Вы находитесь на странице: 1из 8
Protein Expression and Puri W cation 47 (2006) 303–310 www.elsevier.com/locate/yprep Gi/o proteins: Expression for
Protein Expression and Puri W cation 47 (2006) 303–310 www.elsevier.com/locate/yprep Gi/o proteins: Expression for

Protein Expression and Puri W cation 47 (2006) 303–310

Protein Expression and Puri W cation 47 (2006) 303–310 www.elsevier.com/locate/yprep Gi/o proteins: Expression for

www.elsevier.com/locate/yprep

Gi/o proteins: Expression for direct activation enquiry

Lorenzo Di Cesare Mannelli a, ¤,1 , Alessandra Pacini b,1 , Annarita Toscano b , Martina Fortini c , Debora Berti c , Carla Ghelardini a , Nicoletta Galeotti a , Piero Baglioni c , Alessandro Bartolini a

a Department of Preclinical and Clinical Pharmacology, University of Florence, Viale Pieraccini 6, 50134 Florence, Italy b Department of Anatomy, Histology and Forensic Medicine, Anatomy Section, University of Florence, Viale Morgagni 85, 50134 Florence, Italy c Department of Chemistry and CSGI, University of Florence, Via della Lastruccia 3, 50019 Sesto F.no, Italy

Received 8 September 2005, and in revised form 7 November 2005 Available online 5 December 2005

Abstract

G protein-mediated pathways are fundamental mechanisms of cell signaling. In this paper, the expression and the characterization of the i1 , i3 , o1 , 1 , and 2 subunits of the human G protein are described. This approach was developed to evaluate the G protein activa- tion proW le of new compounds. pCR-TOPO T7 vectors, engineered to contain the target sequences, were used to transform Escherichia coli competent cells. Subunits were over-expressed in a preparative scale as fusion proteins with a six-histidine tag, and subsequently puri- W ed by metal chelate chromatography. Afterward, the His-tag was removed by enterokinase digestion, and the secondary structures of the recombinant subunits were analyzed by circular dichroism. To assess the functionality of the subunits, the rate of GTP hydrolysis and GTP S binding were evaluated both in the absence and in the presence of two modulators: the peptidic activator Mastoparan and the non-peptidic activator N-dodecyl-lysinamide (ML250). Tests were conducted on isolated -subunit and on heterotrimeric complex, alone or reconstituted in phospholipidic vesicles. Our results show that recombinant subunits are stable, properly folded and, fully active, which makes them suitable candidates for functional studies. © 2005 Elsevier Inc. All rights reserved.

Keywords: Human Gi proteins; Escherichia coli expression; Puri W cation; Circular dichroism; Mastoparan; Receptor-independent G protein modulation; Direct G protein activator

G proteins are an evolutionarily highly conserved group of molecules known as heterotrimeric guanine nucleotide- binding proteins. Numerous molecules, such as hormones, neurotransmitters, chemokines, local mediators, and sensory stimuli, exert their e V ect on cells by binding to hep- tahelical membrane receptors coupled to heterotrimeric G proteins. When a ligand interacts with a heptahelical recep- tor on the surface of the cell, the ligand either stabilizes or induces a conformation in the receptor that activates a het- erotrimeric G protein, composed of -, -, and -subunits, on the inner membrane surface of the cell [1].

* Corresponding author. Fax +39 0554271280. E-mail address: lorenzo.mannelli@uni W .it (L. Di Cesare Mannelli).

1 These authors contributed equally to this work.

1046-5928/$ - see front matter © 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.pep.2005.11.005

According to the current knowledge, 17 genes encode for 23 mammalian G -subunits [2–4], 5 genes encode for G - subunits [5], and 12 genes encode for G -subunits [2,6]. All -subunits share biochemical and structural properties and each of them can be assigned to structurally and function- ally related groups [7,8]. Classically, G proteins are divided into four families based on similarity of their -subunits:

G i/o , G s , G q/11 , and G 12/13 . When bound to GTP, G -subunits can regulate intracellular e V ectors, such as adenylyl cyclase, phospholipase C , K + , and Ca 2+ channels, and cyclic GMP phosphodiesterases. G protein - and -subunits are tightly associated, and form stable dimers that cannot be separated unless the pro- teins are denatured. Hence, from a functional point of view, they are considered as a single entity, the -dimer. The number of -dimers and, most signiW cantly, of oligomeric

304

L. Di Cesare Mannelli et al. / Protein Expression and Puri W cation 47 (2006) 303–310

G

proteins that can be produced by combinatorial associa-

correlation between pertussis toxin (PTX) 2 -mediated block

tion is presumably very large [7,9,10]. The cycle of G protein activation can be broken down into a four-step reaction: (1) In the basal state, the G pro- tein is an -heterotrimer with GDP bound to the -sub- unit. (2) The agonist-liganded, activated-receptor interacts with the cognate G protein and accelerates the rate of GDP release from the -subunit. (3) In the presence of Mg 2+ ,

of adenylyl cyclase inhibition, and ADP ribosylation of a substrate of approximately 40 kDa. Biochemical puriW ca- tion and molecular cloning have led to the identi Wcation of eight PTX-sensitive G i subunits [4,8], six of which (G i1 , G i2 , G i3 , G t1 , G t2 , and G g ) are products of separate genes, while G o1 and G o2 are splice variants of the same gene. G z is PTX-insensitive but is numbered as a member

