Dissertation

submitted to the
Combined Faculties for the Natural Sciences and for Mathematics
of the Ruperto-Carola University of Heidelberg, Germany
for the degree of
Doctor of Natural Sciences

Presented by

Diplom-Chem.: Alexandru S. Denes

born in: Targoviste, Romania

Oral-examination: ........................
1
 2

The evolution of dorsoventral patterning and of

neuron types in the trunk nervous system of
bilaterian animals

PhD Student:

Alexandru Denes

Group leader:

Dr. Detlev Arendt

Referees:

Prof. Thomas Holstein

Dr. François Spitz

3
 4

“The stars are not meant for Man.”

Arthur C. Clarke, Childhood’s End
5
 6

Table of Contents

Short Summary ................................................................................................................. 12

1 INTRODUCTION........................................................................................................ 16
1.1 Reconstructing the ancestor of bilaterian animals .................................................. 17
1.2 Platynereis as a model organism............................................................................. 19
1.3 The evolution of the central nervous system .......................................................... 21
1.3.1 The dorsoventral inversion theory and the origin of the secondary axis ......... 22
1.3.2 In vertebrates the induction of the neuroectoderm is accomplished by BMP
antagonists................................................................................................................. 24
1.3.3 The formation and patterning of the nervous system in other organisms........ 25
1.4 The evolutionary origin of the dorsoventral axis.................................................... 27
1.5 Mediolateral patterning in the central nervous system ........................................... 30
1.5.1 The expression and function of the column genes in Drosophila.................... 31
1.5.2 Sonic hedgehog signaling controls the dorsoventral patterning in the vertebrate
neural tube................................................................................................................. 31
1.5.3 BMPs and retinoic acid have important roles in the patterning of the neural
tube............................................................................................................................ 33
1.6 The hedgehog signaling pathway............................................................................ 35
1.6.1 The molecules of the hedgehog pathway have several unusual features......... 35
1.6.2 Hedgehog signaling is mediated by two transmembrane proteins, Patched and
Smoothened............................................................................................................... 36
1.6.3 The Shh gradient defines the limits of the nk and pax genes in the ventral half
of the neural tube ...................................................................................................... 38
1.7 The formation of interneurons in the vertebrate neural tube .................................. 40
1.7.1 The ventral half of the neural tube is patterned by a combination of HD and
LIM-HD transcription factors ................................................................................... 40
1.7.2 Several bHLH transcription factors are crucial in the specification of the dorsal
progenitor domains ................................................................................................... 43
1.8 The specification of motoneurons........................................................................... 45
1.8.1 The molecular fingerprint of the vertebrate cholinergic motoneurons contains
the lhx3, islet and hb9 transcription factors .............................................................. 46
1.8.2 The glutamatergic motoneurons from Drosophila are specified by several
combinations of the lim3, islet, hb9 and eve transcription factors ........................... 48
1.9 The vertebrate floor plate and the insect midline.................................................... 50
1.10 Aim of the thesis ................................................................................................... 53

2 RESULTS ..................................................................................................................... 54
2.1 The mediolateral patterning in Platynereis is very similar to that described in
vertebrates ..................................................................................................................... 55
 7

2.1.1 The three column genes nk2.2, gsx and msx are expressed in Platynereis in a
similar but not quite identical fashion to Drosophila................................................ 56
2.1.2 A vertebrate-like model explains better the expression of the column genes in
the Platynereis ventral plate. ..................................................................................... 60
2.1.2.1 The expression of pax6 versus nk2.2 ........................................................ 60
2.1.2.2 The expression of nk6, pax3/7 and pax2/5/8 ............................................ 61
2.1.3 The expression of dbx and the possible interpretations. .................................. 63
2.2 Hedgehog signaling is required for the expression of the column genes ............... 64
2.2.1 The hedgehog pathway in Platynereis ............................................................. 64
2.2.2 The inhibition of the hedgehog pathway with cyclopamine revealed different
sensitivities among the column genes....................................................................... 65
2.3 Platynereis has a neural midline that resembles both the vertebrate floor plate and
the Drosophila midline.................................................................................................. 69
2.4 BMP4 signaling controls the expression of the neural patterning genes. ............... 71
2.5 The serotonergic neurons form within the nk2.2 column ....................................... 75
2.5.1 TrpH+ cells come from the nk2.2 column ....................................................... 76
2.5.2 Some of the projections from the serotonergic neurons make synapses on the
longitudinal muscles ................................................................................................. 78
2.6 The cholinergic motoneurons are derived from the pax6 column .......................... 80
2.6.1 The motoneuron molecular fingerprint............................................................ 80
2.6.2 Motoneurons: cholinergic or glutamatergic? ................................................... 81
2.6.3 The Motoneuron fingerprint at later stages of development............................ 84
2.6.4 Motoneurons in ventral plate cross-sections.................................................... 85
2.7 A group of GABAergic neurons are located adjacent to the cholinergic
motoneurons.................................................................................................................. 87
2.8 Neurogenesis in the Platynereis trunk between 24 and 54 hpf ............................... 89
2.9 The lateral region of the Platynereis neural plate likely contains sensory
interneurons................................................................................................................... 92

3 DISCUSSION ............................................................................................................... 98
3.1 Neurogenesis in the Platynereis ventral plate and the properties of the midline .... 99
3.1.1 Most of the neurons in the ventral plate exit the cell cycle by 48 hpf and are
fully differentiated by 56 hpf .................................................................................... 99
3.1.2 The Platynereis midline is a distinct structure within the neural plate .......... 101
3.2 The mediolateral patterning in the Platynereis ventral plate is very similar to that in
the vertebrate neural tube............................................................................................ 103
3.3 BMP signaling had an ancestral function in the patterning of the urbilaterian CNS
..................................................................................................................................... 107
3.4 Hedgehog signaling has a role in mediolateral patterning.................................... 109
3.5 Motoneurons: cholinergic or glutamatergic? ........................................................ 111
3.6 A model for the expansion of interneuron domains during the evolution of the
vertebrate lineage ........................................................................................................ 115
3.7 How do these results change our view of Urbilateria? ......................................... 119
3.8 Open questions...................................................................................................... 122

4 MATERIALS AND METHODS .............................................................................. 124

 8

4.1 Animals and embryos ....................................................................................... 125

4.2 SMART cDNA synthesis...................................................................................... 126
4.3 The cloning of genes with degenerate primers and subsequent extension through 5’
rapid amplification of complementary ends (RACE) ................................................. 119
4.3.1 The cloning of hb9 ......................................................................................... 126
4.3.2 The cloning of nk6 ......................................................................................... 128
4.3.3 The cloning of dbx ......................................................................................... 129
4.3.4 The 5’ RACE of gsx ...................................................................................... 130
4.3.5 The 5’ RACE of msx ..................................................................................... 130
4.3.6 The cloning of ChAT ..................................................................................... 131
4.3.7 The cloning of VGLUT ................................................................................. 132
4.3.8 The cloning of GAD ...................................................................................... 133
4.4 Southern blotting and radioactive hybridization................................................... 134
4.4.1 Radioactive probe preparation ....................................................................... 135
4.4.2 Membrane hybridization................................................................................ 135
4.5 Cloning of DNA fragments................................................................................... 136
4.6 Colony screening through colony lifts, minipreps and PCR................................. 137
4.7 Generation of labeled probes ................................................................................ 138
4.8 Whole-Mount in-situ Hybridization (WMISH) protocols .................................... 139
4.8.1 The basic WMISH protocol in Platynereis .................................................... 139
4.8.2 The hybridization of the embryos with labeled probes and the washing steps
................................................................................................................................. 140
4.8.3 The formation of a colored precipitate........................................................... 141
4.8.4 The formation of a colored and a fluorescent precipitate .............................. 141
4.8.5 The formation of two different fluorescent precipitates ................................ 142
4.9 Antibody and histochemical stainings .................................................................. 143
4.10 Special nets and modified 2 ml tubes ................................................................. 144
4.11 Cyclopamine inhibitions ..................................................................................... 145
4.12 BMP4 treatment of larvae................................................................................... 145
4.13 Bright field and confocal laser microscopy ........................................................ 146

5 REFERENCES........................................................................................................... 148

6 APPENDIX................................................................................................................. 168
6.1 Sequence alignments and phylogenetic trees of the cloned Platynereis genes..... 169
6.1.1 The hb9 gene.................................................................................................. 169
6.1.2 The nk6 gene.................................................................................................. 171
6.1.3 The dbx gene.................................................................................................. 173
6.1.4 The gsx gene .................................................................................................. 175
6.1.5 The msx gene ................................................................................................. 177
6.1.6 The ChAT gene.............................................................................................. 179
6.1.7 The GAD gene ............................................................................................... 183
6.1.8 The VGLUT gene .......................................................................................... 186
6.2 The glossary of species abbreviation .................................................................... 189
6.3 Abbreviations........................................................................................................ 191
9
 10

Acknowledgements

I am very thankful to the following people: Dr. Detlev Arendt, for giving me the
opportunity to work in his lab, for his essential advice, constant support and patience, and
for critical reading of this manuscript; Dr. Gaspar Jekely, for developing the crucial
technique of reflection confocal microscopy, for his extensive help with my project and
for his interesting scientific insights; Dr. Kristin Tessmar-Raible, for initiating the
project, the cloning of several genes of interest, for her help with the cyclopamine
experiments and other hedgehog related investigations, and for our numerous scientific
discussions.

I would also like to thank Patrick Steinmetz for his help with the basic techniques of
developmental biology research, and for his important contribution to the understanding
of neurogenesis in Platynereis; Heidi Snyman for her excellent job in maintaining the
Platynereis culture, the cloning of several genes, and help with histological stainings; Dr.
Florian Raible, for his assistance with bioinformatic questions; Raju Tomer, for his help
with the Imaris software, and for our numerous discussions. And I would like to thank the
entire lab for a very pleasant working atmosphere.

I am indebted to my thesis advisory committee for their feedback: Dr. Pernille Rørth,
Prof. Thomas Holstein, Dr. Erwin Neher and especially Dr. Klaus Scheffzek. My thanks
to the GeneCore and ALMF facilities for their help with sequencing and image
processing, to the Szilard Library for literature support, and to the Balavoine lab for
providing several genes.

I am also very grateful to the Louis Jeantet Foundation for offering me a scholarship at
EMBL. And last but not least, special thanks to my parents for their support and
encouragement.
11
 12

Short Summary

In this thesis I have addressed the origin and evolution of the central nervous system in
bilaterian animals. I have done so by investigating the CNS of Platynereis, a marine
annelid that retains many ancestral features, and comparing it to the previously described
nervous systems from insects and vertebrates.

In the first part I describe the highly conserved mediolateral patterning genes. By cloning
and studying the expression of several column genes, I was able to show that the
Platynereis CNS is patterned along the dorsoventral axis in a combinatorial fashion by
transcription factors belonging to the nk and pax families. Some of these genes, such as
nk2.2 and pax6, are expressed in non-overlapping domains that are maintained through
mutual cross-repression. Such borders were found to define distinct progenitor domains
within the neural tissue, each with its own molecular fingerprint. I have compared the
relative order of these column genes, from the midline towards the lateral regions, and
found to be almost identical to the one known from vertebrates. Therefore I concluded
the most likely hypothesis is that this gene network was inherited from the last common
ancestor of bilaterian animals: Urbilateria.

To obtain a better understanding of the way mediolateral patterning works in Platynereis

I have investigated the roles of two signaling pathways known to be important in other
species: Dpp and Hedgehog. Both were found to be active in the neural plate, hedgehog
mostly in the ventral region and Dpp mostly in the dorsal region. The fact the Dpp –
Hedgehog axis is inverted between vertebrates and insects, together with the conserved
mediolateral patterning genes, led me to conclude that the inversion theory offers the best
fit to my experimental results.

The second part of my thesis deals with several of the neuron types that emerge from the
progenitor domains in Platynereis. Among them I have found serotonergic, cholinergic
and GABAergic neurons, and assigned a molecular fingerprint to each. The most striking
 13

find were the cholinergic motoneurons that share an identical set of transcription factors
and effector genes with their vertebrate counterparts. Therefore, the similarities observed
at the level of mediolateral patterning are later translated into conserved neuron types,
each originating from a well defined progenitor domain.

In conclusion, this study shows that most features of the early neural patterning along the
dorsoventral axis, as well as the neuron types that subsequently emerge at various
positions, date back to Urbilateria. It also provides strong evidence in favor of an
inversion of the dorsoventral axis in the chordate lineage, probably shortly after
Protostomes and Deuterostome became separated.
 14

Zusammenfassung

Diese Dissertation behandelt eine fundamentale Frage der Biologie: was ist der Ursprung
des Zentralnervensystem rezenter Tierarten? Um diese Frage zu antworten, studierte ich
das Nervensystem des Ringelwurms Platynereis dumerilii und verglich es mit dem
Nervensystem anderer Tierarten (z. B. von Drosophila und verschiedenen Wirbeltieren).
Ich fokussierte besonders auf den neuralen Prozessen der dorsalen (bei Wirbeltieren)
bzw. ventralen (Wirbellosen) Seite.

Waehrend meiner Analyse identifizierte ich zuerst entwicklungsbiologisch ‚frueh’ aktive

Gene und beschrieb durch WMISH ihre Expression in der Larve. Ich fand, dass ihre
Expressionsdomaenen den bereits beschriebenen Genexpressionmusteren im
Wirbeltierneuralrohr aehneln. Es gibt ein paar Unterschieden, trotzdem sind die
Anordnung und die Expressionsgrenzen raeumlich bei Platynereis und Wirbeltieren fast
identisch. Die wahrscheinlichste Erklaerung fuer diesen Befund ist, dass Platynereis und
die Wirbeltiere dieses Genrepertoire und die entsprechende raeumliche Expression vom
letzen gemeinsamen Vorfahren aller Bilateria (Urbilateria) geerbt haben. Das bedeutet,
dass eine dorso-ventrale Umkehrung der Koerperachse auf dem Weg zu den Wirbeltieren
stattgefunden haben muss. Das ist beschrieben in der Doro-Ventralen Inversionstheorie.
Ich habe diesen Befund weiter durch die vergleichende Analyse der Hedgehog und Dpp
Signalwege bekraeftigt. In beiden Faellen ist Expressionsort in Platynereis um 180 Grad
verschoben im Vergleich zum Neuralrohr der Wirbeltiere. Diese zwei Ergebnisen sind
zusammen eine gute Unterstuetzung fuer die Dorso-Ventrale Inversionstheorie.

Zweitens habe ich meine Analyse auf die Ebene von Zelltypen erweitert. Die regionale
Musterung existiert nur fuer einen Zweck: die Entstehung von verschieden Neuronen am
korrekten Ort im Neuralgewebe. Ich fand, dass mindestens drei konservierte
Nervenzelletypen im Rumpfnervensystem von Platynereis und Wirbeltieren existieren.
Diese sind jeweils charakterisiert durch ihre Neurotransmitter, Serotonin, Acetylcholin
 15

bzw. GABA. Meine Analyse zeigt auch, dass die Motorneuronen am besten konserviert
sind, denn sie besitzen dasselbe Set and Transkriptionsfaktoren und den Neurotransmitter
Acetylcholin. Zusammenfassend habe ich damit gezeigt, dass Urbilateria bereits ein
komplexe Nervensystem hatten, und dass die Inversion Theorie ist wahrscheinlich
korrekt ist.
 16

1 INTRODUCTION
 17

1.1 Reconstructing the ancestor of bilaterian animals

The nature of the last bilaterian ancestor is still a controversial issue. There are those who
argue in favor of a “simple” ancestor with an un-centralized CNS, a nerve net that has no
dorsoventral differentiation. And there are others that propose a “complex” Urbilateria, a
worm that already had in place the signaling molecules, cell types and dorsoventral
asymmetry. The problem is compounded by the poor fossil record from this crucial
period in animal evolution (Valentine et al. 1999); (Erwin & Davidson 2002). The
appearance of key features along the evolutionary tree remains unresolved and the
comparison of the molecular details between phyla (although informative) is not without
its problems. For example, if BMPs and their antagonists played a role in the
specification of the secondary axis in cnidarians (Rentzsch et al. 2006), protostomes
(Mizutani et al. 2006) and deuterostomes (Yu et al. 2007); (Levine & Brivanlou 2007),
the most parsimonious interpretation is that the secondary axis was already present in the
last common ancestor of cnidarians and bilaterians, and was specified at least in part
through BMP signaling. Conversely, if a feature is present in one lineage (for example,
the Deuterostomia) but it is absent in a sister lineage (the Protostomia), one interpretation
is that it was “invented” during the evolution of that lineage. However the example
mentioned above is equally well explained by the following model: the “novel” feature
was actually present in the last common ancestor of both groups, and it was lost in one of
them: in this case, in the Protostomia. The best way to choose between the two
alternatives is through the use of a good outgroup, that split shortly before the two
lineages in question. If the feature in question is also present in the outgroup, it would
support the loss scenario; if not, it would strengthen the “novel acquisition” scenario.
However, an outgroup that is at the right evolutionary distance is not always available
when dealing with species that are separated by hundreds of millions of years. There are
two phyla that might serve as outgroups to Bilateria: the cnidarians and the ctenophores
(Philippe et al. 2005). Despite a lot of recent progress in the study of the cnidarian
genome and body plan (Finnerty 2003); (Putnam et al. 2007), there is still no consensus
on the transition from an animal with only one axis and a diffuse nerve net to a modern
bilaterian with well defined AP and DV axes, as well as a CNS. Ctenophores are even
 18

less understood. Without an outgroup we are left in a position where we cannot

distinguish between loss and innovation in the two groups. An alternative approach is to
have a better sampling of sister lineages, or at the very least a third branch for
comparison with the other two. Even if it is closer related to one of them, instead of being
equally distant like an outgroup, if the interval before the first and the second split is
small compared to the total time elapsed the comparison it will be very informative. This
appears to be the case with the three lineages that descend from Urbilateria (Figure 1):
the best molecular clock estimates place the split of protostomes and deuterostomes, as
well as that of lophotrochozoans and ecdysozoans between 600 and 550 My BP (Peterson
et al. 2004). Therefore, comparing a member of the Lophotrochozoa such as Platynereis
with model organisms from the other two bilaterian superphyla (such as mouse and fly)
should give us a much better picture of what were the ancestral features of Urbilateria.

Figure 1. Phylogenetic tree of the

Metazoa

This tree shows the main subdivisions

of the multicellular animals, or
Metazoa. Sponges (Acropora) are
considered the most basal, without any
axes of symmetry, no nervous system
and very few cell types. The
diploblasts (Hydra) have the oral-
aboral axis, and in the case of polyps
also a second one, the directive axis,
as well as a diffuse nervous system.
According to the latest phylogenetic
data, bilaterian animals are divided in
three superphyla: Ecdysozoa,
Lophotrochozoa and Deuterostomia.
Almost all have three germ layers,
bilateral symmetry and a central
nervous system. Platynereis dumerilii
belongs to the Lophotrochozoa.
 19

1.2 Platynereis as a model organism

Platynereis is a marine annelid of the Nereididae family, widely distributed along the
Mediterranean and Atlantic coast. During its lifecycle it alternates between a swimming
planctonic larva (the trochophora) and a benthic adult (Figure 2) that lives in self-spun
tubes on algal mats (Fischer & Dorresteijn 2004) It is relatively easy to grow in the
laboratory under an artificial lunar cycle, and several cultures have been maintained for
decades.

Figure 2. The Platynereis lifecycle and the trochophora larva.

Platynereis is a marine annelid with an indirect development. The egg undergoes spiral cleavage and forms
the trochophora larva that swims for a few days with the plankton before it settles and starts to feed. The
neural plate is the ventral region situated just below the main ciliary band (or prototroch). It is highlighted
in red. Images courtesy of Guillaume Balavoine and Harald Hausen.

The worm has many ancestral features; indeed, it is difficult to find traits that are unique
to it and not shared among other animal groups. If we are to stretch a bit the comparison,
animals with a similar morphology were present as far back as the Cambrian (Conway
1998), as seen in the fossils of the Burgess Shale Fauna (Figure 3), and as far as the
nervous system is concerned, it has a prototypical ladder-like CNS (Bullock & Horridge
1965). When investigated at the genome level Platynereis appears to have had a lower
 20

rate of gene and intron loss compared to other better studied model organisms, such as C.
elegans and Ciona (Raible et al. 2005). Perhaps this is due to its continued existence in a
marine ecological niche (algal mats) that has changed little in the past 500 million years.
Among the species available for study today Platynereis might be as close as we can get
to Urbilateria (Tessmar-Raible and Arendt, 2003). In other words, it is a living fossil and
therefore well worth the effort of understanding its nervous system.

Figure 3. Timeline of the early metazoan evolution.

The evolution of multicellular organisms was a rather sudden event that is poorly documented in the fossil
record. Shortly after a series of severe ice ages during the Cryogenian (image from (Hyde et al. 2000)), the
first traces of embryos are documented. The first marine ecosystems (image downloaded from the webpage
“A Survey of the Fossil Record” maintained by Rick Miller, Department of Geological Sciences, San
Diego State University
http://www-rohan.sdsu.edu/~rhmiller/fossilrecord/Ediacdiorama.jpg), bearing little resemfe to modern
ones, appeared during the Ediacaran. It is likely that Urbilateria also lived during this epoch. By the time of
the middle Cambrian almost all of the extant phyla were already present: their sudden apparition in the
fossil record is also known as the Cambrian explosion, as apparent in the Burgess Shale fauna (image
downloaded from the webpage of the Zoologia General de la Facultad de Biologia Marina – Universidad
Jorge Tadeo Lozano Bogota-Colombia
http://gefmdarwin.tripod.com/sitebuildercontent/sitebuilderpictures/fullimage_20041123151418_307.jpeg).
 21

1.3 The evolution of the central nervous system

The central nervous system (CNS) is one of the defining traits of animals, and in one
form or another is present throughout Metazoa with the possible exception of sponges
(Dewel 2000). Because it is such a unique feature, it has been used in virtually every
attempt to reconstruct the phylogeny and evolutionary history of animals. However, there
is a lot of diversity in the structure and complexity of the CNS in various phyla, and this
has led to some disagreement as to what a central nervous system really is: does a diffuse
nerve net, as seen in cnidarians, qualify as a “true” CNS? Alternatively, should the term
be reserved only for nervous systems where the cell bodies are grouped into ganglions,
and the axon projections are bundled into a scaffold? Has the CNS evolved more than
once in different lineages? These questions are important because they reflect the
disagreement on the evolutionary history of complex animals, and in particular that of the
nervous system. Within Bilateria, several kinds of CNS have been described. The two
major groups of protostomes, namely Ecdysozoa and Lophotrochozoa, share as a
common feature the ventral nerve cord with an apical brain (Figure 4). Within the
Deuterostoma the dorsal nerve cord of chordates, the pentaradial CNS of echinoderms,
and finally the diffuse nerve net of hemichordates are the best described (Nielsen 1999).
Any model for the evolution of the central nervous system must clarify at least these
three questions. First, what are the fundamental properties of the CNS? Second, when did
they appear in the evolutionary record? And third, how did this “ancestral CNS” diversify
into the various types apparent in surviving lineages? Before a detailed comparison can
be done, one problem that has to be dealt with is what exactly is being compared. That is,
some animals are direct developers, whereas others have an intermediate larval stage, and
it has to be agreed what is the representative stage to look at (Holland 2003). Another
problem is one of sampling: when comparing different phyla, ideally one would study the
species that contain the least derived features. However, in practice it is not easy to
distinguish between an ancestrally simple morphology and a secondarily simplified one
(Lacalli 2001).
 22

Figure 4. The evolution of

the CNS in Metazoa.

It is clear that the nervous

system evolved sometime
before the split of diploblasts
from the lineage that gave
rise to Bilateria. The CNS of
cnidarians remained diffuse,
resembling a nerve net. By
definition, the dorsoventral
axis also evolved some time
before Urbilateria. What is
not known is when the
centralization of the CNS in a
brain and nerve cord took
place. The members of
Ecdysozoa, as well as those
of Lophotrochozoa, have a
ventral nerve cord and the
chordates a dorsal one.
Hemichordates have a diffuse
nerve net resembling that of
cnidarians.

1.3.1 The dorsoventral inversion theory and the origin of the

secondary axis

The first attempts at a unifying theory of the central nervous system can be traced to
Anton Dohrn, who proposed as far back as 1875 that the vertebrate CNS is the “inverted”
equivalent of ventral nerve cord of insects. This implied that the last common ancestor of
insects and vertebrates already had a well defined nerve cord, and that the similarities
between the CNSs of animals from the two lineages are due to common descent, rather
than convergent evolution. More recently, these ideas found new support from the
molecular data available (Arendt & Nubler-Jung 1994); (Arendt & Nubler-Jung 1999).
As it turns out, there are some basic traits common for both the nervous systems of
insects and vertebrates, for example that the neurogenic region forms on the opposite side
 23

of the Dpp/BMP signaling center (Harland & Gerhart 1997), (Mizutani et al. 2006), and
that similar genes define the anteroposterior axis (Kurokawa et al. 2004). In contrast, the
Auricularia Hypothesis (Garstang 1928) that proposed the ciliary bands of a larva as the
origin of the CNS failed to gain much support from the molecular data (Gerhart 2000).

Within cnidaria, anthozoans are considered the most basal. The ancestral body plan of the
phylum probably resembled that of a polyp, and the medusoid form was a later addition
that can give little insight into the origins of the CNS (Finnerty 2003). They have only
two germ layers, with most of the neurons concentrated in the ectodermal one. The
overall arrangement is that of a nerve net (Figure 4), with only the most basic circuits
made up of two or three cells (Westfall et al. 2002). It is generally agreed this basic
nervous system was also present in the last common ancestor of cnidarians and
bilaterians (Holland 2003). However, there is a lot of controversy regarding the kind of
nervous system present in the last common ancestor of all bilaterian animals, namely
Urbilateria. One proposal is that of a “simple” bilaterian ancestor, that had a nervous
system much like that of a cnidarian. If this was the case, it probably resembled the acoel
worms, and it made no distinction between the dorsal and the ventral side (Ruiz-Trillo et
al. 1999). This view was strengthened by the presence of a cnidarian-like basiepithelial
CNS in basal deuterostomes (Figure 4) such as hemichordates (Lowe et al. 2003);
(Gerhart et al. 2005). The other model argues in favor of a “complex” urbilaterian
ancestor, with a centralized nervous system resembling that of protostomes. Therefore,
the major features of CNS specification and patterning were already in place before the
split of protostomes and deuterostomes (Arendt & Nubler-Jung 1999). The idea of a
complex Urbilateria is linked to the concept of dorsoventral inversion, the most
straightforward way to explain the different locations of the CNS and the many
similarities they share.

