas asociaciones de alelos en todas las familias. Esto es as porque
existe una situacin de equilibrio de Hardy-Weinberg entre ambos loci, de manera que cada alelo de uno de
los locus puede encontrarse con cualquiera de los alelos del otro locus. Los mtodos de anlisis de
ligamiento no paramtricos que detectan asociacin allica buscarn precisamente desviaciones de esta
situacin de equilibrio, detectando la presencia de un haplotipo (una determinada combinacin de alelos
para dos loci distintos, en nuestro caso seran el alelo mutado y un alelo concreto del marcador) que se
encuentre con mayor frecuencia de la que cabra esperar si esos loci estuviesen en equilibrio. Si
demostramos que, incluso en familias distintas, la enfermedad se asocia significativamente con un alelo
concreto del marcador, podemos decir que existe asociacin allica; como la principal causa de asociacin
allica es el desequilibrio de ligamiento por cercana fsica de ambos loci (estn tan cercanos uno al otro
que no se ha alcanzado todava el equilibrio de Hardy-Weinberg entre ellos), la asociacin allica se traduce
en cercana fsica. Por tanto, podemos servirnos de la asociacin allica para localizar genes responsables de
enfermedades complejas, si detectamos ligamiento con algn marcador conocido. A continuacin se explica
brevemente cmo funciona cada uno de estos mtodos:

1. Los mtodos que detectan ligamiento buscan alelos compartidos por todos los individuos que estn
enfermos en una misma familia. Para comprender cmo se hace esto, es importante aprender a
distinguir los alelos que son idnticos por descendencia (situacin que se denomina IBD: identical by
descent) de los alelos que son idnticos por estado (IBS: identical by state).

En la Figura 11.6 se intenta mostrar el concepto de alelos IBD y alelos IBS.


3-4 1-2
1-3 1-3
3-4 1-2
1-3 1-3
1-4
2-3
2-4
3-4 1-2
1-3 1-3
1-4
2 IBD
1 IBD
0 IBD
2 IBD
1 IBD
2 IBD
3-4 1-2
1-3 1-3
3-4 1-2
1-3 1-3
3-4 1-2
1-3 1-3
1-4
2-3
2-4
3-4 1-2
1-3 1-3
1-4
3-4 1-2
1-3 1-3
1-4
2 IBD
1 IBD
0 IBD
2 IBD
1 IBD
2 IBD
CAPTULO 11: LIGAMIENTO GENTICO EN HUMANOS 121

Los estudios de alelos idnticos por descendencia entre individuos enfermos de una misma familia se basan
en el hecho de que los hermanos que padecen una misma enfermedad tienen mayor probabilidad de
compartir el segmento genmico que contiene el gen causante de esa enfermedad. En ese segmento
tambin habr, en la vecindad del gen, algunos marcadores (polimorfismos), y por tanto esas parejas de
hermanos tambin sern idnticos por descendencia para los alelos de esos marcadores. En
general, se puede demostrar que dos hermanos tienen una probabilidad del 25% de tener 2 alelos
cualesquiera idnticos por descendencia (probabilidad de 1/4), una probabilidad del 50% de compartir 1
alelo IBD (2 de 4 posibilidades) y una probabilidad del 25% de no compartir ningn alelo IBD. En cambio, si
ambos hermanos han heredado la enfermedad, compartirn el segmento genmico que contiene el gen
causal, incluidos los marcadores cercanos, por lo que encontraremos alelos IBD de esos marcadores en una
frecuencia superior a la esperable por el azar. Por ejemplo, en una enfermedad autosmica dominante el
50% de los hermanos enfermos compartirn en promedio 2 alelos IBD, y el 50% restante compartirn un
alelo IBD; en el caso extremo de una enfermedad autosmica recesiva, todos los hermanos afectados
compartirn como promedio 2 alelos IBD.

Por tanto, para realizar estas pruebas es preciso analizar miles de marcadores dispersos por todo el genoma
en un nmero bastante grande de parejas de hermanos enfermos, y as detectaremos una frecuencia de
alelos IBD significativamente superior a lo que sera esperable por el azar para aquellos marcadores
cercanos al gen de la enfermedad. Por esta razn, este mtodo se denomina frecuentemente ASP
(affected sib-pair, parejas de hermanos afectados), porque busca regiones que sean idnticas por
descendencia en parejas de hermanos afectados por la misma enfermedad. Como a veces no es fcil contar
con el nmero suficiente de parejas de hermanos enfermos, otra variante de este mtodo estudia miembros
ms distantes de una misma familia, conocido como APM (affected pedigree member, miembro afectado
del rbol familiar). Como se ha mencionado, para poder detectar ligamiento utilizando estos mtodos es
necesario genotipar un nmero elevado de marcadores distribuidos por todo el genoma y detectar aquellos
cuyos alelos son compartidos por parientes enfermos en proporciones significativamente mayores a lo
esperable por azar. Estos anlisis se realizan utilizando programas de ordenador, tales como SIBPAL
GENEHUNTER. Adems, Haseman y Elston desarrollaron un algoritmo para aplicar esto mismo a variables
cuantitativas (cualquier variable cuantificable numricamente), haciendo una grfica que representa la
diferencia entre hermanos para esa variable elevada al cuadrado (en ordenadas), frente al porcentaje de
alelos IBD compartidos por hermanos (en abscisas). Si la pendiente de la recta de ajuste es
significativamente negativa, esto indica que hay ligamiento, ya que en ausencia de ligamiento los valores
deben distribuirse alrededor de una lnea vertical centrada en torno al 50% de alelos IBD.

2. Deteccin de asociacin allica. Cuando no se dispone de parejas de hermanos para estudios que
buscan alelos idnticos por descendencia, se pueden hacer estudios de asociacin allica para detectar un
marcador muy cercano al gen que causa una enfermedad. Aunque los estudios de asociacin allica pueden
emplearse tambin en cualquier situacin, resultan especialmente tiles en poblaciones aisladas sometidas
a cierto efecto fundador, en las que todava no han pasado el nmero suficiente de generaciones para que
todos los alelos presentes en la poblacin hayan llegado a una equilibrio de Hardy-Weinberg. Por ejemplo, la
identificacin del gen que est mutado en una enfermedad llamada Hemocromatosis Hereditaria se
identific gracias a que la mutacin especfica se origin en una regin geogrfica concreta, y hoy en da se
encuentra especialmente en poblaciones de origen celta.

El tipo de familia que se necesita para los estudios de asociacin es muy sencillo: ambos padres y un solo
descendiente enfermo. El clculo puede hacerse mediante dos pruebas: TDT (Transmission-Disequilibrium
Test, prueba de transmisin del desequilibrio) HRR (Haplotype Relative Risk, riesgo relativo de un
122 GENTICA HUMANA
haplotipo), aunque el ms popular y ms usado es el mtodo del TDT. Para realizar este test, se analiza un
mismo marcador en varias familias distintas, escogiendo un marcador para el que los progenitores sean
heterocigotos; a continuacin se compara la frecuencia con la que se transmite cada alelo de los padres al
hijo afectado. Al hacer esto en varias familias, podemos detectar si hay algn alelo concreto del marcador
que se transmita preferencialmente a los hijos afectados sobre lo que sera esperable por el azar. Por
ejemplo, si a es el nmero de veces que un progenitor transmite el alelo A1 de un marcador, y b es el
nmero de veces que transmite un alelo distinto a A1, se puede demostrar que el estadstico (a-
b)
2
/(a+b) sigue una distribucin chi-cuadrado con un grado de libertad. Si la frecuencia de transmisin de
este alelo a hijos enfermos es significativamente ms alta de lo esperable por azar, podemos concluir que
existe asociacin allica y que, por tanto, el gen de la enfermedad est muy cercano a este marcador.
Lgicamente, como a priori no sabemos dnde est localizado el gen, hay que hacer el anlisis utilizando
miles de marcadores distribuidos por todo el genoma, hasta dar con uno que muestre asociacin con la
enfermedad.

La Figura 11.7 ilustra el Test de Transmisin de Desequilibrio (TDT) como
medida de asociacin allica.

Como resumen, a la hora de escoger un mtodo para la deteccin de genes responsables de enfermedades
complejas hemos de tener en cuenta el tipo de familias de que disponemos, as como factores de tipo
material y econmico (derivados del altsimo nmero de genotipajes que es necesario realizar). Aunque los
tests de ASP requieren menos genotipajes, la regin genmica compartida que detectan es bastante grande,
por lo que la identificacin posterior del gen que causa la enfermedad sera ms laboriosa. Por eso, lo ideal
es complementar un estudio de ASP con estudios de asociacin allica, que requieren el genotipaje
de muchos ms individuos, pero revelan regiones genmicas habitualmente menores a 1 Megabase.
Aunque los estudios que utilizan ligamiento no-paramtrico o asociacin allica suelen dar resultados cuya
significacin es difcil de cuantificar, y a menudo los resultados obtenidos en estudios distintos no
concuerdan entre s, son los nicos mtodos vlidos para localizar genes implicados en el desarrollo de
enfermedades complejas (polignicas y multifactoriales). Precisamente son estas enfermedades las que
tienen mayor repercusin socio-sanitaria, por afectar a gran parte de la poblacin.

Las nuevas tecnologas de genotipaje que utilizan marcadores tipo SNP (Single Nucleotide Polymorphisms,
ya vistos anteriormente) han acelerado enormemente la identificacin de genes que confieren
susceptibilidad a enfermedades comunes. Por ejemplo, en los ltimos aos se ha demostrado asociacin
entre el gen CAPN10 y la susceptibilidad a desarrollar diabetes tipo 2, as como tambin entre un
polimorfismo en el gen de la interleuquina 12 y la diabetes tipo 1. Es previsible que en los prximos aos se
identifiquen las principales variantes que confieren susceptibilidad a las enfermedades ms frecuentes. Por
ejemplo, podemos pensar que en un futuro no muy lejano un paciente hipertenso que acuda a la consulta
gentica ser estudiado para detectar variantes de susceptibilidad en varios genes, y gracias a los
resultados se le clasificar dentro de un grupo molecular determinado que permitir asignarle un
tratamiento diettico o farmacolgico especfico. Desde este punto de vista, el genotipaje de polimorfismos
concretos puede convertirse en un anlisis de rutina en el diagnstico de un nmero creciente de
enfermedades humanas en el prximo decenio. En este sentido, es importante detectar los SNP que pueden
ser ms informativos en estos estudios: se estima que en toda la poblacin mundial se encuentran unos 10
millones de SNPs en los que ambas variantes allicas tienen una frecuencia mayor o igual a 1%. A pesar del
indudable inters que tienen estos polimorfismos para realizar estudios de asociacin allica, genotipar
todos estos SNPs en un nmero grande de individuos es, hoy por hoy, impracticable. Podemos salvar este
obstculo gracias a que muchos SNP, por estar muy cerca fsicamente, se heredan juntos en pequeos
CAPTULO 11: LIGAMIENTO GENTICO EN HUMANOS 123
bloques en los que todava no se ha alcanzado el equilibrio de Hardy-Weinberg. Es decir, se pueden
identificar bloques de desequilibrio de ligamiento en el genoma, puesto que los alelos de los SNP que
estn en un mismo bloque estn en desequilibrio de ligamiento. La combinacin concreta de alelos de los
distintos SNP que estn en un mismo bloque constituye un haplotipo caracterstico de ese bloque. Por
tanto, un grupo reducido de SNPs de cada haplotipo pueden ser representativos de todo ese haplotipo (por
lo que reciben el nombre de tag-SNPs, o SNP-etiqueta); de este modo, no es necesario genotipar todos los
SNPs del genoma, sino slo los SNP-etiqueta. De hecho, se estima que bastara con analizar unos 200.000
para cubrir todos los haplotipos del genoma humano, y esa es una cifra que se puede estudiar con la
metodologa actual. Recientemente se ha publicado un mapa de 1,6 millones de SNPs que han sido
genotipados en 71 individuos estadounidenses de ascendencia europea, asitica y africana. Este mapa fue
completado por el Proyecto Internacional Hapmap, que public en 2005 un mapa con todos los
haplotipos de SNPs presentes en diversas poblaciones humanas, como se ha explicado en el captulo 4. Este
mapa permite identificar la estructura y el tamao de los bloques de desequilibrio de ligamiento del
genoma, y adems har posible la realizacin de estudios de asociacin para identificar las regiones donde
residen los genes que confieren susceptibilidad a enfermedades comunes.
124 GENTICA HUMANA
CAPTULO 12: LOS GENES EN LAS POBLACIONES 125
Captulo 12. Los genes en las poblaciones.
El equilibrio de Hardy-Weinberg. Cambios en las condiciones que mantienen
el equilibrio. Aplicaciones en Gentica Humana. Formacin de la Teora
Sinttica de la Evolucin. Explicacin actual del proceso evolutivo y sus
limitaciones.


La evolucin biolgica es el resultado de los cambios en los tipos y frecuencias de los alelos existentes en
una poblacin de individuos, siempre y cuando dichos cambios son transmitidos a la generacin siguiente.
En otras palabras, la evolucin es el cambio en la constitucin gentica de una poblacin a lo largo
del tiempo. Es importante comprender que: i) el hecho de que los cambios sean heredables quiere decir
que la base molecular de la evolucin est en los genes; ii) la evolucin no afecta a individuos, sino a
poblaciones.


El equilibrio de Hardy-Weinberg

La elaboracin del concepto actual de evolucin se remonta a los orgenes de la gentica de poblaciones,
que describe la estructura gentica de una poblacin de individuos y predice sus cambios en el tiempo. G.H.
Hardy y W. Weinberg demostraron en 1908 que en una poblacin sometida a unas condiciones
determinadas se observa que: i) las frecuencias de los alelos se mantienen estables durante sucesivas
generaciones, y ii) las frecuencias genotpicas tambin se mantienen constantes, debido a que dependen
exclusivamente de las frecuencias allicas. Estos postulados se conocen como la Ley del equilibrio de
Hardy-Weinberg. Cuando no se dan las condiciones necesarias para se cumplan estos presupuestos,
aparecen alelos nuevos en la poblacin o bien las frecuencias allicas cambian. Esto, a su vez, crea las
condiciones bsicas necesarias para que pueda darse evolucin. Las condiciones que deben cumplirse
para que una poblacin se encuentre en equilibrio gentico, es decir, para que se cumpla la Ley de Hardy-
Weinberg, son:

- Poblacin de tamao grande en la que todos los individuos se reproducen.
- Los cruzamientos entre individuos de la poblacin se producen al azar.
- Ausencia de mutacin.
- Ausencia de seleccin natural.
- Ausencia de flujos migratorios.

Lgicamente, en la prctica es muy improbable encontrar una poblacin en la que se cumplan todas estas
condiciones, por lo que la evolucin es un hecho tan frecuente en la naturaleza.

La gran aportacin metodolgica de Hardy y Weinberg es que permite abordar el estudio de los cambios en
la estructura gentica de una poblacin en trminos matemticos precisos. En primer lugar, dedujeron una
ecuacin que permite predecir las frecuencias genotpicas a partir de las frecuencias allicas, y por tanto
saber si una poblacin se encuentra en equilibrio. Segn la ecuacin del equilibrio de Hardy-Weinberg,

p + 2pq + q = 1

126 GENTICA HUMANA
siendo p y q las frecuencias de los dos alelos A y a de un gen que controla un carcter fenotpico. En estas
circunstancias, en una especie diploide, encontraremos individuos con 3 posibles genotipos: AA, aa y Aa.
Por tanto, es fcil establecer la relacin entre frecuencias allicas y frecuencias genotpicas:

p= AA + Aa
q= aa + Aa

Lgicamente, al haber slo dos alelos se cumple que

p+q=1
p=1-q
q=1-p

De aqu se puede deducir que las frecuencias de los genotipos de los individuos de la poblacin se
distribuyen segn la expansin del binomio:

(p+q)
2
= p + 2pq + q

es decir, p
2
es la frecuencia de individuos con el genotipo AA, q
2
es la frecuencia de individuos con
el genotipo aa, y 2pq es la frecuencia de individuos heterocigotos Aa. Lgicamente, el total es el
100% de los individuos de la poblacin, luego

p + 2pq + q = 1

Llegados a este punto es importante recalcar una serie de conceptos fundamentales. En primer lugar, las
frecuencias allicas son en s mismas estables. Este concepto es muy importante y fue revolucionario
en su momento, porque hasta Hardy y Weinberg se pensaba que los alelos dominantes van desplazando a
los alelos recesivos de la poblacin con el transcurso del tiempo, hasta eliminarlos por completo. Hardy y
Weinberg demostraron que esto no es as, siempre que se cumplan las condiciones bsicas de equilibrio. De
hecho, no todas las desviaciones del equilibrio producen evolucin, porque muchas veces se alteran
las frecuencias genotpicas sin que cambien las frecuencias allicas. Como veremos a lo largo de este
captulo, cuando no se cumple alguna de las condiciones necesarias para el equilibrio gentico podemos
tener cambios en las frecuencias allicas, en las frecuencias genotpicas, o en ambas.


Cambios en las condiciones que mantienen el equilibrio: cruzamientos no
aleatorios

Hardy y Weinberg demostraron que, en una poblacin que no est sometida a ninguna fuerza evolutiva, las
frecuencias allicas se mantendrn constantes en generaciones sucesivas siempre que los cruzamientos
entre individuos sean aleatorios. Por ejemplo, para un carcter determinado por un gen que tiene dos
alelos A y a, de modo que la mitad de los alelos sean A y la otra mitad sean a (frecuencias allicas de
0,5 para cada alelo), las frecuencias genotpicas sern 0,25 AA, 0,5 Aa y 0,25 aa. Si los individuos de
esta poblacin se reproducen al azar, encontraremos tericamente 9 tipos de cruzamientos, todos en la
misma proporcin:

CAPTULO 12: LOS GENES EN LAS POBLACIONES 127
AA X AA Aa X AA aa X AA
AA X Aa Aa X Aa aa X Aa
AA X aa Aa X aa aa X aa

Si ahora calculamos los genotipos de la descendencia que resulta de cada cruzamiento, asignando 4
descendientes por pareja, tendremos los resultados que se muestran en la siguiente tabla:


Cruzamiento aleatorio
Cruzamientos posibles
genotipos esperados en la descendencia
AA Aa aa
AA X AA 4

AA X Aa 2 2
AA X aa 4
Aa X AA 2 2
Aa X Aa 1 2 1
Aa X aa 2 2
aa X AA

4

aa X Aa 2 2
aa X aa 4
Total
9
( 25% )
18
( 50% )
9
( 25% )


Como se puede comprobar, en la descendencia se mantienen las frecuencias genotpicas que existan en la
generacin anterior: 25% de individuos AA, 50% de individuos Aa y 25% de individuos aa. Si
contamos el nmero de alelos A y a que hay en la nueva poblacin, vemos que tambin las frecuencias
allicas se han mantenido estables (50% de alelos A y 50% de alelos a).

En la naturaleza es bastante frecuente que los cruzamientos no se realicen totalmente al azar. En
muchas especies, los individuos se cruzan preferencialmente con otros que tienen ciertas caractersticas
fenotpicas (y, por tanto, determinados genotipos). Esto rompe las condiciones de equilibrio y cambia las
proporciones genotpicas esperadas. En los procesos de mejora animal y vegetal se utilizan a veces
cruzamientos dirigidos, con el fin de obtener individuos que tengan determinadas caractersticas fenotpicas
(tamao de la flor, cantidad de carne, etc). En humanos tampoco es raro que se den cruzamientos
preferenciales por razones culturales, sociales, tnicas, geogrficas, etc. Se distinguen varios tipos de
cruzamientos preferenciales:

Cruzamiento preferencial positivo: en este caso, los individuos tienden a cruzarse con otros que
comparten sus mismas caractersticas fenotpicas. En el caso ms extremo, slo tendremos
128 GENTICA HUMANA
cruzamientos de individuos genotpicamente iguales, es decir AA X AA, Aa X Aa y aa X aa. Por tanto, habr
un incremento en el porcentaje de homocigotos y una disminucin en la proporcin de heterocigotos:
















Ntese que en una sola generacin las frecuencias genotpicas han variado sustancialmente
apartndose del equilibrio, aunque las frecuencias allicas se mantienen en 50% A y 50% a.

Cruzamiento preferencial negativo: es muy raro en humanos, y se da cuando los individuos se cruzan
preferencialmente con otros que tienen caractersticas fenotpicas distintas a las suyas. Tericamente, se
produciran 6 tipos de cruzamientos, con un aumento en la proporcin de heterocigotos y un descenso en
las proporciones de homocigotos:

Cruzamiento Preferencial Negativo
cruzamientos posibles
genotipos esperados en la descendencia
AA Aa aa
AA X Aa 2 2
AA X aa 4
Aa X AA 2 2
Aa X aa 2 2
aa X AA

4

aa X Aa 2 2
Total
4
( 17% )
16
( 67% )
4
( 17% )


Ntese que, nuevamente, las frecuencias genotpicas se apartan del equilibrio pero las frecuencias
allicas se mantienen constantes (50% A y 50% a).
Cruzamiento Preferencial Positivo
cruzamientos posibles
genotipos esperados en la descendencia
AA Aa aa
AA X AA 4

Aa X Aa 1 2 1
aa X aa 4
Total
5
( 42% )
2
( 17% )
5
( 42% )
CAPTULO 12: LOS GENES EN LAS POBLACIONES 129

Endogamia: la endogamia (o consanguinidad, como se denomina en poblaciones humanas) es el
cruzamiento entre individuos que guardan algn tipo de parentesco, es decir, que comparten un ancestro
comn. Constituye una forma extrema de cruzamiento preferencial positivo, ya que los individuos
comparten una gran proporcin de sus alelos (1/2 en el caso de hermanos, 1/8 en el caso de primos
hermanos, etc.). La endogamia se puede cuantificar mediante el coeficiente de endogamia (F), que mide
la probabilidad de que dos alelos en dos individuos de una poblacin procedan de un ancestro comn (es
decir, sean idnticos por descendencia). El cociente de endogamia F puede variar entre 0 (cruzamiento
aleatorio) y 1 (todos los alelos son idnticos porque proceden del mismo progenitor). Cuando nos
encontramos en una situacin de endogamia, las frecuencias genotpicas van a cambiar de tal forma que la
frecuencia de homocigotos AA = p
2
+Fpq, la frecuencia de heterocigotos Aa = 2pq2Fpq y la
frecuencia de homocigotos aa = q
2
+Fpq. Es decir, con cada generacin de cruces endogmicos, la
frecuencia de heterocigotos disminuye y la de homocigotos aumenta. En el caso de retrocruzamientos con
un progenitor (como suele hacerse para conseguir lneas puras de ratones, por ejemplo), F=0,5 y la
frecuencia de heterocigotos disminuye a la mitad con cada generacin. En general, el cruzamiento
preferencial puede hacer que en pocas generaciones aumente enormemente la proporcin de individuos que
son homocigotos para un genotipo. El problema es que a veces un carcter resulta deletreo y los individuos
homocigotos tienen su viabilidad su fertilidad reducidas, por lo que toda la poblacin se ve afectada. Este
fenmeno se conoce como depresin endogmica. Lgicamente, la endogamia es un fenmeno ms
grave que el apareamiento preferencial, ya que en ste ltimo slo se alteran las frecuencias genotpicas
para uno o varios genes (aquellos que controlan el carcter que condiciona la preferencia del
apareamiento). La endogamia, por el contrario, afecta a todo el genoma y tiene consecuencias ms severas.

Aunque la gente piensa que los hijos de matrimonios consanguneos tienen una alta probabilidad de sufrir
anomalas, esto no es necesariamente as. nicamente cuando en la familia hay algn alelo recesivo
deletreo, habr mayor frecuencia de homocigotos para ese alelo como fruto de la consanguinidad. Un
ejemplo de lo anterior es el de la comunidad Amish de Pennsylvania y Ohio, que llevan varios siglos
viviendo aislados por razones culturales y religiosas. Los matrimonios repetidos entre miembros de la
misma comunidad han provocado una situacin de endogamia en la que han aflorado algunas enfermedades
recesivas que son mucho ms frecuentes en esta poblacin que en la poblacin general. En este sentido,
estudios hechos en nios japoneses han encontrado que cada aumento del 10% de F conlleva una
disminucin de 6 puntos del cociente intelectual; adems, en ese mismo estudio se vi que los hijos de
primos hermanos (en los que F=0,0625) tuvieron una mortalidad 40% superior a la de nios de
matrimonios no endogmicos. De todas formas, estudios hechos en varias poblaciones han determinado que
la descendencia de primos hermanos slo tiene un riesgo de sufrir malformaciones congnitas
aproximadamente 2% superior al que existe en la poblacin general, y de hecho los matrimonios entre
primos hermanos son relativamente frecuentes en ciertas culturas, como en la hind la rabe.

Hemos visto qu sucede cuando no se cumple una de las condiciones necesarias para mantener el equilibrio
de Hardy-Weinberg en una poblacin. Recordemos que la ausencia de cruzamientos aleatorios provoca un
desvo del equilibrio, con cambios marcados en las frecuencias genotpicas pero sin afectar a las frecuencias
allicas. A continuacin estudiaremos otras situaciones que, adems de alterar las frecuencias
genotpicas, tambin producen cambios en las frecuencias allicas en la poblacin.


Cambios en las condiciones que mantienen el equilibrio: efectos del tamao
poblacional
130 GENTICA HUMANA

Con cierta frecuencia se producen cambios aleatorios en el nmero de alelos que pasan de una generacin a
la siguiente, por un efecto de error de muestreo. Dicho error se debe a que en una poblacin no siempre
se reproducen todos los individuos, por lo que en la siguiente generacin slo tendremos un subgrupo de los
alelos que estaban presentes en la generacin anterior, y esto da lugar a oscilaciones aleatorias en las
frecuencias allicas de una generacin a la siguiente. Este fenmeno se conoce como deriva gentica
aleatoria, y es equivalente a sacar bolas de un saco que contiene, por ejemplo, 50 bolas blancas y 50 bolas
negras (100 bolas en total). Si sacamos 40 bolas para formar 20 parejas (lo que sera equivalente a sacar
alelos de una poblacin para generar individuos diploides en la generacin siguiente), lo normal es observar
pequeas desviaciones respecto a la proporcin terica esperada de 20 bolas blancas y 20 bolas negras. De
este modo, con cada generacin (cada vez que sacamos bolas de una bolsa), las frecuencias allicas oscilan
por efecto del azar. Adems, estas oscilaciones sern mayores cuanto menor sea el tamao de la poblacin.
Por ejemplo, si de la bolsa que contiene 100 bolas sacamos slo 10 bolas, no sera de extraar que
obtuvisemos grupos de 10 bolas en los que la mayora fuesen de un mismo color. Incluso, por mero azar,
podramos sacar 10 bolas blancas, en cuyo caso el color blanco se habra fijado en la nueva poblacin ya
que habra desaparecido la posibilidad de sacar bolas negras en sucesivas generaciones. Por tanto, en el
caso de poblaciones con un pequeo nmero de individuos que se reproducen, la deriva gentica aleatoria
puede tener efectos muy marcados sobre las frecuencias allicas, pudiendo incluso hacer que uno de los
alelos sustituya completamente al otro (se dice entonces que un alelo ha quedado fijado y el otro ha sido
"barrido" de la poblacin).

La Figura 12.1 ilustra el error de muestreo y la deriva gentica aleatoria.

La deriva gentica se puede estimar a partir de la variacin allica existente en la poblacin, que se
cuantifica mediante la varianza estadstica. En una poblacin de tamao N con frecuencias allicas p y q,
la varianza de la frecuencia allica (sp
2
) se puede calcular mediante la frmula sp
2
=pq/2N. En otras
palabras, la deriva observada en una poblacin depende de las frecuencias allicas y del tamao
poblacional. Por el numerador, podemos deducir que la deriva ser mayor si las frecuencias allicas son
iguales que si son muy dispares. De la frmula se desprende tambin que la deriva ser ms acusada en
poblaciones de pequeo tamao. La deriva gentica tiene dos efectos principales: origina cambios en las
frecuencias allicas, y puede tambin reducir la variabilidad gentica cuando alguno de los alelos
se fija en la poblacin. Adems, como es un fenmeno aleatorio, encontramos que diferentes poblaciones
pueden derivar de modo distinto, aunque al principio del proceso tengan el mismo tamao y las mismas
frecuencias allicas.

Dos circunstancias afectan especialmente a poblaciones humanas y provocan cambios en las frecuencias
allicas de la poblacin por deriva gentica aleatoria. En primer lugar, algunas poblaciones humanas
actuales han sido fundadas por un pequeo ncleo inicial de pobladores que han dado lugar a la poblacin
actual. Puede suceder que en el grupo inicial de pobladores existiese algn alelo concreto (por ejemplo, una
mutacin que causa una enfermedad gentica) en baja frecuencia. Si todos los individuos se reproducen,
incluyendo los enfermos, el resultado tras muchas generaciones ser que ese alelo (y la enfermedad
causada por l, en nuestro ejemplo) sern muy frecuentes en la poblacin actual. Este fenmeno se conoce
como efecto fundador. Hay muchos ejemplos de enfermedades o rasgos genticos cuya alta frecuencia en
determinadas poblaciones se puede explicar por un efecto fundador. Por ejemplo, la alta frecuencia del
grupo sanguneo 0 entre los indios de Amrica del Sur y Central parece deberse a que todos
proceden de un pequeo nmero de pobladores que entraron por el estrecho de Behring al final de la ltima
glaciacin, entre los que ese grupo sanguneo deba ser predominante. Quizs el caso ms extremo de
efecto fundador es el de la enfermedad de Huntington, un desorden neurolgico que se encuentra con una
CAPTULO 12: LOS GENES EN LAS POBLACIONES 131
frecuencia mucho ms alta de lo normal en una pequea poblacin del lago Maracaibo, en Venezuela.
Parece que la gran mayora de los pobladores actuales de esa regin, unos 20.000, proceden de una misma
mujer que lleg a la zona en el siglo XIX y que sufra la enfermedad. Otro fenmeno similar que perturba las
frecuencias allicas por deriva gentica aleatoria es el efecto de cuello de botella. En este caso, alguna
causa (un desastre natural, epidemias, guerras) lleva a reducir drsticamente el tamao de una poblacin
en una generacin, por lo que las frecuencias allicas de la generacin siguiente sern muy distintas a las
de la generacin anterior. En casos de cuello de botella muy acentuados, puede llegarse a la prdida de
algn alelo, y a menudo los cuellos de botella provocan una reduccin importante en la diversidad gentica
de la poblacin que sobrevive.

Hasta ahora hemos visto situaciones que alteran el equilibrio de Hardy-Weinberg en una poblacin,
produciendo cambios en las frecuencias genotpicas y allicas por diversos mecanismos. De todas formas,
los mecanismos ms importantes para generar evolucin son los que introducen nuevos alelos en una
poblacin (trasladndolos desde otras poblaciones o generando alelos nuevos a partir de los ya existentes) y
la seleccin natural, que elimina o favorece aquellos alelos que permiten la mejor adaptacin de la
especie a su medio. En primer lugar veremos los procesos que crean nuevos alelos en una poblacin
determinada.


Cambios en las condiciones que mantienen el equilibrio: migracin o flujo
gentico

Sin duda, los fenmenos migratorios son actualmente la principal causa de entrada de alelos nuevos en
poblaciones humanas. La llegada de individuos con una constitucin gentica distinta (flujo gentico), en la
medida en que los nuevos individuos se mezclan con la poblacin existente, hace que las frecuencias
allicas de la poblacin receptora cambien que aparezcan nuevos alelos que antes no estaban presentes.
Del mismo modo, la poblacin que sufre la emigracin tambin puede verse sometida a cambios en las
frecuencias allicas, si los individuos que la abandonan no son totalmente representativos del acervo
gentico de la poblacin. Por ejemplo, si m individuos de una poblacin 1 en la que un alelo tiene una
frecuencia q1 migran a otra poblacin 2 en la que ese alelo est en una frecuencia q2, la frecuencia del
alelo en la poblacin que resulta despus de la migracin ser q= q1m + q2(1-m). De esta ecuacin es
fcil deducir que el cambio en la frecuencia allica en la poblacin 2 (la poblacin receptora) es igual a
m(q1q2), lo que quiere decir que los efectos sobre las frecuencias allicas dependern del nmero de
individuos que migran (m) y de la diferencia inicial en las frecuencias allicas entre ambas poblaciones.
Aunque el efecto de la migracin es homogeneizar las diferencias genticas entre poblaciones (al
contrario que la deriva la seleccin natural, como veremos ms adelante), es una causa importante de
entrada de nuevos alelos y de aumento de la variabilidad en una poblacin concreta.


Cambios en las condiciones que mantienen el equilibrio: recombinacin y
mutacin

Los fenmenos moleculares capaces de crear nuevos alelos nuevas combinaciones de alelos ya existentes
son la mutacin y la recombinacin, respectivamente. La recombinacin tiene lugar en las clulas
germinales, durante la meiosis. En el caso de la especie humana, los 23 cromosomas del gameto masculino
se alinean con los del gameto femenino e intercambian segmentos de material gentico. Esto hace que los
132 GENTICA HUMANA
cromosomas resultantes lleven combinaciones de alelos (haplotipos) que no estaban presentes en
ninguno de los progenitores. Aunque no se crean nuevos alelos sino nuevas combinaciones de los ya
existentes, la recombinacin constituye un importantsimo mecanismo de creacin de diversidad gentica.

La mutacin es el cambio introducido en el material gentico a nivel molecular, alterando la secuencia de
nucletidos. Las mutaciones pueden ser puntuales (si afectan nicamente a un nucletido) o pueden alterar
segmentos ms o menos grandes del genoma (alteraciones cromosmicas, por ejemplo). Desde el punto de
vista evolutivo, las nicas mutaciones que interesan son las que afectan a las clulas germinales, pues
son las nicas que se transmitirn a la generacin siguiente. Lgicamente, adems es necesario que la
mutacin se exprese en un fenotipo, es decir, que altere alguna funcin biolgica. Esto no es lo habitual, ya
que la mayora de las mutaciones son silenciosas (no alteran la secuencia de aminocidos de la protena
codificada por el gen) y, por tanto, son "neutras" desde el punto de vista evolutivo. Las mutaciones
deletreas suelen ser eliminadas por seleccin, aunque a veces quedan en el acervo gentico en forma
recesiva y pueden aflorar en generaciones futuras (esto es lo que se conoce como "lastre gentico"). En
definitiva, cuando la mutacin es la nica fuerza evolutiva que acta sobre una poblacin, los cambios en
las frecuencias allicas son muy pequeos y seran necesarias muchas generaciones para producir
variaciones significativas. Aunque la tasa mutacional (el nmero de mutaciones que se introducen por
generacin) vara de una especie a otra y en general es bastante baja, la mutacin es la "materia prima"
sobre la que acta la principal fuerza evolutiva: la seleccin.

Los enlaces de la Figura 12.2 permiten simular el efecto de la migracin y la
mutacin sobre las frecuencias allicas.


Cambios en las condiciones que mantienen el equilibrio: seleccin

La principal intuicin de Charles Darwin, fruto de las observaciones que le llevaron a escribir "El origen de
las especies", fue que el principal mecanismo evolutivo es la seleccin natural. El concepto de seleccin
natural es simple, y podra definirse como la diferente eficacia biolgica (entendida como viabilidad o
capacidad reproductiva) que confieren alelos distintos. As, los alelos que permiten una mejor adaptacin al
medio tienden a ser favorecidos, mientras que los alelos deletreos tienden a ser eliminados de la
poblacin. Segn esto, los alelos neutros, que no confieren ninguna ventaja ni desventaja, no estarn
sometidos a seleccin. Un ejemplo muy citado es el de la polilla Biston betularia, estudiada por H. B. D.
Kettlewell en la segunda mitad del siglo XIX en Manchester. Kettlewell observ que antes de 1848 esta
especie se encontraba con dos colores distintos, claro u oscuro, y que las polillas oscuras eran menos del
2% de la poblacin de polillas de la zona. Durante los aos siguientes, la proporcin de polillas oscuras fue
creciendo hasta llegar a constituir el 95% del total en el ao 1898. Esto se observaba en las zonas
industrializadas, mientras que en las zonas rurales el aumento de polillas oscuras era menos acusado. Como
el color de las polillas es un rasgo codificado por un gen, el cambio en los colores era el resultado de
cambios en las frecuencias allicas. Kettlewell atribuy el cambio al hecho de que la industrializacin de la
regin hizo que el holln se depositase en los abedules donde se posaban las polillas, y esto haca que las de
color claro destacasen ms y fuesen presa ms fcil de los pjaros depredadores. Las polillas oscuras, en
cambio, tenan una mayor probabilidad de pasar desapercibidas y sobrevivir. Por tanto, las polillas oscuras
sobrevivan ms que las claras y se reproducan con ms frecuencia, haciendo que los alelos que generan el
color oscuro pasaran preferentemente a las generaciones sucesivas. La mejor adaptacin al medio de las
polillas oscuras, simplemente por un mecanismo de seleccin, provoc la evolucin de esta especie en esa
regin.
CAPTULO 12: LOS GENES EN LAS POBLACIONES 133

Para cuantificar los efectos de la seleccin, es necesario calcular la eficacia biolgica relativa fitness,
que es el xito reproductivo relativo de un genotipo concreto. La eficacia se representa por la letra w y su
valor vara entre 0 y 1. Por ejemplo, para dos alelos A y a, se puede calcular la descendencia media que
produce cada genotipo. Supongamos que los individuos con genotipo AA tienen una media de 10
descendientes, los Aa 5 descendientes y los aa 2 descendientes. La eficacia de cada genotipo se calcula
como el nmero de descendientes de ese genotipo respecto al genotipo ms eficaz: wAA = 10/10 = 1; wAa
= 5/10 = 0,5; waa = 2/10 = 0,2.

Una variable relacionada con la eficacia biolgica relativa es el coeficiente de seleccin (s), que indica la
intensidad de la seleccin frente a un genotipo determinado. El clculo se hace con arreglo a la frmula
s=1-w, luego en el ejemplo anterior tendramos que sAA = 0; sAa= 0,5; saa = 0,8. Este modelo permite
predecir que, en ausencia de otros factores, la diferente eficacia biolgica de cada genotipo provocar
cambios en las frecuencias allicas con cada generacin. Estos cambios dependern nicamente de las
frecuencias allicas iniciales y de la eficacia biolgica relativa de cada genotipo. As, para genotipos AA, Aa
y aa que estn en frecuencias p
2
, 2pq y q
2
respectivamente, con eficacias wAA, wAa y waa, las frecuencias
genotpicas tras seleccin durante una generacin sern:

f(AA) = p
2
wAA
f(Aa) = 2pq wAa
f(aa) = q
2
waa

Es importante darse cuenta de que la seleccin, en s misma, no tiene memoria ni es un proceso guiado
hacia un fin, no "piensa" lo que va a suceder dos o tres procesos de seleccin despus. Simplemente
consigue la mejor adaptacin a las condiciones ambientales que se dan en un momento dado, pero si esas
condiciones cambian los rasgos que haban sido seleccionados pueden volver a perderse. Por eso, la
seleccin no es un proceso progresivo de "mejora" de una poblacin, porque los individuos mejor
adaptados en un momento concreto no tienen por qu ser biolgicamente ms perfectos.

En los enlaces de la Figura 12.3 se puede estudiar el efecto de la seleccin en
distintas condiciones.

