DETECTION AND DIFFERENTIATION OF MAREKS DISEASE VIRUS SEROTYPES BY POLYMERASE CHAIN REACTION (PCR) AND CHARACTERIZATION BY DNA SEQUENCING

OF THE PCR PRODUCT A THESIS SUBMITTED TO THE ANAND AGRICULTURAL UNIVERSITY IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF THE DEGREE

OF

Doctor of Philosophy
IN VETERINARY MICROBIOLOGY

BY
KALYANI IRSADULLAKHAN HABIBULLAKHAN M. V. Sc.

DEPARTMENT OF VETERINARY MICROBIOLOGY COLLEGE OF VETERINARY SCIENCE AND ANIMAL HUSBANDRY ANAND AGRICULTURAL UNIVERSITY ANAND-388001 (GUJARAT) 2006

Reg. No. 04-04779-2000

Dr. J. H. Purohut Ph.D. Professor and Head Department of Veterinary Microbiology College of Veterinary Science and Animal Husbandry Anand Agricultural University Anand - 388 001. Gujarat State (India)

CERTIFICATE
This is to certify that the thesis entitled DETECTION AND

DIFFERENTIATION OF MAREKS DISEASE VIRUS SEROTYPES BY POLYMERASE CHAIN REACTION (PCR) AND CHARACTERIZATION BY DNA SEQUENCING OF THE PCR PRODUCT submitted by Mr. IRSADULLAKHAN HABIBULLAKHAN
KALYANI (Reg. No. 04-04779-2000) in partial fulfillment of the requirements for the award of the degree of DOCTOR OF PHILOSOPHY in the subject of VETERINARY MICROBIOLOGY of the Anand Agricultural University is a record of bonafide research work carried out by him under my guidance and supervision and the thesis has not previously formed the basis for the award of any degree, diploma or other similar title.

Place: Anand Date: /2 /2006

(J. H. Purohit) MAJOR ADVISOR

CERTIFICATE

This is to certify that I have no objection for supplying to any scientist only one copy of any part of this thesis at a time through reprographic process, if necessary for rendering reference service in a library or documentation center.

(I. H. kalyani)

Place: Anand (J.H.Purohit) Date: / 2/2006 MAJOR ADVISOR

Dediccted To Dr. Irt Davidson

Ph. D

And My Wife Mrs. Firoza

CONTENTS

CHAPTER NO. I II III IV V VI

CHAPTER INTRODUCTION REVIEW OF LITERATURE MATERIAL AND METHODS RESULTS DISCUSSION SUMMARY AND CONCLUSIONS APPENDIX REFERENCES

PAGE NO. 1 6 30 47 68 89 A1-A2 i-xiii

LIST OF TABLES
Sr. No. Table No. Page No.

Title

1 2 3

3.1 3.2 3.3

Details of clinical samples collected from layer birds for MDV diction Contents of the DNeasy kit

31 33 34

Details of primers used for PCR Composition of reaction mixture for PCR

4 5 6 7

3.4 3.5 3.6 3.7

38 39 41 41

Steps and conditions of thermal cycling for PCR Composition of reaction mixture for Cycle sequencing Cycling protocol for sequencing reaction

8 9 10

4.1 4.2 4.3

Incidence of MD in selected poultry population of Gujarat state Incidence of MD during PM examination.

54 54

Comparative efficacy of different primer pairs in detection of MDV from field samples and vaccine 55 viruses

..contd

contd..
LIST OF TABLES

Sr. No.

Table No.

Title

Page No. 56

11

4.4

Samplewise positivity by different primer pairs for detection of MDV Score table for alignment of 132bp repeats sequence of MDV field isolates M3 with sequence published in gene bank Score table for alignment of 132bp repeats sequence of MDV field isolates M4 with sequence published in gene bank Nucleotide nucleotide BLAST of primer Unique to ICP4 gene of submitted MDV sequences

12 13 14

4.5 4.6 5.1

57 58 80

LIST OF PLATES
Sr. Plate No. No. Page No.

Title

4.1

Locationwise incidence of MDV

66

4.2

Monthwise incidence of MDV Samplewise positivity by different primer pairs for detection of MDV.

66

4.3

67

LIST OF FIGURES Sr. No. 1 Figure No. 1.1 Title

Genome of Mareks disease virus

Page No. 1

2.1

Location of 132 bp repeats in MDV genome Photograph showing post mortem lesions of Mareks disease. Note the enlargement of spleen, tumorous growth in abdominal cavity. Photograph showing post mortem lesions of Mareks disease in liver of birds. Note the Lymphomas of liver. Photograph showing post mortem lesions of Mareks disease. Note the lymphomas in the heart. Agarose gel electrophoresis pattern of MDV 132 bp repeats specific PCR Products ( approximately 434 in case of double 132 bp repeats) amplified with primer pairs BamH1/BamH2. Agarose gel electrophoresis pattern of UL44 gene (common to MDV1 and HVT) specific PCR products (approximately 686 bp) amplified with primer pairs AGA1/AGA1.8.

29

3.1

43

3.2

44

3.3

45

4.1

59

4.2 (A)

60

Agarose gel electrophoresis pattern of MDV UL 44 gene 4.2 (B) specific PCR Products ( approximately 314 bp) amplified with primer pairs GAM1/AGAM2

60

4.3

Agarose gel electrophoresis pattern of MDV UL 44 gene specific PCR Products ( approximately 199 bp) amplified with primer pairs P1/P2 Agarose gel electrophoresis pattern of HVT (MDV 3) US region specific PCR products (approximately 505 bp) amplified with primer pairs HVT1/HVT2

61

10

4.4(A)

62

..contd

contd LIST OF FIGURES 11 4.4 (B) 4.5

Agarose gel electrophoresis pattern of MDV ICP4 gene specific PCR products ( approximately 318 bp) amplified with primer pairs M1.1/M1.8. 132 bp specific sequence of MDV-1 from field samples (M3 and M4).

62

12

63

13

4.6

Alignment of 132 bp repeat sequence of MDV-1field isolate (M3) with Sequence published in Genbank. Alignment of 132bp repeats sequence of MDV field isolate (M4) with the sequence published in gene bank

64

14

4.7

65

ACRONYMS
l C g AGID AGPT ALV bp CEF cDNA DNA dNTPs et al. IE genes etc FF g g HVT i.e. ICP4 IRL IRs M MAb MD MDV mMDV vMDV Per cent Microliter Degree Celsius Microgram (s) Agar gel immunodiffusion Agar gel precipitation test Avian Leukosis virus Base pair chicken embryonic fibroblasts Complementary DNA Deoxyribonucleic acid Deoxynucleoside triphosphate et alii immediate early genes et cetera Feather follicle Gram(s) Acceleration of gravity Herpes virus of turkey id est (that is) Internal cellular protein-4 Inverted repeats long Inverted repeats short Molar Monoclonal antibody Mareks disease Mareks disease virus mild Mareks disease virus ml mM mRNA N ng nm PBS PCR PI pmole RE REV RID RNA RNase OD SPF sec ELISA TBE TE TRL TRS U US UL UV V viz. WLH X-gal W Milliliter Milimolar Messenger ribonucleic acid Normal Nanogram Nanometer Phosphate buffered saline Polymerase Chain Reaction Post infection Picomole (s) Restriction endoniclese Reticuloendothelial virus Radial immunodiffusion Ribonucleic acid Ribonuclease Optical density Specific pathogen free Seconds Enzyme-linked immunosorbent assay Tris borate EDTA buffer Tris-EDTA Buffer Terminal repeats long Terminal repeats short Unit Unique short Unique long Ultra violet Volts Videlicet (namely) White leghorn 5-bromo-4-chloro-3-indolylbD-galactoside Watt

virulent Mareks disease virus very virulent Mareks disease vvMDV virus very virulent plus Mareks vv+MDV disease virus mg Milligram min Minutes

Acknowledgment

ACKNOWLEDGEMENT
At the outset, I take the privilege in expressing my deep sense of gratitude and indebtedness to my Major advisor Dr. J. H. Purohit, Ph.D., Professor & Head, Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, A.A.U., Anand for his invaluable and critical suggestions, scientific acumen perspicacious remarks, scholarly guidance, active persuasion and supervision, which served as a constant source of inspiration throughout the course of my study and research work. I sincerely thank my Minor advisor, Dr. K. S. Prajapati, Professor & Head, Department of Pathology, for his help in sample collection and at various stages of thesis writing, his omniscient knowledge of poultry pathology helped me a lot, and members of Advisory Committee Dr. M. K. Jhala, Ph.D., Associate Research Scientist,, Department of Microbiology for his altruistic approach and Dr. J. V. Solanki, Professor & Head, Department of Animal Genetics and Breeding for his valuable suggestions during the molecular work and Dr. A. I. Patel, Professor & Head, Department of Parasitology for their valuable suggestions and keen interest in my work. I am equally grateful to Dr. M. C. Desai, Principal, College of Veterinary Science and Animal Husbandry, Anand for his generous attitude in providing necessary facilities to carry out the research work. This work was possible mainly due to continuous help and critical suggestions time to time from Dr. Irit Davidson ,Kimron Veterinary Institute Israel 50250. I am extremely grateful to her for her keen interest and kind co-operation at all the stages of this research work. I am highly grateful to Dr Fkrul Islam, School of Rural Science and Agriculture Animal Science W49The University of New England, Armidale NSW2351 Australia Dr.Bob Silva, USDA-ARS,Dr. Hans H. Cheng USDA-ARS, Avian Disease and Oncology Laboratory USA. Dr.Celina Buscaglia,(DVM.MS, PhD), Argentina, for providing information and related research articles required in this study. I take this opportunity to express my deep sense of gratitude towards Dr.Y.L.Vyas professor and Head and Dr.K. M. Panchal Associate professor for their help in completing this entire work, here I would also like to put on record the help rendered by Dr. B.S.Dubbal Associate professor Anatomy department veterinary college Anand. I take this opportunity in expressing my heartfelt thanks to Dr. Ashish Roy, Associate Professor, for his constant help and suggestions during the entire work. I further respectfully acknowledge the untiring help rendered by Dr. C.G. Joshi, and Dr. D. N. Rank during the period of research. I am also thankful to other staff of AGB for their co-operation during the research. I am profoundly thankful to Dr. J.G. Sarvaiya, Director, Information Technology Center, for providing me the world class information technology services whenever needed during the entire study period. I wish to place on record the help rendered by Dr. Kuldeep Khanna and the entire staff of CPRS, for their co-operation during the research .I will always remain thankful to Dr. Nishant Patel, for giving valuable support in sample collection. Words are insufficient for Dr. J.J Hasnani Professor, Department of Parasitology who had provided me the moral and social support throughout my study period. I am immensely thankful to my colleagues Drs. C J Dave, H I Paleja, V N Baort, N D Hirani, and J B Solanki for their kind co-operation and unreserved help during the course of study. I am highly grateful to Anand Agricultural University for permitting me to undergo this PhD study as an in-service candidate. I am highly thankful to departmental staff, Shahbhai, Ramibhai, Jayaben, Khodbhai, Mohanbhai, Surabhai and Harishbhai for their co-operation throughout the course of study. I express boundless gratitude towards my wife Mrs Firoza Pathan and my daughter ZEBA for bearing and tolerating my moods and me during the course of the study Place: Anand Date: 27/2/2006 (Kalyani I H)

ABSTRACT

ABSTRACT
DETECTION AND DIFFERENTIATION OF MAREKS DISEASE VIRUS SEROTYPES BY POLYMERASE CHAIN REACTION (PCR) AND CHARACTERIZATION BY DNA SEQUENCING OF THE PCR PRODUCT Name of the student I. H. Kalyani Major Advisor Dr J. H. Purohit Department of Veterinary Microbiology College of Veterinary Science and Animal Husbandry Anand Agricultural University, Anand-388 001
Mareks disease (MD) is a lymphoproliferative disorder of chicken characterized by oncogenic transformation of T cells that infiltrate lymphoid tissues, peripheral nerves and visceral organs, resulting in a complex pathogenesis that usually leads to death of the affected chicken. The causative agent of MD, Mareks disease virus (MDV) a cell associated herpesvirus, is ubiquitous in almost all poultry population raised under commercial conditions. The present study was under taken to assess incidence of MD as per the farm records on the basis of clinical signs and post mortem lesions, detection of MDV from clinical cases exhibiting frank lesions of MD by PCR, comparing the efficacy of different primers in detecting the MDV as well as differentiating the serotypes in tissues and feather follicle and genetic characterization by sequencing of the PCR amplified fragment carrying 132 bp repeats. During June to November 2005 outbreaks of MD were suspected in flocks of egg type birds on farms situated in and around Anand district located of central Gujarat as well as from farms around Mahuva located in Saurastra region of Gujarat state. The strength of individual affected flocks varied from 4500 to 25000 birds with a total population of 4,26,991 birds. Of these, 14110 birds died due to MD (as per the farm records of history, symptoms and postmorterm lesions) with an over all mortality of 3.30 per cent during the months of June to November 2005. During the investigation, a total of thirty six commercial poultry farms and forty nine batches of layer birds suffered from mortality due to MD, in addition to Central Poultry Research Station (CPRS) Veterinary College Anand, where mortality occured in layer birds. Mortality in commercial poultry farms ranged between 0.6 to 7.3 per cent. A total of 34 clinical samples (17 feather follicles and 17 spleen ) from 27 birds suspected of MD were collected by making visits to the various commercial poultry farms and also from CPRS Veterinary College Anand. Suspected clinical samples and four MD vaccine strains, including three HVT (MDV3) vaccines and one SB-1(MDV-2) vaccine were processed for DNA extraction. DNA was extracted from samples of feather follicle using proteinase K mixture, where as DNeasy Tissue Kit (QIAGEN Pvt. Ltd) was used for tissue samples. Sample showing acceptable purity and concentration were subjected to PCR amplification using six different primers. Total of six pairs of primers were used, which were selected to amplify different gene segments. The primer pair BamH1/BamH2 specifically amplifying a 434 bp segment from BamHI fragment (of MDV-1) containing 132 bp repeats located in TRL and IRL region of MDV genome, detected 32 samples positive indicating presence of double 132 bp repeats in the amplified segment. All the three HVT vaccines and one SB-1 vaccine failed to produce the amplification as the selected primer is specific for MDV-1 only. Primer pair AGAM1/AGAM2 and P1/P2, both targeting the antigen A gene (UL44) produced 314 bp and 199 bp products respectively in 30 out of 34 clinical samples tested, however, none of the HVT vaccine or SB-1 vaccine yielded positive result, suggesting the specificity of these primers for MDV-1.

Primer set M1.1/M1.8 amplified a 318 bp product as against expected 247 bp product in 30 samples. To confirm the result, these primers were subjected to NCBI BLAST, and it was found that the primer specific segment of 318 bp does exist in published sequence of Md5, and Md11BAC. None of the HVT as well as SB-1 vaccine produce any amplification indicating the specificity of primer in detecting MDV-1. Only two field samples produced expected amplicon of 505 bp when tested with MDV3 specific HVT1/HVT2 to detect the vaccine virus (HVT). All the three HVT vaccines produced the amplicon of 505 bp, whereas SB-1 vaccine was negative, proving specificity of this primer pair for HVT. Out of the six primer pairs, BamH1/ BamH2 and AGA1/AGA2 detected MDV in maximum number (32) of field samples. Primers AGAM1/AGAM2, P1/P2 and M1.1/M.1.8 detected the same number (30) of samples positive. Primer pair HVT-1/HVT-2 detected MDV3 in two feather follicle samples indicating possible excretion of the vaccine virus. PCR products (434 bp) of MDV genome amplified by BamH1/BamH2 primers from two field samples (M3, M4) having good quality DNA (i.e.1.7-1.9 OD at 260/280 nm) as determined by spectrophotometry were used for sequencing by ABI PRISM 310 Genetic Analyzer (Applied Biosystems, USA), using BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, USA). The sequence obtained revealed two 132 bp repeats in the 378 bp stretch indicating virulent nature of the field MDV. The alignment of 378 bp sequence of M3 and M4 with previously published sequences of the MDV isolates Md5, Md11, HPRS-16 and CDs of tumourogenicity associated m-RNA and CDs published from BamH gene family revealed that the field isolates of present study shared complete homology (100%). Results of sequencing along with history of vaccination in the affected birds and involvement of different organs on postmortem examination indicated about the increase in virulence of MDV circulating in field causing recent outbreaks.

INTRODUCTION

CHAPTER I INTRODUCTION
Mareks disease (MD) is a lymphoproliferative disorder of chicken characterized by oncogenic transformation of T cells that infiltrate lymphoid tissues, peripheral nerves and visceral organs, resulting in a complex pathogenesis that usually leads to death of the affected birds. The disease is named after Professor Jozef Marek, who described it nearly a century ago (Marek, 1907) as a polyneuritis. The causative agent of MD, a cell associated herpesvirus, was discovered and isolated in cell culture by Churchill and Biggs (1967). Mareks disease virus (MDV) strains that induce disease in chicken are classified as serotype-1 under alpha herpesviruses. The genome of MDV has been shown to be a linear double-stranded DNA with a molecular weight of 110 x 106 and buoyant density of 1.705 g/cm3 in neutral CsCl2. Cebrian et al. (1982) showed by electron microscopic studies that the genome structure consists of a unique long region (UL) and a unique short region (Us) bound by inverted repeats similar to that of Herpes simplex virus. So the genome of MDV is 5- TRL-ULIRL-IRS-US-TRS-3.