One thing both scenarios agree upon is that a cnidarian-like ancestor acquired bilateral
symmetry. There are several models of how this could come about, starting from a
sexually mature planuloid larva that settled to become a benthic, bilaterally symmetrical
worm (Holland 2003). One of these, the “perpendicular amphistome” scenario has
 24

recently received support from a study of gastrulation and gene expression in the marine
annelid Platynereis (Steinmetz et al. 2007); Steinmetz et al., unpublished).

1.3.2 In vertebrates the induction of the neuroectoderm is

accomplished by BMP antagonists

For several species the details of nervous system specification are well understood,
including the signaling pathways and the molecular markers involved. These include
mostly the vertebrate mainstay model organisms such as Xenopus, chick and mouse, and
Drosophila from the protostome side. As first determined by the famous transplantation
experiments of (Spemann & Mangold 1924) the dorsal lip of the blastopore is sufficient
for the induction of neuroectoderm in vertebrates. Later studies put together the so-called
“default model” where factors secreted from Spemanns’ organizer (Figure 5), such as
chordin (Sasai et al. 1995) and noggin (Smith & Harland 1992) suppress BMP signaling
and allow the formation of neural tissue, as reviewed by (Harland & Gerhart 1997);
(Levine & Brivanlou 2007). Subsequent research, especially from chick, has challenged
this simple view on the grounds that also other signaling pathways (such as FGF, Wnt)
play essential roles in the acquisition of the neural fate (Wilson et al. 2000); (Wilson et al.
2001) and that even in the absence of the organizer neurulation can still occur
(Klingensmith et al. 1999). These findings remain controversial because of the
complexity of the interactions, and the timing of different signals. For now, it appears the
basic assumptions of the default model are still standing, with the addition that FGFs are
clearly important, although it is not clear to what extent (Stern 2005). One possibility
would be that FGFs also block the BMP cascade by inhibiting Smads (Niehrs 2005). It is
interesting to note that in ascidians (basal chordates) FGFs alone appear to be responsible
for the formation of the nervous system (Hudson & Lemaire 2001); (Bertrand et al.
2003).
 25

Figure 5. The induction of the neuroectoderm in vertebrate embryos

During early gastrulation the AP and DV axes are collapsed into a single dorsal-anterior/ ventral-posterior
axis. The dorsal lip of the blastopore, or the Spemann organizer, is central to this early axis specification: it
secretes BMP antagonists that shape a gradient across the ectoderm. Where BMP levels are high epidermis
forms, and where they are lower the neural tissue is specified. The relations between the signaling centers
are complex. Wnt signaling from the dorsal side of the embryo induces the organizer on the ventral side,
and Nodal promotes the formation of both the organizer (at higher concentrations) and of the dorsal
signaling center (at lower concentrations).

1.3.3 The formation and patterning of the nervous system in other

organisms

The induction of the nervous system was described for a cephalochordate

(Branchiostoma floridae) in a recent study (Yu et al. 2007). Very similar to Xenopus, the
dorsal blastopore lip expresses chordin and admp, and the BMPs together with their
regulators bambi and tolloid are expressed in the ventral two thirds of the gastrula.
Moreover, several Wnts are coexpressed together with Brachyury posteriorly to the
blastopore, and are involved in the specification of the AP axis, again reminiscent of the
model described in vertebrates (Niehrs 2004). This data strongly supports the view that
 26

the role of BMP and Wnt signaling in the specification of the DV and AP axis dates back
at least to the base of chordates, and is likely even older.

Hemichordates do not have a centralized nervous system or a brain. Instead, they possess
a diffuse nerve net throughout the head and trunk. This diffuse nervous system has a well
defined AP patterning, as assayed by the expression of several genes that in other model
organisms specify different brain and trunk boundaries (Lowe et al. 2003). In contrast,
there is very little in the way of DV patterning, most of the genes that are differentially
expressed along this axis in other species are radially expressed in Saccoglossus.
However, it does have the BMP-chordin axis. More exactly, the synexpression group of
BMPs and their regulators tld, tsg and bambi is present on the dorsal side of the embryos,
whereas chordin and admp are expressed on the ventral side (Lowe et al. 2006).

The formation of the nervous system in Drosophila proceeds through a different route.
The early embryo starts as a syncytium, and the future body axes have already been
specified before fertilization (St Johnston & Nusslein-Volhard 1992). A nuclear gradient
of Dorsal is responsible for the early differentiation of mesoderm, neuroectoderm and
dorsal ectoderm (Roth 2003). In the ventral region of the embryo, where Dorsal levels are
high (Figure 6), snail and twist are expressed, inducing the mesoderm (Seher et al. 2007).
Dpp is expressed on the dorsal side of the embryo, where Dorsal levels are low, and the
ventrolateral region is the place where sog, the homologue of vertebrate chordin, is
expressed (Mizutani et al. 2006). The levels of Dpp in the embryo are tightly controlled
by the specific interaction with sog; in fact, in sog mutants the range of Dpp signaling
was severely reduced. In order to explain this, a rather complex model was proposed: the
diffusing Dpp is degraded by receptors and prevented from forming complexes with Sog
or Tsg; also, the Dpp/Sog complex can be broken down by Tld (Mizutani et al. 2005).
 27

Figure 6. The mediolateral patterning in Drosophila.

The syncytium of Drosophila is patterned by the combined action of several molecules. A dorsal Dpp
gradient defines the ectoderm and the limit of the neuroectoderm. The nuclear Dorsal gradient defines the
mesoderm and part of the neural territory on the ventral side of the embryo. The mesoderm markers twist
and snail are expressed where Dorsal activity is highest. Sog represses both Dpp and Dorsal and maintains
the neuroectoderm. The EgfR is active within the region where vnd an ind are expressed, and specifies the
dorsal border of the ind. The three column genes repress each over in a ventral to dorsal fashion, and define
sharp borders around stage 8-9.

1.4 The evolutionary origin of the dorsoventral axis

According to the traditional view of metazoan evolution sponges do not have any axes of
symmetry, radial symmetric animals such as cnidarians have one (the oral-aboral) and the
dorsoventral axis was a bilaterian invention. However, both morphological data
(Martindale et al. 2002) and the recent flood of molecular data are increasingly
challenging this view. A new consensus is slowly emerging that radial symmetry within
Cnidaria is a derived feature associated with the medusoid lifestyle, and the more basal
members of the phylum like the anthozoans show a distinct asymmetry in the expression
 28

of key genes along an axis perpendicular to the oral-aboral one, the so-called directive
axis (Rentzsch et al. 2006).

When reconstructing the origin of the patterning axes, several criteria may be considered:
morphological, the position of signaling centers and the expression domains of key
patterning genes. The true sister group of Bilateria is yet to be established: so far
cnidarians, placozoans and ctenophores are the plausible candidates (Medina et al. 2001);
(Voigt et al. 2004). Among cnidarians, Hydra has been until recently the model organism
of choice. This has changed lately, with a shift towards anthozoans such as Nematostella
and Acropora; most of the recent molecular data comes from them. As reviewed by
(Holland 2003) there are several ways of deriving a bilaterally symmetrical animal from
one with radial symmetry. The expression of four kinds of genes was used to try to
reconstruct the ancestral AP and DV axes: the Hox genes, the BMPs and their
antagonists, the dorsoventral patterning genes and the Pax family. There are several Hox
gene homologues in Nematostella, and probably there is also something like a “proto-
Hox cluster” containing at least three genes (Ryan et al. 2007). However, they are not
clearly expressed in a linear fashion along a body axis; instead, they seem to show
differential expression on both the oral-aboral and the directive axis (Finnerty et al.
2004); (Kamm et al. 2006).

The expression of the BMP ligands Dpp and GDF5, and that of their antagonists chordin
and gremlin has been described in Nematostella (Matus et al. 2006); (Rentzsch et al.
2006). The results are puzzling however, since the domain of dpp expression largely
overlaps with that of chordin (Figure 7 B); the same is true for GDF5 and gremlin, but on
the opposite side of the embryo. Therefore, there is no real BMP-chordin axis, one that
might give a clue to the origin of the DV axis. It was proposed that the original function
of dpp and its antagonists was to differentiate between endoderm and ectoderm (Matus et
al. 2006) or in the patterning of the nervous system (Matus et al. 2006). Only later were
the same molecules recruited for the specification of the dorsoventral body axis, before
the split of protostomes and deuterostomes.
 29

Figure 7. The expression of axial patterning genes in Nematostella.

(A) Cross-section through the embryo at the level of the pharynx, showing two germ layers (the ectoderm
and the endomesoderm) separated by the mesoglea and four tentacles. (B) Cross-section along the oral-
aboral axis, the mouth is to the left. Dpp (cyan) and netrin (black) are expressed asymmetrically along the
directive axis, on opposite sides of the embryo. However, chordin (pink) and noggin (red) are expressed on
the same side as dpp, so the directive axis is probably not established by a Dpp/BMP gradient. Goosecoid is
expressed transiently at early stages in the endomesoderm on both sides of the embryo (dotted expression,
green) and later in the pharyngeal endomesoderm on the opposite side from noggin. Otx is expressed in the
pharynx, at the oral pole of the embryo.

The orthologs of the bilaterian Otx/otd and Emx/ems are expressed in Acropora at the oral
and aboral pole respectively (Figure 7 B), with a significant region of overlap in the
middle region (de Jong et al. 2006). Again, it is hard to interpret this data if one assumes
that the anteroposterior axis was derived from the oral-aboral one of cnidarians. In the
same study, the expression of the “classical” dorsoventral patterning genes was
investigated. The expression of the Acropora vnd homologues was restricted to the
ectoderm surrounding the oral pore. Am-Msx/msh was found to be expressed in about two
thirds of the ectoderm, starting from the blastopore. And finally, Am-cnox2 (the ind
homologue) is expressed very broadly in the ectoderm, almost from the oral to the aboral
pole. The expression of these genes as mostly overlapping, radially symmetrical domains
does not support the equivalence of the directive axis with the DV axis found in Bilateria.
However, the domain of netrin covers only the about a quarter of the radial
circumference (Figure 7 A), and it is located on the opposite side of the dpp expression.

Pax genes are important for a variety of functions, but almost all have a role in the
patterning of the nervous system. According to phylogenetic analyses Urbilateria
 30

probably possessed five pax genes: pax4/6, pax1/9, paxB-2/5/8, paxA/C-neuro and paxD-
3/7 (Miller et al. 2000); (Hadrys et al. 2005); (Matus et al. 2007). Several paxD related
genes were described in Nematostella, but it is not clear how they relate to the paxD from
Acropora; there it has been shown to be expressed as a band close to the aboral region in
(de Jong et al. 2006). The other pax genes were found to be expressed circumorally
(paxB), aborally (paxC) or in the tentacle crown (paxA). Overall, they cover most of the
oral-aboral axis, and are probably involved in the local patterning of the nerve net (Matus
et al. 2007). In conclusion, more data is required to reconstruct the evolutionary history
of the AP and DV axes in Bilateria.

1.5 Mediolateral patterning in the central nervous system

Bilaterian animals have two major axes: the anteroposterior and the dorsoventral. The
specification of the anteroposterior axis turned out to be remarkably conserved across the
animal kingdom. During head development, the function of orthodenticle and empty
spiracles in Drosophila is similar to that of Otx2 and Emx in mouse (Kurokawa et al.
2004), and the conserved role in trunk patterning of the Hox cluster respectively is
perhaps the best known example (Slack et al. 1993).
The picture is less clear for the dorsoventral axis. First of all the geometry is reversed in
most species, with a ventral nervous system in protostomes and a dorsal one in
deuterostomes. Second, there are many differences in the genes responsible for the
patterning of the neuroectoderm, and in the signaling pathways that regulate them. A
detailed comparison of early CNS patterning revealed an evolutionary conserved role for
only three genes.
 31

1.5.1 The expression and function of the column genes in

Drosophila

In the fly vnd, ind and msh (Figure 6) are expressed as columns in a ventral to dorsal
sequence (Cornell & Ohlen 2000). The orthologous genes nkx2.2/nkx2.9, gsh1/gsh2 and
msx1/msx2/msx3 from vertebrates are expressed in a similar order in the neural tube
(Briscoe & Ericson 1999); (Arendt & Nubler-Jung 1999). Within the Drosophila
neuroectoderm, vnd is expressed first as a ventral column around stage 8. Already by
stage 9 it is absent from the midline cells, and by stage 11 it shows expression mostly in
specific neurons derived from ventral neuroblasts (McDonald et al. 1998). Vnd is capable
of suppressing the more lateral column genes, ind and msh. Conversely, these genes
expand ventrally in vnd -/- mutants. Ind is also expressed early in the neuroectoderm,
around stage 9. In a similar fashion to vnd, its expression also becomes restricted to a
subset of neuroblasts around stage 10, and by stage 11 it is no longer expressed (Weiss et
al. 1998). In ind -/- mutants there are grave defects in the formation of intermediate
column neuroblasts, and there is ectopic msh expression in this region. Msh is expressed
as two dorsal columns around stage 8, is somewhat downregulated around stage 9, but it
reappears in many dorsal neuroblasts around stage 10 (Isshiki et al. 1997). As proposed
by (von Ohlen & Doe 2000) there is a ventral to dorsal dominance in the Drosophila
neuroectoderm. The expression of the three column genes seems to be independently
triggered by the local concentration of several morphogen gradients, such as Dorsal, Dpp
and Egfr.

1.5.2 Sonic hedgehog signaling controls the dorsoventral

patterning in the vertebrate neural tube

The dorsoventral patterning of the vertebrate neural tube takes place in quite a similar
manner, with ventral genes such as nkx2.2 or nkx6.1 repressing more dorsal ones such as
pax6 and dbx2 (Briscoe et al. 2000). However, the networks formed by the column genes,
 32

and some of the upstream signaling cascades are quite different. Hh signaling is very
important for the regulation of these patterning genes in vertebrates (Ericson et al. 1997);
(Briscoe et al. 1999) but not in Drosophila. By growing tissue explants in the presence of
recombinant Shh-N it was shown that different types of neurons form at various
concentration. The curve is not steep, a two fold increase in the amount of added protein
is sufficient to change it from a dorsal fate to a more ventral one. Originating from the
notochord and the floor plate (Figure 8), the Shh gradient is essential in establishing the
expression domains of the ventral genes nkx2.2, nkx6.1 and nkx6.2. It is also responsible
for defining the ventral limits of the dorsal genes such as pax6, dbx1, dbx2 and Irx
(Briscoe & Ericson 2001). There are several boundaries between the class II proteins, that
require Hh signaling, and the class I proteins that are inhibited by high levels of Hh
(Figure 10). One example is the antagonism between the Nkx6 and Dbx transcription
factors. Nkx6.1 directly represses Dbx2, and Nkx6.2 represses Dbx1 (Vallstedt et al.
2001). This way, V0 interneurons form where there is only dbx1 and dbx2 expression
(Figure 8), V1 interneurons form where nkx6.2 and dbx2 are coexpressed and V2
interneurons are specified where only nkx6.1 and nkx6.2 are present (Figure 8). Another
good example is the formation of the motoneuron progenitor domain. The ventral
boundary is defined by the cross-inhibition of nkx2.2 and pax6, and the dorsal boundary
by the limit of Irx3 expression (Briscoe et al. 2000). Therefore, through the combinatorial
action of these transcription factors the ventral half of the neural tube is divided into five
progenitor domains: four interneuron types and the motoneurons.
 33

Figure 8. The mediolateral patterning in the vertebrate neural tube.

The neural tube contains two signaling centers, the floor plate and the roof plate, and 11 neuron progenitor
domains in between them. The Shh gradient extends from the floor plate about halfway into the neural tube.
V3 interneurons are formed in the region where only nkx2.2 and nkx2.9 are expressed. Motoneurons form
where pax6, nkx6.1 and nkx6.2 are coexpressed; irx3 expression stops at the dorsal limit of the motoneuron
domain. V2 interneurons are defined by the coexpression of pax6, nkx6.1 and nkx6.2 and irx3. The V1
interneurons express nkx6.2 and dbx1, whereas the V0 express dbx1, dbx2 and pax7.
Moving on to the dorsal part of the neural tube, we have the dI6 sensory interneurons that are defined by
the coexpression of dbx1, dbx2, pax7 and pax3. The dI5 express dbx1, gsh1, gsh2 and msx1. The dI4 is the
largest progenitor domain in the dorsal neural tube, and is specified by pax2, pax7 and gsh1. dI3
interneurons express pax3, gsh2 and msx1. And finally the dI2 and dI1 express pax3, msx1 and msx3.

1.5.3 BMPs and retinoic acid have important roles in the

patterning of the neural tube

Shh signaling does not extend into the dorsal regions of the neural tube. The patterning of
the dorsal half of the neural tube is due to a second source of signaling: the roof plate.
 34

The roof plate itself is induced by BMP signaling from the overlaying ectoderm, through
the combined action of the Lmx1a and Lmx1b genes (Chizhikov & Millen 2004). Its
importance as a distinct signaling center, essential for the formation of the dorsal
interneurons, was made clear through an experiment of genetic ablation (Lee et al. 2000).
In the mutant mice, the three dorsal-most neuron types were completely absent and
replaced by more ventral ones. This likely happened due to the absence of both BMPs
and Wnts, originally secreted from this region (Chizhikov & Millen 2005). BMP
signaling has been shown to directly regulate the levels of dorsal homeodomain
transcription factors such as pax7, dbx2, gsh2 and msx1, which in turn are crucial for
specifying distinct domains and cell fates (Timmer et al. 2002); (Kriks et al. 2005). Wnt
signaling seems to act in parallel of BMPs, rather as a proliferative cue than a cell-
specific determinant (Megason & McMahon 2002); (Caspary & Anderson 2003),
although there is at least one known example of a more direct role in regulating the
expression of the transcription factor Olig3, via the canonical pathway (Zechner et al.
2007).

Retinoic acid (RA) also plays a role in the specification of neuron types, both in the
ventral and dorsal regions of the nerve cord. It should be kept in mind that RA is also
involved in AP patterning, for example in the specification of different motoneuron
subtypes along the rostro-caudal axis, under the control of several Hox genes (Dasen et
al. 2003). Therefore the effects, such as they are, tend to be more pronounced in the
anterior regions of the neural tube (Wilson et al. 2004). The retinoids coming from
outside the neural tube (the adjacent somites) have a role in the early neurogenesis,
whereas the ones produced locally in the nervous system have a more restricted role, in
specifying distinct neuron types, for example motoneurons (Wilson & Maden 2005). Due
to the ability of RA to directly influence key transcription factors such as pax6 and pax7,
as well as to regulate other signaling patways (Shh, BMP) that act on the same genes, the
effects are rather complex and as of now incompletely understood. It does seem that
retinoic acid promotes the ventral neuron types (possibly through the upregulation of
Shh) at the expense of the dorsal neuron types (Wilson et al. 2004).
 35

1.6 The hedgehog signaling pathway

The Hedgehog pathway is one of the key players in animal development, and it has been
extensively investigated in the past decade. From an evolutionary point of view it is an
old pathway: most of the components are conserved between protostomes and
deuterostomes, with some differences (Huangfu & Anderson 2006). It does not appear to
exist in cnidarians (Putnam et al. 2007) so it is most likely a bilaterian invention. In
Drosophila there is only one hedgehog gene, unlike vertebrates that contain several more.
However, these duplications are of relatively recent origin (Bijlsma et al. 2004), and there
was probably only one gene in the urbilaterian ancestor as well. This view is supported
by the existence of only one hedgehog gene in Amphioxus, equally related to all the genes
in fish and mammals (Shimeld 1999).

1.6.1 The molecules of the hedgehog pathway have several unusual

features
One reason hedgehog has attracted so much interest is that in some respects it is unlike
anything else known. The translated protein contains two parts: an N-terminal region
(Hh-N, the future signaling component) and a C-terminal region that acts as an
autocatalytic protease (Porter et al. 1995). During this cleavage a cholesterol moiety is
attached at the C-terminus of the Hh-N fragment (Porter et al. 1996); it is the only
sterolated protein known so far in the animal kingdom. Actually many of the
dysfunctions caused by improper hedgehog signaling can be traced back to interferences
with cholesterol synthesis (Farese & Herz 1998), highlighting the importance of this
posttranslational modification, but so far it is not clear what is the exact role it plays. If
absent, the extracellular hedgehog gradient is severely restricted in range (Lewis et al.
2001), possibly because of the inability of the protein to interact with the extracellular
matrix, being subsequently diluted (Guerrero & Chiang 2007). It is also clearly required
for the proper intracellular traffic and apical sorting of hedgehog (Gallet et al., 2003).
 36

Likely because of the multiple roles of the cholesterol tag, in both intracellular and
extracellular interactions, the results obtained when interfering with have been difficult to
interpret (Bijlsma et al. 2004). In addition to the cholesterol tail there is also a palmitoyl
moiety. It was shown that after the proteolytic processing another posttranslational
modification occurs, namely the palmitoylation of an N-terminal Cys residue (Pepinsky
et al. 1998). This step further increases the hydrophobicity, which is unusual for a
secreted protein. However, if at some point hedgehog must be inserted in a membrane in
order to perform its function, it is likely that a single hydrophobic tail (the cholesterol
moiety) is simply insufficient, and a second hydrocarbon chain must be added for
optimum efficiency (Mann & Beachy 2004). If this theory is correct, the lack of the
palmitoyl residue should drastically reduce the activity of the protein, but not completely
abolish it, and this is indeed the case (Pepinsky et al. 1998). Conversely, adding more
than one chain, or adding moieties that have a higher hydrophobicity than palmitic acid
should increase the activity, and this was also experimentally confirmed (Taylor et al.
2001). The enzyme responsible for the palmitoylation of hedgehog, an acyltransferase, is
encoded by the sightless/ skinny hedgehog gene (Lee & Treisman 2001); (Chamoun et al.
2001). Lastly, the release of the fully modified Hh-N from the membrane of the secreting
cell depends on the activity of the Dispatched protein (Burke et al. 1999).

1.6.2 Hedgehog signaling is mediated by two transmembrane

proteins, Patched and Smoothened

The mechanisms of signal transduction for the pathway are fairly well understood. The
first step is the binding of the hedgehog to the Patched (Ptc) receptor, that is also a
transcriptional target (Marigo & Tabin 1996). Without the ligand, Ptc suppresses the
activity of Smo (Figure 9 A); although it was shown that the cytoplasmic domain is
required for this interaction (Briscoe et al. 2001), Ptc acts in a sub-stoichiometric fashion
(Taipale et al. 2002) so a direct protein-protein interaction is unlikely. It appears that
most of the hedgehog signaling takes place on the surface of primary cilia, and if their
structure is disrupted there is a corresponding loss of sensitivity (Caspary et al. 2007).
 37

Without ligand, Ptc1 is present at high concentrations in the cilia and prevents the entry
of Smo. Upon binding to hedgehog the situation is reversed (Figure 9 B), Ptc1 becomes
internalized and the concentration of Smo increases in the cilium (Rohatgi et al. 2007). It
was proposed that oxysterols could mediate the targeting of Smo to the cilia, with
Patched (a member of the resistance and modulation transporter family) acting locally to
increase their concentration (Lum & Beachy 2004); (Rohatgi et al. 2007).

Figure 9. The Hedgehog

signaling pathway

(A) In the absence of the

hedgehog ligand the
transmembrane protein Ptc
blocks the access of Smo to
the plasma membrane, or
more precisely to the surface
of the cilia. The mechanism
is not entirely understood, it
probably involves a small
signaling molecule derived
from cholesterol. (B) When
Hedgehog binds to its
receptor the inhibition by Ptc
ceases and Smo can
accumulate at the surface of
the cell, likely on cilia.
Cyclopamine inhibits the
hedgehog pathway by
binding to the Smo receptor.

The final step is the activation of the Gli/Ci zinc-finger transcription factors. In
Drosophila Cubitus interruptus (Ci) is a bifunctional transcription factor: in the absence
of hedgehog it is cleaved by a protease and acts as a transcriptional repressor. If Smo is
inactivated by Ptc (upon the binding of hedgehog to Ptc) it is no longer processed and
functions instead as a transcriptional activator (Aza-Blanc & Kornberg 1999). Among the
three Gli genes in vertebrates, only Gli3 behaves like Ci, acting both as a repressor and
activator (Wang et al. 2000). Because Gli1 and Gli2 cannot be processed, they only act as
transcriptional activators (Aza-Blanc et al. 2000); (Fuccillo et al. 2006). Likely there are
 38

more regulatory steps between Smo and Ci/Gli than previously assumed, especially in
vertebrates, but they are not as highly conserved as the rest of the pathway (Huangfu &
Anderson 2006). Interestingly, several similarities have been noted between the hedgehog
and the Wnt pathway: the palmitoylation of the ligands, the similarity between Smo and
Frizzled, dependence on protein synthesis for full activation (Nusse 2003); (Mann &
Beachy 2004). This would mean the hedgehog pathway was at least partially derived
from the Wnt, which was already established before the split of bilaterians from
cnidarians (Kusserow et al. 2005).

1.6.3 The Shh gradient defines the limits of the nk and pax genes in
the ventral half of the neural tube

Among the many functions of hedgehog, the one that is best understood is in the ventral
half of the neural tube, where it is the key regulator of the dorsoventral patterning genes.
Sonic hedgehog (Shh) is expressed in the notochord and floor plate, and within its family
it is likely the most similar to the ancestral chordate gene: such an expression pattern was
also described in Amphioxus (Shimeld 1999). The hedgehog gradient is interpreted by
two groups of transcription factors (Figure 10), mostly of the nk and pax type (Briscoe &
Ericson 1999). Subsequently, they specify the dorsoventral coordinates of the neuronal
progenitor domain (Jessell 2000).

The range of hedgehog signaling is regulated by other means as well. Hedgehog-

interacting protein (Hip) is expressed by cells close to Shh (as well as Ihh and Dhh)
signaling centers, and it can trap the ligand, limiting the extent of the gradient (Chuang &
McMahon 1999). Like Ptc, it is one of the transcriptional targets of hedgehog itself. And
tectonic, a novel secreted protein that also exists in Drosophila, is acting somewhere
downstream of Ptc and Smo. It is required for the maximum activation of the pathway,
but unlike Ptc or Hip it is not regulated by Shh, and it seems to also have a role in
downregulating the hedgehog levels through a different route (Reiter & Skarnes 2006).
 39

Figure 10. The roles of Shh in the ventral neural tube.

There are two sources of Shh in the neural tube: a primary source in the notochord and a secondary one in
the floor plate that is induced by the first. The gradient is interpreted by the column genes. The ventral ones
such as nkx2.2, nkx2.9, nkx6.1 and nkx6.2 are expressed only where Shh levels are high; nkx2.2 and nkx2.9
in particular are expressed directly next to source. The opposite is true for the genes that do not reach the
midline: for them Shh is a suppressor and their ventral boundary is dependent on their particular sensitivity:
pax6 can tolerate the highest levels, pax7 the least. The initial expression domains are fuzzy, but the
borders are subsequently refined by the mutual cross-repression: nkx2.2 and nkx2.9 with pax6, nkx6.1 with
dbx1 and nkx6.2 with dbx2.