Existen varios tipos de seleccin que tienen distintos efectos sobre las frecuencias allicas y la variabilidad
gentica de la poblacin. Si consideramos un rasgo fenotpico controlado por un gen con dos alelos,
podemos distinguir 4 tipos principales de seleccin:

i) seleccin contra uno de los homocigotos. En este caso, uno de los genotipos homocigticos (AA
aa, en los ejemplos que venimos viendo) tiene desventaja adaptativa y por eso la seleccin acta en su
contra. La consecuencia es la disminucin progresiva de la frecuencia del alelo presente en ese
genotipo. Por ejemplo, en el caso extremo de seleccin completa en contra del genotipo aa, los individuos
aa no llegarn a reproducirse y los nicos emparejamientos posibles sern los que se muestran en la
siguiente tabla:


Seleccin contra un homocigoto (aa)
Posibles cruzamientos Genotipos esperados en la descendencia
134 GENTICA HUMANA
AA Aa aa
AA X AA 4

AA X Aa 2 2
Aa X AA 2 2
Aa X Aa 1 2 1
Total
9
( 56% )
6
( 38% )
1
( 6% )


Como se observa, en la siguiente generacin la frecuencia del alelo a habr cado al 25% (8 alelos a de un
total de 32), y esta tendencia se mantendr mientas dure la seleccin. De todas formas, es importante
darse cuenta de que el alelo a nunca llegar a desaparecer de la poblacin, porque siempre ser
transmitido por individuos heterocigotos Aa. En las poblaciones humanas, los rasgos recesivos se ven
sometidos a este tipo de seleccin, aunque de un modo mucho ms leve. Por una parte, algunos rasgos
recesivos, como el albinismo, no suponen una gran desventaja selectiva. Otras enfermedades ms severas,
en las que hace aos haba una alta mortalidad antes de llegar a la edad reproductiva, cuentan hoy en da
con tratamientos ms eficaces y se consigue que los enfermos vivan ms aos y puedan reproducirse, por lo
que el efecto de la seleccin sobre las frecuencias allicas es menor. Si se conocen los valores de eficacia
biolgica relativa (w) de cada genotipo (y por tanto los del coeficiente de seleccin s), se puede calcular el
cambio que se producir en la frecuencia allica utilizando diversas frmulas para fenotipos recesivos,
dominantes o sin dominancia.

En la historia reciente de las poblaciones humanas encontramos un ejemplo muy ilustrativo de seleccin
contra un homocigoto. Un alelo concreto del gen que codifica el receptor 5 de quimioquinas (alelo
denominado CCR5delta32) confiere a las clulas resistencia frente a la invasin por la bacteria causante de
la peste bubnica. Los individuos homocigotos para ese alelo son inmunes a la peste, y los heterocigotos
tienen cierta inmunidad. Los homocigotos sin ese alelo, en cambio, son los ms susceptibles. Dado que las
poblaciones europeas fueron sometidas a varias epidemias de peste en los siglos XIV a XVIII, durante las
que murieron millones de personas, el alelo CCRdelta32 aument mucho en su frecuencia, y hoy se
encuentra en torno al 10% en poblaciones europeas, muy superior a otras zonas del planeta. Recientemente
se ha visto que este alelo tambin protege frente a la infeccin por el virus VIH causante del SIDA.

ii) seleccin contra ambos homocigotos. En este caso, ambos homocigotos estn en desventaja
selectiva en comparacin con los heterocigotos (wAA < wAa > waa), de ah que se llame seleccin a favor
de heterocigotos tambin sobredominancia. En el caso ms extremo, los individuos AA y aa nunca
llegan a reproducirse, por lo que slo hay cruzamientos Aa X Aa. Aunque este tipo de cruzamientos produce
de homocigotos AA y de homocigotos aa, stos no llegan a reproducirse y slo los heterocigotos Aa
pasan sus alelos a la generacin siguiente. El efecto neto es que en pocas generaciones se estabilizan las
frecuencias de los dos alelos (equilibrio polimrfico estable), por lo que este tipo de seleccin se llama
tambin seleccin estabilizante.

El ejemplo ms ilustrativo de seleccin contra ambos homocigotos es la relacin entre la anemia
falciforme y la malaria en el frica sub-sahariana. La anemia falciforme es una enfermedad recesiva
rara, en la se produce un tipo de hemoglobina anormal (hemoglobina S) que hace que sus hemates
adquieran una conformacin anmala. Los homocigotos sufren una forma grave de la enfermedad y mueren
CAPTULO 12: LOS GENES EN LAS POBLACIONES 135
en la infancia, por lo que habitualmente no llegan a reproducirse. Los heterocigotos, en cambio, sufren una
forma leve que no compromete su viabilidad. Curiosamente, la anemia falciforme protege frente a la
infeccin por Plasmodium falciparum, el organismo causante de la malaria. El parsito crece dentro de los
hemates, pero no puede entrar en hemates que estn deformados como consecuencia de la hemoglobina
S. Por tanto, los individuos con hemoglobina normal son mucho ms susceptibles a la infeccin que los
individuos con anemia falciforme: los individuos heterocigotos para la hemoglobina S estn relativamente
protegidos frente al Plasmodium, aunque no tanto como los homocigotos. Por tanto, tenemos una situacin
en la que tanto ambos tipos de homocigotos tienen comprometida su viabilidad: los individuos con
dos alelos de hemoglobina S, debido a la anemia falciforme, y los individuos con hemoglobina normal,
debido a que son ms fcilmente infectados y mueren de malaria. En cambio, los heterocigotos con un solo
alelo falciforme estn relativamente protegidos frente a la malaria y no padecen la forma mortal de anemia,
de modo que se ven favorecidos respecto a los homocigotos. El efecto neto es que en las zonas de frica
donde hay malaria la frecuencia del alelo falciforme es mucho ms alta que en el resto del planeta.

iii) Seleccin contra heterocigotos y uno de los homocigotos. Esto equivale a la seleccin a favor de
uno de los genotipos homocigotos (wAA > wAa > waa, por ejemplo). En este caso, los cambios en las
frecuencias allicas sern muy rpidos a favor del alelo presente en el genotipo ms eficaz. De hecho, en el
caso extremo en que los heterocigotos y un tipo de homocigotos no se reproduzcan, en una sola generacin
puede perderse un alelo y quedar fijado el otro. Por ejemplo, si la seleccin acta contra heterocigotos Aa y
homocigotos aa, slo llegarn a reproducirse los individuos AA, con lo que el alelo a estar ausente en la
siguiente generacin. Lgicamente, esta forma extrema de seleccin no es frecuente en poblaciones
humanas, aunque las enfermedades dominantes en las que tanto los heterocigotos como los homocigotos
sufren la enfermedad podran estar sujetas a este tipo de seleccin siempre que estos individuos vean
reducida su viabilidad.

iv) seleccin contra heterocigotos. Finalmente, si la seleccin acta nicamente en contra de los
heterocigotos (WAA > WAa < Waa) ocurrir que la poblacin se polarizar hacia los homocigotos, y esto se
conoce como infradominancia. En el caso de alelos A y a con frecuencias p = q = 1/2, nicamente habr
cruzamientos entre homocigotos de ambos tipos, que producirn una descendencia tpica con proporciones
25% AA, 50% Aa y 25% aa.
















De todas formas, como los individuos Aa fallecen antes de reproducirse, las frecuencias allicas se
reajustarn rpidamente hacia 50% A y 50% a. Por tanto, la subdominancia tambin produce un
Seleccin contra heterocigotos (Aa)
Posibles cruzamientos
Genotipos esperados en la descendencia
AA Aa aa
AA X AA 4

AA X aa 4
aa X AA 4
aa X aa 4
Total
4
( 25% )
8
( 50% )
4
( 25% )
136 GENTICA HUMANA
equilibrio polimrfico, pero al contrario que en el caso de la sobredominancia, aqu el equilibrio es
inestable. Cualquier perturbacin por alguna otra fuerza evolutiva har que las frecuencias allicas
cambien rpidamente hasta fijar uno de los alelos en la poblacin.


Aplicaciones en Gentica Humana

Aunque ya hemos visto algunos ejemplos en los que las nociones bsicas de la Gentica de poblaciones se
aplican a poblaciones humanas, podemos hacer otras consideraciones de gran inters prctico. La ms
inmediata es que la Ley de Hardy-Weinberg permite calcular las frecuencias de los alelos mutantes
que causan enfermedades humanas. Esto es especialmente til en el caso de enfermedades recesivas, en
las que slo los homocigotos desarrollan la enfermedad. Si se conocen las cifras de prevalencia de la
enfermedad en una poblacin podemos calcular las frecuencias allicas, la tasa de portadores en la
poblacin y las tasas de incidencia previstas en generaciones futuras. Por ejemplo, si la prevalencia de una
enfermedad recesiva es de 25 enfermos por cada 100.000 habitantes, entonces q
2
=0,00025 y q=0,016.
Por tanto, p=0,984 y 2pq=0,031. En otras palabras, en esa poblacin la tasa de portadores es del
3,1% y se mantendr estable si no se alteran significativamente las condiciones del equilibrio. Tambin es
importante hacer algunas consideraciones respecto a la eficacia de las campaas de deteccin prenatal
de enfermedades recesivas. La finalidad de estas campaas es evitar que nazcan individuos enfermos, es
decir, homocigotos; sin embargo, esto no hace que disminuya la frecuencia allica ni el porcentaje de
individuos portadores (heterocigotos). En efecto, tal y como hemos visto al hablar de seleccin frente a un
homocigoto (en este caso, recesivo), el alelo deletreo nunca desaparece. Esto significa que las campaas
eugensicas son totalmente ineficaces para eliminar alelos recesivos de una poblacin. Por ejemplo, se
ha calculado que si la frecuencia del alelo recesivo causante del albinismo en Noruega es del 1%, un
programa eugensico dirigido a eliminar el alelo albino de la poblacin noruega (esterilizando, por ejemplo,
a todos los albinos) tardara 100 generaciones en reducir la frecuencia allica a la mitad de su
valor actual (0,005) y llevara 9.900 generaciones reducirla al 0,0001. En este sentido, el parmetro
ms importante para saber si es factible aplicar una campaa de deteccin prenatal en una enfermedad
recesiva es el cociente entre heterocigotos y homocigotos: cuanto menor es la frecuencia del alelo
mutante (q), mayor es el cociente 2pq/q
2
y la frecuencia allica q apenas bajar debido al alto nmero de
portadores en la poblacin. En cambio, estas campaas resultan ms eficaces para hacer disminuir el
nmero de nuevos enfermos en el caso de enfermedades recesivas ms frecuentes, en las que q es ms
alto y el cociente 2pq/q
2
menor.

Las enfermedades ligadas al cromosoma X constituyen un caso especial para el clculo de frecuencias
allicas y genotpicas, ya que los enfermos son habitualmente varones hemicigotos que slo llevan una
copia del alelo mutante. Por tanto, la prevalencia de la enfermedad en la poblacin (varones enfermos por
100.000 habitantes) es igual a q (la frecuencia del alelo mutante). El porcentaje de mujeres homocigticas
(y, por tanto, enfermas) es q
2
, y suele ser muy bajo.

Aunque en otras especies es relativamente sencillo calcular la tasa de mutaciones, la eficacia biolgica
relativa y el coeficiente de seleccin, en poblaciones humanas slo podemos obtener aproximaciones. Por
ejemplo, la tasa de nuevas mutaciones en enfermedades dominantes puede estimarse utilizando la
frmula =n/2N, siendo n el nmero de enfermos que nacen de padres sanos (los cuales deben ser
homocigotos sanos si la enfermedad tiene penetrancia completa) y N el nmero total de nacimientos. Los
clculos de varan de unas enfermedades a otras, lo que refleja que las tasas de mutacin no son
iguales para todos los genes.

CAPTULO 12: LOS GENES EN LAS POBLACIONES 137
Finalmente, podemos fijarnos en cmo mutacin y seleccin natural actan en direcciones opuestas,
en especial sobre los alelos deletreos. stos aumentan por efecto de la mutacin, pero la seleccin tiende a
eliminarlos de la poblacin. Cuando ambas fuerzas alcanzan un equilibrio en el que todos los nuevos alelos
mutados son eliminados por seleccin, la frecuencia de un alelo deletreo dominante es igual al
cociente /s, siendo la tasa de mutaciones y s el coeficiente de seleccin. En el caso de un alelo
recesivo, su frecuencia es igual a la raz cuadrada del cociente /s. Si conocemos la tasa de mutacin y
la frecuencia allica, podemos calcular la eficacia biolgica viceversa. Por ejemplo, se sabe que la
acondroplasia, una enfermedad autosmica dominante, tiene una eficacia W=0,74, ya que los individuos
con acondroplasia son frtiles pero tienen en promedio un 74% de la descendencia que tienen los individuos
sin acondroplasia. Por tanto, s=1W=0,26. Si la tasa mutacional calculada para este gen (usando la
frmula del prrafo anterior) es de 3x10
-5
mutaciones por generacin, podemos deducir que la frecuencia
allica es q = 0,0003/0,26 = 0,0012, que corresponde con la frecuencia de la enfermedad en la
poblacin.

Una ltima consideracin es la que hace referencia al papel de la seleccin natural en poblaciones humanas
en la actualidad. As como a lo largo de nuestra historia la seleccin ha jugado un papel importante en los
cambios de frecuencias allicas, y en gran parte del mundo todava es as (recurdese el ejemplo de la
malaria en frica), en el mundo industrializado el papel de la seleccin es cada vez menor. Esto es
consecuencia de las mejoras en la calidad de vida y en los cuidados sanitarios, que hacen posible que
individuos enfermos (que, de otro modo, falleceran antes de la edad reproductiva) vivan ms y puedan
llegar a reproducirse y pasar los alelos mutantes a la siguiente generacin. Esto es especialmente claro en el
caso de tumores hereditarios de la infancia, como el retinoblastoma, que es una enfermedad de herencia
autosmica dominante. Tambin sucede con enfermedades recesivas comunes, como la fibrosis qustica,
que hace aos tena una alta mortalidad durante la infancia y en cambio hoy en da los enfermos suelen
vivir hasta la edad adulta. Lgicamente, no debemos renunciar a los logros alcanzados en el tratamiento de
las enfermedades, pero hemos de ser conscientes de que las poblaciones humanas van acumulando un
lastre gentico cada vez mayor.


Formacin de la Teora Sinttica de la Evolucin

En sentido biolgico amplio, la evolucin es un concepto universalmente aceptado: a lo largo de la historia
natural del planeta, unas especies han ido desapareciendo y dando paso a otras que se derivan de las
anteriores. Lamarck, al comienzo del siglo XIX, fue el primer naturalista en proponer el concepto de que
unas especies se han ido transformando en otras, aunque en aquel momento esto no pasaba de ser una
intuicin, sin el respaldo de datos experimentales convincentes. En la Encyclopedia of Genetics, se define
evolucin como el proceso mediante el cual, segn unos individuos se diferencian gradualmente
de otros al irse reproduciendo, los organismos cambian en otros nuevos a lo largo del tiempo. El
diccionario de la RAE, en su 22 edicin, define la evolucin (biolgica) como "el proceso constante de
transformacin de las especies a travs de cambios producidos en sucesivas generaciones". El Diccionario
del Espaol Actual (edicin de 1999) la define como "cambio gradual y progresivo de las especies a lo largo
de sucesivas generaciones".

Este concepto de evolucin es el que est en el imaginario popular, pero no debe ser confundido con la
Teora General de la Evolucin, evolucin tal y como se entiende en mbitos cientficos, que es la
teora que intenta explicar los mecanismos que dan lugar a evolucin. La Teora de la Evolucin arranca de
las observaciones de Darwin, publicadas en El origen de las especies, y del descubrimiento de las leyes
138 GENTICA HUMANA
de la herencia por Mendel, a finales del siglo XIX. Darwin us inicialmente la expresin descent with
modification para indicar que pequeos cambios heredados de una generacin a la siguiente podan
explicar la transformacin de unas especies en otras. Pero en tiempos de Darwin todava no se haban
descubierto los principios de la Gentica, por lo que no se podan describir los mecanismos que producan
esos cambios ni cmo se heredaban de una generacin a la siguiente. La gran intuicin de Darwin fue que el
principal mecanismo por el que opera la evolucin es la seleccin natural, aunque no pudo demostrarlo
experimentalmente por las razones apuntadas. El redescubrimiento de las leyes de Mendel en el ao 1900 y
la elaboracin de la gentica de poblaciones en las primeras dcadas del siglo XX dieron lugar a la Teora
Sinttica de la Evolucin en torno a 1940. Posteriormente, los datos aportados por la biologa molecular y la
biologa del desarrollo han completado y matizado algunos aspectos de la Teora General.

Por tanto, actualmente la evolucin se define en trminos cientficos como el proceso mediante el cual
una poblacin de individuos adquiere cambios que son heredados a generaciones sucesivas. Por
ejemplo, podemos citar la definicin de evolucin que propone Douglas J. Futuyma en su libro Evolutionary
Biology (Sinauer Associates, 1986): "Biological evolution (...) is change in the properties of populations of
organisms that transcend the lifetime of a single individual. The ontogeny of an individual is not considered
evolution; individual organisms do not evolve. The changes in populations that are considered evolutionary
are those that are inheritable via the genetic material from one generation to the next." Es decir, la
evolucin biolgica es el resultado de los cambios, pequeos o grandes, en los tipos y frecuencias de
alelos existentes en una poblacin de individuos, ya que esos cambios son transmitidos a las
generaciones siguientes.

Es interesante ver con un poco ms de detalle el desarrollo histrico de las ideas que han dado lugar al
concepto moderno de evolucin. En las primeras dcadas del siglo XX, como hemos visto, Hardy y
Weinberg establecieron las bases de la gentica de poblaciones. Los genetistas de principios de siglo
pensaban que los alelos dominantes deberan ir desplazando poco a poco a los alelos recesivos de la
poblacin, hasta reemplazarlos por completo. Hardy (matemtico) y Weinberg (fsico) demostraron
matemticamente que esto no tena por qu ser as, sino que -en determinadas condiciones- las frecuencias
genotpicas deberan mantenerse estables y depender exclusivamente de las frecuencias allicas. En los
aos posteriores, Ronald Fisher, J.B.S. Haldane y Sewall Wright desarrollaron estas ideas y elaboraron
los conceptos que dieron lugar a la gentica de poblaciones. Fisher, creador de la estadstica moderna y del
concepto de varianza, aport entre otras muchas cosas lo que se conoce como el teorema fundamental
de la seleccin natural: el cambio en la eficacia biolgica (fitness) depende de la varianza gentica aditiva
(en otras palabras, a mayor variacin en la poblacin, mayor capacidad adaptativa). Sewall Wright, por su
parte, hizo ms hincapi en los efectos del tamao poblacional, desarrollando el concepto de deriva gentica
y proponiendo la existencia de paisajes adaptativos. Todas estas ideas fueron sistematizadas y
popularizadas por T. Dobzhansky, que en 1937 public Genetics and the Origin of Species. En este
libro se expona una teora unificadora que explicaba de modo razonablemente satisfactorio las leyes por las
que opera la evolucin, la Teora Sinttica o sntesis moderna. En torno a 1970 surgieron nuevas
hiptesis para explicar aspectos evolutivos concretos, de manera que la Teora Sinttica fue matizada y
ampliada para dar lugar a lo que hoy llamamos Teora General de la Evolucin.

Todo lo anterior sirve para subrayar la idea que se ha expuesto al principio de este captulo: la evolucin
es fundamentalmente un fenmeno que afecta a la constitucin gentica de una poblacin (el
acervo gentico, es decir, el conjunto de alelos que estn presentes en una poblacin) y sus cambios en
el tiempo. Por tanto, es natural que la evolucin deba ser estudiada con un enfoque eminentemente
gentico y utilizando las metodologas propias del anlisis gentico. No se puede afrontar el estudio de la
evolucin sin comprender todos los conceptos explicados en la seccin dedicada a la Gentica de
CAPTULO 12: LOS GENES EN LAS POBLACIONES 139
Poblaciones. Los mtodos cuantitativos de anlisis de la variabilidad gentica y de la seleccin natural son
imprescindibles en cualquier discusin cientfica en torno a la evolucin. De hecho, algunos autores resumen
el proceso evolutivo en una expresin sencilla pero llena de significado: "los genes mutan, los individuos
son seleccionados, las poblaciones evolucionan".


Explicacin actual del proceso evolutivo y sus limitaciones

El proceso evolutivo se divide habitualmente en tres fases: microevolucin, especiacin y
macroevolucin. La primera se refiere a los cambios relativamente pequeos que surgen en una poblacin
de individuos de una misma especie, y es la ms fcil de observar y de estudiar experimentalmente. La
especiacin es el proceso por el que una especie da lugar a otra u otras mediante un proceso ramificado
(cladognesis) o lineal (anagnesis). Macroevolucin se refiere a los cambios observados durante largos
periodos de tiempo, que dan lugar a organismos muy diversos. La teora moderna de la evolucin explica
satisfactoriamente la microevolucin y la especiacin, pero los mecanismos de macroevolucin son ms
hipotticos y sujetos a discusin, ya que la evidencia experimental es ms fragmentaria y menos slida. Una
idea central a todos estos procesos es el concepto de especie, que en s mismo es objeto de bastante
controversia. Ernst Mayr fue el taxonomista que ms ha contribuido a dar forma al concepto moderno de
especie: en organismos de reproduccin sexual, una especie es un grupo de poblaciones naturales que de
hecho o en potencia se reproducen entre s y que estn aisladas reproductivamente de otros grupos
similares. Este concepto de especie, que puede aplicarse con bastante generalidad a los animales pero con
menos fiabilidad a las plantas, ha sido matizado ms recientemente por la gentica molecular y el concepto
filogentico de especie: teniendo en cuenta caractersticas taxonmicas basadas en diferencias
morfolgicas y funcionales as como diferencias genticas cuantificables por mtodos moleculares, una
especie es una rama claramente definida en un rbol filogentico.

La Figura 12.4 explica qu es un rbol filogentico.



La teora de la evolucin explica satisfactoriamente cmo se producen la microevolucin y la especiacin.
Una idea central en estos procesos, ya presente en la definicin original de especie, es el aislamiento: para
que pueda surgir una especie nueva, parte de la poblacin original ha de quedar aislada del resto de los
individuos de esa poblacin. De hecho, los ejemplos mejor documentados de especiacin se han verificado
en condiciones de aislamiento: por ejemplo, hay evidencias de especiacin especialmente intensa en
archipilagos, en los que es frecuente encontrar situaciones de aislamiento geogrfico de poblaciones.
escarabajos
avispas
mariposas
moscas
e
s
c
a
r
a
b
a
j
o
s
a
v
i
s
p
a
s
m
a
r
i
p
o
s
a
s
m
o
s
c
a
s
escarabajos
avispas
mariposas
moscas
escarabajos
avispas
mariposas
moscas
e
s
c
a
r
a
b
a
j
o
s
a
v
i
s
p
a
s
m
a
r
i
p
o
s
a
s
m
o
s
c
a
s
e
s
c
a
r
a
b
a
j
o
s
a
v
i
s
p
a
s
m
a
r
i
p
o
s
a
s
m
o
s
c
a
s
140 GENTICA HUMANA
Cuando dos poblaciones de una especie quedan separadas reproductivamente por razones geogrficas,
seguirn rumbos evolutivos distintos con el paso del tiempo, tanto si los ambientes a los que estn
sometidas son distintos o no. Este tipo de especiacin se llama especiacin aloptrica, y es el ms fcil
de explicar y para el que se han encontrado ms ejemplos en la naturaleza. Por el contrario, dos
poblaciones pueden diverger sin estar aisladas geogrficamente, fenmeno que se conoce como
especiacin simptrica. Aunque sta ltima es ms difcil de explicar y est menos documentada, hay
algunos ejemplos en plantas.

El proceso de especiacin es explicado por la teora moderna de la evolucin utilizando los conceptos de
variabilidad, seleccin natural y deriva gentica. El requisito necesario para que haya microevolucin y
especiacin es la presencia de variacin gentica. Si no existe variacin, no puede haber evolucin. Como
hemos visto, ya Fisher haba postulado que la variacin gentica es directamente proporcional a la velocidad
con la que opera la seleccin adaptativa. Al explicar los principios de la Gentica de Poblaciones hemos visto
que la mutacin es el principal mecanismo por el que aumenta la variacin gentica, mientras que la
seleccin natural habitualmente disminuye la variabilidad existente en la poblacin, aunque en algunos
casos la mantiene (seleccin a favor de heterocigotos y equilibrio polimrfico estable). En general, en el
caso de dos poblaciones aisladas sometidas a condiciones ambientales distintas, la principal fuerza
microevolutiva ser la seleccin. El coeficiente de seleccin y la eficacia biolgica (fitness) permiten predecir
la magnitud de los cambios en las frecuencias allicas con las sucesivas generaciones.

La teora moderna de la evolucin tambin permite predecir que dos poblaciones en condiciones de
aislamiento geogrfico sufrirn evolucin aunque no estn sometidas a presiones ambientales diferentes.
Sewall Wright fue el primero en predecir que si el tamao poblacional es pequeo, las frecuencias allicas
pueden cambiar rpidamente por deriva gentica aleatoria, sin estar determinadas por la seleccin
natural. Un mecanismo frecuente de especiacin es el aislamiento de una poblacin pequea que contiene
un pequeo grupo de los alelos presentes en la poblacin original de partida (efecto fundador). En estas
condiciones, la deriva gentica puede fijar rpidamente ciertos alelos en la poblacin y producir evolucin
sin seleccin. El papel de la deriva gentica en la evolucin adquiri especial protagonismo tras los trabajos
de Motoo Kimura en 1968. Durante los aos precedentes, los avances en biologa molecular haban hecho
posible, por primera vez, cuantificar las diferencias genticas que se observan entre especies distintas
definidas por el concepto clsico de especie. Estas comparaciones confirmaron que los grupos taxonmicos
se correspondan extraordinariamente bien con los grupos filogenticos derivados de la comparacin de
secuencias de ADN. Kimura observ que la mayor parte de los cambios moleculares en el ADN eran
neutros desde el punto de vista de la seleccin, ya que afectan a nucletidos que no alteran la secuencia
de aminocidos de la protena codificada. El descubrimiento de que los genomas de mamferos estn
formados en su mayor parte por ADN no-codificante, as como la presencia de numerosos polimorfismos
silenciosos y selectivamente neutros ha supuesto un respaldo de la teora neutral de la evolucin, que
as complement la Teora Sinttica prevalente hasta los aos 70. La teora neutral hace predicciones
importantes, ya que postula que la gran mayora de las mutaciones son neutras y, por tanto, la tasa de
cambio evolutivo (a nivel molecular) viene determinada exclusivamente por la tasa de mutacin,
independientemente del tamao de la poblacin. Esto introdujo el concepto de reloj molecular, tan
importante en los estudios actuales de evolucin molecular. Por otra parte, la teora neutral tambin predice
que la probabilidad de fijacin de un alelo en la poblacin depender exclusivamente del tamao de la
misma. Estas predicciones se han confirmado en bastantes casos, aunque actualmente la teora neutral se
ha modificado para incluir los efectos de alelos deletreos sometidos a seleccin dbil.

Dado que la teora sinttica explicaba satisfactoriamente la microevolucin y la especiacin, hasta los aos
70 era comn aceptar que la macroevolucin sera el resultado de estos mismos mecanismos operando
CAPTULO 12: LOS GENES EN LAS POBLACIONES 141
durante grandes periodos de tiempo. Este modelo de pequeos cambios graduales a lo largo del tiempo se
conoce como gradualismo, y supone que las especies estn constantemente evolucionando a una
velocidad lenta. En 1972, Stephen Jay Gould y Niles Eldredge propusieron la hiptesis del equilibrio
puntuado, para intentar explicar el hecho de que el registro fsil muestra que muchas especies han estado
durante millones de aos bsicamente sin cambios y en poco tiempo sufrieron transformaciones drsticas.
Segn estos autores y otros paleontlogos no es necesario que la evolucin acte constantemente, porque
muchas especies estn bien adaptadas y no necesitan cambiar si no se alteran las condiciones ambientales.
Es precisamente en periodos de cambios ambientales bruscos (glaciaciones, sequas, cambios en el clima o
en los recursos alimenticios, depredadores, etc.) cuando la seleccin natural puede favorecer variedades
que estaban presentes en la poblacin en baja frecuencia, dando lugar a cambios adaptativos rpidos.

Por otro lado, los estudios de evolucin molecular, sobre todo en la comparacin de genomas, han mostrado
que muchos genes reguladores y genes implicados en el desarrollo embrionario estn muy conservados en
la naturaleza. En concreto, la biologa del desarrollo estudia los genes responsables de los patrones
corporales, la polaridad, las extremidades y la organognesis. Los genes implicados en estos procesos son
extraordinariamente similares entre especies evolutivamente distantes, lo que ha llevado a generar una
nueva disciplina llamada biologa del desarrollo evolutiva ("evo-devo", del ingls evolutionary
developmental biology). La idea que se extrae de estos anlisis es que pequeos cambios en genes clave,
que regulan la expresin de un nmero elevado de genes distintos, puede producir alteraciones
morfolgicas importantes en un periodo corto de tiempo.

En esta misma lnea, los estudios comparativos de los genomas de distintas especies muestran que la
duplicacin de genes, la duplicacin de genomas y los reordenamientos cromosmicos han sido
frecuentes en diversos momentos evolutivos. Susumu Ohno public en 1970 el libro Evolution by gene
duplication, proponiendo la idea de que la duplicacin de genomas ha sido una de la fuerzas evolutivas que
han permitido crear complejidad y aumentar la variacin gentica. Aunque en esos aos no haba mucha
evidencia experimental para apoyar esta hiptesis, Ohno postul que los cambios macroevolutivos no
pueden explicarse por la accin lenta de la seleccin sobre la variedad allica presente en la poblacin, sino
que es necesario que haya suficiente redundancia en el genoma para que la seleccin pueda actuar por
separado sobre distintas copias de los mismos genes. Esa redundancia se habra alcanzado mediante
duplicaciones genmicas parciales o totales. Los estudios moleculares de familias y superfamilias de genes,
y la reciente secuenciacin de genomas completos han ido confirmando algunas de las predicciones de
Ohno. Hoy en da se acepta que grandes segmentos de los genomas de eucariotas estn formados por
regiones duplicadas y que la mayor parte de las familias gnicas han surgido por duplicacin y divergencia
separada de las distintas copias, o incluso por duplicaciones genmicas completas. La comparacin de
familias de genes muestra que, en general, los genes ortlogos (copias de un gen en especies distintas)
tienen mayor homologa entre s que los genes parlogos (copias duplicadas de un gen dentro de una
misma especie), lo cual sugiere que la duplicacin inicial es muy antigua. En cuanto a la duplicacin de
genomas, se ha sugerido que durante la evolucin de los vertebrados han tenido lugar dos duplicaciones
genmicas (hiptesis 2R), ya que muchos genes importantes (genes homeobox, genes del complejo
mayor de histocompatibilidad, etc.) tienen una sola copia en invertebrados pero 3 4 copias en
vertebrados. Los anlisis ms recientes del genoma humano muestran la existencia de muchos ms genes
duplicados de los que cabra esperar por azar, y cuando se compara con los genomas de Drosophila y de C.
elegans parece que hubo al menos una duplicacin genmica completa entre invertebrados y vertebrados.
En el caso concreto de los mamferos, los genomas analizados en los ltimos aos permiten constatar la
presencia de gran cantidad de reordenaciones cromosmicas, de mayor o menor tamao. Esto se ve
especialmente bien al comparar genomas de especies muy similares: por ejemplo, si se alinean los genomas
de primates, se observa que la sintenia es casi total, aunque varias translocaciones e inversiones dan lugar
142 GENTICA HUMANA
a los 46 autosomas del chimpanc frente a los 44 de la especie humana. Al comparar especies ms
separadas, como humano y ratn, los bloques de sintenia son ms pequeos y estn ms dispersos (hay
342 bloques de un tamao promedio de unas 10 Megabases cada uno). Esto sugiere que ambos genomas se
han originado a partir de un genoma ancestral mediante complejos eventos de duplicacin, inversin y
translocacin.

La Figura 12.5 muestra la organizacin de los genes homeobox en humanos y
en Drosophila.

Como conclusin, parece bastante claro que la historia evolutiva de la vida del planeta es tremendamente
complicada. Aunque los mecanismos bsicos, sobre todo los que originan microevolucin y especiacin, son
bastante bien comprendidos, los cambios macroevolutivos son ms difciles de analizar. Diferentes especies
han evolucionado a distintas velocidades, en respuesta a factores ambientales muy cambiantes y a
interacciones complejas con otras especies. Estos factores han propiciado, adems, la extincin de la
inmensa mayora de las especies, por lo que el cuadro general macroevolutivo es fragmentario y no es fcil
proponer explicaciones satisfactorias. En cualquier caso, la teora sinttica, que explicaba cambios
pequeos, ha sido matizada y completada por aportaciones importantes como la teora neutral de Kimura, la
teora del equilibrio puntuado y la hiptesis de Ohno. Con estas aportaciones, se ha rebajado algo la
importancia de la seleccin natural gradual en los cambios macroevolutivos y en cambio se tiende a dar
ms importancia a alteraciones genmicas o a cambios ambientales bruscos que pueden haber provocado
fases de evolucin acelerada. Sobre los cambios adquiridos durante estos periodos, la seleccin habra
proporcionado el ajuste fino adaptativo.

La conciliacin de la teora moderna de la evolucin con las convicciones filosficas o religiosas de los
individuos no debera ofrecer problemas, al tratarse de mbitos del conocimiento diferentes. La mayor parte
de los problemas han surgido cuando uno de esos mbitos ha intentado invadir el otro. En el mbito
protestante anglosajn, especialmente en los Estados Unidos, se origin un movimiento llamado
creacionismo al advertir que la teora de la evolucin estaba siendo utilizada para atacar los fundamentos
de las creencias religiosas de los ciudadanos. Las disputas entre creacionistas y evolucionistas son todava
hoy muy acentuadas en ese pas; por desgracia, algunos intentos recientes de deslegitimar ideas propias del
mbito filosfico-teolgico en nombre de la ciencia no han ayudado en absoluto a conciliar ambas visiones.
Un ejemplo muy claro fue la publicacin en 1986 de El relojero ciego por Richard Dawkins. En ese libro
el autor se propone refutar, recurriendo al mecanismo de la evolucin y en particular a la seleccin natural,
el "argumento del diseo" que haba sido propuesto por el telogo protestante William Paley en 1802.
Obviamente, este planteamiento traspasa los lmites de la ciencia experimental, ya que sta responde a
preguntas sobre mecanismos biolgicos pero no puede responder a argumentos teolgicos ni a preguntas
sobre las causas primeras y el origen ontolgico del mundo material; estas cuestiones pertenecen ms al
mbito de la filosofa y escapan al propio mtodo experimental. En cualquier caso, la publicacin de ese libro
dio lugar a una fuerte respuesta que cristaliz en un movimiento que hoy se conoce como Diseo
Inteligente, una reformulacin moderna de la quinta va de Toms de Aquino (como lo era tambin, en el
fondo, el argumento del diseo de Paley). El Diseo Inteligente intenta utilizar la ciencia actual (sobre todo
a nivel molecular, proponiendo el concepto de "complejidad irreductible") para demostrar la existencia de un
diseo en la naturaleza, y por tanto la existencia de un ser inteligente creador de dicho diseo. Nuevamente
nos encontramos ante un intento de utilizar la ciencia con fines que no son los suyos, ya que el argumento
del diseo inteligente, aunque basado en observaciones de la naturaleza, es bsicamente un argumento de
carcter filosfico ms que cientfico. La particular situacin de la sociedad americana, ha hecho que el
debate en torno al Diseo Inteligente y su posible inclusin en las escuelas (en las asignaturas de ciencias
CAPTULO 12: LOS GENES EN LAS POBLACIONES 143
naturales) sea especialmente agrio y haya llegado a las instancias polticas del pas. Por suerte, los crculos
cientficos son cada vez ms conscientes de la magnitud del problema, y estamos asistiendo a grandes
avances en todo lo que rodea a las relaciones entre conocimiento cientfico y convicciones filosficas
personales.

En la Figura 12.6 se puede leer un artculo de opinin acerca de las relaciones
entre ciencia y fe.

En este sentido, un editorial de la revista Nature en abril de 2005 deca: "scientists would do better to
offer some constructive thoughts of their own. For religious scientists, this may involve taking the time to
talk to students about how they personally reconcile their beliefs with their research. Secular researchers
should talk to others in order to understand how faiths have come to terms with science. All scientists
whose classes are faced with such concerns should familiarize themselves with some basic arguments as to
why evolution, cosmology and geology are not competing with religion. When they walk into the lecture hall,
they should be prepared to talk about what science can and cannot do, and how it fits in with different
religious beliefs". Estas frases indican ciertamente una nueva sensibilidad hacia las creencias religiosas de
los cientficos, y un intento de mantener las conclusiones de las ciencias experimentales dentro del mbito
que les es propio.

Un magnfico ejemplo reciente en el que se pone en prctica el consejo del prrafo citado, es la publicacin
de The language of God: a scientist presents evidence for belief, escrito por Francis Collins. El autor es un
genetista de gran reputacin, por haber identificado el gen responsable de la fibrosis qustica y por haber
dirigido el Proyecto Genoma Humano. En este libro, Collins describe su trayectoria intelectual personal hacia
la fe en un Dios personal origen del Universo, creador tambin del mecanismo evolutivo para generar
diversidad.

Adems, en Internet se pueden encontrar varios sitios de asociaciones de cientficos creyentes, como la
American Scientific Affiliation (www.asa3.org) o Christians in Science (www.cis.org.uk), que ilustran
muy bien cmo el conocimiento cientfico y las creencias religiosas de los individuos ofrecen dos visiones del
mundo que no son opuestas, sino que se armonizan y complementan mutuamente.

144 GENTICA HUMANA
CAPTULO 13: CITOGENTICA 145

D. PATOLOGA GENTICA

Consta de 8 temas en los que se aborda el ncleo principal de esta asignatura: los
mecanismos genticos de las enfermedades, el diagnstico de las altraciones
genticas y el clculo de los riesgos de transmisin a la descendencia.



Captulo 13. Citogentica
El estudio de los cromosomas humanos. El fenmeno de no disyuncin
meitica y sus implicaciones. Anomalas del nmero de los cromosomas.
Anomalas estructurales de los cromosomas.


El estudio de los cromosomas humanos

La citogentica constitucional se ocupa del anlisis de los cromosomas en clulas que representan la lnea
germinal del individuo (habitualmente linfocitos de sangre perifrica), y se llama as para distinguirla de los
estudios citogenticos sobre poblaciones celulares concretas que no representan la constitucin gentica de
todo el individuo (clulas somticas, por ejemplo las clulas de un tumor). La citogentica constitucional
refleja, por tanto, la estructura cromosmica que ha sido heredada y que, a su vez, se transmitir a la
descendencia.

La citogentica clsica se basa en la creacin y anlisis del cariotipo, que es la presentacin ordenada de
los cromosomas cuando se hacen visibles en metafase. Hasta los aos 50 se crea que los humanos
tenamos 48 cromosomas y que el sexo dependa del nmero de cromosomas X, como sucede en
Drosophila. En 1956 se determin el nmero exacto de cromosomas de la especia humana, y en 1959 ya
se haban identificado las anomalas cromosmicas caractersticas de los Sndromes de Down, Turner y
Klinefelter. Esto se debi a mejoras tcnicas que permitieron cultivar leucocitos de sangre perifrica
(estimulando el crecimiento en cultivo con fitohemaglutinina y mitgenos), detener el ciclo celular
especficamente en metafase (utilizando sustancias como colchicina) y realizar tinciones especficas del ADN.
En 1968 Caspersson introdujo las bandas Q, y en 1971 se introdujeron las bandas G, que son el mtodo
ms utilizado para generar cariotipos.

