RESEARCH ARTICLE

Molecular diversity and intragenomic variability in the yeast genus Xanthophyllomyces: the origin of Phaa rhodozyma ?
Jack W. Fell1, Gloria Scorzetti1, Adele Statzell-Tallman1 & Kyria Boundy-Mills2
1

Rosenstiel School of Marine and Atmospheric Science, University of Miami, Key Biscayne, FL, USA; and 2Phaff Yeast Culture Collection, Food Science and Technology, University of California Davis, Davis, CA, USA

Correspondence: Jack W. Fell, Rosenstiel School of Marine and Atmospheric Science, University of Miami, 4600 Rickenbacker Causeway, Key Biscayne, FL, USA. Tel.: 11 305 421 4603; fax: 1305 421 4600; e-mail: jfell@rsmas.miami.edu. Received 28 September 2006; revised 15 June 2007; accepted 17 June 2007. First published online 6 September 2007. DOI:10.1111/j.1567-1364.2007.00297.x Editor: Teun Boekhout Keywords basidiomycetous yeast; Xanthophyllomyces ; Phafa ; molecular diversity; rRNA gene sequence analysis; intragenomic sequence heterogeneity.

Abstract The teleomorphic basidiomycetous yeast Xanthophyllomyces dendrorhous is important as a commercial source of astaxanthin, which is a component of feeds for mariculture. Phafa rhodozyma is the anamorphic state of Xanthophyllomyces; however, there are conicting reports in the literature concerning the presence of a sexual cycle in P. rhodozyma. The current study attempted to explain this enigma. Strains were obtained from the Phaff Yeast Culture Collection (University of California, Davis) and other sources in the northern hemisphere. Molecular sequences of three nuclear rDNA regions were examined: the internal transcribed spacers (ITS), intergenic spacer (IGS1) and the D1D2 region at the 5 0 end of the 26S gene. Different levels of genetic variability were observed in the three regions. The D1D2 differentiated major groups of strains, while an increased variability in the ITS suggested that the ITS region could be employed as an ecological marker. The greatest variability was in the IGS1 region, where strains can be dened by the presence and location of indels. Intragenomic sequence heterogeneity in the ITS and IGS1 regions led to the hypothesis that the type strain of P. rhodozyma (CBS 5905T, UCD 67-210T) was derived as a mating-decient basidiospore from the parent teleomorphic strain CBS 9090.

Introduction
Phafa rhodozyma is an economically important basidiomycetous yeast, which is used in commercial feed to produce pink-colored esh in salmon and shrimp (Johnson, 2003). The species was rst isolated by Phaff et al. (1972) from Japan and Alaska and described by Miller et al. (1976) as an anamorphic species with type strain UCD 67-210T, which was submitted to the Centraalbureau voor Schimmelcultures as CBS 5905T. Golubev (1995) discovered the teleomorphic state based on parentbud mating in strains from Japan, Finland and Russia. The genus and species were described as Xanthophyllomyces dendrorhous with the type strain designated as CBS 7918T. Golubev (1995) reported that a subculture of the type strain of P. rhodozyma (VKM Y-2274T) produced a Xanthophyllomyces-type sexual cycle. In contrast, Kucsera et al. (1998) and research in our laboratory failed to observe a sexual cycle with strain CBS 5905T. In addition, we obtained strains, from several laboratories that were labeled UCD 67FEMS Yeast Res 7 (2007) 13991408

210T or reported to be derived from UCD 67-210T. We found that some of these strains produced sexual cycles, whereas other strains lacked that ability. These results suggested that some strains might be erroneously labeled. To resolve the confusion, we examined a series of lyophilized stocks from the years 1968, 1985 and 1986, which are maintained in the Phaff Yeast Culture Collection at the University of California at Davis (UCD). The series revealed two strains that differed on their rRNA gene sequences. One strain, represented by the 1968 lyophilized stock, was identical to CBS 5905T. The other strain, represented by the 1985 and 1986 stocks, was unlike previously studied strains (Fell & Blatt, 1999) and was subsequently labeled UCD 67210.2 (CBS 9090, Scorzetti et al., 2002). For comparative purposes, we included all of the Phafa/Xanthophyllomyces strains from the Phaff Collection as well as unstudied strains in the USDA Collection (NRRL, Peoria, IL; C.P. Kurtzman), which had been isolated from trees in Illinois and Wisconsin. The studies included observations of sexual cycles, sequence analyses of nuclear rDNA regions (internal
c

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

1400

J.W. Fell et al.

transcribed spacers: ITS1 and ITS2, D1D2 region of the large subunit and the intergenic spacer region 1: IGS1) and cloning and sequence analysis of ITS and IGS1 regions to establish the presence of intragenomic sequence heterogeneity.