In addition to dorsoventral patterning, the sonic hedgehog gradient that forms in the trunk
CNS plays other roles as well. Together with netrin-1 it guides the dorsal commissural
axons towards the midline, by means of the Ptc/Smo signaling pathway (Charron et al.
2003). However, after the axon growth cones arrive at the floor plate Shh becomes a
repellant; this new role is mediated through the Hip receptor (Bourikas et al. 2005). The
formation of oligodendrocytes is closely related to that of motoneurons, and both rely on
the bHLH transcription factor Olig2 (Lu et al. 2002); (Takebayashi et al. 2002). Shh is
essential for their specification, as it is for that of motoneurons. There is however a small,
 40

later pulse of oligodendrocyte formation in the dorsal regions of the neural tube, that can
occur in the absence of nkx6 and Smo (Cai et al. 2005).

1.7 The formation of interneurons in the vertebrate neural

tube

The trunk central nervous system contains many types of interneurons, distinguished by
different projections and neurotransmitters. Within the vertebrate neural tube there are
four ventral interneuron classes and 6 dorsal ones (Figure 8). Each type is derived from a
progenitor domain, and as the neurons exit the mitotic cycle they differentiate into many
subtypes. Their specification is a very complex process that depends on the action of
morphogen gradients such as Sonic hedgehog and BMPs, followed by the expression of
HD, LIM-HD and bHLH transcription factors in a combinatorial fashion (Figure 11).
Most of these genes are evolutionary conserved between Drosophila and vertebrates, but
with some differences in the way they are employed. In Drosophila the different types of
neurons do not form distinct domains with separate dorsoventral locations. Instead,
several neuron types are formed from a neuroblast lineage which is in turn derived from a
single ganglion mother cell (Bossing et al. 1996). The neural tube can be divided in two
regions: a ventral portion that is largely under the influence of hedgehog signaling
originating from the notochord and floor plate, and a dorsal region that is largely
patterned by BMPs secreted from the roof plate (Figure 12).

1.7.1 The ventral half of the neural tube is patterned by a

combination of HD and LIM-HD transcription factors

In a ventral to dorsal order, the following neuron types are formed within the hedgehog
gradient: V3 interneurons, motoneurons, V2, V1 and V0 interneurons (Jessell 2000).
Each progenitor domain has a particular molecular fingerprint: one or more of the column
genes are expressed in this region, and act in a combinatorial fashion to specify it (Figure
 41

10). This is followed by a second round of postmitotic markers that are more restricted in
their expression (Figure 11), and they induce the set of neuron specific differentiation
genes: neurotransmitters, adhesion molecules etc.

The formation of the V3 interneurons in the spinal cord requires the highest levels of
sonic hedgehog, therefore they are located the most ventral, adjacent to the floor plate
(Figure 11). They initially express nkx2.2 and nkx2.9 (Briscoe et al. 1999), followed by
single minded (sim). Not much is known about them, they are likely glutamatergic,
although they could use more than one neurotransmitter (Kiehn 2006). In the hindbrain,
the visceral motoneurons are derived from this region, and they express Lmx1b and Isl1
(Ding et al. 2003); (Thaler et al. 2004). The next progenitor domain gives rise to the
somatic motoneurons (Figure 11), discussed below in more detail. The boundary between
the V3 interneurons and the motoneurons is defined by the cross-repression of nkx2.2 and
pax6 (Figure 10).

V2 interneurons are formed immediately dorsal to the motoneuron domain (Figure 11).
There are some differences between chick and mouse in the early specification of the
motoneuron and V2 IN domain. MNR2 plays a prominent and early role in chick,
whereas in mouse Lhx3 is the earliest postmitotic marker expressed in this region
(Tanabe et al. 1998). The LIM-HD transcription factors form complexes through the
interaction with NLI (Chip in Drosophila) of the type 2NLI: 2LIM-HD. This interaction
is essential for their activity both in Drosophila and vertebrates (van Meyel et al. 2000);
(Thaler et al. 2002). The larger Lhx3+ domain is subdivided into the motoneuron pool (as
described below) and the V2 interneuron pool by the expression of islet. The distinction
between the two is maintained through the cross-repression of hb9 and chx10 (Thaler et
al. 1999). These interneurons are probably also glutamatergic (Higashijima et al. 2004).
The expression of Lim3 (the Drosophila orthologue of Lhx3 and Lhx4) is mostly
overlapping with that of hb9, islet or both, generating several motoneuron types that can
be differentiated by their axonal projections (Thor et al. 1999). So far there is no
described cell type in Drosophila that would be equivalent with the V2 interneurons, but
the possibility remains.
 42

At the edge of the Shh gradient two more interneuron types are formed: the V1 and V0.
This is the region of the neural tube where the dbx1 and dbx2 column genes are expressed
(Figure 10), and they are the primary determinants of the neural fates. The V1
interneurons express nkx6.2, dbx1 (Vallstedt et al. 2001) pax2 and engrailed (En1)
(Figure 11) (Burrill et al. 1997). They can also be recognized by their ipsilateral axon
projections in the rostral direction and the use of the neurotransmitter GABA (Saueressig
et al. 1999). Likely there are more determinants of this cell fate, since En1 only plays a
late role in their differentiation (Burrill et al. 1997). Some of them are glycinergic
inhibitory interneurons, according to data from zebrafish and frog (Higashijima et al.
2004); (Li et al. 2004). In the protostome species where the expression of En has been
investigated, namely grasshopper and Drosophila, it was found in interneurons but not in
motoneurons, consistent with the vertebrate data (Siegler & Pankhaniya 1997); (Siegler
& Jia 1999). One difficulty is that in insects engrailed has an additional role in the
formation of segments, with no such function known in vertebrates (Patel et al. 1989).
Furthermore, the En+ neurons from grasshopper are GABAergic (Siegler & Pankhaniya
1997). These findings support the hypothesis of an ancestral inhibitory interneuron that
was specified by En and used the neurotransmitters GABA and possibly Glycine as well.

And finally, the V0 interneurons form in the region where both dbx1 and dbx2 are
expressed, but none of the nkx6 genes (Figure 10). The neuron fate is defined and
maintained by the expression of Evx1 (Figure 11), as well as the closely related Evx2
(Moran-Rivard et al. 2001). These neurons have contralateral projections, and as such are
easy to distinguish from the more ventral V1 interneurons. In keeping with the ventral to
dorsal dominance observed for other neuron types, in Evx1 -/- mutants the neurons that
form at the V0 level assume a phenotype close to that of the V1 interneurons. They are
inhibitory neurons that GABA as the neurotransmitter (Pierani et al. 2001).
 43

Figure 11. The expression of the HD and LIM-HD transcription factors in the postmitotic
motoneurons.

After the mediolateral patterning is established, the motoneuron progenitors exit the mitotic cycle and start
to express a new suit of transcription factors. In the ventral neural tube the following combinations are
expressed: sim in the V3 interneurons, lhx3, islet and hb9 in the motoneurons, lhx3 and chx10 in the V2,
En1 in the V1 and Evx1/2 in the V0. Within the dorsal region of the CNS: lbx1 and lhx1/5 in the dI6 and
dI4, lbx1 in the dI5, islet in the dI3, lhx1/5 in dI2 and lhx2 in the dI1 interneurons.

1.7.2 Several bHLH transcription factors are crucial in the

specification of the dorsal progenitor domains

The dorsal region of the neural tube is composed of a total of six progenitor domains.
They can be split in two classes (of three each) based on the expression of the HD
transcription factor ladybird (Lbx1): the more dorsal class A (dI1-dI3), that are under the
control of signals from the roof plate and do not express Lbx1 (Figure 11), and the more
 44

ventral class B (dI4-dI6) that are largely independent from roof plate signals such as
BMPs (Helms & Johnson 2003) and are Lbx1+ (Muller et al. 2002). The dI4-dI6 neurons
depend on ladybird for their formation, as shown by Lbx1 -/- mutants: the order of the
neuron types is preserved, but they assume more dorsal fates (Gross et al. 2002). Because
these neurons can form in the absence of both roof plate and floor plate signals, they
could be seen as the default types in the neural tube. Among the class A neurons, a well
understood example is the formation of the dI1 interneurons, defined by the expression of
Math1 (Figure 12), or Cath1 in chick (Helms & Johnson 1998). The dorsal limit of the
domain is set by Lmx1a through the repression of Math1 (Chizhikov & Millen 2004), and
the ventral limit by cross-inhibition with Ngn1 (Gowan et al. 2001). After cell-cycle exit
the dI1 neurons express Lhx2 and Lhx9, the most dorsal of the LIM-HD proteins (Gowan
et al. 2001). Unlike dI1, the formation of the dI2 and dI3 neurons depends on the action
of Olig3 (Figure 12), a more distant member of the Olig family of bHLHs. It has the dual
role of inhibiting the class B neuronal fate, through the repression of Lbx1 and of directly
inducing the dI2 and dI3 neurons, as shown by overexpression experiments (Muller et al.
2005). Several other bHLHs, such as Ngn1, Ngn2 and Mash1 are expressed throughout
the neural tube (Figure 12) and play key roles in the formation of the progenitor domains
(Helms et al. 2005); (Zechner et al. 2007). Ngn1 is required for the generation of the dI2
interneurons, and is defining the border between the dI2 and dI3 domains through the
repression of Mash1. Ngn2 is not involved in the specification of any particular neuron
type; instead it regulates their relative numbers (Helms et al. 2005). Whereas Mash1 is
both necessary and sufficient for the formation of dI3 and dI5 interneurons, it has to be
kept at relatively low levels within the dI4 domain (Helms et al. 2005).
In conclusion, the dorsal sensory interneurons are specified by a combination of bHLH,
HD and LIM-HD transcription factors, just like the more ventral types, except that bHLH
transcription factors play a more prominent role (Caspary & Anderson 2003).
 45

Figure 12. The expression of the bHLH transcription factors in the vertebrate neural tube

The bHLH transcription factors have a dual role in neurogenesis and as postmitotic markers, especially in
the dorsal half of the neural tube. Olig2 is expressed in the motoneuron domain and is an important
component of the molecular fingerprint. Ngn1 and Ngn2 are expressed throughout the ventral half of the
neural tube (with the exception of the V3 interneurons) and in the dI2 sensory interneurons. Ash1 is
expressed in the dI3, dI5 and somewhat weaker in the dI4 interneurons. Olig3 is expressed in the dI1, dI2
and dI3 interneurons, and is complementary to lbx1. The most dorsal bHLH is Ath1, expressed by the dI1
sensory interneurons.

1.8 The specification of motoneurons

Motoneurons are the best understood neuron types across a large number of species,
mostly because of several features they possess: stereotyped cell body positions, distinct
projections and innervations. From an evolutionary point of view motoneurons are an
ancient cell type, present in all animals with the exception of sponges (Dewel 2000). The
basic function of innervating muscles is their unifying trait, rather than the use of a
 46

specific neurotransmitter. Motoneurons are generally thought to be glutamatergic in

insects and cholinergic in vertebrates, although recently some have challenged this
distinction (Herzog et al. 2004); (Nishimaru et al. 2005). As of now, it is not known
whether motoneurons from all species can be traced to a single source, in a cnidarian-like
ancestor; however this appears to be the likely scenario (Miljkovic-Licina et al. 2004).

By comparing motoneurons from different species, such as Drosophila and mouse,

several conserved transcription factors have been found to be involved. In one study the
homeodomain transcription factor nk6 has been shown to regulate the formation of
motoneurons in both fish and Drosophila. Furthermore, if the vertebrate Nk6 protein is
expressed in the insect neuroectoderm it promotes the ectopic formation of a specific
motoneuron subtype (Cheesman et al. 2004). This would support a common ancestry of
motoneurons going back at least to the common ancestor of the protostome and
deuterostome lineages, namely Urbilateria. The picture becomes more complicated when
the next level of organization is investigated, the combinatorial expression of
homeodomain and LIM-homeodomain proteins.

1.8.1 The molecular fingerprint of the vertebrate cholinergic

motoneurons contains the lhx3, islet and hb9 transcription factors

Several transcription factors are operating to specify the motoneuron phenotype: islet,
lhx3/lim-3 and hb9 are the most important. Within the mouse neural tube, somatic
motoneuron specification proceeds through several consecutive steps. First, a progenitor
pool is specified within the dorsoventral arrangement by the combined action of two
transcription factors: nk6 and pax6 (Figure 13 A). This pool of precursors is defined by
the expression of the transcription factors lhx3 and lhx4. Second, the ventral part of this
larger domain is specified as a pool of somatic motoneurons by the expression of islet1, a
LIM-HD protein (Pfaff et al. 1996), whereas the more dorsal region gives rise to the
chx10+ V2 interneurons (Figure 13 A). The default fate for the lhx3/lhx4+ cells is to
become interneurons, islet1 expression is necessary to define them as motoneurons by the
 47

formation of an islet1/lhx3 complex and by the suppression of chx10 expression within

this domain (Thaler et al. 2002). After islet becomes established, hb9 (a HD transcription
factor) starts to be expressed by the differentiating motoneurons (Arber et al. 1999). Hb9
and islet1 are working in a mutual activation loop that ensures their continued expression
in the neuron lineage. Another key player in the specification of motoneurons is the
bHLH transcription factor Olig2 (Takebayashi et al. 2002). It suppresses lhx3 and hb9
expression in the motoneuron progenitor domain, acting as a brake on differentiation
(Figure 13 A). Ngn2, also a bHLH transcription factor, has the opposite effect of
promoting motoneuron differentiation and cell cycle exit. When Ngn2 concentration
reaches a certain level Olig2 activity is suppressed and the progenitor cells differentiate
into motoneurons (Lee et al. 2005).

The mechanism for motoneuron specification in chick is slightly different from the one
described above. In the chick neural tube the first motoneuron marker to be expressed is
MNR2 (Figure 13 A), a HD protein closely related to hb9 (Tanabe et al. 1998). In the
signaling cascade it is upstream of lhx3 and Islet, and it can autoregulate its own
expression. It can also activate specific marker genes such as ChAT, and if it’s
misexpressed it induces ectopic motoneurons. The expression of MNR2 is only transient;
however, the chick hb9 gene plays a similar role as in mouse, maintaining the
differentiated state of motoneurons. From an evolutionary perspective hb9 and MNR2 are
closely related genes, with the split occurring sometime during vertebrate evolution
(Ferrier et al. 2001). MNR2 is known from fish as well, and it was apparently lost in
mammals such as mouse and human. Despite some uncertainty about the ancestral
relations between hb9/MNR2 as opposed to islet and lhx3, it can be inferred that all three
genes have been important for motoneuron specification at least as far back as the origin
of vertebrates.
 48

1.8.2 The glutamatergic motoneurons from Drosophila are

specified by several combinations of the lim3, islet, hb9 and eve
transcription factors

Their importance becomes even more apparent when one looks at the mechanisms of
motoneuron specification in Drosophila. As already mentioned, neurogenesis in the fly is
quite different from vertebrates. Motoneurons (along with interneurons and glial cells)
are formed at all dorsoventral positions from ganglion mother cells instead of originating
from a single well defined progenitor domain (Bossing et al. 1996). Drosophila Isl, the
homologue of the vertebrate islet-1 and islet-2, is important for the specification of
ventrally projecting motoneurons (Thor & Thomas 1997). Drosophila hb9, the
homologue of the vertebrate hb9/MNR2 is expressed by the majority of motoneurons
(Figure 13 B). The dorsally projecting eve+ motoneurons (Figure 13 B) do not have a
vertebrate counterpart; hb9 and eve are mutually cross-repressing each other at the cell-
type level (Broihier & Skeath 2002). Motoneurons can be classified according to their
axon projections into three groups: the dorsally projecting ISN (further divided into
ISNb, ISNd, ISNL and ISNDM) and the ventral and laterally projecting SN (SNa, SNc)
and TN respectively (Schmid et al. 1999). With the exception of the ISNDM projecting
motoneurons, all the other groups express some combination of one of the following
genes: lim3, hb9, isl (Thor & Thomas 2002). The ISNb projecting neurons express all
three markers, which makes them the closest analogue to the vertebrate somatic
motoneurons (Figure 13 A, B). This is in line with the results of (Cheesman et al. 2004),
where the ectopic expression of the zebrafish nkx6.1 gene in the Drosophila
neuroectoderm has been shown to promote an increase in the numbers of this particular
neuron type. It is reasonable to conclude these genes were involved in the specification of
motoneurons in Urbilateria as well, downstream of nk6 and possibly pax6 as well.
 49

Figure 13. The specification of motoneurons in vertebrates and in Drosophila.

(A) Motoneurons are formed in the vertebrate neural tube from the region where nkx6.1, nkx6.2 and pax6
are coexpressed, but nkx2.2, nkx2.9 and irx3 are absent. The progenitor cells express lhx3/4, and in chick
(but not in mouse) Mnr2 as well. The bHLH transcription factor Olig2 is also expressed during this stage,
and is responsible for maintaining the undifferentiated state. The motoneurons are distinguished from the
V2 interneurons that form dorsal to them by the expression of islet and chx10 respectively. Olig2 is
downregulated in the motoneurons as they exit the cell cycle, and they start to express another bHLH,
Ngn2. The postmitotic motoneurons express hb9, islet1 or islet2 (depending on their subtype) as well as
several bHLH transcription factors: Ngn1/2 and NeuroM/D. Hb9 expression maintains the identity of the
domain by repressing chx10.
(B) There is no single progenitor domain in Drosophila, motoneurons form at all mediolateral positions and
they express different combinations of the same genes that are active in vertebrates. They can be sorted
according to the path of their projections to the body wall musculature. Those that project through the
transverse nerve (TN) express islet, hb9 and those that do so through the segmental nerve (SNa and SNc)
express hb9 and lim3. The ones that belong to the intersegmental nerve group (ISNb and ISNd) are the
most similar to the vertebrate motoneurons because they express all three genes: islet, lim3 and hb9. Unlike
them, the motoneurons that project to the dorsal musculature (ISNDM) are specified by eve and have no
counterpart in the vertebrate neural tube.

Interestingly, there is more diversity of motoneuron types in Drosophila compared to

vertebrates. It is possible the urbilaterian ancestor possessed several types of
motoneurons, and during vertebrate evolution only the lhx3+/islet+/hb9+ subset was
retained (Thor & Thomas 2002). This view is supported by the existence in C. elegans of
a dorsally-projecting vab-7 (an eve homologue) positive motoneuron population
(Esmaeili et al. 2002). However, no islet or hb9 homologous genes were found in the
worm, indicating that its nervous system is probably derived and unlike that of
Urbilateria. An alternative interpretation is that the signaling cascade of lhx3-islet-hb9
has been reorganized in ecdysozoans, leading to the current state where several
motoneuron types depend on just a subset of them, or none at all in C. elegans, whereas
 50

eve (previously an interneuron marker) has been recruited in the specification of a new,
dorsally projecting motoneuron class without a counterpart in vertebrates.

Within the hindbrain there is another motoneuron population in addition to the somatic
ones: the visceral motoneurons that innervate the branchial arches and the autonomic
ganglia. Unlike the somatic motoneurons, that require pax6 and nkx6.1/2 for
specification, the visceral motoneurons are suppressed by pax6 and require instead the
expression of nkx2.2 and the closely related nkx2.9 (Pattyn et al. 2003). The functions of
nkx2.2 and nkx2.9 seem to be mostly overlapping, and together they are essential for the
expression of Phox2b, the postmitotic marker of the visceral motoneurons (Pattyn et al.
2003).

1.9 The vertebrate floor plate and the insect midline

The Drosophila midline is an important signaling center for the patterning of the neural
plate and for the subsequent neuronal wiring (Kim et al. 2005); (Dickson & Gilestro
2006). In vertebrates a similar structure, the medial floor plate, plays the same roles
(Jessell 2000); (Salinas 2003). Although there are some differences in the signaling
pathways used there are good reasons to believe the two structures are related. In
Drosophila the formation of the midline depends critically on single-mided (sim) (Skeath
1998), and in the honeybee sim is also expressed in the midline, but as a wider stripe
(Zinzen et al. 2006). The expression of the three column genes that are responsible for the
mediolateral patterning of Drosophila (vnd, ind and msh) is disrupted in sim -/- mutants,
and this effect is likely mediated through Fgfr signaling (Kim et al. 2005). Later in
development, the axons of the commissural neurons require several guidance cues from
the midline. The mechanisms involved are complex, involving both attractive and
repellant molecules, but are fairly well understood (Dickson & Gilestro 2006). Slit
encodes a large secreted protein that functions as a repellant when it binds to the
Roundabout (Robo) receptor (Long et al. 2004). Although the robo mRNA levels remain
constant in the commissural neurons, there is a differential localization of the protein: the
Robo receptor is concentrated on the growth cones that have already crossed and are
 51

projecting ipsilaterally, parallel to the midline (Dickson & Gilestro 2006). This sorting is
accomplished by commissureless (comm) that is expressed both in the midline cells and
in the neurons themselves. It acts as switch, and when it is activated it targets Robo
directly from the Golgi to the endosomes (Keleman et al. 2005). Netrins are the attractant
molecules. They are probably not alone in this regard, as embryos lacking netrin still
show some axon migration towards the midline. It could be that they are short ranged in
Drosophila, mostly involved in getting the axons across the midline. (Brankatschk &
Dickson 2006).

The vertebrate floor plate forms from the neural tissue that is located just above the
notochord. It is not committed to a particular fate, indeed it can even form motoneurons if
transplanted (Placzek et al. 2000), but under normal circumstances it is induced by the
notochord. Both Shh and Nodal (a member of the TGFβ superfamily) signaling are
involved in this process (Patten et al. 2003). Actually there are many common features
between the notochord and the floor plate: not only do they share a similar cell lineage
(Teillet et al. 1998), they also both express Forkhead (or HNF3β), a winged helix
transcription factor. This is interesting, because when it is misexpressed Forkhead can
ectopically induce floor plate tissue (Sasaki & Hogan 1994).

The floor plate is not a homogenous structure: it can be subdivided into a medial and a
lateral region. The medial region is closely related to the notochord, and it has been
shown in chick and zebrafish that it is ultimately derived from the Hensen’s node
(Charrier et al. 2002); (Schafer et al. 2007). The medial floor plate (MFP) also expresses
Shh and netrin, and as such acts as a second signaling center in the patterning of the
ventral half of the neural tube (Jessell 2000); (Odenthal et al. 2000). The lateral floor
plate (LFP) has a neuroectodermal origin, and it is induced by signals such as Shh from
the notochord and floor plate (Charrier et al. 2002). Forkhead is expressed throughout the
floor plate (Odenthal et al. 2000), whereas Sim is only expressed in the lateral portion, as
well as in the adjacent V3 interneurons (Briscoe et al. 1999); (Charrier et al. 2002).
Although there are some differences between vertebrate species in the details of the
arrangement, such as the fact that in zebrafish the LFP is not continuous but partially
 52

intercalated with V3 interneurons (Schafer et al. 2007), or that the mouse floor plate
appears to derive entirely from neuroectoderm (Jeong & Epstein 2003) the two
component model is well supported by the experimental data.

The importance of the floor plate in the guidance of commissural neurons is not entirely
understood: for example, in Gli2 mutants that lack it there is still a lot of axon migration
across the midline (although disorganized), possibly due to residual netrin expression
(Matise et al. 1999). It is clear however that the same molecules that are responsible for
axon guidance in Drosophila, namely Netrin and Slit, are also present and active in this
region. The netrin-1 mRNA is found in the floor plate, and the protein forms a gradient
across most of neural tube (Kennedy et al. 2006). This supports the view of netrin as a
long range attractant in vertebrates. Netrin-1 has also been shown to collaborate with Shh
in the guidance of the commissural axons to the midline (Salinas 2003). Slit acts as a
chemorepellant by binding to the Robo1 receptor that in turn blocks the netrin receptor
CCD (Woods 2004). Robo1 is downregulated by Robo3 during midline crossing,
reminiscent of the role played by comm in Drosophila (Jen et al. 2004); (Sabatier et al.
2004).

Amphioxus shows netrin expression both in the ventral region of the neural tube and in
the notochord (Shimeld 2000). This is consistent with an ancestral role for the gene as a
midline and floor plate marker in chordates. In the hemichordate Saccoglossus netrin is
expressed quite broadly in the ventral neuroectoderm and on the opposite side of the
BMP signaling center. Later in development it is restricted to a narrow stripe in the same
region (Lowe et al. 2006). The localized expression of netrin is somewhat surprising,
considering that Saccoglossus has a diffuse CNS; however, it does have a ventral axon
tract, and netrin might play a role in its formation (Lowe et al. 2006).
 53

1.10 Aim of the thesis

The evolution of the central nervous system was a complex affair and there are many
open questions remaining. In particular, currently there is no way to distinguish between
these two competing hypothesis: either Urbilateria had a complex nervous system that
became independently centralized on the opposite sides of the body in protostomes and
deuterostomes, or it had a complex and well defined CNS (by definition on the ventral
side) but the deuterostome ancestor underwent a dorsoventral inversion shortly after the
split from the protostome ancestor. My aim was to investigate the formation and
patterning of the CNS in Platynereis, and then compare it with those already described in
the established model organisms such as Drosophila, chick and mouse.

For this study I chose the “molecular fingerprint” approach, previously used for the
description of the ciliary photoreceptors in the Platynereis brain (Arendt et al. 2004).
Briefly, the concept states that across long evolutionary time spans the most conserved
feature is the cell type. Even when the morphology has changed beyond recognition, the
cell type that was also present in the distant ancestor (where it played the same function
as it does in modern species) can still be identified by a specific combination of
transcription factors, neurotransmitters or subcellular structure.