El mtodo habitual de cariotipado incluye la adicin de un mitgeno (habitualmente fitohemaglutinina) a una
suspensin de linfocitos, tras lo cual se cultivan las clulas durante 48-72 horas; cuando hay suficiente
nmero de clulas, se detiene el ciclo celular en mitosis utilizando colchicina, de modo que todas las clulas
se habrn parado en metafase (momento en que los cromosomas se hacen visibles). El tratamiento con una
solucin hipotnica rompe las clulas y separa los cromosomas, tras lo cual se procede a la fijacin de la
muestra. A continuacin se aplican distintas tinciones, que producen patrones de bandas caractersticos en
los distintos cromosomas. En el mtodo de bandas Q, el primero en aparecer histricamente, los
cromosomas se tien con un colorante fluorescente con afinidad por regiones ricas en adeninas y timinas, lo
cual produce unas bandas caractersticas en los cromosomas cuando se observan con luz ultravioleta. El
mtodo de bandas G consiste en someter las preparaciones a una digestin suave con tripsina antes de
146 GENTICA HUMANA
teirlas con Giemsa, un colorante con afinidad por el ADN; cuando se analizan las preparaciones al
microscopio de luz, se observan unas bandas oscuras (bandas G) separadas por unas bandas claras. Para
teir los cromosomas segn el mtodo de bandas R se someten las preparaciones a un tratamiento de
calor en solucin salina antes de la tincin con Giemsa, lo cual produce un patrn de bandas claras y
oscuras que es justamente el inverso al que se obtiene con el mtodo de bandas G. Esto es as porque el
tratamiento por calor hace que se desnaturalicen las regiones ricas en adeninas y timinas, por lo que las
bandas R oscuras corresponden a las bandas G claras. El mtodo de bandas C se utiliza para teir la
heterocromatina constitutiva (centrmeros), y consiste en la tincin con Giemsa tras la desnaturalizacin en
una solucin saturada de hidrxido de bario.

En conjunto, utilizando estos mtodos, y otros que son menos utilizados, se pueden ver cuatro tipos
principales de estructuras:

- bandas de heterocromatina constitutiva (bandas C) que corresponden a las regiones que
permanecen condensadas durante la interfase.
- bandas de eucromatina, formando un patrn de bandas claras y oscuras alternas a lo largo de todo
el cromosoma; se ven como bandas G, R Q.
- regiones organizadoras del nucleolo, correspondientes a las regiones cromosmicas donde residen
los genes del ARN ribosomal; se tien con una tincin especial de plata.
- quinetocoros, las estructuras centromricas que aparecen en mitosis y meiosis a las que se unen
los microtbulos del huso; se tien con tinciones especiales que usan anticuerpos especficos.

Los patrones de bandas G que definen cada cromosoma humano se publican peridicamente en el
International System for Cytogenetics Nomenclature (ISCN), mostrando distintas resoluciones: desde 350-
550 bandas por cariotipo cuando se estudian clulas en metafase, hasta 850 bandas por cariotipo cuando se
analizan clulas en prometafase. Los cromosomas (22 pares de autosomas ms los cromosomas sexuales X
e Y) se ordenan en parejas de cromosomas homlogos, cada uno de los cuales tiene a su vez las dos
cromtides que resultan de la replicacin del ADN en la fase S previa, aunque en ocasiones las dos
cromtides estn pegadas y no se distinguen al microscopio. La forma de ordenar los cromosomas responde
a un convenio (Pars, 1971) y se lleva a cabo teniendo en cuenta el tamao del cromosoma y la
posicin del centrmero, asignando a cada uno un brazo corto (p) y un brazo largo (q). As se pueden
distinguir cromosomas metacntricos (ambos brazos de la misma longitud), submetacntricos (con el
brazo p ms corto que el brazo q) o acrocntricos (cuyo brazo corto est formado por ADN satlite con
ADN ribosomal en el centro). As, el cromosoma 1 es el de mayor tamao, y el cromosoma 21 el ms
pequeo. Teniendo en cuenta todas estas caracterstica, el cariotipo humano se divide en varios
grupos (que van del grupo A hasta el grupo G), con los cromosomas sexuales X e Y formando un grupo
aparte.

La Figura 13.1 explica la nomenclatura de las regiones y bandas
cromosmicas, y muestra un ejemplo de cariotipo convencional con bandas
G.

Adems de las tcnicas convencionales de bandeo, hoy contamos con una serie de tcnicas que se engloban
bajo una nueva disciplina llamada Citogentica Molecular, que combina la citogentica clsica con la
hibridacin especfica de sondas marcadas con fluorocromos (FISH = Fluorescence In Situ Hybridisation).
La tcnica de FISH, muy utilizada hoy en da, consiste en la hibridacin de sondas especficas con
cromosomas metafsicos, que previamente han desnaturalizados como en cualquier reaccin de hibridacin.
CAPTULO 13: CITOGENTICA 147
Aunque inicialmente se utilizaban preparaciones de metafases, tambin se puede hacer FISH directamente
en ncleos interfsicos, lo que permite detectar anomalas numricas o estructurales especficas
(utilizando sondas especficas) incluso en poblaciones celulares que no pueden dividirse o que no producen
buenas metafases (clulas fijadas e includas en parafina, por ejemplo). Algunas variantes de la tcnica de
FISH incluyen el llamado pintado cromosmico (painting), que permite resaltar un cromosoma concreto,
incluyendo los fragmentos del mismo que se hayan translocado a otras posiciones. Igualmente, la tcnica de
SKY (Spectral Karyotyping) consiste en el pintado de cada cromosoma con un color distinto, gracias a
combinaciones de fluorocromos y tcnicas interferomtricas en la deteccin de la fluorescencia emitida. A
pesar de su complejidad y alto coste, el SKY-FISH es una tcnica valiossima para detectar pequeas
alteraciones cromosmicas que, de otra forma, pasaran totalmente desapercibidas. Otra variante es la
tcnica de CGH (Comparative Genomic Hybridisation, Hibridacin Genmica Comparativa), que permite
detectar ganancias o prdidas de material gentico en un ADN prueba cuando se compara con un ADN de
referencia, y es muy utilizada en la bsqueda de regiones cromosmicas amplificadas o delecionadas en
tumores.

Los videos de la Figura 13.2 muestran distintos ejemplos de tcnicas de
citogentica molecular.

El ISCN tambin es responsable de unificar la nomenclatura para la descripcin de cariotipos normales o
alterados. Las reglas bsicas ms importantes que hay que conocer son las siguientes:

- Se especifica en primer lugar el nmero total de cromosomas, seguido de los cromosomas sexuales y,
si las hay, las alteraciones que se encuentren. Estos datos van separados por comas, sin espacios antes
ni despus de la coma. Por ejemplo, el cariotipo de un varn normal se expresara como "46,XY".
- Los individuos denominados "mosaicos" (es decir, aquellos que tienen dos ms constituciones
cromosmicas distintas) se describen separando cada constitucin cromosmica por una barra "/".
- Las alteraciones que estudiaremos en este captulo se describen utilizando abreviaturas apropiadas. Por
ejemplo, "del" significa delecin, "dup" duplicacin, "inv" inversin, "ins" insercin, "t"
translocacin, "i" isocromosoma, "r" cromosoma en anillo. Despus de cada una de estas alteraciones
se indican los cromosomas implicados (entre parntesis) y a continuacin las regiones implicadas (en
otro parntesis distinto).
- Las ganancias o prdidas de cromosoma completos se indican con el signo + antes del nmero
correspondiente al cromosoma implicado.



Anomalas del nmero de los cromosomas

Las anomalas cromosmicas (cromosomopatas) son un tipo muy importante de patologa gentica. Los
fenotipos provocados por las anomalas cromosmicas son muy variables, pero podemos describir algunas
caractersticas generales que se cumplen en casi todos:

se asocian a retraso en el desarrollo y retraso mental, frecuentemente con talla baja.
se asocian con alteraciones faciales y otras anomalas menores de cabeza y cuello.
se asocian a determinadas malformaciones congnitas (defectos cardacos, malformaciones en
manos y pies, etc) que suelen seguir un patrn especfico de cada sndrome.

148 GENTICA HUMANA
Clsicamente las anomalas cromosmicas se dividen en dos grandes grupos: aquellas debidas a un nmero
anormal de cromosomas (anomalas numricas) y las debidas a alteraciones en la estructura de los
cromosomas (anomalas estructurales). Por lo que respecta a las anomalas numricas, en conjunto
tienen una frecuencia en torno al 0,5% de nacidos vivos (1/200). A continuacin se detalla la frecuencia
de las anomalas numricas ms frecuentes:

Frecuencia de anomalas cromosmicas numricas (por 1000 nacidos vivos):
trisoma 21 1.5
trisoma 18 0.12
trisoma 13 0.07
XXY 1.5
45,X 0.4
XYY 1.5

Las anomalas numricas pueden ser de dos tipos:

Euploidas: constituciones cromosmicas con un nmero total de cromosomas que es mltiplo del nmero
haploide (23 en humanos). Si un cariotipo normal es diploide (46 cromosomas, 2n), es posible encontrar
anomalas numricas debidas a la presencia de otros mltiplos del nmero haploide: tri-ploidas (3n, 69
cromosomas), tetra-ploidas (4n, 92 cromosomas), etc. La nomenclatura aprobada de estos transtornos
consiste en especificar el nmero total de cromosomas seguido de coma (sin espacios) y el conjunto de
cromosomas sexuales. Por ejemplo, una triploida en una mujer se representara como 69,XXX. La
triploida es el tipo ms frecuente de poliploida (se estima que un 2% de todas las concepciones son
triploides), pero la gran mayora son letales y son muy raras en nacidos vivos. Las causas ms frecuentes
son la dispermia (fecundacin de un vulo por dos espermatozoides), la fusin de un vulo con un cuerpo
polar (diginia), un error meitico en la gametognesis que d lugar a un gameto diploide. La tetraploida
(4n) aparece normalmente en las clulas somticas de algunos tejidos, y es el resultado de una
reduplicacin endomittica, en la que hay dos duplicaciones cromosmicas con una sola divisin celular.

Aneuploidas: son alteraciones numricas que no afectan a todo el complemento cromosmico, sino
solamente a un par cromosmico. En ocasiones, la alteracin no afecta a todo el cromosoma, sino slo a un
segmento cromosmico, en cuyo caso suelen denominarse aneusomas segmentarias. Las aneuploidas
son alteraciones con distintos grados de severidad en cuanto a los fenotipos que provocan, aunque en
general se puede decir que son ms graves cuando afectan a un autosoma que a un cromosoma sexual, y
que son ms severas las prdidas de cromosomas (monosomas) que las ganancias de cromosomas
(trisomas). La ausencia completa de un par cromosmico (nulisoma) es incompatible con la vida. A
continuacin veremos algunas de las aneuploidas ms frecuentes en patologa humana:

Trisoma 21 (47,XX XY,+21), Sndrome de Down. Es la causa ms comn de retraso mental
congnito. Presentan una facies caracterstica (en la que destacan las fisuras palpebrales oblicuas,
hipoplasia de la nariz y macroglosia), estatura baja, defectos cardacos y retraso mental variable.
Algunos casos son mosaicos 46,XX/47,XX,+21 (tienen dos poblaciones celulares, una con la trisoma y
otra normal) y son clnicamente ms leves. Alrededor de un 5% de los casos de Sndrome de Down se
deben a una translocacin robertsoniana entre los cromosomas acrocntricos 14 y 21. El resto de los
casos -la gran mayora- son debidos a no-disyuncin durante la gametognesis, de los cuales el 75%
son no-disyunciones en meiosis I. Por las razones que se explicarn ms adelante, existe una mayor
incidencia de Sndrome de Down en mujeres de edad ms avanzada. As, aunque la incidencia global de
CAPTULO 13: CITOGENTICA 149
la enfermedad es de 1 por cada 650 nacidos vivos, las tasas de incidencia desglosada por tramos de
edad materna muestran una clara tendencia, sobre todo a partir de los 30 aos de edad:

Edad materna Riesgo de S. de Down
15 1:1578
20 1:1528
25 1:1351
30 1:909
35 1:384
40 1:112

El riesgo de recurrencia de la enfermedad en una pareja joven (la probabilidad de tener un segundo
hijo con Sndrome de Down) est en torno al 1%. No hay suficiente informacin sobre el riesgo de
transmisin de la enfermedad en individuos que son mosaicos.

La Figura 13.3 muestra el cariotipo de un Sndrome de Down.

Recientemente se ha visto, en un modelo murino, que el funcionamiento de una familia de factores de
transcripcin llamados NFATc (Nuclear Factor of Activated T cells) es muy importante en el desarrollo
de esta enfermedad. Estos factores de transcripcin regulan la expresin de genes durante el
desarrollo, y viajan del ncleo al citoplasma (y viceversa) mediante una fosforilacin que es regulada
por dos genes que estn en el cromosoma 21, en la regin crtica que causa el Sndrome de Down. En
presencia de un nmero alto de copias de estos genes, los NFAT no funcionan adecuadamente y sus
genes diana se expresan dbilmente, lo que podra causar algunas de las manifestaciones fenotpicas de
la enfermedad.

Trisoma 18 (47,XX XY,+18), Sndrome de Edwards. La prevalencia de esta aneuploida es de 1/6000
nacidos vivos. Es la anomala cromosmica que se encuentra ms frecuentemente en abortos
espontneos. Muy pocos casos sobreviven el primer ao de vida.

Trisoma 13 (47,XX XY,+13), Sndrome de Patau. Tiene una prevalencia de 1/10.000 nacidos vivos.
Son rasgos caractersticos de esta enfermedad las fisuras orofaciales, polidactilia y microftalmia. El 90%
de los nacidos vivos fallecen en el primer ao de vida.

Monosoma X (45,X), Sndrome de Turner. Los pacientes con S. de Turner slo tienen un solo
cromosoma X (es la nica monosoma viable en humanos). La frecuencia de la enfermedad es 1/5000
nias recin nacidas. Las enfermas son fenotpicamente mujeres, siendo sus caractersticas ms
comunes la talla corta, malformaciones (cuello corto, pecho en coraza) e inmadurez sexual por
disgenesia gonadal. No suele estar asociado a retraso mental. Se piensa que esta enfermedad se
debe que el cromosoma X contiene genes que escapan a la inactivacin fisiolgica de uno de los
cromosomas X, y que por tanto se necesitan las dos copias para un correcto funcionamiento celular. Al
existir un solo cromosoma X en los sujetos con S. de Turner, estos genes estaran en dosis gnica
mitad de la normal (una sola copia), originando las alteraciones propias de la enfermedad. Tambin
existen individuos con S. de Turner que son mosaicos 46,XX/45,X o tienen anomalas estructurales del
cromosoma X (como el isocromosoma del brazo largo). Los individuos con esta enfermedad suelen
padecer abortos espontneos.

150 GENTICA HUMANA
Sndrome de Klinefelter, 47,XXY. Esta aneuploida se encuentra con una frecuencia de 1/1000 nacidos
varones. Son individuos con talla alta, hipogonadismo y ginecomastia, inteligencia ligeramente inferior
a lo normal. Hasta un 15% de los enfermos muestran mosaicismo. De los raros casos de enfermos con
S. de Klinefelter que tienen cariotipos 48,XXXY y 49,XXXXY se deduce que a mayor nmero de
cromosomas X "extra", la gravedad de la enfermedad y el retraso mental son tambin mayores.


El fenmeno de no disyuncin meitica

Se estima que hasta un 5% de todas las concepciones humanas son aneuploides, aunque la gran
mayora de stas terminan en abortos espontneos y no se reconocen clnicamente. La incidencia de
aneuploidas vara segn el periodo gestacional, tal y como se muestra en la siguiente Tabla:

Frecuencia de anomalas cromosmicas en:
Mortinatos (20 a 40 semanas de gestacin): 4%
Abortos espontneos detectables clnicamente (7 a 8 semanas de gestacin): 35%
Abortos espontneos NO detectables clnicamente (antes de 7 semanas): 20%

Tambin se ha visto que hasta un 20% de los oocitos humanos son portadores de aneuploidas, mientras
que slo el 1-2% de los espermatozoides tienen alteraciones en el nmero de cromosomas. De estos datos
se concluye que la segregacin de cromosomas durante la meiosis especialmente durante la
oognesis es un proceso que no se lleva a cabo de modo totalmente eficaz en humanos. La segregacin
cromosmica incorrecta origina alteraciones cromosmicas en el embrin, pero la mayora de estos
embarazos se pierden porque esas alteraciones son letales en estados iniciales del desarrollo embrionario.

Como se recordar, los cromosomas homlogos y las cromtides hermanas se separan en cada una de las
dos divisiones que tienen lugar durante la meiosis. Las aneuploidas se producen por una separacin
incorrecta (no-disyuncin) en una de las dos divisiones meiticas, aunque lo ms frecuente es la falta de
disyuncin en meiosis I por la presencia de un sobrecruzamiento mal posicionado. Se ha visto en el Captulo
2 que una gonia diploide da lugar a cuatro gametos haploides ya que, tras la replicacin del ADN en el
gonocito primario, la primera divisin meitica genera clulas con un solo cromosoma de cada par (aunque
cada uno tiene todava dos cromtides hermanas); la segunda divisin meitica separa las cromtides
hermanas a cada uno de los gametos. Teniendo este esquema en mente, es fcil comprender que los
efectos de una no-disyuncin en la meiosis I sern distintos a los efectos de una no-disyuncin
en la meiosis II. Si la no-disyuncin ha tenido lugar en meiosis I, se producirn 2 gametos nulismicos
(sin ninguna copia de ese cromosoma) y dos gametos dismicos (con dos copias), los cuales llevarn una
copia de cada cromosoma homlogo presente en la clula progenitora (es decir, son heterodismicos). Por
el contrario, si la no-disyuncin sucede en la meiosis II, tendremos 2 gametos normales, un gameto
nulismico y un gameto dismico con dos copias idnticas (isodismico).

El video de la Figura 13.4 muestra los tipos de gametos resultantes de la no-
disyuncin en meiosis I o en meiosis II.




CAPTULO 13: CITOGENTICA 151

Como se ha mencionado ms arriba, est comprobado que la mayora de los errores de disyuncin
tienen lugar durante la oognesis, especialmente en meiosis I. Esto se ha relacionado con el hecho
de que la gametognesis femenina al contrario de lo que sucede en la espermatognesis experimenta
una meiosis I especialmente larga (comienza en el periodo fetal y culmina individualmente con cada
ovulacin, entre 15 y 45 aos despus). Este hecho podra aumentar la sensibilidad del oocito a sufrir no-
disyunciones. Estudios recientes muestran que la aparicin de no-disyunciones tiene que ver con la
posicin de los quiasmas durante la recombinacin, de modo que los quiasmas que estn demasiado
cerca de los centrmeros o de los telmeros favorecen los errores en la separacin de los cromosomas
homlogos. Actualmente se piensa que la maquinaria que procesa los quiasmas va perdiendo eficacia con
los aos, por lo que los oocitos con quiasmas en localizaciones "subptimas" originan errores de disyuncin
con mayor facilidad en oocitos "viejos" que en oocitos "jvenes". Esto encaja bien con el hecho de que las
aneuploidas son ms frecuentes al aumentar la edad materna.

Respecto a las causas moleculares de la no-disyuncin, es razonable pensar que la des-regulacin de los
procesos de recombinacin, cohesin y separacin de cromtides sea responsable, en buena
medida, de la segregacin deficiente de los cromosomas a las clulas hijas. Como se recordar, durante la
meiosis I cada pareja de quinetocoros hermanos es arrastrada hacia un extremo del huso; si ha habido un
sobrecruzamiento, la cohesin debida a la presencia de los quiasmas se opondr a la fuerza de los
microtbulos que tienden a separar los dos cromosomas homlogos. Por tanto, es fundamental que la
cohesin entre cromosomas homlogos se mantenga a nivel de los centrmeros mientras los homlogos se
separan, para que las cromtides se mantengan unidas hasta la llegada de la meiosis II. En el Captulo 2 se
han esbozado los mecanismos moleculares que regulan estos procesos, por lo que la alteracin de
cualquiera de las protenas implicadas puede provocar la aparicin de aneuploidas. Esto se ha visto
corroborado por la deteccin de alteraciones en estos mecanismos en cncer, que en la mayora de los
casos se asocia con aneuploidas muy marcadas. Se ha visto, por ejemplo, que en tumores colorrectales
aneuploides hay mutaciones en el gen BUB1, que codifica una protena del complejo proteico que regula la
cohesin en los quinetocoros. Adems, se ha demostrado que una securina denominada PTTG (pituitary
tumour transforming gene) tiene propiedades de oncogn: muestra niveles altos de expresin en tumores
pituitarios y es un factor de mal pronstico en cncer de colon, ya que los niveles de PTTG correlacionan con
la invasividad del tumor. Todo esto pone de manifiesto que los genes implicados en los mecanismos que
regulan la segregacin de cromtides hermanas durante la divisin celular son muy importantes para
mantener una correcta segregacin cromosmica durante la mitosis, y es lgico pensar que lo mismo se
puede aplicar a la meiosis.
No disyuncin en Meiosis I No-disyuncin en Meiosis II No disyuncin en Meiosis I No-disyuncin en Meiosis II
152 GENTICA HUMANA


Anomalas estructurales de los cromosomas

Existen muchos posibles tipos de alteraciones en la estructura de los cromosomas. Si la alteracin da lugar
a la prdida ganancia de material gentico, se habla de alteraciones desequilibradas; en el caso
contrario, se denominan equilibradas. Las alteraciones equilibradas no suelen producir patologa en el
individuo que las lleva, aunque determinadas alteraciones equilibradas pueden favorecer la formacin de
aneuploidas en la descendencia, como se ver ms adelante. Se piensa que las alteraciones estructurales
se producen por errores durante la meiosis, bien porque los cromosomas homlogos no se alinean
correctamente bien porque se produce emparejamiento entre secuencias homlogas que pertenecen a
cromosomas distintos. La recombinacin entre cromosomas que no estn correctamente alineados entre
cromosomas que no son homlogos tiene como resultado la generacin de duplicaciones, deleciones,
inversiones, translocaciones, isocromosomas cromosomas en anillo.

La Figura 13.5 muestra distintos tipos de anomalas cromosmicas
estructurales.

Las inversiones son alteraciones estructurales intracromosmicas debidas a la aparicin de dos roturas
dentro de un mismo cromosoma y la inversin completa del segmento que queda entre ellas. Hay
bsicamente dos tipos de inversiones: pericntricas (el centrmero del cromosoma queda incluido dentro
de la regin invertida) o paracntricas (la regin invertida est en uno de los brazos cromosmicos, sin
incluir el centrmero). Habitualmente, las inversiones son equilibradas. Sin embargo, pueden originar
problemas cuando se forman los bivalentes entre cromosomas homlogos durante la recombinacin en
miosis: al formarse el bivalente, el cromosoma con la inversin puede formar un bucle para que todas las
regiones queden alineadas con las correspondientes secuencias del cromosoma homlogo. Si tiene lugar
un sobrecruzamiento dentro del bucle de una inversin paracntrica, se originar un cromosoma
acntrico (sin centrmero) y otro dicntrico (con dos centrmeros). En anafase, cada centrmero del
cromosoma dicntrico migrar hacia cada uno de los polos, formndose un puente que se romper al final
de anafase. El resultado ser la generacin de gametos con diversas deleciones y/o duplicaciones,
dependiendo del punto donde se rompa el puente anafsico. En cambio, si el sobrecruzamiento se
produce dentro de una inversin pericntrica, los dos cromosomas resultantes llevarn un solo
centrmero pero tendrn duplicada delecionada la regin distal a los lmites de la inversin. Por tanto,
aunque un individuo portador de una inversin sea fenotpicamente normal, es importante recordar que en
su descendencia pueden aparecer individuos con reordenaciones des-equilibradas (deleciones o
duplicaciones), aunque no es posible calcular la probabilidad de que esto suceda.

La Figura 13.6 contiene un video en el que se muestran esquemticamente
los tipos de gametos que se generan por una recombinacin entre
cromosomas homlogos, cuando uno de ellos lleva una inversin.

Los isocromosomas son cromosomas en los que ambos brazos son idnticos, y se originan por la prdida
total de uno de los brazos y la duplicacin del otro brazo; el resultado final es un cromosoma simtrico. Los
isocromosomas de cromosomas autosmicos son habitualmente letales; el isocromosoma ms frecuente en
humanos es el del cromosoma X, , que aparece en algunos sujetos con Sndrome de Turner dando lugar a
cariotipos 46,X,i(Xq).
CAPTULO 13: CITOGENTICA 153

Las deleciones pueden ser terminales (afectan a la regin terminal o telomrica de un cromosoma) o
intersticiales. Si son lo suficientemente grandes como para ser visibles citogenticamente suelen ser graves.
Por ejemplo, la delecin denominada 46,XY,del(5p), en la que se pierde un fragmento terminal del brazo
corto del cromosoma 5, es causa del Sndrome de Cri-du-chat (maullido de gato); la delecin terminal
46,XY,del(4p) da lugar al Sndrome de Wolf-Hirschhorn. Desde que se ha utilizado la tcnica de FISH, se
ha conseguido delimitar mejor las deleciones cromosmicas, e incluso se ha podido identificar algunos
sndromes debidos a deleciones que no eran visibles por citogentica convencional (cariotipo de bandas G).
Por esta razn, estas enfermedades se denominan "Sndromes por Microdelecin", aunque tambin se
les llama aneusomas segmentarias o sndromes de genes contiguos (ya que en las pequeas deleciones se
pierden habitualmente varios genes). La siguiente tabla recoge algunos de los principales sndromes por
microdelecin, indicando la regin delecionada y el gen (o genes) implicados en esas deleciones:



Las translocaciones consisten en el intercambio de fragmentos cromosmicos entre cromosomas no
homlogos. Hablamos de translocaciones recprocas cuando ambos cromosomas son donantes y
receptores de material cromosmico, de modo que parte de un cromosoma pasa a otro y, a su vez, parte de
ste pasa al primero. Las translocaciones recprocas desequilibradas, en las que se ha perdido o ganado
material gentico durante el proceso de formacin de la translocacin, son habitualmente causa de
enfermedad. Por el contrario, las translocaciones equilibradas no son necesariamente patognicas, a no
ser que los puntos de rotura en alguno de los cromosomas interrumpan algn gen concreto. En cambio, un
individuo portador de una translocacin recproca equilibrada puede tener descendencia con alteraciones
cromosmicas estructurales. Esto se debe a que, durante la meiosis, los cromosomas translocados se
alinean con los dos cromosomas normales respectivos, dando lugar a la formacin de un tetravalente en vez
de un bivalente. La segregacin de los cromosmas del cuadrivalente a cada gameto puede realizarse segn
un patrn adyacente o alternante: mientras la segregacin alternante puede generar gametos normales
o equilibrados, la segregacin adyacente da lugar a gametos nulismicos o dismicos, que causarn
monosomas o trisomas en el embrin.

La Figura 13.7 explica la segregacin de cromosomas con una translocacin
recproca equilibrada.

Otro tipo importante de translocacin son las llamadas translocaciones Robertsonianas (tambin
denominadas "fusin cntrica"), en las que dos cromosomas acrocntricos se fusionan por sus centrmeros.
Al igual que en las translocaciones equilibradas, los individuos portadores de una translocacin
robertsoniana no suelen padecer ninguna patologa, ya que llevan dos copias completas de cada uno de los
Sndrome Delecin (genes)
Wolf-Hirschhorn 4p16.3
Williams-Beuren 7q11.23 (elastina)
WAGR (Wilms, aniridia, genital defects, growth retardation) 11p13 (WT1 y PAX6)
Prader-Willi/Angelman 15q11-q13
Rubinstein-Taybi 16p13.3 (CBP)
Miller-Diecker lisencefalia 17p13.3 (LIS1)
Smith-Magenis 17p11.2 (KER)
Alagille 20p12.1-p11.23 (Jagged1)
DiGeorge (CATCH22) 22q11.21-q11.23
154 GENTICA HUMANA
cromosomas implicados (la copia normal ms la copia presente en el cromosoma con la translocacin). En
cambio, en la descendencia s que pueden aparecer monosomas o trisomas de los segmentos implicados.
Esto se debe a que durante la meiosis el cromosoma con la fusin cntrica se aparear con los dos
cromosomas homlogos correspondientes, formando un trivalente en vez de un bivalente. El resultado de
esta estructura, dependiendo de cmo sea la segregacin, ser la formacin de gametos normales
(segregacin alternante) o de gametos nulismicos o dismicos (segregaciones adyacentes), que a
su vez provocarn monosomas o trisomas en la descendencia.

En la Figura 13.8 se muestra la segregacin de cromosomas con una
translocacin robertsoniana.



CAPTULO 14: MUTACIONES SIMPLES COMO CAUSA DE ENFERMEDAD 155
Captulo 14. Mutaciones simples como causa de enfermedad.
Caractersticas generales de las mutaciones. Mutaciones simples: tipos y
nomenclatura. Potencial patognico de las mutaciones en el ADN codificante
y en el ADN no-codificante intragnico e intergnico.


Caractersticas generales de las mutaciones

Ya se ha mencionado que el genoma humano est sujeto a variacin gentica y que esta capacidad de
introducir modificaciones genticas heredables supone una ventaja para la especie, al permitir la adaptacin
a condiciones ambientales cambiantes. Sin embargo, la existencia de una tasa mutacional basal tiene el
peligro de introducir cambios genticos deletreos en un individuo o una familia concreta, provocando
enfermedades heredables. Por tanto, de modo general podemos decir que la presencia de mutaciones en
una poblacin est sujeta al juego entre la tasa mutacional basal (la velocidad a la que se producen) y la
presin selectiva frente a cada una de las mutaciones, de forma que aquellas mutaciones que sean muy
agresivas no se extendern al resto de la poblacin tan rpidamente como mutaciones con efectos
fenotpicos ms leves. Por ejemplo, ya hemos visto en otro captulo que las aberraciones cromosmicas
(trisomas, monosomas, etc) son raras pero casi siempre patognicas, mientras que los polimorfismos de
secuencia variantes allicas que no causan ninguna enfermedad son mucho ms frecuentes. En cierto
modo, lo mismo sucede con los distintos tipos de mutaciones: aquellas que provocan alteraciones graves del
producto proteico, que estn sometidas a una fuerte presin selectiva en su contra, suelen ser menos
frecuentes que mutaciones con efectos ms leves.

Antes de estudiar todos los posibles tipos de mutaciones, ser de gran utilidad recordar la estructura y
procesamiento de un gen tpico, porque esto nos ayudar a comprender cmo se clasifican y sus efectos.
Recordemos que en el ADN genmico se puede distinguir una regin 5' no-traducida (desde el inicio de la
transcripcin hasta el ATG que seala el inicio de la traduccin), exones separados por intrones (que
contienen las secuencias consenso de ayuste GT-AG), el codn de terminacin (TAA en la figura) y la
regin 3' no traducida, que incluye la seal de poliadenilacin (AATAAA). La transcripcin del gen y la
posterior maduracin del transcrito primario dan como resultado el ARNm maduro, que despus es
traducido en la protena correspondiente. En general, los distintos tipos de mutaciones que se encuentran
en un gen pueden ser tanto mutaciones simples (deleciones, inserciones o substituciones que afectan a
un nucletido o a unas pocas bases) o reordenamientos grandes (deleciones parciales o reordenamientos
que dan lugar a duplicaciones o deleciones del gen).

En la Figura 14.1 se muestran esquemticamente los distintos tipos de
mutaciones que se pueden encontrar en un gen, y cmo afectan a su funcin.

A lo largo de este captulo, veremos con detalle los distintos tipos de mutaciones que provocan
enfermedades humanas.


Mutaciones simples: tipos y nomenclatura

156 GENTICA HUMANA
Las substituciones simples de un nucletido por otro se denominan transiciones
transversiones, segn provoquen el cambio de purina por purina pirimidina por
pirimidina (transiciones), o el cambio de una purina por pirimidina viceversa
(transversiones). En el esquema adjunto, las transiciones se representan por flechas
grises y las transversiones por flechas negras. Como puede apreciarse, las
transversiones deberan ser el doble de frecuentes que las transiciones (8 posibles
transversiones por 4 posibles transiciones). En cambio, al analizar las mutaciones presentes en
enfermedades humanas encontramos que las transiciones son ms frecuentes. Esto es debido a que
en general las transiciones provocan una alteracin menos severa del producto proteico, por lo que la
presin selectiva contra ellas es menor. Adems, el dinucletido CpG suele estar metilado en la citosina, y la
des-aminacin espontnea de una metil-citosina da lugar a una transicin del tipo CT. Como este
cambio tiene lugar con relativa frecuencia en el genoma de mamferos, esto tambin contribuye a la alta
frecuencia de transiciones que se observa en estas especies.


Potencial patognico de las mutaciones en el ADN codificante

Cuando las substituciones simples tienen lugar en ADN codificante, sus efectos pueden ser de varios
tipos:

a) substituciones silenciosas (llamadas sinnimas, sin cambio de sentido): no cambian ningn
aminocido en la protena codificada, debido a que la mutacin cambia un codn por otro codn
sinnimo. Como son biolgicamente neutras, no estn sujetas a seleccin y por tanto son
relativamente frecuentes en ADN codificante. Habitualmente se producen por cambios en la tercera
base de un triplete, ya que es habitualmente este nucletido el que vara entre codones sinnimos.

b) substituciones no-sinnimas (el cambio de nucletidos origina un cambio en la capacidad codificante
del ARNm). Segn el cambio introducido, podemos distinguir:

- Mutaciones con cambio de sentido (mis-sense, en ingls), cuando el cambio de nucletidos
provoca un cambio de aminocidos. Se habla de cambio conservativo cuando ambos aminocidos
(el original y el nuevo) pertenecen al mismo grupo bioqumico, o no conservativo cuando
pertenecen a grupo distintos. Estos ltimos son en general ms graves, puesto que alteran la
estructura de la protena en mayor grado. Tambin son importantes los cambios que afectan a
Cistenas y Prolinas, que son aminocidos muy importantes en el mantenimiento de la estructura
terciaria de la protena.

- Mutaciones sin sentido (non-sense), cuando un codn que codifica un aminocido se convierte en
un codn de parada (UAA, UAG UGA). Estas mutaciones dan lugar a protenas truncadas en la
regin C-terminal, adems de disminuir la estabilidad del ARNm. En general son muy graves, por lo
que son menos frecuentes que las mutaciones con cambio de sentido.

En la figura 14.2 se muestran distintos tipos de mutaciones puntuales y
su efecto sobre el producto proteico.

- Mutaciones con ganancia de sentido, cuando la mutacin transforma un codn de parada en un
codn codificante. Son casos infrecuentes, entre los que destaca el de una variante de la
A
G
C
T
CAPTULO 14: MUTACIONES SIMPLES COMO CAUSA DE ENFERMEDAD 157
hemoglobina denominada "Hemoglobina Constant Spring" (variante allica HBA20001),
originada por el cambio de UAA (codn de parada) a CAA. Esto tiene como resultado la adicin de
30 aminocidos a la secuencia de la hemoglobina alfa-2, que se hace ms inestable y provoca una
enfermedad de la sangre llamada alfa-talasemia.

En la figura 14.3 se esquematiza la mutacin que origina la
hemoglobina Constant Spring.

c) Deleciones e inserciones de uno de unos pocos nucletidos pueden introducir o eliminar
aminocidos sin cambiar la pauta de lectura, siempre que se trate de inserciones o deleciones de tres
nucletidos ( mltiplos de tres). Cuando se insertan o delecionan nucletidos en un nmero que no es
mltiplo de tres, se produce un frameshift (desplazamiento del marco de lectura) con un cambio
muy importante en la estructura proteica. Para comprender las mutaciones con cambio del marco de
lectura, es importante repasar este concepto, ya presentado en el Captulo 1.

En la Figura 14.4 se recuerda el concepto de marco de lectura (frameshift)
y se muestra su desplazamiento por efecto de distintos tipos de
inserciones.


LOS QUE VES SON LOS QUE SON ...
LOS QaU EVE SSO NLO SQU ESO N.. FRAMESHIFT +1
LOS Qab UEV ESS ONL OSQ UES ON. FRAMESHIFT +2
LOS Qab cUE VES SON LOS QUE SON INSERCIN 3bp (2 aa)


Al igual que las mutaciones sin sentido, las mutaciones con cambio del marco de lectura provocan
alteraciones importantes del producto proteico y, por tanto, estn sometidas a mayor presin selectiva, por
lo que suelen ser menos frecuentes en ADN codificante que las mutaciones sinnimas. Adems, los
cambios del marco de lectura suelen introducir codones de parada prematuros, por lo que habitualmente se
producen tambin protenas truncadas que ven muy comprometida su funcionalidad.

Otro mecanismo por el que puede perderse o recuperarse el marco de lectura es la edicin del ARN,
fenmeno que ya se explic en el Captulo 1. Una variedad curiosa de edicin del ARN surge en unas ratas
que tienen una delecin de un solo nucletido en el gen de la vasopresina, haciendo que desarrollen
hipertensin arterial. Estas ratas mejoran espontneamente al envejecer, debido a un proceso de edicin
del ARNm mediante el cual se pierde el dinucletido GA en un motivo GAGAG de ese mismo gen. La
delecin de estos dos nucletidos, aadida a la delecin de un nucletido que ya tenan, hace que se
recupere el marco de lectura original y que se produzcan mayores niveles de vasopresina funcional.
Recientemente, se ha encontrado un motivo GAGAGA en el gen de la protena precursora de
amiloide-| (|-APP) y se ha visto que tiene lugar una edicin similar, con delecin de dos bases en el
ARNm y la interrupcin del marco de lectura que produce una protena truncada y es causa de algunos
casos de enfermedad de Alzheimer en humanos.


Potencial patognico de las mutaciones en el ADN no-codificante
158 GENTICA HUMANA

Las mutaciones simples que tienen lugar en ADN no codificante intragnico (es decir, en intrones y
regiones no traducidas) son silenciosas, excepto cuando afectan a las secuencias de consenso para ayuste
(splicing) de los extremos 5' y 3' de los intrones. En este caso, podemos encontrar:

- Mutaciones que destruyen una de las secuencias de consenso. Si esto tiene lugar en ausencia de
secuencias de ayuste crpticas (escondidas) y en intrones pequeos, habitualmente se lee todo el
intrn, que queda as incluido en el ARNm. Esto hace que se aadan aminocidos a la protena,
aunque tambin es posible que se introduzca un cambio en el marco de lectura y se altere toda la
secuencia de aminocidos a partir de ese punto.

- Si la mutacin que destruye la secuencia de ayuste tiene lugar en presencia de una secuencia de
ayuste crptica en ese mismo intrn, el exn vecino ser ms largo; por el contrario, si la secuencia
crptica est en el exn cercano a la mutacin, dicho exn ser ms corto.

- En ocasiones, las mutaciones que destruyen una de las secuencias consenso de ayuste hacen que se
"salte" el exn adyacente (lo que en ingls se denomina skipping del exn), dando lugar a una
protena que ha perdido un cierto nmero de aminocidos, aunque tambin es posible que produzca un
cambio en el marco de lectura. El exn afectado ser el 5 o el 3 a la mutacin, segn se destruya el
GT el AG de un intrn, respectivamente.

En la Figura 14.5 se muestran distintas mutaciones que afectan a las
secuencias consenso de ayuste.