Materials and methods

The strains studied, and the GenBank accession numbers of their ribosomal sequences, are listed in Table 1. The three regions examined in the nuclear rDNA were the D1D2 domain at the 5 0 end of the large (26S) subunit (LSU), the ITS region including ITS1, 5.8S and ITS2 and the IGS1 region, which extends from the LSU to the 5S. Amplication of the D1D2 and ITS regions was performed with primers NS7, 5 0 -GAGGCAATAACAGGTCTGTGATGC-3 0 , and LR6, 5 0 -CGCCAGTTCTGCTTACC-3 0 . IGS primers were LR11, 5 0 -TTACCACAGGGATAACTGGC-3 0 , and 5SR, 5 0 -GATC GGACGGGCAGGGTGC-3 0 . Eppendorf HotMaster Mix
Table 1. Origin of strains studied

(Eppendorf North America) and DyNAzyme Polymerase (Finnzymes) were alternatively employed. The optimized amplication program consisted of one denaturation cycle at 94 1C for 5 min followed by 35 cycles of 1 min denaturation at 94 1C, 1 min annealing at 55 1C and 3 min extension at 72 1C. The nal extension was at 72 1C for 7 min. Samples of the resulting amplicons were analysed by gel electrophoresis on a 2% agarose minigel. The PCR products were puried with the QIAquick PCR Purication Kit (Qiagene Inc.) The D1D2 domain was sequenced with primers F63, 5 0 -GCATATCAATAAGCGGGAGGAAAAG-3 0 , and (R635) LR3, 5 0 -GGTCCGTGTTTCAAGACGG-3 0 . The ITS region was sequenced with primers ITS1, 5 0 -TCCGTAGGTGAACC TGCGG-3 0 , and ITS4, 5 0 -TCCTCCGCTTATTGATATGC-3 0 . The IGS region employed primers LR12, 5 0 -CTGAACGCC TCTAAGTCAGAA-3 0 , and 5SR, 5 0 -GATCGGACGGGC AGGGTGC-3 0 . A LiCor (Lincoln, NB) automated sequencer with IRD800 conjugate primers was employed for

GenBank accession numbers Strain Other numbers Origin Betula papyrifera Alaska Betula tauschii Japan Betula sp. Finland D1D2 DQ870193 AF444793 AF444721 ITS AF139631 AF139630 AF139632 AF444488 DQ904243 DQ904244 DQ870211 Betula verrucosa Russia Betula populifolia Wisconsin B. populifolia Wisconsin B. populifolia Wisconsin B. populifolia Illinois B. populifolia Illinois B. populifolia Illinois B. populifolia Illinois B. populifolia Illinois B. populifolia Illinois B. populifolia Illinois Cornus brachypoda Japan C. brachypoda Japan Fagus crenata Japan AF075496 DQ870185 DQ870186 DQ870187 DQ870188 DQ870189 DQ870190 DQ870191 DQ870192 DQ913745 DQ904245 AF139628 DQ870197 DQ870198 DQ870199 DQ870200 DQ870201 DQ870202 DQ870203 DQ870204 DQ913746 DQ870205 DQ870206 DQ870207 AF139629 DQ904246 AF139634 DQ870209 IGS 1 AF139636 AF139635 AF13937 DQ870210 DQ904247

Xanthophyllomyces dendrorhous ATCC 24228 UCD 68-653.3 ATCC 24230 UCD 67-385 CBS 6938 VKM Y-2793 CBS 9090 UCD 67-210.2 CBS 9090 C3 CBS 9090 C4 CBS 9090 C6 CBS 9090 C7 CBS 9090 C10 CBS 7918T T VKM Y-2786 NRRL Y-17430 NRRL Y-17430 C4 NRRL Y-17431 NRRL Y-17432 NRRL Y-17433 NRRL Y-17434 NRRL Y-17434 C1 NRRL Y-17438 NRRL Y-17438 C2 NRRL Y-17441 NRRL Y-17441 C9 NRRL Y-17442 NRRL Y-17443 NRRL Y-27348 NRRL Y-27348 C2 UCD 67-202 ATCC 24229 UCD 67-203 ATCC 24201 Phafa rhodozyma CBS 5905T T UCD 67-210T CBS 5905T C2 CBS 5905T C10