Figure 1.1: Genome of Mareks disease virus Two additional serotypes (serotype-2 and 3) of alpha herpesviruses occur naturally in chicken and turkey. Both are non-oncogenic, but share antigenic determinants with MDV-1 as detected by immunological assays and protection test. Serotype-1 MDV is the prototype virus for this group of avian viruses, and except where otherwise indicated, MDV refers to serotype1 virus. Serotype-1 strains are further divided into pathotypes, which are often referred to as mild (m) MDV, virulent (v) MDV and very virulent (vv) MDV, very virulent plus (vv+) MDV (Witter, 1998b). Soon after the isolation of MDV type-1 (MDV-1), the first vaccine became available based either on highly passaged attenuated MDV-1 (Churchill et al., 1969) or on the serologically related herpesvirus of turkey (HVT) serotype-3 of MDV like viruses (Okazaki et al., 1970). MDV-1 is an evolving pathogen, and vaccine viruses do not prevent infection by oncogenic field MDV-1 viruses, thus creating an environment for natural selection of more virulent viruses. Pathogenicity of MDV-1 viruses has been based on their ability to break protection induced by various vaccine formulations (Witter, 1997). MD induced by virulent pathotype strains emerging in 1950s was successfully protected against by HVT, the very virulent strains break the HVT vaccination barrier, and very virulent plus strains are capable of causing MD in chicken immunized with bivalent vaccine (a mixture of MDV-2 and HVT). Belongings also to serotype-1 are viruses with naturally low pathogenicity such as CVI988, also commonly called Rispens (Rispens et al., 1972), derivatives of which have been serving recently as the best protecting MD vaccines (Zelnik, 2003). MDV spreads rapidly throughout flocks by direct and indirect contact with infected chicken, premises, litter, dust and chopped feathers. Most important is the airborne route of infection. Very soon after the infection of the respiratory tract, cell-associated viremia results, reaching a peak at about eight days later. Macrophages carry and distribute MDV all over the body infecting susceptible cells and causing lymphocyte transformation. At this time, cytolysis and atrophy can be observed in the bursa of Fabricius. MDV may be detected in epithelial cells of feather follicles five days after the infection causing degeneration of feather follicles or neoplastic lymphoproliferative lesions in tissues around them. Viral antigen, intranuclear inclusion bodies and cell-free virus can be detected in skin, the only sites where cell- free virus

is formed. Shedding of the virus from the skin through desquamated danders, begins before the clinical signs of the disease, and may continue throughout the whole life. Dust with danders and moulted feathers can be readily transported passively from infected houses over long distances by air or with clothing, infected eggs, utensils, trucks and other ways. Some ground arthropods were shown to be passive carrier of MDV but they are not a major vector in modern houses. Chicks can usually be infected very early in life, from the first day after hatching, although it may be some weeks or months later. With age, the possibility of infection is reduced because of increased resistance. Vertical transmission of the virus has not been proven and day-old chicks are free of the virus, although they could be infected in hatcheries, which had not been disinfected (Josipovic, 1990). Clinical signs associated with MD vary according to the specific syndrome. In classical MD, which is also called as neurolymphomatosis, there is asymmetric paralysis of one or both legs or wings if sciatic or brachial nerves are involved (Witter and Schat, 2003). The disease is immunosuppressive, and the degree of suppression is linked to the virulence of the virus strain (Calnek et al., 1998). The four phases of infection in vivo can be delineated: 1) early productive-restrictive virus infection causing primarily degenerative changes: 2) latent infection: 3) second phase of cytolytic, productive-restrictive infection coincident with permanent immunosuppression: and 4) a proliferative phase involving non-productively infected lymphoid cells may or may not be progressing to the point of lymphoma formation (Calnek, 1998). The presence of MD and/or MDV has been reported from different states in India, like Orissa (Pradhan and Nayak 1973), Punjab (Grewal and Singh 1976), Assam (Baruah and Kwatra 1979), Uttar Pradesh (Goel et al.,1980), Andhra Pradesh (Reddy et al., 1980), Arunachal Pradesh and Tripura (Verma et al. 1987 and 1989). In Gujarat, cases of MD were reported to exist since 1971 and the incidence was on an increasing trend as reported by Varia and coworkers in 1972. They found that on each farm under the study, five to 60 per cent birds were found ailing showing various symptoms suggestive of MD. On an average mortality ranged from 5 to 30 per cent in older age group and in younger age group, rarely less than 15 per cent, commonly 20 to 30 per cent and as high as upto 60 per cent. Recently, Posia (2003) screened ten serum and ten feather follicle samples from each of the 20 selected commercial broiler farms in Gujarat, and found that overall seroprevalence of MD was 7.5 per cent. Technique for diagnosis of infection with MDV is isolation and identification of MDV from the infected tissues. Virus isolation is usually by virus propagation in cell culture and identification/quantification by cytopathic changes (plaque formation) or identification of the infected cells by immunostaining (De Laney et al., 1998). Polymerase chain reaction (PCR) has emerged in recent years as an additional diagnostic tool offering advantages of serotype specificity (Davison et al., 1995,) and the ability to differentiate between vaccinal and wild strain of MDV serotype-1 (Beaker et al., 1992, Silva 1992, Handberg et al., 2001). Although, MDV infection has been known to occur in this state for past 35 years or more work involving detection and differentiation of various serotypes of MDV and other aspects like genetic characterization by DNA sequencing has not been done. Present scenario warranted the need to establish diagnostic assay which will not only facilitate the diagnosis in a specific and sensitive way, but also helps in serotyping as well as molecular characterisation of MDV. Economic consequences of MDV infection are lymphoma induction leading to mortality in layers and breeders and condemnation at the time of slaughter and processing in broilers. Despite reduction in such losses through the live virus vaccines, a high level of concern persists. These concerns appear based on a) The unpredictable nature of outbreaks, as currently going on in the state and b) The increasing virulence of the field isolates, which results in reduced efficacy of existing vaccines.

Changes in MD and MDV are numerous and are brought by many intercurrent forces. Understanding and anticipating these changes is fundamental to achieve further progress in poultry industry. Keeping above facts in view, the study was under taken on following aspects of MDV for a detailed consideration 1) To study the prevalence of MD in chicken of selected areas of Gujarat state. 2) Standardization of PCR for detection of MDV from clinical samples. 3) Comparative efficacy of different primers for MDV detection and serotyping. 4) Genetic characterization of the field MDV by sequencing the PCR targeted gene segment.

REVIEW OF LITERATURE

CHAPTER II REVIEW OF LITERATURE

2.1 INCIDENCE
Incidence of Mareks disease (MD) has been reported by various workers. The seminal report by Jozef Marek, published in 1907 of paresis in four roosters was the first account of the disease that now bears the authors name (Witter and Schat, 2003). Incidence in India Sharma and co-workers reported the skin form of MD in naturally as well as experimentally infected birds in 1972. They described gross pathology and histopathology of skin lesions in four spontaneous cases of MD as well as an experimentally inoculated chicken. Grossly, the feather follicles were enlarged and skin surface had varying sized tumourous nodules. Histopathologically, the patchy infiltration of skin with pleomorphic and lymphoid cells, and presence of intranuclear eosinophilic inclusion bodies in the feather follicles were observed. In Gujarat, cases of MD were reported since 1971 and the incidence was found on increasing trend (Varia et al., 1972). They found that on each farm under the study, five to 60 per cent birds were found ailing, showing various symptoms suggestive of MD. On an average, mortality ranged from five to 30 per cent in older age group and in younger age group rarely less than 15 per cent, which was commonly 20-30per cent and sometimes as high as upto 60 per cent. Pradhan and Nayak (1973) used the Agar gel precipitation test (AGPT) to study the prevalence of MD in Orissa. Out of 152 chicks examined, 40 (26.31%) were found positive for MDV antibodies Grewal and Singh (1976) reported MDV infection in Punjab State in domestic fowl. Sharma et al. (1977) studied the prevalence of MD in organized poultry farms in some of the Indian states, by assessing serum precipitin and/or feather follicle (FF) precipitinogen. Out of the 83 poultry farms investigated, all except six were found positive for the presence of MDV antigen and/or antibodies. Incidence of MD at 11.7 per cent in the birds of older age group and 80.8 per cent in younger age group was observed by Damodar Reddy (1979). Prevalence of MD in chicken in Assam was reported by Baruah and Kwatra in 1979. They performed AGPT and found sixteen (32%) out of 50 sera positive for MDV antibodies. In 1979, a serological survey was carried out by Garg and co-workers on 28 commercial poultry farms of Kashipur, Haldwani, Pantnagar and Ajmer areas. From 1420 serum tested, 571 (40.2%) revealed positive reaction when tested by feather follicle extracted antigen, and 412 (29.1%) were found positive when tested by chicken embryo fibroblast cell antigen . The percentage of positive birds amongst broilers, growers and layers were 30.7, 51.9 and 44.5, respectively. In an another survey Garg et al. (1980) performed a serological study of MD on 13 farms in Kashipur, Pantgnagar and Haldwani areas. Out of 2003 birds tested for MDV antibodies, 656 (32.7%) were found positive by AGPT. The age wise distribution of positive reactors was 33.4% between 2-5 months, 28.7% between 3-5 months and 33.9% in the birds having age of six weeks and above. Sero-epidemiological survey of MD in some parts of Uttar Pradesh was carried out by Goel et al. (1980). Out of 1835 serum samples from 15 poultry farms, 1045 (57%) were positive for MDV precipitins. The seroprevalence ranged from 42 to 75 per cent (average 60.7%) on Government farms and 16 to 83 per cent (average 37%) on private farms. Reddy et al. (1980) reported that all the 37 farms of Andhra Pradesh on which survey for MD was carried out, were positive for MD. A total of 2,914 samples (2013 serum samples and 901 feather follicles) were collected, out of which 995 (34.15%)

2.1.1

2.1.2

samples were positive for either MDV antibodies or antigen. The infection was observed in 9 weeks to 72 weeks old birds and the incidence was as high as 80 per cent at 26 weeks of age. Singh et al. (1981) reported an over all seroprevalence of 40.01 per cent in the unvaccinated flocks by performing AGPT and radial immunodiffusion (RID) test. The presence of MDV antigen in the feather follicles was 15.7 per cent in the unvaccinated and 12.8 per cent in the vaccinated flocks by AGPT and RID. Panda et al. (1983) observed higher mortality (28.15 per cent) due to MD at 21 to 40 weeks of age as compared to 8.86 per cent mortality at 9 to 20 weeks of age. According to sexwise mortality, the mortality rate was found higher in females than in males. Haribabu (1986) conducted seroprevalence of MD by gel diffusion test. A total of 1536 serum samples were collected from two to five months old birds with or without clinical MD. The overall seroprevalence was 13.67 per cent. The highest incidence of 17.52 per cent was recorded in three months old birds, followed by 13.21 per cent in four months, 11.25 per cent in two months and 6.67 per cent in five months old birds. The FF material collected from 129 birds that died of MD revealed AGPT positive reaction in 112 (86.82%) birds. Verma et al. (1987 and 1989) reported 44.08 per cent and 49.30 per cent seroprevalence of MD in Arunachal Pradesh and Tripura state during their study. Ghosh et al. (1989) collected a total of 42 serum samples from affected and moribund birds in Meghalaya. Feather follicles were also collected from the birds showing growth on skin. They noticed that out of 42 sera tested, 20 samples showed the presence of MDV antibodies and out of eight samples tested for antigen, six samples showed MD specific precipitinogen. Dave (1989) studied the outbreaks of acute form of MD in five successive flocks of WLH birds at Poultry Complex of Gujarat Agricultural University, Anand. Mortality due to acute MD ranged from 12.30 to 30.09 per cent. Mishra et al. (1994) carried out seroprevalence study on MD in different breeds of layer and broiler birds mainly Hubhard, Babcock, Cobb, Austrolop and Kalinga Brown. Among 455 suspected serum samples collected and screened by AGPT, the overall rate of MD incidence was found to be 21.97 per cent. The rate of incidence in Hubbard breed was found maximum i.e. 27.5 per cent, whereas in Cobb breed it was 2.5 per cent. Posia (2003) screened ten serum and ten feather follicle samples from each of the 20 selected commercial broiler farms situated near Anand, for MDV specific antibodies and antigens respectively, against known standard MDV antigen and antisera by AGPT. The overall seroprevalence of MD was found to be 7.5 per cent (15/200). Based on detection of MDV antigen from the feather follicles, the overall prevalence of MD precipitinogen was found to be 14.5 per cent (29/200). Incidence Abroad Benton and Cover (1957) studied acute form of MD in broiler chicken, and observed tumours in multiple viscera, muscle and skin. Zanella and Raymonds (1969) carried out AGPT for testing serum samples from chicken of various poultry farms for detecting MDV antibodies. MDV antigens HPRS-16, LCBS-212 and LCBS-216 were used for the test. Antibodies were found in the birds from 6-7 weeks onwards and were present in almost 100 per cent birds at 17 to 18 weeks of age. Ianconescu and Samberg (1971) studied the spread of MDV infection among commercial flocks by using the AGPT. In all the flocks tested, positive birds were found and over 90 per cent of 12 weeks old fowls had MDV antibodies. The incidence was much higher among meat breeds than layers.

Adene (1983) carried out serological survey of MDV in exotic and local chicken in Nigeria. Of 152 fowls of exotic commercial strains and of 108 local fowls, 16.4 and 8.3 per cent, respectively had positive precipitating antibody titers for MDV. Of 110 exotic and 105 local fowls tested for MDV feather follicle antigen, 41.8 and 12.4 per cent respectively were positive. Juranavo et al. (1983) carried out serological examination of 20 randomly selected batches of slaughter broiler for precipitating antibodies to MDV, Infectious bronchitis and New Castle disease. MDV antibodies were detected in seven of 20 batches with an overall seroprevalence rate of 4.3 per cent. Witter (1983) reported the presence of MDV in 63 problem flocks in USA. Antibodies were measured by indirect immuno fluorescence and by AGPT. vvMDVs were isolated from 7 of 29 flocks. Moriguchi et al. (1984) evaluated the association between nuclear inclusion (NI) formation in the feather follicle epithelium (FFE) to mortality from MD thereby presenting useful data on epidemiology of MD in HVT vaccinated field chicken. Incidence of NI formation in the FFE of chicken at 19-20 weeks of age was related to mortality from MD, Chickens with NI formation had MD mortality rate of 66.7per cent, whereas chicken without NI formation only 0.8 per cent. Wickramasinghe (1984) carried out serological survey in five poultry farms in Sri Lanka. Serum samples were collected at random from 150 birds over 12 weeks of age and tested for precipitating antibodies to MDV by AGPT. Precipitating antibodies were present even among the clinically healthy chicken as observed in three out of the five farms. Kobavashi et al. (1986) studied the outbreaks of MD in adult quails in vaccinated with herpesvirus of Turkey (HVT) by examinig them pathologically and serologically for MD in Japan. Forty three of the 220 quail exhibited microscopic lesions similar to those of chicken with MD. MDV specific antigen was found in feather tips of 44 of the 220 birds and the HVT specific antibodies were found in sera of 56 of the 220 birds by AGPT. Positive co-relation was observed between incidence of lymphomatous changes and the presence of MDV specific antigen. Lu and Gao (1987) carried out AGPT on birds from eight districts of Guizhou Province of China. Of the 1905 chicken tested from 94 flocks on 17 farms, 25.7, 90 and 100 per cent respectively were positive for MDV antibodies. Sung et al. (1997) tested feather tips collected from field broiler chicken for MDV infection both by AGPT test and PCR to compare their relative sensitivity. They found 12 out of 35 farms (34.0%) positive for MDV by PCR whereas only three farms (8.6%) were positive by AGPT. In a nation wide survey (Korean republic) using PCR technique from DNA extracted from feather follicle of broiler birds, MDV infection was detected in 31 farms out of 80 tested. Ross et al. (1997) from USA reported use of in situ hybridization for detection of MDV and showed that all the tumours examined, contained MDV DNA in areas of lymphoid infiltration. In 3/5 tomours, there was a correlation between the number of cells expressing the E CORI-G gene (Meq) and those that carried lymphoid cell marker AV 37. Cho et al. (1998) reported the use of cytology of feather pulp lesions (FPL) for diagnosis and prediction of MD. They found that birds having MD lymphoma or nerve lesions exhibited the characteristic changes on the cytological smears of FPL, comprising of initial non-suppurative inflammatory to the late lymphomatous FPL. Davidson et al. (2002) observed that MDV caused immunosuppression and tumours in chicken, but turkey was an unusual host for the virus, and the tumours caused by MDV in turkeys were unique. They described the prevalence of turkey tumours in Israel between 1993 and 2000, their molecular diagnosis by polymerase

chain reaction (PCR) and the natural distribution of herpesvirus of turkeys (HVT). Most clinical cases with tumours in commercial turkeys were diagnosed as MDV. Sung (2002) found that the incidence of MD suddenly increased in 1997 in Korea. Most MD cases in this country were detected in chicken over 20 wk of age. Five MDV isolate were obtained from field flocks, in which severe losses had occurred, and one of the virus isolate was studied to compare its pathotype with the prototype JM strain. The isolate KOMD-IC induced severe depression not only in body weight but also in relative bursal weight, and the depression by KOMD-IC was more severe than that induced by JM strain. In addition, the incidence of MD tumour caused by KOMD-IC was higher than that caused by the JM strain. Gimeno et al. (2005) reported a novel criteria for diagnosis of MDV induced lymphoma after examining the several criteria to assist in the differential diagnosis of tumours induced by MDV from those induced by avian leukosis virus (ALV) and reticuloendotheliosis virus (REV). A collection of tumours induced by inoculation of specific strains of MDV, ALV and REV, alone or in combination, were tested for quantification of MDV DNA by real-time polymerase chain reaction, expression of the MDV oncogene Meq, expression of several cell markers associated with transformation (CD30, Marek's disease-associated surface antigen, and p53), and level of DNA methylation in the tumour cells. In addition, tissues latently infected with MDV and non-infected tissues were tested as controls. Tumours induced by MDV had about 10(2)-fold more copies of MDV DNA than either tissues latently infected by MDV or tumours induced by retrovirus in MDV-vaccinated chickens. Moreover, the MDV antigen Meq was consistently expressed in all MDV tumours, but it could not be detected in tissues latently infected with MDV or in tumours induced by retrovirus in MDV-vaccinated chickens. Other markers studied were not specific for MDV and therefore had limited value for diagnosis. Nonetheless, some of these markers were found to have potential value in research, as they would help to identify the transformed cells.

2.2

DETECTION OF MAREKS DISEASE VIRUS BY PCR

A polymerase chain reaction (PCR) test using primers flanking 132 bp tandem repeats in pathogenic MDV DNA was developed by Becker et al. (1992). These primers amplified a dimmer or a trimer 132 bp repeats in pathogenic MDV-1 DNA from blood and organs of commercial chicken with symptoms of MD. Using the same primers in a radioactive PCR test, it was possible to distinguish between vvMDV-1 and the non-pathogenic MDV-1 (CVI-988 vaccine virus) in which, the 132 bp repeats were found more, i.e. up to nine repeats. The MDV-1 specific primers did not amplify MDV-2 (SB-1) and MDV-3 (HVT) DNA. They concluded that PCR test could be used for early identification of vvMDV-1 in pathological samples from diseased commercial chicken and to distinguish between the vvMDV-1 and three types of virus vaccines used to immunize chicken. Silva (1992) differentiated pathogenic and non-pathogenic serotype-1 MDVs by PCR amplification of the 132 bp tandem direct repeats within the MDV genome. The PCR reaction was specific for serotype-1 MDVs, amplifying fragments corresponding to one to three copies of the tandem repeats present in Md11/8, JM/102W and GA viruses. A high molecular weight DNA smear was observed when the DNA from an attenuated MDV (Md11/100) was amplified. The technique allowed the detection of two copies of the 132 bp repeats in the DNA extracted from MDV induced lymphomas removed from two chicken. No DNA was amplified from the DNA extracted from lymphomas induced by either Avian leukosis virus (RAV-1) or Reticuloendotheliosis virus (chick syncytial virus). In a similar study, Zhu et al. (1992) reported the differentiation of oncogenic and non-oncogenic strains of MDV type I by PCR, using primers chosen from the sequences within the long inverted repeats of MDV1 DNA. Oncogenic strain infected

cells and MD tumours cell lines produced a major product containing two or three copies of 132 bp repeats, whereas the non oncogenic strain infected cells yielded amplified products with various sizes corresponding to the number of 132 bp repeats. The primers chosen from the glycoprotein A genes of MDV1 and HVT were also used for determination of their serotype specificity. The PCR procedure was found to be simple and sensitive for identification of MDV1 and HVT, as well as for estimation of oncogenicity of MDV1. Becker et al. (1993) developed a radioactive PCR test that amplified vvMDV1 DNA sequence containing the 132 bp repeats. In apathogenic MDV-1 (CVI 988, Rispense), amplified DNA band containing multiple copies of 132 bp repeats were identified. PCR was also used to monitor the passage level of vvMDV-1 in chicken embryo fibroblast (CEF) cell culture, in which the number of tandem 132 bp repeats was found increasing. At passage level 32 of vvMDV-1 B isolate, the 132 bp tandem repeat was markedly amplified and its pattern resembled that of the MDV-1 (CVI 988, Rispense) vaccine virus. The PCR test demonstrated that a pathogenic MDV-1 Md11/75c virus passeged extensively in vitro had amplified 132 bp DNA repeats similar to those of the commercial vaccine viruses (CVI 988, Rispense). Davidson et al. (1995) reported the use of PCR for the diagnosis of natural infection of chicken and turkeys with MDV and Reticuloendotheliosis virus. Bumstead et al. (1997) described quantification of MDV in chicken lymphocytes using the PCR with fluorescence detection. The primers were tagged with fluorescent. The assay determines the numbers of viral genomes present in samples by PCR amplification of a portion of the viral genome for a restricted number of cycles. Fluorescent-tagged primers were used for the PCR amplification, which allows quantification of the fluorescent product. Sung et al. (1997) carried out a survey of MD in a broiler farm using PCR to detect pathogenic MDV. PCR was carried out using the primers chosen from sequences that flank the 132 bp tandem direct repeats. The size of major amplified products for DNAs of JM10 and 88-57 (a Korean isolate) was 460 bp, indicating that these viral DNA contained mainly two copies of 132 bp repeats. However, the amplified product of the DNA extracted from attenuated serotype-1 MDV (CVI 988 Rispense) was variable in size. Borenshtein and Davidson (1999) reported the development of a two-step PCR, the Hot Spot-combined PCR assay for the identification and characterization of recombinant viruses in Marek's disease(herpes) and retrovirus co-infections. Burgess et al. (1999) standardized quantitative duplex PCR technique for measuring the amount of cell-associated MDV. Reddy et al. (2000) developed a quantitative competitive PCR for the detection of MDV. The assay utilized a competitor DNA that differed from the viral DNA of interest by having a small insertion, which acted as internal standard for the estimation of viral DNA in an unknown sample. They found that a more virulent strain of MDV (648 A) replicated better in thymus during cytolytic infection than did a less virulent strain. Handberg et al. (2001) developed a method to detect serotype-1 and serotype3 MDV by specific PCR. The method was applied to various tissue samples from chicken experimentally inoculated with serotype-1 or serotype-3 MDV. The serotype-1 strains of CVI 988 and RB-1B could be detected in feather follicle epithelium upto 56 and 84 days post-inoculation (PI.) respectively, while the MDV-3 serotype was detected until 42 days PI. In addition the PCR was applied to the samples collected from four commercial table egg layer flocks of young stock or pullets vaccinated with either serotype-1 or serotype-3 (HVT) vaccine, which had various clinical signs of MD. MDV-1 was detected in buffy-coat cells, spleen, liver, skin, feather tips and