-subunit binds GTP, and subsequently G -GTP dissoci- ates from -dimer. Both -subunit and -dimer are then free to activate downstream eV ectors. (4) The duration of the signal is determined by the intrinsic GTP hydrolysis rate of the G -subunit and the subsequent reassociation of G -GDP with G [1,2].

of the Gi protein family on the basis of the similarity of function. Mutations in the G i genes have been associated with tumors of the adrenal cortex, endocrine tumors of the ovary [21], and pituitary ACTH-secreting adenomas [22]. A somatic mutation of the GNAI2 gene, coding for the iso-

During activation and deactivation, the G protein sub- units interact sequentially with a series of reaction part- ners, and these interaction points and binding sites provide opportunities for targeting by synthetic ligands, guanine nucleotides, compounds that act at the receptor/

form 2 of G i , has been correlated to an idiopathic ventric- ular tachycardia [23]. Recently, our group has identi Wed a Gi protein hypofunctionality in lymphocytes of subjects with either headache or Wbromialgia [24,25]. In this view, it is of particular interest to obtain new compounds that

G

protein interface or that block the interaction between

directly activate Gi proteins.

G

protein subunits and e V ectors, as well as regulatory

Up to now, only few molecules are known to directly

molecules.

bind Gi proteins in a receptor-independent manner [26]:

Moreover, the receptors are the target for many pharma- ceutical products and are the focus of intense drug discov- ery eV orts; traditionally, the agonist binding site is the point

peptides, such as Mastoparan [27,28], Substance P, and Compound 48/80 [29], peptidic hormones, and low molecu- lar weight compounds [30,31], such as alkyl-substituted aminoacid amides, like N-dodecyl-lysinamide (ML250) [32], and lipoamines [33], but at fairly high doses. More- over, the properties of new compounds are typically evalu- ated in a cellular system. Nevertheless, the ability to stimulate the Gi/o protein signal in a cellular system fails to demonstrate a direct action on G proteins, because receptor interaction cannot be excluded. To evaluate the e Y ciency and the potency of new molecules, synthesized as candidate for directly activate Gi proteins, in an isolated protein sys- tem, a DNA recombinant-based method was set up to obtain puri Wed Gi proteins.

Materials and methods

of

intervention. Another possible target for modulation is

G

proteins that oV er many binding sites, for example the

receptor–G protein interface, which has been deWned in some detail and involves the intracellular loops of the seven-transmembrane helix receptors with several regions

heterotrimeric G proteins [11,12]. On the other hand, many receptors couple to multiple G proteins and thus cellular stimulation by a receptor often results in the concerted activation of several distinct G pro- teins leading to the recruitment of multiple eV ectors that produce the biological response [13]. On the contrary, there are pathological conditions in which multiple receptors converge on a common G protein-dependent signaling pathway. For example, cardiac hypertrophy is, at least in part, mediated by the chronic stimulation of several Gq-coupled receptors. Akhter et al. [14] have inhibited suc-

on

cessfully G q , uncoupling all receptors from G q itself, in a cardiac hypertrophy murine model. Therefore, it would be a powerful preclinical and clinical tool to control the signaling pathway by direct modulation

Materials

TriReagent for total RNA extraction was purchased from Sigma. SuperScript One-Step RT-PCR System, pCR T7-NT-TOPO TA vector, Escherichia coli strain DH5- competent cells, and BL21(DE3) plysS One Shot competent cells were purchased from Invitrogen. Luria–Bertani (LB) broth was purchased from Invitrogen. Tris–HCl, ethylene- diaminetetraacetic acid (EDTA), isopropyl- -D-thiogalac- toside (IPTG), Triton X-100, lysozyme, and bicinchoninic acid were purchased from Sigma. His-Bind Resin for Ni a Y nity chromatography, EKMax, EK-Away resin, and protein marker were purchased from Invitrogen. Protease

of

the single G protein in a receptor-independent manner.

This goal can be achieved by compounds that selectively bind distinct G proteins [15,16]. Speci Wc direct G protein ligands would be helpful in disease states associated with altered G protein mutations and functions. Mutations in the genes that encode for many G s isoforms are demon- strated to be involved in Albright Hereditary Osteodystro- phy [17], in cancerous disease like GH-secreting pituitary adenomas, in thyroid tumors [18], and bipolar aV ective dis- orders [19]. G inhibitory subunits (G i/o ) were identiW ed, for the

2 Abbreviations used: PTX, pertussis toxin; LB, Luria–Bertani; EDTA, ethylenediaminetetraacetic acid; IPTG, isopropyl- -D-thiogalactoside; His 6 , six-histidine; EK, enterokinase; CD, circular dichroism; ORF, open reading frame; MP, Mastoparan.