DQ870215 DQ870216 DQ870217 DQ870218 DQ870219 DQ870220 DQ870221 DQ870222 DQ870223 DQ913747 DQ870224 DQ870225

DQ870194 DQ870195 AF189871

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

FEMS Yeast Res 7 (2007) 13991408

Origin of Phafa rhodozyma

1401

sequencing. Sequences were analysed with Align IR for Mac OS 9. The sequences with double pattern images were resequenced on an ABI 3730 DNA Analyzer (Applied Biosystems) and analysed with Seqman 5.51 for Mac OS X. Following amplication and purication, amplicons representing the IGS1 and ITS regions from selected strains (Table 1) were ligated and transformed in competent cells (TA Cloning Kit with INVaF chemically competent Escherichia coli, Invitrogen Corp.) using the manufacturers protocols. Sixteen clones from each sample were puried (Wizard SV 96 Plasmid DNA Purication System, Promega Corp.) and sequenced with an ABI 3730 DNA Analyzer (Applied Biosystems) using primers M13F (M13/pUC universal primer code 1, Sambrook & Russell, 2001) (5 0 -GTAAAA CGACGGCCAGT-3 0 ) and M13R (5 0 GGAAACAGCTATG ACCATG3 0 ), which is a 3-nt 5 0 extension of M13/pUC universal primer code 4 (Sambrook & Russell, 2001). Sequences were analysed with Seqman 5.51 for Mac OS X. Phylogenetic analysis of the D1D2 region employed maximum-likelihood (ML) with the HKY85 substitution model (Hasegawa et al., 1985) and a heuristic search. The ITS and IGS analyses compared ML with maximum-parsimony (MP: gaps treated as missing data) and neighbor-joining (NJ) analyses. Heuristic search consisted of random stepwise addition and tree-bisection-reconnection branch swapping (TBR). Bootstrap analyses consisted of 1000 replicates in a full heuristic search. All analyses employed PAUP 4.0b10. The MP, ML and NJ analyses agreed in terms of strain relationships, and therefore the trees illustrated are those that were considered to be the most appropriate for data presentation and discussion. The IGS1 region was cloned for strains CBS 5905T, 7918T, 9090, NRRL Y-17430, Y-17431, Y17432, Y17433, Y-17434, Y-17438, Y-17441 and Y-27348. Strains cloned for the ITS region were CBS 5905T, 7918T, 9090, Y-17433 and Y-27348. The selection included strains with and without apparent multiple copies. Basidial formation was studied with CBS 9090, CBS 5905T and all of the NRRL strains. The strains were grown for 1 month on 0.5% glucitol yeast nitrogen base (YNB) agar, then transferred to 0.5% glucitol YNB agar at 18 1C for 5 days.

identical D1D2 sequence with the exception of CBS 9090, UCD 67-202 and UCD 67-203; (2) CBS 9090 and P. rhodozyma (CBS 5905T) have identical sequences, which differ from CBS 7918T (X. dendrorhous) by the absence of a T at position 558 (Table 2) and a C instead of a T at position 562; (3) two UCD strains (67-202 and 67-203), as represented by 67-202, differ from CBS 5905T and CBS 7918T by the presence of a C instead of a T at position 569 (Table 2).

ITS sequence analysis

Analysis of the ITS region (Fig. 2), which includes c. 650 bp, suggests that alignment differences can be related to the geographic origins of the strains. The two clusters of strains collected from birch trees (Betula spp.) appear to be closely related as they differ by a single nucleotide. Greater distances are demonstrated by the type strain of P. rhodozyma (CBS 5905T), which was obtained from a beech tree (Fagus) and the UCD strains from dogwood (Cornus brachypoda). The distinction between CBS 5905T and CBS 9090 is of particular interest in this study. As illustrated in Table 3, the majority of the differences are in the ITS2 region.