ovaries. The detection of MDV in feather tips appeared to be as sensitive as cocultivation of Buffy coat cells. Islam et al. (2001) studied the influence of vaccine deposition site on post vaccinal viramia and vaccine efficacy in broiler chickens following in ovo vaccination against Mareks disease. To detect the presence of MDV, in their experiments serotype-1 specific PCR was performed using DNA extracted from frozen PBV (Peripheral blood leucocytes). Islam et al. (2001b) investigated the factors that might influence the interpretation of PCR results in commercial broiler chickens including the effect of route of infection and HVT vaccination status. They also investigated the suitability of PBL and spleen as tissue samples for MDV detection. Over all data revealed that route of infection (intraperitoneal) verses inhalation had minor effects on the timings of subsequent MDV detection by PCR. Lee et al. (2001) in their study, demonstrated that plaque formation by cellfree MDV is inhibited by the addition of the soluble heparin to the cell culture . From their result they concluded that the MDV entry, at least in case of cell free MDV, is dependent on the presence of cell surface glycosamino glycans principally HS. Total cellular DNA was used for PCR to detect the MDV specific nucleotide sequence. The oligonucleotide primer specific to 132-bp direct repeat in the MDV genome, primers DR1 and DR2 were designed from the nucleotide sequence of strain GA (MDV-1) reported previously (Bradley et al., 1989). Davidson and Borenshtain (2002) aimed at examining the efficacy of amplifying MDV and / or ALV-J feather tip DNA as compared to DNA purified from liver and spleen. They found that the PCR for MDV and ALV-5 using DNA from feather tips was more effective for diagnosis of naturally infected commercial chicken than using the liver and spleen. Davidson et al. (2002) reported that MDV caused immunosuppression and tumours in chicken, but the turkey was an unusual host for the virus, and the tumours caused by MDV in turkeys were unique. They described the prevalence of turkey tumours in Israel between 1993 and 2000, their molecular diagnosis by PCR, and the natural distribution of HVT. Most clinical cases with tumours in commercial turkeys were diagnosed as MDV. The reproduction of MD in turkeys by two turkey MDV strains, Ar and La, was analyzed, and it was shown that these strains could induce tumours in experimental trials. Real time PCR provides a superior method to quantification of DNA, which has recently been used for quantification of the MDV genome. Levy et al. (2003) quantified MDV DNA in a cultured cell by duplex real time PCR using the host ovotransterin gene as an internal standard.They used a plasmid containing MDV IC P4 gene sequence as a standard and fluorescent PCR product were electrophoresed and quantified using the Applied Biosystems Genescan Software. Burgess and Daxision (2002) modified the method described by Burmstead et al. (1997) to measure the ICP4 gene and the chicken IFN- gene, as an internal standard in the same PCR, permitting comparison of samples in terms of MDV per equivalent number of cells. Islam et al. (2004) developed Quantitative real-time PCR (qPCR) assays for the three serotypes of MDV. An internal control qPCR assay that detected chicken 2 (VI) collagen gene was also developed to allow quantitation of MDV. To reduce cost and time, the assays for MDV1 and the internal control were combined into a duplex assay. The MDV qPCR assays were specific to their target gene when compared using Australian field and vaccine strains of MDV and 10 to 100 fold more sensitive than standard PCR Baigent et al. (2005) optimised and validated, real-time PCR to enable quantitation of MDV genomes as copy number per million host cells. The duplex PCR

measured the virus meq gene and host ovotransferrin gene in a single reaction, enabling correction for differences in amount of sample DNA added. A bacterial artificial chromosome (BAC) clone of the virus genome, and a plasmid (pGEM-Tovo) bearing a fragment of the chicken ovotransferrin gene, were used to quantify virus and host genomes respectively. This sensitive and reproducible assay was established initially using chicken lymphocyte DNA, then adapted for feather tip DNA by inclusion of bovine serum albumin in the reaction to overcome inhibition by melanin. The principal advantages are: (1) determination of absolute virus genome copy number enabling meaningful comparison between samples; (2) expression of copy number per million cells, allowing direct correlation with plaque assays; (3) using BAC-cloned whole virus genome as a standard potentially enables any virus gene to be used as the PCR target. This was the first report of quantitation of MDV genomes in feather tips, it was opined that application of this assay could significantly further our understanding of pathogenesis, spread, diagnosis, genetic resistance and vaccinal control of MD.

2.3 SEQUENCING AND GENETIC CHARACTERIZATION OF MDV GENOME

Mareks disease virus is a lineate double-stranded DNA with a molecular weight of Ca. 120 x 106. Cebrian et al. (1982) reported that the structure of MDV DNA and turkey Herpesvirus DNA were similar to that of herpes simplex virus types 1 and 2, in which, inverted repeat segments were detected at terminal and internal regions of the molecules by electron microscopy studies. A partial restriction map of the MDV DNA was designed by Lee et al. (1982), digestion with restriction endonucleases (RE) BamHI, BglI and SmaI and by blotting hybridization. The data suggested that there was a terminal heterogeneous sequence at least on one end of the MDV DNA molecule. The data did not reveal four different orientations of the terminal fragments of MDV DNA molecules despite the observation that MDV DNA contains inverted repeat sequences as also present in Herpes simplex virus (HSV) DNA molecules (Cebrian et al., 1982). (Terminal deletion of MDV DNA, SalI-H and I, was found in high passage number preparations.) Working in the same laboratory group Fukuchi et al. (1984) constructed the restriction map of MDV DNA (nearly completed). Purified virion DNA (120 x 106 molecular weight) of MDV strain GA was cleaved with BamHI and 27 out of 29 fragments were cloned into bacterial plasmids. Restriction maps for BamHI, BglI and SmaI endonucleases were constructed. The genomic structure of MDV DNA was found to be similar to that of Herpes simplex virus type 1 and 2. A unique long region (75 x 106 MW, located at 10 x 106 to 85 x 106 MW (10-85) from the left end of the genome) which was subdivided into segment 1 (22 x 106 MW located at 10-32) and segment 2 (51 x 106 MW, located at 34-85) by direct repeats (32-34), was flanked by a long terminal region (10 x 106 MW located at 103 111) and was plunked by a short terminal region (8 x 106 MW located at 111-119) and a short inverted region (8 x 106 MW located at 95-103). The direct repeat fragments (0.9 x 106) could be isolated by cleavage with SmaI. The right terminal end was found to be heterogenous. Silva and Witter (1985) described an EcoRI RE pattern of Md11 virus DNA, a very virulent strain of MDV. This was obtained by using total cellular DNA from the infected cells. With the EcoRI RE pattern and a published BamHI map of MDV (Fukuchi et al.. 1984), partial EcoRI map of series of MDV clones was constructed. The clones were used to identify a region of the Md11 genome, which was thought to get altered as the oncogenic virus gets passaged in vitro. The region was mapped into a 1.8 kb segment in the inverted repeat sequences flanking the unique long region of the virus genome. The alteration appeared to result from multiple DNA insertions that resulted in an increase of 0.6 to 5.4 kb. They concluded that although the expansion of

this region did not diminish the ability of MDV to replicate in vitro it might be associated with the loss of MDV. Hirai et al. (1981a) reported that serial passage of oncogenic MDV in culture resulted in structural changes of its DNA with loss of oncogenicity. In a similar study, the RE fragments BamHI-D and H produced in enzyme digest of oncogenic MDV DNA were lost at higher passage levels with loss of oncogenicity and were not found in the digest of standard nononcogenic MDV DNA (Hirai et al.1981b). Maotani et al. (1986) reported the amplification of a tandem direct repeats within inverted repeats of MDV DNA during serial in vitro passage, and found that DNA of the oncogenic strain BC-1 contained three units of tendem direct repeats and 132 bp segment in the terminal repeats and internal repeats respectively of the long region of the MDV genome, whereas the attenuated, nononcogenic viral DNA contained multiple units of the tendem direct repeats. Isfort et al. (1987) identified the gene encoding the Mareks disease herpesvirus A (MDHV-A) antigen. The gene encoding this glycoprotein precursor polypeptide Pr47 was delineated by using Northern blot (RNA blot) analysis and hybrid selection of its mRNA with cloned MDHV DNA, cell-free translation of the mRNA and immunoprecipitation of the polypeptide. The resulting piece of DNA with strongly positive hybrid selection was 2.2 kbp. PvuII EcoRI restriction fragment was localized to the centre of the 18.3 kbp MDHV BamHI-B fragment of the total viral genome. Bradley et al. (1989) studied the transcriptional activity of BamHI-H fragments of MDV after sequencing the BamHI-H region, confirmed the presence of 132 bp repearts which was responsible for the observed genomic expansion. The 132 bp repeat region was found to be of high transcriptional activity producing a diffuse signal upon hybridization with the 132 bp sequence or the 1.2 kpb SmaI PstI fragment. Strand specific hybridization studies revealed significant differences in the transcriptional patterns of the pathogenic and attenuated viruses. A RNA of 3.8 kb and an abundant RNA of 1.8 kb were produced by the pathogenic viruses but not by the attenuated viruses. The 1.8 kb family of transcripts contained only one small open reading frame, which may encode a protein of 63 amino acids. Silva and Barnett (1991) reported RE pattern of DNA from serotype-1 MDV to be unique to serotype-1 viruses, which could also be used to differentiate between low and high cell-culture passaged viruses, and suggested that the RE pattern provide a simple and accurate method to 1) differentiate between the three MDV serotype, and 2) differentiate between virus strains within serotype and 3) determine whether the viruses have been passaged extensively in cell culture. Camp et al. (1991) reported cloning, sequencing and functional analysis of MDV origin of DNA replication. A comparison of MDV replicon sequence with other herpesvirus replication origin sequences revealed a 90 bp sequence containing 72% identity to the lytic origin (oris) of Herpes simplex virus type 1.This 90 bp sequence displayed no similarity to beta herpes virus or gama herpesvirus replication origins. The 90 bp sequence was arranged as an imperfect palindrom centered around an A+T rich region. This sequence also contained a nine bp motif (5 CGTTCGCAC 3) highly conserved in alpha herpesvirus replicon origin. In conclusion, they stated that functional origin of DNA replicon showed similarity of MDV origin sequences to those of alpha herpesviruses and this supported the then contention that MDV is more closely related to alpha herpesviruses than to gama herpesviruses. Chen et al. (1992) identified MDV gene, which encodes a 38-kd phosphoprotein that expressed in both lystically infected cells and latently infected lymphoblastoid tumour cells. Through, cDNA and nucleotide sequencing analysis, an

open-reading frame (designated pp38 ORF), which encodes a predicted polypeptide of 290 amino acids was identified in BamHi-H. Parcells et al. (1995) constructed MDV mutant in RB113 oncogenic strain that is lacking six unique short (US) region genes. Deletion mutant contained the Lac gene of Escherichia coli inserted at si ect 4.5 kbp of US region DNA. The deletion removed MDV homologs to the US1, US2, and US 10 genes of herpes simplex virus type 1, as well as three KDV specific open reading frames. The author reported the construction of mutant MDV containing a similar deletion in US region of highly oncogenic RB1B strain. This mutant, RB1B 4.5 lac had growth impairment in established chicken embryo fibroblast culture, as it showed decreased early cytolytic infection, mortality, tumour incidence and horizontal transmission. Several lymphoblastoid cell lines were established from RB1B 4.5 lac induced tumours, and virus reactivated from these cell lines was lacZ+. These results indicated that the deleted genes are nonessential for transformation of chicken T cell or for the establishment and maintenance of latency. Ross et al. (1997) described that MDV EcoRI-Q gene (meq) and a small RNA antisense to ICP4 were abundantly expressed in CD4 cells and cells carrying a novel lymphoid marker, AV 37, in MD lymphomas. Mature lymphomas produced in Rhode Island Red (RIR) chicken infected with RB1B strain of MDV were examined for the presence of viral DNA and RNA and expression of viral antigens. In situ hybridization showed that all the tumours examined contained viral DNA in areas of lymphoid infiltration. In 3/5 tumours, there was a correlation between the number and distribution at cells expressing the MD EcoRI-Q gene (meq) and those that carried the lymphoid cell marker AV 37. Expression of the MDV-specific phosphoprotein pp38 was infrequent in lymphomas, but abundant in splenic tumour, which also expressed the viral glycoprotein g 13. Northern blot analysis at lymphocyte fractions purified by immuno affinity showed that CD4 and AV 37 fractions from lymphomas expressed meq and small RNA antigen se to ICP 4 (SAR). Katsumata et al. (1998) analysed the replication origin of MDV type 1 by using transient replication assay with plasmids containing various fragments of MDV strain Md5 genomic DNA. Plasmid pMBH, containing the BamHI-H fragment, showed replication activity in MDV-infected chicken embryonic fibroblasts (CEF). By deletion analysis of pMBH, two regions, the promoter enhancer region of the MDV pp 38 gene and the 132 bp tandem direct repeat, were shown to be required for replication activity. Replication of pMBH was not observed in uninfected CEF, suggesting that a trans-acting factors (s) encoded by the MDV genome was necessary for replication. Tulman et al. (2000) presented the first complete genomic sequence, with analysis of a very virulent strain of MDV serotype-1 Md5. The genome is 1,77,874 bp and was predicted to encode 103 proteins. MDV1 is a coline__ with the prototypic alpha herpesvirus herpes simplex virus type 1 (HSV-1) within the unique long (UL) region, and it is most similar at the amino acid level to MDV2, herpesvirus of Turkeys (HVT), and nonavian herpesviruses, equine herpesviruses 1 and 4. MDV 1 encodes 55 HSY-1 UL regions homologous together with six additional UL proteins that are absent in nonavian herpesviruses. The unique short (US) region is colinear with and has greater than 99% nucleotide identity to that of MDV strain GA. However, an extra nucleotide sequence at the Md5 US/short terminal repeat boundary results in a shorter US region and the presence of a second gene (encoding MDV 097) similar to SORF2 gene Md5, like HVT, encodes an ICP4 homologoas that contain a 900-amino acidamino-terminal extension not found in other herpesviruses. Putative virulence and host range gene products include the encoprotein MEQ, oncogenicity associated phosphoproteins pp38 and pp24, a lipase homalogve, a CxC chemokine, and unique proteins of unknown function MDV 087 and MDV 097 (SORF 2 homologues) and MDV 093 (SORF 4). Consistent with its virulent phenotype, Md5 contains only two

copies of the 132 bp repeat, which has previously been associated with viral attenuation and loss of oncogenicity. Silva et al. (2004) found that expansion of a unique region in MDV (132 bp repeats) genome occurs concomitantly with attenuation but is not sufficient to cause attenuation. Pathogenic MDVs have two head-to-tail copies of a 132-bp repeats. As MDV is serially passaged in cell culture, the virus becomes attenuated and the number of copies of the 132-bp repeat increases from two to often more than 20 copies. To determine the role of the repeats in attenuation, they used five overlapping cosmid clones that spanned the MDV genome to reconstitute infectious virus (rMd5). By mutating the appropriate cosmids, they generated clones of infectious MDVs that contained zero copies of the 132-bp repeats, rMd5(132); nine copies of the 132-bp repeats, rMd5(9-132); and nine copies of the 132-bp repeats inserted in the reverse orientation, rMd5(rev9-132). After two passages in cell culture, wild-type Md5, rMd5, and rMd5(132) were stable. However, rMd5(9-132) and rMd5(rev9-132) contained a population of viruses that contained from three to over 20 copies of the repeats. A major 1.8-kb mRNA, containing two copies of the 132-bp repeat, was present in wildtype Md5 and rMd5, but was not present in rMd5(132), rMd5(9-132), rMd5(rev9132), or an attenuated MDV. Instead, the RNAs transcribed from the 132-bp repeats region in rMd5(9-132) and rMd5(rev9-132) closely resembled the pattern of RNAs transcribed in attenuated MDVs. When inoculated into susceptible day-old chicks, all viruses produced various lesions. Thus, expansion of the number of copies of 132-bp repeats, which accompanies attenuation, is not sufficient in itself to attenuate pathogenic MDVs.

Fig. 2.1 Location of 132 bp repeats in MDV genome The MDV-1 viruses contain two copies of a 132-bp repeat, located in two separate parts of the genome. One pair of repeats is in the terminal repeat region (TRL) adjacent to the unique long region (UL). The other pair of repeats is inverted and located in the internal repeat (IRL) at the other end of the UL. The five overlapping cosmid clones are shown below the MDV genome and are aligned with the regions of the MDV genome from which they were cloned. The small bar in SN5 and A6 represents the location of the 132-bp repeats in these cosmids and their corresponding location in the TRL and IRL (Silva et al., 2004).

MATERIAL AND METHODS

CHAPTER - III MATERIAL AND METHODS

3.1
3.1.1

GENERAL MATERIAL

Glassware and Plasticware During course of the study, properly cleaned and neutral glassware (Corning/Borosil grade) and plasticware were used. Glassware and plasticware used for PCR and sequencing work were compatible with molecular biology work. 3.1.2 Chemicals, Buffers and Reagents Details of the chemicals, buffers and molecular biological reagents used during course of the study are given in Appendix. The reagents and chemicals used were of molecular biology grade and procured from Sigma, SRL, Merck etc. 3.2 INCIDENCE The data regarding incidence of Mareks disease (MD) in layer birds of 36 different private poultry farms (involving 49 batches of layer birds with a total population of 4,26,991 birds), situated in and around Anand district located in central Gujarat as well as from farms around Mahuva located in Saurashtra region, Gujarat, were collected by making personal visits to the different farms. The data regarding mortality, age at which the symptoms of the disease were observed and the total number of birds in the affected batches, were recorded considering the history and postmortem lesions suggestive of MD. The data were also recorded from Central Poultry Research Station (CPRS), College of Veterinary Science, A.A.U. Anand, with a population of 7417 birds. Data regarding incidence of MD by postmortem examination were collected from Department of Pathology, College of Veterinary Science, A.A.U., Anand, for the years 2000 to 2004. The aim of this exercise was to know the broader scenario of MD with regards to recent layer mortality in and around the Anand district, Gujarat.

3.3 DETECTION OF MDV BY PCR

3.3.1 Material 3.3.1.1 Clinical samples Clinical samples (n=34) for MDV detection by PCR were collected from layer birds (n=27). Minimum of five feathers were collected from an individual bird. Samples were collected (Table 3.1) from different commercial poultry farms located in Anand district as well as from CPRS, A.A.U., Anand, with a history of mortality and postmortem lesions suggestive of MD (Fig 3.1-3.3)

Table 3.1: Details of clinical samples collected from layer birds for MDV
detection. Location Private farms, Anand district CPRS AAU TOTAL No of birds screened 12 15 27 Type and No of samples collected Feather Spleen 8 9 17 8 9 17 Total 16 18 34

3.3.1.2 Reference MD viruses a) Lyophilized freeze-dried live HVT vaccine (HVT-126 ) obtained from the Division of Standardization, IVRI, Izatnagar, U.P. was used as the reference serotype-3 MDV (MDV-3). b) Cell free HVT vaccine commercially available from Ventri Biologicals Ltd., Pune. c) Cell associated HVT vaccine commercially available from Ventri Biologicals Ltd., Pune. d) Cell associated MDV-2 (serotype-2 MDV) vaccine commercially available from Ventri biologicals Ltd.,Pine.