W rst time, by Katada and Ui [20] that demonstrated a direct

L. Di Cesare Mannelli et al. / Protein Expression and PuriW cation 47 (2006) 303–310

305

inhibitor cocktail was purchased from Roche. [ 32 P]GTP and [ 35 S]GTP S were supplied by Perkin-Elmer. Polyclonal antibodies for G protein i1 , i3 , o1 , 1 , and 2 subunits, horse radish peroxidase-conjugated secondary antibody, and i1 , i3 standards were purchased from Santa Cruz. Western blot detection kit Opti 4-CN was purchased from Bio-Rad. Mastoparan was purchased from Alexis. N-Dode- cyl-lysinamide (ML250) was synthesized by Prof. Fulvio Gualtieri and co-workers, Department of Pharmaceutical Science, University of Florence, according to the synthetic pathway proposed in [32].

RT-PCR and plasmid construction

Total RNA from human brain, heart, and lung (brain for isoforms i1 and io , heart for isoforms i3 and 1 , and lung for isoform 2 ) was puriW ed using TriReagent (Sigma) and used to synthesize cDNA by SuperScript One-Step RT-PCR System (Invitrogen) according to the manufac- turer’s protocol. The cDNAs encoding human i1 and i3 isoforms were generated by two sequential ampliW cation reactions. In the Wrst reaction, primer pairs were designed to obtain two diV erent fragments of the CDS (fragment A and fragment B) which shared a common primer: the downstream primer of the A fragment and the upstream primer of the B fragment. After reverse transcription and ampliW cation of the two fragments, 10 L of each PCR product was run on 1.2% agarose gel and the ethidium bro- mide-stained DNA bands were excised from gel. Then, 5 L of the excised DNAs was used as template for a second ampliW cation reaction with the forward primer of the A fragment and the reverse primer of the B fragment. For o1 , 1 , and 2 subunits PCRs were carried out in one-step with upstream primers annealing to the 5 -end starting from ATG and downstream primers complementary to the 3 UTR region. The conditions of PCR cycles were 94 °C, 2 min; 94 °C, 15 s; 60 °C 30 s; 68 °C, 1 min, and 35 cycles; and 68 °C, 5 min. All the primers were designed, using published sequence informations, as described in Table 1. cDNAs of i1 , i3 , io , 1 , and 2 subunits were cloned into E. coli expression vec- tors, pCR T7-NT-TOPO TA (Invitrogen), which were named as expression plasmids pCR- i1 , pCR- i3 , pCR- o1 , pCR- 1 , and pCR- 2 , respectively. The resulting vectors encoded G protein subunits, a six-histidine (His 6 ) sequence, and an enterokinase cleavage site. After ampliW cation, puri- Wcation, and sequencing, the constructed vectors were transformed using E. coli strain BL21(DE3)plysS

competent cells for protein expression using the following protocol. LB media (10 mL) containing 100 g/mL ampicil- lin and 34 g/mL chloramphenicol were inoculated with 30 L of the glycerol stock of BL21(DE3)plysS pCR-sub- unit. After overnight at 37 °C, 500 L of each culture was used to inoculate 10 mL of the LB media with ampicillin and chloramphenicol. Cells were grown by shaking at 37 °C for about 2 h to obtain a cell density that corresponds to an absorbance of 0.8 at 600 nm. The expression of the

His 6 -subunit fusion proteins was induced by the addition of IPTG to a W nal concentration of 1 mM. The cultures were shaken continuously for 16 h at 37 °C, and the cells were subsequently harvested by centrifugation (Beckman model

J2-21)

stored at ¡ 80 °C until use.

at 5000 rpm for 5 min at 4 °C. The cell pellets were

Puri W cation of His 6 -subunit fusion proteins

Cell pellets were resuspended in 8 mL of 50 mM Tris– HCl buV er, pH 8.0, containing protease inhibitor cocktail (Roche). Cells were incubated for 30 min on ice with 8 mg lysozyme and then sonicated with six 10-s bursts at high intensity. DNA was sheared by passing the preparation through an 18-gauge syringe needle several times. The lysates were centrifuged at 3000g for 15 min to pellet the insoluble debris. Ni aYnity chromatography (IMAC, immobilized metal aYnity chromatography) was used to purify the His-tag fusion proteins. The Ni aYnity resin (2 mL) was packed into a column according to the protocol provided by the manu- facturer and loaded with the cell lysates. Columns were washed four times with a buVer containing Tris–HCl 50 mM and 20mM imidazole (pH 8.0). The bound His-tag fusion proteins were eluted by applying 10 mL of a buVer contain- ing Tris–HCl 50 mM with 250 mM imidazole (pH 8.0). One milliliter fractions were collected. The protein eluates were dialyzed against Tris–HCl 50 mM, pH 8.0, and SDS–PAGE was performed using 4–20% gradient gels to determine the presence of the fusion proteins by anti-subunit primary anti- bodies (dilution 1:1000) and HRP-conjugated secondary antibody (dilution 1:5000). The yield of the fusion proteins was estimated to be about 8–10mg/L of culture. Protein concentration was evaluated by bicinchoninic acid assay.