IGS1 sequence analysis

There were two major difculties associated with IGS1 analyses. (1) Some strains demonstrated intragenomic heterogeneity between copies of the rDNA operons. This heterogeneity was indicated by the presence of multiple patterns in the sequencing images. In some cases, the secondary patterns were weak and the primary pattern could be read. In other cases, the strength of the secondary sequence precluded sequence interpretation. The double pattern, which initiated in the region of position 390 (Table 4), varied in length from 3040 bp to nearly half of the sequence. This double pattern corresponded to the most variable portion of the sequence. As a consequence, not all strains were included in the IGS1 analysis (Fig. 3, Table 4). (2) Multiple repeats and indels were present in the sequences, which required visual and manual alignments. Individual strains may have indels at different positions in the sequence, and therefore alignments varied with the strains included in the analysis (Table 4). The IGS1 data consisted of 687 bp. The initial 392 bases consist of a relatively conserved region, which we examined with NJ, MP and ML analyses. The rst 60 bases from the primer at the 5 0 end were trimmed due to uneven data acquisition between strains. The results, as illustrated by an MP tree (Fig. 3), are similar to the ITS data with the exception that ATCC24230 and ATCC24228 are on a separate branch and CBS 5905T and CBS 9090 have identical sequences. The greatest sequence diversity is in the 390687 region due to the presence of multiple indels (Table 4). The number and location of these indels provide markers for
c

Results
D1D2 sequence analysis
Xanthophyllomyces and Phafa are members of the Cystolobasidiales (Fig. 1, Fell et al., 1999; Scorzetti et al., 2002), which includes the teleomorphic genera Mrakia and Cystolobasidium and anamorphic species of the genera Udeniomyces, Cryptococcus, Itersonilia and Guehomyces. There are three groups of strains within the Xanthophyllomyces cluster: (1) all of the X. dendrorhous strains listed in Table 1 have an
FEMS Yeast Res 7 (2007) 13991408

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

1402

J.W. Fell et al.

Fig. 1. Phylogenetic tree representing nuclear rDNA D1D2 large subunit sequence analysis of Cystolobasidiales prepared by maximum likelihood with a heuristic search (PAUP 4.0b10): 4045 rearrangements, tree score 2790. Numbers on the branches represent bootstrap percentages ( 4 50%). Cryptococcus fuscescens, Cryptococcus aerius and Cryptococcus terricola formed the outgroup.

Table 2. D1D2 Sequence differences between strains of Xanthophyllomyces and Phafa Nucleotide position

X. dendrorhous UCD 67-202 CBS 9090 P. rhodozyma

C C C C

550 A G A G A G A G

C C C C

G G G G

C C C C

G G G G

C C C C

C C C C

T -

C C C C

560 T T T T T T T T

T C C C

A A A A

C C C C

G G G G

G G G G

G G G G

G G G G

T C T T

570 C C C C

strain identication. Of particular importance, CBS 9090 and the P. rhodozyma CBS 5905T had identical sequence alignments with the sole difference based on the presence of an insertion or deletion at position 482523. Indels, which
c

were present in all of the strains, were prevalent in a GT-rich area from 392 to 560 and in a TAC-rich region from 560 to 687. As examples of strain specicity, CBS 7918T is distinguished by insertions at 500520 and 560575. Similarly,
FEMS Yeast Res 7 (2007) 13991408

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

Origin of Phafa rhodozyma

1403

Fig. 2. Cladogram representing the nuclear rDNA ITS region of Xanthophyllomyces strains and clones of CBS9090 (clones C4 and C6) as prepared by maximum-parsimony analysis with a heuristic search (PAUP 4.0b10). Midpoint rooting (MINF optimization): 2794 rearrangements. Numbers on branches represent branch lengths. Numbers in parentheses represent bootstrap percentages ( 4 50%).

Table 3. Partial ITS sequence alignment of CBS 9090 and CBS 5905T: positions 481660. Lowercase letters indicate nucleotide sequence differences
481 540 GAAGCGCGGGCGGTGCCTTGACATGATAAGAAATTGTCGTCGAGtgtcGCTGTCTGTGTG GAAGCGCGGGCGGTGCCTTGACATGATAAGAAATTGTCGTCGAGC--TGCTGTCTGTGTG 600 541 aGTGTGTGggTTTCCTCGGGAAcaCgcaGACTAGCtaGTaCaACTAAaCGACGCATGCGA TGTGTGTGCTTTTCCTCGGGAAGGCATGGACTAGCCGGTGCGACTAA-CGACGCATGCGA 660 601 ACTGCTTCTAACGATACTGTGTGtGtgGtC-TTtGCGGaCtgCaTGCGCACACTTCTGAT ACTGCTTCTAACGATACTGTGTGGGGAGCCCTTCGCGGGCCCCTTGCGCACACTTCTGAT

CBS9090 CBS5905 CBS9090 CBS5905 CBS9090 CBS5905

NRRL Y17434 and Y 17442 can be separated by a 24-bp indel in the 603624 TAC region (Table 4).