Un caso especial de este tipo de mutaciones es la transicin AG en posicin +3 de la secuencia
donante de ayuste, una alteracin que est asociada con desarrollo de enfermedades en al menos
8 genes humanos. Como se recordar, la secuencia donante de ayuste (la del extremo 5' del intrn) es
Exon 1 Exon 2
Intron 1
GUC CAUUCA
ARNnp U1
CAG GUAAGU
UGAC...[C/U] [C/U][C/U][C/U] [C/U] [C/U]UG AG
Exon 1 Exon 2
Intron 1
GUC CAUUCA GUC CAUUCA
ARNnp U1
CAG GUAAGU CAG GUAAGU CAG GUAAGU
UGAC...[C/U] [C/U][C/U][C/U] [C/U] [C/U]UG AG
CAPTULO 14: MUTACIONES SIMPLES COMO CAUSA DE ENFERMEDAD 159
complementaria a la secuencia del ARN nuclear pequeo U1 (U1snRNA), cuya presencia es necesaria
para que se lleve a cabo el proceso de ayuste. Los dos primeros nucletidos del intrn son siempre GT
(complementarios a CA en el U1snRNA), y el tercer nucletido de la secuencia de ayuste suele ser
adenina (complementaria al uracilo correspondiente en el U1snRNA). En cambio, las posiciones +4 a
+6 no siempre son perfectamente complementarias. De hecho, la adenina en posicin +3 dota de
cierta flexibilidad a los nucletidos de las posiciones +4 a +6, que pueden ser discordantes de la
secuencia del U1snRNA y an as son capaces de funcionar correctamente como secuencia donante de
ayuste. En cambio, si alguna de las posiciones +4 a +6 no son complementarias a la secuencia del
U1snRNA, una mutacin en la posicin +3 tiene como resultado la falta de funcionalidad de esta
secuencia de ayuste, con lo que se salta el exon precedente.

La figura 14.6 muestra una mutacin de la posicin +3, que provocar el
skipping del exon 16 del gen COLQ.

- Finalmente, existen mutaciones que, sin afectar directamente a secuencias consenso de ayuste, pueden
activar un lugar crptico en un intrn y producir un exn ms grande y posiblemente un cambio en
el marco de lectura.

La figura 14.7 muestra la creacin de secuencias de ayuste crpticas
intrnicas.

Como regla general, podemos afirmar que las mutaciones que afectan al mecanismo de ayuste son ms
raras que las substituciones, aunque algunos genes tienen una estructura exnica que les otorga una
tendencia especial a sufrir mutaciones de este tipo: se trata, habitualmente, de genes con muchos
intrones y con exones pequeos, como sucede con los genes que codifican cadenas del colgeno (COL7A1,
por ejemplo, tiene 118 exones), o bien genes con muchos sitios crpticos de ayuste (como es el caso del gen
de la beta-globina).

Como se explicaba en el Captulo 1, recientemente se ha descrito que ciertas secuencias exnicas o
intrnicas pueden actuar como potenciadores o silenciadores del ayuste. Estas secuencias se denominan
ESE (Exonic Splicing Enhancers) ESS (Exonic Splicing Silencers) cuando estn en exones; ISE
ISS cuando estn en intrones. A estas secuencias se unen protenas llamadas protenas SR (las que se
unen a los potenciadores de ayuste) o algunas hnRNP (las que se unen a los silenciadores). Por tanto,
estas protenas regulan el proceso de ayuste y determinan si un exn va a estar presente en el transcrito
final o, por el contrario, se va a saltar. Es importante tener en cuenta que algunas mutaciones en estos
motivos, aunque sean silenciosas porque no cambian el aminocido (o porque se localizan en intrones),
pueden sin embargo tener efectos sobre el mensajero, haciendo que un exn se pierda y alterando as la
estructura de la protena o rompiendo el marco de lectura. De hecho, en algunos genes (ATM, NF1) se
ha estimado que el 50% de las mutaciones que originan enfermedades afectan a regiones que
cambian el patrn de ayuste sin cambiar la secuencia de aminocidos. Un buen ejemplo para ilustrar
esta situacin es una enfermedad llamada Atrofia Muscular Espinal, debida a deleciones y/o mutaciones
del gen SMN1. Cerca de este gen hay un gen parlogo casi idntico llamado SMN2, en el que un cambio C
T modifica el patrn de ayuste (sin cambiar la secuencia de aminocidos) y hace que el exn 7 se pierda,
dando lugar a una protena truncada no funcional. De todas formas, un pequeo porcentaje de las
molculas siguen un ayuste normal (con el exn 7) y producen protena normal a partir del gen SMN2. Por
tanto, aunque no haya ninguna copia funcional de SMN1 (como sucede en enfermos con atrofia muscular
espinal) la enfermedad tiene distinta gravedad segn el nmero de copias de SMN2 presentes. De hecho, se
160 GENTICA HUMANA
piensa que esta circunstancia podra utilizarse para corregir la sintomatologa de los pacientes con Atrofia
Muscular Espinal.

La figura 14.8 muestra la diferencia de ayuste entre los genes SMN1 y SMN2.




Otro tipo de mutaciones del ADN no-codificante intragnico son las que afectan a la seal de poli-
adenilacin, que se encuentra en la regin no traducida 3 de un gen. Estas mutaciones pueden originar
protenas defectuosas llevar a la degradacin del ARNm. Por ejemplo, una mutacin en la seal de
poliadenilacin del gen que codifica la hemoglobina alfa-2 (alelo HBA2 0024) convierte la seal AATAAA
en AATGAA, con lo que el ARNm no se poli-adenila correctamente, el ARNm se degrada y se desarrolla la
enfermedad alfa-talasemia por ausencia de cadenas de hemoglobina alfa-2.

Finalmente, las substituciones en el ADN no codificante intergnico, sern silenciosas excepto
cuando afectan a elementos reguladores de la expresin gnica (promotores, potenciadores, etc) o a otros
elementos necesarios para el correcto procesamiento del ARNm. Por ejemplo, mutaciones que afectan a la
Regin de Control del Locus de las alfa- y beta-globinas (un conjunto de potenciadores situados unas
4060 kb en direccin 5' de los genes respectivos) provocan unas enfemedades denominadas talasemias,
debidas a la sntesis deficiente de globinas.

Nomenclatura general de mutaciones: Llegados a este punto, interesa estudiar la nomenclatura
recomendada para describir los distintos tipos de mutaciones que hemos visto hasta ahora. Aunque las
recomendaciones van cambiando con el paso de los aos, a continuacin se resumen las reglas principales:

1. Describir la mutacin utilizando la numeracin de nucletidos de la secuencia genmica (g.) o del ADNc
(c.) o la numeracin de la secuencia de aminocidos, segn los casos. Siempre la Adenina del codn de
iniciacin ATG se toma como posicin +1, de forma que el nucletido anterior es la posicin -1.

2. Describir las substituciones de nucletidos segn el esquema general:
Intervalo + secuencia antigua + tipo de cambio + secuencia nueva.
Utilizar una flecha el signo ">" para las sustituciones, "del" para deleciones, "ins" para inserciones.
Los rangos se indican con guin bajo (de subrayado) para evitar confusiones con el signo negativo. Las
6 8
CAGACAA
6 8
UAGACAA
SMN1
SMN2
SMN1
SMN17
6 8
CAGACAA CAGACAA
6 8
UAGACAA UAGACAA
SMN1
SMN2
SMN1
SMN17
CAPTULO 14: MUTACIONES SIMPLES COMO CAUSA DE ENFERMEDAD 161
combinaciones de dos o ms alteraciones se separan con el signo + y se incluyen en corchetes. Algunos
ejemplos:

g.12T>A (Cambio de timina por adenina en el nucletido 12 de la secuencia genmica)
[6T>C + 13_14del] (Dos cambios en el mismo alelo)
[6T>C] + [13_14del] (Dos mutaciones, una en cada alelo)
14-15insT (Insercin de timina entre dos nucletidos)
112_117delAGGTCAinsTG (Insercin de TG en vez de AGGTCA, tambin se podra indicar como
112_117>TG)

3. En repeticiones en tandem, se asigna por convenio el cambio a la ltima repeticin (la que ocupa una
poscin ms 3): por ejemplo, la delecin de un dinucletido TG en la secuencia ACTGTGTGCC (siendo A el
nucletido 1991) se describira como 1997-1998del ( 1997-1998delTG).

4. La variabilidad en microsatlites se designa contando la posicin de la primera repeticin. Si la
secuencia del ejemplo anterior fuese polimrfica, se designara 1993(TG)3-22, para indicar que en
posicin 1993 comienza un dinucletido TG que se encuentra en la poblacin repetido entre 3 y 22 veces.

5. En intrones (cuando no se conoce la secuencia genmica), se seala la posicin dentro del intrn con
referencia al exn ms cercano (utilizando nmeros positivos comenzando con la G de la secuencia de
ayuste GT donante, y nmeros negativos contando desde la G de la secuencia AG aceptora). Se puede usar
tanto la sigla IVS como sinnimo de intrn, como la numeracin correspondiente a la secuencia del ADNc.
Ejemplos:

IVS3+1G>T c.621+1G>T (621 es el ltimo nucletido del exn 3, luego +1 es la G de la
secuencia donante GT del intrn 3)
IVS6-5C>A c.1781-5C>A (1781 es el primer nucletido del exn 7, luego 1 es la G de la
secuencia aceptora AG del intrn 6, -2 es la A, y as sucesivamente hasta llegar a -5).

6. Para describir substituciones de aminocidos, se indica el nmero del aminocido y el cambio
operado, considerando la metionina iniciadora como +1. Se sigue el esquema general aminocido
cambiado + rango + aminocido nuevo.
Se recomienda usar el cdigo de aminocidos de una letra, aunque tambin puede utilizarse el de tres
letras, empleando la letra X para indicar un codn de parada. Ejemplos:

R117H (la Arg en posicin 117 pasa a His)
G542X (la Gly 542 se convierte en codn de parada)
T97del (delecin de la treonina 97) T97_C102del (delecin de los aminocidos 97 a 102)
T97_W98insLK (insercin de leucina y lisina entre las posiciones 97 y 98, ocupadas por treonina y
triptfano)


162 GENTICA HUMANA
CAPTULO 15: POTENCIAL PATOGNICO DE LAS SECUENCIAS REPETIDAS 163
Captulo 15. Potencial patognico de las secuencias repetidas.
Mutaciones en secuencias que estn repetidas en tndem. Expansin de
trinucletidos: neuropatas por expansiones de CAG y enfermedades por
expansin de otros trinucletidos. Otras enfermedades por expansin de
secuencias repetidas. Mutaciones debidas a repeticiones dispersas.
Desrdenes genmicos.

Adems de las mutaciones simples estudiadas en el captulo anterior, puede haber mutaciones ms
complejas que afectan a secuencias repetidas, tanto repeticiones en tandem (mini- y micro-satlites) como
repeticiones dispersas (elementos Alu, LINE, etc).


Mutaciones en secuencias que estn repetidas en tndem

Un tipo de mutacin que afecta con frecuencia a las repeticiones cortas en tndem de tipo microsatlite es
la expansin o contraccin de la repeticin. Como ya vimos al estudiar los mecanismos de reparacin,
este fenmeno se produce habitualmente por un mecanismo llamado "desemparejamiento por deslizamiento
de cadenas" (slipped-strand mispairing en ingls). Dicho proceso puede tener lugar durante la replicacin
del ADN que contiene la repeticin, si se da un deslizamiento hacia atrs hacia delante de la cadena que
est siendo sintetizada sobre la cadena molde. Este deslizamiento origina un bucle en una de las cadenas,
cuyo resultado final es que la nueva cadena de ADN tendr una repeticin ms o una repeticin menos que
la cadena original, segn el desplazamiento haya sido hacia atrs o hacia delante, respectivamente. Este
mecanismo explica los polimorfismos de longitud de los microsatlites, que ya hemos estudiado al hablar de
estos marcadores en el Captulo 1.

La Figura 15.1 muestra esquemticamente el mecanismo de expansin de un
trinucletido por deslizamiento de una cadena durante la replicacin.

Lo importante ahora es darse cuenta de que si la expansin o contraccin tiene lugar en la regin
codificante de un gen que contiene repeticiones en tandem cortas, el resultado ser la aparicin de
deleciones de aminocidos (si se delecionan 3 nucletidos)
cambios en el marco de lectura (si se delecionan repeticiones de
1, 2, 4 5 nucletidos). Se presentan a continuacin dos
ejemplos de lo dicho. En el cuadro superior observamos, arriba, la
secuencia nativa del gen CFTR (mutado en una enfermedad
llamada "Fibrosis Qustica del pncreas"), que contiene una
repeticin en tandem del nucletido Timina (hay 5 Timinas
seguidas en los codones 142 y 143). La delecin de una T por el
fenmeno que acabamos de describir provocar un cambio del
marco de lectura, como se aprecia en la fila de debajo. En el
cuadro inferior vemos un ejemplo de delecin de un trinucletido
TTG en la regin codificante del Factor IX de la coagulacin: la secuencia nativa (fila superior) contiene dos
repeticiones TTG en tandem, de modo que la delecin de una de ellas provoca la delecin de un aminocido
sin alterar el marco de lectura (fila inferior). Lgicamente, lo mismo que se ha ilustrado aqu con deleciones
puede decirse de las inserciones. Los microsatlites del tipo trinucleotdico pueden adems sufrir
141 142 143 144 145
GCC ATT TTT GGC CTT

141 142 143 144 145
GCC ATT TT*G GCC TT
329 330 331 332 333
CCA CTT GTT GAC CGA

329 330 331 332
CCA CTT G** *AC CGA
164 GENTICA HUMANA
expansiones mayores, dando lugar a un grupo de enfermedades conocidas como "enfermedades por
expansin de trinucletidos". Dada su importancia en patologa humana, las estudiamos con ms detalle en
el siguiente apartado.


Expansin de trinucletidos y el fenmeno de anticipacin

Hay un grupo de enfermedades debidas a la expansin de repeticiones de trinucletidos, que tienen una
serie de rasgos en comn. El descubrimiento del mecanismo por el que se desencadenan estas
enfermedades ayud a comprender un fenmeno clnico que se conoca con el nombre de anticipacin:
la aparicin de la enfermedad a una edad cada vez ms temprana y de forma ms severa en sucesivas
generaciones de una misma familia. Como veremos, la presencia de secuencias trinucleotdicas inestables,
que aumentan de tamao en cada generacin, permiti explicar este fenmeno.

Las enfermedades por expansin de trinucletidos pueden agruparse en dos grandes categoras: (1)
enfermedades debidas a expansiones cortas (40 a 70 repeticiones) de un trinucletido CAG localizado en la
regin codificante de un gen; y (2) enfermedades debidas a expansiones mayores (desde 50 hasta miles de
repeticiones) de trinucletidos situados en regiones no codificantes. Como ya hemos comentado, el
mecanismo de expansin ms probable es el desemparejamiento por deslizamiento de cadenas, aunque las
grandes expansiones son ms fciles de explicar mediante un mecanismo de reparacin por recombinacin
homloga. De todas formas, todava no se explica bien por qu en estas secuencias se dan muchas ms
expansiones que contracciones.


Neuropatas por expansiones de CAG

Las enfermedades del primer grupo tienen como resultado la expansin de un tracto de poliglutaminas
en la protena codificada por el gen respectivo, y constituyen un grupo de enfermedades
neurodegenerativas de gran importancia. La siguiente tabla resume las caractersticas ms importantes
de cada una de estas enfermedades:

Repeticin Normal Enfermedad Localizacin Efecto
Huntington CAG 11-34 40-121 ORF (HD) Ganancia
Smith (Haw-River) (DRPLA) CAG 7-34 49-88 ORF (DRPLA) Ganancia
Kennedy (SBMA) CAG 9-36 38-62 ORF (AR) Ganancia
SCA1 CAG 6-39 40-82 ORF (SCA1) Ganancia
SCA2 CAG 15-24 32-200 ORF (SCA2) Ganancia
SCA3/MJD CAG 13-36 61-84 ORF (SCA3) Ganancia
SCA6 CAG 4-20 20-29 ORF (CACNA1A) Ganancia
SCA7 CAG 4-35 37-306 ORF (SCA7) Ganancia
SCA17 CAG 25-42 47-63 ORF (TBP) Ganancia
SCA12 CAG 7-45 55-78
5UTR?
(PPP2R2B)
?
CAPTULO 15: POTENCIAL PATOGNICO DE LAS SECUENCIAS REPETIDAS 165

El modo de expansin, en general, es gradual. As, la inestabilidad va aumentando con el tamao de la
expansin: por debajo de las 40 repeticiones, la frecuencia de expansiones es baja, pero al llegar a un
rango de 40 a 100 repeticiones la inestabilidad ya es prcticamente del 100%. Adems, se observan
diferencias si la transmisin es materna (las repeticiones de la descendencia se distribuyen normalmente
alrededor de la media materna) o paterna (produce repeticiones con una media ms alta que la paterna,
con tendencia a aumentar en funcin de la edad paterna).

El mecanismo patognico en estas enfermedades se ha atribuido a la expansin de un tracto de glutaminas
en las protenas implicadas, lo que llevara al mal plegamiento y/o formacin de agregados proteicos que
alteran la funcin neuronal. En general, se piensa que la expansin produce una ganancia de funcin, ya
que mutaciones y deleciones que anulan la funcin de esos mismos genes no dan lugar a la misma
enfermedad que la expansin del trinucletido. Por ejemplo, la expansin de un trinucletido CAG en el gen
del receptor de andrgenos da lugar a la Atrofia Muscular Espino-Bulbar (SBMA, Enfermedad de Kennedy),
mientras que las mutaciones de ese mismo gen provocan el Sndrome de feminizacin testicular. Por otro
lado, la longitud de la expansiones correlaciona con la gravedad de la sintomatologa, lo que hace pensar
que estas enfermedades se deben a una ganancia de funcin con un efecto txico que aumenta con el
nmero de glutaminas que lleva la protena, probablemente a partir de un umbral de 35-40 residuos.
Tambin se ha demostrado que, para provocar degeneracin neuronal, las protenas mutantes deben
entrar en el ncleo, ya que cuando se envan al citoplasma no se observa efecto patognico alguno. Esto
sugiere que pueden interaccionar con factores de transcripcin ricos en glutamina y alterar la
transcripcin de genes necesarios para la supervivencia neuronal. De hecho, se ha demostrado que
la acetilasa de histonas CBP (co-activador transcripcional del que hemos hablado en el captulo 2) es
secuestrada en presencia de protenas con tractos de poli-glutaminas, con lo que se altera la expresin de
genes necesarios para la supervivencia neuronal. Dado que las protenas con tractos de poli-glutaminas
pueden unirse entre s por interacciones protena-protena, otros factores de transcripcin con poli-
glutaminas tambin podran quedar secuestrados en estas enfermedades. De hecho, se ha visto
recientemente que el factor de transcripcin TAFII130, un componente de TFIID, interacciona con el factor
de transcripcin Sp1 a travs de regiones con tractos de glutaminas; la presencia de una protena con
tractos largos de poliglutaminas podra impedir esta interaccin y cancelar la expresin de los genes
regulados por estos factores. En el caso concreto de la huntingtina (la protena codificada por el gen
mutado en la Enfermedad de Hutington) se ha demostrado, por ejemplo, que la presencia de huntingtina
con expansin de glutaminas impide la expresin del gen que codifica el receptor D2 de la dopamina,
mediante un mecanismo como el descrito.

En la Figura 15.2 se esquematiza un posible mecanismo patognico de la
huntingtina que lleva expansin de un tracto de glutaminas.


Enfermedades por expansin de otros trinucletidos

El segundo grupo de enfermedades por expansin de trinucletidos incluye enfermedades ms
heterogneas, aunque tambin se caracterizan por afectar al sistema nervioso. Sus caractersticas se
resumen en la siguiente tabla, donde se muestra que la inestabilidad propia del rango de 40-100
repeticiones (llamado en estos casos "premutacin") no causa la enfermedad, sino que favorece la
aparicin de una expansin explosiva, llegando de golpe hasta varios miles de repeticiones ("mutacin
completa"), que ya causa la enfermedad. Esta "explosividad" no se produce cuando la repeticin est
166 GENTICA HUMANA
interrumpida por un triplete distinto; por ejemplo, algunos alelos del gen FRAXA tienen repeticiones del
trinucletido CGG que estn interrumpidas por el trinucletido AGG cada 10 repeticiones CGG, y esos alelos
no sufren expansin.



En estas enfermedades, como regla general, el efecto patognico es resultado de la prdida de funcin de la
protena de la alteracin en la funcin del ARNm, ya que las expansiones estn en regiones no
codificantes. En este grupo destacan:

- Sndrome del X frgil. Es la causa ms frecuente de retraso mental ligado al cromosoma X (un 40%
de los casos) y la causa heredada ms frecuente de retraso mental aislado. Inicialmente, esta
enfermedad se detectaba por el cariotipo, que muestra una rotura en Xq27.3 cuando las clulas se
cultivan en presencia de metrotexato en ausencia de folato. Posteriormente, la identificacin en 1991
del gen FMR1 revel la existencia de un gen de 38 kb y 17 exones, con un trinucletido CGG en una isla
CpG de la region promotora del gen. Fue el primer ejemplo de una enfermedad originada por la
expansin de una repeticin de trinucletidos. Las mutaciones de la regin codificante son raras, pero
tambin provocan la enfermedad cuando implican disminucin de la protena FMRP, lo que sugiere que
la expansin del trinucletido provoca una prdida de funcin. La protena codificada por el gen es
citoplasmtica y se expresa en cerebro (por igual en todos los tipos de neuronas, aunque no se expresa
en clulas no-neuronales), as como en testculo (en clulas germinales pero no en clulas de Sertoli
de Leydig). La protena posee dominios de unin al ARN y dominios de unin a otras protenas, y se ha
comprobado que se une a su propio mensajero, a un 4% de todos los ARNm de cerebro fetal, y tambin
a la subunidad 60S de los ribosomas. Podra por tanto entrar en el ncleo, capturar mensajeros y
exportarlos al citoplasma como parte de la maquinaria traduccional, especficamente aquellos
mensajeros que son cruciales para el desarrollo de las dendritas y para la funcin sinptica en las
neuronas. Curiosamente, se ha visto que la mayor parte de los ARNm que se unen a FMRP forman
estructuras secundarias llamadas cuartetos-G, debido a la presencia de Guaninas espaciadas
regularmente; mediante estas estructuras, los mensajeros se unen al dominio RGG (arginina-
glicina-glicina) de la FMRP. Tambin se ha visto que, en Drosophila, la protena FMRP forma parte del
complejo de silenciamiento por interferencia de ARN (RISC), lo que abre la posibilidad de que dicho
mecanismo tambin est implicado en la fisiopatologa del Sndrome del X frgil. Aunque el hallazgo del
gen y la elucidacin de la estructura de la protena todava no han permitido desvelar completamente el
mecanismo fisiopatolgico de la enfermedad, s han servido para explicar el modo inusual de transmisin
de la misma, que se ver en un captulo posterior.

La Figura 15.3 muestra la estructura de los cuartetos G.

La distrofia miotnica se puede producir por alteraciones en 2 loci. La forma ms frecuente es la
DM1, debida a la expansin del trinucletido CTG en la regin no traducida-3 del gen DMPK,
Repeticin Normal Pre-mutacin Mutacin Localizacin
Distrofia Miotnica (DM1) CTG 5-37 50-80? 80-2000+ 3 UTR (DMPK)
X Frgil (FRAXA) CGG 6-52 59-230 230-2000+ 5 UTR (FMRP)
X Frgil (FRAXE) GCC 4-35 (35-61)? 200-900 5' UTR (FMR2)
Ataxia Friedreich GAA 6-32 (35-40)? 200-1700 Intron (FRDA)
SCA8 CTG 16-37 ? 107-127 3 UTR (SCA8)
CAPTULO 15: POTENCIAL PATOGNICO DE LAS SECUENCIAS REPETIDAS 167
que codifica una proten-quinasa. Como la enfermedad se hereda de forma autosmica dominante,
parece que el complejo fenotipo de esta enfermedad (que incluye miotona muscular, cataratas y
arritmias cardacas) debe ser el resultado de la alteracin de algn proceso celular importante. De
hecho, se ha comprobado que la expansin del trinucletido CTG en el gen DMPK inhibe la expresin
de un gen vecino llamado SIX5. Se ha visto que los ratones knock-out para el gen DMPK tienen una
arritmia similar a la que se ve en los pacientes con distrofia miotnica, mientras que los ratones knock-
out para SIX5 sufren unas cataratas que recuerdan a las de los enfermos. La miopata se produce por la
presencia de ARN con largas expansiones de repeticiones CUG (esto se ha comprobado tambin en
ratones). La hiptesis ms aceptada es que la expansin da lugar a un ARN que es capaz de unirse a
varias protenas de unin a ARN que regulan el fenmeno del ayuste, alterando su funcin. Como
resultado, se altera el ayuste correcto de otros ARNm, y de hecho se han identificado ms de 10 genes
cuyo ayuste y funcin est alterada en esta enfermedad. Estos genes incluyen un canal de cloro, el
propio SIX5, el gen de la troponina T, el receptor de la insulina, genes con funciones neuronales, etc.
En conjunto, se piensa que la sintomatologa de la enfermedad es el resultado conjunto de la
desregulacin de todos estos genes por la presencia de un ARNm con la expansin de CTG.




La ataxia de Friedreich, enfermedad autosmica recesiva que no muestra el fenmeno clnico de
anticipacin, parece tambin un buen ejemplo de prdida de funcin debida a la expansin, ya que los
sujetos enfermos deben ser homocigotos (tener ambos alelos con la expansin) o heterocigotos
compuestos (un alelo con expansin y el otro alelo con una mutacin puntual). El trinucletido GAA que
sufre la expansin est localizado en una secuencia Alu del primer intrn del gen FRDA, que codifica
una protena llamada frataxina. Los alelos normales estn interrumpidos por la secuencia (GAGGAA)5-9
y no tienen ms de 32 repeticiones GAA. La expansin impide la transcripcin del gen, al formar un
intrn muy largo con estructuras de triple hlice en el ADN genmico. Los niveles bajos de frataxina
alteran la funcin mitocondrial, ya que esta protena es importante en la homeostasis del hierro en la
mitocondria, y dan lugar a una disminucin en la produccin de energa y a la formacin de especies
reactivas de oxgeno.


Otras enfermedades por expansin de secuencias repetidas

Recientemente se ha descrito un tipo de epilepsia mioclnica progresiva de herencia autosmica
recesiva, debida a la expansin de una secuencia de 12 nucletidos (CCCCGCCCCGCG). Este es el primer
ejemplo de enfermedad por expansin de un minisatlite, que en este caso se encuentra en la regin
promotora del gen CSTB (cistatina B, un inhibidor de proteasas). Los alelos normales tienen hasta 3
repeticiones, mientras que sujetos con "premutacin" tienen 12 a 17 repeticiones y los enfermos tienen
entre 30 y 75 copias (en total, un tamao de 360-900 nucletidos). Un 14% de los individuos con esta
enfermedad tienen mutaciones en la regin codificante del gen, por lo que el mecanismo patognico parece
ser por prdida de funcin. De hecho, la presencia de la expansin conduce a disminucin de los niveles de
ARNm, probablemente debido a la desorganizacin del promotor del gen CSTB.

DMPK CTG SIX5 DMPK CTG SIX5 DMPK CTG SIX5
168 GENTICA HUMANA
Tambin se ha identificado un nuevo tipo de ataxia espino-cerebelosa (SCA10), de herencia autosmica
dominante. La causa de esta enfermedad reside en la expansin de un pentanucletido (ATTCT) en el
intrn 9 del gen SCA10. Los individuos normales tienen 10 a 22 repeticiones, mientras que los sujetos con
esta enfermedad tienen alelos entre 500 y 4500 repeticiones. Posteriormente a este hallazgo, se identific la
primera enfermedad debida a la expansin de un tetranucletido: la Distrofia Miotnica tipo 2. Los
individuos normales tienen menos de 26 repeticiones CCTG en el intrn 1 del gen ZNF9, mientras que las
expansiones en pacientes van desde 75 a 11.000 repeticiones.


Mutaciones debidas a repeticiones dispersas

Las repeticiones dispersas del genoma humano, estudiadas con detalle en el Captulo 4, suelen dar lugar a
reordenamientos cromosmicos por un mecanismo denominado "sobrecruzamiento desigual" (en ingls,
UnEqual Cross-over, UEC). Habitualmente, la recombinacin homloga durante la meiosis tiene como
finalidad producir nuevas combinaciones de alelos, ya que se recombinan cromosomas homlogos. El
sobrecruzamiento desigual consiste en la recombinacin entre secuencias homlogas pero no-allicas (es
decir, que tienen homologa en su secuencia pero estn en localizaciones genmicas diferentes). Tal es el
caso, por ejemplo, de los genes parlogos (miembros de una familia gnica, con alto grado de homologa
entre ellos) o de las repeticiones dispersas tipo SINE LINE (cuyos miembros tienen una secuencia
muy homloga). Un buen ejemplo que ilustra los efectos del sobrecruzamiento desigual es el mecanismo
que origina varones con cariotipo XX mujeres XY (con disgenesia gonadal y disfuncin ovrica). Hasta un
30% de los casos de estas patologas son debidos a un sobrecruzamiento desigual entre los genes PRKX y
PRKY, genes homlogos que estn cerca de la Regin Pseudoautosmica de los cromosomas sexuales X e
Y, respectivamente. Fruto de esta recombinacin desigual, el gen SRY gen que determina el sexo
masculino, situado en el cromosoma Y acompaa al fragmento telomrico del cromosoma Y que se mueve
al cromosoma X, dando como resultado un cromosoma X que contiene SRY y un cromosoma Y sin SRY. Esto
origina individuos que fenotpicamente son varones a pesar de ser XX, as como mujeres con cariotipo XY.

La Figura 15.4 muestra el proceso de recombinacin desigual entre los genes
PRKX y PRKY.

Adems, los fenmenos de recombinacin desigual son causa frecuente de duplicaciones o deleciones
cuando tienen lugar entre repeticiones no allicas de gran tamao con un alto grado de homologa, como
son las duplicaciones segmentarias del genoma humano, que ya mencionamos en el captulo 4.
Habitualmente, esto sucede entre secuencias que pertenecen a cromosomas distintos, pero en ocasiones la
recombinacin o sobrecruzamiento desigual tambin puede tener lugar entre cromtides hermanas. En
este caso se produce el llamado "intercambio desigual entre cromatides hermanas" (en ingls,
UnEqual Sister Chromatid Exchange, abreviado UESCE), que da lugar a alteraciones en ambas cromtides
de un mismo cromosoma: habitualmente se produce una duplicacin en una cromtide y una delecin en la
otra.

El video de la Figura 15.5 ilustra el proceso de recombinacin desigual entre
secuencias de cromosomas homlogos o de cromtides hermanas.

Otro posible efecto de la recombinacin desigual entre secuencias homlogas es la conversin gnica entre
ellas. Como hemos visto en un captulo anterior, durante los procesos de recombinacin homloga se forma
CAPTULO 15: POTENCIAL PATOGNICO DE LAS SECUENCIAS REPETIDAS 169
un heterodplex que puede dar lugar a un proceso de conversin gnica, de modo que una de las
secuencias se copia a la otra. Habitualmente, la conversin gnica tiene lugar entre alelos de un mismo
gen; sin embargo, la recombinacin desigual entre dos secuencias no allicas (un gen y un pseudogen no
funcional, por ejemplo) puede provocar la conversin de la secuencia del gen en la secuencia del
pseudogen, lo que equivaldra a anular la funcin del gen. Un ejemplo clsico de este mecanismo es la
enfermedad llamada "Hiperplasia Suprarrenal Congnita" (dficit del enzima 21-hidroxilasa). Alrededor
del 75% de los casos de esta enfermedad estn provocados por un fenmeno de conversin gnica entre
el gen CYP21B (que codifica el enzima) y el pseudogen CYP21A (que no es funcional).

De modo general, hasta ahora hemos considerado que los elementos repetidos que se recombinan
ilegtimamente estn en la misma orientacin. Puede suceder, sin embargo, que estn invertidos (en
orientaciones contrarias uno respecto del otro). En este caso, la recombinacin entre elementos repetidos
dar lugar a la inversin de la regin que queda entre las repeticiones, como se ver en un ejemplo del
siguiente apartado.


Desrdenes genmicos

En conjunto, los procesos de recombinacin desigual dan lugar a un grupo de enfermedades humanas que
se conocen con el nombre de Desrdenes Genmicos, y que incluyen entre otros los Sndromes por
microdelecin que se han mencionado estudiado en el Captulo 13. Los Desrdenes Genmicos se pueden
agrupar como sigue:

A. Debidos a deleciones:

- Los pacientes con Ictiosis ligada al X tienen una delecin del gen de la sulfatasa esteroidea en
Xp22, por reordenacin entre elementos repetidos (separados por 1,9 Mb) que flanquean este gen.
- La delecin que produce el Sndrome de Williams-Beuren est originada por recombinacin
entre duplicaciones segmentarias que flanquean el gen de la elastina en 7q11, repeticiones que
estn separadas por 1,6 Mb.
- La causa ms frecuente de los Sndromes de Prader-Willi y de Angelman es una delecin de 4
Mb por recombinacin desigual entre duplicaciones en 15q11-q13.
- La reordenacin ms frecuente en el cromosoma 22 es la delecin de unas 3 Mb en 22q11.2, que
se encuentra en el 90% de pacientes con Sndrome de Di George con Sndrome Cardio-velo-
facial.
- Un caso especial de delecin de secuencias repetidas es la contraccin de una serie de
repeticiones en tndem cerca del telmero 4q, que origina una enfermedad llamada distrofia
facio-escpulo-humeral. Recientemente se ha comprendido el mecanismo molecular de dicha
enfermedad. En la regin subtelomrica 4q existe un elemento llamado D4Z4 que est repetido en
tndem. Los cromosomas normales tienen entre 10 y 100 repeticiones del elemento. Los
cromosomas contrados, que tienen entre 1 y 10 repeticiones, pueden dar lugar a la enfermedad
si adems ese cromosoma tiene un satlite beta a continuacin de la repeticin (lo que se conoce
como variante 4qA); los cromosomas 4q sin el satlite beta no dan lugar a la enfermedad,
aunque tengan slo 1-10 repeticiones D4Z4 (variante 4qB). Esta contraccin desencadena la
enfermedad mediante la des-regulacin de genes cercanos a esa regin, especialmente por sobre-
expresin del gen FRG1.

170 GENTICA HUMANA
En la Figura 15.6 se incluyen esquemas de los principales desrdenes
genmicos debidos a deleciones.



B. Debidos a duplicaciones/deleciones: Los reordenamientos entre dos elementos llamados
CMT1A-REP, localizados en 17p12, dan lugar a individuos con la duplicacin o con la delecin de la
regin comprendida entre ambas repeticiones. Esta regin incluye el gen PMP22, que codifica una
protena de la mielina, y la duplicacin o delecin de esta regin origina enfermedades dos distintas
(Charcot-Marie-Tooth o Neuropata Hereditaria con Parlisis por Presin, respectivamente). Las
repeticiones CMT1A-REP tienen un tamao de unas 30 kb y estn a una distancia de 1,5 Mb, de forma
que el sobrecruzamiento desigual entre ellas origina la delecin o duplicacin de esa regin. Estas
repeticiones tienen una regin pequea (1,7 kb) que es casi totalmente idntica en todas ellas, y
tambin contienen un elemento similar al transposn "mariner". Parece que la presencia de ste ltimo
puede favorecer la accin de una transposasa a este nivel y facilitar la recombinacin desigual entre
cromtides. Algo similar sucede en el Sndrome de Smith-Magenis, debido a una delecin de unas 5
Mb en 17p11.2. Los individuos con duplicacin de esa regin tienen un fenotipo distinto.

La Figura 15.7 ilustra el proceso de recombinacin desigual que origina las
enfermedades de Charcot-Marie-Tooth y la Neuropata Hereditaria con
Parlisis por Presin.

C. Debidos a Inversiones: Cuando la recombinacin desigual se produce entre repeticiones
invertidas que estn en la misma cromtide, a menudo se originan inversiones cromosmicas. Este
fenmeno es especialmente frecuente como causa de Hemofilia A, una coagulopata debida al dficit
de Factor VIII de la coagulacin. El gen que codifica el Factor VIII tiene un elemento llamado int22h
que est repetido dos veces antes del exn 1 y otra vez (en la orientacin contraria) en el intrn 22
(entre los exones 22 y 23). Un sobrecruzamiento desigual entre uno de los elementos que estn antes
del exn 1 con el elemento del intrn 22 dar lugar a una inversin de toda la regin comprendida
entre ambas repeticiones, rompiendo totalmente la capacidad codificante del gen. Este mecanismo es
responsable de un 45% de los casos de Hemofilia A en humanos, lo que subraya la gran importancia de
este tipo de fenmenos en patologa humana.
Delecin de 3 Mb
(90%)
Di George (22p)
Delecin de 1,5 Mb
(5-10%)
Delecin de 3 Mb
(90%)
Di George (22p)
Delecin de 1,5 Mb
(5-10%)
4 Mb
15q11-q13
Prader-Willi/Angelman
4 Mb
15q11-q13
4 Mb
15q11-q13
Prader-Willi/Angelman
CAPTULO 15: POTENCIAL PATOGNICO DE LAS SECUENCIAS REPETIDAS 171

La Figura 15.8 muestra el proceso de recombinacin desigual que origina
la inversin del gen del Factor VIII, causante de Hemofilia A.

Otro ejemplo de inversin es la que da lugar a la distrofia muscular de Emery-Dreifuss, por
recombinacin entre repeticiones invertidas en Xq28. Este caso es especialmente interesante porque se
ha detectado la inversin de esta regin en un tercio de las mujeres normales.

D. Otras anomalas: La recombinacin desigual entre elementos duplicados del genoma humano
origina tambin otros procesos. Por ejemplo, la duplicacin invertida del cromosoma 15 es el
cromosoma marcador que se encuentra con mayor frecuencia en recin nacidos. Tambin se encuentra
un cromosoma marcador dicntrico debido a una duplicacin invertida en 22q en pacientes con
Sndrome de Ojo de Gato, por reordenamientos entre duplicaciones segmentarias. Estas mismas
duplicaciones estn implicadas en la translocacin t(11;22)(q23;q11), que es la nica translocacin
recproca equilibrada recurrente en humanos. Finalmente, se ha observado que hasta un 1% de los
casos de retraso mental espordico pueden ser debidos a una microdelecin en 17q21.31, por
recombinacin entre duplicaciones segmentarias flanqueantes. Curiosamente, esa regin se presenta en
humanos en dos configuraciones diferentes, ya que existe un polimorfismo de inversin debido tambin
a la presencia de duplicaciones segmentarias en orientacin invertida; una de esas configuraciones, la
llamada H2, es la que puede dar lugar a la microdelecin.

La Figura 15.9 muestra la estructura de 17q21.31 y la microdelecin que
se origina en esta regin.



700 kb
900 kb
H1
(80%)
H2
(20%)
microdelecin
17q21.31
700 kb
900 kb
H1
(80%)
H2
(20%)
microdelecin
17q21.31
172 GENTICA HUMANA
CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 173
Captulo 16. Efectos fenotpicos de las mutaciones.
Prdida de funcin, fenotipos recesivos y haploinsuficiencia. Fenotipos
dominantes por ganancia de funcin. Alteraciones de la impronta genmica.
Mutaciones que afectan a la morfognesis.


Cuando un gen est mutado por cualquiera de los mecanismos que hemos visto en el captulo anterior,
pueden suceder fundamentalmente dos cosas: (a) que esa mutacin se silenciosa, no tenga ningn efecto
pernicioso ni provoque ningn fenotipo anmalo; (b) que esa mutacin provoque la aparicin de un
fenotipo aberrante que conduzca al desarrollo de una enfermedad. En este segundo caso, que es el que nos
ocupa en esta asignatura, es importante darse cuenta de que la alteracin de un gen puede provocar un
fenotipo anormal mediante dos mecanismos, fundamentalmente: la prdida de funcin la ganancia de
funcin. La prdida de funcin de un gen equivale a su ausencia total, ya que el gen no codifica la
protena respectiva. En general, esto da lugar a fenotipos que se heredan de manera recesiva, ya que es
necesario que estn mutados los dos alelos para que se manifieste el fenotipo. Sin embargo, en aquellos
casos en los que hay un efecto de dosis gnica, en los que se producen fenotipos dominantes por un
fenmeno llamado haploinsuficiencia, la prdida de funcin genera fenotipos de herencia dominante. En
el caso de las mutaciones que provocan una ganancia de funcin, los fenotipos resultantes son
generalmente de herencia dominante, porque la mutacin facilita que el gen escape a los mecanismos que
regulan su expresin, o bien crea una nueva funcin que tiene un efecto dominante negativo. Como
regla general, podemos decir que cuando las mutaciones puntuales en un gen producen el mismo fenotipo
que las deleciones de todo el gen, lo ms probable es que esas mutaciones provoquen una prdida de
funcin; en cambio, las mutaciones que operan a travs de una ganancia de funcin suelen provocar
fenotipos distintos a los que genera la delecin o disrupcin de ese gen. A continuacin veremos un poco
ms a fondo cada una de estas dos situaciones.