Fusion protein cleavage and puriW cation of subunits

The fusion proteins were cleaved by enterokinase (EK) digestion according to the manufacturer’s protocol. In a

Table 1 Accession number for GenBank protein sequence and primer used to obtain G protein open reading frame

 

Upstream primer

Downstream primer

GenBank Accession No.

i1

ATGGGCTGCACCTGAGCG

CAAGACTCTAGTCTACAGAGATCC

NM_002069

i3

ATGGGCTGCACGTTGAGCG

GTCTGGTCTCAACACTCCACAC

NM_006496

oi

ATGGGATGTACTCTGAGCGCAGA

CAGGACAAGAGGTCAGTACAAGC

NM_020988

1

ATGAGTGAGCTTGACCAGTTACGG

GCTACTGGCGTTAGTTCCAGATCT

NM_002074

2

ATGGCCAGCAACAACACCGC

CCTCTCAAAGACTTAAAGGATGGC

BC020774

306

L. Di Cesare Mannelli et al. / Protein Expression and Puri W cation 47 (2006) 303–310

representative run, approximately 20 g of subunit fusion protein with His 6 -tag was cleaved through incubation with EKMax for 16 h at 37 °C in a total volume of 30 L EKMax BuV er (500 mM Tris–HCl, pH 8.0, 10 mM CaCl 2 , and 1% Tween 20). After digestion, EKMax was removed by EK-Away resin (Invitrogen) following the manufac- turer’s protocol. Proteins in Tris–HCl 50 mM, pH 8.0, solu- tions were examined by SDS–PAGE and immunoblot to verify the presence and the integrity of the G subunits using speci Wc antibodies (Santa Cruz). Western blotting results are shown in Fig. 1.

Circular dichroism

G i/o protein subunits (3 M) were incubated for 10 min at room temperature (23–25 °C) in a buV er of Tris–HCl 50 mM (pH 8.0). Circular dichroism (CD) spectra were recorded at room temperature on a J-715 spectropolarime- ter (JASCO, Tokyo, Japan) using a 1 mm path length Hellma quartz cuvette. For each sample, six scans were accumulated at 50 nm/min and measurements were repeated at least twice using freshly prepared solutions to test reproducibility. Background from bu V er solution and empty cell contribution was subtracted from each spectrum.

Liposome preparation

Soy phosphatidylcholine was purchased from Avanti Polar Lipids (Alabama). Multilamellar vesicles (10 mg/mL

220 130 90 70 60 α io α i1 α i3 β 1 40 30
220
130
90
70
60
α io
α i1
α i3
β 1
40
30
20
15
10
γ
2

Fig. 1. SDS–PAGE analysis and immunoblot of puri W ed and cleaved G proteins. E. coli were harvested at 16 h after IPTG induction. Bacterial lysates were processed by IMAC and puri W ed proteins were subjected to EK digestion followed from enzyme removal by EK-Away resin. Recom- binant subunits were evaluated by Western blot using primary polyclonal speci W c antibodies and HRP-conjugated secondary antibody.

total lipid concentration) have been prepared by dispersing

a dry lipid Wlm in the bu V er (50 mM Tris–HCl bu V er, pH

8.0). These lipids spontaneously form in water polydisperse vesicular suspensions by simple shaking. This dispersion

was subjected to 5 min of forceful shaking, frozen (liquid

N 2 ), and thawed (40 °C) six times. Then it was sized down

to unilamellar vesicles of approximately 90 nm radius by 11 repeated extrusion through two stacked polycarbonate W lters with 200 nm-sized pores, followed by 11 repeated extrusions through 100 nm-sized pores membranes [34]. Filtration was performed at room temperature with the Extruder by Lipex Biomembranes, Vancouver (Canada), and Nucleopore polycarbonate membranes. The size distri- bution of unilamellar liposomes was veri Wed by dynamic light scattering.

Reconstitution of phospholipidic vesicles

G protein solution was mixed with liposome to a Wnal concentration of 150 nM for -subunits, 750 nM for -dimer and 0.3 mg/mL for liposomes, in Tris–HCl 50 mM (pH 8.0). The system was incubated at room temperature for 20 min and at 4 °C overnight.

GTP hydrolysis

GTPase activity was measured using recombinant G i1 protein according to a standard method [35]. Heterotri- meric complex ( ) was obtained by mixing i1 with 1 2 subunits in a 1/5 concentration ratio and incubated for 1 h at 4 °C. Three picomoles of complex alone or incorpo- rated into lipidic vesicles was incubated at 20 °C for 30 min in 100 L of a reaction mixture containing 50 mM Tris–HCl (pH 8.0), 1 mM EDTA, 1 mM DTT, 0.1% Lubrol, 1.1 mM MgSO 4 , and 0.5 M [ - 32 P]GTP (0.1 Ci per tube). Reaction was stopped by the addition of 700 L of an ice-cold 5% (w/v) charcoal suspension in 50 mM NaH 2 PO 4 . The mix- ture was centrifuged at 13,000g for 18 min at 4 °C. A frac- tion of the supernatant (200 L) was counted in 2 mL scintillation solution. The high-a Ynity GTPase activity was calculated by subtracting the 32 Pi released in the presence of 100 M cold GTP from total 32 Pi hydrolyzed.

GTP S binding

Binding of GTP S (the non-hydrolyzable GTP analog) to recombinant G protein was measured according to a standard method [35]. Three picomoles of -subunit in native conditions or reconstituted into lipoid vesicles was

incubated at 30 °C (20 °C for G o ) for 30 min in 100 L of a reaction mixture containing 50 mM Tris–HCl (pH 8.0), 1 mM EDTA, 1 mM DTT, 1.1 mM MgSO 4 , and 0.1 M [ 35 S]GTP S (0.1 Ci/tube). Reaction was stopped by the addition of 1 mL of an ice-cold stop bu V er (consisting of 10 mM Tris–HCl, pH 8.0, 25 mM MgCl 2 , and 100 mM NaCl). The diluted samples were Wltered through cellulose nitrate membranes (0.45 m pore size) under weak vacuum.