Cloning experiments
The ITS and IGS regions were cloned to ascertain the presence of intragenomic sequence heterogeneity, which was indicated by the double banding pattern in the sequence images. Strains, with and without a double banding pattern,
FEMS Yeast Res 7 (2007) 13991408

were sequenced. Throughout this presentation of results and discussion, the dominant sequence (as reported to GenBank and used for tree construction) is signied by the strain number, i.e. CBS 9090. Clone numbers, such as CBS 9090 C4, designate the sequences obtained from clones. The ITS cloning experiments did not reveal the presence of heterogeneity in CBS 7918T, NRRL Y-17433 and Y-27348. In contrast, clones from CBS 9090 (Fig. 2) had sequences represented by (1) CBS 9090, (2) CBS 9090 C4, with 2-bp
c

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

1404

J.W. Fell et al.

Table 4. Location of indels in the 361-687-bp region of the rDNA IGS1 for strains of Xanthophyllomyces dendrorhous and Phafa rhodozyma

differences from ATCC 24230 and related species and (3) CBS 9090 C6 (and 9090 C10, Table 1), which was identical to CBS 5905T. The clones from CBS 5905T were all identical with one exception. CBS 5905T C2 had the appearance of the 5905x9090 hybrid; however, we conservatively treated the sequence as a chimera. For reference, the sequence was submitted to GenBank (Table 1). Sequencing of the IGS1 clones demonstrated a lack of intragenomic variability in the IGS1 regions of strains CBS 7918T, NRRL Y17431, Y17432 and Y17433. In contrast, CBS 5905T, Y17430, Y17434, Y17438, Y17441 and Y27348 contained at least two different IGS1 sequences in their genomes. Analysis of the 60392-bp 5 0 region of the IGS1 (Fig. 3) demonstrated the presence of a limited number of scattered single nucleotide substitutions. For example (Fig. 3), CBS 5905T C10 and CBS 9090 C7 had two single nucleotide sequence differences. The other clones were not included in Fig. 3 due to the apparent lack of signicant substitution differences.
c

The major differences between clones of a single strain were in the 392687 region, which contains indels that represent the gain or loss of repeat units. Table 5 lists the position of the indels, which can be located in Table 4. For example, Y-17430 C4, as compared with the dominant sequence, had an insert (398416) in the GT-rich region and a deletion (650670) in the TAC region of multiple repeats (Tables 4 and 5). Y-17434 C1 had two deletions: one at 432446, the other at 605629. Although the clone study was limited in numbers of strains analysed, none of the clones from individual strains was identical to sequences obtained from other strains. Exceptions were clones obtained from CBS 9090 and CBS 5905T (Table 5, Fig. 3). CBS 5905T C10 had an insert at 482523; as a result, CBS 5905T C10 was identical to CBS 9090 (with the exception of the single nucleotide substitution). Clones from CBS 9090 had three distinct sequences: (1) the dominant CBS 9090 sequence; (2) CBS 9090 C7, which had a deletion at 482523, was identical to CBS 5905T; and (3) CBS 9090 C3, which is
FEMS Yeast Res 7 (2007) 13991408

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

Origin of Phafa rhodozyma

1405

Fig. 3. Sequence analysis of nuclear rDNA IGS1 bases 60-392. The cladogram represents relationships between strains in the 5 0 region preceding the indels (see Table 3). Clones from CBS 9090 and CBS 5905T are included in the analysis. The tree was prepared by maximum-parsimony analysis (heuristic search) as an unrooted tree (PAUP 4.0b10). One of two equally parsimonious trees. Xanthophyllomyces dendrorhousT, type strain; Phaffia rhodozymaT, type strain. Bases 160 were trimmed due to the lack of complete sequence data for some strains. Numbers on branches represent branch lengths. Numbers in parentheses represent bootstrap percentages (450%).

not included in Table 5, does not represent a deletion/ insertion event. CBS 9090 C3 (Fig. 3) has the CBS 7918T type of sequence rather than the 5905T/9090 sequence. The two types of sequences are distinctly different (Table 4). CBS 9090 C3 aligns with ATCC 24230 with the exception of differences at four separate base positions (two of the differences are in the 361687 region, which is not included in Fig. 3).

states. CBS 5905T did not produce a sexual stage, either in our study or the Kucsera et al. (1998) study. Based on current information, the only known anamorphic strain is CBS 5905T.