Prdida de funcin, fenotipos recesivos y haploinsuficiencia

Un gen puede perder su funcin de varias maneras:

- Mutaciones en el propio gen: cualquier tipo de mutacin que interrumpa la capacidad codificante del
gen har que se pierda su funcin. Como hemos visto en el captulo precedente, puede tratarse de
mutaciones puntuales, deleciones o inserciones que interrumpen el marco de lectura, as como
alteraciones de las secuencias de ayuste (splicing). Tambin podemos incluir aquellas mutaciones que no
afectan a la secuencia del transcrito (ARNm) sino a su estabilidad, de forma que el mensajero se
degrada rpidamente y no llega a traducirse en la protena correspondiente.

- Mutaciones que afectan a los elementos que regulan la expresin gnica. Un gen puede dejar de
expresarse por mutaciones que afectan al promotor, bien por mutaciones que alteran las secuencias
de unin a factores de transcripcin o bien provocando su metilacin. Otro mecanismo que disminuye
la expresin gnica es el que se conoce como efectos de posicin, es decir, una reordenacin
cromosmica que mueve un gen de su posicin original a otra regin del genoma que est silenciada
(una regin de heterocromatina, por ejemplo). En ocasiones, esto hace que el gen deje de expresarse.
Hay varios ejemplos de enfermedades humanas producidas por este mecanismo, como el caso de la
Distrofia Facio-Escpulo-Humeral que hemos estudiado en el captulo anterior. Otros ejemplos son la
Aniridia (por alteraciones del gen PAX6) o la Displasia Campomlica (alteraciones del gen SOX9),
174 GENTICA HUMANA
enfermedades en las que muchas veces se observan translocaciones que no interrumpen directamente
los genes respectivos, sino que los separan de su contexto genmico habitual y los colocan en una
regin de cromatina silenciada.

Aunque la prdida de funcin de un gen suele desencadenar fenotipos recesivos, a veces se obtienen
fenotipos con herencia dominante. Esto sucede en aquellos casos en los que la disminucin de la dosis
gnica al 50% de lo que es habitual ya es capaz de provocar el fenotipo patolgico. Como es sabido, los
genes autosmicos y el cromosoma X en mujeres estn en doble dosis gnica (hay dos alelos para cada
gen), lo que hace que en circunstancias normales se produzcan unos niveles determinados de producto
proteico. Habitualmente, la prdida de uno de los alelos no tiene ningn efecto patolgico: aunque slo se
produce la mitad de protena de lo que sera normal, la cantidad producida por el alelo normal es suficiente
para realizar la funcin respectiva. Sin embargo, en algunos casos la simple disminucin de la dosis gnica a
la mitad, por la inactivacin de uno de los alelos mediante cualquier mecanismo mutacional de los que se
han estudiado, provoca el desarrollo del fenotipo patolgico. Cuando esto sucede, se habla de enfermedades
causadas por haploinsuficiencia o insuficiencia haploide, que lgicamente se heredan con un patrn
dominante. Aunque hay bastantes enfermedades humanas causadas por haploinsuficiencia, un buen
ejemplo es el S. de Turner (45,X0), en el que basta la prdida de una copia de los genes implicados para
que se desarrollen las caractersticas fenotpicas propias de esta enfermedad. En concreto, se ha visto que
uno los genes responsables de esta enfermedad (SHOX) se localiza en la regin pseudoautosmica del
cromosoma X y habitualmente escapa a la inactivacin del cromosoma X, por lo que en condiciones
normales est presente en doble dosis gnica. Cuando se pierde una copia de este gen (por la ausencia de
uno de los cromosomas X), la nica copia que queda no es suficiente para llevar a cabo correctamente su
funcin y esto parece ser la causa de la talla corta de las mujeres con Sndrome de Turner.


Fenotipos dominantes por ganancia de funcin

Los mecanismos por los que las mutaciones pueden originar una ganancia de funcin que se manifieste en
un fenotipo dominante son variados, pero podemos sealar tres:

- Una mutacin que altera la protena de forma que sta adquiere una nueva funcin. El mejor
ejemplo es el alelo "Pittsburgh" de alfa-1 antitripsina, un enzima con actividad anti-elastasa.
Habitualmente, los alelos mutantes de alfa-1 antitripsina producen una prdida de funcin, con la
consiguiente disminucin de la actividad enzimtica y el desarrollo de una enfermedad denominada
enfisema pulmonar. En cambio, el alelo "Pittsburgh" est debido a una mutacin que cambia la
metionina en posicin 358 a una arginina (M358R). Esto hace que el enzima adquiera una actividad
anti-trombina que antes no tena, dando lugar a un transtorno de la coagulacin en vez de provocar
enfisema pulmonar. Las mutaciones con ganancia de funcin son muy frecuentes en cncer, siendo uno
de los principales mecanismos de activacin de oncogenes. Por ejemplo, la fusin de los genes BCR y
ABL, en pacientes con leucemia mieloide crnica, es el resultado de una translocacin (9;22) en la
que el gen ABL una tirosina-quinasa pierde su regin reguladora y queda fusionado con la regin 5'
del gen BCR, que se expresa en clulas progenitoras hematopoyticas. Esto provoca un nuevo gen de
fusin que conduce a una expresin constitutiva y des-regulada de la tirosina-kinasa ABL en clulas de la
serie mieloide en la mdula sea, lo que lleva el desarrollo de la leucemia.

- Ganancia de funcin tambin por la sobre-expresin de un gen, como resultado de duplicaciones o
amplificaciones gnicas: un segmento genmico que se copia varias veces, de forma que los genes
CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 175
contenidos en ese segmento estarn en un nmero de copias muy superior al normal. Este tambin es
un mecanismo frecuente en distintos tipos de cncer. Por ejemplo, el oncogn C-MYC est amplificado
en varios tumores (sobre todo en neuroblastomas), C-ERBB2 en tumores de mama, etc. Aunque estas
amplificaciones pueden verse en un cariotipo convencional como regiones de tincin homognea
(Homogenous Staining Regions, HSR), o tambin como "Dobles Diminutos" (cromosomas minsculos), la
tcnica de FISH las detecta con mucha mayor sensibilidad y permite adems contar el nmero de veces
que el gen se ha amplificado.

La Figura 16.1 muestra algunos ejemplos de mutaciones que producen
ganancia de funcin en cncer.

- Por un efecto dominante-negativo. Consiste en que ciertos tipos de genes codifican molculas que
funcionan como dmeros o forman parte de complejos multimricos, de modo que basta la mutacin en
uno de los alelos del gen para que las molculas proteicas mutantes desestabilicen totalmente los
complejos de los que forman parte. Un ejemplo tpico es el de enfermedades que afectan a los genes
que codifican alguna de las cadenas de colgeno. La molcula de pro-colgeno es un trmero formado
por distintos tipos de cadenas, cuya combinacin da lugar a los diferentes tipos de colgeno que existen.
De modo general, una mutacin en el gen de una de las cadenas provocar la desestabilizacin de todo
el complejo trimrico, por lo que basta la mutacin en un solo alelo para que se desarrolle la
enfermedad. En estos casos, puede darse la circunstancia de que una mutacin puede tener distinta
gravedad en funcin del nmero de molculas mutantes y nativas que se generan.

En la Figura 16.2 se ilustra el efecto dominante negativo de las mutaciones
que provocan la desestructuracin de las molculas de procolgeno tipo I.

Todo lo dicho hasta ahora supone, en cierta medida, una simplificacin con fines didcticos. De hecho,
existen algunos genes en los que distintas mutaciones pueden originar tanto una prdida como una
ganancia de funcin, llevando al desarrollo de fenotipos y enfermedades distintas segn se trate de una
prdida o una ganancia. Ya hemos visto, por ejemplo, el caso del gen del receptor de andrgenos, en el
que la expansin de un trinucletido provoca la enfermedad de Kennedy (atrofia muscular espino-bulbar)
mientras que las mutaciones con prdida de funcin dan lugar al llamado Sndrome de feminizacin
testicular. Otro ejemplo es el de PMP22 (localizado en 17p11.2), un gen sensible a dosis en el que la
duplicacin de uno de los alelos lo que supone la existencia de tres copias funcionales del gen provoca la
enfermedad de Charcot-Marie-Tooth (un tipo de neuropata perifrica). Por el contrario, la prdida de uno
de los alelos por delecin o menos frecuentemente por mutacin puntual provoca otra neuropata
distinta llamada "Neuropata hereditaria con parlisis por presin".

A continuacin veremos otras dos situaciones especiales que sirven para ilustrar muy bien la variedad de
efectos fenotpicos que se obtienen por mutaciones. En primer lugar estudiaremos el fenmeno de la
impronta genmica y sus alteraciones; despus veremos algunas alteraciones en el desarrollo embrionario
debidas a mutaciones en genes que codifican factores de transcripcin y receptores de membrana.


Alteraciones de la impronta genmica

El imprinting o impronta genmica es la marca epigentica que define una regin genmica como materna
paterna en el cigoto. La existencia de este fenmeno se descubri al crear embriones de ratn por
176 GENTICA HUMANA
transferencia nuclear: cambiando un proncleo masculino por un segundo proncleo femenino se obtiene un
ginogenonte; reemplazando el proncleo femenino por un segundo proncleo masculino se obtiene un
androgenonte. En teora, estos embriones (excepto los androgenontes YY) deberan ser viables, pero en
cambio se observ que estas modificaciones son letales en el periodo embrionario, y que esa letalidad tiene
dos formas diferentes: los ginogenontes muestran un embrin normal con falta de desarrollo de tejidos
extraembrionarios, mientras que los androgenontes muestran ms alteraciones en el embrin que en
tejidos extraembrionarios. En humanos, las concepciones uniparentales androgenticas, que se originan
raramente por la prdida de los cromosomas maternos poco despus de la fertilizacin, se manifiestan en
una estructura que se conoce como mola hidatidiforme completa. Por el contrario, los oocitos que se
dividen por partenognesis slo contienen material materno, y dan lugar a quistes dermoides. Estos
hallazgos se explican actualmente por la existencia en el genoma de genes "improntados" (sometidos al
fenmeno de la impronta), en los que de algn modo se reconoce el origen parental de cada alelo y se
produce el silenciamiento selectivo de uno de ellos: en unos casos siempre se silencia el materno, en otros
genes siempre se silencia el alelo paterno. Por tanto, cuando el ncleo del cigoto slo contiene material de
uno de los progenitores, pero no una mezcla de ambos, los embriones resultantes son inviables. Esto
sugiere la existencia de una asimetra de los genomas materno y paterno, en cuanto a que ambos
genomas tienen silenciados distintos grupos de genes. Esta asimetra es necesaria para el correcto
desarrollo embrionario.

Dado que ambos alelos de los genes sometidos a imprinting son idnticos y capaces de interaccionar con los
mismos factores de transcripcin, el mecanismo que silencia uno de ellos de manera estable y heredable
debe ser un mecanismo epigentico, que haga posible que el imprinting pueda borrarse durante la
gametognesis y re-establecerse tras la fecundacin. La metilacin, como mecanismo silenciador de la
expresin gnica, cumple la mayor parte de estos requisitos, y hay bastantes lneas de evidencia que
apoyan el papel de la metilacin en el fenmeno de imprinting: 1) todos los genes improntados descritos
hasta el momento -excepto uno- muestran regiones con metilacin diferencial (abreviadas DMR en
ingls, regiones que estn metiladas en uno de los alelos pero no en el otro), cuyos patrones de metilacin
se establecen durante la gametognesis y se mantienen gracias a la metilacin especfica de ADN hemi-
metilado; 2) los embriones de ratn dnmt1
-/-
(que carece de ADN-metiltransferasa-1) muestran expresin
bi-allica de genes improntados, es decir, en ausencia de la metilasa de mantenimiento se re-expresa el
alelo que estaba silenciado; 3) se ha descrito el caso de una mujer con mutaciones en el gen DNMT3L
(que codifica una metilasa) que tiene infertilidad porque los embriones fallecen al implantarse en el tero; y
4) no se ha encontrado un fenmeno similar al imprinting en especies incapaces de llevar a cabo
metilacin.

Igualmente, se ha comprobado que los genes sometidos a imprinting tambin se replican de manera
asincrnica: por FISH se suelen ver dos seales de hibridacin correspondientes a las dos cromtides que
se forman durante la fase S del ciclo celular, pero en genes improntados se ve un cromosoma con dos
seales y el otro cromosoma homlogo con una sola seal. Esto sugiere que el alelo especficamente
silenciado se replica ms tarde.

Existen varios modelos para explicar cmo la metilacin diferencial da lugar a las diferencias de expresin
entre alelos paterno y materno, y cmo se regulan genes vecinos que tienen patrones de imprinting
opuestos. Parece claro que en algunos casos es muy importante la protena CTCF (CTC-binding factor) una
protena que se une a la las regiones de metilacin diferencial (DMR) nicamente cuando stas no estn
metiladas. Por ejemplo, se ha visto que la regulacin de los genes Igf2 y H19 en ratn (que tienen patrones
de imprinting opuestos) se lleva a cabo por este mecanismo, ya que CTCF acta como aislador (insulator)
del promotor de Igf2 de unos potenciadores lejanos.
CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 177

La Figura 16.3 muestra varios modelos de regulacin de los genes que estn
sometidos a imprinting.

La importancia de la protena CTCF se ha puesto de manifiesto gracias a un hallazgo sorprendente, al
conseguir ratones partenogenticos viables cuando se deleciona de su genoma el gen H19 y la
regin de metilacin diferencial a la que se une CTCF. Inicialmente, un ratn partenogentico lleva dos
copias del genoma materno, por lo que tendr expresin biallica del gen H19 y silenciamiento de ambos
alelos de Igf2, de ah que sean inviables. La delecin de una de las copias del H19 reestablece la expresin
monoallica de este gen, pero todava hay silenciamiento total de Igf2e inviabilidad embrionaria. En cambio,
si adems se deleciona la regin de metilacin diferencial a la que se une CTCF, ahora los potenciadores
pueden promover la expresin de Igf2 en este cromosoma, con lo que se reestablece la expresin
monoallica de Igf2. El resultado final es la expresin monoallica de H19 de uno de los cromosomas y la
expresin monoallica de Igf2 del cromosoma homlogo, que es la situacin normal. Esto ilustra la
importancia que tiene la impronta genmica en el desarrollo embrionario, y sugiere que la ineficacia de
los procesos de clonacin de mamferos probablemente se deba a que los ncleos somticos utilizados
para la transferencia nuclear no tienen los patrones de imprinting necesarios para la viabilidad embrionaria.

El video de la Figura 16.4 muestra la importancia del fenmeno del imprinting
en el desarrollo embrionario.

En cada ciclo reproductivo, los patrones de imprinting han de establecerse de nuevo, puesto que lo que en
una meiosis fue material de origen paterno (transmisin de un varn a su hija, por ejemplo) en la siguiente
meiosis pasar a ser marcado como materno (cuando esa hija tenga descendencia). Para poder cambiar el
Me
Alelo 1
Alelo 2
Alelo 1
Alelo 2
Me
Alelo 1
Alelo 2
Me
Me
Alelo 1
Alelo 2
Alelo 1
Alelo 2
Me
Alelo 1
Alelo 2
Me
Alelo 1
Alelo 2
Me
Alelo 1
Alelo 2
Me
178 GENTICA HUMANA
imprinting es necesario borrar toda la informacin previa sobre cul de los alelos debe silenciarse. Como el
genoma est muy desmetilado en los gametos, el cambio en los patrones de imprinting debe de tener
lugar durante la gametognesis. Con los datos actuales, la hiptesis ms aceptada para explicar el
borrado y re-establecimiento de los patrones de metilacin durante la gametognesis es la existencia de
protenas capaces de unirse a las DMR no-metiladas (y as protegerlas de la mutilacin), junto con otros
factores que se unen a las DMR metiladas y ayudan a mantener el estado silenciado. Se piensa que slo
una de las lneas germinales (masculina femenina) es capaz de producir los factores que
protegen de la metilacin a las regiones no-metiladas. As, estas regiones se mantendrn des-
metiladas en la lnea germinal que produzca estos factores. Por el contrario, estas regiones se metilarn y
silenciarn en la lnea germinal que no los produce. Por lo que respecta a la identidad de dichos factores, los
candidatos ideales son las protenas que se unen especficamente a regiones metiladas (MeCP2, HDAC, etc)
a regiones no metiladas (CTCF, factores de transcripcin que se unen a CpGs no metilados, etc).

La impronta es, por tanto, un mecanismo fisiolgico normal. Sin embargo, algunas alteraciones
genticas que afectan a regiones sometidas a imprinting pueden dar lugar a enfermedades. Este es el caso
de la llamada disoma uniparental, situacin en la que ambas copias de de un cromosoma o de una regin
cromosmica proceden del mismo progenitor. Si esa regin contiene genes improntados, el resultado
puede ser la presencia de dos copias silenciadas de un gen, con lo que el efecto viene a ser similar a una
delecin homocigtica de ese locus. Hoy en da conocemos una larga lista de enfermedades y tumores
humanos debidos a disoma uniparental de loci sometidos a impronta. Adems, se han detectado regiones
improntadas en los cromosomas 11, 15, 7 y 14, y actualmente se conocen unos 30 genes improntados en
ratn y humanos.

Los loci sometidos a impronta tienden a aparecer agrupados en determinadas regiones cromosmicas, de
manera que dentro de cada uno de estos grupos o clusters unos genes muestran expresin materna y
otros genes muestran expresin paterna. Esto se ilustra con el ejemplo de dos enfermedades llamadas
Sndrome de Prader-Willi y Sndrome de Angelman, originados por alteraciones en el grupo de genes
improntados que se encuentran en 15q11-q13. Todos los genes improntados en esta regin muestran
expresin especfica del alelo paterno excepto el gen UBE3A, que muestra expresin materna en
cerebro. Parece que la expresin de UBE3A depende de la expresin de un transcrito antisentido que
comienza 6,5 kb en direccin 3 del codn de parada de UBE3A y que alcanza hasta la mitad 3 de UBE3A,
de manera que en la mayora de los tejidos somticos este transcrito no se expresa y por tanto la expresin
de UBE3A en estos tejidos es biallica. Por el contrario, el transcrito antisentido se expresa en clulas de
Purkinje, neuronas del hipocampo y clulas mitrales olfatorias, silenciando el alelo paterno y originando el
imprinting de UBE3A en estos tejidos.

En la Figura 16.5 se muestra el cluster de genes sometidos a imprinting en
15q11, cuyas alteraciones causan los sndromes de Prader-Willi y de
Angelman.

Por estudios en pacientes con microdeleciones, sabemos que el centro de imprinting de esta regin es
bipartito y cubre en total unas 100 kb. Dentro de esta regin, el centro de imprinting para Angelman cubre
1,15 kb, mientras que el centro de imprinting Prader-Willi es ms distal y cubre unas 4,3 kb (incluyendo el
promotor y el exn 1 del gen SNRPN). Se postula que durante la gametognesis estos centros fijan los
patrones de expresin de toda esta regin, de forma que en la oognesis se activa el centro de
imprinting AS que, a su vez, bloquea la funcin del centro de imprinting PW. Como resultado, los
gametos femeninos slo expresan el gen UBE3A. En cambio, en la espermatognesis el centro AS estara
CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 179
bloqueado, de manera que el centro de imprinting PW es ahora activo y promueve la expresin de todos los
genes de expresin paterna, includo el gen antisentido que bloquea la expresin de UBE3A. De este modo
se crean los epigenotipos paterno y materno que se mantendrn durante el desarrollo embrionario y en
clulas somticas adultas.

El Sndrome de Prader-Willi, cuya incidencia estimada es de 1/25.000, se caracteriza por disminucin de
la actividad fetal, obesidad, hipotona muscular, retraso mental, hipogonadismo hipogonadotrfico, manos y
pies pequeos, hipopigmentacin, baja estatura y rasgos dismrficos. Se debe a la falta de expresin de los
genes especficos del cromosoma paterno dentro de esta regin. Por el contrario, el Sndrome de
Angelman tiene una incidencia de 1/15.000 nacimientos y est caracterizado por un fenotipo distinto al de
Prader-Willi: retraso mental severo, temblor, ataxia, marcha anormal, tendencia a la risa, transtornos del
sueo y convulsiones. Est provocado por la falta de expresin del gen UBE3A, que se expresa
especficamente en el cromosoma materno. Las alteraciones de la impronta de todos estos genes pueden
tener lugar por varios mecanismos:

1) Deleciones grandes de la regin: producirn Sndrome de Prader-Willi (SPW) si la delecin afecta al
cromosoma paterno, Sndrome de Angelman (AS) si la delecin afecta al cromosoma materno.
Constituyen la principal causa de estas enfermedades (70% de todos los casos).

2) Disoma uniparental (UPD), debida a no-disyuncin durante una de las meiosis parentales. En
efecto, la no-disyuncin puede originar gametos dismicos o nulismicos, que originan cigotos
trismicos o monosmicos. En estas circunstancias, la disoma uniparental puede ser resultado tanto de
la recuperacin de un cigoto trismico por prdida de uno de los cromosomas, como de la duplicacin
completa de un cromosoma para recuperar un cigoto monosmico. En este ltimo caso vemos una
isodisoma (ambos cromosomas provienen de la duplicacin de un mismo cromosoma parental),
mientras que un 70% de los casos de reduccin de cigotos trismicos dan lugar a heterodisoma
(presencia de los dos cromosomas del mismo progenitor). La presencia de dos cromosomas 15
paternos da lugar a un 2% de los casos de Sndrome de Angelman, mientras que el 25% de los casos
de Sndrome de Prader-Willi se deben a la presencia de dos cromosomas 15 maternos.

3) Mutaciones puntuales en los genes responsables. En el Sndrome de Angelman se detectan
mutaciones en el gen UBE3A (que codifica la E6 ubiquitin-ligasa) hasta en un 20% de los enfermos. En
ZNF127
NECDINA
SNRPN
PAR-5
IPW
PAR-1
UBE3A
Antisense
Paterno
Materno
ZNF127
NECDINA
SNRPN
PAR-5
IPW
PAR-1
UBE3A
Antisense
Paterno
Materno
180 GENTICA HUMANA
el caso del Sndrome de Prader-Willi, en cambio, la bsqueda de un gen candidato no ha dado
resultados, aunque el principal gen implicado es SNRPN. En el caso concreto de este gen (SNRPN), se
ha visto que existe otra secuencia codificante en direccin 5 (SNURF por "SNRPN Upstream Reading
Frame") de manera que, de hecho, ambos forman un nico gen bicistrnico: un solo transcrito del que
se traducen dos protenas. Con los datos actuales, hay que considerar el Sndrome de Prader-Willi como
un sndrome de microdelecin causado por la prdida de varios genes contiguos.

4) Mutaciones o microdeleciones que afectan a los centros de imprinting, de manera que no se
podrn re-establecer los patrones durante la gametognesis en el caso de que haya
transmisin de un sexo al opuesto (madre-hijo padre-hija). El resultado funcional en el cigoto
es idntico a lo que sucede en la disoma uniparental: ambos alelos llevan el mismo patrn de
imprinting. Este tipo de alteraciones son responsables de un 5% de los casos de Sndrome de Prader-
Willi o de Sndrome de Angelman. El ejemplo tpico es el de la abuela paterna portadora de una
mutacin en el centro de imprinting del cromosoma 15 que lleva marcado como materno. Al transmitir
este cromosoma a un hijo varn, el cromosoma mutado pasar a su hijo marcado como materno, por lo
que no es necesario reestablecer el imprinting y el hijo ser normal (llevar un cromosoma marcado
como paterno y otro como materno). En la siguiente generacin, en cambio, este individuo varn
deber pasar su cromosoma 15 marcado como paterno, por lo que la marca que lo identificaba como
materno deber ser borrada durante la espermatognesis y sustituida por la marca que lo identifique
como paterno. En este individuo dicho cambio ser imposible, debido a la mutacin en el centro de
imprinting de su cromosoma 15 materno, por lo que su descendencia llevar dos cromosomas con
epigenotipo materno y desarrollar Sndrome de Prader-Willi. Lo mismo puede suceder para el
Sndrome de Angelman, cuando la mutacin del centro de imprinting afecta al cromosoma paterno.

El diagnstico gentico en estas dos enfermedades va dirigido a la deteccin de deleciones, de disoma
uniparental o de alteraciones en el centro de imprinting, y se realiza por los siguentes procedimientos:

- Cariotipo convencional. Es insuficiente para detectar la microdelecin tpica, pero es til en el probando
y en los padres para detectar posibles translocaciones, ya que un pequeo porcentaje de las deleciones
son fruto de translocaciones no equilibradas (casi siempre de novo). Tambin detectar translocaciones
equilibradas de novo o heredadas, aunque estos casos son excepcionales.

- FISH: detecta todas las deleciones, usando sondas frente al gen SNRPN en combinacin con una sonda
centromrica del cromosoma 15. La mayora de las deleciones son intersticiales, siendo la ms frecuente
una pequea delecin de unas 4 Mb de tamao.

- Deteccin de Disoma Uniparental: se usan microsatlites del cromosoma 15 para determinar el origen
parental de cada cromosoma. Lgicamente, es necesario descartar primero la presencia de delecin, y
adems este procedimiento viene limitado por la necesidad de obtener muestras del probando y de
ambos progenitores, as como por la posible falsa paternidad.

- Anlisis de metilacin: puede hacerse bien por Southern blot tras digestin del ADN genmico con
enzimas de restriccin sensibles a metilacin, o por PCR especfica de metilacin (MS-PCR). Si el exn 1
de SNRPN y el centro de imprinting adyacente estn metilados en los dinucletidos CpG, esto indica un
patrn materno; si no estn metilados, podemos excluir el silenciamiento de SNRPN y los dems genes
de expresin paterna. Es un anlisis que no requiere muestras de los progenitores, y permite confirmar
la existencia de Sndrome de Prader-Willi cuando se observa slo el patrn de metilacin materno. Tiene
la ventaja de que si el anlisis es normal (es decir, si se observan dos patrones distintos de
CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 181
metilacin, correspondientes a los cromosomas paterno y materno), esto automticamente excluye la
presencia de delecin o de disoma uniparental. Cuando esta prueba es anormal (patrn nicamente
materno) y no se detecta delecin ni disoma uniparental, esto sugiere la existencia de alteraciones en el
centro de imprinting.

- En el caso concreto del Sndrome de Angelman tambin es necesario buscar mutaciones en UBE3A:
aunque esto slo supone un 20% de los pacientes, su deteccin es de gran importancia por el aumento
dramtico en el riesgo de recurrencia de la enfermedad en la misma familia. Se estima que hasta un
tercio de los pacientes que tienen estudios de metilacin normales tienen mutaciones en UBE3A, por lo
que la estrategia diagnstica recomendada es comenzar con estudios de metilacin y despus buscar
mutaciones de UBE3A en aquellos sujetos con resultados de metilacin normales.

La Figura 16.6 muestra la estrategia diagnstica en los sndromes de Prader-
Willi y Angelman.

En el Sndrome de Prader-Willi el riesgo de recurrencia (un segundo individuo enfermo en la misma familia)
es prcticamente cero en los casos de delecin y de disoma uniparental que no estn asociados a
reordenaciones cromosmicas. De todas formas, a efectos de consejo gentico se considera un riesgo de
recurrencia del 1%, ya que en una muestra amplia de pacientes se detect un riesgo de recurrencia en
hermanos de probandos del 1,6% (aunque esto inclua todas las posibles causas). El mayor riesgo de
recurrencia se produce en los casos familiares que estn debidos a alteraciones en el centro de imprinting.
En estos casos, el riesgo de recurrencia es del 50% ya que volver a suceder siempre que el padre
transmita el cromosoma 15 que lleva la mutacin. En el Sndrome de Angelman, el riesgo de recurrencia
tambin se considera habitualmente del 1%, excepto en los casos de mutaciones del centro de imprinting y
de mutaciones en UBE3A, en las que el riesgo de heredar el cromosoma materno mutado es del 50% (si el
cromosoma mutado se hereda del padre no hay enfermedad porque en ese cromosoma el gen UBE3A no se
expresara en cualquier caso).


Mutaciones que afectan a la morfognesis

El estudio comparativo del desarrollo embrionario en humanos, ratn y Drosophila ha permitido identificar
los mecanismos genticos por los que se generan varias enfermedades congnitas de la morfognesis.
En general, estas mutaciones afectan sobre todo a genes que codifican dos tipos de protenas:

A. Factores de transcripcin: son protenas con actividad reguladora de la expresin gnica gracias a que
poseen dos propiedades principales: capacidad de unin a determinados elementos reguladores en el ADN y
capacidad de transactivacin de otros factores proteicos. Los factores de transcripcin tienen, por tanto, un
dominio de unin al ADN y un dominio de transactivacin por el que se une a los otros componentes de un
complejo activador o represor de la transcripcin. Hay cuatro tipos principales de dominios de unin al ADN
que se encuentran en la gran mayora de factores de transcripcin: 1) HTH (helix-turn-helix hlice-
vuelta-hlice), presente sobre todo en factores de transcripcin que intervienen en la regulacin de la
expresin gnica durante el desarrollo embrionario. El ejemplo mejor conocido es el homeodominio, que
est presente en los genes homeobox que determinan la identidad posicional de las clulas a lo largo del eje
craneo-caudal del embrin; 2) dedos de zinc, que suelen unirse a elementos de respuesta en el ADN; 3)
cremalleras de leucina, con una hlice en la que hay una leucina cada 7 aminocidos de manera que
quedan en la misma cara de la hlice y dimerizan fcilmente; 4) HLH (helix-loop-helix hlice-lazo-
182 GENTICA HUMANA
hlice) son similares a cremalleras de leucina y tambin forman homo- y heterodmeros; ambos son
importantes en la regulacin de procesos de diferenciacin celular y desarrollo embrionario.

En la Figura 16.7 se muestra la estructura de algunos factores de
transcripcin.

Entre los sndromes malformativos debidos a alteraciones en factores de transcripcin encontramos
varios grupos:

- Las extremidades se organizan en torno a 3 ejes (Antero-Posterior, Dorso-Ventral y Proximal-
Distal), y se desarrollan a partir de un brote en el que hay una intensa actividad mittica en la
llamada zona de progresin, actividad que es inducida por el repliegue apical ectodrmico.
Esta actividad mittica est en equilibrio con los procesos de apoptosis de clulas del mesnquima,
que da lugar a los espacios interdigitales e interseos. El principal mecanismo de formacin
del eje antero-posterior es la va de sealizacin intracelular de las protenas Hedgehog,
integrada por SHH, los factores de transcripcin GLI1, GLI2 y GLI3, y los receptores Patched
(PTCH) y Smoothened (SMO). El gen llamado Sonic Hedgehog (SHH) se expresa en la lnea
media del Sistema Nervioso Central, en la notocorda y en la Zona de Actividad Polarizante, que
es la regin que determina la posterioridad de un miembro. En general, la disregulacin de este
gen provoca sindactilia (fusin de dos ms dedos) y/o polidactilia, (aparicin de uno ms
dedos extra) que tienden afectar a los dedos cercanos al pulgar (preaxiales) en casos de sobre-
expresin de SHH, o bien afectan a los dedos cercanos al meique (centrales/postaxiales) en casos
de represin de este gen. Sin embargo, no se han encontrado mutaciones de SHH en
malformaciones de miembros, pero s en pacientes con holoprosencefalia autosmica
dominante. Esta enfermedad se origina por el desarrollo defectuoso del cerebro anterior y de la
cara, con unas manifestaciones muy variables que van desde un incisivo nico hasta individuos con
un solo ojo (cclopes), pero es genticamente heterognea ya que mutaciones en otros genes como
ZIC2, SIX3, TGIF y PATCHED tambin la causan. Por otro lado, las mutaciones del gen PTCH
(localizado en 9q22.3) causan el Sndrome de Gorlin autosmico dominante (carcinoma
nevoide de clulas basales), que adems cursa frecuentemente con polidactilia pre- o postaxial, o
bien sindactilia del 3 y 4 dedos del pie. Finalmente, los factores de transcripcin GLI comparten
el dedo de zinc de la protena codificada por el gen cubitus interruptus de Drosophila, y actan
como activadores o represores de la va de transduccin de seales de SHH. Por ejemplo, el
Sndrome de cefalopolisindactilia de Greig (polidactilia postaxial de manos, preaxial de pies,
macrocefalia, frente prominente con hipertelorismo leve), de herencia autosmica dominante, se
debe a haploinsuficiencia de GLI3 por mutaciones que destruyen el dedo de zinc de este gen, de
manera que se produce expresin ectpica preaxial de SHH (GLI3 normalmente inhibe la expresin
de SHH). En cambio, GLI3 tambin parece implicado en el Sndrome de Pallister-Hall
(hamartomas hipotalmicos con malformaciones de extremidades), por mutaciones que respetan el
dedo de zinc y por tanto mantienen constitutivamente la actividad represora sobre SHH. Un
mecanismo similar parece implicado en la Polidactilia postaxial tipo A (en la que se ha
identificado una mutacin de GLI3 que respeta el dedo de zinc). Por su parte, el Sndrome de
Rubinstein-Taybi (retraso psicomotor y del crecimiento, dismorfismo facial, anomalas de los
pulgares y, raramente, polidactilia preaxial de los pies) se debe a mutaciones en CBP: como GLI se
transactiva a travs de un dominio de unin a CBP, la ausencia de ste factor provoca una
expresin baja de GLI, seguida por la expresin anormalmente elevada de SHH.

CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 183
La Figura 16.8 ilustra el desarrollo de los miembros y la funcin de varios
genes en este proceso.

- Los genes que codifican protenas con el homeodominio se denominan genes homeobox (la
homeobox es la caja o secuencia de ADN que codifica el homeodominio), y se agrupan en varias
familias. En Drosophila, el plan corporal se regula durante la embriognesis por la expresin del
grupo de genes HOM-C, organizados en un complejo Antennapedia (3, estructuras anteriores) y
un complejo Bithorax (5, estructuras posteriores). Los factores de transcripcin que regulan la
expresin de estos genes son el grupo trithorax (regulacin positiva) y el grupo polycomb
(regulacin negativa). Los ortlogos humanos de HOM-C son la familia de genes HOX, de los que
hay 4 grupos parlogos (cada grupo se denomina por una letra de la A a la D). Dentro de un grupo,
cada gen se designa con un nmero del 1 al 13 en direccin 3 a 5. As, los parlogos 1 determinan
regiones anteriores y los parlogos 13 las regiones posteriores del eje corporal. El desarrollo de
las extremidades tienen una fase inicial en la que es importante la expresin de genes HOX, y de
hecho se ha descrito un tipo de sin-polidactilia en pacientes que tienen un aumento de 7-14
alaninas en el gen HOXD13, expansin que provoca una ganancia de funcin de dicho gen.
Tambin se han encontrado mutaciones en HOXA13 en pacientes con Sndrome mano-pie-
genital, caracterizado por hipoplasia del quinto dedo de manos y pies y malformaciones
genitourinarias (hipospadias o tero bicorne).

La Figura 16.9 muestra un esquema de los genes homeobox humanos.

- Los genes de la familia Pax codifican factores de transcripcin que contienen un dominio de
unin al ADN de 128 aa con dos regiones de hlice-vuelta-hlice, llamado "paired domain" porque
originalmente se encontr en el gen "paired" de Drosophila. Adems, los factores Pax3, Pax4, Pax6
y Pax7 tambin contienen un homeodominio. Las mutaciones en el dominio paired de PAX6 causan
anomalas oculares (aniridia, anomala de Peters, distrofia corneal, catarata congnita e hipoplasia
de la fovea). En estos casos, la aniridia (o, a veces, anoftalmia) no parece producirse por un
efecto dominante negativo, sino por haploinsuficiencia del gen PAX6, ya que los heterocigotos slo
tienen aniridia pero en cambio los homocigotos padecen anoftalmia, lo cual sugiere un efecto de
dosis. Las mutaciones en PAX6 tambin son responsables de la aniridia del Sndrome WAGR, por
una microdelecin en 11p13 que deleciona todo el gen. Por lo que respecta al gen PAX3, algunas
mutaciones en el mismo producen el Sndrome de Waardenburg tipo 1 (distopia cantorum,
pigmentacin anormal y sordera sensorioneural), mientras que otras mutaciones en este mismo
1 2 3 4 5 6 7 8 9 10 11 12 13
3 5
Antennapedia
Bithorax
HOX A
HOX B
HOX C
HOX D
1 2 3 4 5 6 7 8 9 10 11 12 13
3 5
Antennapedia
Bithorax
HOX A
HOX B
HOX C
HOX D
184 GENTICA HUMANA
gen dan lugar al Sndrome de Klein-Waardenburg (lo anterior ms camptodactilia y
malformaciones de las extremidades). Otro miembro de esta familia, el gen PAX8, est mutado en
casos familiares de disgenesia tiroidea. Por su parte, las mutaciones que afectan al gen PAX2
causan una condicin autosmica dominante que incluye colobomas del nervio ptico, anomalas
renales y reflujo vesico-ureteral.

- SRY es el gen que controla el desarrollo de la gnada masculina y, lgicamente, se localiza en el
cromosoma Y. La protena codificada por SRY contiene una caja HMG (High Mobility Group), que es
un motivo de 79 aas por el que la protena se une al ADN y lo dobla hasta 130 grados, con lo que
favorece la activacin de genes cercanos. Las mutaciones en SRY son causa de la aparicin de
individuos con cariotipo XY que fenotpicamente son mujeres. Otros genes relacionados con
SRY son los genes de la familia SOX; por ejemplo, SOX9 est mutado en una enfermedad
autosmica dominante llamada Displasia campomlica (inversin de sexo en varones,
arqueamiento congnito de huesos largos, paladar hendido, ausencia costillas y trax pequeo). Se
piensa que las malformaciones esquelticas de la displasia campomlica se deben a que SOX9 es
un factor de transcripcin que transactiva secuencias reguladoras que se encuentran en el primer
intrn del gen COL2A1, que da lugar al colgeno tipo II. Por tanto, la falta de SOX9 lleva consigo
una produccin insuficiente de cadenas alfa-1 del colgeno tipo 2, con las consiguientes
malformaciones en huesos y cartlagos.


B. Receptores de las vas de transduccin de seales: constituyen otro gran grupo de protenas que
suelen dar lugar a fenotipos de herencia dominante, habitualmente por un efecto dominante negativo de las
molculas mutadas. A continuacin se sealan dos de los ejemplos ms ilustrativos:

El video de la Figura 16.10 ilustra la estructura y funcionamiento de los
receptores tirosina-quinasa, as como el efecto dominante negativo de las
mutaciones que provocan la activacin constitutiva de la va de sealizacin.