L. Di Cesare Mannelli et al. / Protein Expression and PuriW cation 47 (2006) 303–310

307

The W lters were washed with 12 mL of the same buV er and dried. The retained radioactivity was quanti Wed by scintilla- tion spectroscopy. SpeciW c binding was calculated by sub- tracting the GTP S bound in the presence of 100 M cold GTP S from total binding.

Statistical analysis

All experimental results are expressed as means § SEM and statistical analysis was performed by ANOVA. P < 0.05, or P < 0.01 where indicated, was considered as sig- niW cant.

Results and discussion

Plasmid construction and protein expression

Recombinant G protein i1 and i3 subunits were obtained by RT-PCR with two sequential ampliW cation reactions (data not shown). In the W rst PCRs, two frag- ments (A and B) of the cDNA were obtained; after DNA excision from ethidium bromide-stained gel, a second ampliW cation produced the entire open reading frame (ORF). The ampliW cation products of G protein o1 sub- unit, and of 1 and 2 subunits were obtained by a one-step RT-PCR. cDNAs were subcloned into the expression vector pCR- TOPO-T7 (Invitrogen). The pCR-TOPO T7 plasmid was ampliW ed by TOP10F’ E. coli cells and the appropriate con- structs were identiWed by restriction digestion after trans- formation into such strain. Sequencing of pCR-TOPO T7/G , pCR-TOPO T7/G , and pCR-TOPO T7/G have conW rmed the homology with GenBank sequences. These constructs were transformed using E. coli BL21(DE3)plysS cells and the further expressions utilized LB media after induction with IPTG, as described under Materials and methods. After cellular lysis, the proteins were puri Wed by IMAC and analyzed by SDS–PAGE and immunoblot. The result for all subunits was at least 80% purity (data not shown). Eight to ten milligrams of fusion was produced from 1 liter of culture. Histidine-tag was removed by EKMax, and proteins were puriW ed by EK-Away resin (Invitrogen). Western blot analysis was performed to verify protein speciW city and integrity (results are shown in Fig. 1). G i1 , G i3 , and G o1 subunits showed a 41 kDa molecular weight, G 1 showed a 36 kDa molecular weight and G 2 5 kDa. Recombinant protein molecular weights are comparable with the actually determined molecular weights and, at least for i subunits, with standard G pro- teins (data not shown). After cleavage and puriW cation the yield of human G protein subunits was 3.5–4 mg/L of culture.

Circular dichroism analysis

Circular dichroism (CD) spectroscopy was carried out as a preliminary structural analysis on the expressed -subunits

of G protein to assess their secondary structure and com- pare the same to the physiological human subunits. On the basis of the primary sequence the -helical con- formation is expected to prevail over the other structural elements [36]. Fig. 2 shows CD spectra of i1 , i3 , and o1 subunits (3.0 M) in Tris–HCl 50 mM bu V er solution (pH 8.0); the spectra show the double minima at 222 and 208 nm, typical signature of -helical conformation. These results agree with structural properties of extracted G protein -subunits obtained both by CD [37] and crystallographic analysis [38,39]. The proper refolding in solution, inferred from this spec- troscopic investigation, provides a basis for functionality studies.

Evaluation of G protein functionality: GTPase activity and GTP S binding

To evaluate the functionality of recombinant G proteins, we measured the GTPase activity of the -subunits and the complex, in the absence and in the presence of phos- pholipidic vesicles. Fig. 3 shows that, according to the pub- lished and well-known kinetic data [35], the level of phosphate hydrolyzed by G i/o was 0.1 mol/mol-G /min (Basal, white bar). On the contrary, in the presence of 150 nM of the -dimer ( / 1:5 molar ratio), which physi- ologically inhibits GTPase activity, the GTP hydrolysis of 30 nM G was reduced by 36% (Basal, striped white bar). Aimed to obtain a more physiological system, we recon- stituted the G proteins in phospholipidic vesicles because the presence of a phospholipidic bilayer creates an environ- ment analogous to plasmatic membrane that would be a better condition for the functional protein folding. When G was mixed with phospholipids, no change in GTP hydrolysis was observed (Basal, dark bar). Nevertheless,

0 -2000 Gα o1 Gα i1 Gα i3 -4000 200 220 240 260 [θ] λ
0
-2000
Gα o1
Gα i1
Gα i3
-4000
200
220
240
260
[θ] λ (mdeg cm 2 dmol -1 )

λ (nm)

Fig. 2. CD analysis. Circular dichroism spectra of 3 M G i1 , G i3 , and G o1 subunits in Tris–HCl 50 mM bu V er solution (pH 8.0).