Discussion
The present study was initiated by the conicting reports concerning the ability of UCD 67-210T to produce a sexual cycle. We initially addressed the possibility that a transfer strain had been mislabeled during the routine maintenance of the culture collection at UCD. This seemed unlikely because multiple studies over the years in the UCD laboratory had not indicated the presence of additional
c

Teleomorphic state
The NRRL strains (Table 1) and CBS 9090 formed basidia as illustrated by Golubev (1998). Previous studies demonstrated that CBS 6938, ATCC 24230 and UCD 67-202 (ATCC 24229) (Kucsera et al., 1998) also produced sexual
FEMS Yeast Res 7 (2007) 13991408

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

1406

J.W. Fell et al.

Table 5. Location of IGS1 insertions between copies within individual strains ( sequence repeat is absent, see Table 4) CBS5905 CBS5905 C10 CBS9090 CBS9090 C7 NRRLY17430 NRRLY17430 C4 NRRLY17434 NRRLY17434 C1 NRRLY17438 NRRLY17438 C2 NRRLY17441 NRRLY17441 C9 NRRLY27348 NRRLY27348 C2 ------482523 482523 -------------, 398416, 432446, -------, 650670 ------604649 ------------420435

650670 ------605629 -------

anamorphic strains in the Phaff Collection. In addition, a lack of published reports on the isolation of other anamorphic strains suggests that the type strain (67-210T) of P. rhodozyma represents a rare occurrence in nature. To clarify this point, we sequenced D1D2 and ITS regions of all of the Phafa/Xanthophyllomyces strains (16) in the Phaff Collection (data not shown) and did not nd another strain that resembled 67-210T. We also investigated the history of the maintenance transfers of UCD 67-210T. The Phaff Collection has maintained a series of lyophilized stocks of UCD 67-210T since 1967. We sequenced subcultures from several of these transfers and found that the April 1968 stock strain had a nucleotide sequence identical to that of CBS 5905T. In addition, the April 1968 stock did not produce a sexual cycle. Of note, a subculture of 67-210T was accessioned in May 1968 at CBS as CBS 5905T, the designated type strain of P. rhodozyma. The stocks dated June 1985, July 1985, March 1986 and April 1986 produced a typical Xanthophyllomyces sexual structure and they had identical IGS and ITS sequences, which were distinct from CBS 5905T. These subcultures were identical to strains that had been sent to us from other laboratories, which we had presumed to be strains mislabeled as 67-210T. To distinguish the different strains, the June 1985 transfer stock was designated 67-210.2 and submitted to CBS, where it was accessioned as CBS 9090. The presence of a teleomorphic strain in the transfer stocks of 67-210T is possibly the source of the reported sexual cycle in P. rhodozyma. In particular, Golubev (1995) reported a sexual cycle in a subculture of the type strain, which he accessioned as VKM Y-2274T. Golubev (personal communication) obtained the culture from H.J. Phaff (UCD) in 1975. Golubevs report of a teleomorphic state suggests that the VKM strain originated from the same line
c

as CBS 9090 (UCD 67-210.2) and the apparent strain shift took place prior to 1975. This information did not explain the origin of the teleomorphic strain. As a possible clue to solve this dilemma, we turned our attention to our observations of sequence heterogeneity. We found that CBS 9090 and CBS 5905T are heterologous in the ITS and IGS regions. CBS 9090 carries the CBS 5905T ITS and IGS sequences and CBS 5905T carries the CBS 9090 IGS sequence. Other strains of Xanthophyllomyces (Table 5) have multiple copies with indel differences, yet none of these strains had copies that are identical to other genotypes. Hypothetically, the mating-decient strain CBS 5905T (Kucsera et al., 1998) could have originated as a basidiospore from the parent CBS 9090 strain in the UCD 67-210T culture tube. Conceptually, the detection of a mating-decient strain, followed by a teleomorph, does not correlate with this hypothesis. The anticipation would be to nd the teleomorph, followed by the anamorph. However, culture purication methods are generally employed in the course of transfer and submission of subcultures to other collections. This method entails a streak culture and transfer of a single colony. By the repeated use of this technique over time, the anamorphic strain could have been sent to CBS and subsequently lost in the Phaff Collection to the more prevalent diploid form. In conclusion, we hypothesize that the origin of CBS 9090 in the culture collection tube labeled UCD 67-210T was not the result of a mislabeled strain; rather, strain UCD 67-210T may have been derived from a basidiospore from the parent teleomorph represented by strain CBS 9090. This hypothesis could be examined by micromanipulation and analysis of multiple basidiospores from CBS 9090. In the meantime, researchers should be aware of the heterologous nature of these strains and that some strains, marked as UCD 67-210T, represent CBS 9090. The two strains can be differentiated by ITS sequences (Table 3), either by sequence analysis or through the use of strain-specic PCR primers or probes. In addition to our analysis of the source of these strains, we gained insight on the use of sequence analysis to distinguish specic strains (Fell & Blatt, 1999). The genus Xanthophyllomyces appears to be associated with exudates from trees, such as birch, beech and dogwood, in temperate regions throughout the world. The strains isolated from the different geographic regions demonstrate considerable genotypic variability in the D1D2, ITS and IGS regions. Although our present comparison is geographically limited, a greater diversity can be anticipated as the search for new habitats is expanded. The D1D2 alignments distinguish three groups (Fig. 1), which are separated by differences at three positions (Table 1). Additional diversity was recorded in the ITS region (Fig. 2) with the greatest separation between the strains isolated from Betula and the strains
FEMS Yeast Res 7 (2007) 13991408