- Los genes que codifican receptores para el factor de crecimiento fibroblstico (FGF). Tras la
unin del ligando extracelular al receptor, unin mediada por heparn-sulfato de la matriz
extracelular, los receptores forman homo- o heterodmeros, se transfosforilan en el dominio
quinasa intracelular y a continuacin fosforilan protenas intracelulares implicadas en diversas vas
de transduccin de seales. Las mutaciones que afectan a los genes de estos receptores (FGFR1,
FGFR2 y FGFR3) causan varios sndromes de craniosinostosis y enanismo cuyas bases moleculares
estn comenzando a comprenderse. Por ejemplo, la Acondroplasia (un tipo de enanismo) es una
enfermedad de herencia autosmica dominante debida a mutaciones en el gen del receptor del
Factor de Crecimiento Fibroblstico-3 (FGF3). Este receptor forma un homodmero que se activa
en respuesta a su ligando natural. En cambio, en los pacientes con acondroplasia se encuentran
mutaciones en uno de los alelos del gen, de forma que la molcula mutada conduce a la
dimerizacin del receptor incluso en ausencia de ligando. Como resultado, se obtiene una
activacin constitutiva de la cascada de seales iniciada por el receptor, que en ltimo trmino
provoca el cierre prematuro del cartlago de crecimiento de los huesos largos y la baja talla
caracterstica de esta enfermedad. La mutacin ms frecuente en casos de acondroplasia es la
mutacin G380R del gen FGFR3, que afecta al dominio transmembrana del receptor.
Curiosamente, mutaciones en otras regiones de este mismo gen causan fenotipos similares pero no
idnticos, como por ejemplo la displasia tanatofrica (micromelia e hipoplasia de costillas con
CAPTULO 16: EFECTOS FENOTPICOS DE LAS MUTACIONES 185
fallo respiratorio). Estas enfermedades son de herencia dominante por el efecto dominante
negativo de estas mutaciones, que hace que con una sola molcula mutada ya que se produzca la
activacin constitutiva del receptor en ausencia de ligando. Respecto a mutaciones en otros genes
que codifican receptores de FGF (FGFR1 y FGFR2), tambin causan enfermedades con alteraciones
de huesos y cartlagos, como el Sndrome de Crouzon (craniosinostosis, bien aislada o bien
asociada con otros defectos esquelticos), el Sndrome de Pfeiffer (pulgares y primer dedo del
pie anchos con anquilosis interfalngica), el Sndrome de Jackson-Weiss (lo anterior ms
coalescencia tarso-metatarsiana) y el Sndrome de Apert (sindactilia severa).

- Mutaciones que afectan al gen RET. Este gen codifica un receptor tirosina-quinasa, cuyo ligando
es el GDNF (Glial cell line-Derived Neurotrophic Factor). Las mutaciones de RET son muy
interesantes, ya que muestran cmo un mismo gen puede sufrir mutaciones que provocan
prdida o ganancia de funcin, dando lugar a fenotipos diferentes. En el caso concreto de RET,
algunas mutaciones con cambio de sentido afectan a aminocidos del dominio extracelular o del
dominio quinasa, y provocan la activacin del receptor de manera independiente de ligando. Estas
mutaciones carcinoma medular de tiroides familiar u otros cuadros de cncer familiar
denominados MEN2 (Multiple Endocrine Neoplasia), que son de herencia dominante porque un solo
alelo mutado desencadena la enfermedad por un efecto dominante negativo. Por el contrario,
algunas mutaciones de RET que llevan a la prdida de funcin (mutaciones sin sentido, cambios del
marco de lectura, deleciones, etc) provocan la ausencia de las molculas del receptor codificadas
por el alelo mutado, con el resultado de que la intensidad de la sealizacin de esta va se ve
disminuida. Esto provoca un dficit en la migracin de precursores neurales al tubo digestivo
durante el desarrollo embrionario, lo que da lugar a la Enfermedad de Hirschsprung (megacolon
aganglinico: ausencia congnita de los plexos submucosos y mientrico del colon distal). Esta
enfermedad se hereda con un patrn dominante, aunque tambin se han identificado mutaciones
en otros genes que causan la misma enfermedad con herencia recesiva, como el gen EDNRB del
receptor para endotelina B (receptor de proteinas G) tambin el gen de su ligando EDN3
(endotelina 3).

CAPTULO 17: DIAGNSTICO DE ENFERMEDADES GENTICAS 187
Captulo 17. Diagnstico de enfermedades genticas.
Estrategias generales de diagnstico de enfermedades genticas. Mtodos de
deteccin de mutaciones. Aplicacin del ligamiento gentico al diagnstico: el
proceso de diagnstico indirecto de enfermedades genticas.


Estrategias generales de diagnstico de enfermedades genticas

Como en cualquier otro tipo de patologas, el diagnstico de enfermedades genticas se realiza mediante la
identificacin clnica de los sntomas y signos que caracterizan cada sndrome concreto, apoyado en datos
de laboratorio. Con los avances del Proyecto Genoma Humano, hoy en da es posible, en muchos casos,
analizar directamente la alteracin causal a nivel del ADN. De todas formas, en el entorno clnico nos
encontramos varios problemas que pueden dificultar el diagnstico correcto. En primer lugar, la posible
presencia de heterogeneidad gentica: varios genes pueden ser los responsables de una nica
enfermedad. Esta circunstancia hace muy laborioso el estudio mutacional, ya que multiplica el nmero de
exones que hay que analizar. Incluso en aquellos casos en los que se sabe con exactitud cul gen est
alterado, puede suceder que las mutaciones responsables del cuadro clnico se distribuyan por todo el gen
(fenmeno que algunos autores denominan heterogeneidad allica), de manera que sera necesario
analizar toda la regin codificante antes de poder descartar o confirmar que el gen en cuestin est mutado.
Lgicamente, si se trata de un gen de gran tamao, el anlisis se hace extremadamente laborioso. La
situacin opuesta vendra dada por aquellas enfermedades genticas que estn causadas, en la gran
mayora de familias, por una misma mutacin, de manera que podemos centrarnos en el estudio de esa
mutacin concreta para confirmar o descartar el defecto molecular que provoca esa enfermedad.

Por tanto, hemos de sopesar todas las circunstancias mencionadas para decidir si nos inclinamos por
realizar lo que se denomina diagnstico directo (anlisis de un individuo para ver si es portador de la
mutacin concreta que causa la enfermedad en esa familia), o si por el contrario aplicaremos el denominado
diagnstico indirecto (anlisis de marcadores genticos en la familia para ver si el consultando ha
heredado el cromosoma que lleva la mutacin). A continuacin discutiremos las ventajas e inconvenientes
de cada una de estas aproximaciones diagnsticas, as como los mtodos ms habitualmente empleados.

La Figura 17.1 explica las dos estrategias diagnsticas para detectar
alteraciones genticas en enfermedades humanas.


Mtodos de deteccin de mutaciones

Como hemos dicho, el diagnstico directo consiste en el estudio de un gen cuya implicacin en el
desarrollo de una enfermedad ya ha sido demostrada para detectar la presencia de posibles mutaciones
en el mismo. En aquellos casos en que las mutaciones patognicas pueden estar localizadas a lo largo de
toda la secuencia codificante del gen (heterogeneidad allica fuerte), se deben utilizar mtodos "de
barrido", que examinan cada exn por separado para detectar simplemente si existe una mutacin o no.
Estos mtodos no identifican el tipo de mutacin, pero nos permiten descartar rpidamente todos aquellos
exones normales, para centrarnos en el estudio de los exones mutados. En cambio, cuando queremos
detectar una mutacin concreta, porque ya sabemos que es sta mutacin la que origina la enfermedad en
188 GENTICA HUMANA
esta familia, utilizaremos mtodos dirigidos a identificar nicamente esa mutacin (mtodos "de
confirmacin"). stos ltimos son quizs los mtodos ms utilizados en el contexto de un laboratorio
diagnstico, especialmente en aquellas enfermedades que tienen una heterogeneidad allica limitada, es
decir, enfermedades en las que un pequeo nmero de mutaciones causan la inmensa mayora de los casos.
Los ejemplos ms notorios son la mutacin C282Y (que causa la mayora de los casos de Hemocromatosis
Hereditaria en europeos); la mutacin F508del, responsable de hasta el 80% de los casos de Fibrosis
Qustica en individuos nor-europeos; la inversin de los exones 1-22 del gen del Factor VIII de la
coagulacin (responsable de un 50% de los casos de hemofilia A); la mutacin G380R del gen FGFR3 (que
causa la mayora de los casos de Acondroplasia), las mutaciones N370S y L444P (que detectan la mayora
de los casos de Enfermedad de Gaucher), o las enfermedades por expansin de trinucletidos (Enfermedad
de Huntington, Sndrome del X Frgil, etc). A continuacin analizaremos algunos de los mtodos ms
utilizados en el diagnstico directo, tanto mtodos de barrido como de confirmacin.

1. Mtodos de barrido para la deteccin rpida de mutaciones (sin identificar el tipo concreto de
mutacin). Excepto en el primero (SSCP) estos mtodos se basan en la deteccin de heteroduplexes,
que se forman por la reasociacin lenta de las cadenas tras la desnaturalizacin del fragmento de ADN.
Cuando el fragmento contiene una mutacin y se mezcla con un ADN normal, la desnaturalizacin-
reasociacin da lugar a molculas heteroduplex portadoras de un desemparejamiento (mismatch)
precisamente en el nucletido donde est la mutacin.

SSCP (Single Strand Conformation Polymorphism, Polimorfismo de la Conformacin de Cadenas
Sencillas). Un cambio en la secuencia provoca cambios conformacionales cuando el ADN se
desnaturaliza (se separan las dos cadenas) y se deja que cada cadena se repliegue por separado. Estos
cambios conformacionales se detectan porque alteran la migracin electrofortica en geles de
poliacrilamida no-desnaturalizantes. En el ejemplo tpico, se amplifica un exn mediante PCR, se
desnaturaliza el producto de PCR por calor, se cargan los productos desnaturalizados en un gel de
acrilamida, se realiza la electroforesis y se tie el gel mediante una tincin especfica para el ADN
(tincin de plata, por ejemplo). Si no hay mutaciones, se detectarn nicamente las bandas
correspondientes al homodplex (resultado de la reasociacin parcial de las dos cadenas
complementarias durante la electroforesis) y las bandas correspondientes a cada una de las cadenas
sencillas que se han replegado adoptando una conformacin determinada. En cambio, la presencia de
una mutacin dar lugar a nuevas bandas debidas al patrn de plegamiento de las cadenas
sencillas mutantes, que ser diferente al de las cadenas nativas. Como hemos comentado, este
anlisis no nos dice de qu tipo de mutacin se trata: para eso es necesario secuenciar este producto
de PCR y compararlo con la secuencia normal. La ventaja es que nos permite descartar la presencia de
mutaciones rpidamente, lo que ahorra tiempo y recursos.

La Figura 17.2 explica grficamente la tcnica de SSCP.

DGGE (Denaturing Gradient Gel Electrophoresis, Electroforesis en Gel con Gradiente Desnaturalizante)
y sus variantes, entre las que destaca TGGE (Temperatura Gradient Gel Electrophoresis). Esta tcnica
se basa en someter una muestra de ADN a una electroforesis en geles de acrilamida con un gradiente
desnaturalizante qumico o trmico, de manera que la muestra se encuentra con condiciones cada vez
ms desnaturalizantes a medida que avanza por el gel. Las muestras de ADN son productos de PCR
(exones, habitualmente) en cuyo extremo hay una regin corta muy rica en citosinas y guaninas
(regin llamada "clamp" o "pinza" GC), de forma que la temperatura de desnaturalizacin de esta
pequea regin es mayor que la del resto del fragmento. Por tanto, cuando el fragmento va avanzando
por el gel, llegar un momento en que se desnaturaliza todo excepto la regin del clamp-GC. El
CAPTULO 17: DIAGNSTICO DE ENFERMEDADES GENTICAS 189
resultado es que el fragmento se frena y deja de avanzar por el gel. Cuando la muestra de ADN es un
heteroduplex que contiene un desemparejamiento, su punto de desnaturalizacin ser distinto al del
fragmento nativo, y por tanto se parar en un punto distinto del gel. Esto se reflejar en la aparicin de
una banda con distinta migracin electrofortica.

La Figura 17.3 ilustra el fundamento de las tcnicas que detectan la
presencia de heterodlex, con ejemplos de DGGE y TGGE.

DHPLC (Denaturing HPLC) es una tcnica en la que los heteroduplex y homoduplex son separados en
un aparato de HPLC (High Performance Liquid Chromatography) utilizando un gradiente
desnaturalizante de acetonitrilo y variando la temperatura de la columna. La muestra se injecta en una
columna de cromatografa y el ADN se une a la matriz. El acetonitrilo deshace estas interacciones y el
ADN eluido se detecta a la salida de la columna midiendo la absorbancia a 260 nm, originando un pico a
un tiempo de elucin caracterstico. En temperaturas bajas, no desnaturalizantes, la concentracin de
acetonitrilo necesaria para eluir un fragmento depende del tamao y la secuencia del mismo, por lo que
cada fragmento da lugar a un pico de elucin caracterstico. Al aumentar la temperatura de la columna,
la elucin tiene lugar a concentraciones menores de acetonitrilo, a medida que el fragmento comienza a
desnaturalizarse. Como los heteroduplex se desnaturalizan a temperaturas distintas a los homoduplex,
generan picos a tiempos de elucin diferentes. De este modo es posible detectar mutaciones puntuales.
La gran ventaja del DHPLC es su rapidez, ya que los tiempos de elucin tpicos estn en torno a los 5
minutos y una muestra se puede analizar en 10 minutos. Por tanto, conserva la gran sensibilidad de los
mtodos de deteccin de heteroduplex que utilizan un gradiente desnaturalizante (temperatura, en este
caso), pero tiene una procesividad mucho mayor y es fcilmente automatizable.

La figura 17.4 presenta ejemplos del anlisis mediante DHPLC.

Rotura de Desemparejamientos (Mismatch Cleavage). Es un mtodo basado en el hecho de que
determinados tratamientos qumicos o enzimticos son capaces de romper un fragmento de ADN
especficamente en el punto donde existe un desemparejamiento. Como hemos dicho, los
heteroduplexes son portadores de un desemparejamiento (mismatch) precisamente en el nucletido
donde est la mutacin. Por tanto, el tratamiento con determinadas sustancias romper el fragmento
Gradiente
E
l
e
c
t
r
o
f
o
r
e
s
i
s
G
r
a
d
i
e
n
t
e
E
l
e
c
t
r
o
f
o
r
e
s
i
s
Gradiente
E
l
e
c
t
r
o
f
o
r
e
s
i
s
G
r
a
d
i
e
n
t
e
E
l
e
c
t
r
o
f
o
r
e
s
i
s
190 GENTICA HUMANA
slo en el caso de que existan desemparejamientos, de forma que una electroforesis en gel ser
suficiente para comprobar la presencia de una mutacin.

PTT (Protein Truncation Test, Prueba de truncamiento de protenas). Es un mtodo especialmente
dirigido a la deteccin de mutaciones que crean un codn de parada prematuro y provocan el
truncamiento de la protena. Para llevar a cabo esta prueba, se prepara ADNc mediante RT-PCR (PCR
tras transcripcin reversa del ARN del paciente) utilizando un cebador que contiene la secuencia del
promotor del fago T7 y la secuencia consenso de inicio de la traduccin (secuencia de Kozak). Esta
construccin permite realizar la transcripcin y traduccin in vitro, a partir del producto de la RT-PCR. El
anlisis en un gel de acrilamida de los fragmentos proteicos que resultan de la transcripcin/traduccin
revelar la presencia de una banda correspondiente al tamao esperado para la secuencia nativa, o
bien otras bandas de menor tamao correspondientes a todas las posibles mutaciones que provoquen
un truncamiento del producto proteico (mutaciones sin sentido, los cambios del marco de lectura y las
mutaciones que afectan a las secuencias de ayuste).

La figura 17.5 ilustra el fundamento de la tcnica de PTT.

Secuenciacin. Hoy en da, con la aparicin de equipos fluorescentes automatizados y con bajo coste
por reaccin, la secuenciacin directa de productos de PCR (exones, o incluso la secuenciacin directa
de un ADNc obtenido por RT-PCR) es un mtodo cada vez ms popular de deteccin de mutaciones.
Tiene la ventaja de que identifica el tipo de mutacin, y de hecho es un paso obligado para identificar
las mutaciones detectadas por los mtodos de barrido que acabamos de explicar. Sin embargo, slo es
realmente fiable cuando el ADN mutado est en una proporcin superior al 15-20% del total de ADN
presente en la muestra. Aunque esto se cumple en las enfermedades hereditarias, no es el caso de la
deteccin de mutaciones en muestras procedentes de tumores, en las que con frecuencia la cantidad de
clulas tumorales es baja y no todas son portadoras de una mutacin concreta.

La figura 17.6 muestra una mutacin detectada mediante secuenciacin
con terminadores marcados.

CAPTULO 17: DIAGNSTICO DE ENFERMEDADES GENTICAS 191
Cada uno de los mtodos de barrido que hemos visto tiene sus ventajas e inconvenientes, sobre todo en lo
referente a la sensibilidad (porcentaje de mutaciones que son capaces de detectar), coste, complejidad
tcnica, capacidad de especificar la posicin de la mutacin, etc. Aunque las caractersticas de cada mtodo
se presentan resumidas en la siguiente tabla, la eleccin de un mtodo u otro depender de las
peculiaridades de cada laboratorio, del gen que se quiera estudiar, los medios disponibles y la experiencia
previa con cada uno de los mtodos.

MTODO VENTAJAS INCONVENIENTES
Secuenciacin
Detecta todas y especifica la
posicin.
Excesiva informacin, coste alto,
laboriosa.
SSCP
Sencillo.
Buena sensibilidad.
Secuencias <400bp.
No especifica posicin.
DGGE y DHPLC Muy alta sensibilidad.
Cierta complejidad.
No especifica posicin.
Rotura de
Desemparejamientos
Muy alta sensibilidad.
Puede especificar posicin.
Gran dificultad tcnica.
Toxicidad OsO4.
PTT
Alta sensibilidad.
Especifica la posicin.
No todos los tipos de mutaciones.
Complejidad tcnica, coste.


2. Mtodos de comprobacin para detectar de la existencia de una mutacin especfica:

- PCR-Digestin. El fundamento de esta tcnica reside en el hecho de que la mutacin crea o destruye
una diana de restriccin, de modo que la simple digestin del producto de PCR con el enzima de
restriccin permite determinar, en un gel de agarosa, el patrn de digestin indicativo de la presencia o
ausencia de la mutacin. Es un mtodo que, por su sencillez y rapidez, es uno de los ms utilizados en
laboratorios clnicos. La principal limitacin, lgicamente, es que no todas las mutaciones alteran una
diana de restriccin.

La figura 17.7 explica el proceso de deteccin de una mutacin especfica
mediante la digestin de un producto de PCR con enzimas de restriccin.

- ASO (Allele Specific Oligonucleotide, Oligonucletido Especifico de Alelo). Una tcnica bastante utilizada
en los primeros aos del diagnstico molecular, aunque hoy en da ha cado en cierto desuso. Se basa
en el diseo de sondas especficas para el alelo mutado y para el alelo nativo, utilizando
oligonucletidos. El tamao de las sondas hace que su Tm (temperatura de desnaturalizacin) sea lo
suficientemente distinta para que en determinadas condiciones de hibridacin la sonda especfica
del alelo normal hibride solamente con ADN normal, y la sonda especfica del alelo mutado hibride
especficamente con ADN genmico que contiene la mutacin. El ADN de los pacientes (puede ser tanto
ADN genmico como un exn amplificado mediante PCR) se deposita en membranas de nylon haciendo
un "dot-blot", y esas membranas se hibridan con cada una de las sondas (oligonucletidos marcados
con radioactividad o con fluorescencia). El anlisis de la hibridacin de cada sonda permite identificar si
la muestra contiene un solo alelo mutado (heterocigoto), dos alelos mutados (homocigoto para la
mutacin), o ninguno (homocigoto sano).
192 GENTICA HUMANA

- ARMS (Amplification Refractory Mutation System, Sistema de Mutacin Resistente a la Amplificacin)
est basada en el mismo principio que ASO, es decir, la utilizacin de oligonucletidos especficos para
la secuencia normal y para la secuencia mutada. La diferencia estriba en que, en el caso del ARMS,
estos oligonucletidos son cebadores de PCR. Se disean, por tanto, dos reacciones de PCR que
comparten un mismo cebador comn pero se diferencian en los cebadores especficos para cada alelo:
un cebador amplificar slo el alelo normal, el otro cebador amplificar slo el alelo mutado. Dada la
rapidez y sencillez de la PCR, esta tcnica est desplazando cada vez ms a la tcnica de ASO.

- OLA (Oligonucleotide Ligation Assay, Ensayo de Ligacin de Oligonucletidos). Se trata de un mtodo
algo ms laborioso, pero que una vez optimizado permite analizar gran nmero de muestras con
rapidez y fiabilidad. Se basa en la ligacin de dos oligonucletidos, uno de los cuales est marcado con
biotina y el otro con una molcula radioactiva o fluorescente. El punto crucial es el diseo de ambos
oligonucletidos a ambos lados de la base mutada. Por ejemplo, un diseo habitual es que ambos oligos
hibriden sobre la secuencia normal, de modo que la mutacin impida la hibridacin de uno de ellos.
Como consecuencia, la reaccin de ligacin slo ser efectiva en presencia de una secuencia normal.
Cuando se separan las sondas y se unen por los residuos de biotina a un soporte que contiene
estreptavidinas, slo las molculas completas (fruto de la ligacin de los dos oligos) emitirn la seal
correspondiente al marcador (radioactividad o fluorescencia). Por el contrario, el ADN de un sujeto
homocigoto para la mutacin no dar ninguna seal. En principio, este mtodo tambin permite
detectar los individuos heterocigotos para la mutacin, ya que la intensidad de la seal emitida ser la
mitad de la de un individuo homocigoto normal. El mtodo de OLA permite la automatizacin y la
cuantificacin de la seal cuando se utilizan marcadores fluorescentes, lo que le convierte en un buen
mtodo para el anlisis de gran cantidad de muestras.

- MLPA (Multiplex Ligation-dependent Probe Amplification) es una modificacin del OLA que permite
determinar el nmero de copias de hasta 45 genes en un solo ensayo, pudiendo discriminar secuencias
que difieren en un solo nucletido. MLPA utiliza, para cada gen, dos sondas: una de ellas es
complementaria a la secuencia que se quiere estudiar (21-30 nucletidos), a la que se aade la
secuencia de un cebador universal en el extremo 5'; la otra sonda de la pareja tiene otra secuencia
complementaria a la diana, un ADN de relleno que puede ser de distintos tamaos y la secuencia de
otro cebador universal en el extremo 3'. Ambas sondas hibridan a ambos lados de la secuencia diana, y
son ligadas por una ligasa termoestable. Con un solo cebador se pueden amplificar las sondas que se
han ligado correctamente. Utilizando secuencias de relleno de distintos tamaos para cada gen,
podemos amplificar en una misma reaccin muchos fragmentos distintos, lo que ahorra mucho tiempo
y reactivos. Adems, como las condiciones de reaccin son las mismas, la cantidad final de producto es
proporcional a la cantidad inicial de ADN, por lo que los resultados de MLPA pueden ser cuantificados.
Por tanto, MLPA permite detectar deleciones y amplificaciones, adems de detectar mutaciones.

La figura 17.8 resume los principios generales de varios mtodos para la
deteccin de mutaciones especficas, basados en la utilizacin de
oligonucletidos especficos.

Un comentario final a todas estas tcnicas de anlisis directo es que pueden aplicarse a ADN procedente de
distintos tipos de muestra, ya que trabajan con secuencias amplificadas mediante PCR. Por tanto, es posible
detectar la presencia de mutaciones no slo en ADN de sangre perifrica, sino tambin en raspados bucales,
CAPTULO 17: DIAGNSTICO DE ENFERMEDADES GENTICAS 193
vellosidades coriales, cabello, biopsias, material incluido en bloques de parafina o incluso de tarjetas
impregnadas con manchas de sangre (tarjetas de Guthrie, por ejemplo).


El proceso de diagnstico indirecto de enfermedades genticas

Como ya se ha mencionado al principio de este captulo, hay ocasiones en las que no es posible, o resulta
muy poco prctico, llevar a cabo diagnstico directo. Esto sucede en aquellos casos en los que no se conoce
la secuencia del gen causante de una enfermedad, o cuando ste es excesivamente grande y complejo
(compuesto por muchos exones, por ejemplo). En estos casos todava podemos predecir si un individuo ha
heredado la enfermedad, estudiando marcadores especficos que nos permitan identificar cul cromosoma
de los progenitores es el que lleva la mutacin. Una vez identificado, simplemente hemos de ver qu
cromosomas han heredado los hijos, para predecir la probabilidad de que tambin hayan heredado la
mutacin. Como no estudiamos directamente el gen, sino marcadores genticos que nos ayudan a
identificar los cromosomas, se denomina a este proceso "Diagnstico Indirecto". Para comprender el
diagnstico indirecto es necesario repasar los conceptos generales de ligamiento gentico y su aplicacin a
familias humanas que han sido expuestos en el Captulo 11.

A veces nos enfrentamos con una enfermedad gentica cuyo gen causal no ha sido todava identificado, lo
que obviamente impide realizar diagnstico directo. En otras ocasiones, an conociendo el gen que debe
estar mutado, resulta impracticable realizar estudios de diagnstico directo en la rutina de un laboratorio
clnico, por la gran heterogeneidad allica que muestra esa enfermedad (un gran nmero de posibles
mutaciones pueden ser las responsables del cuadro clnico), o en genes con una estructura exnica muy
compleja. Un ejemplo bastante claro es la Distrofia Muscular de Duchenne (DMD), debida a mutaciones en
el gen de la distrofina. Este gen es muy grande (ARNm de 14 kb) y tiene 79 exones distribuidos a lo largo
de 2,3 Megabases de ADN genmico, por lo que el estudio mutacional de cada exn sera excesivamente
laborioso. En este tipo de situaciones, una alternativa muy utilizada es la de establecer si el probando ha
heredado el cromosoma o los cromosomas parentales que llevan el gen mutado, o si por el contrario ha
heredado los cromosomas parentales normales. Para hacer esto se sigue un proceso denominado "gene
tracking", algo as como "seguir la pista" a los alelos enfermos en una familia concreta. Esto se hace
utilizando marcadores polimrficos situados muy cerca o incluso dentro del gen en cuestin, escogiendo
aquellos marcadores que sean informativos en cada familia concreta. Los marcadores son del mismo tipo
que los utilizados en el anlisis de ligamiento (RFLP, microsatlites). Utilizando esta estrategia podemos
saber si un individuo ha heredado una mutacin de su progenitor enfermo simplemente determinando si ha
heredado el cromosoma mutado de ese progenitor.

Lgicamente, esta estrategia es vlida siempre que no haya habido ninguna recombinacin entre el locus de
la enfermedad y el locus del marcador, de ah que utilicemos marcadores tan cercanos al gen que la
frecuencia de recombinacin sea prcticamente 0. De hecho, la metodologa empleada es la misma
que en los estudios de ligamiento, pero vara la manera de utilizar la informacin obtenida: mientras en los
estudios de ligamiento queremos determinar la distancia entre dos loci, en el anlisis indirecto ya sabemos
cul es esa distancia (y conocemos por tanto la frecuencia de recombinacin) y simplemente utilizamos esa
informacin para determinar cul cromosoma ha sido transmitido por cada progenitor a un individuo
concreto de la descendencia. El proceso general que se sigue en el diagnstico indirecto es el siguiente:

a) distinguir los dos cromosomas en cada uno de los progenitores: para esto es imprescindible encontrar
un marcador para el que ambos progenitores sean heterocigotos (a poder ser no idnticos), de manera
que esta familia sea totalmente informativa.
194 GENTICA HUMANA

b) resolver la fase de ligamiento en el individuo transmisor: esto supone ser capaces de determinar cul
de los alelos del marcador segrega con el alelo de la enfermedad (y "viaja", por tanto, en el mismo
cromosoma). Para esto hay que estudiar a los progenitores del individuo transmisor o a su
descendencia y deducir la fase de ligamiento entre el marcador y el gen. Nuevamente, una
recombinacin entre ambos loci (enfermedad y marcador) llevara a resultados errneos, de ah la
importancia de usar marcadores cercanos al gen (o intragnicos) de modo que la frecuencia de
recombinacin entre ambos sea despreciable.

c) Determinar el alelo del marcador que ha sido transmitido al probando. Esto nos dir (con una fiabilidad
mayor o menor dependiendo de la fraccin de recombinacin entre el marcador y el gen) si se ha
transmitido el cromosoma con el alelo mutado o el alelo normal. Aqu se hace evidente la enorme
utilidad del diagnstico indirecto: permite establecer si un individuo ha heredado la mutacin sin
necesidad de detectar directamente la presencia de la misma. Como hemos comentado, su gran
limitacin viene dada porque en ocasiones los marcadores estn a cierta distancia del locus de la
enfermedad y las predicciones no son fiables al 100%. Por ejemplo, si la distancia entre el marcador y
el locus de la enfermedad fuese de 5 cM (lo que supone una frecuencia de recombinacin del 5%), la
fiabilidad del anlisis slo sera del 95%, ya que en un 5% de los casos podra haberse dado un
sobrecruzamiento entre ambos loci que hubiese trasladado el alelo mutado al cromosoma homlogo. En
la prctica, solventamos esta limitacin mediante el uso de varios marcadores, preferiblemente situados
a ambos extremos del locus de la enfermedad. De esta forma, la nica posibilidad de error sera un
doble sobrecruzamiento entre el locus de la enfermedad con cada uno de los marcadores, pero la
probabilidad de que esto suceda es prcticamente despreciable. Lgicamente, a mayor nmero de
marcadores, mayor fiabilidad de los resultados, sobre todo si adems se incluyen marcadores situados
dentro del propio gen de la enfermedad.

La figura 17.9 explica el proceso general del diagnstico indirecto utilizando
marcadores polimrficos en ligamiento con el gen responsable de una
enfermedad gentica.

CAPTULO 18: GENTICA CLNICA 195
Captulo 18. Gentica Clnica.
Gentica clnica y consejo gentico. Enfermedades de herencia autosmica y
de herencia ligada al cromosoma X. Aplicacin del teorema de Bayes al
clculo de riesgos genticos. Enfermedades por alteracin del ADN
mitocondrial. Diagnstico prenatal.


Gentica clnica y consejo gentico

La gentica clnica se ocupa del diagnstico y atencin de las personas y familias en las que aparece una
enfermedad gentica. Incluye varios aspectos, algunos de ellos algo diferentes de la prctica mdica
habitual:

Diagnstico correcto de la enfermedad, de lo contrario el clculo de riesgos genticos no tiene sentido.
Para ello, adems de los mtodos clsicos de diagnstico, es importante realizar bien el diagnstico
molecular (estudiado en el Captulo anterior) y reconstruir la historia familiar detallada.

La aplicacin de los principios de la gentica mendeliana permite calcular el riesgo de recurrencia de la
enfermedad en la misma familia, establecer el pronstico, iniciar medidas de diagnstico precoz y de
prevencin en individuos de riesgo (antes de la aparicin de los sntomas). Por todo esto, la gentica
clnica es un pilar bsico de la "Medicina predictiva" del futuro.

Un elemento fundamental es el consejo gentico, que, segn la definicin de la Sociedad Americana
de Gentica Humana (1975) "es un proceso de comunicacin que trata de los problemas humanos
asociados con la ocurrencia, o riesgo de ocurrencia, de un transtorno gentico en una familia. Este
proceso requiere que una o ms personas adiestradas de forma apropiada ayuden al individuo o familia
a: 1) comprender los hechos mdicos, incluyendo el diagnstico, la evolucin probable del transtorno y
el tratamiento disponible; 2) apreciar el modo en que la herencia contribuye al transtorno y el riesgo de
recurrencia en parientes concretos; 3) comprender las alternativas para enfrentarse al riesgo de
recurrencia; 4) escoger un curso de accin que les parezca apropiado a la vista de su riesgo, sus
objetivos familiares y sus normas ticas y religiosas, y actuar de acuerdo con la decisin tomada, y 5)
procurar la mejor adaptacin posible a la enfermedad en un miembro afectado de la familia y/o al
riesgo de esta enfermedad". En contraste con el mtodo mdico tradicional, en el que el facultativo
prescribe al paciente lo que debe hacer, entre profesionales de la Gentica Clnica existe un amplio
consenso a favor de que el consejo gentico sea un proceso no-directivo, es decir, que sea el propio
paciente o la familia los que decidan qu accin tomar en funcin de la informacin proporcionada por
el facultativo. En este sentido, es importante comprender que la carga de una enfermedad gentica
para el paciente y para la familia puede ser valorada de modo muy distinto de unos casos a otros,
dependiendo de varias circunstancias. Es importante explicar bien las posibilidades de modificar la
carga gentica o el riesgo gentico, y poner a las familias afectadas en contacto con servicios sociales
de apoyo, organizaciones de afectados por la enfermedad, etc.

Las dos herramientas bsicas de la gentica clnica, que el estudiante debe dominar, son la realizacin de
la historia familiar y la estimacin de riesgos genticos. La historia familiar es la parte de la historia clnica
en la que se reconstruye el rbol familiar y se intenta identificar otros miembros del mismo que puedan
196 GENTICA HUMANA
estar afectados por la enfermedad. Esto permitir deducir el tipo de herencia y el riesgo de recurrencia. Se
utilizan las reglas generales de construccin de rboles familiares, y adems es importante:

Preguntar acerca de nacidos muertos abortos espontneos.
Indagar la existencia de posible consanguinidad.
Tener en cuenta posibles casos de falsa paternidad.
Recoger tambin informacin bsica de las ramas del rbol que parezcan no estar afectadas.
Siempre es mejor registrar la fecha de nacimiento que la edad.
Tener en cuenta que el diagnstico puede no ser acertado, sobre todo en el caso de individuos ya
fallecidos. Por tanto, es importante examinar directamente, siempre que sea posible, a los individuos
afectados; examinar a los presumiblemente sanos, para excluir que en realidad tengan una forma
poco severa de la enfermedad; tratar de obtener toda la informacin posible de otros parientes ms
lejanos.

Por lo que respecta a la estimacin del riesgo gentico, se expresa siempre como una probabilidad, es
decir en modo fraccional o en porcentaje (un riesgo de es igual a un riesgo del 50%). El riesgo gentico
no es ms que la probabilidad de padecer la enfermedad que tiene un individuo concreto de la familia,
probabilidad estimada a partir de los datos del rbol familiar que nos permiten deducir el tipo de herencia y
aplicar las leyes mendelianas.

Los patrones hereditarios tpicos se pueden reconocer al analizar el rbol genealgico de la familia en la que
hay individuos enfermos, ya que cada tipo de herencia produce rboles familiares con unas caractersticas
propias. Para la construccin de rboles familiares, llamados tambin "genealogas" "pedigrs" (por
influencia del trmino ingls pedigree), se utilizan unos smbolos aceptados por convenio, y se construyen
siguiendo unas reglas que hay que conocer.

La Figura 18.1 muestra los principales smbolos utilizados en la creacin de
rboles genealgicos (genealogas o pedigrs).


Enfermedades de herencia autosmica

Las enfermedades autosmicas dominantes suelen tener una frecuencia gnica muy baja (la prevalencia
de estas enfermedades es habitualmente inferior a 1/1000 individuos), y por tanto los individuos
homocigotos son extremadamente infrecuentes; de hecho, la homocigosidad para estas enfermedades
es muchas veces letal y provoca abortos espontneos. El rbol tpico de una enfermedad autosmica
dominante muestra individuos enfermos en todas las generaciones, afectando ambos sexos por igual.
Cuando se ve una transmisin de padre enfermo a hijo varn, podemos descartar la presencia de una
enfermedad ligada al cromosoma X. Para calcular el riesgo de padecer la enfermedad en la descendencia, se
utilizan los cuadrados de Punnet, como se muestra en la siguiente figura para el caso de la unin entre un
individuo heterocigoto enfermo (Aa) y un individuo sano (AA), pues este es el tipo de unin ms frecuente
en estas enfermedades. Mediante el uso de estos diagramas es fcil concluir que la mitad de la
descendencia sern heterocigotos enfermos (Aa), y la otra mitad homocigotos sanos (AA). Dos individuos
sanos, si efectivamente son homocigotos (veremos alguna excepcin ms adelante), no pueden tener
descendencia con la enfermedad.

CAPTULO 18: GENTICA CLNICA 197
Ya se ha mencionado antes que es muy poco frecuente encontrar enfermos homocigotos (dos alelos
mutados), pues esto exigira la unin de dos heterocigotos enfermos. Sin embargo, hay algunas
enfermedades autosmicas dominantes en la que esto sucede con mayor frecuencia de lo habitual, debido a
que tienen una frecuencia gnica ms alta de lo habitual (no son letales, sino de comienzo tardo, por lo que
permiten llegar a la edad frtil, tener descendencia y propagar la mutacin). Un buen ejemplo de lo dicho es
la Hipercolesterolemia familiar, una enfermedad autosmica dominante debida a mutaciones en el
receptor de las LDL (lipoprotenas de baja densidad) que cursa con niveles altos de colesterol total y
colesterol LDL, xantomas tendinosos, xantelasmas y aterosclerosis precoz. La enfermedad afecta a 1 de
cada 500 individuos de la poblacin, y es causa del 5% de los infartos de miocardio que se producen antes
de los 60 aos de edad. Como es una enfermedad que no altera la fertilidad, la frecuencia allica es alta (en
torno a 1 de cada 1000 alelos presentes en la poblacin estn mutados) y no es raro encontrar individuos
homocigotos (en torno a 1 por milln). Los homocigotos estn afectados con ms gravedad que los
heterocigotos, mostrando niveles ms altos de colesterol y mayor riesgo de enfermedad coronaria. El
anlisis molecular de los individuos enfermos y de los miembros de su familia permite predecir la gravedad
de la enfermedad, establecer el riesgo en la descendencia y comenzar el tratamiento preventivo con dieta o
frmacos hipolipemiantes. Tambin se pueden encontrar individuos homocigotos en enfermedades
autosmicas dominantes en las que existe una cierta predisposicin a las uniones entre individuos
enfermos. Esto ltimo sucede, por ejemplo, en una enfermedad llamada acondroplasia. Los individuos que
sufren esta enfermedad, dada su baja estatura, tienden a formar matrimonios entre ellos, lo que eleva la
probabilidad de que aparezcan sujetos homocigotos.

Las enfermedades autosmicas recesivas requieren, por definicin, que los individuos afectados sean
homocigotos (dos alelos mutados) y, por tanto, sus progenitores son habitualmente portadores sanos
heterocigotos. El rbol tpico de un patrn autosmico recesivo muestra generaciones con algn miembro
afectado, separadas por generaciones en las que no hay ningn individuo enfermo, patrn muy poco
probable en transtornos dominantes. Se encuentran individuos enfermos de ambos sexos, y es muy
frecuente la presencia de uniones con-sanguneas (entre individuos que comparten un ancestro comn,
como primos, primos segundos, etc).

Un buen ejemplo de enfermedad autosmica recesiva es la Fibrosis Qustica del Pncreas, enfermedad
debida a mutaciones en el gen CFTR (Cystic Fibrosis Transmembrane Regulator), localizado en 7q31. La
enfermedad afecta a 1 de cada 2.500 nacidos vivos de raza caucsica, lo que significa una frecuencia allica
del 0,02 (2% de los alelos presentes en la poblacin estn mutados) y una frecuencia de portadores del
0,04 (1 de cada 25 individuos de la poblacin general son heterocigotos). La enfermedad surge por el mal
funcionamiento de un canal de cloro, lo que provoca una mucoviscidosis (secreciones mucosas muy
viscosas) que poco a poco conduce a la destruccin del tejido pulmonar y pancretico, adems de provocar
obstruccin intestinal en algunos neonatos. Se conocen alrededor de 400 mutaciones diferentes en el gen
CFTR, pero en poblaciones europeas un 70% de los casos se deben a la delecin F508del, que deleciona 3
bases sin cambiar el marco de lectura:

SECUENCIA NORMAL GAA AAT ATC ATC TTT GGT GTT
Glu Asn Ile Ile Phe Gly Val

F508del GAA AAT ATC AT- --T GGT GTT
Glu Asn Ile Ile Gly Val

198 GENTICA HUMANA
Adems de F508del, hay otras mutaciones que causan Fibrosis Qustica y que se encuentran con frecuencia
allica mayor a 1%, de modo que el anlisis de 8 mutaciones (incluyendo F508del) puede detectar hasta un
85-90% de los casos en poblaciones de origen europeo.