308

L. Di Cesare Mannelli et al. / Protein Expression and Puri W cation 47 (2006) 303–310

** 0,22 Gα + liposomes 0,20 Gαβγ Gαβγ + liposomes 0,18 0,16 0,14 ^ ^
**
0,22
Gα + liposomes
0,20
Gαβγ
Gαβγ + liposomes
0,18
0,16
0,14
^
^
0,12
0,10
*
0,08
0,06
0,04
0,02
0,00
Basal
Mastoparan 1x10 -4 M
mol 32 P/mol G i/o /min

Fig. 3. Evaluation of GTP hydrolysis. Comparison of GTPase activity between i1 subunit alone and heterotrimeric complex i1 , incubated with or without liposomes. E V ect of MP 1 £ 10 ¡ 4 M on GTPase activity of i1 subunit alone and of heterotrimeric complex i1 , incubated in the presence or in the absence of liposomes. *P < 0.05 vs basal level of G , P < 0.05 vs G , and **P < 0.01 vs basal level of G in the presence of liposomes (ANOVA). Data are expressed as means § SEM.

0,25 Mastoparan * ML250 0,20 * * 0,15 0,10 0,5 0 1x10 -7 1x10 -6
0,25
Mastoparan
*
ML250
0,20
*
*
0,15
0,10
0,5
0
1x10 -7
1x10 -6
1x10 -5
1x10 -4
M
mol 32 P/mol G i/o /min

Mastoparan and ML250 concentration

Fig. 4. Comparison of GTP hydrolysis in the presence of MP and ML250. GTP hydrolysis was evaluated on recombinant G i1 protein reconsti- tuted in phospholipidic vesicles and incubated with increasing concentra- tion (1 £ 10 ¡ 7 –1 £ 10 ¡ 4 M) of MP or ML250 in the presence of 100 M free Mg 2+ . *P < 0.01 vs basal level of G i1 (ANOVA). Data are expressed as means § SEM.

G complex activity in the presence of phospholipids was able to revert the inhibition due to the presence of the -dimer (Basal, striped dark bar). This e V ect was probably due to the presence of phospholipids that induce a G -sub- unit conformation that facilitates its hydrolytic activity. According to the previous reports [27,28], the same experi- ments performed in the presence of the peptidic activator Mastoparan (MP), demonstrated that MP 100 M was not able to stimulate the GTPase activity of isolate -subunits (Fig. 3, MP 1 £ 10 ¡ 4 M, white bar) but, the same concentra- tion of MP, signiWcantly enhanced the hydrolysis of GTP when the -subunit was bound with the -dimer, both in the absence or in the presence of phospholipidic vesicles (Fig. 3, MP, striped white and dark bars, respectively). Par- ticularly, MP 100 M exerted the maximum e V ect when G protein was reconstituted in liposomes as heterotrimeric complex: MP increased the level of phosphate hydrolyzed from 0.11 to 0.20 mol/mol-G /min (Fig. 3, Mastoparan, striped dark bar). Starting from these results, we evaluated the rate of GTP hydrolysis of the heterotrimeric complex in the presence of increasing concentration of MP. Results are shown in Fig. 4: MP (white bars) induced an increase in GTP hydro- lysis in a dose dependent manner, accelerating nucleotide hydrolysis up to 86% (at 100 M) with respect to the basal level. Moreover, according to Higashijima et al. [27,28] and Oppi et al. [35], we found that the rate of MP-stimulated GTP hydrolysis was function of Mg 2+ concentration, with 100 M magnesium as optimal concentration for maximal MP activity (data not shown). MP is a tetradecapeptide that forms a cationic amphiphilic -helix, probably 100 M Mg 2+ allows optimal conformation for interaction between peptide and G protein.

To compare the MP stimulation of GTP hydrolysis with non-peptidic compound, we measured the e V ects of ML250. Notably, graphic in Fig. 4 (dark bars) shows that, in the presence of 100 M Mg 2+ , the Gi protein activator ML250 increased the hydrolysis of GTP up to 43% with respect to the basal level, but with a lesser extent compared with MP. Finally, we evaluated the binding of GTP S, a non-hydrolyzable analog of GTP, on G i/o subunits, in the presence of increasing concentration of ML250 (100 nM– 100 M concentration range). Results are indicated in Fig. 5, where it is shown that ML250 stimulated G i1 (dark

120 100 * * 80 * * 60 40 20 0 10 -6 10 -5
120
100
* *
80
* *
60
40
20
0
10 -6
10 -5
10 -4
GTPγS bound(fmol)

ML250 Concentration (M)

Fig. 5. GTP S binding. EV ect of increasing concentrations of compound ML250 on the stimulation of [ 35 S]GTP S binding on G i1 ( ), G i3 ( ), and G o1 ( ) subunits. *P < 0.01 vs e V ect of the same concentrations of ML250 on G i1 and G i3 proteins. Data are expressed as means § SEM.

L. Di Cesare Mannelli et al. / Protein Expression and PuriW cation 47 (2006) 303–310

309

squares) and G i3 (dark circles) with a lesser potency com- pared with G o1 (white circles; EC 50 47.9 § 2.0 and

43.9 § 1.4 for G i1 and G i3 , respectively, EC 50 27.8 § 0.7 for G o1 ). Moreover, 50 M ML250 was able to stimulate GTP S binding, with respect to basal activity, 10-fold for

G i1 and G i3 , and 25-fold for G o1 .