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

Origin of Phafa rhodozyma

1407

from Fagus and Cornus, which suggests that the ITS region could be an indicator of host specicity. Our study viewed ITS variability within the context of differentiating strains, although many systematic studies separate species at this level of sequence diversity. For example, Rhodotorula glutinis and Rhodotorula graminis are considered to be separate species based on 30% nuclear DNA relatedness, yet they are identical in the ITS region and differ at one base position in the D1D2. In contrast, Sporobolomyces holsaticus is a designated synonym of Sporidiobolous johnsonii based on 93% relatedness; they are identical in the D1D2 region and differ by 5 bp in the ITS. The extensive ITS variability between CBS 5905T and CBS 9090 (30 bp) may not be unusual as mating strains of Sporidiobolus salmonicolor differ by 26 bp (Scorzetti et al., 2002). The use of differences in the ITS region to separate species must be considered on a case-by-case basis: one rule does not t all. There are considerable ITS and IGS sequence differences between strains of Xanthophyllomyces, but at present, there is no additional biological data (such as mating genetics) to suggest the presence of more than one species. The apparent geographic strain isolation provides an opportunity to explore the state and rate of speciation within Xanthophyllomyces. The diversity in the IGS1 region is due to the presence of indels (Table 4) and differences at specic nucleotide positions (Fig. 3). The sequence specicity suggests that these markers could be used in ecology to track the source and distribution of strains. The method is complicated by the presence, in some strains, of intragenomic sequence heterogeneity, which requires cloning to obtain readable data. Intragenomic variation in the rDNA spacer regions is not uncommon among fungi and reports include ITS variation in Fusarium (ODonnell & Cigelnik, 1997) and IGS variability in hybrids of Cryptococcus neoformans (Bovers et al., 2006). The sexual state in Xanthophyllomyces is generally considered to initiate with parentbud mating. However, Golubev (1995) and Kucsera et al. (1998) reported mating between independent cells. Consequently, there is the potential for hybridization between strains. CBS 9090 carries both the 5905T/9090 and 7918T types of sequences in the ITS and IGS regions. CBS 9090 C4 (ITS) is nearly identical (3-bp difference) to CBS 7918T (Fig. 2) and CBS 9090 C3 (IGS) aligns with ATCC 24230 (difference of 2 bp, Fig. 3). However, the distinct tree hosts and geographic distributions complicate the hypothesis of hybridization. The potential of sequence heterogeneity caused by polymorphisms in the rDNA repeat units could be a more plausible explanation. Libkind et al. (2007) reported an extended range of Xanthophyllomyces to Argentina. The authors isolated strains from fruiting bodies of the ascomycetes Cyttaria hariotti, which is a parasite of a southern beech tree,
FEMS Yeast Res 7 (2007) 13991408

Nothofagus sp. Based on their ITS analysis, the yeast strains from Nothofagus represent a separate clade, which is distinct from clusters representing other tree hosts. Their IGS analysis indicates that the Nothofagus yeasts are related to CBS 9090. The Libkind et al. (2007) article appeared while our manuscript was in revision following journal review. Consequently, their data were not included in the present study. This extended geographic range and molecular diversity is important for future phylogenetic studies of strains with consideration of haplotype network analyses (Posada & Crandall, 2001; Templeton et al., 2005) and of the structures and evolutionary rates of indels (Mes et al., 2000; Yamane et al., 2006). Strains of Phafa/Xanthophyllomyces are extensively studied and utilized throughout the world. Major corporations produce astaxanthin for aquaculture, whereas academic research examines various aspects including the carotenoid synthesis pathway, culture conditions for improved expression, and new applications such as colorants for egg yolks (Johnson, 2003). Clarication of the taxonomic designation and molecular diversity of the strains can be important for patent and safety concerns. The present work should assist researchers in this regard.