3.3.1.3 DNA extraction a) From feather follicles i) Proteinase K (MBI Fermentas) ii) Proteinase K buffer (Appendix) iii) Proteinase K mixture (Appendix) iv) Sodium acetate (5M) (Appendix) v) Phenol: Chloroform: Isoamyl alcohol (Appendix) vi) Isopropanol vii) Ethanol (70%) b) From tissue samples DNeasy Tissue Kit (Catalog no. 69504, QIAGEN Pvt. Ltd) was obtained for extraction of DNA from tissue samples. The contents of the kit were as in Table 3.2. Table 3.2: Contents of the DNeasy kit Contents Quantity DNeasy Mini Spin Columns in 2 ml Collection Tubes 50 2 ml) collection tube 100 Buffer ATL 10 ml Buffer AL 12 ml Buffer AW1 (concentrate) 19 ml Buffer AW2 (concentrate) 13 ml Buffer AE 22 ml Proteinase K 1.25 ml Handbook 1 3.3.1.4 Polymerase Chain Reaction a) PCR Master mix (Catalog no. K0171, MBI Fermentas) containing i) 0.05U/l TaqDNA polymerase (recombinant) in reaction buffer, ii) MgCl2 (4mM) and iii) dNTPS (0.4 mM of each). b) Thin walled PCR tubes of 200 l capacity (Axygen) c) Gel loading buffer 6X d) Agarose gel (2%) Primers: Six pairs of primers were used for PCR amplification as per the details given e) in Table 3.3. Table 3.3: Details of the primers used for PCR Sr. No. Primer* BamH1 (F) BamH2 (R) AGA1 (F) AGA2 (R) AGAM1 (F)

Primer sequence
TACTTCCTATATAGATTGAGACGT GAGATCCTCGTAAGGTGTAATATA ATACCACGCCAACGAAAAGAATGT CTATAGTACATATTGCATACCCAT GAGGTACCTCATGGACGTTCCACA

Targeted gene location 2281123244

Expected amplicon Size (bp).

Reference Becker et al. (1992)

434

113197113882

686

100830101143

314

AGAM2 (R) P1 (F) P2 (R) M1.1 (F) M1.8 (R) HVT-1 (F) HVT-2 (R)

ACATTCTTTTCGTTGGCGTGGTAT CATGCAAGTCATTATGCGTGA TGTTTCCATTCTGTCTCCAGGA GGATCGCCCACCACGATTACTACC ACTGCCTCACACAACCTCATCTCC ATGGAAGTAGATGTTGAGTCTTCG CGATATACACGCATTGCCATACAC X686534222-472 717-964 113437113636 Islam et al. (2001)

199

247 Handberg et al. (2001) 505

*Primers BamH1/ BamH2, target nucleotide sequences flanking the 132 bp repeats in BamHIH and BamHI-D fragments of the MDV genome. Primers AGA1/AGA2 and P1/P2, target a nucleotide sequence in Antigen A gene (unique for MDV-1). AGAM1/AGAM2 primers target a nucleotide sequence in Antigen A gene (common to both MDV-1 & MDV3). Primers M1.1/M1.8 target a nucleotide sequence in ICP4 gene (unique for MDV-1). Primers pair HVT1/HVT-2 target a nucleotide sequence in US region (unique for MDV-3). 3.3.2 Method 3.3.2.1 Extraction of DNA from feather follicle Extraction of DNA from feather follicles was carried out as per the procedure described by Handberg et al.(2001). Briefly a) Proximal shaft of (about one cm) five feather follicles of different sizes collected from each chicken were shaken over night at 55 in 200l proteinase K mixture (Appendix)(400g/ml proteinase K) in proteinase K buffer (Appendix). b) To this 20l of 5 M sodium acetate and 200l of Phenol: chloroform: Isoamyl alcohol (Appendix) was added and mixture was centrifuged at 13000g for 15 min. c) The hydrophilic phase was transferred to 200l isopropanol and was centrifuge at 13000g for 15 min. d) Removed the supernatant and the DNA pellet was washed twice with cold (-200C) 70% ethanol for 10 min. by vortexing and subsequent centrifugation at 13000g for 15 min at 4C. e) Removed the ethanol and air dried the DNA pellet for 15-30 min. f) DNA pellet was dissolved in100l sterile purified water and left at room temperature for at least 30 min. g) Stored at -20C till further use.

3.3.2.2: Extraction of DNA from tissues

Extraction of DNA from tissue samples was carried out using DNeasy Tissue Kit as per the manufacturers protocol described below a) Spleen tissue (10 mg) was cut in to into small pieces and placed in a 1.5 ml microcentrifuge tube, to which 180 l Buffer ATL was added. b) Proteinase K (20 l) was added, mix by vortexing, and incubated wi8th occasional vortexin at 55C until the tissue was completely lysed. Lysis was usually complete in 3 hrs.. c) After the incubation, the mixture was again vortexed for 15 sec and. 200l Buffer AL was added to the sample, mixed thoroughly by vortexing and incubated at 70C for 10 min. d) To the mixture 200l ethanol (98-100%) was added and mix thoroughly by vortexing.

`e)

The mixture was pipetted into the DNeasy Mini spin column placed in two ml collection tube and centrifuged at 6000 x g (8000 rpm) for one min. The flowthrough and collection tube were discarded. f) The DNeasy spin column was placed in a new two ml collection tube. 500l Buffer AW1 was added and centrifuge at 6000 x g (8000 rpm) for one min. The flowthrough and collection tube were discarded. g) The DNeasy spin column was placed in a new two ml collection tube. 500l Buffer AW2 was added and centrifuged for three min at 20,000x g 14000 rpm ) to dry the DNeasy membrane. The flow-through and collection tube were discarded. During the centrifugation steps as in e), f) and g), the spin column was removed carefully to ensure that the column did not touch the flow-through, since it results in carryover of ethanol, affecting the elution process. h) The DNeasy spin column was placed in a clean two ml collection tube (not provided) and 200l Buffer AE was pipetted directly onto the DNeasy membrane. The mixture was incubate at room temperature for one min, and then centrifuged for one min at 6000 x g (8000 rpm) to elute. i) Elution step was repeated once as described in step h) and elute from step h. and step i) were collected in a separate tubes to prevent dilution of DNA. 3.3.2.3 Quantitation and Quality assessment of DNA Quality and purity of DNA were checked by submarine agarose gel electrophoresis using 0.8 percent agarose in 0.5X TBE (PH 8.0) buffer (Sambrook et al., 1989). Ethidium bromide (1 %) was added @ 0.5l /100ml. The wells were charged with 5l of DNA preparations mixed with IX BPB dye. Electrophoresis was carried out at 5V/cm for 20 min at room temperature and then the DNA was visualized under UV transilluminator. Quantity of DNA was calculated by spectrophotometric method. OD at 260 and 280 nm was taken in UV spectrophotometer with distilled water as reference. Purity of DNA was judged on the basis of optical density ratio at 260:280 nm. The samples with acceptable purity (i.e. ratio 1.7-2.0) were quantified using the following formula and used for PCR. Concentration (g/ml) = OD at 260 x dilution factor x 50 Where, 50 is concentration of dsDNA express in g/ml at OD of 1 PCR was carried out in a final reaction volume of 25 l using 200 l capacity thin wall PCR tube. A reaction mixture was prepared as per the details given in Table 3.4. PCR tubes containing the mixture were tapped gently and spun briefly. The PCR tubes with all the components were transferred to thermal cycler (Eppendorf Master cycler, Germany). The PCR protocol use for all the six pairs of primers designed (with slight modification of Becker et al.1992) for 31 cycles was as shown in Table 3.5.

3.3.2.4 Polymerase Chain Reaction

Table 3.4: Composition of reaction mixture for PCR

Sr. No. 1 2 3 4 Components DNase-RNase free water 2X PCR master mix Forward Primer (10 pmole/l) Reverse Primer (10 pmole/l) TOTAL 5 CDNA Template GRAND TOTAL Quantity 7.50 l 12.50 l 1.00 l 1.00 l 22.00 l 3.00 l 25.00 l Final Concentration -1X 10 pmole 10 pmole ----

Table 3.5: Steps and conditions of thermal cycling for PCR Sr. No. Steps Temp. Time Step 1 Initial denaturation 94C 1min Step 2 Denaturation 94C 1min Step 3 Annealing 55C 1min Step 4 Extension 72C 1min Step 5 31 cycles from step 2 to step 4 Step 6 Final Extension 72C 10min 3.3.2.5 Visualization of PCR product To confirm the targeted PCR amplification, five l of the PCR product from each tube was mixed with one l of 6X gel loading buffer and electrophoresed along with 50bp DNA molecular weight marker (Gene Ruler, MBI Fermentas) on 2.0% agarose gel containing ethidium bromide (at the rate of 0.5g/ml) at constant 80V for 30min in 0.5X TBE buffer. The amplified product was visualized as a single compact band of expected size under UV light and documented by gel documentation system (Syn Gene,Gene Genius BioImaging System,UK). 3.4 sequencing of bamh1/ bamh2primer amplified PCR product. 3.4.1 Material a) Two PCR products from samples M3 and M4 b) BigDye Terminatorv1.1Cycle Sequencing Kit with following components. i) Ready reaction premix ii) Big dye sequencing buffer (5X) iii) pGEM--3Zf(+) double stranded control DNA template c) Performance optimized polymer (POP-6TM) (Part No. 402837 Applied Biosystems, USA) d) Sequencing primer BamHI forward (Synthesized by Sigma Aldrich, Banglore, India) e) Ethanol f) EDTA 125mM g) Sodium acetate ( 3M) h) 70 % Ethanol i) Formamide (Sigma Aldrich, USA, Catalog No. F-9037) 3.4.2 Methods Cycle sequencing was performed following the instructions supplied along with BigDye Terminatorv1.1 Cycle Sequencing Kit. The reaction was carried out in a final reaction volume of 20l using 200l capacity thin wall PCR tube. A reaction mixture was prepared as per details given in Table 3.6. The tubes containing the mixture were tapped gently, spun briefly and then the tubes with all the components were transferred to thermal cycler. The cycling protocol (Table 3.7) was designed for 25 cycles with the thermal ramp rate of 10C per second. After the cycling the extension products were purified as described in the section 3.4.2.1 below. Table 3.6: Composition of reaction mixture for Cycle sequencing Sr. Final Components Quantity No. Concentration Ready Reaction Premix (2.5X) 1 0.5X 4 .00 l Big dye sequencing buffer (5X) 2 1X 2.00 l 3 4 5 Forward primer BamHI (3.2pmol/l) PCR product (30ng/l) Deionized water TOTAL 1 .00 l 5 .00 l 8.00 l 20.00 l 3.2 pmol 150 ng -

Table 3.7: Cycling protocol for sequencing reaction Sr.No. 1 2 3 4 Step Initial denaturation Denaturation Annealing Extension Temperature 94C 94C 55C 72C Time 5min 30sec 10sec 4min

3.4.2.1 Purification of extension products Before subjecting the extension products for electrophoresis through the POP-6 polymer filled capillary of automated DNA sequencer, the unincorporated dye terminators were removed complete by ethanol precipitation in presence of EDTA and sodium acetate as follows. a) The 20 l extension product was mixed thoroughly with 2 l of 125mM EDTA, 2 l of 3 M sodium acetate and 50l of 100% ethanol. DNA was allowed to precipitate by incubating the mixture for 15 minutes at room temperature. b) The precipitated DNA was pelleted by centrifuging at 11,000 rpm for 45 minutes at 40 C. c) The pellet was washed with 70 l of 70 % ethanol by centrifuging at 11,000 rpm for 15 0 minutes at 4 C. d) Finally the pellet was dried and resuspended in 20 l formamide. 3.4.2.2 Electrophoresis and data analysis Electrophoresis and data analysis were carried out on the ABI PRISM 310 Genetic Analyzer using appropriate Module, Basecaller, Dyeset/Primer and Matrix files. 3.4.2.3 Sequence analysis. The nucleic acid sequence obtained from the 132bp repeats PCR products were aligned with known sequences of 132bp repeats of MDV genome available in Genbank . The nucleotide sequences (excluding primer sequences) of both m3 and m4 samples 132 bp repeats located within BamHI-H and BamHI-D segment of viral genome amplified by PCR were aligned using the Clustal W programme (Thompson, 1994).

Fig 3.1: Photograph showing post mortem lesions of Mareks disease. Note the enlargement of spleen, tumorous growth in abdominal cavity.

Figure3.2: Photograph showing post mortem lesions of Mareks disease in liver of affected birds. Note the Lymphomas of liver.

Fig 3.3 : Photograph showing post mortem lesions of Mareks disease. Note the lymphomas in the heart.

3.5
i) ii) iii) iv) v) vi) vii) viii) ix) x) xi) xii) xiii) xvi)

LIST OF EQUIPMENTS
Some of the important equipments used for the present study were as below. Bench top refrigerated centrifuge Universal 30RF Hettich Zentrifugen, Germany Microcentrifuge Minispin, Eppendorf, Germany Micropipettes Finnpipette, Thermo Electron Corporation, USA Spectrophotometer UV/VIS Spectrophotometer Unicam, UK Thermocycler Eppendorf Master cycler, Germany Submarine gel electrophoresis apparatus Atto Corporation, Japan UV transilluminator Mini Transilluminator, Bio-Rad, USA Weighing balance BP 210 D, Sartorius, Germany Camera CT-1, Super Cosina, Japan Power pack Power pack 1000, BioRad, USA ATTO, Japan Gel documentation system Syn Gene,Gene Genius Bio Imaging System, UK Orbital Shaker S-03, Stuart Scientific,UK. Incubator Jouan, France Automated DNA SequencerABI PRISM 310 Genetic Analyzer. Applied Biosystems, U

RESULTS

CHAPTER IV RESULTS
4.1 INCIDENCE
During the period of June 2005 to November 2005, outbreaks of Mareks disease (MD) were suspected in flocks of egg type birds in farms situated around Anand district located in central Gujarat as well as from farms around Mahuva located in Saurastra region of Gujarat state. All the flocks were housed in cage system. Data were recorded in terms of the affected farms, flock strength, age of birds, months of outbreaks and mortality rates. The details are presented in Table 4.1 and Plate 4.1. The data regarding detection of MDV during the post morterm examination of layer birds were also collected from department of Veterinary Pathology Veterinary college A.A.U., Anand for the year 2000 to 2004 (Table 4.2). 4.1.1 Overall Incidence The strength of individual affected flock varied from 4500 to 25000 birds, with a total population of 4,26,991 birds. Of these, 14,110 birds died due to MD (as per the farm records of history, symptoms and post morterm lesions), with an over all mortality of 3.3 per cent during the months of June to November 2005. The outbreaks of MD appeared in a flock as young as 17 weeks of age and as old as 38 weeks age. The clinical symptoms observed in MD affected birds were characteristic of visceral form of MD. The post mortem lesions recorded were characteristic of MD involving tumours in different organs viz. liver, spleen, heart and in other organs (Fig 3.1-3.3). MD cases diagnosed during the year 2000 to 2004 (Table 4.2), indicated that the disease was quite prevelent in the area of Anand zone as majority of the cases brought to the Veterinnary College for post mortem, were from Anand area. In grower birds, the detection percentage ranged from 4.12 per cent to 9.07, per cent where as, it was quite high in layer birds ranging from 4.9 per cent in the year 2001 to 34.83 per cent in the year 2003. 4.1.2 Locationwise Incidence Out of 47,000 and 2,81,604 birds of the affected population in Anand zone, 1902 and 8854 died with mortality ratio of 4.04 and 3.14 per cent respectively during the months of June-August and Sept-Nov, 2005. For the Mahuva zone, 347 and 2432 birds died out of the population of 13,000 and 71,388, with mortality ratio of 2.66 and 3.44 percent, respectively. Out of 7,417 and 6,582 birds housed at CPRS during June-Aug and Sept-Nov. 2005, 371 and 204 birds died with mortality of 5.00 and 3.09 per cent, respectively (Table 4.1, Plate 4.1). During the investigation, a total of thirty six commercial poultry farms and forty nine batches of layer birds suffered from mortality due to MD, in addition to Central Poultry Research Station, Anand, where three batches of layer birds showed mortality. Mortality in commercial poultry farms ranged between 0.6 to 7.3 per cent. 4.1.3 Monthwise Incidence The data regarding MD incidence were collected in two time phases, i.e. June to August, 2005 and Sept to Nov, 2005. Out of the 67,417 and 3,59,574 birds housed at three locations during these two time phases, 2,620 and 11,490 birds died, with mortality rates of 3.88 and 3.10, percent respectively (Table 4.1, Plate 4.2).

4.2

DETECTION OF MAREKS DISEASE VIRUS BY PCR

A total of 34 clinical samples (17 feather follicles and 17 spleen ) from 27 birds suspected of MD were collected by making visits to the various poultry farms having mortality due to MD. Samples from the birds died due to MD in CPRS, and brought for postmortem at Department of Veterinary Pathology, College of Veterinary science and Animal Husbandry, A.A.U., Anand, were also included (Table 3.1). All the samples including the vaccines were processed for DNA extraction as described in sections 3.3.2.1 and 3.3.2.2. Purity of the extracted DNA was judged on the basis of optical density ratio. All the DNA

samples were found of acceptable purity (i.e. ratio 1.7-2.0) and were quantified using spectophotometric analysis as described in section 3.3.2.3. DNA samples showing concentration of 30 ng DNA per l were used for PCR amplification, using six sets of primers as outlined in Table 3.3. PCR amplified product and 50/100 bp DNA molecular weight marker (GeneRuler, MBI Fermentas) were electrophoresed on two per cent agarose gel and were visualized using gel documentation system (Syn Gene, Gene Genius Bio-Imaging system, U.K.). The size of the PCR amplicons was analyzed by comparing them with that of 50/100 bp molecular weight marker using Gene Tools computer software. 4.2.1. Detection by Primer (Bamh1/Bamh2) Amplifying 132 bp Repeats Out of 34 samples (17 feather follicles and 17 spleen tissues) tested for detection of MDV, 32 samples produced approximately 434 bp (double 132 bp repeats) amplicon, (Fig.4.1). Of the 17 feather follicle samples, 15 produced the targeted amplicons, where as, all the 17 spleen samples produced the amplicons of about 434 bp. All the three HVT vaccines as well as SB-1 (MDV-2) vaccine failed to produce the expected amplicons, there by proving negative for the targeted 132 bp repeats of MDV genome by the primers BamH1/BamH2. 4.2.2 Detection by UL44 Gene Based Primers Three different sets of primers were used from different regions of MDV UL44 gene, of which, one set of primer (AGA1/AGA2) is common to both MDV1 as well as HVT, while the other two (AGAM1/AGAM2 and P1/P2) are unique for MDV1. 4.2.2.1 Detection by primer (AGA1/AGA2) amplifying 686 bp fragment Out of 34 field samples tested, 32 samples plus three HVT vaccines produced approximately 686 bp amplicons. One vaccine SB-1 (MDV-2) failed to produce the expected amplicon. All the 17 feather follicles and 15 spleen samples tested, produced the expected amplicons of about 686 bp. Two spleen samples failed to produce the targeted amplicon (Fig 4.2). 4.2.2.2 Detection by primer (AGA M1/ AGA M2) amplifying 314 bp fragment Out of 34 samples tested for MDV, 30 samples were found positive producing the expected amplicons of approximately 314 bp. Fifteen samples each of feather follicles and spleen, produced the expected amplicons, while two samples each of spleen and feather follicle failed to produce the expected amplicon. Three HVT vaccines and one SB-1 (MDV-2) vaccine failed to produce the expected amplicon (Fig 4.2). 4.2.2.3 Detection by primer (P1/P2) amplifying 199 bp fragment Out of 34 samples tested for MDV, 30 samples were found positive producing the expected amplicons of approximately 199 bp. Fifteen feather follicles and fifteen spleen samples produced the expected amplicons, while two spleen and two feather follicles failed to produce the expected amplicons. Three HVT vaccines and one SB-1 (MDV-2) vaccine failed to produce the expected amplicon (Fig 4.3). 4.2.3 Detection by ICP4 Gene (unique for MDV-1) Based Primer (M1.1/M1.8) Amplifying 247 bp Fragment Out of 34 samples tested for MDV, 30 samples produced amplicons of approximately 318 bp (Fig. 4.4) instead of 247 bp product as described by Handberg et al. (2001). All the three HVT vaccines and SB-1 (MDV-2) vaccine did not produce any amplified PCR product. 4.2.4 Detection by US Gene (unique for MDV-3) Based Primer (HVT-1/HVT-2) Amplifying 505 bp Fragment Out of 34 clinical samples tested, two feather follicles, and all the three HVT vaccines produced the expected amplicons of 505 bp (fig. 4.4). The remaining 32 clinical sample and SB-1 (MDV-2) vaccine were found negative.