La Figura 18.2 muestra los rboles genealgicos tpicos de las enfermedades
con herencia autonmica dominante y autonmica recesiva.

Hay una serie de fenmenos muchos de los cuales ya se han mencionado que complican la
evaluacin de los rboles de enfermedades autosmicas dominantes y recesivas, y hacen que el
clculo de los riesgos en la descendencia sea menos fiable. A continuacin se sealan los problemas ms
frecuentes:

- Heterogeneidad gentica de locus. Ya se ha mencionado que muchas enfermedades hereditarias
pueden estar causadas por mutaciones en genes distintos, y se han visto algunos ejemplos. Esto se
manifiesta, habitualmente, en la aparicin de distintos patrones de herencia en familias diferentes. As,
por ejemplo, hemos visto un tipo de enfermedad de Charcot-Marie-Tooth que sigue un patrn
autosmico dominante (por duplicaciones del gen PMP22), pero tambin existen familias en las que
esta enfermedad sigue un patrn ligado al sexo (por mutaciones en otro gen situado en el cromosoma
X). Otro ejemplo notable es el Sndrome de Ehlers-Danlos, que puede estar causado por mutaciones
en al menos 8 loci diferentes, dando lugar a familias con patrn autosmico dominante, autosmico
recesivo o ligado al sexo recesivo, dependiendo del gen implicado en cada caso. Lgicamente, la
identificacin del tipo de herencia en una familia concreta nos ayudar a predecir el gen afectado (y
buscar mutaciones en el mismo, si es posible) y a estimar el riesgo de padecer la enfermedad en la
descendencia.

I
II
III
1 2 3 4 5 6 7 8
1 2 3 4 5 6 7 8
I
II
III
1 2 3
?
4
1 2 3 4
5
IV
1 2
1 2
I
II
III
1 2 3 4 5 6 7 8
1 2 3 4 5 6 7 8
I
II
III
1 2 3 4 5 6 7 8
1 2 3 4 5 6 7 8
I
II
III
1 2 3
?
4
1 2 3 4
5
IV
1 2
1 2
I
II
III
1 2 3
?
4
1 2 3 4
5
IV
1 2
1 2
CAPTULO 18: GENTICA CLNICA 199
- Penetrancia incompleta. Hasta ahora hemos dado por supuesto que siempre que un gen est mutado
se desarrollar la enfermedad correspondiente. Por desgracia para el profesional de la Medicina (pero
por suerte para los pacientes), esto no se cumple en el 100% de los casos. De hecho, no es infrecuente
encontrar rboles en los que un individuo ha transmitido una enfermedad dominante sin haber estado
l mismo afectado por dicha enfermedad. En la figura puede observarse una familia afectada por una
enfermedad autosmica dominante en la que el individuo II-4 (sealado por la flecha) ha heredado y
transmitido la mutacin, pero no ha llegado a desarrollar la enfermedad. Descartando la posibilidad de
que se trate de una nueva mutacin que ha surgido en ese individuo, ya que esa misma enfermedad
estaba ya presente en los progenitores, hemos de concluir que este individuo es portador de la
mutacin pero no expresa la enfermedad. Este fenmeno se denomina "penetrancia incompleta", y es
caracterstico de algunas enfermedades dominantes, como por ejemplo el Retinoblastoma hereditario.

- Expresividad variable. Muchas enfermedades hereditarias tienen manifestaciones clnicas complejas,
con signos y sntomas que se pueden presentar en distintas combinaciones y con distinto grado de
severidad. Se dice entonces que estas enfermedades tienen expresividad clnica variable. En algunos
casos, como por ejemplo la Neurofibromatosis tipo 1, distintos miembros de una misma familia (todos
con la misma mutacin), pueden tener manifestaciones clnicas de la enfermedad muy dispares. No
tenemos hoy en da una explicacin clara para el fenmeno de la distinta expresividad de una misma
mutacin, pero es probable que est originado por factores ambientales que influyen en el desarrollo de
la enfermedad o por diferencias inter-individuales en otros genes que modifican la expresin del
fenotipo.

En la Figura 18.3 se ilustran los conceptos de penetrancia incompleta y
expresividad variable.

Por lo que respecta al clculo de riesgos, podemos resumir:

- Las enfermedades de herencia autosmica dominante tienen, en general, frecuencias allicas muy
bajas (<0,001) y por eso los individuos homocigotos (ambos alelos mutados) son muy raros. Lo normal
es encontrar cruces entre un heterocigoto y un homocigoto sano, por lo que el riesgo en la
descendencia es de 50% heterocigotos enfermos y 50% homocigotos sanos. Por eso, para cada hijo el
riesgo de recurrencia es del 50%, aunque siempre hay que tener en cuenta los factores que pueden
modificar estos riesgos (penetrancia incompleta, expresividad variable, tasa de nuevas mutaciones).

- En enfermedades de herencia autosmica recesiva, ambos progenitores tienen que ser al menos
portadores, por lo que en la descendencia habr 25% de enfermos (homocigotos con mutacin), 25%
de sanos (homocigotos sin mutacin) y 50% de portadores sanos (heterocigotos). Por tanto, el riesgo
de recurrencia es inicialmente (25%). Es importante recordar que la presencia de consanguinidad es
un hecho muy frecuente en estas enfermedades. Ms raramente hay matrimonios entre un portador
sano y un enfermo homocigoto, en cuyo caso se produce un patrn de herencia cuasi-dominante con
50% de enfermos y 50% de portadores sanos en la descendencia. Una causa frecuente de consulta en
el caso de enfermedades de herencia autosmica recesiva es el matrimonio entre un portador y un
individuo de otra familia distinta en la que no existe la enfermedad. Lgicamente, el riesgo final para la
descendencia depender fundamentalmente de la probabilidad que tenga este individuo de ser
portador, lo cual, a su vez, depende de la tasa de portadores en la poblacin general. Como se
recordar, la ley de Hardy-Weinberg permite estimar esta tasa en funcin de la prevalencia de la
enfermedad en esa poblacin.
200 GENTICA HUMANA

En la Figura 18.4 se muestran los cuadrados de Punnet que ayudan a calcular
el riesgo de recurrencia en enfermedades de herencia autonmica dominante
y recesiva.


Enfermedades de herencia ligada al cromosoma X

Al igual que las enfermedades autosmicas, las enfermedades ligadas al sexo pueden ser recesivas o
dominantes. Lo ms habitual es encontrar enfermedades de herencia ligada al sexo recesivas, en las que
las mujeres portadoras son sanas. El rbol tpico muestra nicamente varones enfermos, habitualmente sin
transmisin de la enfermedad de un padre a sus hijos varones. Se pueden dar 3 situaciones, cuyos
cuadrados de Punnet se presentan a continuacin. En primer lugar, la unin entre una mujer portadora (Aa)
y un varn sano (A) dar lugar a un 50% de hijas homocigotas sanas y un 50% de heterocigotas
portadoras, mientras que el 50% de los hijos varones sern sanos y el otro 50% sern enfermos. En el caso
de uniones entre una mujer portadora sana (Aa) y un varn enfermo (a), los hijos varones tendrn los
mismos riesgos que en el caso anterior (la mitad sanos y la mitad enfermos), pero las hijas sern
homocigotas (enfermas, por tanto) en el 50% de los casos y portadoras sanas en el otro 50%. Por ltimo,
las uniones entre un varn enfermo (a) y una mujer homocigota sana (AA) dan lugar a una descendencia
en la que todos los hijos son sanos y todas las hijas son portadoras sanas. Como puede apreciarse, es
importante distinguir las mujeres sanas que son homocigotas de aquellas que son heterocigotas portadoras.

Ya hemos comentado que la inactivacin del cromosoma X se realiza al azar en clulas somticas, de forma
que toda mujer es, en el fondo, un mosaico con poblaciones celulares en las que se ha inactivado un
cromosoma X y poblaciones celulares en las que se ha inactivado el otro. Sin embargo, en algunas
circunstancias la inactivacin puede ser preferencial, inactivndose el mismo cromosoma X en todas
las clulas. Esto sucede, por ejemplo, en casos de anomalas estructurales (deleciones o duplicaciones) que
afectan a uno de los cromosomas X, en cuyo caso suele inactivarse el cromosoma anormal. En cambio, en
individuos con translocaciones equilibradas entre el cromosoma X y un autosoma se inactiva
preferencialmente el cromosoma normal, ya que de lo contrario se producira a una monosoma parcial del
autosoma implicado en la translocacin. Tambin se ha visto inactivacin sesgada en algunas familias con
deleciones que afectan a XIST o a TSIX, as como en familias con mutaciones que afectan al promotor de
XIST. En algunos casos raros de enfermedades ligadas al sexo recesivas, la inactivacin preferencial del
cromosoma X normal en mujeres portadoras (que deberan ser fenotpicamente sanas) puede dar a lugar a
la aparicin de la enfermedad, aunque habitualmente con unas manifestaciones ms leves.

La Distrofia Muscular de Duchenne (DMD) es quizs uno de los mejores ejemplos de enfermedad ligada al
sexo recesiva. Esta causada por mutaciones en el gen de la distrofina, localizado en Xp21, y afecta a 1 de
cada 3.300 varones en todos los grupos tnicos. La ausencia de distrofina provoca la desestructuracin del
Complejo Asociado a la Distrofina (DAC) del sarcolema y conduce a la aparicin de una degeneracin
muscular progresiva que suele terminar con la vida del paciente alrededor de la tercera dcada de la vida.
Como se recordar, el gen DMD es uno de los de mayor tamao conocido, lo que condiciona una alta tasa
de nuevas mutaciones (en torno a 10
4
nuevas mutaciones por generacin). Alrededor del 60% de las
mutaciones son deleciones (con tamaos que van desde varias kilobases hasta una megabase), con un
"punto caliente" (hot spot) de aparicin de deleciones en el exn 7. El resto de las mutaciones son
deleciones pequeas y mutaciones puntuales que alteran el marco de lectura. La distrofia muscular de
Becker es un fenotipo ms leve causado por mutaciones en el mismo gen, pero en este caso las
CAPTULO 18: GENTICA CLNICA 201
mutaciones NO rompen el marco de lectura (deleciones pequeas y mutaciones puntuales con cambio de
sentido).

El rbol tpico de las enfermedades con herencia ligada al sexo dominante muestra una estructura similar
al de las enfermedades autosmicas dominantes, con la peculiaridad de que nunca hay transmisin
padre-hijo, pero en cambio todas las hijas de los varones enfermos son heterocigotas enfermas. Por el
contrario, desarrollar la enfermedad el 50% de los hijos y el 50% de las hijas de una mujer portadora y un
varn normal. En general, los rboles suelen mostrar la presencia del doble de mujeres enfermas que de
varones enfermos, excepto en aquellos casos en que la enfermedad es letal en varones. De todas formas,
las mujeres suelen desarrollar formas ms leves de la enfermedad, debido a que el 50% de sus clulas
habrn inactivado el cromosoma X portador de la mutacin y expresarn el alelo normal del gen implicado.
Algunos ejemplos de estas enfermedades son el Sndrome de Rett, el Raquitismo Hipofosfatasmico, o la
Incontinencia Pigmentaria tipo 1 (enfermedad en la que slo se ven mujeres afectadas, probablemente por
letalidad embrionaria en varones).

En la Figura 18.5 se muestran los pedigrs tpicos de enfermedades ligadas al
sexo recesivas y dominantes.

Un patrn hereditario anmalo, dentro de las enfermedades ligadas al cromosoma X, es el que presentan
las familias con Sndrome del X Frgil. El estudio del rbol de una familia con esta enfermedad pone de
manifiesto un patrn de herencia dominante con penetrancia reducida en mujeres, adems de otros hechos
que constituyen lo que se conoce como "paradoja de Sherman": 1) el riesgo de transmisin de la
enfermedad aumenta en sucesivas generaciones, y 2) se encuentran varones normales que transmiten la
enfermedad a todas sus hijas, que sern por tanto portadoras sanas. Como hemos comentado en otro
Captulo, hoy en da sabemos que esta enfermedad est causada por la expansin de un trinucletido en el
gen FMR1, con alelos que varan en el nmero de veces que est repetido el trinucletido. La presencia de
premutacin (rango de 50 a 230 repeticiones) no provoca manifestaciones fenotpicas en los portadores
(tanto varones como mujeres). La expansin de estos alelos premutados slo se produce por va materna, y
la probabilidad de que esto suceda depende de la longitud del alelo premutado.

La Figura 18.6 ilustra la paradoja de Sherman, mostrando en un rbol los
riresgos de expansin a mutacin completa dependiendo del tamao de la
premutacin y del sexo.

I
II
III
1 2
4 5
4 5
1
2
1 2
3
1
2
IV
3
I
II
III
1 2
4 5
4 5
1
2
1 2
3
1
2
IV
3
202 GENTICA HUMANA
En general podemos afirmar que la expansin de pre-mutacin a mutacin completa tiene lugar en
menos del 20% de los alelos <70 repeticiones y en ms del 70% de los alelos >90 repeticiones. Como se
recordar, la expansin a mutacin completa va acompaada de hipermetilacin del promotor del gen
FMR1, lo que provoca la ausencia de la protena. Aunque la mutacin provoca una prdida de funcin del
gen, el fenotipo es dominante (basta un alelo con la mutacin completa para desarrollar la enfermedad). De
hecho, la presencia de un cromosoma con mutacin completa e hipermetilacin se asocia con retraso
mental en todos los varones y en el 50-70% de las mujeres (por la inactivacin del X, muchas clulas
habrn inactivado el cromosoma X mutado). Las mujeres que llevan un alelo con pre-mutacin no suelen
desarrollar la enfermedad, pero tienen riesgo de sufrir expansin en su descendencia. Por el contrario, los
varones con pre-mutacin denominados Varones Transmisores Normales (NTM, Normal Transmitting
Male) transmiten el alelo premutado, sin sufrir expansin, a todas sus hijas (que sern portadoras sanas),
y como es lgico no lo transmiten a ninguno de sus hijos. Recientemente se ha encontrado que estos
varones desarrollan una enfermedad neurolgica llamada FXTAS (sndrome de temblor/ataxia asociado con
el X-frgil) en las ltimas dcadas de la vida. Estos individuos muestran inclusiones cerebrales con aumento
del mRNA y de la protena FMRP, adems de otras protenas como laminina A/C. Esta enfermedad es un
bello ejemplo de cmo la identificacin del mecanismo molecular gentico ha permitido explicar una serie de
fenmenos clnicos y hereditarios de difcil comprensin.

El clculo de riesgos en las enfermedades de herencia recesiva ligada al cromosoma X, por tanto, debe
hacerse teniendo en cuenta que las mujeres portadoras (heterocigotas) son sanas pero los varones
hemicigotos (con una mutacin en su nico cromosoma X) son enfermos. En el caso de mujeres portadoras,
la mitad de sus hijos varones sern enfermos y la otra mitad sanos; de sus hijas, la mitad sern portadoras
y la otra mitad homocigotas sanas. Es caracterstico que nunca hay transmisin de padre enfermo a
hijos varones, lo cual es muy importante para el consejo gentico. En cambio, el 50% de las hijas de un
varn enfermo sern portadoras (sanas), pero ninguna ser enferma. La excepcin a esta regla general es
el matrimonio de un varn enfermo con una mujer portadora, lo cual sucede a veces en casos de
consanguinidad. En estos casos puede haber mujeres enfermas (heredan dos mutaciones) e incluso
transmisin de padre enfermo a hijo varn (aunque, en realidad, el hijo hereda la enfermedad de su
madre). Por lo que respecta a la herencia ligada al X dominante, el matrimonio entre una mujer enferma
(heterocigota) y un varn normal produce una descendencia con riesgo de recurrencia en el 50% de los
hijos y en el 50% de las hijas. En cambio, el matrimonio entre un varn afectado y una mujer normal da
lugar a un riesgo del 100% de recurrencia en las hijas (todas heredan el cromosoma X paterno, que
transmite la mutacin), pero todos los hijos varones sern sanos.


Teorema de Bayes y su aplicacin al clculo de riesgos genticos

En algunas situaciones, los riesgos de recurrencia calculados segn los principios mendelianos pueden ser
matizados y precisados por informacin adicional acerca de esa familia. Por este motivo, el consejo gentico
hace uso de la estadstica bayesiana, derivada de la aplicacin del teorema de Bayes. En su formulacin
general, el teorema de Bayes dice que:

P(A) x P(B|A)
P(A|B) =
E P(A) x P(B|A)

Esto significa que la probabilidad de un suceso A cuando se verifica una condicin B (eso se representa
como "A sobre B") es igual a la probabilidad inicial del primer suceso, multiplicado por la probabilidad de
CAPTULO 18: GENTICA CLNICA 203
que la condicin B se verifique en presencia del suceso A, dividido por la probabilidad total de la condicin B
(que es el sumatorio de todos los posibles numeradores). Es decir, la probabilidad inicial terica de un
suceso cualquiera puede ser modificada si se cumple alguna condicin que afecta a ese suceso, dependiendo
de la probabilidad de esa condicin y de la probabilidad de que cuando tal condicin se cumple se vea
afectado el suceso inicial. Este tipo de anlisis estadstico tiene aplicacin en muchos campos, pero en el
caso concreto del consejo gentico es especialmente til en el clculo de riesgos de recurrencia de
enfermedades recesivas ligadas al cromosoma X, en las que podemos incluir informacin de tipo
condicional. Tambin es posible incorporar los datos del diagnstico molecular para matizar los riesgos de
recurrencia calculados segn los principios mendelianos, como veremos en algunos ejemplos.

Quizs el ejemplo ms sencillo de cmo utilizar la informacin derivada de rboles genealgicos para
modificar los riesgos iniciales sea el clculo del riesgo de ser portador de una enfermedad autosmica
recesiva. Como sabemos por los principios mendelianos, cualquier hermano o hermana de un afectado con
una enfermedad autsomica recesiva, cuyos progenitores son portadores sanos, tiene una probabilidad
inicial del 50% de ser portador sano, 25% de ser homocigoto sano y 25% de ser homocigoto enfermo. En
cambio, puede darse el caso de que nos encontremos una familia en la uno de los hermanos es sano, y
claramente no ha desarrollado la enfermedad. En ese individuo, lgicamente, podemos despreciar el 25%
de probabilidad de ser enfermo, porque de hecho est sano. En efecto, slo hay dos posibilidades de ser
hermano sano de un afectado por una enfermedad autosmica recesiva: o ser portador (probabilidad inicial
del 50%) o ser homocigoto sano (probabilidad inicial del 25%). De este 75% total, un 50% corresponde a la
probabilidad de ser portador, luego el riesgo que tiene un hermano sano de ser portador de la enfermedad
no es 50%, como inicialmente cabra suponer, sino realmente 2/3. Esto, que se comprende modo intuitivo,
supone realmente una aplicacin del teorema de Bayes. En efecto, la probabilidad (P) inicial de ser portador
sano es y de ser homocigoto sano es , como acabamos de ver. Establecemos la condicin ("si el
individuo es SANO") y calculamos la probabilidad condicional para cada estado posible: en este caso, la
probabilidad condicional es 1 (100%) siempre, ya que tanto un portador sano como un homocigoto sano
son sanos. Si hacemos una tabla en la que indicamos las probabilidades bajo cada una de las dos posibles
situaciones, obtenemos algo como lo que se muestra a continuacin. Un individuo portador tiene una
probabilidad inicial (a priori) del 50% de ser sano, y si cumple la condicin de estar sano su probabilidad
condicional (estar sano) es del 100% (P=1); lo mismo puede calcularse para un homocigoto sano
(probabilidades inicial y condicional de y 1, respectivamente). A continuacin se calcula la probabilidad
combinada conjunta de que ambos sucesos tengan lugar a la vez, es decir, se multiplican la probabilidad
inicial y la condicional. La probabilidad conjunta corresponde al trmino P(A) x P(B|A) de la ecuacin
anterior. Como vemos en la tabla, las probabilidades conjuntas son 1/2 y 1/4, respectivamente, para el caso
de ser portador sano o de ser homocigoto sano:










La suma de todas las posibles probabilidades conjuntas (el sumatorio que est en el denominador de la
ecuacin) es, en nuestro caso, 3/4 (1/2 + 1/4). Por tanto, la probabilidad final se calcula hallando el
cociente entre la probabilidad conjunta de cada situacin y la suma de todas ellas. En nuestro ejemplo, la

Portador Homocigoto (sano)
Inicial 1/2 1/4
Condicional ("si es sano") 1 1
Conjunta 1/2 1/4
Final 2/4 3/4=2/3 1/3

204 GENTICA HUMANA
probabilidad final de que el hermano de un enfermo con una enfermedad autosmica recesiva sea portador
de la misma, si es sano, es de (1/2) (3/4) = 2/3, y la probabilidad final de que sea homocigoto sano es
1/3. Como se puede ver, los riesgos no siempre son algo fijo, sino que en ocasiones pueden modificarse, a
veces de manera sustancial, con la incorporacin de nueva informacin.

El teorema de Bayes tambin se utiliza con frecuencia para calcular el riesgo derivado de pruebas
diagnsticas bioqumicas o moleculares, y puede combinarse con la informacin obtenida del rbol
genealgico. Por ejemplo, si se sabe que una enfermedad tiene una prevalencia de 1/100.000 individuos, la
probabilidad inicial de padecerla es P(A)=10
-5
. Si una prueba diagnstica es positiva en el 80% de los
individuos enfermos y en un 5% de sanos (falsos positivos), podemos calcular la probabilidad de que un
individuo en el que la prueba es positiva realmente padezca la enfermedad. Para esto, calculamos la
probabilidad de tener alterada la prueba si uno est enfermo: P(B|A)=0,8. Igualmente, la probabilidad de
tener alterada la prueba si uno est sano es 0,05 (obsrvese el uso del condicional para calcular las
probabilidades condicionales). La probabilidad final de que un sujeto tenga la enfermedad y adems una
prueba diagnstica positiva es, por tanto, el producto de la probabilidad inicial de enfermar multiplicado por
la probabilidad condicional de tener alterada la prueba si est realmente enfermo, dividido por la
probabilidad de que el marcador est alterado en general (la suma de ambas probabilidades conjuntas):










Obsrvese que hemos multiplicado por ms de diez el riesgo inicial, en aquellos casos en los que la prueba
diagnstica est alterada.

En cualquier caso, la situacin en la que ms se utiliza el teorema de Bayes en consejo gentico es para el
clculo del riesgo de ser mujer portadora en las enfermedades con herencia ligada al X recesiva,
ya que en estos casos el riesgo puede modificarse sustancialmente. En estas familias es importante
identificar correctamente la mujeres portadoras obligatorias (aquellas que han tenido al menos un hijo
enfermo o una hija portadora) y asignar la informacin condicional correctamente, sobre todo en el caso de
estudios moleculares de anlisis indirecto.

La Figura 18.7 ilustra la aplicacin del teorema de Bayes al clculo de riesgos
en enfermedades de herencia ligada al X recesiva, utilizando algunos
ejemplos prcticos.


Enfermedades por alteracin del ADN mitocondrial

El ADNmt presenta una serie de caractersticas genticas que lo diferencian claramente del ADN nuclear:


Enfermo Sano
Inicial 10
-5
0,99999
Condicional 0,8 0,05
Conjunta 0,8 x 10
-5
0,0499995

Final (0,8 x 10
-5
) 0.0500075 = 1.6 x 10
-4



CAPTULO 18: GENTICA CLNICA 205
- Alta tasa de mutacin: La tasa de mutacin espontnea del ADNmt es unas 10 veces superior a la del
ADN nuclear. Por tanto, hay una gran variacin de secuencias entre especies e incluso entre individuos
de una misma especie. En el hombre se ha calculado que dos individuos escogidos al azar tienen como
promedio 50-70 nucletidos diferentes en su genoma mitocondrial. Adems de estas diferencias, en un
individuo determinado se est produciendo continuamente, a lo largo de la vida, una heterogeneidad en
el ADNmt como consecuencia de las mutaciones que se estn dando en las clulas somticas. Se ha
propuesto que una acumulacin de este dao mitocondrial pudiera ser la causa de la disminucin en la
capacidad respiratoria de los tejidos que tiene lugar durante el envejecimiento.

- Poliplasmia y Segregacin mittica: En cada clula hay cientos o miles de molculas de ADNmt. En
principio, todas las clulas de un individuo normal tienen molculas idnticas de ADNmt, situacin que
se denomina homoplasmia. Si en una clula aparecen dos poblaciones de ADNmt, una normal y otra
mutada, se dice que estamos en una situacin de heteroplasmia. Durante la divisin celular, las
mitocondrias y, por tanto, las molculas de ADNmt se distribuyen al azar entre las clulas hijas.

- Efecto umbral: El fenotipo de una clula en heteroplasmia depender del porcentaje de ADN daado
que exista en la clula; es decir, del grado de heteroplasmia de una mutacin. Cuando el nmero de
molculas de ADNmt mutadas es pequeo, el ADNmt normal es capaz de mantener la funcin
mitocondrial. Sin embargo, cuando el nmero de copias de ADNmt mutado sobrepasa un umbral
determinado, la produccin de ATP puede llegar a estar por debajo de los mnimos necesarios para el
funcionamiento de los tejidos, llevando al desarrollo de patologa mitocondrial. Es importante tener en
cuenta que los distintos tejidos pueden variar en el grado de homoplasmia o heteroplasmia para un
ADNmt mutado, lo que origina una gran variabilidad en la expresividad clnica de las enfermedades
mitocondriales. Por otra parte, los tejidos tienen distintas necesidades energticas, y el nmero de
orgnulos y de molculas de ADNmt es tambin diferente en cada tejido. Por tanto, los rganos
preferentemente afectados en las enfermedades mitocondriales son aquellos que dependen en mayor
grado de la produccin de energa para su correcto funcionamiento.

- Herencia materna: El ADNmt se hereda exclusivamente por va materna. La pequea cantidad de
genoma mitocondrial contenido en el espermatozoide raramente entra en el vulo fecundado, y cuando
lo hace es eliminado activamente. El tipo de herencia matrilineal es bastante fcil de reconocer al
examinar un rbol genealgico, y tiene importantes consecuencias en el consejo gentico (ver ms
adelante).

Por lo que respecta a las enfermedades humanas debidas a mutaciones del ADNmt, podemos dividirlas en
dos grandes grupos: enfermedades asociadas a mutaciones puntuales y enfermedades debidas a
alteraciones estructurales del ADNmt. Las enfermedades asociadas a mutaciones puntuales son
frecuentes, debido a la alta tasa de mutacin del ADNmt. Actualmente se han descrito ms de 50
mutaciones puntuales, que se localizan en los tres tipos de genes codificados en el ADNmt (ARNr, ARNt y
polipptidos del OXPHOS). Segn su efecto patognico, distinguimos las mutaciones que originan el cambio
de un aminocido por otro, afectando a alguno de los 13 genes codificantes de protenas, y las mutaciones
que afectan a los genes de los ARNr ARNt, que tienen efectos globales en la sntesis de las protenas
mitocondriales. Las enfermedades asociadas a alteraciones estructurales del ADNmt pueden ser tanto
deleciones ms o menos grandes como, menos frecuentemente, inserciones y/o duplicaciones. Hasta el
momento se han descrito varios cientos de reordenaciones del ADNmt, que al contrario que las
mutaciones puntuales suelen ser espordicas. Como regla prctica, podemos decir que en aquellos
casos que muestran herencia matrilineal ha de sospecharse la presencia de mutaciones
puntuales del ADNmt; en casos espordicos, en cambio, son ms frecuentes las deleciones y/o
206 GENTICA HUMANA
duplicaciones. Si, por el contrario, se confirma un patrn de herencia autosmico dominante, el
estudio debe ir dirigido hacia la bsqueda de deleciones mltiples; si fuese autosmico recesivo,
deben buscarse depleciones del ADNmt.

La Figura 18.8 muestra las mutaciones puntuales ms frecuentes del ADN
mitocondrial.

La deteccin de mutaciones puntuales se realiza habitualmente por digestin de fragmentos de PCR con
enzimas de restriccin sensibles al cambio de nucletido introducido por la mutacin. En cualquier caso,
resulta ms fiable la deteccin mediante Southern del ADNmt digerido con enzimas de restriccin especficas
para cada una de las mutaciones concretas, pero esto no siempre es posible y, por otra parte, es ms
laborioso.

Las deleciones se encuentran siempre en heteroplasmia, aunque pueden llegar a constituir un
porcentaje muy alto de la poblacin de ADNmt. Su determinacin se hace fundamentalmente en biopsias
musculares, pero si la afectacin es muy grave se pueden llegar a detectar tambin en sangre perifrica.
Las deleciones se detectan con relativa facilidad por la tcnica de Southern, que muestra poblaciones de
ADNmt de menor tamao que el normal (16.569 pb). Se emplea habitualmente ADNmt digerido con BamHI
o con EcoRV, utilizando como sonda un gran fragmento de ADNmt obtenido mediante PCR de largo alcance.

El diagnstico de deplecin del ADNmt se realiza tambin por hibridacin Southern, comparando los
niveles de ADNmt con los de ADN nuclear.

La confirmacin molecular de una alteracin del ADNmt ayuda a establecer el diagnstico de enfermedad
mitocondrial y el patrn de herencia matrilineal. Esto tiene una importancia capital desde el punto de vista
del consejo gentico y el clculo del riesgo de recurrencia de la enfermedad, ya que la herencia matrilineal
est caracterizada por la transmisin exclusivamente por va materna. Esto hace que tenga algunas
caractersticas especiales: se afectan ambos sexos, pero los varones -enfermos o no- nunca transmiten
la enfermedad, y sus descendientes (hijos o hijas) no son portadores; por otro lado, las mujeres
afectadas transmiten la enfermedad a toda su descendencia, de forma que todas sus hijas tienen
riesgo de transmitir y/o padecer la enfermedad, y todos sus hijos tienen riesgo de padecerla.

La Figura 18.9 muestra un rbol genealgico tpico de herencia matrilineal.

CAPTULO 18: GENTICA CLNICA 207
Las enfermedades mitocondriales pueden deberse a defectos en genes nucleares o a alteraciones del propio
genoma mitocondrial. La diferencia entre ambos tipos de procesos es importante porque los tipos de
herencia son diferentes y las implicaciones para el clculo de riesgos pueden ser grandes. Dada la
importancia del metabolismo oxidativo, las enfermedades mitocondriales presentan gran variedad de
sntomas y signos, y suponen un problema diagnstico importante. En general encontramos afectacin
neuromuscular: neuropata ptica, convulsiones, accidentes cerebrovasculares, mioclonas, neuropata
perifrica, ataxia, demencia, miopatas. De todas formas, los pacientes con enfermedad del ADN
mitocondrial pueden agruparse en tres categoras:

- Raramente se presenta como un sndrome fcilmente identificable: MELAS (encefalopata
mitocondrial con acidosis lctica y episodios de accidentes cerebrovasculares) muestra estatura baja,
sordera bilateral, diabetes, convulsiones, accidentes cerebrovasculares y encefalopata en la 3 o 4
dcadas de la vida. LHON (Leber hereditary optic neuropathy) muestran fallo visual bilateral en la 2-
3 dcadas. Otras presentaciones clsicas son la oftalmoplegia externa con o sin ptosis, que aparece
junto con una miopata proximal en CPEO (chronic progressvie external ophtalmoplegia) o con ataxia,
sordera bilateral y defectos de conduccin cardaca en el Sndrome de Kearns-Sayre. Otros
sndromes son NARP (neurogenic weakness, ataxia, retinitis pigmentosa) y MERRF (epilepsia
mioclnica y ragged-red-fibers o fibras musculares rojas deshilachadas).

- Un segundo grupo de pacientes tienen una constelacin de datos clnicos que sugieren enfermedad
mitocondrial, pero no encajan en ninguno de los sndromes citados. Por ejemplo, son tpicos los casos
de estatura baja con sordera neurosensorial bilateral, oftalmoplegia con ptosis, diabetes y migraas. Es
necesario un estudio neurolgico exhaustivo, y la asociacin de cualquiera de estos datos con miopata
o signos de afectacin neurolgica central hace el diagnstico de enfermedad mitocondrial muy
probable. Sin embargo, lo ms habitual es que estos pacientes sean estudiados para descartar gran
cantidad de enfermedades neurolgicas hereditarias autosmicas (alguna forma de ataxia
espinocerebelosa, estados iniciales de la enfermedad de Huntington, sndrome de Usher, Charcot-
Marie-Tooth) antes de que se llegue a pensar en enfermedad mitocondrial. Un diagnstico comn en
estos pacientes es el de myastenia congnita.

- El ltimo gran grupo de enfermos es el ms difcil de definir, y est constitudo por pacientes con
sntomas aislados que -despus de un estudio exhaustivo- terminan achacndose a patologa
mitocondrial. Por ejemplo, un cierto porcentaje de accidentes cerebrovasculares juveniles son resultado
de patologa mitocondrial, pero adems la presentacin a menudo es extra-neurolgica: cardiomiopata
hipertrfica, enfermedad tubular renal, hipoparatiroidismo, insuficiencia suprarrenal, diabetes, disfagia.
La sordera familiar neurosensorial progresiva es frecuentemente debida a patologa mitocondrial, como
demostr el grupo de Xavier Estivill en 70 familias espaolas con la mutacin del nucletido 1555.

Entre las pruebas diagnsticas que resultan tiles para llegar al diagnstico de patologa mitocondrial,
contamos con las siguientes:

- Investigaciones generales: habitualmente, estos pacientes han sido sometidos a gran catidad de
tests. Es necesario ver la funcin cardaca, test de tolerancia a glucosa, nivel de lactato en sangre (es
ms especfico en el lquido cefalo-raqudeo), electroencefalograma para detectar encefalopata
subaguda, TAC cerebral (es comn la calcificacin bilateral de ganglios basales).

- Investigaciones especficas: deteccin de alteraciones en el ADN mitocondrial, tanto
reordenamientos (deleciones, duplicaciones) como mutaciones puntuales. Lo ms habitual es que las
208 GENTICA HUMANA
mutaciones estn en heteroplasmia, y esto determina la expresividad fenotpica (habitualmente es
necesario >85% de ADNmt mutado para que se manifieste la enfermedad). Las mutaciones letales slo
pueden estar en heteroplasmia, pero en general el porcentaje de heteroplasmia vara en distintos
rganos en un mismo individuo e incluso tambin con la edad, de ah la enorme variabilidad clnica. En
algunas entidades es relativamente sencilla la deteccin molecular: por ejemplo, hay 3 mutaciones que
en conjunto explican el 95% de los pacientes con LHON. En cambio, las deleciones responsables de los
sndromes de CPEO o Kearns-Sayre no son detectables en sangre, por lo que los resultados negativos
han de ser interpretados con cautela. En estos casos, la biopsia de msculo esquletico es la piedra
angular para el diagnstico de patologa mitocondrial: por un lado, la deteccin histoqumica de fibras
deficientes en COX y en otros complejos de la cadena respiratoria confirma la afectacin mitocondrial;
adems, los estudios moleculares en ADN muscular confirman la presencia de deleciones o de
mutaciones puntuales.


Diagnstico prenatal

El avance de las tcnicas diagnsticas genticas permite hoy en da, para determinados procesos, realizar
diagnstico precoz dentro del tero. Esta modalidad diagnstica, llamada diagnstico prenatal, es con
frecuencia causa de la peticin de consejo gentico, y tiene unos matices especiales por las implicaciones
emocionales fuertes que conlleva para la familia. El desarrollo de los mtodos de diagnstico prenatal ha ido
parejo a la prctica del consejo gentico, y por tanto se ha realizado de modo responsable y adecuado. En
cambio, el uso generalizado de nuevos mtodos, especialmente la ecografa, fuera del contexto del consejo
gentico (o incluso como sustituto del mismo) sin realizar adecuadamente el clculo de riesgos, la deteccin
de portadores ni otras medidas de apoyo, supone un descenso en la calidad de la asistencia que reciben las
familias con enfermedades genticas. El uso de pruebas de barrido (screening) en el primer trimestre del
embarazo significa que la mayor parte de las consultas de diagnstico prenatal se realizan en situaciones
en las que no exista riesgo previo de una enfermedad gentica, lo cual genera situaciones
especialmente delicadas que es importante gestionar bien.

Dado que los procesos de diagnstico prenatal suponen una cierta tensin emocional para la familia,
especialmente para la madre, y pueden provocar una morbilidad fetal significativa, se recomienda que slo
se realice diagnstico prenatal cuando se cumplen una serie de condiciones y en aquellos casos en que est
indicado. En concreto, slo se debe plantear el diagnstico prenatal en el caso de enfermedades graves para
las que exista un mtodo diagnstico especfico y fiable, y que sean susceptibles de tratamiento o
prevencin. Las indicaciones principales, por tanto, son las cromosomopatas, los defectos del tubo neural, y
la edad materna avanzada. Tambin se debe valorar la aceptacin o no, por parte de la familia, del aborto
eugnico como opcin, ya que algunos autores desaconsejan iniciar los estudios de diagnstico prenatal
cuando dicha opcin no se acepta (por motivos ticos, religiosos o de ndole personal). En efecto, en estas
circunstancias no est claro que el diagnstico conlleve ningn beneficio, y por el contrario pueden
generarse conflictos serios que son difciles de resolver y a los que el facultativo no podr dar respuesta. En
estas circunstancias, el diagnstico prenatal slo sera de utilidad si se pueden tomar medidas preventivas o
teraputicas en el periodo fetal, lo cual slo es posible en un nmero reducido de enfermedades. Por tanto,
antes de la puesta en marcha del proceso de diagnstico prenatal es importante conocer las disposiciones
de la pareja respecto a las posibles opciones teraputicas, adems de considerar otros factores como la
severidad de la posible enfermedad, la posibilidad de tratamiento o medidas preventivas, y la fiabilidad
de las tcnicas de diagnstico prenatal. Este ltimo punto es tambin de gran importancia, y debe ser
explicado con claridad y ejemplos prcticos, porque el concepto de "riesgo" no siempre es correctamente
entendido. Igualmente es importante que no se realice diagnstico prenatal sin una estimacin previa del
CAPTULO 18: GENTICA CLNICA 209
riesgo que tiene un feto concreto de padecer la enfermedad: el diagnstico prenatal no est exento de
complicaciones y supone en s mismo un riesgo para el feto, por lo que no est justificado realizarlo cuando
el riesgo previo de padecer esa enfermedad es muy bajo. Esto supone, lgicamente, que el diagnstico
prenatal debe formar parte del proceso global de consejo gentico y ser realizado, siempre que sea posible,
por especialistas en gentica clnica.

Los dos mtodos ms utilizados para la obtencin de material fetal son la amniocentesis y la toma de una
biopsia de vellosidades corinicas. La amniocentesis consiste en la toma de una muestra de lquido
amnitico, que contiene clulas fetales en suspensin. Dichas clulas se pueden cultivar in vitro para
despus realizar estudios cromosmicos, bioqumicos o moleculares, lo cual requiere entre 1 y 3 semanas.
El procedimiento es guiado por ultrasonidos y, en manos experimentadas, fiable. Sus principales
inconvenientes son el lmite de edad fetal, ya que no puede realizarse antes de las 15 semanas de
gestacin, y los riesgos de prdida fetal que conlleva (en torno al 0,5-1%). La biopsia de de vellosidades
corinicas puede realizarse durante el primer trimestre del embarazo, en torno a la dcima semana, y es
especialmente til para realizar estudios moleculares y en la presencia de un riesgo alto de
cromosomopata. En cambio, es menos utilizada que la amniocentesis cuando el riesgo de alteraciones
citogenticas es bajo. El procedimiento se realiza mediante puncin a travs de la pared abdominal
(transabdominal) o a travs del cuello del tero (transcervical), bajo gua ecogrfica. En ese momento, el
tejido corinico todava no forma una placenta propiamente dicha, por lo que la biopsia se examina bajo
microscopio y se aslan las vellosidades (que nicamente contienen tejido fetal). El material obtenido puede
utilizarse directamente (sin necesidad de cultivo) para estudios moleculares o enzimticos. En general, este
procedimiento se reserva para embarazos de alto riesgo, ya que la probabilidad de prdida fetal es mayor
que en la amniocentesis (en torno al 2-3%).