I have concentrated on the trunk nervous system of the trochophora larva, and I have
studied several levels of organization. First I have investigated the patterning of the
neural plate (along the DV axis) by the combinatorial expression of a number of
transcription factors. Second, I tried to find out what are the signaling pathways that are
involved in establishing the patterning, and I interfered with them using pharmacological
agents. And third, I have extended the analysis to include the formation of neuron types,
both motoneurons and interneurons, at different mediolateral locations. My final
objective was to assemble a “minimal package” of cell types that are conserved across the
three superphyla, and to answer the question: what kind of nervous system was present in
Urbilateria?
 54

2 RESULTS
 55

2.1 The mediolateral patterning in Platynereis is very

similar to that described in vertebrates

From many studies over the past years it became apparent that the central nervous
systems of bilaterian animals share several conserved features, even between species as
widely divergent as mouse and Drosophila. The molecular details of the mechanisms
used to specify the dorsoventral axis have been compared, and it turned out that a key
feature is the early expression of several homeodomain genes, in parallel stripes along the
anteroposterior axis. These findings, as reviewed by (Arendt & Nubler-Jung 1999);
(Cornell & Ohlen 2000), were persuasive enough to swing the balance in favor of the
long advocated “dorsoventral inversion theory”, that claimed a common ancestry for the
CNS in extant organisms. However, due to the sparse molecular data available (in most
cases, the absence) for all but the most studied species, some researchers still insisted the
issue remained unresolved. This point of view gained a measure of support from the
study of the CNS in Saccoglossus kowalevskii, a hemichordate (Lowe et al. 2003). In
essence, the authors had shown that for this species a very well patterned anteroposterior
axis can coexist with basically very little organization on the dorsoventral axis. They also
proposed this was the ancestral condition of the last common ancestor of all
deuterostomes (Lowe et al. 2003); (Gerhart et al. 2005) and possibly that of the last
ancestor of all bilaterian animals as well.

At the same time, there was a growing consensus among phylogenists that protostomes,
the sister group of deuterostomes, should be split into two distinct superphyla: Ecdysozoa
and Lophotrocozoa (Aguinaldo et al. 1997); (Peterson & Eernisse 2001). This meant that
the mainstay invertebrate models C. elegans and Drosophila were part of the Ecdysozoa,
leaving about half of all protostome phyla almost without a representative model
organism. The need for a new model organism to fill this gap was highlighted in a paper
(Tessmar-Raible & Arendt 2003) that proposed Platynereis dumerilii, a marine annelid,
as a suitable candidate. In addition to being a lophotrocozoan, Platynereis also held the
promise of having retained many ancestral features compared to other, potentially faster
evolving species. According to the inversion theory the ventral plate of Platynereis
 56

corresponds to the dorsal CNS of vertebrates. However, there is a complication because

the vertebrate neuroectoderm is folded into a tube. This means that mediolateral axis in
Platynereis corresponds to the DV axis in the vertebrate neural tube (Figure 14).

Figure 14. The mediolateral

patterning in Platynereis is
equivalent to the DV
patterning in the vertebrate
neural tube.

There are two differences

between the trunk CNS of
Platynereis and vertebrates. The
first is in the ventral versus the
dorsal position, and the second is
that the initially flat neural plate
folds into a tube in the
vertebrates. Taking the midline
as a reference, the more lateral
the expression domain in
Platynereis, the more dorsal is
the corresponding domain in the
vertebrate neural tube.

2.1.1 The three column genes nk2.2, gsx and msx are expressed in
Platynereis in a similar but not quite identical fashion to
Drosophila

Some work had already been done in this direction, before I started the project.
Specifically, the three column genes that had been identified as the most obvious
conserved feature between protostomes and deuterostomes were cloned: nk2.2 and msx
by Heidi Snyman and Kristin Tessmar-Raible, and gsh by David Ferrier. My first task
was to study the expression of these in the Platynereis neural plate at different stages and
to compare it to the one described in other species. I have used the standard Whole
Mount in-situ Hybridization (WMISH) protocol, as described in the Materials and
Methods section. The expression of nk2.2 (or vnd in Drosophila) in the ventral plate
 57

starts very early (around 22 hpf), in the form of a few cells on either side of the midline,
and directly adjacent to the stomodaeum. By 24 hpf the expression domain resembled a
triangle, extending about halfway around the stomodaeum (Figure 15, A).
The nk2.2 column extended further along the midline as development progressed, until
around 34 hpf it spanned the full length of the ventral plate (Figure 17 A, C). Besides the
actual column, there were also two branches of weaker expression at the top of the neural
plate, giving the overall shape of Y that was centered on the stomodaeum. At 48 hpf the
expression remained almost unchanged, with the difference that the two lateral branches
of the Y have almost disappeared (Figure 16 A, B). I have also investigated the
expression of nk2.2 beyond 48 hpf, for example at 60 and 72, and it remains similar
except the column begins to break into clusters of neurons (data not shown). There is no
expression in the brain, not even at later stages.

Figure 15. The expression of the column genes at 24 hpf.

(A) The expression of nk2.2 at 24 hpf, ventral view, consists of two narrow stripes that follow the contour
of the stomodaeum and are joined just below it. (B) The expression of pax6 at 24 hpf consists of two thick
columns arranged in V-shaped pattern, flanking the stomodaeum; the arrow indicates a gap between the
pax6 domain and the stomodaeum, where nk2.2 is likely expressed. (C) msx is expressed as two lateral
domains, far away from the stomodaeum (situated at the top center of the image); the segmental aspect is
apparent.

The expression of msx (msh in Drosophila) was also seen as early as 20 hpf, in the lateral
regions of the embryo, and with some expression in the brain. At 24 hpf it was visible in
the form of lateral stripes, likely both in the ectoderm and mesoderm; however, there was
no expression in the region around the stomodaeum, or in the more medial regions of the
ventral plate (Figure 15 C). The situation remained largely unchanged until about 40 hpf,
when two narrow stripes became visible quite close to the midline and the nk2.2 domain.
 58

This expression, although very faint in comparison to the lateral regions, persisted to 48
hpf (Figure 16 O, P). This immediately raised an interesting point, since the expression
domains of nk2.2 and msx do not come into contact, and indeed they are widely separated
in the two previously known cases (mouse and Drosophila). Because the RNA probe was
very short, the stainings tended to be very dirty. In order to confirm the expression of the
two ventral columns, I have amplified the fragment using a 5’ RACE reaction and the
same pattern was observed. Visualizing the expression of gsx (gsh in Drosophila) raised a
few issues as well. The first was a technical one, namely that David Ferrier had cloned a
small fragment (about 200 bp) with degenerated primers, as well as a longer fragment of
genomic DNA. Unfortunately the longer fragment had been lost, and the short one was
too small for the generation of probes. I have used the remaining amount of RNA probe
for my initial experiments, and subsequently I amplified the short fragment in a 5’ RACE
reaction, to obtain a 1 kb fragment suitable for probe generation. The second was that it
showed an early expression in the stomodaeum, but no expression in the ventral plate
until 48 hpf (Figure 16 I, J). Also, even at 48 hpf it did not form a continuous column:
there was always a gap somewhere between the second and third segment. If one
assumed a similar patterning scheme to that found in Drosophila, all three column genes
should be expressed in a medial to lateral sequence: vnd/nkx2.2, gsh/gsx and msh/msx;
also, the timing should be similar, since these genes must cross-repress each over to
establish distinct domains. This was clearly not the case in Platynereis, where gsx was
not expressed at the right stage to take part in such an interaction, and msx confusingly
showed two separated domains, one of them likely overlapping with gsh, and probably
nk2.2 as well.
 59

Figure 16. The expression of the column genes at 48 hpf

(A, C, E, G, I, K, M, O) WMISHs of the column genes, bright field Nomarski optics, ventral plate view.
(B, D, F, H, J, L, N, P) Whole Mount confocal laser reflection microscopy images (red), ventral plate,
counterstained with anti α-acetylated tubulin (cyan). (A, B) nk2.2 is expressed as a column along the
midline, and does not extend beyond the main axon tracts. (C, D) dbx is not expressed as a continuous
column in the neural plate; instead it is present in clusters of neurons just outside the main axon tracts. (E,
F) nk6 is expressed as a broad column starting at the midline and extending beyond the axon tracts. (G, H)
pax2/5/8 is expressed in two broad lateral domains, outside of the axon tracts. (I, J) The gsx expression
forms two incomplete columns in between the axon tracts, separated by a narrow gap. (K, L) pax3/7 is
expressed in two domains, even more lateral than those of pax2/5/8. (M, N) pax6 is expressed in two
columns that are just above the main axon tracts. (O, P) msx is expressed in two regions of the ventral
 60

plate: as two narrow ventral columns, in between the axon tracts, and as two very lateral columns at the
edge of the neural plate.

2.1.2 A vertebrate-like model explains better the expression of the

column genes in the Platynereis ventral plate.

Because the expression of the three columns genes alone shed little light on the matter, I
decided to extend my search to other genes. Since the patterning in Platynereis seemed to
be quite different from that of Drosophila, I looked into the vertebrate literature for hints
as to what these might be. Around the same time as the common features between the
mouse and the Drosophila were becoming accepted, a clearer picture was being
generated for the patterning of the chick neural tube. The importance of Pax6 and Shh
signaling had been recognized for a few years already (Ericson et al. 1997) but a true
model of the interactions taking place was only put together later, especially by the work
of (Briscoe and colleagues, 1999, 2000). As discussed in the introduction, the model
proposed that Shh produced from the notochord and floor plate promotes the expression
of four ventral genes, nkx2.2, nkx2.9, nkx6.1 and nkx6.2, and suppresses in a
concentration-dependent manner another group of more dorsal genes: pax6, dbx1, dbx2
and pax7.

2.1.2.1 The expression of pax6 versus nk2.2

Fortunately the Platynereis pax6 orthologue was already available, and I studied its
expression in the ventral plate. It was expressed as early as 16 hpf (Detlev Arendt,
personal communication) in the form of two columns, flanking the stomodaeum and
going both into the brain and the ventral plate. At 24 hpf it was expressed in a V-shaped
pattern, somewhat similar to that of nk2.2 but much broader and not extending quite as
ventral as it (Figure 15 B). The reason for the V shape was explained by Patrick
Steinmetz who showed that the neural plate forms through the fusion of two lateral
 61

domains that slide past the stomodaeum, and at this stage the midline is still forming.
Later at around 34 hpf the expression looked very similar, and it was visually apparent
that the two symmetrical pax6 domains were interlocked with the medial nk2.2 domain
(Figure 17 A, B). Since the cross-repression of nkx2.2 and pax6 had been highlighted as a
key feature of establishing the ventral domains of the vertebrate neural tube (Jessell
2000), I tried to clarify the issue in Platynereis. In particular, I wanted to know if there
really is a sharp border between the two genes. To that end I have done a double
fluorescent WMISH according to the published protocol (Tessmar-Raible et al. 2005) and
confirmed there are no cells at the border that coexpress both transcription factors (Figure
17 A, B). This result suggested that insofar mediolateral patterning is concerned,
Platynereis might be much more similar to vertebrates than to Drosophila, despite being
a protostome and hence phylogenetically closer. From this point on I have used
predominantly the vertebrate data as a guide for investigating the patterning of the
Platynereis neuroectoderm.

2.1.2.2 The expression of nk6, pax3/7 and pax2/5/8

I have cloned the Platynereis nk6 gene using degenerated primers, and I have amplified
the resulting fragment through both 5’ and 3’ RACE reactions. I have also confirmed that
it is equally distant from both nkx6.1 and nkx6.2, hence a true orthologue. It is expressed
in a very similar fashion to nk2.2, both in the timing and in the medial position (Figure 16
E, F). The only difference was in its extent: about twice as broad as that of nk2.2. I
examined its expression against pax6 in a double WMISH, only this time using a more
flexible approach, of combining an NBT/BCIP staining with a fluorescent one. In this
case there was a clear overlap between the two regions (Figure 17 E, F). The
visualization of the staining was done using the Whole Mount confocal laser reflection
microscopy technique, developed by Gaspar Jekely (Jekely & Arendt 2007). Gaspar also
provided crucial assistance during the acquisition of many of the confocal data sets for
the mediolateral patterning, and in the subsequent image processing.
 62

Figure 17. The arrangement of the column genes expression domains at 34 hpf.

(A-D) The double fluorescent WMISH of nk2.2 and pax6, scanned through confocal laser microscopy. (A)
The nk2.2 and pax6 domains are non-overlapping. (B) Double WMISH of nk2.2 (red) and pax6 (cyan), (C)
nk2.2, single channel, (D) pax6 single channel.
(E-H) The double fluorescent and NBT/BCIP WMISH of nk6 and pax6, scanned through confocal laser
microscopy. (E) The nk6 and pax6 domains have a considerable region of overlap. (F) Double WMISH of
nk6 (red) and pax6 (cyan), (G) nk6 single channel, (H) pax6 single channel.
(I-L) The double fluorescent and NBT/BCIP WMISH of nk6 and pax3/7, scanned through confocal laser
microscopy. (I) The nk6 and pax3/7 domains have almost no overlap. (J) Double WMISH of nk6 (cyan)
and pax3/7 (red), (K) nk6 single channel, (L) pax3/7 single channel.
(M-P) The double fluorescent and NBT/BCIP WMISH of pax6 and pax3/7, scanned through confocal laser
microscopy. (M) The pax6 and pax3/7 domains show a lot of overlap. (N) Double WMISH of pax6 (cyan)
and pax3/7 (red), (O) pax6 single channel, (P) pax3/7 single channel.
 63

The expression of pax258, a gene already published by Fabiola Zelada, was very weak
(probably due to a short probe) but it was clearly lateral (Figure 16 G, H). It was also
overlapping to a small extent with pax6 (data not shown). I have also looked at the
expression of the Platynereis pax3/7 gene (the orthologue of the vertebrate pax3 and
pax7 genes), kindly provided by the Balavoine lab. It turned out to be the most lateral of
the column genes, reminiscent of the expression described in the vertebrate neural tube
(Figure 16 K, L). At 34 hpf, the stage when the boundaries between the column genes
seemed to be the sharpest, pax3/7 showed a good amount of overlap with pax6 (Figure 17
M, N). This was in accordance with the vertebrate data, and together with the lack of any
gap between pax3/7 and nk6 it suggested that the arrangement of the mediolateral genes
is highly conserved between Platynereis and vertebrates.

2.1.3 The expression of dbx and the possible interpretations.

Together with nk6 I have also cloned the Platynereis dbx gene. Despite the fact that it
proved very difficult to amplify the initial fragment through RACE, I have eventually
succeeded in obtaining a 1.5 kb fragment. As for nk6, there was likely only one gene in
Platynereis, and it was equally related to the vertebrate dbx1 and dbx2. Despite a
reasonable probe length, the expression remained weak and hard to detect, even after a
prolonged staining. In some respects its expression was similar to that of gsh: it was not
present at earlier stages, only around 48 hpf, it did not form a continuous column (it
seemed to be confined to a few clusters of neurons) and it showed a lot of expression in
the stomodaeum (Figure 16 C, D). Because of the extreme weakness of the staining I was
unable to do a double WMISH; however, if one compared its expression with that of nk6
(using the main axon tracts for reference) there was probably no boundary or antagonism
present (Figure 16 F, D). The expression of dbx, together with that of gsh, was the main
difference between the patterning described in Platynereis and in vertebrates. Since there
is no data from Drosophila on a dbx gene, we are left to speculate as to why this may be
so. One possibility would be that dbx has been recruited as a column gene along the
vertebrate lineage, to drive the formation of new types of interneurons.
 64

2.2 Hedgehog signaling is required for the expression of the

column genes
The hedgehog pathway plays multiple roles in development, and is conserved between
Drosophila and vertebrates. However, there are some important differences as well, both
in the molecules themselves and in the developmental processes where it is used. The
most obvious is the gene duplication seen in vertebrates, with several hedgehog ligands
that bind to two Patched (Ptc) receptors, and at the end-point of the signaling cascade
there are three Gli proteins. Also, despite the fact that Smoothened (Smo) is the central
point in the pathway, its structure is quite different between the two phyla (Huangfu &
Anderson 2006). In fact it is so different that small molecule inhibitors (such as
cyclopamine) that are active in vertebrates do not function in Drosophila (Chen et al.
2002). The mechanism by which Ptc downregulates Smo is so far unknown, but it is
likely mediated by some intermediary (possibly a small molecule) because it is not
stoichiometric (Taipale et al. 2002). It is likely that one of the ancestral functions of
hedgehog was in the patterning of nervous system: among chordates, both Shh and the
Amphioxus hedgehog gene are expressed in the CNS (Shimeld 1999). Shh is directly
upstream of the column genes, setting up a gradient that defines their dorsal (Class II) and
ventral (Class I) boundaries (Figure 10). For this reason I decided to investigate it in
Platynereis.

2.2.1 The hedgehog pathway in Platynereis

A lot of work on the hedgehog pathway had already been done by Kristin Tessmar-
Raible, including the cloning of the Hh, patched and smoothened orthologues, and the
establishment of a cyclopamine inhibition protocol. My focus was on the effects of
cyclopamine on the column genes. In Platynereis there is no expression of Hh in the
midline region of the ventral plate (Kristin-Tessmar et al., unpublished), which was a
surprise considering such an expression had been described in the lophotrochozoan
 65

Patella vulgate (Nederbragt et al. 2002). Hedgehog is expressed in the stomodaeum,

which is technically part of the midline, and furthermore due to the gastrulation
movements of the ventral plate the entire neural tissue slides past it (as shown by Patrick
Steinmetz) and can receive the signal (Figure 19 A, B). Since nk2.2 is the closest to the
midline, it would be expected to receive the highest levels (Figure 19 A, C), whereas a
more lateral gene such as pax3/7 should receive much less. Unfortunately the expression
of Ptc and Smo was fuzzy and hard to interpret, so it was not possible to confirm the
sensitivity of the neural plate to Hh signaling (Kristin-Tessmar et al., unpublished).

2.2.2 The inhibition of the hedgehog pathway with cyclopamine

revealed different sensitivities among the column genes

In vertebrates, cyclopamine has been used at concentration as high as 50-100 µM for

short periods of times, of about five hours (Chen et al. 2001). In several in-vitro studies
on neural tube explants cyclopamine was found to be active in repressing weak levels of
Shh signaling, at concentrations as low as 50 nM (Cooper et al. 1998). Considering the
uncertainty with regard to the activity of cyclopamine on the Platynereis Smo, as well as
the wide range of concentrations used in vertebrates, I determined empirically the best
concentrations using the µM range as a starting point. Most of the column genes were
expressed in the ventral plate starting at about 22 hpf, so this was a natural choice for the
start of the inhibition. For my initial experiments I have inhibited the embryos between
22 and 48 hpf, with a range of concentrations between 2 and 20 µM. I have found that
concentration above 12 µM resulted in significant mortality, so I used this as the
maximum tolerable concentration. Nk2.2, the gene that should have the highest
sensitivity, was strongly downregulated in the almost all the treated embryos. However,
even at this concentration the morphology of the embryos was quite different from the
controls, and the inhibitor seemed to have a general toxic effect (data not shown).

Therefore I decided to use a shorter inhibition interval, that would allow less time for the
development of toxic effects, but long enough for the pathway to respond. I settled on a
 66

10 hour inhibition, between 22 and 32 hpf, when most of the mediolateral patterning is
established and the boundaries between the column genes are sharpest. The amount of
cyclopamine that could be tolerated without lethal effects was about three times higher
than in the previous experiment, and could be pushed as high as 36 µM. I have studied
the effects mostly at three concentrations: 12, 24 and 36 µM (Figure 18). There was
always a significant variation in the observed effects within a batch of inhibited embryos,
so I had to choose the representative phenotypes for a particular gene and concentration
in order to take pictures. However, the overall trend with increasing concentrations was
unmistakable.

As the closest gene to the Hh signaling center, nk2.2 was predicted to be the most
affected. This was indeed the case: at 12 µM cyclopamine concentration, the weaker
regions of the expression domain, such as the two branches below the stomodaeum were
gone, and at 24 µM only the cells that were just below the stomodaeum and presumably
at the highest concentrations of remaining Hh still expressed nk2.2 (Figure 18 B, C). At
the highest concentration of 36 µM, over 50% of the embryos were completely blank
(Figure 18 D), and the remaining expression was confined to just a few cells close to the
stomodaeum. Therefore nk2.2 was clearly downregulated in a concentration dependent
manner in the inhibited embryos. The effects on nk6 closely paralleled those on nk2.2,
only to a slightly lesser degree. At the lower concentrations of 12 and 24 µM there was a
pronounced restriction of the expression domain, with the remaining expression again
centered just below the stomodaeum (Figure 18 F, G). The highest concentration was
able to extinguish the expression in some embryos, but not as many as previously
observed for nk2.2 (Figure 18 H).
 67

Figure 18. The inhibition of Platynereis embryos with several cyclopamine concentrations.

(A, E, I, M) control embryos, incubated between 22 and 32 hpf with sea water and an equivalent amount of
ethanol to the treated ones; ventral plate views, Nomarski bright field microscopy images. (A) The
expression of nk2.2, (E) nk6, (I) pax6, (M) pax3/7. (B, F, J, N) embryos incubated between 22 and 32 hpf
with sea water containing 12 µM cyclopamine; ventral plate views. (B) The expression of nk2.2, (F) nk6,
(J) pax6, (N) pax3/7. (C, G, K, O) embryos incubated between 22 and 32 hpf with sea water containing 24
µM cyclopamine; ventral plate. (C) The expression of nk2.2, (G) nk6, (K) pax6, (O) pax3/7. (D, H, L, P)
embryos incubated between 22 and 32 hpf with sea water containing 36 µM cyclopamine; ventral plate
views, Nomarski optics. (D) The expression of nk2.2, (H) nk6, (L) pax6, (P) pax3/7.
 68

The expression of pax6 in inhibited embryos was an interesting case. First of all, the
levels of expression were not upregulated; in fact, there was even a slight reduction
(Figure 18 J, K, L). It was also apparent, especially in the strongest inhibited embryos,
that the shape of the expression domains was different: the angle between the two pax6
columns increased, and their posterior end reached only about halfway across the neural
plate (Figure 19 F, Figure 18 L). This argues against the idea that Hh is simply setting a
ventral boundary for pax6, since the dorsal boundary of the domain also shifted. Instead
the results can be better explained if we assume that pax6 is expressed where the
concentration of Hh is between certain values. Also, since nk2.2 (the presumed repressor
of pax6), is absent from the more ventral regions these cells can be respecified for a more
lateral fate (Figure19 D).

The expression of pax3/7 was intriguingly downregulated in the inhibited embryos

(Figure 18 N, O, P). Although it was not as severe as that observed for the nk genes (there
was always a bit of staining left, even at the highest concentration) the fact that it
happened is at odds with the model I proposed based on the pax6 data. There was no
apparent shift in the ventral boundary of the expression domains, just a general
downregulation. One alternative explanation could be that high levels of cyclopamine can
act as a general suppressor of transcription; if this was the case, it would also explain the
more mild reduction in the levels of pax6. The difference would be that since pax6
expression (as well as that of nk2.2 and nk6) is stronger than that of pax3/7, this effect is
more readily apparent in the weakest gene.
 69

Figure 19. The hedgehog expression in the stomodaeum controls the extent of the column genes
expression domains.

(A) In the control embryos, hedgehog diffuses from the stomodaeum and maintains the expression of nk2.2,
and in turn nk2.2 represses pax6. (B) The expression of hedgehog in the stomodaeum at 34 hpf, courtesy of
Kristin Tessmar-Raible. (C) The expression of nk2.2 and (E) pax6 in the control embryos, the white circle
denotes the stomodaeum. (D) In the treated embryos the nk2.2 domain is almost gone, and the pax6 domain
can move closer to the stomodaeum. (F) The two pax6 columns have pivoted closer to the signaling center
in the inhibited embryos.

2.3 Platynereis has a neural midline that resembles both the

vertebrate floor plate and the Drosophila midline.

As shown by Patrick Steinmetz, in Platynereis the neural midline forms through the
fusion of the two lateral domains as they slide past the stomodaeum. I have found nk2.2
to be expressed in the midline region, from early (Figure 17 A, B) to later stages (Figure
16 A, B), and also in virtual cross-sections through the ventral plate (Figure 29 A). This
resembles the expression of nkx2.2 in the vertebrate neural tube (Briscoe et al. 1999),
because in Drosophila vnd is absent in the midline, and there is a small gap between the
two stripes (McDonald et al. 1998). I have examined many embryos and found that Sim
does not form a bona-fide column in the Platynereis midline; instead, it is expressed only
at the level of the second and the third segment (Figure 20 B), sometimes with an
additional gap between them (data not shown). It is also expressed throughout the
stomodaeum (Figure 20 B) like most of the other midline genes. This pattern resembled
more the one found in insects, where sim is necessary for midline formation (Kim et al.
2005); (Zinzen et al. 2006), than the vertebrate one where the sim+ V3 interneurons are
found just adjacent to the floor plate (Briscoe et al. 1999).

The expression of forkhead raised an interesting point: in addition to the domain in the
stomodaeum, it is broadly expressed in the ventral region of the neural plate (Figure 20
C), almost as wide as nk2.2 (Figure 20 B). It cannot be considered a midline specific
marker in Platynereis, since it expressed beyond that region. That aside, what is the best
way to define the midline region in Platynereis?
 70

Figure 20. The molecular fingerprint of the Platynereis midline

(A) Ventral plate of the 48 hpf larva, with the midline highlighted in red. (B-F) The expression of the
midline markers (red) counterstained with anti α-acetylated tubulin; ventral plate images scanned with
whole mount confocal laser microscopy. (B) sim is expressed in an incomplete column in the midline, as
well as in the stomodaeum. (C) forkhead is expressed in the stomodaeum and in a wide column along the
midline. (D) netrin shows expression both in the midline and at the level of the axon tracts. (E) slit is
expressed only in the stomodaeum and in a narrow but deep column in the midline region. (F) GLT1 is
expressed in the midline but it has even more expression than netrin at the level of the axon tracts.

One way was to look for the expression of the evolutionary conserved chemoattractants
and chemorepellents that have been shown to be required for the formation of the axon
commissures: netrin and slit (Woods 2004); (Dickson & Gilestro 2006). Slit was
expressed in the stomodaeum and along the full length of the midline, in a narrow and
deep column (Figure 20 E). Netrin was also expressed along the midline, with one
difference: it was also present as a fine mesh at the level of the axon tracts (Figure 20 D).
This probably means that netrin is also expressed by some of the neurons or glial cells
outside the midline; however it should be mentioned that this expression, although real,
was far weaker than the one seen in the midline.
 71

Elav, one of the pan-neuronal genes, is basically absent from the midline at all the stages
investigated (Figure 30 A, D, G). Therefore, it is likely the midline contains glial cells,
like the one in Drosophila (Kim et al. 2007). Another argument in favor of a glial
connection is the expression of GLT1, a homologue of the glutamate transporter
expressed mainly in the astrocytes of the rat brain (Chen et al. 2002). In Platynereis
GLT1 mRNA can be found both in the midline and in several groups of cells at the level
of the axon tracts (Figure 20 F), whereas the Platynereis orthologue of the Vesicular
Glutamate Transporter (VGLUT) that is associated with the glutamatergic neurons
(Alvarez et al. 2004) was not expressed in the midline (data not shown). An interesting
observation is also the expression of the gsx gene. As discussed, it does not resemble that
of its vertebrate or Drosophila counterparts; instead, it forms two columns that likely
flank the midline domain (Figure 16 I, J). In conclusion, despite an overall conservation
of midline markers in the Platynereis ventral plate its neural midline shows a mixture of
conserved and novel features, and it is not completely identical to either its Drosophila
counterpart, or to the vertebrate medial floor plate.