4.3

COMPARATIVE EFFICACY OF DIFFERENT PCR PRIMERS IN DETECTION OF MDV

A total of six primer pairs, including one pair (BamH1/BamH2) amplifying a 132 bp repeats within BamHI fragments of MDV, three pairs of primers (AGA1/AGA2, AGAM1/AGAM2 and P1/P2 ) amplifying different regions of Antigen A gene (UL44), one primer pair amplifying a fragment from ICP4 region of MDV-1 genome and one pair (HVT1/HVT-2) specific for MDV-3 (HVT) were used. A total of 34 clinical samples and four MDV vaccines were processed by all these six primer pairs (Table 4.3). Out of the six primer pairs, BamH1/ BamH2 and AGA1/AGA2, detected MDV in maximum number (32) of field samples. Primers AGAM1/AGAM2, P1/P2 and M1.1/M.1.8 detected the same number (30) of samples positive. Primer pair HVT-1/HVT-2 detected MDV-3 in two feather follicle samples (Table 4.4, Plate 4.3). Three HVT vaccines and one SB-1 (MDV-2) did not produce any amplification by primer pairs, BamH1/BamH2, AGAM1/AGAM2, P1/P2 and M1.1/M1.8, while all the three HVT vaccine samples produced the expected amplicons (686 bp) by primer pair AGA1/AGA2 and an amplicon of 505 by primer pair HVT-1/HVT-2. Where as SB-1 (MDV2) did not produce the expected amplification by any of the six primer pairs.

4.4

SEQUENCING OF (132bp repeats) PCR AMPLIFIEDPRODUCT

PCR products (434 bp) of MDV genome amplified by BamH1/BamH2 primers from two field samples having good quality DNA (i.e.1.7-1.9 OD at 260/280 nm) as determined by spectrophotometry were used for sequencing by ABI PRISM 310 Genetic Analyzer (Applied Biosystems, USA), using BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, USA). The sequences determined for 132 bp terminal repeats within BamHI segments of MDVgenome from both the samples are given in Fig 4.5.

4.5

SEQUENCE ANALYSIS

The nucleic acid sequences obtained from PCR products were aligned with known sequences of MDV published in GenBank. A 378 bp nucleic acid sequences within which a 132bp seequences appears twice (132bp repeats) were aligned with complete CDs published from BamHI gene family (Accesion no M26392) as well as tumourogenicity associated mRNA CDs (Accesion no M62573), HPRS-16 (Accesion no S58431) and complete genome of Md5 (Accesion no AF243438) and Md11BAC (Accesion no AY510475). The homology scores and sequence alignment for M3 and M4 field samples are presented in Table 4.5, Table 4.6, and Fig. 4.6 and Fig. 4.7, respectively. The homology between the field isolates was 97 per cent. The homology for the field isolates and published sequence was 100 per cent. Table 4.1: Incidence of MD in selected poultry population of Gujarat state No of birds No of birds died % mortality Location June September June September June to September to to to to to August November August November August November Anand zone 47000 281604 1902 8854 4.04 3.14 Mahuva zone 13000 071388 347 2432 2.66 3.44 CPRS 07417 006582 371 204 5.00 3.09 Sub-Total 67417 359574 2620 11490 3.88 3.19 Total 4,26,991 14,110 3.30

Table 4.2: Incidence of MD during PM examination Year Bird Total PM 2000 558 Grower Layer 1259 2001 Grower 560 Layer 750 2002 Grower 636 Layer 1494 2003 Grower 364 Layer 1424 2004 Grower 669 Layer 1309

% positive for MD 4.12 15.95 5.17 4.93 4.4 25.56 9.07 34.83 6.29 25.59

Table 4.3: Comparative efficacy of different primer pairs in characterization of MDV from field samples and vaccine viruses
Location Birds 1 2 3 4 5 6 7 8 9 10 Shivam navali 11 12 13 Sample details feather feather spleen spleen Feather Feather spleen spleen Feather Feather spleen spleen Feather Feather spleen spleen Feather spleen Feather spleen Feather spleen Feather Feather Feather Feather Primers BamH1/ Bamh2 + + + + + + + + + + + + + + + + + + + + + + + + AGA1/ AGA2 + + + + + + + + + + + + + + + + + + + + + + + + + + AGAM1 AGAM2 + + + + + + + + + + + + + + + + + + + + + + + + P1/ P2 + + + + + + + + + + + + + + + + + + + + + + + + M1.1/ M1.8 + + + + + + + + + + + + + + + + + + + + + + + + HVT-1/ HVT-2 + + -

Kailash Sarsa

Asha Sarsa

Nilam Vadod

14 CPRS VETY. COLLE. AAU, Anand

15 16 17 18 19

20 21 22 23 24 25 26 27 1 2 3 1

Feather Feather spleen spleen spleen spleen spleen spleen HVT HVT HVT SB1

+ + + + + + + + + + + +

+ +

+ + + + + + +

+ + + + -

+ + + + -

+ + + + -

Table 4.4 : Samplewise positivity by different primer pairs for detection of MDV Sr.no Type of No Found positive by primer pairs... M1.1/ sample tested BamH1/ AGA1/ AGAM1 P1/ HVT-1/
Bamh2 AGA2 17 15 32 AGAM2 15 15 30 P2 15 15 30 M1.8 15 15 30 HVT-2 02 00 2

1 2 3

Feather Spleen Total

17 17 34

15 17 32

Table 4.5 : Score table for alignment of 132bp repeats sequence of MDV field isolates M3 with sequence published in Gene Bank Seq Name of Length Seq Name of Length Score A Isolate/sequence (nt) B Isolate/sequence (nt) Md11BAC 1 M3 378 2 378 100 Md5 1 M3 378 3 378 100 BamHI-H fragment 1 M3 378 4 378 100 DNA from MSB-1 tumourogenicity 1 M3 378 5 378 100 associated mRNA Md11BAC Md5 2 378 3 378 100 BamHI-H fragment Md11BAC 2 378 4 378 100 DNA from MSB-1 tumourogenicity Md11BAC 2 378 5 378 100 associated mRNA BamHI-H fragment Md5 3 378 4 378 100 DNA from MSB-1 tumourogenicity Md5 3 378 5 378 100 associated mRNA BamHI-H tumourogenicity 4 fragment DNA 378 5 378 100 associated mRNA from MSB-1

Table 4.6 : Score table for alignment of 132bp repeats sequence of MDV field isolates M4 with sequence published in Gene bank Seq Name of Length Seq Name of Length Score A Isolate/sequence (nt) B Isolate/sequence (nt) 1 M4 378 2 Md11BAC 378 100 1 M4 378 3 Md5 378 100 tumourogenicity 1 M4 378 4 378 100 associated mRNA BamHI-H fragment 1 M4 378 5 378 100 DNA from MSB-1 1 M4 378 6 HPRS16 378 99 2 Md11BAC 378 3 Md5 378 100 tumourogenicity 2 Md11BAC 378 4 378 100 associated mRNA BamHI-H fragment 2 Md11BAC 378 5 378 100 DNA from MSB-1 2 Md11BAC 378 6 HPRS16 378 99 tumourogenicity 3 Md5 378 4 378 100 associated mRNA BamHI-H fragment 3 Md5 378 5 378 100 DNA from MSB-1 3 Md5 378 6 HPRS16 378 99 tumourogenicity BamHI-H fragment 4 378 5 378 100 associated mRNA DNA from MSB-1 tumourogenicity 4 378 6 HPRS16 378 99 associated mRNA BamHI-H 5 fragment DNA 378 6 HPRS16 378 99 from MSB-1

Figure 4.1: Agarose gel electrophoresis pattern of MDV 132 bp repeats specific PCR Products (approximately 434 in case of double 132 bp repeats) amplified with primer pairs BamH1/BamH2. M : DNA molecular weight Markers N : Negative control 1-6 : Field samples H : HVT vaccine

Figure 4.2 : (A) Agarose gel electrophoresis pattern of UL44 gene (common to MDV1 and HVT) specific PCR products (approximately 686 bp) amplified with primer pairs AGA1/AGA1.8. (B) Agarose gel electrophoresis pattern of MDV UL 44 gene specific PCR Products ( approximately 314 bp) amplified with primer pairs AGAM1/AGAM2. M : DNA molecular weight Markers 1-7 : Field samples N : Negative control

Figure 4.3 : Agarose gel electrophoresis pattern of MDV UL 44 gene specific PCR Products ( approximately 199 bp) amplified with primer pairs P1/P2. M : DNA molecular weight Markers 1-7 : Field samples N : Negative control

Figure 4.4 : (A) Agarose gel electrophoresis pattern of HVT (MDV 3) US region specific PCR products (approximately 505 bp) amplified with primer pairs HVT1/HVT2. (B) Agarose gel electrophoresis pattern of MDV ICP4 gene specific PCR products (approximately 318 bp) amplified with primer pairs M1.1/M1.8. M : DNA molecular weight Markers 1-4 : Field samples N H1-H3 : Negative control : HVT vaccine

Figure 4.5 : 132 bp specific sequence of MDV-1 from field samples (M3 and M4)

M3
GTAAGGTGTAATATAAGGGCACCTAAAACAGTTTCTAATCGAAAGCGTTACCGA ACTTGTCTTTAATGAGAATCCCTATGAGAAAGCGCTTGAATGTGGAAGTAGACAT AAAAACTTGTTTCGGCAGATCGTAAGCATTGCCGAACTCACATTTAATAAGGCGA GGCTCGTGTGAAGAACCCTAGCAAGGGCAGTTACAGAACATGCTCGCCGAGCAC CACCCCCTTGTGGAAGTAGACATAAAAACTTGTTTCGGCAGATCGTAAGCATTGC CGAACTCACATTTAATAAGGCGAGGCTCGTGTGAAGAACCCTAGCAAGGGCAGT TACAGAACATGCTCGCCGAGCACCACCCCCTTATTCCTCCATAGCACTTTC Reverse and complimentry--M3 GAAAGTGCTATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACT GCCCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAAT GCTTACGATCTGCCGAAACAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCT CGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGTTCTTCACACGAGCCTCGCCTT ATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAACAAGTTTTTATGTCTA CTTCCACATTCAAGCGCTTTCTCATAGGGATTCTCATTAAAGACAAGTTCGGTAA CGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATATTACACCTTAC

M4 TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCT AGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGA TCTGCCGAAACAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGC ATGTTCTGTAACTGCCCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATG TGAGTTCGGCAATGCTTACGATCTGCCGAAACAAGTTTTTATGTCTACTTCCACAT TCAAGCGCTTTCTCATAGGGATTCTCATTAAAGACAAGTTCGGTAACGCTTTCGA TTAGAAACTGTTTTAGGTGCCCTTATATTACACCTTACGAGGATCT

Figure 4.6: Alignment of 132 bp repeat sequence of MDV-1field isolate (M3) with Sequence published in Genbank.
M3 AY510475 AF243438 gb/M26392. gb|M62573. M3 AY510475 AF243438 gb/M26392 gb|M62573 M3 AY510475 AF243438 gb/M26392 gb|M62573 M3 AY510475 AF243438 gb/M26392 gb|M62573 M3 AY510475 AF243438 gb/M26392 gb|M62573 M3 AY510475 AF243438 gb/M26392 gb|M62573 M3 AY510475 AF243438 gb/M26392 gb|M62573 M3 AY510475 AF243438 gb/M26392 gb|M62573 GTAAGGTGTAATATAAGGGCACCTAAAACAGTTTCTAATCGAAAGCGTTA GTAAGGTGTAATATAAGGGCACCTAAAACAGTTTCTAATCGAAAGCGTTA GTAAGGTGTAATATAAGGGCACCTAAAACAGTTTCTAATCGAAAGCGTTA GTAAGGTGTAATATAAGGGCACCTAAAACAGTTTCTAATCGAAAGCGTTA GTAAGGTGTAATATAAGGGCACCTAAAACAGTTTCTAATCGAAAGCGTTA ************************************************** CCGAACTTGTCTTTAATGAGAATCCCTATGAGAAAGCGCTTGAATGTGGA CCGAACTTGTCTTTAATGAGAATCCCTATGAGAAAGCGCTTGAATGTGGA CCGAACTTGTCTTTAATGAGAATCCCTATGAGAAAGCGCTTGAATGTGGA CCGAACTTGTCTTTAATGAGAATCCCTATGAGAAAGCGCTTGAATGTGGA CCGAACTTGTCTTTAATGAGAATCCCTATGAGAAAGCGCTTGAATGTGGA ************************************************** AGTAGACATAAAAACTTGTTTCGGCAGATCGTAAGCATTGCCGAACTCAC AGTAGACATAAAAACTTGTTTCGGCAGATCGTAAGCATTGCCGAACTCAC AGTAGACATAAAAACTTGTTTCGGCAGATCGTAAGCATTGCCGAACTCAC AGTAGACATAAAAACTTGTTTCGGCAGATCGTAAGCATTGCCGAACTCAC AGTAGACATAAAAACTTGTTTCGGCAGATCGTAAGCATTGCCGAACTCAC ************************************************** ATTTAATAAGGCGAGGCTCGTGTGAAGAACCCTAGCAAGGGCAGTTACAG ATTTAATAAGGCGAGGCTCGTGTGAAGAACCCTAGCAAGGGCAGTTACAG ATTTAATAAGGCGAGGCTCGTGTGAAGAACCCTAGCAAGGGCAGTTACAG ATTTAATAAGGCGAGGCTCGTGTGAAGAACCCTAGCAAGGGCAGTTACAG ATTTAATAAGGCGAGGCTCGTGTGAAGAACCCTAGCAAGGGCAGTTACAG ************************************************** AACATGCTCGCCGAGCACCACCCCCTTGTGGAAGTAGACATAAAAACTTG AACATGCTCGCCGAGCACCACCCCCTTGTGGAAGTAGACATAAAAACTTG AACATGCTCGCCGAGCACCACCCCCTTGTGGAAGTAGACATAAAAACTTG AACATGCTCGCCGAGCACCACCCCCTTGTGGAAGTAGACATAAAAACTTG AACATGCTCGCCGAGCACCACCCCCTTGTGGAAGTAGACATAAAAACTTG ************************************************** TTTCGGCAGATCGTAAGCATTGCCGAACTCACATTTAATAAGGCGAGGCT TTTCGGCAGATCGTAAGCATTGCCGAACTCACATTTAATAAGGCGAGGCT TTTCGGCAGATCGTAAGCATTGCCGAACTCACATTTAATAAGGCGAGGCT TTTCGGCAGATCGTAAGCATTGCCGAACTCACATTTAATAAGGCGAGGCT TTTCGGCAGATCGTAAGCATTGCCGAACTCACATTTAATAAGGCGAGGCT ************************************************** CGTGTGAAGAACCCTAGCAAGGGCAGTTACAGAACATGCTCGCCGAGCAC CGTGTGAAGAACCCTAGCAAGGGCAGTTACAGAACATGCTCGCCGAGCAC CGTGTGAAGAACCCTAGCAAGGGCAGTTACAGAACATGCTCGCCGAGCAC CGTGTGAAGAACCCTAGCAAGGGCAGTTACAGAACATGCTCGCCGAGCAC CGTGTGAAGAACCCTAGCAAGGGCAGTTACAGAACATGCTCGCCGAGCAC ************************************************** CACCCCCTTATTCCTCCATAGCACTTTC CACCCCCTTATTCCTCCATAGCACTTTC CACCCCCTTATTCCTCCATAGCACTTTC CACCCCCTTATTCCTCCATAGCACTTTC CACCCCCTTATTCCTCCATAGCACTTTC **************************** 378 378 378 378 378 50 50 50 50 50 100 100 100 100 100 150 150 150 150 150 200 200 200 200 200 250 250 250 250 250 300 300 300 300 300 350 350 350 350 350

Figure 4.7 :Alignment of 132bp repeats sequence of MDV field isolate M4 with the sequence published in Gene bank
M4 AY510475. AF243438. M62573. M26392. S58431. M4 AY510475. AF243438. M62573. M26392. S58431. M4 AY510475. AF243438. M62573. M26392. S58431. M4 AY510475. AF243438. M62573. M26392. S58431. M4 AY510475. AF243438. M62573. M26392. S58431. M4 AY510475. AF243438. M62573. M26392. S58431. M4 AY510475. AF243438. M62573. M26392. S58431. TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGT TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGT TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGT TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGT TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGT TATGGAGGAATAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGCCCTTGCTAGGGT ************************************************************ TCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAA TCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAA TCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAA TCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAA TCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAA TCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTACGATCTGCCGAAA ************************************************************ CAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGC CAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGC CAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGC CAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGC CAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGC CAAGTTTTTATGTCTACTTCCACAAGGGGGTGGTGCTCGGCGAGCATGTTCTGTAACTGC ************************************************************ CCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTAC CCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTAC CCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTAC CCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTAC CCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTAC CCTTGCTAGGGTTCTTCACACGAGCCTCGCCTTATTAAATGTGAGTTCGGCAATGCTTAC ************************************************************ GATCTGCCGAAACAAGTTTTTATGTCTACTTCCACATTCAAGCGCTTTCTCATAGGGATT GATCTGCCGAAACAAGTTTTTATGTCTACTTCCACATTCAAGCGCTTTCTCATAGGGATT GATCTGCCGAAACAAGTTTTTATGTCTACTTCCACATTCAAGCGCTTTCTCATAGGGATT GATCTGCCGAAACAAGTTTTTATGTCTACTTCCACATTCAAGCGCTTTCTCATAGGGATT GATCTGCCGAAACAAGTTTTTATGTCTACTTCCACATTCAAGCGCTTTCTCATAGGGATT GATCTGCCGAAACAAGTTTTTATGTCTACTTCCACATTCGAGCGCTTTCTCATAGGGATT *************************************** ******************** CTCATTAAAGACAAGTTCGGTAACGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATAT CTCATTAAAGACAAGTTCGGTAACGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATAT CTCATTAAAGACAAGTTCGGTAACGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATAT CTCATTAAAGACAAGTTCGGTAACGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATAT CTCATTAAAGACAAGTTCGGTAACGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATAT CTCATTAAAGACAAGTTCGGTAACGCTTTCGATTAGAAACTGTTTTAGGTGCCCTTATAT ************************************************************ TACACCTTACGAGGATCT TACACCTTACGAGGATCT TACACCTTACGAGGATCT TACACCTTACGAGGATCT TACACCTTACGAGGATCT TACACCTTACGAGGATCT ****************** 378 378 378 378 378 378 60 60 60 60 60 60 120 120 120 120 120 120 180 180 180 180 180 180 240 240 240 240 240 240 300 300 300 300 300 300 360 360 360 360 360 360

Plate 4.1 Locationwise incidence of MDV

450000 400000 350000 300000 250000 200000 150000 100000 50000 0
426991 328604

No. of birds

Number of birds Number of birds died

84388 10756 2779 13999 575 14110

Anand zone

Mahuva zone

CPRS

Total

Location

Plate 4.2 Monthwise incidence of MDV

450000 400000 350000 300000 250000 200000 150000 100000 50000 0
426991 359574

Number of birds

Number of birds Number of birds died

67417 2620 11490 14110

June to August

September to November Time phase

Total

Plate 4.3 Samplewise positivity by different primer pair for detection of MDV
40 35
Number of samples

30 25 20 15 10 5 0 Feather Spleen Total

Type of sample

No tested Found positive by Found positive by Found positive by Found positive by Found positive by Found positive by

primer pairs... BamH1/ Bamh2 primer pairs... AGA1/ AGA2 primer pairs... AGAM1 AGAM2 primer pairs... P1/ P2 primer pairs... M1.1/ M1.8 primer pairs... HVT-1/ HVT-2