Dado el riesgo relativamente alto de dao fetal que tienen la amniocentesis y, sobre todo, la obtencin de
vellosidades corinicas, desde hace aos se estn buscando mtodos no invasivos que permitan realizar
estudios moleculares o bioqumicos en material fetal. Entre stos, estan siendo muy utilizados los mtodos
ecogrficos, el anlisis bioqumico de sangre materna, el anlisis de clulas fetales presentes en la sangre
materna, o incluso la obtencin de sangre fetal (aunque este procedimiento es ms invasivo y por tanto
ms peligroso que los otros mencionados). Tambin en los ltimos aos, con la proliferacin de las tcnicas
de fertilizacin in vitro, es posible realizar diagnstico gentico preimplantatorio, obteniendo un
blastmero a partir de un embrin de pocas clulas y realizando estudios moleculares a partir del ADN de
esa nica clula. Por desgracia, dicho procedimiento habitualmente no se realiza en el contexto del consejo
gentico, y todava no existen datos claros acerca del posible dao fetal que pueda producir. Tampoco hay
estudios abundantes sobre las tasas de error que se obtienen en el diagnstico de las distintas
enfermedades genticas, y en cualquier caso su aplicacin est limitada por la baja tasa de xito de la
fertilizacin in vitro.

210 GENTICA HUMANA
CAPTULO 19: TERAPIA GNICA 211

E. NUEVAS HERRAMIENTAS DE LA GENTICA MODERNA

Esta seccin aborda los dos ltimos temas del programa, que introducen al alumno en
las cuestiones de ms actualidad y le abren perspectivas de futuro.


Captulo 19. Terapia Gnica.
Componentes de un sistema de terapia gnica y vas de administracin.
Naturaleza del cido nucleico teraputico. Tipos de vectores y su utilizacin
en distintas estrategias de transferencia gnica. Aplicaciones clnicas
actuales de la terapia gnica.


Componentes de un sistema de terapia gnica y vas de administracin

El desarrollo de la gentica molecular durante los ltimos aos, y especialmente toda la informacin
derivada del Proyecto Genoma Humano, han propiciado que podamos afrontar la modificacin directa de las
alteraciones genticas o la utilizacin de cidos nucleicos como agentes teraputicos. La terapia gnica es
una nueva modalidad teraputica surgida a finales de los aos 80, y que puede definirse como la
transferencia de cidos nucleicos (ADN ARN) con fines teraputicos.

Toda estrategia de terapia gnica se basa, por tanto, en la transferencia de cidos nucleicos (transferencia
gnica) al interior de un grupo de clulas. Estas clulas pueden ser las clulas enfermas cuyo dao se
pretende reparar, o bien un grupo de clulas normales que se modifican genticamente para que sean las
efectoras de una accin teraputica, por ejemplo sintetizando una protena concreta. Por lo tanto, todo
sistema de terapia gnica es anlogo a un sistema de transporte, en el que hay un agente que es
transportado y un vehculo de transporte. En nuestro caso, el agente transportado es un cido nucleico y el
vehculo encargado de llevarlo al interior de las clulas diana se denomina vector. Segn el modo de hacer
VECTOR
In vivo
Ex vivo
VECTOR
In vivo
Ex vivo
212 GENTICA HUMANA
llegar el vector (conteniendo el agente teraputico) a las clulas diana, es ya clsica la distincin entre
terapia gnica ex vivo y terapia gnica in vivo. En el primer caso, la administracin del vector se realiza
fuera del cuerpo: se obtiene una biopsia del rgano de inters, se expanden las clulas mediante cultivo
celular y se ponen en contacto con el vector mientras estn siendo cultivadas. Esto hace posible seleccionar
las clulas que hayan sido modificadas genticamente y re-introducirlas en el paciente. En la administracin
in vivo, el vector teraputico se administra directamente al individuo enfermo por cualquiera de las vas
habituales (intramuscular, oral, intravenosa, intraportal, subcutnea), escogiendo aquella que nos permita
alcanzar la mxima eficacia teraputica.

La Figura 19.1 ilustra los componentes de un sistema de terapia gnica y las
vas de administracin.


Naturaleza del cido nucleico teraputico

Segn el efecto biolgico que pretendemos obtener, el agente teraputico ser de distinta naturaleza. En
general, podemos clasificar los cidos nucleicos teraputicos en tres grupos, dependiendo de si buscamos la
correccin directa de una mutacin, la suplementacin gnica, o la inhibicin de la expresin.

a) En los ltimos aos se ha conseguido corregir especificamente defectos a nivel del ADN mediante la
utilizacin de quimeraplastos, molculas quimricas (hbridas) formadas por ADN y ARN que son
capaces de reconocer especficamente una mutacin y corregirla. Este tipo de tecnologa funciona con
cierta eficacia cuando se aplica a clulas en cultivo (in vitro), y es de esperar que en los prximos aos
se pueda utilizar tambin in vivo. Los quimeraplastos son oligonucletidos formados por una molcula
lineal de ADN que contiene un tracto de 5 desoxi-ribonucletidos complementarios a la secuencia
genmica que se quiere corregir. Es importante que esta regin correctora est flanqueada por
fragmentos de 10 ribonucletidos (ARN). El oligonucletido se empareja especficamente con la regin
mutada y los sistemas de reparacin celulares llevan a cabo la reparacin de la mutacin tomando
como molde la base correspondiente del oligonucletido teraputico. Tericamente, es posible disear
oligonucletidos ARN/ADN para corregir directamente las mutaciones puntuales que causan las
enfermedades hereditarias ms frecuentes.

b) En el caso de mutaciones que simplemente producen prdida de funcin, puede ser suficiente la
suplementacin gnica, es decir, suplementar las clulas con copias normales del gen sin
preocuparnos de corregir las mutaciones presentes en el ADN genmico. Lo ms habitual en estos
casos es que el agente teraputico sea una unidad de expresin en la que la transcripcin del gen en
cuestin viene regulada por promotores virales potentes, por promotores regulables o por promotores
especficos de un tipo celular concreto.

c) Cuando el defecto gentico que tratamos de corregir origina una ganancia de funcin, como suele
suceder en mutaciones con efectos oncognicos, lo lgico es intentar inhibir la expresin del gen que
est causando el fenotipo aberrante. Los agentes teraputicos ms utilizados en estas circunstancias
son las molculas antisentido o los ribozimas. Los oligonucletidos antisentido pueden inhibir
directamente la expresin de un gen al unirse a la doble hlice de ADN mediante enlaces tipo
Hoogsteen, formado una triple hlice que impide la transcripcin mediada por la ARN polimerasa II.
Estos oligonucletidos suelen estar modificados qumicamente para aumentar su estabilidad y eficacia,
siendo las principales modificaciones los grupos fsforo-tioato en el esqueleto desoxi-ribosa-fosfato de
CAPTULO 19: TERAPIA GNICA 213
los oligonucletidos, o bien los cidos nucleicos en los que el enlace fosfo-dister viene substituido por
un enlace peptdico (denominados Acidos Nucleicos Peptdicos, PNA). Los ARNm antisentido son
capaces de emparejarse con los ARN sentido y formar molculas bicatenarias de ARN que no pueden
ser traducidas y son digeridas por la RNAsa H celular. Los ribozimas, pequeas molculas de ARN con
actividad cataltica, pueden ser diseados para reconocer un ARNm especfico y degradarlo merced a su
actividad endonucleoltica especfica. En general, la utilizacin de molculas antisentido y ribozimas est
limitada por la baja eficacia que muestran todava en modelos in vivo. Hoy en da, las mejores
perspectivas de inhibicin eficaz y especfica de la expresin gnica se basan en la interferencia de
ARN, un mecanismo de silenciamiento gnico post-transcripcional descrito en plantas y C. elegans que
consiste en la degradacin de ARN mensajeros endgenos por la presencia de molculas pequeas de
ARN de doble cadena homlogas al mensajero que se destruye. Este proceso depende de una RNAasa
tipo III llamada DICER, responsable de la formacin de los ARN pequeos, y de un complejo llamado
RISC (RNA Induced Silencing Complex) que contiene unas protenas del complejo ARGONAUTA y los
ARN pequeos que dirigen el complejo a la diana. Se ha visto que este mecanismo tambin juega un
papel importante en la regulacin gnica en humanos, ya que el anlisis del genoma ha revelado la
presencia de genes que codifican ARN pequeos (aproximadamente 75 nucletidos) que forman
horquillas y que son procesados por DICER y protenas del complejo Argonauta para generar ARN
intereferentes pequeos, de unos 21-22 nucletidos. Estos genes endgenos se denominan miRNA
(microRNA), para diferenciarlos de los siRNA que provienen de molculas bicatenarias de ARN de
procedencia externa. Actualmente se piensa que ambos tipos de molculas (miRNA y siRNA) tienen la
misma va efectora, que acta impidiendo la traduccin (si la homologa de la molcula interferente
con el ARN mensajero no es total), o bien eliminando los mensajeros si la homologa es total.
Sorprendentemente, tambin se ha visto que las repeticiones centromricas y los transposones, cuando
se transcriben, dan lugar a ARN interferentes pequeos que utilizan este mecanismo para modificar la
cromatina, induciendo metilacin en las histonas en el ADN y provocando la formacin de
heterocromatina o el silenciamiento transcripcional. En los ltimos aos se ha demostrado que se
pueden utilizar siRNAs microRNAs para inhibir la expresin de genes endgenos, generando molculas
interferentes especficas para un gen concreto. Por ejemplo, se ha conseguido silenciar genes
endgenos en clulas humanas mediante siRNAs dirigidos especficamente frente a promotores
concretos. Dicho silenciamiento se lleva a cabo por metilacin de los dinucletidos CpG de esos
promotores y por metilacin de la lisina 9 de la histona H3 de esa regin. El avance ms espectacular
usando esta tecnologa tuvo lugar en 2004, cuando un grupo consigui reducir hasta un 40% los niveles
de colesterol en ratn, usando unos siRNA sintticos conjugados con colesterol que fueron injectados
directamente en la vena de la cola. Los siRNA fueron captados eficazmente por receptores del hgado,
yeyuno y otros rganos y provocaron la degradacin de los ARNm endgenos de apolipoprotena B, con
el consiguiente descenso en los niveles de LDL y colesterol total.

En la Figura 19.2 se muestran algunos ejemplos de molculas utilizadas en
distintas estrategias de terapia gnica.


Tipos de vectores y su utilizacin en distintas estrategias de transferencia
gnica

Los cidos nucleicos teraputicos han de ser vehiculizados al interior de las clulas diana por medio de
vectores adecuados. Se distinguen dos tipos fundamentales de vectores: los basados en virus (vectores
214 GENTICA HUMANA
virales) y los vectores sintticos (vectores no virales) que intentan emular la capacidad natural que tienen
los virus de introducir cidos nucleicos en las clulas.

1. Los vectores virales fueron los primeros en ser utilizados, dada su alta eficacia como vehculos de
cidos nucleicos. Los virus estn compuestos por un ADN un ARN rodeado de una cpside proteica y, en
algunos casos, una envuelta lipoproteica. El ciclo biolgico de los virus pasa por la introduccin del genoma
viral en determinados tipos celulares, habitualmente por la presencia de receptores en la membrana de las
clulas. Para poder utilizar un virus como vector en terapia gnica, es preciso insertar el cido nucleico
teraputico en el genoma viral, y conseguir al mismo tiempo que el virus no se replique y por tanto no sea
patognico. Por esto, los virus utilizados en terapia gnica se denominan virus recombinantes y
defectivos (carecen de alguna funcin necesaria para su propio ciclo replicativo). A continuacin se
repasan los principales vectores virales utilizados actualmente en terapia gnica.

a) Vectores retrovirales. La familia Retroviridae est compuesta por las subfamilias Spumaviridae,
Lentiviridae y Oncoviridae. Los vectores retrovirales utilizados en terapia gnica estn derivados de los
oncovirus murinos del tipo C, especialmente los que son anfitrpicos (que pueden infectar tanto clulas
murinas como humanas). Recientemente se han desarrollado vectores derivados de lentivirus,
especialmente del HIV-1.

Los retrovirus son virus ARN que tienen una envuelta fosfolipdica, con glicoprotenas que determinan el
tropismo del virus al ser reconocidas por receptores celulares especficos. Dentro de esta envuelta hay una
cpside proteica de estructura icosadrica que contiene 2 copias del genoma viral, la transcriptasa inversa
(RT), y la integrasa. El genoma de un retrovirus es una molcula de ARN de polaridad positiva en la que se
distinguen 3 tipos de genes: genes gag (que codifican las protenas de la cpside), genes pol (que
codifican las enzimas necesarias para el ciclo viral, como la proteasa y la integrasa) y genes env (que
codifican las glicoprotenas de la envuelta). El genoma est flanqueado por dos repeticiones terminales
largas (LTR, Long Terminal Repeat), y contiene tambin una seal de empaquetamiento PSI mediante la
cual las molculas de ARN se unen a las protenas de la cpside y son empaquetadas eficazmente. El LTR
izquierdo contiene una regin (U3) para el comienzo de la transcripcin, y un primer binding site (pbs) para
el comienzo de la retrotranscripcin. El LTR derecho contiene una secuencia de poli-purinas (ppt) para la
replicacin de la segunda cadena.

El ciclo replicativo de los retrovirus comienza cuando el virus es reconocido por receptores celulares, lo
que lleva a la fusin de la envuelta viral con la membrana celular y a la internalizacin del nucleoide. A
continuacin tiene lugar la retrotranscripcin del ARNm para formar un ADNc bicatenario (este proceso
tiene lugar dentro de la nucleocpside, antes de su llegada al ncleo de la clula), y despus se
desensambla la cpside al llegar a la membrana nuclear. El genoma viral se integra en el genoma de la
clula husped (integracin mediada por la propia integrasa del virus), y entonces comienza la transcripcin
a partir del promotor U3 que est en el LTR izquierdo. Se producen distintos tipos de ARNm,
fundamentalmente un transcrito que contiene gag y pol y otros transcritos que codificarn las protenas de
la envuelta. Los ARNm son exportados al citoplasma y traducidos, dando lugar a poliprotenas gag-pol y a
las protenas de la envuelta. Estas ltimas viajan a la membrana celular, mientras que las poliprotenas gag-
pol forman nuevas nucleocpsides al unirse a la seal de empaquetamiento de los ARNm positivos. Tras el
empaquetamiento, que tiene lugar en el citoplasma, las cpsides salen de la clula por gemacin, quedando
rodeadas de nuevo por una envuelta compuesta por la membrana celular y las glicoprotenas codificadas por
el virus que haban llegado anteriormente a la membrana. Las nuevas partculas retrovirales se activan
cuando la proteasa rompe la poliprotena gag-pol dentro de la propia partcula viral y da lugar a molculas
independientes de proteasa, integrasa y retrotranscriptasa.
CAPTULO 19: TERAPIA GNICA 215

La Figura 19.3 muestra la estructura del genoma de un retrovirus.

Es importante sealar que el nucleoide de un oncovirus es incapaz de atravesar la membrana nuclear, por lo
que es necesario que la clula sufra al menos una mitosis para que el genoma viral entre en contacto con el
genoma de la clula husped. En cambio, los retrovirus de la familia de los lentivirus s que pueden
atravesar la membrana nuclear, por lo que pueden infectar clulas que no estn en divisin. Esta es una
propiedad muy importante a la hora de valorar las posibles aplicaciones de estos tipos de vectores.

Para generar un retrovirus recombinante defectivo, es necesario sustituir los genes de las protenas
virales por el gen teraputico que se quiere utilizar. Lgicamente, para producir estos virus defectivos
debemos usar una lnea clular (clula empaquetadora) que aporte los genes virales en trans. Estas clulas
empaquetadoras tienen los genes virales insertados en el genoma celular, de modo que expresan
establemente las protenas virales. Sin embargo, las copias de los genes virales que estn integradas en el
genoma celular carecen de la seal de empaquetamiento, por lo que sus transcritos no pueden
empaquetarse en las nuevas partculas virales. De este modo, una clula empaquetadora en condiciones
normales no produce viriones completos, sino slo partculas vacas. En cambio, cuando transfectamos
estas clulas con un plsmido recombinante que contenga el ADN teraputico flanqueado por los LTR y por
la seal de empaquetamiento (adems de otros elementos necesarios en cis como el primer binding site, y
el tracto polipurnico necesario para la sntesis de la segunda cadena) se generarn partculas retrovirales
recombinantes y defectivas, que pueden ser purificadas y concentradas a partir de los sobrenadantes del
cultivo celular. En este proceso es muy importante evitar la aparicin de retrovirus con capacidad
replicativa, que podran generarse por recombinacin homloga entre las secuencias virales que estn
presentes en nuestro plsmido con las secuencias virales presentes en el genoma de la clula
empaquetadora. Por este motivo, se utilizan clulas empaquetadoras que tienen los genes virales separados
entre s, de modo que seran necesarias varias recombinaciones independientes para generar un virus
replicativo, algo altamente improbable.

El video de la Figura 19.4 explica el ciclo replicativo de los retrovirus y el
proceso de generacin de retrovirus defectivos recombinantes.

Los retrovirus recombinantes defectivos han sido muy utilizados en terapia gnica. Por las limitaciones
propias del tamao del genoma viral, el ADN teraputico no puede ser mayor a 7-8 kb. Son vectores con
buena infectividad, un tropismo amplio, pero son bastante lbiles (lo que dificulta su purificacin) y slo
transducen eficazmente clulas que estn en divisin. Adems, son inactivados en el torrente sanguneo por
el sistema del complemento, por lo que su principal uso ha estado reservado a estrategias de terapia gnica
ex vivo. Su capacidad integrativa les permite alcanzar, en teora, una duracin muy larga de la expresin
incluso en clulas que estn dividindose activamente. Sin embargo, los promotores virales suelen
silenciarse por metilacin, por lo que la expresin no es tan prolongada como cabra esperar. Se est
investigando la posibilidad de modificar el tropismo de estos vectores, mediante la creacin de protenas de
LTR gag pol env PSI LTR
U3 pbs ppt
LTR gag pol env PSI LTR
U3 pbs ppt
216 GENTICA HUMANA
la envuelta quimricas que incluyan algn scFv (anticuerpo monocatenario) u otros ligandos de receptores
celulares conocidos.

Como se ha mencionado, recientemente se han desarrollado vectores retrovirales basados en lentivirus,
aprovechando la circunstancia de que el HIV-1 es uno de los virus mejor estudiados. El genoma de este
virus contiene algunos genes (tat y rev, por ejemplo) que no estn presentes en los oncoretrovirus y que
son esenciales para la expresin de los genes virales. Algunas de las protenas virales tienen seales de
localizacin nuclear y facilitan la entrada del virus por los poros nucleares, de ah la capacidad que tienen
estos virus de infectar clulas que no estn en divisin. Aunque los problemas de seguridad de los
lentivirus estn prcticamente superados, todava hay que mejorar los sistemas de produccin para poder
utilizarlos en pacientes con total seguridad. Su principal aplicacin est en la transferencia de genes a
clulas del sistema nervioso in vivo, y a progenitores hematopoyticos ex vivo, siendo esta ltima una
propiedad especialmente interesante por su inmenso potencial teraputico, y porque estas clulas son
prcticamente intransfectables por otros medios.

b) Vectores adenovirales: Se conocen gran cantidad de serotipos de adenovirus humanos, pero los ms
utilizados en terapia gnica han sido los serotipos 2 y 5. Los adenovirus son virus ADN sin envuelta,
responsables de las principales enfermedades de vas respiratorias altas (el catarro comn), con muy buen
tropismo por clulas humanas. La nucleocpside de un adenovirus consta de una cpside icosadrica que
est compuesta por 720 protenas hexona y 60 protenas pentona. De las pentonas parte la protena de la
fibra (una protena trimrica) que termina en una protena botn (knob) mediante la cual el adenovirus
se une a receptores celulares especficos.

El genoma adenoviral es un ADN de doble cadena de aproximadamente 35 kb de tamao, flanqueado por
repeticiones terminales invertidas (ITR) de 100-140 nucletidos y una seal de empaquetamiento (psi)
cerca del ITR izquierdo. Contiene gran cantidad de genes, que se agrupan en regiones tempranas (early) y
tardas (late), segn el momento en que se transcriben despus de la infeccin. As, las regiones tardas
se transcriben tras la replicacin del genoma viral, y contienen los genes que codifican las protenas
estructurales del virus. En cambio, las regiones tempranas se transcriben antes de la sntesis del ADN
viral, y cumplen varias funciones:

- las protenas codificadas en E1 incluyen, por ejemplo, E1A (protena necesaria para transactivar la
transcripcin de los dems genes virales) y E1B 55kd (que se une a E4). Adems, estas protenas
interfieren con las funciones de la clula husped: E1A es una oncoprotena, E1B 19kd inhibe la
apoptosis mediada por p53 y E1B 55kd promueve la degradacin de p53.
- la regin E2 codifica protenas necesarias para la replicacin viral: ADN polimerasa, protena terminal,
etc.
- la regin E3 codifica algunas protenas que ayudan al adenovirus a escapar al sistema immune, como la
protena gp19kd que inhibe la presentacin de fragmentos antignicos con molculas de clase II del
Complejo Mayor de Histocompatibilidad.
- la region E4 codifica diversas protenas que silencian genes endgenos, regulando el transporte de ARN
mensajeros fuera del ncleo.

El ciclo replicativo de un adenovirus es ms sencillo que el de los retrovirus. El adenovirus se une a un
receptor de membrana especfico denominado CAR (CoxackieAdenovirusReceptor) mediante el botn de la
fibra, y a continuacin la pentona se une por un motivo RGD (arginina-glicina-asprtico) a integrinas
cercanas para despus ser internalizado por endocitosis. La propia cpside adenoviral es capaz de
desestabilizar el endosoma, que se rompe y libera las partculas virales al citoplasma. Las nucleocpsides
CAPTULO 19: TERAPIA GNICA 217
llegan a la membrana nuclear y son capaces de introducir el genoma viral a travs de los poros
nucleares.

Para generar adenovirus recombinantes defectivos (es decir, que lleven el ADN teraputico pero no
puedan replicarse) se sigue una estrategia similar a la que veamos para los retrovirus: substituir algn gen
viral por el gen teraputico. Lo ms habitual es delecionar el genoma viral en la regin E1, para lo que
necesitaremos una clula empaquetadora que exprese de manera estable los genes contenidos en esa
regin. La lnea celular ms utilizada como clula empaquetadora para construir adenovirus recombinantes
se denomina clula 293. Para conseguir el adenovirus recombinante, se cotransfectan clulas 293 con
dos plsmidos distintos: un plsmido en el que el gen teraputico est flanqueado por parte del gen E1, la
seal de empaquetamiento y los ITR virales, y otro plsmido que contiene todo el genoma viral excepto la
seal de empaquetamiento y la regin de E1 que est presente en trans en el genoma de las clulas 293.
Una vez dentro de la clula, los mecanismos de recombinacin son capaces de generar un genoma viral
recombinante que llevar el gen teraputico dentro del genoma viral (al que le falta E1). Como el gen
teraputico va unido a la seal de empaquetamiento PSI, nicamente estos transcritos se empaquetarn
correctamente en las nuevas cpsides virales, mientras que los genomas virales producidos endgenamente
carecen de la seal PSI y por tanto no producen viriones infectivos. Los adenovirus delecionados en E1
permiten insertar genes teraputicos con un tamao mximo de 5 kb, por lo que posteriormente se han
generado vectores que llevan adems deleciones en E3 y E4, para conseguir llegar a una capacidad de 7-8
kb. La ltima generacin de vectores adenovirales consiste en los llamados adenovirus gutless (vacos), en
los que todo el genoma viral ha sido delecionado y por tanto tienen una capacidad terica en torno a las 30
kb de ADN exgeno. Para producirlos hay que aportar en trans todas las funciones adenovirales necesarias,
mediante plsmidos helper por estrategias que utilizan el sistema Cre/loxP.

La figura Figura 19.5 muestra la estructura del genoma de un adenovirus y de
una partcula adenoviral, as como el proceso general de produccin de
adenovirus recombinantes defectivos.

Los adenovirus comenzaron a usarse en terapia gnica ms tarde que los retrovirus, pero rpidamente
ganaron en popularidad y hoy en da son los vectores ms utilizados para aplicaciones in vivo. Infectan gran
variedad de clulas, son relativamente estables y fciles de purificar y concentrar, y son eficaces tanto
sobre clulas quiescentes como sobre clulas en divisin. Como el genoma del vector no se integra en el
genoma de la clula husped, la duracin de la expresin en clulas en divisin es limitada. Su principal
inconveniente es la toxicidad que producen a dosis altas, y la fuerte respuesta inmune celular y humoral que
sigue a su administracin, con la consiguiente disminucin de eficacia teraputica. Los nuevos vectores
adenovirales vacos superan algunos de estos invonvenientes.

c) Vectores Virales Adenoasociados: Se trata de Parvovirus que infectan al hombre pero no son
patgenos. Pertenecen al grupo de los Dependovirus, virus ADN sin envuelta que necesitan de funciones
helper para completar su ciclo replicativo completo. Estas funciones helper las aporta un adenovirus o un
herpesvirus que sobreinfecta las mismas clulas que previamente haban sido infectadas por un
dependovirus. El genoma de un virus adenoasociado es un ADN monocatenario con un tamao de 4,8 kb
y una estructura muy simple, con dos regiones codificantes: cap, que codifica las tres protenas de la
cpside, y rep, que codifica 4 protenas necesarias para la replicacin viral. El genoma est flanqueado por
dos repeticiones terminales invertidas (ITR), que forman unas estructuras en horquilla y que son los nicos
elementos necesarios en cis para poder llevar a cabo el ciclo vital del virus.

218 GENTICA HUMANA
La infeccin por un virus adenoasociado comienza por la unin del virus a receptores celulares y su
entrada en la clula. El genoma viral es capaz de entrar en el ncleo incluso en clulas que no se dividen, y
una vez all se convierte a doble hebra y se integra en un locus especfico localizado en el brazo largo
del cromosoma 19 humano (banda 19q13). Todas estas funciones estn mediadas por protenas de la clula
husped, pero adems se ha comprobado que las protenas virales Rep78/68 son necesarias para la
integracin especfica del genoma viral en una secuencia llamada AAVS1 que est en 19q13. En ausencia de
funciones helper, el genoma viral integrado permanecer como un provirus, en forma latente. Ante una
sobreinfeccin por adenovirus herpesvirus, el adenoasociado comienza su fase ltica con la transcripcin
de los genes virales, la replicacin del genoma viral y el empaquetamiento en las cpsides para dar lugar a
nuevos viriones. Para obtener virus adenoasociados recombinantes como vectores en terapia gnica, se
construye un plsmido recombinante que contiene el gen teraputico flanqueado por los ITR virales. En el
mtodo clsico de produccin de estos vectores, se cotransfectan clulas 293 con el plsmido recombinante
y con otro plsmido que aporta en trans las funciones cap y rep, y despus se infectan esas mismas clulas
con un adenovirus. El problema de este procedimiento es que los preparados virales tienen una fuerte
contaminacin por adenovirus, por lo que es necesario inactivar este adenovirus contaminante mediante
tratamiento con calor. Los mtodos actuales de produccin evitan este problema al aportar las funciones
helper del adenovirus en un tercer plsmido que se cotransfecta con los otros dos, de forma que la
generacin de adenovirus maduros es prcticamente imposible.

Los vectores adenoasociados estn ganando popularidad rpidamente por sus extraordinarias
caractersticas: buena infectividad, integracin en el genoma de la clula husped, muy baja toxicidad y
ausencia de respuesta inmune celular frente a las protenas virales. Por desgracia, la especificidad de la
integracin en un locus concreto se pierde en los virus adenoasociados recombinantes, ya que no se
produce Rep68/78 (que es absolutamente necesaria para que tenga lugar esta integracin especfica). En
consecuencia, la integracin se realiza al azar, como en el caso de los retrovirus. Los virus adenoasociados
pueden transducir clulas quiescentes o clulas en divisin, y estn especialmente indicados en aplicaciones
in vivo en las que se requiere una expresin prolongada del gen teraputico.

d) Otros vectores virales que actualmente estn ganado en popularidad son los Herpesvirus, basados en el
virus del herpes simplex (HSV), que tienen un marcado tropismo neuronal y por eso se emplean
fundamentalmente para la transferencia de genes al sistema nervioso. Los HSV son virus envueltos con un
genoma lineal de 152 kb de ADN bicatenario, en el que se han identificado ms de 80 genes. El genoma
est dividido en dos regiones nicas (Larga y Corta) que estn flanqueadas por repeticiones terminales (TR)
y repeticiones internas (IR). El virus se une a glicosamino-glucanos celulares y a receptores celulares
especficos (por ejemplo, el receptor HveC, que pertenece a la superfamilia de las inmunoglobulinas y se
expresa a alto nivel en el sistema nervioso). Tras la entrada en la clula, el virus avanza por transporte
retrgrado y llega al ncleo, penetrando por los poros nucleares. Despus de entrar en el ncleo se
expresan los genes inmediatos tempranos, que activan la expresin de los genes tempranos (necesarios
para la sntesis de ADN viral) y de los genes tardos (protenas estructurales). Una caracterstica importante
es que uno de los genes inmediatos tempranos (ICP4) es absolutamente necesario para la replicacin viral,
por lo que basta eliminarlo del genoma para obtener virus defectivos. En los vectores actualmente en uso se
han delecionado todos los genes inmediatos tempranos, por lo que son totalmente apatognicos.

Otra caracterstica importante de estos virus es que cuando no se replican entran en un periodo de latencia
en el que se transcriben nicamente unos transcritos asociados a latencia (LATs), aunque no se expresen
los genes inmediatos tempranos. Por tanto, incluyendo la unidad transcripcional en la regin de latencia se
pueden obtener virus defectivos que expresan de forma persistente un gen teraputico. Adems, se trata de
vectores de gran capacidad porque permiten acomodar hasta 50 kb de ADN exgeno.
CAPTULO 19: TERAPIA GNICA 219

En la Figura 19.6 se muestra la estructura del genoma de virus
adenoasociados (AAV) y herpes (HSV), as como el ciclo replicativo del AAV.

2. Los Vectores no-virales representan un intento de imitar las funciones de los virus como vehculos de
transferencia gnica mediante sistemas sintticos, de forma que en principio son vectores mucho ms
seguros desde el punto de vista de su peligrosidad biolgica y su patogenicidad. En este sentido, los
vectores no-virales no se diferencian conceptualmente de los frmacos a los que estamos habituados. La
principal limitacin de este tipo de vectores es que, en la actualidad, su eficacia in vivo es mucho menor que
la de los vectores virales. Esto se debe a la inestabilidad propia de sistemas sintticos complejos y a las
diferentes barreras que han de superar:

- Los complejos entre el cido nucleico y los dems componentes de estos sistemas han de ser estables
tras su administracin, y no desintegrarse antes de alcanzar las clulas. Por otra parte, la
biodistribucin de estos preparados hace que la concentracin efectiva en las clulas diana sea baja,
por lo que es importante que lleven en su superficie algn tipo de ligando para receptores especficos
de las clulas a las que lo queremos enviar.

- Habitualmente, estos complejos entran en las clulas por endocitosis, de manera que quedan expuestos
al ataque de las enzimas lisosomales. Para evitar esto, se intenta incluir en estos vectores algn tipo de
molcula que altere el pH del endosoma y consiga romperlo antes de su fusin con los lisosomas y
liberar as el complejo intacto al citoplasma. Estas molculas suelen ser pptidos o protenas virales que
cumplen esta misma funcin en algunos tipos de virus. Una vez en el citoplasma, estos complejos han
de ser lo suficientemente estables como para llegar hasta el ncleo, pues si el cido nucleico se libera
muy pronto ser degradado por nucleasas citoplasmticas. Pero si son demasiado estables, el cido
nucleico no conseguir liberarse y por tanto no podr entrar en el ncleo de la clula. Este compromiso
entre proteccin y liberacin es quizs uno de los retos ms importantes que tienen que superar los
vectores no virales para aumentar su eficacia actual.

- En cierta medida, la inclusin en estos complejos de alguna molcula capaz de dirigirlos al ncleo
celular servira para acelerar su trnsito citoplasmtico. Por tanto, otro componente habitual en los
vectores no virales son las molculas con seales de localizacin nuclear que adems permitan la
entrada del cido nucleico a travs del complejo del poro nuclear, pues de lo contrario slo sern
capaces de ser efectivos en clulas que estn en mitosis.

Como se ve, la tarea de construir un vector no-viral ideal equivale a intentar reconstruir en el laboratorio
lo que los virus consiguen de manera natural, lo cual no es en absoluto sencillo. En cualquier caso, son uno
de los campos de investigacin ms activa, sobre todo por parte de empresas farmacuticas y de
biotecnologa, y es previsible que los prximos aos vean avances significativos en este terreno.
Actualmente, los vectores no-virales ms utilizados son los siguientes:

a) Inyeccin Directa: Lgicamente, lo ms sencillo es injectar directamente el cido nucleico (ADN
desnudo) en el rgano de inters. Aunque poco eficaz, este procedimiento funciona razonablemente en
ciertas aplicaciones y en algunos rganos. Por ejemplo, el msculo esqueltico es uno de los rganos que
ms eficazmente incorporan un plsmido inyectado, alcanzando niveles de expresin suficientes para
conseguir inmunizacin frente a protenas virales, tumorales, etc. En ocasiones se utiliza la inyeccin de
ADN formulado con diversos polmeros (sobre todo poli-vinil-pirrolidona) que lo protegen de la accin de
220 GENTICA HUMANA
las nucleasas y prolongan su vida media tras la administracin. Tambin se utiliza el ADN encapsulado en
microesferas de polmeros biodegradables (por ejemplo, copolmeros de cido lctico y gliclico), que
pueden inyectarse en un rgano y proporcionar liberacin sostenida del cido nucleico teraputico durante
un periodo de tiempo ms o menos prolongado, dependiendo del tipo de polmero utilizado. Otra variedad
es la transferencia gnica balstica (pistola gnica o gene gun), en la que el cido nucleico teraputico
se adsorbe sobre la superficie de una bolas microscpicas de oro u otro metal inerte, que son disparadas a
presin sobre el rgano diana. Es una va de administracin utilizada en la piel (para inmunizacin gnica) o
a veces sobre otros rganos, pero las bolas no tienen un gran poder de penetracin (raramente superior a
unos pocos milmetros).

b) Complejos formados por el cido nucleico teraputico y otros componentes: son los sistemas ms
complicados de elaborar y optimizar, pero los ms eficaces dentro de los vectores no-virales. El principio
que subyace a todos los sistemas de este tipo es la complejacin del ADN (molcula grande con alto nmero
de cargas negativas) con polmeros de naturaleza catinica (con cargas positivas), de manera que la
neutralizacin de cargas da lugar a complejos ms o menos estables, de pequeo tamao, en los que el
ADN est protegido de la accin de nucleasas. Suele distinguirse entre lipoplexos (cuando el ADN se
compleja con lpidos catinicos) y poliplexos (ADN complejado por policationes, habitualmente poli-lisina o
poli-etiln-imina). Sobre la estructura bsica de un lipoplexo o un poliplexo pueden aadirse otro tipo de
molculas que acten como estabilizadores, ligandos para receptores especficos, molculas
desestabilizadoras del endosoma, seales de localizacin nuclear. Por ejemplo, se ha utilizado poli-etiln-
glicol para aumentar la estabilidad de lipoplexos en el torrente sanguneo y evitar la inactivacin por el
suero. Asmismo, ha sido muy utilizada la unin de poli-lisina a transferrina o a orosomucoide, para
conseguir unin especfica a receptores hepticos. Otra estrategia utilizada con bastante xito ha sido la
formacin de lipoplexos que adems incluyen partculas del virus hemaglutinante del Japn (virus
Sendai) inactivados, lo que proporciona una entrada en las clulas muy eficaz (por la fusogenicidad del virus
Sendai) y buen escape endosomal.

En la Figura 19.7 se muestran algunos ejemplos de vectores no virales.

La siguiente Tabla resume las principales caractersticas de los vectores que se han mencionado:



Como resumen de todo lo dicho acerca de vectores, podemos concluir diciendo que el vector ideal de
terapia gnica debera ser fcil de preparar, tener gran capacidad para aceptar genes teraputicos de gran
Retrovirus Adenovirus AAV No virales
Tamao mximo terico 7-8 kb 7-8 kb (30 kb) 5 kb No lmite
Ttulos alcanzados durante la
preparacin (partculas/ml)
10
8
/ml 10
12
/ml 10
11
/ml No lmite
Administracin preferente Ex vivo Ex/in vivo Ex/in vivo Ex/in vivo
Integracin en el genoma Si No Si/No Mnima
Duracin expresin in vivo Corta Corta Larga Corta
Inmunogenicidad Poca Mucha Poca Nada
Inmunidad previa Improbable Si Si No
Problemas de seguridad Mutagnesis
Inflamacin
Toxicidad
Mutagnesis Ninguno
CAPTULO 19: TERAPIA GNICA 221
tamao, funcionar tanto en clulas en divisin como en clulas quiescentes, ser totalmente inocuo e
invisible para el sistema inmune, fcilmente dirigible a distintos tipos de clulas diana, ser capaz de
persistir en las clulas durante periodos prolongados y poseer elementos reguladores de la transcripcin
del gen teraputico que sean fcilmente regulables para poder variar los niveles del producto teraputico
segn sea necesario. Hay numerosos ejemplos de cmo se han conseguido mejorar los distintos tipos de
vectores para dotarlos con alguna de estas propiedades. Por ejemplo, los retrovirus se han podido
pseudotipar con las protenas de la envuelta del virus de la estomatitis vesicular para modificar su tropismo.
Igualmente, se ha modificado la protena botn de la fibra de los adenovirus mediante anticuerpos bi-
especficos o por modificacin gentica. Los vectores no virales se han glicosilado para ser selectivamente
reconocidos por receptores especficos presentes en distintos tipos celulares. Tambin se han construido
sistemas de transcripcin regulables muy efectivos, que se pueden incorporar en los distintos tipos de
vectores.


Aplicaciones clnicas de la terapia gnica en el momento actual

Desde el caso de la nia Ashanti Da Silva, primer paciente de la historia tratado mediante terapia gnica en
1989 por sufrir Inmunodeficiencia Combinada Severa (dficit del enzima adenosn-desaminasa), el nmero
de ensayos clnicos llevados a cabo en todo el mundo ha aumentado rpidamente, de manera que en la
actualidad hay varios miles de enfermos includos en protocolos clnicos de terapia gnica. Como las
estrategias utilizadas son variadsimas, a continuacin se resumen las ms utilizadas hasta el momento:

Terapia gnica del cncer: la estrategia ms utilizada es, sin duda, la utilizacin de los llamados genes
suicidas. Se trata de transferir a las clulas tumorales un gen que codifique una protena capaz de activar
un pro-frmaco inactivo a su forma activa. Es muy popular la utilizacin del gen de la timidn-kinasa del
virus del Herpes Simplex (HSV-tk), que codifica una timidn-kinasa capaz de fosforilar el ganciclovir a
ganciclovir-trifosfato. El ganciclovir tri-fosfato es la forma activa capaz de interferir con la replicacin del
ADN y provocar la muerte de las clulas que