2.4 BMP4 signaling controls the expression of the neural

patterning genes.
Having concluded that hedgehog signaling might play a role in the patterning of the
ventral plate (Figure 18, Figure 19) I turned my attention to the BMP pathway and its
possible roles in the Platynereis CNS. As a general principle in Bilateria, the neural
territory forms on the opposite side of the BMP signaling center, where specific
antagonists such as chordin and noggin are expressed (Harland & Gerhart 1997); (Rusten
et al. 2002). The BMP2/4 gene was cloned by Patrick Steinmetz, and I have confirmed
his initial findings by finding it expressed on the dorsal side of the embryo, opposite to
the ventral plate as one would expect (Figure 21 A, B). The expression domain was quite
complex at 48 hpf, containing three regions. Most of it was confined to the dorsal non-
neural territory, but there was also a stripe of expression in the region of the ventral row
of chaetal sacs, as well as a small domain deep in the stomodaeum (Figure 18 B). No
orthologues of the BMP inhibitors could be retrieved from ESTs or through degenerate
 72

primer cloning, so we have no way of knowing exactly how the BMP2/4 gradient is
regulated. However, the fact that a gradient likely exists opened up the possibility of
interference with the pathway. It had already been demonstrated that the zebrafish BMP4
is active across different species and can mimic the overexpression of the endogenous
genes (Darras & Nishida 2001); (Lowe et al. 2006) so I used the same approach. The
Platynereis larvae have the advantage of being small and with a permeable cuticle, so I
used the same experimental setup as for the cyclopamine inhibitions: soaking in 1 ml of
sea water containing the active ingredient. The protein was reconstituted with PBS
containing BSA and used fresh or frozen in aliquots at -80 °C. In my experiments I
observed a loss of up to 50 % of its activity upon a single freeze-thaw cycle, so it is
difficult to compare the inhibition results obtained using fresh protein to those that used
frozen one. As a rule of thumb, 300 nM of fresh protein had the same activity as 500 nM
of the thawed one. I have tried to process the embryos in large assays that included all of
the genes of interest, to minimize the effects of protein activity and batch to batch
sensitivity. The maximum concentration has been established through trial and error,
following the principle that the embryos exposed to the highest amount should not
experience more than 10 % mortality, and I worked my way down from there.

First I have conducted a large screen with the highest tolerable concentration that
included most of the neural genes involved in dorsoventral patterning as well as the
specific neuron markers; they were 26 in total. This provided several candidates that I
studied in more detail by doing a titration curve with several concentrations. Although
this limited the number of genes that could be investigated, the latter method offered
valuable information such as the threshold for certain effects. Because the effects tend to
vary significantly from embryo to embryo even in the same batch (possibly due to small
differences in the handling of the larvae during the WMISH procedure) I made sure to
examine large numbers to average out these variations. Together with Gaspar Jekely I
have developed an arbitrary scale that covered everything from no signal to ectopic
expression. Naturally, the “normal” level corresponded to the great majority of the
control embryos, usually around 95% or more. By manually sorting and counting them I
was able to quantify the effects in each case.
 73

Figure 21. The effect of ectopic BMP2/4 on the neural patterning genes in Platynereis.

(A,B) The expression of bmp2/4 at two stages, lateral view; the circles indicate the expression in the
stomodaeum. (A) continuous expression domain extending from the dorsal side to the lateral region, 34
hpf. (B) dorsal and lateral domains of expression, 48 hpf. (C) The expression of gsx in the stomodaeum and
midline, (D) in the treated embryos only the expression in the stomodaeum remains. (E) The expression of
nk2.2 along the midline, (F) most treated embryos show a severe reduction in the expression of nk2.2. (G,
H, K, L, O, P) The number of embryos showing different levels of expression in control samples and in
those treated with 150 and 300 ng/ml of zebrafish BMP2/4. (G) The expression of nk2.2 is strongly
affected with almost all embryos in the weak category at the higher concentration of 300ng/ml. (H) The
expression of nk6 is comparatively less affected, there is a slow increase with higher levels of BMP2/4. (I)
 74

The lateral expression of pax3/7 in the control, (J) the reduction in expression levels in the treated embryos.
(K) Pax3/7 is also strongly affected with most treated embryos showing either weak or no expression. (L)
The expression of pax6 is affected very little by BMP2/4, there is only a slight increase in the number of
embryos showing weak expression compared to the control. (M) The expression of ath is restricted in the
control embryos to small groups of cells in the lateral region. (N) In the treated embryos the ath domain
drastically expands, encompassing almost the entire neural plate. (O) The number of embryos showing
either strong or even ectopic ath expression greatly increases with the exogenous BMP2/4 concentration;
the majority of those exposed to 300 ng/ml express ath throughout the trunk neuroectoderm. (P) Within
experimental error, no change in the expression levels of elav was apparent.

The genes could be grouped into three categories according to their sensitivity to the
exogenous BMP4: (1) almost not affected, (2) somewhat or even completely
downregulated and (3) strongly upregulated. Only a few genes were in the first group:
among them nk6 that was just a bit affected (Figure 21 I), as well as pax6 and elav
(Figure 21 C, L) that were almost unchanged even at the higher concentration. The
majority were downregulated to some extent, such as nk2.2 and pax3/7 (Figure 21 E, G).
The effect was specific because for genes that had additional expression in the
stomodaeum, such as gsh, only the domain in the neural plate was downregulated (Figure
21 F). As for the last category, out of the 26 genes investigated only two were found to be
upregulated: the cholinergic marker ChAT, and to a much larger extent the bHLH
transcription factor atonal (ath). The effect of BMP4 on the expression of ath was
nothing less than dramatic (Figure 21 J): already at the lower concentration there were
significant numbers of embryos with strong overexpression (Figure 21 K). At the higher
concentration these embryos actually became the majority. This is an important finding
for two reasons. First, it absolves the method of a possible criticism regarding specificity:
since some genes are upregulated and others are downregulated, the effects are likely due
to a genuine sensitivity to the exogenous BMP2/4. And second, the ath+ interneurons are
located in the dorsal-most region of the vertebrate neural tube, immediately adjacent to
the roof plate and the BMP signaling center (Helms & Johnson 1998). They probably
represent an ancestral pool of interneurons or sensory neurons that formed in the region
of high BMP levels.
 75

2.5 The serotonergic neurons form within the nk2.2 column

Since the mediolateral patterning is very similar between Platynereis and vertebrates, I
investigated the possible conservation of the next level of complexity: the neuron types.
One example was the serotonergic neurons. Following Gaspar Jekelys’ observation that
an anti-serotonin antibody labels several neurons in the Platynereis ventral plate at 48
hpf, I have investigated their specification and some of their properties. In vertebrates the
somatic motoneurons (sMNs) extend from the spinal cord into the hindbrain; however,
there are also motoneurons that are restricted to the hindbrain levels: the visceral
motoneurons (vMNs) that innervate the branchial arches and the visceral ganglions
(Pattyn et al. 2003). Unfortunately I was not able to obtain the Platynereis Phox2b
homologue, the characteristic marker of the vMNs in the vertebrates.

Instead I have investigated the relation between nkx2.2 and the serotonergic neurons,
since it was shown that in chick their formation strictly requires nkx2.2 and nkx2.9
(Briscoe et al. 1999); (Cheng et al. 2003). The serotonergic neurons that form in the
vertebrate hindbrain have a distinct molecular fingerprint. Nkx2.2 was the first essential
component to be identified (Briscoe & Ericson 1999), and later Lmx1b and Pet-1 were
also found to be crucial determinants of this cell type (Cheng et al. 2003); (Ding et al.
2003). Although the relative positions of Lmx1b and Pet-1 in the signaling cascade
remain somewhat controversial, it is clear they are both downstream of nkx2.2 (Cheng et
al. 2003). Also the bHLH transcription factor Mash1 is coexpressed with nkx2.2, and it is
essential for the formation of the serotonergic neurons (Pattyn et al. 2004). However, it is
clear that more components remain to be discovered, for the simple reason the known
transcription factors do not differentiate between the serotonergic neurons and the rest of
the nk2.2+ cells. Many functions have been attributed to these serotonergic neurons, for
example in the formation of central pattern generators in rat (Vinay et al. 2002), however
there was a recent controversial finding that Lmx1b mutant mice, although completely
lacking these neurons, do not show any obvious abnormalities in their nervous system or
behavior (Zhao et al. 2006).
 76

For WMISH stainings I have used the gene that encodes tryptophan hydroxylase
(Pdu_TrpH), the rate limiting enzyme in the synthesis of serotonin, and for the
immunostainings that combined serotonin and phalloidin I have used the above-
mentioned antibody because the exposure of the embryos to methanol during the fixation
protocol destroyed the binding sites of phalloidin.

2.5.1 TrpH+ cells come from the nk2.2 column

The expression of TrpH starts very early in the ventral plate: two cells at the level of the
first segment. It is possible they are even the source of the pioneering axons of the first
segments’ commissure (Figure 22 F, G). I have checked many developmental stages
between 20 and 60 hpf, at approximately 4 h intervals, to get an image of the dynamic
expression of the gene (data not shown). Surprisingly, between about 22 hpf (when the
two cells become visible) and 48 hpf this is the only expression apparent in the ventral
plate. The only changes are a progressive increase in the depth of the expression domain,
and a few cell divisions that give rise to a compact group of a few TrpH+ cells (Figure 29
B). However, soon after 48 hpf there is an increase in the number of serotonergic neurons
in the trunk, and by 54 hpf there are pairs of them at the level of each segment (Figure 28
D). In order to examine their position in the mediolateral context, I have done a double
WMISH of TrpH/nk2.2 and TrpH/pax6, counterstained with anti acetylated α-tubulin.
The chosen stage was 34 hpf, because that is just before postmitotic markers such as lhx3
and islet begin to be expressed: we called it the predifferentiation stage, when the column
genes define the distinct regions of the neuroectoderm in a combinatorial fashion. The
conclusion was that the TrpH+ neurons come from the nk2.2 column (Figure 22 A, B)
rather than the pax6 column (Figure 22 E, F). A careful analysis of the confocal
microscope stacks revealed that the TrpH+ cells are just below the nk2.2+ ones, so by this
stage the neurons are probably fully differentiated and nk2.2 expression is no longer
required to maintain their fate (such a role is probably played by another transcription
factor, like Phox2b). The situation is less clear for the serotonergic neurons that appear
after 48 hpf, since by that time the boundary between the expression of nk2.2 and pax6 is
 77

harder to make out due to the thickening of the neural plate. To circumvent that I have
done high resolution scans and used the data for a 3D reconstructions of the embryos. In
virtual cross-sections through the ventral plate there is little apparent overlap between
nk2.2 and TrpH expression (Figure 29 A, B) but the two regions are on top of each other,
reminiscent of the situation observed at 34 hpf in the first segment. In conclusion, TrpH+
cells can be traced back to the nk2.2 column, but their molecular fingerprint is still
incomplete (for lack of a postmitotic marker).

Figure 22. The serotonergic neurons form from the nk2.2 and not the pax6 column.

(A) Schematic of the location of the TrpH+ cells (red) within the nk2.2 column (blue) in the 34 hpf ventral
plate view. (B) ThpH and nk2.2 coexpression, counterstained with acetylated tubulin. (C) TrpH single
channel, (D) nk2.2 single channel. (E) Schematic of TrpH+ cells (red) outside of the pax6 column (blue) in
the 34 hpf ventral plate. (F) ThpH and pax6 coexpression, counterstained with acetylated tubulin. (G) TrpH
single channel, (H) pax6 single channel.
 78

2.5.2 Some of the projections from the serotonergic neurons make

synapses on the longitudinal muscles

Because an anti-serotonin antibody was readily available, I have also investigated the
projections of these neurons together with Gaspar Jekely. Since most of the neuron-
specific markers begin to be expressed in the ventral plate only after 48 hpf, I have used
54 hpf as a reference stage for them (Figure 28); most of the serotonergic neurons are no
different in this regard. They are organized in pairs, almost ganglion like, at the level of
each segment (Figure 23 C, D), and the cell bodies are positioned just above the axon
tracts (Figure 23 K, L). The musculature of the Platynereis trunk (visualized with a
rhodamine-phalloidin staining) is complex, with 4 longitudinal columns (two ventral and
two dorsal) and many other lateral and oblique bundles (Figure 20 D, L). Although the
serotonergic neurons are confined to the ventral side of the embryo, their axons also
project dorsally in between the chaetal sacs (Figure 20 G, K) and make synapses on the
dorsal longitudinal muscles (Figure 20 H). This qualifies them as serotonergic
motoneurons, homologous to the vMNs from the vertebrate hindbrain. The function of
the serotonergic neurons as regulators of the musculature was confirmed by experiments
from Gaspar Jekely, who showed that the addition of a serotonin antagonist inhibits the
rate of spontaneous contractions.
 79

Figure 23. The serotonergic neurons and their axon projections, counterstained with anti α-
acetylated tubulin and rhodamine-phalloidin.

(A-D) Ventral view of 54 hpf old embryos stained for serotonin, axon tracts with anti α-acetylated tubulin
antibodies and muscles (with rhodamine-phalloidin). (A) Overlay of the three channels with serotonin
(blue), tubulin (green) and red (phalloidin). (B) The axon tracts and the muscles, the longitudinal tracts are
seen extending well into the brain. (C) the axon tracts and the subset of serotonergic neurons, (D) the
serotonergic neurons and the muscles.
(E-H) Lateral view of 54 hpf old embryos, stained for serotonin, tubulin, and muscles. (E) Overlay of the
three channels with serotonin (blue), tubulin (green) and muscles (red). (F) the axon tracts and the muscles,
the intersegmental nerves are visible, as well as the contacts they make with the longitudinal musculature
(arrow). (G) Overlay of tubulin and serotonin, it shows that most of the fibers that project in between the
chaetal sacs and to the muscles are serotonergic. (H) Overlay of serotonin and muscles, the arrow indicates
the synaptic contacts on the muscles.
(I-L) Lateral view of 54 hpf old embryos, stained for serotonin, tubulin, and muscles. (I) Overlay of the
three channels with serotonin (blue), tubulin (green) and muscles (red). (K, L) arrow indicates the position
of the cell bodies for the serotonergic neurons, at the level of the axon tracts and just a bit above the ventral
longitudinal muscles.
 80

2.6 The cholinergic motoneurons are derived from the pax6

column
Somatic motoneurons are a fundamental component of the animal nervous system, and I
wanted to find out how they are specified in Platynereis. There is a considerable body of
evidence that argues for the existence of an ancestral motoneuron type that goes back at
least to Urbilateria. The same transcription factors that specify the motoneurons in
vertebrates (islet, lhx3/lhx4 and hb9) play a similar role in Drosophila, albeit with some
differences (Thor & Thomas 2002). Also, since at least one column gene (nk6) has a
conserved role in the signaling sequence that defines motoneurons in Drosophila and fish
(Cheesman et al. 2004) an even a higher level of conservation was likely in Platynereis,
considering it retained more of the ancestral mediolateral patterning arrangement.

2.6.1 The motoneuron molecular fingerprint

The motoneuron markers can be divided into postmitotic transcription factors and late
differentiation markers. For the first category, I have initially looked at the expression of
lhx3 (cloned by Kristin Tessmar-Raible) and islet. However, the hb9/MNR2 gene is not
only conserved as a motoneuron marker across phyla, it is also the most specific (unlike
the other two LIM-HD transcription factors, it is not expressed by other neuron types). So
I have cloned the Platynereis orthologue, and included it in the study. Like the
Amphioxus or Drosophila orthologues (Ferrier et al. 2001), it was equally distant from
the vertebrate hb9 and MNR2 genes. Among these three genes the first to be expressed
were islet and lhx3, starting around 36 hpf; no hb9 expression was visible at this early
stage (data not shown). At 48 hpf islet expression was very broad, with several stripes in
the ventral plate, and also some expression in the stomodaeum and in the lateral regions
of the embryo (Figure 24 G, H). At the same stage, lhx3 expression was almost equally
broad: it showed a partially segmental pattern, with two main domains symmetrically
mirrored on the midline (Figure 24 E, F). Finally, hb9 was the most restricted in its
expression, with a domain just above the axon tracts (Figure 24 C, D). These patterns
 81

were reminiscent of the situation described in the vertebrate neural tube: islet is expressed
both by the ventral motoneurons and some of the dorsal interneurons (Pfaff et al. 1996);
(Helms & Johnson 2003), and the lhx3 domain is subdivided into a ventral portion that
coexpresses hb9 and gives rise to the somatic motoneurons (Arber et al. 1999), and a
more dorsal region that coexpresses chx10 and produces V2 interneurons (Thaler et al.
2002). It is the hb9 expression that maintains the motoneuron phenotype in vertebrates,
after the lhx3/4 genes are downregulated. The region of overlap between the expression
domains of lhx3 and islet with that of hb9 was a strong candidate for the location of the
somatic motoneurons in Platynereis (Figure 24 A). The overlap of these transcription
factors was corroborated with the mediolateral patterning genes nk2.2, nk6 and pax6, and
found to be consistent with a vertebrate-like model (Figure 13 A). Since in Drosophila
there are several motoneuron types that do not express all three transcription factors,
rather just one or two of them (Thor & Thomas 2002), I could not exclude the possibility
there are other types outside this region of overlap. However, the fact remains that the
hb9+/lhx3+/islet/+ molecular fingerprint is so far the defining trait of somatic
motoneurons in all the studied organisms, and most likely the majority of motoneurons in
Platynereis fall under this category.

2.6.2 Motoneurons: cholinergic or glutamatergic?

The next question was what neurotransmitter is employed by these neurons. Strangely
enough, although the combination of transcription factors that specifies them appear to be
conserved, the neurotransmitters used are different in Drosophila and vertebrates:
glutamate and acetylcholine, respectively. In the beginning of my project I only had one
of the marker genes, the Platynereis homologue of the Vesicular Acetylcholine
Transporter (VAChT), a marker of cholinergic neurons (Schafer et al. 1995). It was
expressed almost in the same region as the hb9+/lhx3+/islet+ neurons: a good hint that
the Platynereis motoneurons were in fact cholinergic, just like those of vertebrates.
 82

Figure 24. The molecular fingerprint of motoneurons in Platynereis.

(A) The region of overlap between the expression domains of hb9, lhx3 and islet, as seen in the ventral
plate of a 48 hpf embryo. (B) The region where ChAT and VAChT are expressed in the ventral plate, 48 hpf.
(C, D) The expression of hb9, 48 hpf ventral plate as seen with bright field (C) and confocal laser (D)
microscopy is restricted to a small set of neurons on either side of the midline and just above the axon
tracts. (E, F) The expression of lhx3, 48 hpf ventral plate as seen with bright field (E) and confocal laser
(F) microscopy is broader, with a ventral domain that overlaps with that of hb9 and a lateral domain that is
segmental. (G, H) The expression of islet, 48 hpf ventral plate as seen with bright field (G) and confocal
laser (H) microscopy is very broad, including domains in the stomodaeum, in the lateral regions of the
neural plate and in the region where the hb9+ neurons are located. (I, J) The expression of VAChT, 48 hpf
ventral plate as seen with bright field (I) and confocal laser (J) microscopy is just beginning, there are
patches at the level of the first and second segment, just outside of the axon tracts. (K, L) The expression of
ChAT, 48 hpf ventral plate as seen with bright field (K) and confocal laser (L) microscopy is very similar
to that of VAChT, both mark the site of the cholinergic neurons.

To clarify the issue, I have cloned two more genes. The Choline acetyltransferase
(ChAT) is the enzyme that synthesizes acetylcholine and was widely used as a marker
(together with VAChT) for cholinergic neurons (Eiden 1998). The Vesicular Glutamate
Transporters (VGLUT1, 2 and 3) are responsible for packaging glutamate into synaptic
vesicles and were employed as markers of glutamatergic neurons (Bai et al. 2001);
 83

(Fremeau et al. 2004). The Pdu_ChAT was expressed in an almost identical fashion with
the Pdu_VAChT (Figure 24 I-L), confirming the cholinergic nature of the neurons in
question. Surprisingly, although Pdu_VGLUT was clearly expressed in the brain (data not
shown), there was no convincing expression in the ventral plate (including the
motoneuron domain) even after prolonged staining or at stages as late as 120 hpf. In
conclusion, since the Platynereis motoneuron candidates expressed two different
cholinergic markers and no glutamatergic ones, I was left to conclude that they are indeed
cholinergic; of course, this makes them even more similar to their vertebrate counterparts.

Figure 25. The expression of neuron markers at 54 hpf.

(A-F) The expression of the motoneuron markers hb9, lhx3 and islet, the HD vsx/chx10 and the two
cholinergic markers VAChT and ChAT in the ventral plate of 54 hpf old embryos, bright field microscopy
images. (A) The expression of hb9 is largely unchanged from 48 hpf, it is still restricted to a small group of
neurons. (B) lhx3 and (C) islet are expressed in that region and more lateral as well. (D) chx10/vsx is
expressed only in the second and third segment, and with the exception of a few cells is largely absent from
the hb9 domain. (E, F) The cholinergic markers VAChT and ChAT are expressed slightly more lateral than
hb9, but for the most part they overlap with it.
 84

2.6.3 The Motoneuron fingerprint at later stages of development

As for the other neuron markers, most of the VAChT and ChAT expression becomes
visible only after 48 hpf, therefore I have looked at two older stages as well: 54 and 60
hpf. The expression of hb9, lhx3 and islet was also investigated for comparison purposes.
At 54 hpf the expression domains of VAChT and ChAT were even more similar than at
48 hpf, and they take the form of continuous columns (Figure 25 E, F). There was still a
considerable overlap between hb9 and the more ventral regions of the lhx3 and islet
domains (Figure 25 A, B, C). So in essence the motoneuron fingerprint was preserved. At
even older stages (60 hpf), the arrangement was somewhat changed. The gap between the
two bilaterally symmetrical domains of the hb9 and lhx3 was not visible anymore (Figure
26 A, B) and the space between the two VAChT columns was also correspondingly
reduced (Figure 26 F). These results could be interpreted as a downregulation of the hb9
and the LIM-HD genes in the cholinergic neurons. However, between 48 and 60 hpf there
is a significant extension of the ventral plate along the AP axis, accompanied by
mediolateral intercalation (Steinmetz et al. 2007). Such movements were liable to change
the position of cells, so I decided to study the expression of the motoneuron markers on
the Z axis as well.
 85

Figure 26. The expression of neuron markers at 60 hpf.

(A-F) The expression of the motoneuron markers hb9, lhx3 and islet, the HD vsx/chx10 and the two
cholinergic markers VAChT and ChAT in the ventral plate of 60 hpf old embryos, bright field microscopy
images. (A) The expression of hb9 is restricted to the first and second segment, and there is no gap apparent
at the midline (B) lhx3 is also expressed in this region, in a wider domain. (C) islet remains widely
expressed in the neural plate and in the stomodaeum. (D) chx10/vsx is expressed in lateral, segmental
domains, as well as in a few cells close to the midline. (E, F) The cholinergic markers VAChT and ChAT
are still expressed as two columns, with a prominent gap between them along the midline.

2.6.4 Motoneurons in ventral plate cross-sections

Through double WMISH I had managed to show that hb9 and the VAChT were both
expressed within the pax6 column (Figure 27 A, B). Unfortunately, for technical reasons
it was not possible to show the coexpression of hb9 and VAChT themselves. Instead, I
have done separate whole mount in-situ hybridizations of all three genes, at 54 hpf,
counterstained with acetylated α-tubulin and a nuclear staining (DAPI). The embryos
were scanned at high resolution with a confocal laser microscope, and I have used the
resulting datasets to assemble a 3D model of the genes’ expression in the ventral plate.
Taking advantage of the Imaris software, it was possible to do virtual cross-sections
along the Z axis, at any anteroposterior level (data not shown). I have found that cross-
sections at the level of the second segment commissure were the most informative with
regard to the relative arrangement of the genes. As it turned out, the expression domains
were wedge shaped, forming an angle of about 40 degrees relative to the midline. There
is also a clear distinction in the depth of the different domains. Pax6, as an early column
gene, was expressed throughout the whole neural plate, from the surface to the axon
tracts (Figure 27 C). The genes from the second step of neuron specification, such as hb9,
were expressed almost in the same manner, but not quite reaching all the way to the
surface (Figure 27 D). And finally the VAChT, as the marker for the final differentiation
stage, was expressed at the deepest level in the neural plate (Figure 27 E). By taking into
account the oblique form of the expression domains, as well as their relative depth in the
neural plate, most of the differences in mediolateral position when viewed from the
ventral side (between hb9 and VAChT for example) could be explained as projection
artifacts. Therefore, this data strongly supports the original assumption of the motoneuron
 86

fingerprint, as defined by the coexpression of hb9, ChAT, VAChT and to some extent islet
and lhx3.

Figure 27. The motoneuron molecular fingerprint, in double in-situ and virtual cross-sections
through the neural plate.

(A) Double WMISH of hb9 (red) and pax6 (cyan), ventral plate 48 hpf, it shows hb9 to be situated within
the pax6 column. (B) Double WMISH of VAChT (red) and pax6 (cyan), ventral plate 48 hpf, it shows
VAChT to be expressed within the pax6 column. (C, D, E) Virtual cross-sections through the neural plate at
the level of the second commissure, reconstructed from embryos labeled for acetylated tubulin and nuclei
(DAPI). (C) pax6 is expressed in the form of two wedge-shaped domains that span the entire region from
the surface to the axon tracts. (D) hb9 is expressed in the same region as pax6, with the exception that it
does not extend all the way to the superficial layers of the neural plate. (E) The VAChT domain is located in
the deepest layers of the neural plate, at the level of the axon tracts and it overlaps with the domains of both
pax6 and hb9.
 87

2.7 A group of GABAergic neurons are located adjacent to

the cholinergic motoneurons.
Having identified two motoneuron types, the serotonergic and the cholinergic, I turned
my attention to the interneurons: how many types are they, and what are their molecular
fingerprints? Since Platynereis, like other Nereidids is capable of coordinated swimming
behavior (Dorsett 1965), the presence of at least one type of inhibitory interneuron is to
be expected (Skinner & Mulloney 1998). There are several neurotransmitters that might
be employed in such a role: glutamate, glycine and GABA are the likely candidates. In
the vertebrate neural tube there are several interneuron types that form dorsal of the
motoneuron domain: the V2, V1 and V0. The V1 interneurons project ipsilaterally for a
short distance, and most of them make direct inhibitory synapses with the somatic
motoneurons. The V0 domain is composed entirely of ascending commissural
interneurons that are known to be important in the control of left-right synchrony during
locomotion (Kiehn 2006).