DISCUSSION

CHAPTER- V DISCUSSION
Mareks disease (MD) is a lymphoproliferative disorder of chicken characterized by oncogenic transformation of T cells that infiltrate lymphoid tissues, peripheral nerves and visceral organs, resulting in a complex pathogenesis that usually leads to death of the affected birds. The disease is named after Professor Jozef Marek, who described it nearly a century ago (Marek, 1907) as a polyneuritis. The causative agent of MD, a cell associated herpesvirus, was discovered and isolated in cell culture by Churchill and Biggs (1967). Soon after the isolation of MDV type 1 (MDV-1) the first vaccine became available based either on highly passaged attenuated MDV-1 (Churchill et al., 1969) or on the serologically related herpesvirus of turkey (HVT) serotype 3 of MDV like viruses (Okazaki et al., 1970). MDV-1 is an evolving pathogen, and vaccine viruses do not completely prevent the infection by oncogenic field MDV-1 viruses, thus creating an environment for natural selection of more virulent viruses. From the classification point of view, three serologically related but distinct viruses; MDV-1, MDV-2 and HVT have been recognized. The latter two viruses are non-oncogenic. Within MDV-1, there are categorized viruses of varying pathogenicity and their attenuated derivatives. Pathogenicity of MDV-1 viruses has been based on their ability to break protection induced by various vaccine formulations (Witter,1997). MD induced by virulent pathotype strains emerging in 1950s was successfully protected by HVT, the very virulent strains break the HVT vaccination barrier, and very virulent plus strains are capable of causing MD in chickens immunized with bivalent vaccine (vaccine based on a mixture of MDV-2 and HVT). Belonging also to serotype-1 are viruses with naturally low pathogenicity such as CV1988, also commonly called Rispens (Rispens et al., 1972), derivatives of which have been serving recently as the best protecting MD vaccines (Zelnik, 2003). MDV is ubiquitous and very frequent in almost all poultry population raised under commercial conditions (Buscaglia et al. 2004). In India, `Sharma and co-workers reported the skin form of MD in naturally as well as experimentally infected birds in 1972. In the same year, Varia and co-workers reported that cases of MD were on increasing trends in Gujarat. Dave (1989) studied the outbreaks of acute form of MD in five successive flocks of WLH birds at Poultry Complex of Gujarat Agricultural University, Anand and reported the mortality due to acute MD ranging from 12.30 to 30.09 per cent. Mishra et al. (1994) carried out seroprevalence study on MD in different breeds of layer and broiler birds mainly Hubbard, Babcock, Cobb, Austrolop and Kalinga Brown. Among 455 suspected serum samples collected and screened by AGPT, the overall rate of MD prevalence was found to be 21.97 per cent. The rate of incidence in Hubbard breed was found maximum i.e. 27.5 per cent, whereas in Cobb breed, it was 2.5 per cent. Posia (2003) at this Institute, screened ten serum and ten feather follicle samples from each of the 20 selected commercial broiler farms in Gujarat, India, for MDV specific antibodies and antigens respectively, against known standard MDV antigen and antisera by AGPT. The overall seroprevalence of MD was found to be 7.5 per cent (15/200). Based on detection of MDV antigen from the feather follicles, the overall prevalence of MD precipitinogen was found to be 14.5 per cent (29/200). Despite the elaborate established guidelines for the pathological diagnosis of MD, diagnosis of the clinical disease remains difficult in practice for several reasons. First, no truly pathognomonic gross lesion exists for MD. Gross lesions of MD can resemble those of other neoplasm and unrelated conditions characterized by tumour in visceral organs or grossly enlarged nerve. And lastly, MDVs, Avian leucosis viruses (ALVs) and Reticulo Endothelial viruses (REVs) are wide spread in commercial poultry, often resulting in simultaneous

infection (Davidson and Borenstein, 1999), complicating the diagnostic efforts that depend on virological methods. Technique for diagnosis of MDV infection is isolation and identification of MDV from the infected tissues. Virus isolation is usually by virus propagation in cell culture and identification/quantification by cytopathic changes (plaque formation) or identification of infected cells by immunostaining (De Laney et al. 1998). Polymerase chain reaction (PCR) has emerged in recent years as an additional diagnostic tool offering advantages of serotype specificity (Davison et al., 1995,) and the ability to differentiate between vaccinal and wild strains of MDV serotype-1 (Becker et al., 1992, Silva, 1992, Handberg et al., 2001). The above points formed the basis for present study on MDV. The study focused mainly on following areas. 5.1 Incidence of MD as recorded on the basis of clinical signs and post mortem lesions observed by concerned veterinarian. 5.2 Detection of MDV from clinical cases exhibiting frank lesions of MD by PCR technique. 5.3 Comparing the efficacy of different primers in detecting MDV from clinical samples. 5.4 Sequencing of PCR amplified fragment carrying 132bp repeats MDV genome. 5.1 INCIDENCE Under present investigation, the strength of individual affected flocks involved, varied from 4500 to 25000 birds with a total population of 4,26,991 birds. Of these, 14110 birds died due to MD (as per the farm records of history, symptoms and postmorterm lesions) with an over all mortality of 3.30 per cent. during the months of June to November 2005. Mortality percentage was 3.8 during June to August 2004, and 3.19 during the next three months. Though, the per cent mortality decreased compared to perivious three months, number of farms affected and the number of birds died had increased to the tune of 4-5 times. As such, poultry population in Anand zone was 30 lacks (aproximately) and that of Mahuva zone was six lacks (aproximately) for layer type birds. The outbreaks of MD appeared in a flock as young as 17 weeks of age and as old as 38 weeks age. The clinical symptoms observed in MD affected birds were characteristic of visceral form of MD. The post mortem lesions recorded were characteristic of MD involving tumours in different organs viz. liver spleen, heart and in other organs (Fig 3.1-3.3). In Gujarat, MD was first reported by Varia et al.. (1972). They found that on each farm under the study, five to 60 per cent birds were found ailing, showing various symptoms suggestive of MD. On an average, mortality ranged from five to 30 per cent in older age group and in younger age group rarely less than 15 per cent, which was commonly 20-30 per cent and sometimes as high as up to 60 per cent. During present study, the mortality reports were collected from different farms on the basis of PM lesions suggestive of MD. It was found that mortality in a commercial farm ranged between 0.6 to 7.3 per cent and in the organized farm, it was between zero to 20.5 per cent in a particular month. The mortality figures for MD reported by different workers were five per cent (Rao and Sharma, 1984), five to 10 per cent (Grewal and Singh, 1973), five to 20 per cent (in general) and 45 per cent in two farms ( Grewal et al., 1980), 10 to 60 per cent (Sharma et al., 1977) and 38.4 per cent (Adelekha, 1980). Dave (1989) reported mortality due to MD at CPRS, Anand. Among all the five flocks at CPRS, mortality was maximum in AKP (32.09 %) flock, followed by RBCP (22.37 %), AICRP (19.67 %), CPRS (14.69 %) and RRS (12.30 %) flocks. Very recently, Posia (2003) reported overall seroprevelance rate of MD in broiler birds to the tune of 14.5 per cent. There was a striking difference in mortality pattern observed in commercial farms and the organized farm under the study. Though the total number of birds were less in the organized farm, overall mortality was quite high, up to five per cent, where as the mortality in commercial farms was comparatively low even though the flock size was big. One major

managemental difference found was that all the commercials farms were vaccinated by dual vaccination i.e. MDV-2 and HVT, where as the organized farm (CPRS) under the investigation, was vaccinated only with HVT vaccine. The three major pathotype shifts as described by Witter (1998a, 1998b) are From MDV to virulent MDV (vMDV) in the late 1950 (successfully protected against by HVT) From vMDV to very virulent MDV (vvMDV) in the late 1970 (break the HVT vaccination barrier) The appearance of putative vv+ pathotypes in the early 1998 (very virulent strains break the HVT+MDV2 vaccination barrier, and very virulent plus strains are capable of causing MD in chicken immunized with bivalent vaccine (vaccine based on a mixture of MDV-2 and HVT). Considering the above facts, MD losses were much higher in commercial farms than expected, in spite of practice of bivalent vaccination protocol. Hence it is logical to believe that the field outbreaks of MD were due to vvMDV. This was further substantiated by the result of PCR (as discussed under the section 5.2), as out of 34 samples of feather follicles and spleen collected, 32 were found positive, suggesting towards the increase in the virulence of MD viruses as described by Witter (1998a, 1998b). On the basis of maximum involvement of visceral organs and minimum involvement of nerves in the affected birds of all the commercial as well as organized farms, the present outbreaks might be categorized as acute or visceral form of MD. DETECTION OF MDV The traditional diagnosis of MD is based on the clinical signs and pathological alteration. However, more specific methods for surveillance of MDV would be desirable. The detection of viral antigen in the feather follicle epithelium by agar gel precipitation test has been described by Haider et al. (1970). The different serotypes can be differentiated by the agar gel precipitation test (Lee et al., 1983), but the sensitivity of the test is inferior to that of Enzyme linked immunosorbent assay (ELISA) and DNA hybridization (Davidson et al., 1986). Virus isolation is usually by virus propagation in cell culture and identification/quantification by cytopathic changes (plaque formation) or identification of infected cells by immunostaining (De Laney et al., 1998). Polymerase chain reaction (PCR) has emerged in recent years as an additional diagnostic tool offering the advantages of serotype specificity (Davidson et al., 1995,) and the ability to differentiate between vaccinal and field strains of MDV serotype-1 (Silva, 1992, Zhu et al., 1992, Handberg et al., 2001). PCR not only provides a sensitive way to detect the virus in low concentration but also forms the basis for further genetic characterization studies like gene sequencing. PCR was therefore used in the present study using six pairs of different primers targeting different gene segments for their comparative efficacy. 5.2.1 Detection by Primers Unique to the 132bp Repeats In BamH1-H Region The importance of BamHI-H region in the pathogenesis of MDV was initially pointed out, when it was shown that there was an increase in the number of copies of 132 bp repeats within the BamHI-H region of IR (Inverted repeats) as a result of attenuation by cell culture passage (Silva and Witter, 1985). A PCR based on primer flanking 132 bp repeat sequence located within the BamHI-H fragment in pathogenic MDV-1 DNA was developed by (Becker et al., 1992). The primers were selected from the nucleotide sequence flanking 132bp repeat sequence located within the BamHI-H fragment published by (Bradley et al., 1989). The direct primer is located 65 bp 5 to the tandem132 bp repeats, the reverse primer is 105 bp downstream of 132 bp repeats. Altogether, the expected amplified DNA band size in case of double 132 bp repeat is 434 bp. 5.2

In present study, 34 clinical samples from layer birds were tested by PCR using the primers described by Beckar et al. (1992). Out of 32 positive samples, 15 samples were from commercial poultry farms and 17 samples were from the organized (CPRS) farm. All the birds, which were showing the MD symptoms were vaccinated on day one by HVT (MDV-3) vaccine, from different commercial vaccine producing companies. More over the birds from commercial poultry farms were vaccinated with SB-1 (MDV-2) vaccine also. However, the birds of CPRS were vaccinated only with HVT vaccine. But the PCR amplified product from all the positive cases did not differ in the band size i.e. 434 bp irrespective of single or double vaccination status. Same way, PCR product either from feather follicle sample or spleen sample also did not differ in band size i.e. 434 bp. Hence it is logical to believe that all the positive samples by this primer pair had double 132 bp repeats. This was also confirmed by sequencing two representative samples (PCR product) as in section 5.4. Silva (1992) differentiated pathogenic and non-pathogenic serotype-1 MDV by amplification of the 132 bp tandem repeats within the MDV genome. The PCR was specific for serotype-1 MDV amplifying fragments corresponding to one to three copies of tandem repeats present in MD11/8, JM/02 and GA viruses. The PCR assay could detect two copies of the 132 bp repeats in the DNA extracted from MDV induced lymphomas removed from chicken. Similar observation was made by Becker et al. (1992), when DNA extracted from spleen and liver of MDV infected birds revealed dimmer tandem 132 bp repeats. In five of the MDV-1 isolates, one DNA fragment was amplified. This fragment corresponded to an amplification of two tandem repeats of 132bp yielding a DNA band of 453 bp (264 bp plus 189 flanking tandem repeats). These five isolates with two 132bp repeats were from commercial flocks affected with number of lymphomas in the internal organs or from experimentally infected SPF chicken. To substantiate the finding, Backer et al (1993) used the same PCR (i.e. amplification of 132 bp repeats) in MDV type-1 as an indicator for critical genomic rearrangement leading to the attenuation of virus virulence. In a similar study, Zhu et al. (1992) differentiated the oncogenic and non-oncogenic strain of MDV-1 by primer chosen from the sequence within the long inverted repeats of MDV-1 DNA. Oncogenic strain infected cell and MD tumour cell line produced a major product containing two or three copies of 132 bp repeats. This was also similar to our finding i.e. we found two 132 bp repeats from the field samples indicating the presence of serotype-1 of MDV. Using the same 132bp fragment, in amplification Sung et al. (1997) carried a survey on MD in a broiler farm. The size of major amplified products for DNA of JM10 and 88-57 (Korean isolates) was 460 bp indicating that these viral DNA contained mainly two copies of 132bp repeats. Bradley et al. (1989) suggested that the open reading frame (ORF) in the BamHI-H DNA fragment of vvMDV-1, which contains the 132 bp as an intron, produces a spliced 1.8 kb mRNA species that can be translated in to a protein containing 63 amino acids. This ORF has homology to the retroviruses-related gag polyprotein and a kinase-related transforming protein. This along with the findings of Becker et al. (1992), Becker et al (1993) and the present study allowed to follow the genetic changes in vvMDV-1 DNA, enabling the detection of the change in the 132 bp repeats that can be correlated with either increase/decrease in MDV virulence. The technique allowed us to detect specifically MDV-1 from the MD affected birds which were vaccinated either with MDV-3 (as in CPRS farm) or with the dual vaccination by MDV-3 and MDV-2 (as in commercial farms) 5.2.2 Detection by Primers Unique to Antigen A Gene (UL44) Churchill and co-workers (1969) identified two glycoproteins by AGP test, the soluble A antigen, and cell bound B antigen, which are now known as gC and gB respectively.The UL44 gene encodes for gC, a 57-65 KD glycoprotein identified in early references as gA, which is extensively synthesized in productively the infected cells and is expressed on the cell surface and cytoplasm. In addition, gC is actively secreted by the

infected cells. A gC deletion mutant had an attenuated phenotype with decrease in infectivity, horizontal transmission and oncogenicity (Lee et al., 1978). Beeker et al. (1992) used the nucleotide sequence of MDV-1 Antigen A gene with little or no homology to nucleotide sequence of Antigen A gene of MDV-3 (HVT) and on the basis of these primers, they differentiated the pathogenic and non-pathogenic MDV-1 serotypes and vaccine viruses of MDV serotype-2 and serotype-3. In present investigation, we found that primer (AGAM1/AGAM2), which is unique for MDV-1, did amplifiy the 314 bp product from the field sample (30 out of 34) which were also positive for MDV-1 by primer BamH1/BamH2. But, no DNA fragment was amplified from MDV-3 DNA (HVT vaccine) or MDV-2 DNA (SB-1 vaccine). This is similar to the finding reported by Becker et al. (1992). Similarly, primer AGA1/AGA2 amplified 686 bp repeat from MDV-1 genome as well as from MDV-3 (HVT vaccine), but no DNA fragment was amplified from MDV-2 (SB1) vaccine, which indicated that this primer pair was also specific for MDV-1 and HVT but not to MDV-2. This observation was similar to the result obtained by Becker et al. (1992) using the same set of primers. As we had two sets of primers targeting antigen A gene, AGA1/AGA2, which is common to both MDV-1 and MDV-3 (686 bp product) and AGAM1/AGAM2 (314 bp product), which is unique to MDV-1, both the primers amplified the DNA from the respective serotypes. But, no DNA was amplified from MDV-2 (SB-1) DNA, thus indirectly ruled out the possibility of presence of MDV-2 virus in the affected birds. As we have not used a primer set, which specifically amplify MDV-2 (SB-1) DNA ruling out the presence of MDV2 in the field samples needs to be confirmed in future using the specific primers. Further, we have also used another set of primers (P1/P2), amplifying the UL44 gene (antigen A) fragment from MDV-1. The primers amplified a product of 199 bp (approximately), in 30 out of 34 clinical samples tested. The results of the primers are very similar to the primers AGAM1/AGAM2, that also amplified the product from UL44 gene of MDV-1. The primer pair P1/P2 was used by Islam et al. (2001b) to detect the effect of route of infection and HVT vaccination status on detection of virus from blood or spleen by PCR. Same primer set was used by Islam et al. (2001a) to study the influence of vaccine deposition site on post vaccinal viremia and vaccine efficacy in broiler chicken following in ovo vaccination against MD in broilers. The primers P1 / P2 in the present study were also found to be unique for MDV-1 and it did not amplifiy DNA either from HVT or SB-1 vaccine samples. Further, personal communication with Islam (2005) confirmed the uniqueness of the primers in detection of MDV-1. 5.2.3 Detection by Primers Unique to ICP4 gene. The ICP4 gene belongs to a major category of genes in MDV classified or grouped under Genes with Homologoues in alpha herpesviruses. This is a broad category of genes further divided in to immediate early (IE), early and late genes, which are with few exception important for virus replication. Out of four IE gene identified, Anderson et al. (1971) described intracellular protein (ICP4) as a 4245 bp ORF, but sequencing data indicated the presence of ORF of 6969 bp (Witter and Schat, 2003). Proof that ICP4 protein is transactivator, was provided by transfection of the MD cell line MSB-1 with the short form of ICP4. This experiment showed increased transcription of PP38 and PP24 genes (Pratt et al., 1994). The primer to amplify ICP4 fragment of MDV-1 was desired as per the sequence published by Handberg et al. (2001). In present study, 34 samples were tested for presence of MDV-DNA using the same primers i.e. M 1.1 / M 1.8. To our surprise, instead of 247 bp product size, which was expected from a positive sample, all the 30 positive samples yielded a product of 318 bp i.e. a difference of 71bp. To confirm our result, we took the help of NCBI facilities. Taking forward and reverse primer sequences, we did Nucleotide Nucleotide blast and it was found that

(Table 5.1) there was more chance to get the PCR fragment of about 318 bp. From the Table it is evident that the targeted product of 318 bp is very likely and further they are located in ICP4 region of MDV only. The most possible reason for this could be that, one of the primers might be capable of annealing to more than one site on the DNA. Table 5.1: Nucleotide nucleotide BLAST of primer Unique to ICP4 gene of submitted MDV sequences LOCATION of ICP4 141467-148438 164315-171286 154120-161085 143804-150769 167675-174640 10524-10070 LENGTH (bp) 6971 6965 454