Conclusion

We have reported the expression and puriWcation of

G i1 , G i3 , G o1 , G 1 , and G 2 subunits as a 6 £ His fusion

proteins with pCR-TOPO T7 vector. The His 6 was used for the puriWcation of the protein subunits by chelating chro- matography. Also, an enterokinase cleavage site was used to enable an eYcient removal of the His-tag. IMAC pro- vided a su Y cient amount of puriWed protein for subsequent examination as con Wrmed by CD experiments. These mea-

surements showed that the bacteria-expressed Gi/o sub- units were useful for functional analysis. Aimed to evaluate

a direct interaction among these subunits and peptidic and

non-peptidic compounds, we clearly demonstrated that the developed method can be applied to study the pro Wle of new synthesized molecules. Taken together, these results showed that the expressed Gi/o subunits were properly folded, fully active, and therefore suitable for further structural and functional studies.

References

[1] H.E. Hamm, The many faces of G protein signalling, J. Biol. Chem. 273 (1998) 669–672. [2] S.R. Sprang, G protein mechanism: insights from structural analysis, Annu. Rev. Biochem. 66 (1997) 639–678. [3] M.I. Simon, M.P. Strathmann, N. Gautam, Diversity of G proteins in signal transduction, Science 252 (1991) 802–808. [4] G.B. Downes, N. Gautam, The G protein subunit gene families, Genomics 62 (1999) 544–552. [5] A.J. Watson, A. Katz, M.I. Simon, A W fth member of the mamma- lian G protein -subunit family, J. Biol. Chem. 269 (1994)

22150–22156.

[6] K. Ray, C. Kunsch, L.M. Bonner, J.D. Robishaw, Isolation of cDNA clones encoding eight di Verent human G protein gamma subunits, including three novel forms designated the gamma 4, gamma 10, and gamma 11 subunits, J. Biol. Chem. 270 (1995) 21765–21771. [7] J.R. Hepler, A.G. Gilman, G proteins, Trends Biochem. Sci. 17 (1992)

383–387.

[8] T.A. Fields, P.J. Casey, Signalling functions and biochemical proper- ties of pertussis toxin-resistant G-proteins, Biochem. J. 321 (1997)

561–571.

[9] D.E. Clapham, E.J. Neer, G protein beta gamma subunits, Annu. Rev. Pharmacol. Toxicol. 37 (1997) 167–203. [10] T. Schneider, P. Igelmund, J. Hescheler, G protein interaction with K + and Ca 2+ channels, Trends Pharmacol. Sci. 18 (1997) 8–11. [11] B. Konig, A. Arendt, J.H. McDowell, M. Kahlert, P.A. Hargrave, K.P. Hofmann, Three cytoplasmic loops of rhodopsin interact with trans- ducin, Proc. Natl. Acad. Sci. USA 86 (1989) 6878–6882. [12] S. Verrall, M. Ishii, M. Chen, L. Wang, T. Tram, S.R. Coughlin, The thrombin receptor second cytoplasmic loop confers coupling to G q -like G proteins in chimeric receptors, J. Biol. Chem. 272 (1997)

6898–6902.

[13] K.L. Laugwitz, A. Allgeier, S. OV ermans, K. Spicher, J. Van Sande, J.E. Dumont, G. Schultz, The human thyrotropin receptor: a heptahe-

lical receptor capable of stimulating members of all four G protein families, Proc. Natl. Acad. Sci. USA 93 (1996) 116–120. [14] S.A. Akhter, L.M. Luttrell, H.A. Rockman, G. Iaccarino, R.J. Lefko- witz, W.J. Koch, Targeting the receptor-Gq interface to inhibit in vivo pressure overload myocardial hypertrophy, Science 280 (1998)

574–577.

[15] M. Freissmuth, M. Waldhoer, E. Bo W ll-Cardona, C. Nano V , G-pro- tein antagonists, Trends Pharmacol. Sci. 20 (1999) 237–245. [16] M. Hohenegger, M. Waldhoer, W. Beindl, B. Boing, A. Kreimeyer, P. Nickel, C. NanoV , M. Freissmuth, Gs alpha-selective G protein antag- onists, Proc. Natl. Acad. Sci. USA 95 (1998) 346–351. [17] Z. Farfel, A.S. Brickman, H.R. Kaslow, V.M. Brothers, H.R. Bourne, Defect of receptor-cyclase coupling protein in pseudohypoparathy- roidism, New Engl. J. Med. 303 (1980) 237–242. [18] L. Vallar, A. Spada, G. Giannattasio, Altered Gs and adenylate cyclase activity in human GH-secreting pituitary adenomas, Nature

330 (1987) 566–568.