As already mentioned, most of the neurons in the ventral plate become fully
differentiated only after 48 hpf. The 54 hpf stage was optimal because the mediolateral
patterning was still in place, and the embryos have not undergone much elongation and
mediolateral intercalation that might displace the neurons from their birth place. I have
studied the distribution of five neurotransmitters (Figure 28): serotonin (using TrpH as
the marker gene), acetylcholine (with both ChAT and VAChT), GABA (using GAD as a
marker), glycine (with the GlyT2) and glutamate (with the glial marker GLT1 and the
neural marker VGLUT). The serotonergic neurons were associated with nk2.2 column
(Figure 22 A) and with the innervation of the longitudinal muscles (Figure 23 H), and the
cholinergic ones were nested within the pax6 column (Figure 27 B, Figure 28 A) and had
the molecular fingerprint of motoneurons (Figure 27 C-E). GlyT2 is expressed only in the
most lateral regions of the neural plate, in between the chaetal sacs (Figure 31 H). There
is also more ventral expression (Figure 31 G), but it is too deep to be part of the ventral
plate. Although the GLT1 marker was expressed in the midline (Figure 20 F), the VGLUT
showed no expression whatsoever in the neural plate. This was hard to reconcile with the
 88

fact that it was clearly expressed in the brain (data not shown). Therefore, I was only left
with GABA as a candidate interneuron neurotransmitter for the pax6 column. GAD is
expressed in clusters of neurons at the level of each segment (Figure 28 H).
Approximately within the same region, as determined by the anti α-acetylated tubulin
counterstaining, dbx and eve are also expressed. I have confirmed this domain overlap
using the same technique as for the cholinergic motoneurons: virtual cross-sections
through the neural plate.

Figure 28. The molecular fingerprint of the GABAergic interneurons in relation to the column genes
and other neurotransmitters.

(A) Scheme representing the expression domain of the TrpH+ neurons (red) in relation to pax6 (cyan) and
VAChT (yellow contour). (B, C, D, F, G, H) Whole mount reflection confocal microscopy images of pax6,
VAChT, TrpH, dbx, eve and GAD of 54 hpf embryos, counterstained with acetylated tubulin. (B) The pax6
column is straddling the axon tracts and extends into the lateral regions, very similar to the 48 hpf embryos.
(C) The VAChT domain looks very similar to that of pax6, except that it does not extend to the space
between the axon tracts. (D) The TrpH+ cells are clustered just outside the axon tracts, at the level of each
segment. (E) Schematic representation of a 54 hpf embryo that shows the location of the GAD+ cells (red)
within the pax6 column (cyan). (F) The expression of dbx is in the form of two incomplete columns outside
the axon tracts but within the pax6 domain. (G) eve is expressed as pair of narrow columns just outside the
axon tracts. (H) GAD expression is very similar to that of TrpH, except it is located more lateral in the
ventral plate.
 89

The GABAergic neurons are comparatively closer to the surface (Figure 29 H) than
either the serotonergic (Figure 29 B) or the cholinergic ones (Figure 29 D). They are
located within the pax6 column (Figure 28 B, Figure 29 C), and most likely overlap with
both the eve and dbx domains (Figure 013 G, F). In vertebrates, the differential
expression of the dbx1 and dbx2 genes distinguishes between the V0 and V1
interneurons. Dbx1 is required for the activation of Evx1 that in turn maintains the V0
interneuron phenotype and excludes En1 from this region (Pierani et al. 2001). The
molecular fingerprint of the GABAergic neurons from Platynereis resembles both the V1
and V0 interneurons. The mediolateral coordinates, within the pax6 and dbx columns are
a unifying feature. Whereas the GABAergic V1 interneurons express engrailed but not
Eve, in Platynereis engrailed is no longer expressed in the ventral plate at 48 hpf and
later stages (Patrick Steinmetz et al., unpublished). Although I could not trace the axon
projections of these neurons, their presence in direct proximity to the cholinergic
motoneurons (Figure 29 D, H) is suggestive. Most likely they represent an ancestral type
of interneuron that made inhibitory synapses on the somatic motoneurons, and was
involved in the control of swimming behavior.

2.8 Neurogenesis in the Platynereis trunk between 24 and

54 hpf
Most of the neurogenesis takes place between 24 and 54 hpf in Platynereis. The column
genes start to be expressed around 22 hpf, and by 34 hpf (or predifferentiation stage) they
have already defined the dorsoventral patterning of the ventral plate (Figure 002). After
36 hpf the neuron progenitors begin to exit the cell cycle and to express a different group
of postmitotic genes, mostly LIM-HD transcription factors. Between 36 and 48 hpf all of
the neuron specific markers are expressed in the ventral plate, with the exception of the
final differentiation genes. These include those responsible for the synthesis of the
neurotransmitters, such as ChAT and GAD. TrpH is a special case: although most of the
expression starts only after 48 hpf, it is also expressed as early as 24h in two groups of
cells at the level of the first commissure.
 90

Figure 29. The expression of the column genes and the neuron markers in virtual cross-sections
through the neural plate.

(A-H) The expression of some of the column genes and neuron markers, counterstained with acetylated
tubulin and DAPI, in virtual cross-sections at the level of the second commissure. (A) nk2.2 is expressed in
the midline region, from the surface to the axon tracts. (B) The TrpH+ neurons are located very deep, just
above the axon tract level. (C) pax6 is expressed in two domains with an oblique cross-section, flanking the
nk2.2 domain and extending from the surface to the level of the axon tracts. (D) The VAChT+ motoneurons
are located within the middle region of the neural plate, and within the pax6 column. (E) The pax3/7
domain is located in the lateral regions of the embryo and does not go as deep as that of nk2.2 or pax6. (F)
The eve domain is closer to the surface than that of VAChT but it is absent from the very first cell layer. (G)
The dbx+ cells look rather scattered in cross-section, and do not extend all the way to the surface like the
other column genes. (H) The GAD+ neurons are located in the same region as the eve+ ones, close to the
surface and within the pax6 column.

I used two pan-neural genes to track the progress of neurogenesis in the ventral plate.
Elav (also known as Hu) is an RNA binding protein involved in various post-translational
processes. It is exclusively expressed in postmitotic neurons throughout the CNS of all
 91

studied animals (Soller & White 2004). Synaptotagmin (syt) is a calcium regulated sensor
(Geppert et al. 1994) that is expressed by the fully differentiated and vesicle releasing
neurons (Fernandez-Chacon et al. 2001). Around the predifferentiation stage elav is
expressed only in two groups of cells at the level of the stomodaeum, probably associated
with the protonefridia (Figure 30 A). The levels of elav expression quickly rise as more
neurons exit the cell cycle, and six hours later there are many more cells in the ventral
plate (Figure 30 D). By 48 hpf most of the neurons in the ventral plate are elav+ (Figure
30 G, F), and the expression domain extends beyond the edge of the neural plate and into
the chaetal sac region as segmental stripes (Figure 31 O). The expression of
synaptotagmin follows a similar pattern through the larval development, with a delay of
about six hours. Therefore, at 38 hpf it is still only expressed in two cell groups on either
side of the stomodaeum and in the pioneering neurons at the level of the telotroch (Figure
30 E), and it becomes widespread in the ventral plate only from 48 hpf onwards (Figure
30 H).

I also investigated the neurogenesis within the layers of ventral plate, by doing virtual
cross-sections on 3D reconstructions of confocal microscope Z stacks (as described in the
Materials and Methods section). I have used the BrdU staining method to visualize
dividing neurons, and the two neural markers elav and syt. The chosen stage was 48 hpf,
when there is a mixture of postmitotic and fully differentiated neurons, as well as some
ongoing cell division. The results were as following: all of the dividing neurons were
close to the surface of the neural plate (Figure 30 C), elav was expressed throughout the
thickness of the tissue, about six cell layers (Figure 30 F) and the syt+ cells were found
only at the deepest level (Figure 30 I). Therefore the neural plate architecture consists of
three tiers: a proliferation zone that contains the neuronal precursors, an intermediate
region that contains the postmitotic neurons and a deep zone where the fully
differentiated and firing neurons are found. Such an arrangement is typical for a
protostome CNS (Arendt & Nubler-Jung 1999).
 92

Figure 30. Neurogenesis in the Platynereis ventral plate.

(A) At 32 hpf the expression of elav is restricted to two patches on either side of the stomodaeum. (B) The
expression of syt is very similar to that of elav at 32 hpf, except that it is prominent in the pioneering
neurons as well. (C) Virtual cross-section through the ventral plate of a 48 hpf embryo stained with BrdU
(red) and DAPI (cyan) showing that the dividing cells are all restricted to the surface of the neuroectoderm.
(D) elav begins to be expressed more broadly around 38 hpf. (E) At 38 hpf the expression of syt is still
confined to a few cells at the level of the first commissure and in the posterior pioneering neurons. (F) The
expression of elav spans the entire thickness of the neural plate at 48 hpf, almost from the surface to the
axon tracts. (G) At 48 hpf elav is expressed everywhere in the ventral plate, except in a narrow stripe along
the midline. (H) The expression of syt expands, but it trails behind that of elav at 48 hpf. (I) The actively
firing neurons, as revealed by syt expression, are located only at the deepest levels of the neural plate in 48
hpf old embryos.

2.9 The lateral region of the Platynereis neural plate likely

contains sensory interneurons.
The sensory interneurons that will eventually migrate into the dorsal horn of the spinal
cord are formed in the dorsal half of the vertebrate neural tube (Helms & Johnson 2003).
They can be divided by the requirement for roof plate signals (BMPs and Wnts) into two
 93

groups: class A (dI1-dI3) that is dependent on them for their formation (Lee et al., 2000;
(Chizhikov & Millen 2005) and class B (dI3-dI6) that emerges by default, as it does not
require either dorsal or ventral signals. Lbx1 is necessary and sufficient for the formation
of the class B interneurons (Gross et al. 2002). The boundary between dI3 and dI4 is
defined by the suppression of Lbx1 by Olig3 (Muller et al. 2005), and the one between
dI6 and V0 interneurons is defined by the presence of the pax3 and pax7 genes (Muller et
al. 2002).

I have investigated the expression of the Platynereis orthologues of some of the genes (by
no means all) that are active in the dorsal region of the vertebrate neural tube, with the
help of Gaspar Jekely. These include the bHLHs Olig2/3 and atonal, the LIM-HD genes
islet, lhx1 and lhx2 and the column genes whose expression extends into this region.
From the expression of elav in the lateral regions of 48 hpf embryos (Figure 31 O) I have
concluded there are more neurons beyond the neural plate border and in between the
chaetal sacs. The challenge was to identify the molecular fingerprint of these neurons and
to compare it with the ones found in the vertebrate neural tube. There are two possibilities
that I have considered. One would be that all the neurons beyond the edge of the
Platynereis neural plate are part of the peripheral nervous system, and are not comparable
to the ones from the vertebrate dorsal CNS. Alternatively, the cell types from the two
regions are comparable but the vertebrate dorsal neural tube has gained a lot in terms of
complexity and structure, and the roles of some of the transcription factors involved have
changed as well.

The argument in favor of the first hypothesis is the dorsal limit of two column genes:
pax3/7 and msx. In the vertebrate neural tube the expression domains of the pax3 and the
msx1/msx3 genes extend all the way to the roof plate (Figure 8). In Platynereis the
pax3/7 domain extends no further than the region of continuous elav expression (Figure
31 B, O), or slightly beyond the axon tract as seen from the lateral projection. The
expression of msx is harder to interpret because it is not only expressed in the ectoderm
(quite weakly), but in the mesoderm as well (where it is stronger). From the lateral
projection a gap is apparent between the domain that ends just beyond the axon tract and
 94

the one that is situated in the middle (Figure 31 F). Judging from the depth of the msx+
cells, it is likely that only the expression domain above the axon tract is in fact neural.
Therefore, both pax3/7 and msx do not span the entire lateral region of the embryo;
instead, they stop being expressed at about the same place where the elav+ cells becomes
divided into intersegmental stripes.

Atonal and lhx2 are expressed in the most dorsal sensory interneurons, the dI1 from the
vertebrate neural tube (Helms & Johnson 1998); (Gowan et al. 2001); (Zechner et al.
2007). The second hypothesis explains better their expression in Platynereis. Lhx2 was
expressed in wide segmental stripes in the lateral region of the embryos; it shows no
expression in the ventral plate proper, and is almost absent even at the level of the axon
tract (Figure 31 N). It has the most lateral expression of all the genes I have investigated
so far, and is consistent with an ancestral lhx2+ sensory interneuron located at the edge of
the neural plate. The expression of atonal was restricted to a pair of neurons per segment.
One cell was just adjacent to the axon tract (Figure 31 L), and the second one on the
border between the ventral and the dorsal side of the embryo, very likely coexpressed
with lhx2 (Figure 31 L, N). According to these results, the dorsal-most neuron types are
not found at the edge of the neural plate, but in between the first and second row of
chaetal sacs.

As already discussed, Olig3 and Lbx1 define two classes of dorsal interneurons (Zechner
et al. 2007). In addition, Olig3 was shown to specify the border between the dorsal CNS
and the neural crest cells (Filippi et al. 2005). I have investigated the Platynereis
orthologues, and the results were intriguing. First of all lbx was broadly expressed, from
well within the ventral plate (Figure 31 I) to the dorsal side of the embryo (Figure 31 J).
As a side note, it also had a small domain within the nk2.2 column (Figure 31 I),
reminiscent of msx that also sported an additional ventral domain (Figure 31 E). In any
case, I could exclude the existence of a specific class of lateral interneurons that were
defined by the expression of lbx alone.
 95

Figure 31. The expression of neuron markers in the lateral regions of the Platynereis trunk at 48 hpf.

(A, B) The expression of pax3/7 is limited to the edge of the neural plate, and it extends a bit beyond the
axon tracts as seen from the side. (C, D) Olig2/3 is expressed in a segmental fashion in the lateral region of
the embryo, and is more lateral than pax3/7. (E, F) msx is expressed in the ventral region of the neural plate
as two thin columns, and in the lateral regions up to the axon tracts; it is also expressed in the mesoderm in
between the first and the second row of chaetal sacs. (G, H) The glycine transporter GlyT is expressed
throughout the lateral region of the embryo, and there is also some deep expression below the axon tract
level. (I, J) Lbx is expressed ventrally, between the axon tracts, and in between the chaetal sacs in the
lateral zone of the embryos. (K, L) Ath is restricted to a few cells in the second and third segment, with a
pair at each level. (M, N) The expression of lhx2 is restricted to the most lateral part of the embryos, where
it is present as segmental stripes in between the chaetal sacs. (O) elav is expressed as a continuous domain
slightly beyond the axon tracts as seen from lateral, and it continues as segmental stripes beyond that. (P)
The mechanoreceptor marker TRPV is expressed in a few neurons in between the first and second row of
chaetal sacs.
 96

Apparently there is only one Olig gene in Platynereis, equally distant to the vertebrate
Olig2 and Olig3. Olig2 is important for the specification of the somatic motoneurons
(Takebayashi et al. 2002). However, the Olig2/3 gene is expressed only in the lateral
regions of the neural plate, and is most likely absent from the pax6 column (Figure 31 C)
where the motoneurons are located (Figure 28 A, B, C). The lateral expression of Olig2/3
includes two domains: a ventral one that closely resembles that of pax3/7, except for the
more obvious segmentation (Figure 31 C, D), and after a gap a narrow segmental stripe
of cells (Figure 31 D). In conclusion, I could find no evidence for an antagonism between
lbx and Olig2/3.

The lateral region of the Platynereis trunk likely contains several neuron types that
resemble the sensory interneurons from the dorsal region of the vertebrate neural tube.
However, unlike for the more ventral neuron types I could not find evidence for a set of
genes that define clear domains (to be subsequently partitioned in various neuron types)
as there are no sharp boundaries between the expression domains. The sensory cells that
are likely located in the parapodial region remain poorly described as well. TRPV, a gene
that encodes an ion channel involved in mechanoreception (Boekhoff-Falk 2005) is
expressed in this region (Figure 31 P), but I was not able to integrate it in a molecular
fingerprint. Clearly more research is needed to understand the neuron types found in the
lateral regions of the Platynereis neural plate.
97
 98

3 DISCUSSION
 99

3.1 Neurogenesis in the Platynereis ventral plate and the

properties of the midline
The trunk nervous system forms through the joining of two lateral domains. During this
morphogenetic movement the stomodaeum and the proctodaeum are pushed apart, and
the midline is formed from the fused region (Denes et al. 2007). This process begins
around 20 hpf and it is mostly complete by 32 hpf. The Platynereis midline has been
shown to express brachyury (bra) during the early stages of development (Arendt et al.
2001) and this is interesting because in vertebrates bra is one of the genes responsible for
the formation of the dorsal midline, and of the notochord in particular (Lopez et al. 2003).
These results support the view that in Urbilateria the AP axis formed through the fusion
of the blastopore lips, in a process known as amphistomous gastrulation (Arendt &
Nubler-Jung 1997), and that the protostome ventral midline corresponds to the
deuterostome dorsal midline. However, my main interest has been in the later stages of
neurogenesis, in particular the ongoing dorsoventral patterning and how it is used to
specify the different neurons types.

3.1.1 Most of the neurons in the ventral plate exit the cell cycle by
48 hpf and are fully differentiated by 56 hpf

I have traced the expression of two neural markers, elav and syt at intervals of a few
hours between 22 and 72 hpf (Figure 30 A, B, D, E and data not shown) and determined
that most of the neurons exit the mitotic cycle sometime between 36 and 48 hpf. This
view was reinforced by the sequence of the patterning genes that were expressed during
this interval. The earliest were the column genes such as nk2.2 and pax6, starting before
22 hpf (Figure 15 A, B). About twelve hours later, when the mediolateral patterning was
well established, the expression of some postmitotic neuron markers appeared, such as
islet and lhx3, and this coincided with an increase in the number of elav+ cells around
this stage (Figure 30 D). Some genes took longer to be expressed, for example hb9, but
by 48 hpf all postmitotic transcription factors that I investigated were expressed
somewhere in the neural plate. As such, it is useful to distinguish between two stages of
 100

neurogenesis in the trochophora larva: the time between about 22 to 32-34 hpf, that can
be considered the predifferentiation stage, and the interval from around 34 to 48 hpf that
should be called the differentiation stage.

This distinction is important because it helps us to classify the mediolateral patterning

genes, as opposed to the postmitotic marker genes. Because the basic function of the
mediolateral genes is to establish broad domains early in the patterning of the neural
tissue, any gene that is not expressed during the predifferentiation stage should not be
included in this group. Therefore genes such as gsx and dbx, although they have been
described as column genes in Drosophila and mouse cannot be considered as such in
Platynereis, because they are only expressed during the differentiation stage (Figure 16
C, D, A, J).

Lastly, I have identified a third time point in the trunk neurogenesis, the so-called final
differentiation stage. It represents approximately the 48 to 56 hpf interval, when the
marker genes for different neurotransmitter types start to be expressed. The fully
differentiated neurons can be traced by the expression of synaptotagmin, and at 48 hpf
the domains that are present (Figure 30 H) resemble remarkably well an overlap of the
two serotonergic cells at the level of the first axon commissure (data not shown) and the
cholinergic cells just outside the axon tracts (Figure 24 J, L). There is some overlap
between the last two stages, because the neurotransmitter markers are not all
synchronized. The most dramatic example is TrpH that is expressed as early as the
predifferentiation stage (Figure 22 C), although most TrpH+ neurons only appear after 50
hpf (Figure 28 D). ChAT and VAChT (the two cholinergic markers) are expressed in a
few cells at 48 hpf (Figure 24 J, L), but their expression domains expand significantly by
the time the embryos reach 54 hpf (Figure 28 C). The gene coding for the rate limiting
enzyme GAD, a marker for the GABAergic neurons, is the latest to be expressed, no
earlier than 52 hpf (Figure 28 H).

Therefore we have a clear sequence of neural specification. During the predifferentiation

stage the column genes are expressed and define broad progenitor domains in a
 101

combinatorial fashion. In the following differentiation stage most neurons exit the cell
cycle and are distinguished by the expression of different combinations of HD and LIM-
HD transcription factors. And in the final differentiation stage the neurons become fully
functional and start firing, as assayed by the expression of syt and the synthesis of
neurotransmitters. It is probably no coincidence that shortly after the third stage the
neuromuscular system is developed enough to allow the transition from swimming with
their ciliary bands to a behavior closer to that of the adults, with undulatory movements.

So far I have discussed the temporal sequence of neurogenesis in the trunk CNS. There is
also a spatial segregation of neurons during differentiation that becomes apparent when
the ventral plate is examined in cross-section. The proliferating neuroblasts are located
close to the surface of the ventral plate, as determined by BrdU labeling (Figure 30 C),
and the column genes such as nk2.2 and pax6 are expressed in this region (Figure 29 A,
B). In the intermediate region of the neural plate, about four to five cells thick, the
postmitotic neuron markers such as hb9 are coexpressed with the column genes (Figure
27 D). And just above the axon tracts, at the deepest level in the neural plate, the fully
differentiated neurons can be identified by their expression of syt (Figure 30 I) and
neuron markers such as VAChT (Figure 27 E). However, this arrangement is transient and
only applies around 48 hpf; the bottom layer of differentiated cells continues to increase
in thickness, as more neurons become active. This can be seen when comparing the
expression domains of the VAChT at 48 (Figure 27 E) and at 54 hpf (Figure 29 D).

3.1.2 The Platynereis midline is a distinct structure within the

neural plate

Within the neural plate tissue, the midline has a rather special status. Elav expression is
almost absent in this region, as seen both in ventral projections (Figure 30 G) and in
cross-section (Figure 30 F). Also GLT1 (a glial cell marker) is expressed within this gap
of the elav domain (Figure 20 F).With regard to mediolateral patterning, this region is
located within the nk2.2 column (Figure 16 A, B; Figure 29 A). Following the premise
 102

that mediolateral patterning in Platynereis is similar to the dorsoventral patterning in the

neural tube, there are three possible counterparts: the medial floor plate, the lateral floor
plate and the V3 interneurons. The floor plate is a Shh signaling center (Jessell 2000) that
expresses the transcription factor forkhead (Teillet et al. 1998). In Platynereis forkhead
is expressed in wide domain (Figure 20 C), almost as broad as that of nk2.2, and as such
it would suggest a very broad midline, at least part of it neural. As already mentioned
hedgehog is not expressed in the midline, although it is present in the stomodaeum
(Figure 19 B). How about the V3 interneurons? In vertebrates they are adjacent to the
floor plate and express the transcription factor sim. The expression domain of sim in is
centered on the midline in Platynereis, and forms a narrow, incomplete column (Figure
20 B). It is also expressed relatively late in development, around 48 hpf, as would be
expected for a postmitotic neuron marker. If we continue the analogy to the vertebrate
neural tube, one could say that the dorsoventral order of the V3 interneurons and the MFP
has been reversed. The problem with this interpretation is that the narrow portion of the
midline that expresses sim does not express elav, so there is no evidence for the existence
of a V3-like interneuron in Platynereis.

The comparison with the Drosophila midline yields equally conflicting results. The sim+
cells that comprise it can be thought of as the “fourth column” in the fly neuroectoderm
(Skeath 1998). They are located at the ventral border of the vnd column (Kim et al. 2005)
and form a signaling center (that acts probably through EgfR signaling, rather than
hedgehog) that is crucial for the latter mediolateral patterning. This is inconsistent with
the late expression of sim in Platynereis, when the midline is already formed and the
mediolateral patterning is established. Also, the vnd and sim expression domains are non-
overlapping in the fly, which is not the case in Platynereis either.

In conclusion the Platynereis midline is a sui-generis structure that shares common

features with the vertebrate floor plate, the V3 interneurons and the Drosophila midline,
although in some respects it does not resemble either of them. It probably contains two
regions: a narrow strip of non-neural cells that is sim+ and two flanking domains that are
neural and express forkhead and gsx. The only aspect that does appear to be conserved
 103

across all three superphyla is the role of the ventral midline in axon guidance. Both
attractant (Netrin) and repellant molecules (Slit) are produced by this region in
Drosophila and vertebrates (Dickson & Gilestro 2006); (Kennedy et al. 2006). The
Platynereis slit and netrin are also expressed in the sim+ stripe (Figure 20 D, E), and
most likely are involved in the guidance of the commissural axons.

3.2 The mediolateral patterning in the Platynereis ventral

plate is very similar to that in the vertebrate neural tube
There has been a lot of interest in the patterning of the CNS on the dorsoventral axis; this
is an old question whose answer may finally be within reach. During the past decade,
some of the key molecular players have been identified in a growing number of species.
Among insects, the importance of the three column genes vnd, ind and msh has been
recognized early on. In Drosophila they are expressed early in the neuroectoderm, and
through lateral inhibition define three distinct domains (McDonald et al. 1998); (Weiss et
al. 1998); (Isshiki et al. 1997). However in Tribolium the most lateral column is absent,
inasmuch as msh is expressed much later than the more ventral vnd and ind (Wheeler et
al. 2005). Also, msh is not involved in regulating the dorsal border of the ind domain,
which should have been expected according to the principle of ventral dominance
described in Drosophila (von Ohlen & Doe 2000). Moving along to vertebrates, the
homologues of these three column genes (known as nkx2.2, gsx and msx) are all
expressed in the neural tube, and in the same order (Figure 8), with the closely related
nkx2.2 and nkx2.9 as the most ventral (Briscoe et al. 1999), and msx1, msx2, msx3 as the
most dorsal (Liu et al. 2004); (Ramos & Robert 2005). Gsh1 and gsh2 are expressed
somewhere in between (Kriks et al. 2005). These three column genes have been proposed
as an ancestral trait shared between insects and vertebrates, on account of their expression
(Arendt & Nubler-Jung 1999); (Cornell & Ohlen 2000). However, on a closer inspection
only the role of the most ventral gene vnd/nkx2.2 is really similar between mouse and
Drosophila. There is a big gap in the vertebrate neural tube between nkx2.2 and
gsh1/gsh2, and the msx genes not only overlap with the gsx domain, they also do not
seem to be regulated by them in any way (Kriks et al. 2005). Perhaps this should not be
 104

surprising, considering that the three column model from Drosophila breaks down even
among insects (Wheeler et al. 2005). So how does Platynereis fit into all this?
To begin with, the orthologues of all three column genes are expressed in the
neuroectoderm, as one might expect (Figure 003). However, they do not resemble either
the mouse or the Drosophila pattern, except in their ventral to dorsal order. More
precisely, in Platynereis gsx is not expressed at the predifferentiation stage (around 34
hpf) and only comes up around 48 hpf (Figure 16 I, J); therefore, it does not qualify as a
column genes, since it does not take part in the early mediolateral patterning. And as to
the domain of expression, it is very ventral and most likely overlapping with that of
nk2.2. This argues against any possible cross-inhibition between nk2.2 and gsx, as that
observed in insects, but this also means that whatever function gsx might have in
Platynereis it bears little resemblance to that from the vertebrate neural tube. The
expression of msx is also intriguing, since it contains two widely separated domains: a
ventral one (that is located slightly more lateral than that of gsx) and a dorsal one at the
edge of the neural plate (Figure 16 O, P). As noted before, the only column gene that
seems conserved across all three superhyla is the medial one, vnd/nk2.2.