ACCESION NO gb/AF14806.2 gb/AY510475.1 gb/AF243438.1 gb/UI17701.1 5.2.4

LOCATION 145079-145397 167651-167379 157726-158044 147410-147728 171034-170716 717-964

LENGTH 318 318 318 318 318 247

Detection by primers specific to HVT Out of 34 clinical samples tested, two feather follicles, and all the three HVT vaccines produced the expected amplicons of 505 bp (Fig. 4.4). The remaining 32 clinical samples and SB-1 (MDV-2) vaccine were found negative. The primer pair was selected to know the probable shading of the vaccine virus in the vaccinated flock. Because the efficacy of vaccination is related inversely to the amount of virulent virus that can be detected, or in other words, if vaccination is effective, one can not detect the virulent virus (personal communication Davidson 2005). Using the same primer set Handberg et al. (2001) detected the presence of HVT by screening all the three strains of MDV. They subjected seven strains of MDV-1, two strains of MDV-2 and one strain of HVT (FC-126) for PCR amplification using the primer set HVT-1 / HVT-2 and the amplified 505 bp fragment only in HVT but not in other strain. COMPARATIVE EFFICACY OF DIFFERENT PCR PRIMERS IN DETECTION OF MDV A total of six primer pairs, including one pair (BamH1/BamH2) amplifying a 132 bp repeats within BamHI fragments of MDV, three pairs of primers (AGA1/AGA2, AGAM1/AGAM2 and P1/P2) amplifying different regions of Antigen A gene (UL44), one primer pair amplifying a fragment from ICP4 region of MDV-1 genome and one pair (HVT1/HVT-2) specific for MDV-3 (HVT) were used. A total of 34 clinical samples and four MDV vaccines were processed by PCR using these six primer pairs (Table 4.3,Table 4.4, plate 4.3). Out of the six primer pairs, BamH1/ BamH2 and AGA1/AGA2, detected MDV in maximum number (32) of field samples. Primers AGAM1/AGAM2, P1/P2 and M1.1/M.1.8 detected the same number (30) of samples. Two more samples positive by Bam H1/ Bam H2 could be assigned to MDV-1, whereas two other samples positive by AGA1/AGA2 where also positive by HVT-1/HVT-2, and this was possible as AGA1/AGA2 is specific to both MDV-1 and MDV-3. Hence, Bam H1/ Bam H2 proved to be the most sensitive primer in detecting MDV-1. Primer pair HVT-1/HVT-2 detected MDV-3 in two feather follicle samples (Table 4.4). Important point here is that out of 32 samples showing positive result, two samples were only positive with HVT1/HVT2 and this set of primer is unique for MDV-3 (HVT), where as, AGA1/AGA2 amplified the product in both viruses MDV1 and MDV3. This implies that the 5.3

two addtional positive samples as compared to AGAM1/AGAM2, P1/P2 and M1.1/M1.8 most probably contained only HVT vaccine virus. Three HVT vaccines and one SB-1 (MDV-2) did not produce any amplification by primer pairs, BamH1/BamH2, AGAM1/AGAM2, P1/P2, and M1.1/M1.8, while all the three HVT vaccine samples produced the expected amplicons (686 bp) by primer pair AGA1/AGA2 and an amplicon of 505 bp by primer pair HVT-1/HVT-2. SB-1 (MDV-2) did not produce expected amplification by any of the six primer pairs used. The literature appeared scanty with regards to comparative evaluation of different primers for MDV detection, however, a very few workers have attempted similar approach for herpesvirus. Mendez et al. (1998) carried out evaluation of PCR primers for early diagnosis of Cytomegalo virus infection following liver transplantation. The performance characteristics in terms of the sensitivity of primers for amplifying CMV DNA associated with symptomatic infection ranged from 100% (HindIII-X) to 20% (MIE gene); however, specificity was inversely related (HindIII-X, 45%; MIE gene, 91%) to primers directed to these gene targets. 5.4 SEQUENCING STUDY Genetic and gene expression studies require information on the primary structure of genome. Restriction enzyme and southern blotting analyses provided the first evidence that MD viruses of individual serotype have distinctly different restriction enzyme patterns ( Igarashi et al. 1987). The restriction endonucleause fragments BamHI-D and H in enzyme digest of oncogenic MDV DNA were lost at higher passage level with loss of oncogenicity and the fragments were not found in the digest of standard non-oncogenic MDV DNA (Hirai et al., 1981). Subsequently, Silva and Witter (1985) reported the genomic expansion of MDV to be associated with serial in vitro passages. This was followed by a report in 1985 by Maotani et al. (1986) who studied the amplification of tandem direct repeat within Inverted Repeats of MDV DNA during serial in vitro passages. These oncogenic strain specific fragments share homology with the DNA fragments with heterogenous electric mobilities of non-oncogenic MDV at higher passage level in culture, which were larger than BamHI-D and H and named BamHI-Dhet and BamHI-Hhet (Hirai et al., 1984). Maotani et al. (1986) showed that this variation of BamHI-Dhet and Hhet fragments was due to variation in the copy number of tandem repeats of 132 bp. The tandem repeats were maped within the terminal repeat (TRL) and internal repeats (IRL) of the long region of MDV genome. Bradley et al. (1989) described the structure of MDV BamHI-H gene family and showed the partial sequence as well as analysed the transcriptional activity within this region. They reported that lymphomagenesis gene was characterized by the presence of tandem arranged direct repeats each of 132 bp. Cui et al. (1991) identified the gene for the phosphoprotein PP38 with the MDV-1 BamHI-H DNA fragments and indicated that this viral protein was the only known antigen to be constantly associated with the transformed state and might play a significant role in MDV transformation. Thus the amplification of 132 bp repeat in non-pathogenic MDV-1 virus might lead to change in expression of the pp38 gene and /or gene for additional virus genes involved in transformation. Considering the above facts, in present study PCR product amplified by a primer pair BamH1/BamH2 was selected for sequencing analyses to know exactly whether the amplified fragment contained the 132 bp repeats and if so how many. Two PCR products of the field samples M3 and M4 of 434 bp (approx) were purified and sequenced directly using the sequencing protocol as described in section 3.4. Both the samples resulted in 378 bp long sequences, the remaining length of bps were not showing high confidence level and hence were not used for further analysis study. In both the samples, 132 bp repeats were found and they were two.

The alignment of 378 bp sequence of M3/ M4 with previously published sequences of MDV isolates Md5, Md11, HPRS-16 and CDs of tumourogenicity associated m-RNA and CDs published from BamH gene family revealed that the two representative field isolates of present study shared maximum homology (100%) as expected, due to highly conserved region. The alignment of 378 bp sequence of M3 and M4 with Md5, Md11 and HPRS16 indicated that both the samples contained a genome (fragment) of MDV-1 only. The PCR product of BamH1/BamH2 was specifically selected for sequencing study, because the part of MDV genome which is amplified with this set of primer exists only in MDV-1 (i.e. 132 bp repeats) and not in MDV-2 or MDV-3 and the results were as per the expectation and in accordance with the other published reports concerning the same (132 bp repeats) segment of MDV genome(Bradley et al., 1989., Tulmen et al., 2000) The double 132 bp repeats as observed in the present study has also been reported by Tulmen et al. (2000) in a genome of vvMDV (Md5). However, Maotani et al. (1986) reported that pathogenic MDV-1 DNA contained three units of a tandem direct repeat, each with 132 bp in the terminal and internal repeats, of the unique L fragment of MDV-1 DNA, while the presence of two units of tandem direct repeat in MDV-1 DNA fragment BamHI was reported by Bradley et al. (1989). However, Kanamori et al. (1986) reported the presence of two or three tandem direct repeats in oncogenic MDV-1 and two tandem repeats in MDV-1 DNA present in transformed MD cell line. BamHI-H is a transcriptionally active region and it was suggested that oncogenicity associated with 132 bp expansion could be due to a direct effect on the BamHI- H gene family transcripts. It is believed that the formation of Stemp-loop structure as a direct effect of 132 bp expansion in the attenuated strains cause premature termination of transcription (Bradley et al.,1989). BamHI-H gene family transcripts are also involved in the growth control of MDV-1 derived lymphoblastoid cell line, since antisense oligonucleotides complementary to the BamHI-H gene transcripts inhibited the proliferation and DNA synthesis in this cell line (Kawamura et al., 1991). Iwata et al. (1992) during their study on sequence determination of DNA clones of transcripts from the tumour associated region of the MDV genome, found that the number of 132 bp tandem direct repeats within the long inverted repeat region of MDV type 1 genome increased concomitantly with loss of oncogenicity during serial passage in cultured cells. Twelve clones carrying 132 bp sequence were isolated from cDNA library constructed from chicken embryo fibroblast infected with the MDV1 Md5 strain. Through sequence analysis of cDNA clone and primer extension analysis the corresponding mRNA was found to be a linear transcript, which included the two 132 bp tandem direct repeats. Furthermor, Peng et al. (1993) showed that BamH-H transcripts prolonged the proliferation and serum dependence of CEF suggesting that these genes play an important role in the establishment and growth of tumour cells. Contrary to all these reports, Silva et al. (2004) found that expansion of a unique region in MDV (132 bp repeats) genome occurs concomitantly with attenuation but is not sufficient to cause attenuation. Pathogenic MDVs have two head-to-tail copies of a 132-bp repeats. As MDV is serially passaged in cell culture, the virus becomes attenuated and the number of copies of the 132-bp repeat increases from two to often more than 20 copies. To determine the role of the repeats in attenuation, they used five overlapping cosmid clones that spanned the MDV genome to reconstitute infectious virus (rMd5). By mutating the appropriate cosmids, the generated clones of infectious MDVs that contained zero copies of the 132-bp repeats, rMd5 (132); nine copies of the 132-bp repeats, rMd5(9-132); and nine copies of the 132-bp repeats inserted in the reverse orientation, rMd5(rev9-132). After two passages in cell culture, wild-type Md5, rMd5, and rMd5 (132) were stable. However, rMd5 (9-132) and rMd5 (rev9-132) contained a population of viruses that contained from three to over 20 copies of the repeats. A major 1.8-kb mRNA, containing two copies of the 132-bp

repeat, was present in wild-type Md5 and rMd5, but was not present in rMd5 (132), rMd5 (9-132), rMd5 (rev9-132), or an attenuated MDV. Instead, the RNAs transcribed from the 132-bp repeats region in rMd5 (9-132) and rMd5 (rev9-132) closely resembled the pattern of RNAs transcribed in attenuated MDVs. When inoculated into susceptible day-old chicks, all the viruses produced various lesions. Thus, expansion of the number of copies of 132-bp repeats, which accompanies attenuation, is not sufficient in itself to attenuate pathogenic MDVs. The sequencing of two field samples allowed to establish that the field virus contains two copies of 132 bp repeats and it is the very characteristics of pathogenic MDV and together with other supportive evidence i.e. presence of lesions characteristics of MD and history of mortality and vaccination (i.e. HVT and / or HVT + SB-1) indicated that the recent outbreaks of MD were due to very virulent strain of MD Although MDV is a virus of great importance not just from economic point of view, but also as a model of virus induced lymphomas, basic genetically oriented studies have lagged behind those conducted on other herpesviruses. This fact can be attributed mainly to properties of MDV, namely its relative slow groth in cell culture, attenuation after serial in vitro passage, and strong cell association, latter preventing cloning of virus derived from single infectious particle (Zelnik 2003). However, the present study gives an insight in to nature of the MDV circulating in the field based on its genetic characters. Thus unifying the overall results of the present study it appears that the incidence of MD were high during recent outbreaks in commercial poultry farms even though with practice of dual vaccination (HVT + SB-1) which is expected to provide better protection then single zero day HVT vaccination. This finding points towards the increase in the virulence of the field virus involved in present outbreaks. i.e. very virulent MDV or very virulent plus MDV. PCR was found very satisfactory in detecting the presence of MDV either in feather follicle or in tissue samples. PCR not only detects the presence of MDV but it is useful in differentiating the different serotypes present in the field samples. The six sets of primers used in the study showed almost similar sensitivity and specificity in detecting the respective MDV serotypes. Sequencing study has proved beyond doubt that the two representative samples contained two 132 bp repeats indicating the virulent nature of the field virus.

SUMMARY AND CONCLUSIONS

CHAPTER-VI SUMMARY AND CONCLUSIONS

6.1 SUMMARY
Mareks disease (MD) is a lymphoproliferative disorder of chicken characterized by oncogenic transformation of T cells that infiltrate lymphoid tissues, peripheral nerves and visceral organs, resulting in a complex pathogenesis that usually leads to death of the affected birds. MDV is ubiquitous and very frequent in almost all poultry population raised under commercial conditions. Present study was undertaken with a view to asses the incidence of MDV in field; detect the presence of MDV in clinical samples by advanced technique like PCR; differentiate different serotypes of MDV using different primers in PCR and genetic characterization of the field virus by sequencing the PCR amplified product. Overall mortality during the period of June to November 2005 due to MD in Anand zone (comprising of poultry farms located in and around Anand district in central part of Gujarat) and Mahuva zone (comprising of poultry farms located in and around Mahuva Saurastra region of Gujarat) was found to be 3.30 per cent as per farmrecords of history, symptoms and post mortem lesions. Mortality in individual commercial farms ranged between 0.6 to 7.3 per cent and the outbreaks were observed in age group as young as17 weeks of age and as old as 38 weeks age. A total of 34 clinical samples from 27 birds suspected of MD, three HVT (MDV-3) vaccines and one SB-1 (MDV-2) vaccine were screened for the presence of different serotypes of MDV by PCR using six pairs of primers. The primers were selected to amplify different gene segments. First set of primer BamH1/BamH2 specifically amplified a 434 bp segment from BamHI fragment (of MDV-1) containing 132 bp repeats located in TRL and IRL region of MDV genome. Out of 34 clinical samples tested, 32 samples produced positive results, indicating double 132 bp repeats in the amplified segment. All the three HVT vaccines and one SB-1 vaccine failed to produce the amplification as the selected primer was specific for MDV-1 only. Three primer pairs targeting the antigen A gene (UL44) were used of which, AGA1/AGA2 primer pair amplifying a 686 bp fragment was common to MDV1 and HVT but not for MDV2. Out of 34 clinical samples tested, 32 produced the expected amplicon of 686 bp. These included two feather follicle samples, which were negative with all MDV specific primer but positive with MDV-3 specific primer HVT1/HVT2. Second primer pair AGAM1/AGAM2 targeting the antigen A gene (UL44) produced 314 bp product in 30 out of 34 clinical samples tested, however non of the HVT vaccines or SB-1 vaccine produced positive result, suggesting the specificity of this primer for MDV-1. Similarly, a set of primer P1/P2 also amplified 199 bp fragments from Antigen A gene (UL44) in 30 samples. Primer set M1.1/M1.8 amplified a 318 bp product as against 247 bp product. To confirm this result, the primers were subjected to NCBI BLAST, and it was found that the primer specific segment of 318 bp exists in the published sequences of Md5 and Md11BAC strains of MDV-1. Out of 34 clinical samples, 30 samples produced the expected amplicon of 318 bp while none of the vaccine produced any amplification indicating the specificity of the primer in detecting MDV-1. To specifically detect HVT (MDV-3), a set of primer HVT-1/HVT-2 was used. Out of 34 clinical samples two samples and all the three HVT vaccines produced the expected amplicon of 505 bp, where as, SB-1 vaccine was negative. Out of the six primer pairs, BamH1/ BamH2 and AGA1/AGA2 detected MDV in maximum number (32) of field samples. Primers AGAM1/AGAM2, P1/P2 and M1.1/M.1.8 detected 30 samples positive. Primer pair HVT-1/HVT-2 detected MDV-3 in two feather follicle samples indicating possible presence of the HVT vaccine virus.

PCR products (434 bp) of MDV genome amplified by BamH1/BamH2 primers from two field samples (M3 and M4) was used for sequencing to determine the 132 bp terminal repeats within BamHI segments of MDV genome.The alignment of resulting 378 bp sequences of M3/ M4 with previously published sequences of the MDV isolates Md5, Md11, HPRS-16 and CDs of tumourogenicity associated m-RNA and CDs published from BamH gene family revealed that the field isolates of the present study shared complete homology (100%) the presence of double 132 bp repeats in the sequence confirmed that the field virus belonged to virulent type of MDV-1.

6.2 CONCLUSIONS
The analysis of the findings from the present study implies following conclusions 6.2.1 Overall mortality rate due to MD in two major poultry zones of Gujarat viz. Anand and Mahuva was 3.30 with highest mortality (7.3 %) in a commercial farm in Anand Zone. 6.2.2 As all the commercial farms had adopted the bivalent vaccination protocol the recent outbreaks could be due to a very virulent strain of MDV-1. 6.2.3 Primer pair (BamH1/Bamh2) amplified a 434 bp (two 132 bp repeats) fragment, in 32 out of 34 clinical samples indicate the presence of virulent oncogenic MDV in the field. 6.2.4 Primer pairs AGAM1/AGAM2, P1/P2 (both targeting Antigen A gene) and M1.1/M1.8 (targating ICP4 gene were equally sensitive as well as specific in detection of MDV-1 infection. 6.2.5 Primer HVT1/HVT2 can be used to detect presence of the vaccine virus in feather follicle. 6.2.6 Majority of clinical samples (32 out of 34) did not produce amplification by HVT1/HVT-2 primer (specific for MDV-3), indicating that the vaccine virus may become latent in the presence of the virulent virus and can not be detected by routine PCR technique as applied here and warrant the use of still advanced and sensitive technique like Real Time PCR. 6.2.7 Sequencing of the BamH1/BamH2 primers amplified 434 bp fragment confirmed the presence of the two 132 bp repeats indicating the presence of virulent type of MDV-1 in the field. 6.2.8 Comparison of the sequence from the field virus and the submitted sequences in Gene Bank revealed complete homology in the 378 bp stretch. 6.2.9 Sequencing, history of vaccination (monovalent or bivalent) and involvement of different organs on postmortem examination, point towards the increase in virulence of MDV circulating in the field causing outbreaks.

REFERENCES

REFERENCES
Adelekha, S. C. (1980). Disease as a limiting factor in poultry production. Paper presented in Summer Institute on Layer Production and Management. Central Avian Research Institute, Izatnagar (U. P.), India. Adene, D. F. (1983). Serological survey at Mareks disease in exotic and local chickens in Nigeria. Trop. Vet. 1 : 138-140. ( c.f. Vet. Bull. 54: Abstr. 4499). Anderson, D.P.; Eidson, C. S. and Richey, D. J. (1971). Age susceptibility of chickens to Mareks disease. American Journal of Veterinary Research. 32: 935-938. Baigent, S. J.; Petherbridge, L. J.; Howes, Ken. ; Smith, L. P.; Currie R.J.W. and Nair, V.K. (2005). J Virol. Methods. 123 : 53-64. Baruah, G. K. and Kwatra, M. S. (1979). Studies on Mareks disease in Assam I. Prevalence. Indian Vet. J. 56 : 983-987. Becker, Y.; Asher, Y.; Tabor, E.; Davidson, I.; Malkinson, M. and Weisman, Y. (1992). Polymerase chain reaction for differentiation between pathogenic and non-pathogenic serotype 1 Mareks disease viruses (MDV) and vaccine viruses of MDV-serotypes 2 and 3. J. Virol. Methods. 40: 307-327. Becker, Y.; Tabor, E.; Asher, Y.; E.; Davidson, I.; Malkinson, M. and R.L. Witter. (1993). PCR detection of amplified 132 bp repeats in Mareks disease virus type 1 (MDV-1) DNA can serve as an indicator for critical genomic rearrangement leading to the attenuation of virus virulence. Virus Genes 7 : 277-287. Benton, W. J. and Cover, M. S. (1957). The increased incidence of visceral lymphometosis in broiler and replacement birds. Avian dis. 1 : 320-327. Cited by Witter, R.L.; Schat, K.A. (2003). Mareks disease. In Eelnek, B.W., Diseases of Poultry 11th edition, Iowa State University Press, Ames., Iowa, 407-465. Borenshtein, R. and Davidson I. (1999). Development of the hot spot-combined PCR assay for detection of retroviral insertions into Mareks disease virus. J. Virol. Methods. 82 : 119-127. Bradley, G.; Hayashi, M.; Lenez, G.; Tanaka, A. and Nonoyama, M. (1989). Structure of the Mareks disease virus Ham H1-G gene family: genes of putative importance for tumor induction. J. Virol. 63: 2534-2542. Bumstead, N.; Sillibourne, J.; Rennie, M..; Ross, L.J.N. and Davison, F. (1997). Quantification of Mareks disease virus in chicken lymphocytes using polymerase chain reaction with fluorescence detection. J. Virol. Methods, 65 : 75-81. Burgess, S. C. and T. F. Davison. (1999). A quantitative duplex PCR technique for measuring amounts of cell-associated Mareks disease virus: Differences in two populations of lymphoma cells. Journal Virol. Methods. 82 :27-37. Buscaglia, C.; Nervi, P. and Miguel, R. (2004). Characterization of four very virulent argentinian strains of Mareks disease virus and the influence of one of those isolates on synergism between Mareks disease vaccine viruses. Avian Pathol. 33 : 190-195. Calnek, B. W. (1998). Lymphomagenesis in Mareks disease. Avian Pathol. 27:s54-s64 Camp, H. S.; Coussens, P. M. and Silva, R. F. (1991). Cloning, sequencing, and functional analysis of a Marek's disease virus origin of DNA replication. J. Virol. 65 : 6320 6324 Cebrian, J.; Kaschkar-Deitrich, C.; Berthelol, N. and Shrldrick, P. (1982). Inverted repeat nucleatide sequences in the genome of Mareks disease virus and Herpes virus of turkey. Proc.Natl.Acad.Sci.U.S.A.79:555-558. Chen, X. B. and Velicer, L. E. (1992). Expression of the Mareks disease virus homolog of herpes simplex virus glycoprotein-B in Escherichia-Coli and its identification as Bantigen. J. Virol. 66 : 4390-4398.