Acknowledgements
This study was supported by NSF Grant DEB 0206521. We gratefully acknowledge C.P. Kurtzman, USDA, Peoria, IL, for supply of NRRL strains and the laboratory assistance with mating studies provided by Nicholas Pinel with NSF REU support. We acknowledge anonymous journal reviewers, whose comments and questions were instrumental in the revision of the manuscript.

References
Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL & Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res 6: 599607. Fell JW & Blatt G (1999) Separation of strains of the yeasts Xanthophyllomyces dendrorohous and Phafa rhodozyma based on rDNA IGS and ITS sequence analysis. J Ind Microbiol Biotech 21: 677681. Fell JW, Roeijmans H & Boekhout T (1999) Cystolobasidiales, a new order of basidiomycetous yeasts. Int J Syst Bacteriol 49: 907913. Golubev WI (1995) Perfect state of Rhodomyces dendrorhous (Phafa rhodozyma). Yeast 11: 101110. Golubev WI (1998) Xanthophyllomyces Golubev. The Yeasts, A Taxonomic Study, 4th edn (Kurtzman CP & Fell JW, eds) pp. 718719. Elsevier, Amsterdam, The Netherlands.

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

1408

J.W. Fell et al.

Hasegawa M, Kishino H & Yano T (1985) Dating the human-ape split by a molecular clock of mitochondrial DNA. J Mol Evol 22: 160174. Johnson EA (2003) Phafa rhodozyma: a colorful odyssey. Ind Microbiol 6: 169174. Kucsera J, Pfeiffer I & Ferenczy J (1998) Homothallic life cycle in the diploid red yeast Xanthophyllomyces dendrorohous. Antonie van Leeuwenhoek 73: 163168. Libkind D, Rufn A, van Broock M, Alves L & Sampaio JP (2007) Biogeography, host specicity and molecular phylogeny of the Basidiomycetous yeast Phafa rhodozyma and its sexual form, Xanthophyllomyces dendrorhous. Appl Environ Microbiol 73: 11201125. Mes THM, Kuperus P, Kirschner J, Stepanek J, Oosterveld P, Storchova H & den Nijs JCM (2000) Hairpins involving both inverted an direct repeats are associated with homoplasious indels in non-coding chloroplast DNA of Taraxacum (Lactuceae: Asteraceae). Genome 43: 634641. Miller MW, Yoneyama M & Soneda M (1976) Phafa, a new yeast genus in the Deuteromycotina (Blastomycetes). Int J Syst Bacteriol 26: 286291. ODonnell K & Cigelnik E (1997) Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the

fungus Fusarium are nonorthologous. Mol Phylogenet Evol 1: 103116. Phaff HJ, Miller MW, Yoneyama M & Soneda M (1972) A comparative study of the yeast orae associated with trees on the Japanese islands and on the west coast of North America. Proc IV IGS: Fermentation Technology Today (Terui G, ed.), pp. 759774: Kyoto Society of Fermentation Technology, Osaka, Japan. Posada D & Crandall KA (2001) Intraspecic gene genealogies: trees grafting into networks. Trends Ecol Evol 16: 3745. Sambrook J & Russell DW (2001) Molecular cloning: a laboratory manual. Vol. 2, 3rd edn. Cold Springs Harbor Laboratory Press, New York, NY. Scorzetti G, Fell JW, Fonseca A & Statzell-Tallman A (2002) Systematics of basidiomycetous yeasts: a comparison of large sub-unit D1D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res 2: 495517. Templeton AR, Maxwell T, Posada D, Stengard JH, Boerwinkle E & Sing CF (2005) Tree scanning. A method for using haplotype trees in phenotype/genotype association studies. Genetics 169: 441453. Yamane K, Yano K & Kawagara T (2006) Pattern and rate of indel evolution inferred from whole chloroplast intergenic regions in sugarcane, maize and rice. DNA Res 13: 197204.

2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

FEMS Yeast Res 7 (2007) 13991408