[19] S. Andreopoulos, P.P. Li, K.P. Siu, S.J. Kish, J.J. Warsh, Altered CTX- catalyzed and endogenous [32]ADP-ribosylation of stimulatory G

protein alpha s isoforms in post-mortem bipolar aV ective disorder temporal cortex, J. Neurosci. Res. 72 (2003) 638–645. [20] T. Katada, M. Ui, Direct modi W cation of the membrane adenylate cyclase system by islet-activating protein due to ADP-ribosylation of a membrane protein, Proc. Natl. Acad. Sci. USA 79 (1982) 3129–3133. [21] J. Lyons, C.A. Landis, G. Harsh, L. Vallar, K. Grunewald, H. Feichtin- ger, Q.Y. Duh, O.H. Clark, E. Kawasaki, H.R. Bourne, et al., Two G pro- tein oncogenes in human endocrine tumors, Science 249 (1990) 655–659. [22] E.A. Williamson, P.G. Ince, D. Harrison, P. Kendall-Taylor, P.E. Har- ris, G-protein mutations in human pituitary adrenocorticotrophic hormone-secreting adenomas, Eur. J. Clin. Invest. 25 (1995) 128–131. [23] B.B. Lerman, B. Dong, K.M. Stein, S.M. Markovitz, J. Linden, D.F. Catanzaro, Right ventricular out X ow tract tachycardia due to a somatic cell mutation in G protein subunit alpha i2, J. Clin. Invest.

101 (1998) 2862–2868.

[24] N. Galeotti, C. Ghelardini, M. Zoppi, E. Del Bene, L. Raimondi, E. Beneforti, A. Bartolini, A reduced functionality of Gi proteins as a possible cause of W bromialgia, J. Rheumatol. 28 (2001) 2298–2304. [25] N. Galeotti, C. Ghelardini, M. Zoppi, E. Del Bene, L. Raimondi, E. Beneforti, A. Bartolini, Hypofunctionality of Gi proteins as aetio- pathogenic mechanism for migraine and cluster headache, Cephalal- gia 21 (2001) 38–45. [26] Y. Odagaki, N. Nishi, T. Koyama, Receptor-mediated and receptor- independent activation of G-proteins in rat brain membranes, Life Sci. 62 (1998) 1537–1541. [27] T. Higashijima, S. Uzu, T. Nakajima, E.M. Ross, Mastoparan, a peptide toxin from wasp venom, mimics receptors by activating GTP-binding regulatory proteins (G proteins), J. Biol. Chem. 263 (1988) 6491–6494. [28] T. Higashijima, J. Burnier, E.J. Ross, Regulation of Gi and Go by mastoparan, related amphiphilic peptides, and hydrophobic amines, mechanism and structural determinants of activity, J. Biol. Chem. 265 (1990) 14176–14186. [29] M. Mousli, C. Bronner, J. Bockaert, B. Rouot, Y. Landry, Interaction of substance P, compound 48/80 and mastoparan with the -subunit C-terminus of G protein, Immunol. Lett. 25 (1990) 355–358. [30] A. Hagelüken, L. Grünbaum, B. Nürnberg, R. Harhammer, W. Schunack, R. Seifert, Lipophilic beta-adrenoceptor antagonists and local anesthetics are e V ective direct activators of G-proteins, Biochem. Pharmacol. 47 (1994) 1789–1795. [31] J.L. Bueb, M. Mousli, C. Bronner, B. Rouot, Y. Landry, Activation of Gi-like proteins, a receptor-independent e V ect of kinins in mast cells, Mol. Pharmacol. 38 (1990) 816–822. [32] C. Lesckhe, R. Storm, E. Breitweg, T. Exner, B. Nürnberg, W. Schunack, Alkyl-substituted amino acid amides and analogous di- and triamines: new non-peptide G protein activators, J. Med. Chem. 40 (1997) 3130–3139. [33] E. Breitweg-Lehmann, C. Czupalla, R. Storm, O. Kudlacek, W. Schunack, M. Freissmuth, B. Nürnberg, Activation and inhibition of G proteins by lipoamines, Mol. Pharmacol. 61 (2002) 628–636.

310

L. Di Cesare Mannelli et al. / Protein Expression and Puri W cation 47 (2006) 303–310

[34] M.J. Hope, M.B. Bally, G. Webb, P.R. Cullis, Production of large uni- lamellar vesicles by a rapid extrusion procedure. Characterization of size distribution, trapped volume and ability to maintain a membrane potential, Biochim. Biophys. Acta 812 (1985) 55–65. [35] C. Oppi, T. Wagner, A. Crisari, B. Camerini, G.P Tocchini Valentini, Attenuation of GTPase activity of recombinant G o by peptides representing sequence permutations of mastoparan, Proc. Natl. Acad. Sci. USA 89 (1992) 8268–8272. [36] The secondary structure has been predicted from the amminoacidic sequence through the PSIPRED program available at: <http:// bioinf.cs.ucl.ac.uk/psipred/>.

[37] T. Tanaka, T. Khono, S. Kinoshita, H. Mukai, H. Itoh, M. Ohya, T. Miyazawa, T. Higashijima, K. Wakamatsu, -Helix content of G pro- tein subunit is decreased upon activation by receptor mimetics, J. Biol. Chem. 273 (1998) 3247–3252. [38] D.E. Coleman, A.M. Berghuis, E. Lee, M.E. Linder, A.G. Gilman, S.R. Sprang, Structures of active conformations of Gi alpha 1 and the mechanism of GTP hydrolysis, Science 265 (1994)

1405–1412.

[39] M.A. Wall, D.E. Coleman, E. Lee, J.A. Iniguez-Lluhi, B.A. Posner, A.G. Gilman, S.R. Sprang, The structure of the G protein heterotri- mer Gi alpha 1 beta 1 gamma 2, Cell 83 (1995) 1047–1058.