Figure 32. Comparison between the

nk2.2/ pax6 antagonism in Platynereis
and the vnd/ey expression in
Drosophila.

( (A) In Platynereis both nk2.2 and pax6

are expressed as wide columns that are
directly abutting, and likely maintain
this boundary through cross-repression.
The pax6 domain is continuous along
the AP axis, and is as broad as that of
nk2.2. (B) In Drosophila ey is expressed
adjacent to the vnd domain but it does
not form a continuous and wide column,
instead it is present in clusters of
neurons at the level of each segment.

This leaves us with the question: how was the trunk neuroectoderm patterned in
Urbilateria, if not by the three column genes? In particular, what gene defined the dorsal
border of the nk2.2 domain if not gsx? The answer turned out to be the pax genes, and in
 105

the case of nk2.2 it is pax6. It has been recognized for some time that the ventral part of
the neural tube is patterned by a complex interaction of nk, pax and dbx genes (Jessell
2000), that is in turn controlled by a Shh gradient (Figure 10). The two ventral genes,
nkx2.2 and nkx6, are expressed from the floor plate to their dorsal boundary that is
formed through cross-inhibition with pax6 and dbx, respectively (Figure 10). So if this is
the case, is there anything similar in Drosophila? It seems that most of these genes are
actually expressed in the fly neuroectoderm, but since the focus was always on the three
column genes and there was no hedgehog signaling center in the midline region, they
received comparatively little attention. The exception is nk6, that was actually studied
and compared between fly and zebrafish, and was found to be quite similar, down to its
role in the formation of motoneurons (Cheesman et al. 2004). Taken together with the
already mentioned expression of vnd, this means at least the nk genes play a conserved
role in the more medial regions of the trunk CNS. There is less information about the
expression and function of the pax genes in the Drosophila CNS. Therefore I have
studied myself the expression of eyless, and I found it to be expressed late (around stage
10-11) in a restricted pattern (Figure 32 B). Interestingly, although it does not form a
column (the pattern is segmental and narrow) it is directly adjacent and non-overlapping
with vnd. Pax3/7 (or gooseberry) expression is more difficult to interpret because it is not
expressed as a column but rather as pair-rule gene (Skeath et al. 1995). This function in
the segmental patterning seems to be derived within arthropods (Davis et al. 2005). As
for dbx, there seems to be no Drosophila orthologue, suggesting it might have been lost
(Kriks et al. 2005). In conclusion, more research is necessary in this direction but even so
there are quite some common features between the vertebrate dorsoventral patterning and
the mediolateral patterning in Drosophila.

As a protostome and lophotrochozoan, Platynereis should provide valuable insights into

the ancient role of nk and pax genes in the trunk CNS. As it turned out, it actually
exceeded my expectations: the expression domains of these genes and the boundaries
between them are practically identical with those described in vertebrates (Figure 34).
The expression of nk2.2 and nk6 is indeed conserved, as one might expect considering the
fly data. What is remarkable is that pax6 forms a true column, and probably through
 106

cross-repression defines the dorsal boundary of nk2.2 (Figure 17 A, B). Pax3/7 and
pax2/5/8 are expressed in the lateral regions of the embryo (Figure 16 G, H, K, L) where
they probably specify the lateral interneuron types (Figure 34 A). The only clear
difference is in the behavior of dbx: similar to gsh, it is no expressed until 48 hpf, and
does not form an uninterrupted column. Although it is expressed at a similar mediolateral
position to its vertebrate counterpart, the Platynereis dbx does not qualify as a column
gene, and does not form a sharp boundary with nk6 (Figure 16 C, D, E, F).

I propose the following model for the mediolateral patterning in Urbilateria. The two nk
genes, nk2.2 and nk6 were expressed in partially overlapping domains starting from the
neural midline. Pax6 formed a column that was non-overlapping with nk2.2 and partially
overlapping with nk6. As for gsh (and possibly msx as well), it was likely expressed in
this region, on the border between nk2.2 and pax6, not necessarily as a column gene, but
like a marker for a subset of neurons. The same was probably true for dbx, except that it
was located more dorsally, at the border between nk6 and pax3/7. Partially overlapping
with pax6, pa2/5/8 and pax3/7 were expressed in the more lateral regions of the ventral
plate. It is not clear if msx was also expressed at the edge of the neural plate, but it is
likely. Assuming this model is accurate, most of the mediolateral patterning was already
in place as far back as Urbilateria, and we can reconstruct what happened along the
different lineages descended from it.

Along the vertebrate lineage, evolution acted towards an increase in the diversity of the
neuron types, probably driven by the need for a finer control of swimming behavior. With
the aid of genome duplication events that increased the number of mediolateral genes, the
interneuron domains could now be specified by more complex combinatorial
arrangements, involving more than one or two genes. It is likely that during this time the
dbx genes were also “promoted” to column gene status.

Along the insect lineage, possibly due to evolutionary pressures to reduce generation
time, a different process took place. The early mediolateral patterning became simplified,
probably involving even fewer genes than the urbilaterian ancestor (maybe two or three).
 107

Genes were either lost altogether, like dbx, recruited for different functions such as
segmentation (pax3/7) or maintained as specific markers for certain groups of neurons:
nk6 and pax6. For gsh the reverse process is more likely: although originally it was
expressed somewhat later in development by a small number of neurons, it was
respecified as a column gene, possibly replacing pax6 in this role. Such major changes in
the mediolateral architecture were probably made easier by the reorganization of early
neurogenesis. With the emphasis changed from progenitor domains to neuroblast
lineages, it is likely that the dorsoventral coordinate system lost some of its importance
and was free to change.

Too little is known about the CNS of Saccoglossus to attempt a similar reconstruction of
the evolutionary story, as the expression of the nk and pax genes, the “core” of
mediolateral patterning, have not been described yet. However, based on the tendency of
many genes to be expressed radially in the trunk (Lowe et al. 2003); (Lowe et al. 2006) it
appears even less preserved than in Drosophila.

3.3 BMP signaling had an ancestral function in the

patterning of the urbilaterian CNS
What have we learned from the study of BMP2/4 signaling in Platynereis? Most details
remain to be worked out, however several conclusions can already be drawn. First of all
BMP2/4 is expressed on the opposite side of the neuroectoderm, just like in the other
model organisms studied so far. This asymmetry can be traced as far back as the
cnidarians (Rentzsch et al. 2006); (Matus et al. 2006) and was most likely present in
Urbilateria. The pathway itself is both older (Putnam et al. 2007) and better conserved
among bilaterians than the hedgehog signaling. As to its role, there have been two
possibilities.

The first is as a dorsalizing agent: the BMPs have to be inhibited in order for the
induction of neural tissue to take place (Harland & Gerhart 1997). Of course, the
inhibition of the BMP pathway is not sufficient in itself, FGFs and Wnts are also
 108

involved in this process (Wilson et al. 2001), but it is a key component. The dorsal
boundary of the elav expression domain (the best marker for the neural tissue) did not
shift in the BMP4 treated embryos (Figure 21 P) therefore at least by itself BMP
signaling is not sufficient to change the ratio of ectoderm to neural tissue in Platynereis.
BMPs also establish a morphogen gradient that is necessary for the patterning of the
neuroectoderm. In a recent study (Mizutani et al. 2006) the three column genes that are
responsible for the mediolateral patterning of Drosophila have been shown to have
different sensitivities to Dpp. The same was known to be true in the vertebrate neural
tube, where the signals originating from the roof plate were found to be essential for the
formation of the dorsal-most interneuron types, namely dI, dI2 and dI3 (Lee et al. 2000),
and to be important even in the more ventral regions of the neural tube (Nguyen et al.
2000). The sensitivity of the Platynereis ath to the exogenous BMP2/4 (Figure 21 J, K)
could be an indication for the existence of an interneuron type homologous to the dI1
from vertebrates. One problem with this interpretation is that lhx2, a transcription factor
that is likely coexpressed with ath in the dI1 interneurons (Zechner et al. 2007), is
downregulated by the recombinant BMP4 in Platynereis (data not shown).

Although the differential effects observed for the column genes and the other neuron
markers examined in the BMP treated embryos are probably genuine, they cannot be
explained by a simple model, like an increasing dorsal to ventral sensitivity. For example,
nk2.2 is downregulated more than pax6 (Figure 21 G, L), although it is located further
away from the signaling center, and pax3/7 levels go down despite the fact it is the most
dorsal of the column genes (Figure 21 K). Another mystery is the expression of BMP2/4
deep within the stomodaeum, also known to be a hedgehog signaling center.

Clearly more research is needed to understand the complex interactions between BMP
signaling and the mediolateral patterning in Platynereis. However, the existence of this
link is an interesting result in itself. It contradicts the model based on the Saccoglossus
data (Lowe et al. 2006) that claimed the ancestral function of BMPs was to distinguish
between the different germ layers, rather than to pattern the neuroectoderm.
 109

3.4 Hedgehog signaling has a role in mediolateral

patterning

When comparing the differences between the mediolateral patterning in fly and in mouse,
one of the most obvious is that Shh plays an important part in the vertebrate neural tube
(Ericson et al. 1997); (Briscoe & Ericson 1999); (Jessell 2000), whereas the Drosophila
hedgehog is not known to have such a role (Eisen 1998); (Cornell & Ohlen 2000). For
example, despite the fact that nk6 plays a conserved role in the specification of
motoneurons in fly and zebrafish, it was actually determined that only the fish nkx6 gene
can respond to hedgehog (Cheesman et al. 2004). Because the mediolateral patterning in
Platynereis was so similar to that described in vertebrates (Figure 34), I investigated the
possible role of hedgehog through cyclopamine inhibitions. Although there were
indications that cyclopamine can inhibit the pathway in our worm (Tessmar-Raible,
unpublished), as in vertebrates (Cooper et al. 1998) and unlike in Drosophila (Chen et al.
2002), the possibility that the effects both of us observed were artifacts has not been
completely eliminated. I have tried various concentrations and lengths of inhibition,
trying to balance the cumulative toxic effects from cyclopamine exposure with the
reaction time of the pathway, measured in several hours at least (Lum & Beachy 2004).
In the end I have settled for a ten hour inhibition between 22 and 32 hpf and several
concentrations; the highest (36 µM) was chosen as the one that killed no more than about
5-10% of the embryos by the end of the incubation. Another advantage of using this time
frame was that hedgehog expression was restricted to a single center, the stomodaeum
(Figure 19 B), unlike later in development when there was additional expression in the
ventral plate in the form of segmental stripes (Kristin Tessmar-Raible, unpublished). If
the column genes from Platynereis were under similar control to those in the vertebrate
model organisms, one would expect a differential effect that is directly correlated to the
distance of their expression domain from the signaling center (Jessell 2000). More
precisely, the class II genes that require hedgehog and have their dorsal boundaries
defined by a cutoff concentration (such as nk2.2 and nk6) should be much more sensitive
to cyclopamine than the class I genes (pax6, pax3/7) that have ventral boundaries defined
by a threshold of hedgehog concentration (Figure 10).
 110

I have tested this hypothesis by inhibiting embryos with three different amounts of
cyclopamine (12, 24 and 36 µM), and I have observed the effects on the expression of
nk2.2, nk6, pax6 and pax3/7. As expected, nk2.2 and nk6 were downregulated in a
concentration dependent manner with nk2.2 being the more sensitive of the two (Figure
18 A-H). However pax6 was also downregulated to a modest extent, and pax3/7 levels
were repressed almost as much as those of nk6 (Figure 18 I-P). This means that although
the class II genes are indeed more sensitive, cyclopamine probably acts as a general
transcription inhibitor as well, and this makes the results harder to interpret. Fortunately
all four genes had similar levels of expression (as assayed by the speed of the WMISH
staining in the control embryos) so the differential effects observed are probably genuine.
One result that should not be understated is the change in the aspect of the pax6 domain
in the inhibited embryos as compared to the control ones (Figure19 D, E, F). If nk2.2 and
pax6 are indeed cross-repressing each other, when nk2.2 is downregulated (at the highest
concentration, in many of the embryos it entirely absent) the pax6 expression should
expand in that region. This was indeed the observed effect, as the two pax6 columns
pivoted much closer to the stomodaeum; however, the dorsal boundary changed as well,
so the width of the domain did not increase.

These results are best explained if we assume that the column genes, including pax6, are
expressed within a certain range of hedgehog concentration. If the addition of
cyclopamine has indeed shifted the gradient towards the stomodaeum, then the
expression domains of the column genes would follow their preferred range and also
move closer to the signaling center. Even so, the high sensitivity of pax3/7 (the most
lateral of the column genes) to cyclopamine remains a puzzle requiring further
explanation.

There are also other arguments for a link between hedgehog and the column genes. I have
tried to physically eliminate the signaling center, by laser ablation of the stomodaeum
using the setup developed by Julien Colombelli. The preliminary results indicated a
strong reduction of nk2.2 in the ablated embryos, as compared to the controls (data not
 111

shown). There is also the observation that the serotonergic neurons in the trunk are
strongly reduced in comparison to the ones in the brain (Tessmar-Raible, unpublished) in
cyclopamine treated embryos. Since the serotonergic neurons in the trunk form within the
nk2.2 column, it is likely that this is a specific effect mediated through the suppression of
nk2.2 (that is expressed only in the trunk and not in the brain region).
In conclusion, the evidence for the role of hedgehog in the mediolateral patterning of
Platynereis is persuasive but still incomplete.

3.5 Motoneurons: cholinergic or glutamatergic?

Motoneurons are for sure older than Urbilateria, since they are already present in more
basal groups such as cnidarians. However, this does not mean they could not have been
“invented” more than once in evolution, and it remains to be proven that the protostome
and deuterostome motoneurons all descend from an ancestral bilaterian cell type. One
obstacle to the hypothesis of a common descent has been the fact that insect motoneurons
use glutamate as a neurotransmitter, and the vertebrate motoneurons employ
acetylcholine. Several recent studies have called into question such a simple model of a
one neuron- one neurotransmitter. There is evidence for the expression of one of the
glutamate transporters (VGLUT3) in both cholinergic and serotonergic neurons (Gras et
al. 2002); (Boulland et al. 2004). A more detailed study has even shown that a single
motoneuron, in addition to expressing both cholinergic and glutamatergic markers, can
release the two neurotransmitters separately, from different axon terminals (Nishimaru et
al. 2005). This of course complicates the picture, but it might provide a natural link
between the fly and vertebrate motoneurons.

Another level for comparison is the combinatorial expression of transcription factors at

the level of cell types. In this regard the Drosophila motoneurons are quite similar to
those described in mouse and chick; there are only two main differences. The first has to
do with the lack of progenitor domains in the fly: unlike vertebrates, where all somatic
motoneurons are ultimately derived from a single region in the neural tube (Jurata et al.
2000), the Drosophila motoneurons form at many mediolateral positions and can be
 112

sorted by their axon projections into ventrally and dorsally projecting classes (Thor &
Thomas 2002). With one small difference, namely the early expression of MNR2 in chick
(Tanabe et al. 1998), the specification of motoneurons proceeds identically in all studied
vertebrates. They form at the mediolateral coordinates defined by the overlapping
expression of nk6 and pax6 (Briscoe et al. 2000) but not nk2.2 (Figure 13 A). Through
the consecutive action of lhx3/4 (Thaler et al. 2002), islet (Pfaff et al. 1996) and hb9
(Arber et al. 1999) the motoneuron fate is established. Hb9 is the gene that continues to
be expressed even after the downregulation of the other two, as it is required for the
maintenance of the differentiated state. The same three genes are involved in the
specification of the Drosophila motoneurons, and are expressed in pairs (in the case of
the ISN, all three of them are present) by al the ventrally-projecting ones (Landgraf &
Thor 2006). The second difference is the existence in the fly of a motoneuron type that
projects to the dorsal musculature (Figure 13 B) and is defined by the expression of eve
(Broihier & Skeath 2002). In vertebrates eve is expressed in the V0 interneurons (Moran-
Rivard et al. 2001), and is not a motoneuron marker.

Because Platynereis has retained more of its mediolateral arrangement compared to

Drosophila, one would expect that it would also have something like a motoneuron
progenitor domain. Before starting with the comparison, it should be mentioned there are
two types of motoneurons in vertebrates: the visceral and the somatic. Their molecular
fingerprint is slightly different between the trunk and the hindbrain. In the trunk both
types form at the level of the pax6 column and are cholinergic, however at the level of the
hindbrain they form separately. The vMNs originate within the nk2.2 column and are
islet+ (Takahashi & Osumi 2002), whereas the sMNs form as in the trunk within the
nkx6/pax6 region. Pax6 suppresses the vMNs just as it does the V3 interneurons in the
trunk, and nkx6 is required only for the formation of the somatic motoneurons (Pattyn et
al. 2003). Another aspect is that at least some of the motoneurons that come from the
nk2.2 column are serotonergic rather than cholinergic (Briscoe et al. 1999). These
differences have to be kept in mind because the Platynereis trunk could actually be more
similar to the vertebrate hindbrain.
 113

I have investigated the expression of the three motoneuron markers hb9, islet and lhx3 in
the neural plate (Figure 24 C-H), and they do have a region of overlap (Figure 24 A).
Hb9 is expressed exclusively in this region, hence it is the most specific of the three; it is
also the latest to appear during development, around 48 hpf, whereas the other two show
some expression as early as 36 hpf. Therefore we have a high resemblance to the
situation in vertebrates, where there is a sequence of neuronal differentiation that starts
with broader domains (like lhx3) and arrives at more restricted progenitor domains. The
hb9+ cells, that can be considered equivalent to the motoneuron domain, are located
within the pax6 column, as shown by double WMISH (Figure 27 A) and virtual cross-
sections through the neural plate (Figure 27 C, D). As such they correspond to the
somatic motoneurons in the vertebrate neural tube. However, the similarities do not stop
here. Two cholinergic markers, the enzyme ChAT and the transporter VAChT were
expressed in the same region (Figure 24 B). These two results make a strong argument in
favor of a cholinergic, hb9+ motoneuron type that was specified within the pax6 column.
In cross-section it occupies a significant portion of the ventral region of the neural plate
(Figure 33 A). Such a neuron type was most likely already present in Urbilateria, and was
preserved in the deuterostome and lophotrochozoan lineages.
 114

Figure 33. The neuron types in Platynereis and vertebrates, as seen in cross-sections through the
ventral plate and the neural tube.

(A) Most neuron types identified so far in the Platynereis ventral plate are close to the midline. The midline
itself (dark blue) contains glial cells, and it expresses a glutamate marker, GLT1. The serotonergic neurons
(purple) are located deep within the ventral plate, at the axon tract level. The cholinergic motoneurons (red)
are located on either side of the midline, and above the serotonergic ones. The domain of the GABAergic
neurons (cyan) is found above and slightly to the lateral of the cholinergic motoneurons. As for the
glycinergic neurons (gray), they are located in the lateral-most region of the embryo. (B) In the vertebrate
neural tube we have the same sequence of neurons. Most ventral is the floor plate, a structure that is similar
to the Platynereis midline. The serotonergic motoneurons that form adjacent to the floor plate are also
similar to the ones in the worm. Next are the motoneurons, a comparatively large domain in both cases.
And finally there are the V1 interneurons that use GABA and Glycine.

Within the nk2.2 column I have found a serotonergic neuron type (Figure 20 A, B) that
on account of its projections to the muscles (Figure 21 E-H) could be a motoneuron as
well. This class of serotonergic, nk2.2+, motoneurons resembles some of the neurons
from the vertebrate hindbrain (Briscoe & Ericson 1999). Unfortunately the molecular
fingerprint remains incomplete, since I do not have any data on the existence of an Lmx1b
or Pet-1 gene in Platynereis, or its possible domain of expression. In cross-section these
neurons are found very deep in the neural plate, below the cholinergic motoneurons
(Figure 33 A).

Because I did not have an antibody against one of the cholinergic markers, I could not
trace their axon projections and prove they actually project to muscles. Instead I have
used a histochemical staining that allowed the labeling of muscles innervated by
cholinergic neurons (Karnovsky 1964). The method, as adapted by Adriaan Dorresteijn
for use in Platynereis, involved the formation of a colored copper precipitate wherever
the enzyme acetylcholine esterase (AChE) was present. A subset of muscles, (the
longitudinal ones) was stained in this assay (data not shown), thereby providing
circumstantial evidence that at least some of cholinergic neurons in the trunk are
motoneurons rather than interneurons. What is interesting is that the same longitudinal
muscles also receive the serotonergic innervation (Figure 23 H). This means I have still
not identified the neurons that innervate the lateral and oblique muscles (Figure 23 J), or
what their neurotransmitter might be.
 115

An important question concerns the possibility of eve+ motoneurons in Platynereis. Eve

is indeed expressed very close to the hb9 domain (Figure 29 F, Figure 27 D), and within
the pax6/ nk6 region. This is interesting, because the hb9 and eve have been shown to be
mutually exclusive in Drosophila (Broihier & Skeath 2002). However, I believe that the
eve+ cells are most likely interneurons, since they overlap with the expression of GABA,
an inhibitory neurotransmitter (Figure 29 F, H), rather than one of the cholinergic
markers (Figure 29 D).

Regarding the possibility of glutamatergic motoneurons in Platynereis, the picture

remains unclear. Because the VGLUT gene is not expressed in the trunk CNS, there is
little that this study can add to the question of why glutamate became the
neurotransmitter in the insect motoneurons. One possibility would be that the gene I
cloned was brain-specific, and there could be another one that is also expressed in the
neural plate. This would also help to explain the expression of a glutamate receptor by the
lateral and oblique trunk muscles (data not shown).

3.6 A model for the expansion of interneuron domains

during the evolution of the vertebrate lineage

The majority of the mediolateral patterning genes described in the vertebrate neural tube
have counterparts in the Platynereis ventral plate. Furthermore, the relative positions and
boundaries (with some exceptions) are conserved as well. This is a strong indication that
the neuroectoderm of Platynereis is partitioned into progenitor domains, and that different
neuron types are formed within a well defined coordinate system. In the case of the
cholinergic neurons, I was able to confirm this supposition by reconstructing a detailed
molecular fingerprint. As discussed, this cell type forms from the region of overlap
between nk6 and pax6 (Figure 16 F, M) with regard to dorsoventral coordinates, it is
specified by the consecutive action of lhx3, islet and hb9 (Figure 24 A-H) and the
differentiated neurons are cholinergic (Figure 24 I-l, Figure 27 E). Since the similarity of
 116

the motoneurons between the two groups is so good (Figure 34 A, B), I tried to identify
the other neuron types that were likely present.

The method used was the same as for the motoneurons. First, the mediolateral
coordinates were specified, preferably at boundaries determined through cross-repression,
such as nk2.2 and pax6. Second, a transcription factor (or a combination of several ones)
that are exclusively expressed in that region was found. And third, the neurotransmitter
employed by that particular neuron type was identified. With this approach I identified
the midline cells, a second type of motoneuron, and an interneuron type (Figure 34 A).
However, in all cases the molecular fingerprint was not as clear as that of motoneurons,
and there are several reasons why it might be so. One explanation could be that I simply
did not have sufficient markers, or that Platynereis uses different transcription factors to
specify its interneurons. I find this unlikely, because through cloning and retrieval from
EST sequences I obtained almost all of the neuron markers that are expressed in the
vertebrate interneurons; also, it would be strange if all the column genes and the
motoneuron markers were conserved but not the rest of the neuron specific transcription
factors. In my opinion, a more plausible explanation is that during vertebrate evolution
the interneuron types diversified, whereas Platynereis retained a simpler complement that
was closer to that of Urbilateria. Of course, this does not mean that Platynereis retained
exactly the same neuron types as Urbilateria, it could have also lost or invented some of
its own. In the end, we can just say that vertebrates probably ended up with more
specialized neural circuits.

Such a process would have been greatly aided by the genome duplications that occurred
early during vertebrate evolution. When comparing the mediolateral patterning between
the two groups (Figure 34 A, B) it is immediately apparent that vertebrates have two and
sometimes three homologous genes for each one from Platynereis. Although in some
cases they seem to play a redundant role, such as nkx2.2 and nkx2.9 (Briscoe et al. 1999)
in the V3 interneurons (Figure 34 B) most of the sister genes have slightly different (if
mostly overlapping) domains. More importantly, the shifts in the ventral or dorsal
boundaries correspond to the borders of different progenitor domains (Figure 34 B). This
 117

is best exemplified by the pairs of nkx6 and dbx genes that in different combinations
specify no less than three progenitor domains (Vallstedt et al. 2001), or half of the cell
types in the ventral neural tube.

In line with this, one of the major differences between Platynereis and vertebrates is in
the role of dbx. Whereas the two vertebrate column genes dbx1 and dbx2 are essential for
the specification of the V0 and V1 interneurons, the Platynereis dbx is expressed only at
differentiation stage and as such does not qualify as a column gene. I was able to identify
a molecular fingerprint that resembles both the V1 and the V0 neurons. It is located
within the pax6 column and consists of dbx, eve and GAD (Figure 29 F, G, H). I propose
the following scenario: this inhibitory interneuron was already present in Urbilateria, and
it is still functioning in Platynereis; in vertebrates dbx has undergone a duplication event
and the two sister genes have been recruited into the mediolateral patterning scheme.
They are now differentially expressed and the two cell types they specify have diverged
in terms of projections and function (Moran-Rivard et al. 2001).

Moving to the edge of the neural plate, we have another molecular fingerprint (stretching
a bit the concept), only this time for a sensory interneuron. It is located at the lateral limit
of the pax3/7 and msx domains, and is defined by the coexpression of Ath, Olig2/3 and
lhx2. This corresponds to the dI1 cells from the vertebrate neural tube, and can be
interpreted to also represent the lateral limit of the trunk CNS in Platynereis. Although a
“bare bones” CNS, composed of motoneurons, an inhibitory interneuron type and a
sensory interneuron is conceivable, there are indications for more complexity in the
Platynereis ventral plate. There is a large region between the GABAergic neurons and the
Ath+ neurons (Figure 33 A) where I could not find any expression of a neurotransmitter
marker, although it is bound to contain neurons of some type. It roughly corresponds to
the pax3/7 and msx domains (Figure 34 A). Surprisingly, in this region there is some lhx3
and chx10 expression (Figure 25 B, D), so it actually resembles the V2 interneurons
(Figure 11).
118
 119

Figure 34. Comparison between the Platynereis and the vertebrate progenitor domains.