Cho, K. O.; Endoh, D.; Quian, J. F.; Ochiai, K.; Onuma, M. and ltakura, C. (1998). Central nervous system lesions induced experimentally by a very virulent strain of Mareks disease virus in Mareks disease-resistant chickens. Avian Pathol 27 : 512-517. Churchill, A. E.; Chubb, R.C. & Payen, L. N. (1969). Immunization against Mareks disease using a live attenuated virus. Nature. 221: 744-747. Churchill, A.E. & Biggs, P.M. (1967). Agent of Markes disease in tissue culture. Nature. 215 : 528-530. Cui, Z. Z.; Lee, L. F.; Liu, J. L. and Kung, H. J. (1991). Structural analysis and transcriptional mapping of the Marek's disease virus gene encoding pp38, an antigen associated with transformed cells. J Virol. 65 : 65096515. Damodar Reddy, S. (1979). Serological studies on Mareks disease in Adhra Pradesh. Indian J. Poult. Sci. XIV : 14 Suppl. : II. Dave, P. N. (1989). Pathological and serological studies on natural outbreaks of acute (visceral) Mareks disease in chickens. M.V.Sc. thesis, Gujarat Agricultural University, Anand. Davidson, I (2005). Personal communication. Davidson, I., Malkison,M., Strenger,C. and Becker,Y.(1986). An improved Elisa method using a streptavidin-biotin for detecting Mareks Disease virus antigens in feathers of infected chickens. Journal of Virological Methods 14: 237-241. Davidson, I. and Borenshtein, R. (2002). The feather tips of commercial chickens are a favourable source of DNA for the amplification of Mareks disease virus and avian leucosis virus, subgroup. J. Avian Pathol. 31: 237-240. Davidson, I. and Borenstein, R (1999). Multiple infection of chickens and turkeys with avian oncogenic viruses: Prevalence and Molecular analysis. Acta.Virlogica. 43 : 136-142. Davidson, I.; Borovskaya, A.; Peri, S. and Malkinson, M. (1995). Use of the polymerase chain reaction for the diagnosis of natural infection of chickens and turkeys with Mareks disease virus and reticuloendotheliosis virus. Avian Pathol., 24: 69-94. De Laney, D.B.; Morrow, C.J.; Kelly, M. R. and Tannock, G. A. (1998). The development and evaluation of two tissue culture grown Mareks disease challenge viruses. Avian Pathol. 27: 472-477. Fukuchi, K.; Sudo, M.; Lee, Y.; Tanaka, A. and Nonoyama, M. (1984). Structure of Mareks Disease virus DNA: detailed restriction enzyme map. J. Virol 51: 102-109. Garg, S. K.; Singh, I. P.; Rao, V.D.P. and chandra, R. (1979). Incidence of Mareks disease precipitins in commercial poultry farms. Indian Poult. Rev. 10 : 11-13. Garg, S. K.; Singh, I. P.; Rao, V.D.P. and chandra, R. (1980). Serologial survey of Mareks disease. Indian Vet. Med. J. 4 : 17-20. (c.f. Winspris Cab Abstr.) Ghosh, S. S.; Katariya, J. M.; Mukit, A. and Bora, H. N. (1989). An outbreak of Mareks disease in poultry in Meghalaya. Indian Vet. J. 66 : 774-775. Gimeno, I. M.; Witter, R. L.; Fadly, A. M. and Silva, R. F. (2005). Novel criteria for the diagnosis of Mareks diasease virus-induced lymphomas. Avian Pathol. 34 : 332-340. Goel, V. P.; Sharma, D. N. and Dwivedi, J. N. (1980). Sero-epidemiology of Mareks disease (MD) in some part of Uttar Paradesh. Vet. Res. J. 3 : 6-8. Grewal, G. S. and Singh, B. (1973). J. Res.10:105-113.(c. f. Dave 1989) Grewal, G. S. and Singh, B. (1976). Bursal lesions in HVT-vaccinated and unvaccinated chicks challenged by Mareks disease agent. Indian J. Anim. Sci. 46 : 203-207. Grewal, G. S.; Singh, B.; Singh, H. P. and Ravinder Kumar (1980). Mareks disease in the Punjab. Trop. Anim. Hlth. Prod. 12: 105-106. Haider, S. A.; Lapen, R. F. and Kenzy, S. G. (1970). Use of feathers in gel precipitation test for Mareks disease. Poult. Sci. 49 : 1654-1657. Handberg, K.J.; Nielsen, O.L. and Jergensen, P.H. (2001). The use of serotype 1 and serotype 3 - specific polymerase chain reaction for the detection of Mareks disease virus in chickens. Avian Pathol. 30: 243-249.

Haribabu, Y. (1986). Seroprevalence of Mareks disease on gel diffusion test. Indian J. Poult. Sci. 21: 240-242. Hirai, K.; Ikuta, K. and Kato, S. (1981a). Structural changes of the DNA of Mareks disease virus during serial passage in cultured cells. Virol. 115: 385-389. Hirai, K., Ikuta, K.; Kitamoto, N. and Kato, S. (1981b). Latency of herpesvirus of turkey and Mareks disease virus genomes in a chicken T-lymphoblastoid cell line. J. Gen. Virol. 53:133-143. Hirai, K.; Honman, H.; Ikata, K. and Kato, S. (1984). Genetic Relatedness of virulent and avirulent strains of Mareks disease virus. Arch. Virol. 79: 293-298. Ianconescu, M. and Samberg, Y. (1971). Etiology and immunological studies in Mareks disease. II. Incidence of Mareks disease precipitating antibodies in commercial flocks and in eggs. Avian Dis. 15 : 177-186. Igarashi,T.; Takahashi, M.; Donovan, J.; Jessip, J.; Simth, M.; hirai, K.; Tanaka, A and Nonoyama, M. (1987). Restriction enzyme map of herpes virus of turkey DNA and its collinear relation ship with Mareks disease virus DNA. Virol. 157 :351-358. Isfort, R. J.; Kung, H. J. and Velicer, L. E. (1987). Identification of the gene encoding Mareks disease herpesvirus A antigen. J. Virol. 61: 2614-2620. Islam, A. F. M. F. (2005). Personal Communication. Islam, A. F. M. F.; Walkden-Brown, S. W.; Wong, C. W.; Groves, P. J.; Burgess, S.K.; Arzey, K. E. and Young, P. L. (2001a). Influence of vaccine deposition site on postvaccinal viraemia and vaccine efficacy in broiler chickens following in ovo vaccination against Mareks disease. Avian Pathol. 30 : 525-533. Islam, A. F. M. F.; Walkden-Brown, S.W.; Burgess, S.K. and Groves, P.J. (2001b). Mareks disease in broiler chickens: effect of route of infection and herpesvirus of turkey vaccination status on detection of virus from blood or spleen by polymerase chain reaction, and on weights of birds, bussa and spleen. Avian Pathol. 30 : 621-628. Islam, A.; Harrison, B.; Cheetham, B. F.; Mahony, T. J.; Young P. L. and Walkden-Brown, S. W. (2004). Differential amplification and quantitation of Mareks disease viruses using real-time polymerase chain reaction J. Virol. Meth. 119 :103113. Iwata, A.; Ueda, S.; Ishihama, A. and Hirai, K. (1992). Sequence determination of cDNA clones of transcripts from the tumor-associated region of the Mareks disease virus genome. Virology. 187 : 805-808. Josipovic, D. (1990). Mareks disease Still aproblem in poultry. In Sauveur B. (ed.). L'aviculture en Mditerrane . Montpellier : CIHEAM-IAMM, 1990. p. 185-194 (Options Mditerranennes : Srie A. Sminaires Mditerranens ; n. 7). Sminaire sur l'Aviculture en Mditerrane, 1987/11/05-07, Belgrade (Yugoslavia) Juranova, R.; Jurajda, V. and Pokorna, M. (1983). Serological examination of broiler flocks with oedema disease. Veterinarni Medicina 28 : 503-509. (c.f. winspris Cab Abstr.). Kanamori A, ; Nakajima K, ; Ikuta K, ; Ueda S, ; Kato S. and Hirai K. (1986). Copy number of tandem direct repeats within the inverted repeats of Marek's disease virus DNA. Biken. J. 29. : 83-89. Katsumata, A.; Iwata, A. and Ueda, S. (1998). Cis-acting elements in the lytic origin of DNA replication of Mareks disease virus type 1. J. Gen. Virol. 79 : 3015-3018. Kawamura, M.; Hayashi, M.; Furuichi, T.; Nonoyama, M.; Isogai, E. and Namioka, S. (1991). The inhibitory effect of oligonucleotides complementary to Mareks disease virus mRNA transcribed from the BamHI-H region, on the proliferation of transformed lymphoblastoid cells, MDCC-MSBI. J. Gen. Virol. 72 : 1105-1111. Kobayashi, S.; Kobayashi, K. and Mikami, T. (1986). A study of Marek's disease in Japanese quails vaccinated with herpesvirus of turkeys. Avian Dis. 30 : 816-819 Konobe, T.; Ishikaa, T.; Takaku, K.; Ikuta, K.; Kitamoto, N. and Kato, S. (1979). Mareks disease virus and herpesvirus of turkey noninfective to chickens, obtained by repeated in vitro passages. Biken J. 22 :103-107.

Lee L. F,: Sharma J.M,: Nazerian K. and Witter R. L (1978) Suppression and enhancement of mitogen response in chickens infected with Marek's disease virus and the herpesvirus of turkeys. Infect Immun. 21: 474-479. Lee, L. F.; Liu, X.; Sharma, J. M. ; Nazearian, K. and Bacon, L. D. (1983). A monoclonal antibody reactive with Mareks disease tumor-associated surface antigen. J. Immunol. 130:1007-1011. Lee, S.; I., Ohashi, K.; Sugimoto, C. and Onuma, M. (2001). Hepain inhibits plaque formation by cell-free Mareks disease viruses in vitro. J. Vet. Med Sci. 63 : 427-432. Lee, Y. S.; Tanaka, A. and Nonoyama, M. (1982). Partial restriction map of Mareks disease virus DNA. Gene. 19 : 185-190. Levy M. A.; Burgess, S. C.; Davidson, I.; Underwood, G.; Leitner, G. and Dan Heller, E. (2003). Interferon-containing supernatants increase Mareks disease herpesvirus genomes and gene transcription levels, but not virion replication in vitro. Viral Immunol. 16 : 501-509. Lu, C. L. and Gao, D. H. (1987). Study and diagnosis of Mareks disease in chickens in Guizhou province, China. Acta Veterinaria-et-zootechnica-Sinica 18 : 41-47. (c.f. winspris Cab Abstr.). Maotani, K.; Kanamori, A.; Ikuta, K.; Ueda, S.; Kato, S. and Hirai, K. (1986). Amplification of a tandem direct repeat within inverted repeats of Mareks disease virus DNA during serial in vitro passage. J. Virol. 58: 657-660. Marek, J. (1907). Multiple nervenentzundung (polyneuritis) Huhnern. Deutsche Tierarztliche Wochenschrift 15: 417-421. (c. f. Witter and Schat, 2003). Mendez J. C.; Mark J. E.; Thomas, F. S.; Jennie, A. W. and Carlos, V. P. (1998) Evaluation of PCR Primers for Early Diagnosis of Cytomegalovirus Infection following Liver Transplantation. J. Clin. Microbiol. 36 : 526-530. Mishra, R.; Dutta, N. K.; Mishra, P.R. and Rao, A.G. (1994). Seroprevalence of Mareks disease in poultry in Orissa. Poult. Guide. 31 : 17-19. Moriguchi, R.; Fujimoto, Y. and Izawa, H. (1984). Mareks disease in field chickens. Correlation between incidence of Mareks disease and nuclear inclusion formation in the feather follicle epithelium. Avian dis. 28 : 331-342. Okazaki, W.; Purchase, H. G. and Burmester, B. R. (1970). Protection against Mareks diease by vaccination with herpesvirus of turkeys. Avian Dis. 14 : 413-463. Panda,B.K.; Arya,S.C.; Pradhan, H. K and Johari, D. C. (1983). Mareks disease incidence in Various strains of white leghorn chikens. Indian J. Poult.. Sci. 18: 100-103. Parcells, M. S.; Anderson, A. S. and Morgan, R. W. (1995). Retention of oncogenicity by a Mareks disease virus mutant lacking six unique short region genes. J. Virol. 69 : 7888-7898. Peng, F.; Donovan, J.; Specter, S.; Tanaka, A. and Nonoyama, M. (1993). Prolonged proliferation of primary chicken embryo fibroblast transfected with cDNAs from BamHI-H gene family of Mareks disease virus. International Journal of Oncology. 3: 587-591. Posia, R. U. (2003). Status of Mareks disease and chicken infectious aremia in commercial broiler birds Serological and pathological study. M.V.Sc. thesis, Anand Agricultural University, Anand. Pradhan, H. K. and Nayak, B. C. (1973). Preliminary observations on the incidence of Mareks disease in Orissa. Indian J. Anim. Sci. 43 : 255-257. Pratt, W. D. ; Cantello, J. L. ; Morgan, R. W. and Schat, K. A. (1994). Enhanced expression of the Mareks disease virus-specific phosphoproteins after stable transfection of MSB-1 cells with the Mareks disease virus homologue of ICP4. Virology. 201:132136. Rao, G. D. and Sarma, P. L. N. (1984). Some observations on Mareks disease in an organized flock of white leghorn. Indian J. Poult. Sci. 19:74-76.

Reddy, S. D.; Pargaonkar, V. N. and Moorthy, K.G. (1980). Serological survey of Mareks disease by agar gel precipitation test. Indian Vet. J. 57 : 185-189. Reddy, S. M.; Witter, R. L., and Gimeno, I. M. (2000). Development of a quantitativecompetitive polymerase chain reaction assay for serotype 1 Mareks disease virus. Avian Dis. 44 : 770-775. Rispens, B. H.; Van Volten, J.; Mastenbroek, N.; Maas, H. J. L. and Schat, K. A. (1972). Control Mareks disease in The Netherlands. I. Isolation of an avirulent Mareks disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Dis. 16 : 108-125. Ross, L. J. N.; OSullivan, G.; Rothwell, C.; Smith, G., Burgess, S. C.; Rennie, M.; Lee, L. F. and Davison, T. F. (1997). Mareks disease virus EcoRI-Q gene (meq) and a small RNA antisense to ICP4 are abundantly expressed in CD4+ cells and cells carrying a novel lymphoid marker, AV37, in Mareks disease lymphomas. J. Gen. Virol. 78 : 2191-2198. Sambrook, J. and Russel, D.W. (2001). Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laborartory, Cold Spring Harbor, NY. Sharma, R. N.; Mohanty, G. C. and Rajya, B. S. (1972). Skin manifestations of Mareks disease. Current Science. 41 : 708-710. Sharma, R. N.; Mohanty, G. C.; Gopalkrishna, S. and Rajya, B. S. (1977). Effect of Mareks disease virus on bursa of Fabricius. Indian J. Anim. Sci. 47 : 410-413. Silva R. F. (1992). Differentiation of pathogenic and non-pathogenic serotype 1 Marek's disease viruses (MDVs) by the polymerase chain reaction amplification of the tandem direct repeats within the MDV genome. Avian Dis. 36: 521-528. Silva, R. F. and Barnett, J. C. (1991). Restriction endonuclease analysis of Mareks disease virus DNA: differentiation of viral strains and determination of passage history. Avian Dis. 35: 487-495. Silva, R. F., Reddy, S. M. and Lupiani, B. (2004). Expansion of a unique region in the Mareks disease virus genome occurs concomitantly with attenuation but is not sufficient to cause attenuation. J. Virol. 78 : 733-740. Silva, R.F. and Witter R.L. (1985). Genomic expansion at Mareks disease virus DNA is associated with serial in vitro passage. J. Virol. 54: 690-696. Singh, J.; Kalra, D. S. and Kharole, M.U. (1981). Note on the status of Mareks disease in the poultry farms of Haryana. Indian J. Anim. Sci. 51 : 1016-1017. Sung, H. W. (2002). Recent increase of Mareks disease in Korea related to the virulence increase of the virus. Avian Dis. 46 : 517-524. Sung, H. W. (2002). Recent increase of Mareks disease in korea related to the virulence increase of the virus. Avian Dis. 46 : 517-524. Sung, H.W.; Kim, S.J.; Song, C. S.; Lee, Y.J.; Lee, Y.J.; Lee, C.W.; Kim, K.S. and Kim, S.J. (1997). Detection of pathogenic Mareks disease (MD) virus and survey on MD in broiler farms by the polymerase chain reaction. RDA J. Vet. Sci. 39 : 38-44. Thompson, J. D.; Higgins, D. G. and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. Nov 11; 22: 4673-80. Tulman, E. R. Afonso, C. L.; Lu, Z.; Zsak, L.; Rock, D. L. and Kutish, G. F. (2000). The genome of a very virulent Mareks disease virus. J. Virol. 74 : 7980-7988. Varia, M. R.; Vaishnav, T. N. and Umerji, G. Y. (1972). Mareks disease in Gujarat. GUJVET. 6: 33-37. Verma, N. D.; Sharma, D.; Ghosh, S. S.; Verma, K. C.; Katariya, J. M. and Singh, S. D. (1989). Serological screening against common infections of poultry diseases in Tripura State. Indian J. Anim. Sci. 59 : 362-364.

Verma, N. D.; Verma, K. C.; Katariya, J.M. and Singh, S. D. (1987). Serological evidence of common avian infections in Arunachal Pradesh. Indian J. Anim. Sci. 57 : 841-843. Wickramasinghe, R. (1984). A serological observation on Mareks disease in Sri Lanka. Sri Lanka Vet. J. 32 : 12-19. (c.f. Winspris Cab Abstr.). Witter, R. L. (1983). Characteristics of Mareks disease viruses isolated fom vaccinated commercial chicken flocks: association of viral pathotype with lymphoma frequency: Avian Dis. 27: 113-132. Witter, R. L. (1997) Increased virulence of Mareks disease virus field isolates. Avian Dis.: 41:149-163. Witter, R. L. (1998a) Control Strategies for Mareks Disease: A Perspective for the future. Poultry Sci. 77: 1197-1203. Witter, R. L. (1998b). The changing landscape of Mareks disease. Avian Pathol. 27: 546553. Witter, R. L. and Schat, K. A. (2003). Mareks disease. In Eelnek, B.W., Diseases of Poultry 11th edition, Iowa State University Press, Ames., Iowa, 407-465. Zanella, A. and Raymonds, S. (1969). Serological survey with immuno diffusion test in Mareks disease. Cinica Vet. Milano. 92 : 424-428. (c.f. Vet. Bull. 40 : Abstr. 3526). Zelink,V. (2003). Mareks disease virus research in post-sequencing era: new tools for the study of gene functions and virus host interaction. Avian Pathol. 33 : 323-333. Zhu, G. S.; Ojima, T.; Hironaka, T.; Ihara, T.; Mizukoshi, N.; Kato, A.; Ueda, S. and K. Hirai. (1992). Differentiation of oncogenic and nononcogenic strains of Mareks disease virus type 1 by using polymerase chain reaction DNA amplification. Avian Dis. 36: 637-645.

APPENDICES

Appendix A.1 Extraction of DNA from feather follicle

a) Proteinase K mixture
Proteinase k Proteinase k buffer 4mg 10ml 0.930g 2.500g 0.605g 50ml

b) Proteinase K buffer
EDTA SDS Tris HCl Deionized water up to

c) 5M Sodium acetate
Sodium acetate 13.608g Deionized water up to 20ml

d) Phenol:Chloroform:Isoamyl alcohol
Phenol Chloroform Isoamyl alcohol 25ml 24ml 1ml

A.2

Important buffers and reagents

Some of the important buffers and reagents used in the present study are given here under. a) TAE (50X) Tris base 242 g Glacial acetic acid 57.1 ml 0.5 M EDTA (pH 8.0) 100 ml Deionized water up to 1000 ml b) TBE (5X) Tris base 54 g Boric acid 27.5 g 0.5 M EDTA (pH 8.0) 20 ml Deionized water up to 1000 ml c) Agarose gel loading buffer (6X) Bromophenol blue 0.25% (w/v) Xylene cyanol FF 0.25% (w/v) Ficoll 15% (w/v) (Type 400; Pharmacia) Dissolved in appropriate volume of deionized water