(A) The scheme represents the right half of a cross-section through the ventral plate; the stomodaeum is in
the lower left corner and the midline is at the bottom. The colored regions represent either progenitor
domains or identified neuron types, and are defined by the combination of transcription factors that are
expressed there. Starting from the bottom, we have: the midline (dark red) where nk2.2 and nk6 are
expressed, and in the same region the serotonergic neurons (pink). The gsx+ neurons (dark blue) and the
motoneurons (red) are located within the region where nk6 and pax6 are expressed. Slightly more lateral,
within the dbx domain, the GABAergic neurons (cyan) are positioned. The domains of pax3/7+ (light blue)
and msx (violet) cover the rest of the neural plate.
(B) This scheme represents the eleven progenitor domains from the ventral neural tube, and the ventral and
dorsal limits of the column genes that define them. The V3 interneurons correspond to the midline and the
serotonergic neurons from Platynereis (dark red and pink). The motoneurons form in both cases within the
region of overlap between nk6 and pax6, and outside that of nk2.2. The V2 interneurons have so far no
equivalent in the worm CNS. The V1 and V0 interneurons correspond to the GABAergic neurons from
Platynereis (cyan), both types seem to be equally related to it. A region that would correspond to the dI6
and dI5 sensory interneurons is present in the ventral plate, as evidenced by pax3/7 expression (light blue),
however the neuron types in Platynereis remain to be characterized. The same is true for the dI4 neurons,
where the pax3/7 and msx domains overlap.

However, it is unlikely that this portion of the ventral plate contains five distinct neuron
types, as the equivalent part of the vertebrate neural tube. The differentiation between the
dorsal sensory interneurons domains requires the expression of duplicated genes such as
the msx family (Ramos & Robert 2005) and the expression of the gsx genes (Kriks et al.
2005); the Platynereis gsx is expressed in another region, very close to the midline
(Figure 34 A) and the msx domain is very narrow. There is also the antagonism between
Olig3 and lbx that is very important in vertebrates (Zechner et al. 2007) but is absent in
Platynereis (Figure 31 D, J). Therefore the picture that emerges is one of increasing
complexity and specialization in the CNS of vertebrates since their split from Urbilateria.

3.7 How do these results change our view of Urbilateria?

In conclusion, I can say that the study of the trunk CNS in Platynereis has shed some
light on the legendary Urbilateria. First of all, this data strongly supports the
“complexity” camp, for the simple reason that so many features have been found to be
conserved between protostomes and deuterostomes. If one can make a plausible argument
for convergent evolution with regard to the three column genes that are conserved
between Drosophila and mouse, it is much more difficult to do the same for the seven
that are conserved between Platynereis and vertebrates (Figure 34). It is simply unlikely
 120

that out of hundreds of choices the same transcription factors were recruited twice in the
same dorsoventral sequence, and the probability of something like this happening by
chance decreases exponentially with the number of genes that are found to be conserved.
Higher up the signaling cascade, there is convincing evidence that BMPs had a role in the
patterning of the dorsoventral axis, and it is likely that hedgehog signaling was active on
the opposite side of the BMP source.

With regard to the neuron types, they were probably formed at distinct mediolateral
positions. The motoneuron molecular fingerprint is identical between Platynereis and
vertebrates, so very likely all bilaterian animals alive today have inherited their
motoneurons from their last common ancestor. The situation is less clear cut for the other
neuron types, but there is good evidence that Urbilateria possessed at least one type of
inhibitory interneurons, as well as sensory interneurons. It also employed the full
complement of neurotransmitters available in modern species, including acetylcholine,
serotonin, glutamate and GABA.

In addition to the sophisticated dorsoventral patterning and neuronal specification that

can be traced back to Urbilateria, there is also another argument for the existence of an
ancestral centralized nervous system: the molecules responsible for axon guidance and
midline crossing are well conserved between all three superphyla. This means that
Urbilateria probably had a ladder-like nervous system, with segmental commissures.
However, if we accept that a centralized nervous system dates back at least as far as the
ancestor of protostomes and deuterostomes, we are still left with the question of how it
became located on different sides of the dorsoventral axis. The inversion theory can fully
account for this (Figure 35) with the condition that the rearrangement, whatever its cause,
took place in a relatively short time (on evolutionary time scale, a few million years).
Provided that the ancestral deuterostome did not pass through a long “decentralization
phase”, the molecular machinery could have been retained with just minor modifications,
and this seems to have been the case.
 121

This is probably the opposite of what happened in the hemichordate Saccoglossus. Unlike
the chordate ancestor that became a swimmer and added new layers of complexity to its
neural circuits, the acorn worm adapted to a burrowing lifestyle that probably altered its
locomotor patterns and allowed the trunk CNS to change through evolutionary drift to its
present state of a poorly differentiated nerve net (Figure 35). The evolutionary path of the
nervous system in bilaterian animals remains a fascinating story, with most chapters still
waiting to be written. However, it should no longer be doubted that the starting point was
already well advanced on the path towards complexity, and contained in simplified form
many of the traits that blossomed in the billions of species that followed since then.

Figure 35. The evolution of the CNS in the descendants of Urbilateria.

The scheme represents a brief overview of what likely happened with the nervous system in different
bilaterian lineages. Because the CNS of a lophotrochozoan like Platynereis is much more similar to that of
 122

a deuterostome like a mouse than would be reasonable to expect through convergent evolution, the only
explanation is that those conserved features were inherited from their last common ancestor. Urbilateria had
a ventral nervous system and a sophisticated patterning that produced many neuron types. Such a CNS was
inherited along the protostome lineage, with the difference that slower evolving phyla have retained more
of the ancestral features than the fast evolving ones. Early on the deuterostome lineage there has been an
inversion of the dorsoventral axis that moved the CNS to the dorsal side (retaining the molecular
mechanisms involved) and the heart to the ventral side. The diffuse CNS of hemichordates is a secondary
trait that came about probably through changes in the lifestyle, and no longer resembles the ancestral one
present in Urbilateria.

3.8 Open questions

As the first in depth study of mediolateral patterning and neuronal specification in the
trunk CNS of a lophotrochozoan, this project has naturally raised more questions than it
has answered. Among the most important I would include the following.
Is hedgehog signaling responsible for the induction of the column genes in the ventral
plate? And if so, how exactly is the gradient interpreted? A similar question could be
posed for the BMP signaling: why are there two, perhaps even three distinct sources of
BMPs in the dorsal half of the embryo? What is the shape of the gradient, and where are
the antagonists (such as chordin) expressed?
How many distinct interneuron types are there in the neural plate? In particular, what
kinds of neurons form in the lateral regions, where pax3/7 and msx are expressed? And
why are there no glutamatergic neurons in the trunk, especially when there is a subset of
muscles that are probably innervated by glutamatergic fibers? Are all the motoneurons
cholinergic and serotonergic?
Finally, why did the mediolateral patterning change so much in Drosophila compared to
Platynereis? What is the actual extent of the changes? How was gsx employed in
Urbilateria, considering that it is expressed differently in Drosophila, Platynereis and in
vertebrates?

And the list could go on…

123
 124

4 MATERIALS AND METHODS

 125

4.1 Animals and embryos

For all my studies I used embryos obtained from an in-house culture of Platynereis,
established by Detlev Arendt and maintained by Heidi Snyman according to the
procedures described by (Dorresteijn 1993). The animals were grown at 18 °C, following
a light regime similar to the natural moon cycle: approximately one week of artificial
moonlight and three weeks of darkness. Five to fifteen days after the moon was turned
off, a number of both female and male matured (the epitokes) and were allowed to spawn
in a limited volume of natural sea water (NSW). Usually several thousand synchronously
developing embryos would result from each successful fertilization, and they were left to
develop at 18 °C until the desired developmental stage. About 24 hr after fertilization, I
filtered the embryos using a nylon net (hole size 100 µm) to remove the egg jelly, and
transferred them to fresh NSW.

The embryos were fixed with one of several protocols, depending on the intended use.
For Whole-Mount in-situ Hybridization (WMISH) I used the following protocol: 2 hr
fixation with PTW (phosphate saline buffer, or PBS, containing 0.1% Tween 20) and 4%
paraformaldehyde (PFA). This was followed by three washes with 100% methanol, 30
min each. For long term storage (up to a year) the embryos were stored in methanol at -20
°C. For stainings that were sensitive to methanol treatment, such as the phalloidin
staining, the following protocol was used: one hour of incubation with 4% PFA in PTW,
followed by three PTW washes (30 min each). The fixed embryos had to be used fresh,
there was no possibility of storing them. For the acetylcholine esterase staining, I used the
protocol described by (Karnovsky 1964) adapted for use in Platynereis. The embryos
were fixed with 100% ethanol for 2 min on ice. As for the previous protocol, the embryos
were used directly in the next step without storage. The most important developmental
stages for my work were 24 hpf, 34 hpf (neural patterning stage), 48hpf (neural
differentiation stage) and 54 hpf (neural circuit stage).
 126

4.2 SMART cDNA synthesis

Total RNA was obtained from several stages, using the RNAeasy kit (Qiagen) or the
trizol extraction method. It was the starting material for cDNA synthesis. The SMART
technology can be used in generating both 5’ and 3’ cDNA libraries. 3’ SMART library
generation: a standard RT reaction is performed using a special oligo (dT) primer that
contains the SMART sequence at the 5’ end. An added feature is the presence of two
degenerated nucleotides to help position it at the beginning of the polyA+ tail. This is a
useful feature for obtaining full length clones.

5’ SMART library generation: the reaction uses two primers and the PowerScript Reverse
Transcriptase (MMLV RT variant). The first primer is similar to the one mentioned
above, a poly (dT) with the two degenerated nucleotides but without the SMART tag. It
is used to initiate first strand synthesis. The second primer (SMART II oligo) contains the
SMART tag and a short dG stretch at the 3’ end. The RT exhibits terminal transferase
activity, and adds a few dCs before falling from the mRNA template. The SMART II
oligo can bind to this end by virtue of its dG stretch, and Then it can act as a template in a
second step. The RT performs a template switch and adds the SMART tag to the 5’ end.

4.3 The cloning of genes with degenerate primers and

subsequent extension through 5’ rapid amplification of
complementary ends (RACE)

4.3.1 The cloning of hb9

A protein alignment was generated using the ClustalX software of the Hb9 and MNR2
proteins from several vertebrate species, as well as the Drosophila Hb9. The most
conserved region was identified and I designed the following degenerate primers:
Hb9_DEG_U1 TNYTNGARYTNGARAARCARTTYAA
 127

Hb9_DEG_U2 GNCCNAARMGNTTYGARGTIGC
Hb9_DEG_L1 CYTTYTTNSWNCKYTTCCAYTTCAT
The primers were all below 4096 degeneracy, and with melting temperature in the range
of 55 to 65 °C. They were reconstituted with double distilled water at a final
concentration of 100 µM. Their final concentration in the PCR reaction was 250 pM, and
the dNTPs were used at 250 µM (each). For each 50 µl reaction I used one unit of Taq
polymerase, added after heating the sample to 95 °C (hot start PCR). The PCR program:
95 °C for 3 min
95 °C for 1 min, 50 °C for 2 min, 72 °C for 4 min
Repeat 40 times.
72 °C for 10 minutes.

The resulting 100 bp fragment was used as a template for designing the 4 RACE primers,
two upper ones for the 3’ direction and another two lower ones for the 5’ direction.
Hb9_U1 CGACACTCATGCTGACAGAAACACAGG
Hb9_U2 CAGGTGAAAATCTGGTTCCAAAACCGA
Hb9_L1 TCGGTTTTGGAACCAGATTTTCACCTG
Hb9_L2 CCTGTGTTTCTGTCAGCATGAGTGTCG
For the RACE extension I used the following PCR program:
95 °C for 3 min
95 °C for 1 min, 52 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 57 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.

As template I used cDNA prepared by Kristin Tessmar-Raible according to the SMART

protocol (see above). In the first step, two reactions were set up: U1 and U2 (for the
3’RACE) and L1 and L2 (for the 5’RACE) with the universal primer mix, or UPM. The
products from the first run were used in a nested reaction for both the 5’ and the 3’
 128

amplifications. The PCR products were run on a 1.5% agarose gel, and then blotted by
the semi-dry Southern blotting protocol.

4.3.2 The cloning of nk6

I have used the conserved regions (highlighted by the sequence alignment) to design the
following degenerate primers:
Nk6_DEG_U1: CCNACNTTYWSNGGICARCARAT
Nk6_DEG_U2: AARTAYYTNGCNGGICCIGA
Nk6_DEG_L1: GTNGCCATYTCNGCNGCRTG
Nk6_DEG_L2: GTNCKNCKRTTYTGRAACCAIAC
For the degenerated PCR I used the following program:
95 °C for 3 min
95 °C for 1 min, 43 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 48 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.
As template I used the 48h cDNA library (cloned in the pSport6 vector), prepared by
Kristin Tessmar-Raible.

The resulting 95 bp fragment (excluding the degenerate sequence) was used as a template
for designing the RACE primers.
Nk6_3RACE_U1: GCCGGAGCGGGCGAGGCTG *
Nk6_3RACE_U2: GGCGAGGCTGGCTTATGCCCTGG
Nk6_5RACE_L0: CCATCTCTGCCGCATGTCGCTTG
Nk6_5RACE_L1: GAACCAGACCTTGACTTGACTCTCGGAC *
Nk6_5RACE_L2: CTTGACTTGACTCTCGGACATGCCCAGG *
Nk6_5RACE_L3: CCAGGTACTTGGTCTGCTCGAACGTC
 129

For the RACE PCR I used the following program:

95 °C for 3 min
95 °C for 1 min, 53 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 58 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.

4.3.3 The cloning of dbx

Using the alignment as a guide, I have designed the following degenerate primers:
Dbx_DEG_U1: CARMGNAARGGNYTIGARAA
Dbx_DEG_U2: CARCARAARTAYATHWSNAARCCIGA
Dbx_DEG_U3: AARCCNGAYMGNAARAARYTIGC
Dbx_DEG_L1: SWNARRTCNGGRTKIGGRTT
Dbx_DEG_L2: CKYTCYTTNSWRTTICKCCAYTTCAT
As template I used the 48h pSport6 cDNA library.
For the degenerated PCR I used the following program:
95 °C for 3 min
95 °C for 1 min, 38 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 43 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.

The resulting 80 bp fragment (fully new sequence) was used to design the following
RACE primers:
Dbx_3RN_U1: TCGCAAGAAACTCGCTGACAAACTCGG
Dbx_3RN_U2: CGGACTCAAAGATTCACAGGTTAAGATCTGG
Dbx_5RN_L1: TCATTCTTCTGTTTTGGAACCAGATCTTAACC *
 130

Dbx_5RN_L2: GGAACCAGATCTTAACCTGTGAATCTTTGAG *
Dbx_5RN_L3: TAACCTGTGAATCTTTGAGTCCGAGTTTGTC
The primers were used with the following program:
95 °C for 3 min
95 °C for 1 min, 50 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 55 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.
The RACE PCRs were done using the Takara polymerase cocktail.

4.3.4 The 5’ RACE of gsx

The 200 bp fragment cloned by David Ferrier was used to design RACE primers:
Gsh_5R_L0: TGTTTTTCACTTAGATTCAAGTACGTGGCGA *
Gsh_5R_L1: ACGTGGCGATTTCTATTCTCCTCAGTCG
Gsh_5R_L2: GGGATAAGTACATGTTGCTGGAGAACTCGC *
The primers were used with the following program:
95 °C for 3 min
95 °C for 1 min, 50 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 55 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.
As template I used the 48h pSport6 cDNA library.

4.3.5 The 5’ RACE of msx

The 500 bp fragment cloned by Heidi Snyman was used as a template for the design of
RACE primers:
 131

Msx_5RACE_L1: CCGGTTTGTCTTGTGCTTACGTAACTGCAC *
Msx_5RACE_L2: GGGTCGTGGAGGTGAAGTGGATAGTCTAGG *
Msx_5RACE_L3: CTGAAAGCTCCATGGGGACTGTGTCCAG
The primers were used with the following program:
95 °C for 3 min
95 °C for 1 min, 53 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 58 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.
As template I used the 48h pSport6 cDNA library.

4.3.6 The cloning of ChAT

The protein alignment was used as a guide to create the following degenerate primers:
ChAT_DEG_U1: ANTAYTGGYTNAAYGAYATGTAY
ChAT_DEG_U2: CCNYTNTGYATGRMNCARTA *
ChAT_DEG_US1: GCNAAYMGNTGGTWYGAYAA
ChAT_DEG_U3: BTNGCNYTICARYTNRC
ChAT_DEG_L1: TGNADNSWYTTRTCRWACCA *
ChAT_DEG_L2: TTDATRAANKYYTTNCCRTA
ChAT_DEG_L3: CKDATRYWRTCNACICKNCC
ChAT_DEG_L4: TTRTANSWNSMICCRTANCC *
The primers were used with the following program:
95 °C for 3 min
95 °C for 1 min, 45 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 50 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
72 °C for 10 min.
 132

As template the 48h pSport6 cDNA library was used.

The fragment obtained with ChAT_DEG_U2 and ChAT_DEG_L1 was used to make 2
specific primers, that were subsequently used in a semi-degenerated PCR.
ChAT_SpU1: AGGGCATTGCTGTTGTTCAG *
ChAT_SpU2: GACAGCGGAAGTTGCCTC *
ChAT_2U2: CCNYTNTGYATGRMICARTAYTA *

4.3.7 The cloning of VGLUT

The protein alignment was used to identify the best regions for degenerate primers.
VGLUT_DEG_U1: ACNCARATHCCNGGNGGNT *
VGLUT_DEG_U2: YTNGTNGARGGNGTNACNTA *
VGLUT_DEG_U3: GCNTGYCAYGGNATNTGG
VGLUT_DEG_U4: WSNGGNWSNTAYGCNGG
VGLUT_DEG_U5: CNAAYTTYTGYMGNWSNTGG
VGLUT_DEG_U6: AAYTGYGGNGGNTTYGG
VGLUT_DEG_U7: TTYWSNGGNTTYGCNATH
VGLUT_DEG_U8: GCNATHWSIGGNTWYAAYGT
VGLUT_DEG_L1: ACNCCRTTNSWIADNCCCAT *
VGLUT_DEG_L2: CCCATNARDATNSWNGCRT *
VGLUT_DEG_L3: CATNCCRAANCCNCCRCA
VGLUT_DEG_L4: CANSWNCKRCARAARTTNGC
VGLUT_DEG_L5: TTNGCNACDATDATNGCRTANAC
The primers were used with the following program:
95 °C for 3 min
95 °C for 1 min, 52 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 57 °C for 2 min, 72 °C for 4 min
Repeat 34 times.
 133

72 °C for 10 min.
The 48h pSport6 cDNA library was used as template.

The fragment obtained with the VGLUT_DEG_U1 and VGLUT_DEG_L1 primers was
used to design specific primers that were used in a mixed DEG-specific PCR:
VGLUT_Sp_U1: ATTGAAACCACACTACGAGAGTCAGG
VGLUT_Sp_U2: TCAGGCGTTACAGTCATCAAGGAG
The PCR program used was:
95 °C for 15 min (HotStar Taq)
95 °C for 1 min, 55 °C for 2 min, 72 °C for 4 min
Repeat 39 times
72 °C for 10 min.

4.3.8 The cloning of GAD

The following degenerate primers were constructed within the regions of maximum
conservation, as determined from the protein alignment:
GAD_DEG_U1: GCNAAYACNAAYATGTTYACNTAYG *
GAD_DEG_U2: CCNGTNTTYRTNYTNATGGA *
GAD_DEG_U3: CAYRTNGAYGCNGCNTGG
GAD_DEG_L1: GTNGTNCCNGCNGTNGC
GAD_DEG_L1.3: CCANGCNGCRTCNAYRTG *
GAD_DEG_L1.6: CATNADYTTRTGNGGRTTCC *
GAD_DEG_L2: CNWYRTGNCKICCRCAYTG
GAD_SpL3: TCGAAAGAAGTTGACCTTATC
The primers were used with the following program:
95 °C for 15 min (HotStar Taq)
95 °C for 1 min, 47 °C for 2 min, 72 °C for 4 min
Repeat 4 times.
95 °C for 1 min, 52 °C for 2 min, 72 °C for 4 min
 134

Repeat 34 times.
72 °C for 10 min.
As template I used a mixture of 4 day and 5 day old SMART cDNA.

The resulting fragment was used to make RACE primers:

GAD_5R_L1: CAAATGCGCCCATGACGGTGTTACCAGC *
GAD_5R_L2: ATGCCAAGAAGGGCTCCAGCTCTCTTGATGG *
GAD_5R_L3: GGGCCTGTTCTGAAGTGAACATGACCATCCTG

4.4 Southern blotting and radioactive hybridization.

The samples are run on a 1.5% agarose gel, including a DNA ladder. After Ethidium
bromide staining, a picture of the resulting bands is taken for later analysis. The gel is
denatured for 20 min in a 0.5% sodium hydroxide solution, in order to separate the two
DNA strands. I did not perform the optional step of renaturing the gel with an HCl
solution, instead I proceeded to the blotting step.

For blotting I used a stack in the following order, from the bottom up:
-2 layers of Whatman paper, cut to the gel size and soaked in denaturing buffer
-the denatured gel.
-a nylon membrane, again cut to gel size (Amersham Hybond-N+), carefully avoiding the
formation of bubbles between it and the gel.
-another two pieces of Whatman paper
-a ten centimeter stack of paper towels
The assembled setup was weighted down with 1-2 kg overnight.
I recovered the membrane on the following day, dried it for several hours and then cross-
linked with UV radiation (using a Stratalinker oven, 2 min crosslink).
 135

4.4.1 Radioactive probe preparation

As template for the radioactive probe I used the fragment cloned by degenerate PCR. The
insert was excised with EcoRI digestion, and purified using the Gfx kit from Amersham.
Reaction setup:
- 5 µl of buffer
- 4 µl of dATP, dGTP and dTTP
- 21 µl of purified DNA and 5 µl of primer (random hexanucleotides) were heated to
95 °C for 5 min
The two solutions were mixed and incubated 5 min at room temperature for annealing of
the primers to the template. In the hot lab, the last two items were added:
- 5 µl of 32P labeled dCTP
-1 µl of Klenow fragment
The reaction was incubated for 30 min at 37 °C.

Alternative protocol for preparing the radioactive probe, using the Rad Prime kit
(Invitrogen):
- 1 µl of dATP, dGTP and dTTP
- 20 µl of Rad Prime Buffer (contains the random primers as well)
In a separate reaction, 20 µl of template are heated to 95 °C for 5 min. The two reactions
are mixed and left to anneal. In the hot lab, the last components are added:
- 5 µl of 32P labeled dCTP
-2 µl of Klenow enzyme
The reaction was incubated for 30 min at 37 °C.

4.4.2 Membrane hybridization

During probe generation, the membrane was prehybridized with 5 ml of Rapid Hyb
Buffer (Amersham) in a rotating glass cylinder, at 65 °C. The enzyme was inactivated by
heating the reaction for 5 min at 95 °C. I used half of the probe (already denatured by the
 136

95 °C incubation) in the subsequent step without purification. The membrane was

incubated for 2 hr at 65 °C in the presence of the 32P labeled probe. The washes were as
follows: 2 quick rinses with 2xSSC buffer, followed by two more washes at 65 °C with a
buffer containing 0.1xSSC and 0.1% SDS. After washes I transferred the membrane to a
film cassette and exposed a film (high sensitivity Kodak) from 1 hr for strong radioactive
signals (over 2000 counts/min on the Geiger counter) to overnight for weak signals (less
than 500 counts/min). The signals on the film were matched to the position of bands on
the gel using geometric scaling.

4.5 Cloning of DNA fragments

I ran again on a preparative agarose gel the PCR products that gave positive signals, and
excised the largest fragments. The DNA was purified using the Gfx kit (Amersham) and
eluted in a concentrated form from the columns (10 µl elution volume, deionized water).
The fragments were cloned using the pCRII-TOPO system (Invitrogen). I set up a
reaction mixture consisting of 2 µl insert, 0.5 µl Dilute Salt Solution and 0.5 µl TOPO
vector, and left it for 30 min at room temperature. Next, I mixed two µl of the ligation
mixture with 50 µl of electrocompetent bacteria, and electroporated it with at 2.3 kV in a
2 mm cuvette. The bacteria were transferred to 900 µl of LB medium, and shaken for 30
min at 37 °C. LB-agar plates containing 50 µg/ml Ampicillin were treated with 40 µl of
8% X-GAL (DMSO solution) and 40 µl of 150 mM IPTG, and then left to dry in the
incubator. The transformed bacteria were plated and left to grow at 37 °C for 14-17 hr.
Due to the inherent efficiency of the TOPO cloning, the great majority of colonies (over
80%, as ascertained by the blue-white screening and by PCR analysis) contained an
insert. However, I observed a strong bias in favor of shorter fragments; the colonies
containing inserts above 1 kb were quite rare.
 137

4.6 Colony screening through colony lifts, minipreps and

PCR

In order to find the longest RACE products, the screening of colonies was necessary. I
have done this in several ways: through colony lifts, through random picking of clones
followed by purification of minipreps and restriction analysis, or through large scale PCR
screening for insert size.

Colony lift protocol: after the colonies on a plate have grown to a good size, I applied an
Optitran nylon membrane on top of the plate, I made a notch to help with the subsequent
alignment, and then I carefully lifted it to avoid the smearing of the colonies. The plate
was incubated for 8-10 hr to allow the regrowth of the colonies. For processing the
membranes, I prepared three trays, containing Whatman paper soaked with denaturing
buffer, neutralizing buffer, and 2xSSC. The colonies on the membrane were first lysed
for 3 min in the denaturing buffer, then they were transferred to the neutralizing tray (also
for 3 min) and finally to the the 2xSSC. After this the membranes were baked for 2h at 70
°C. The radioactive hybridization was done as already described, except that after
prehybridization the Rapid Hyb buffer was exchanged for fresh one.
Miniprep screen: thirty white colonies were picked and used to inoculate LB + Amp
medium. Using the standard alkaline lysis protocol, followed by isopropanol precipitation
of the DNA, the plasmids from the picked colonies were purified. The plasmids were
digested with EcoR I to check for insert size, and with a frequent cutter such as Hinf I or
Rsa I to distinguish between similar-sized inserts. I used this protocol together with the
colony lift to ensure I only picked the positive ones. However, I soon realized that most
colonies were positive anyway for the right gene; it was the size of the insert that varied a
lot. Therefore, my method of choice became PCR plate screening. I picked 96 white
colonies into a plate with PCR mix, as well as one with LB. After the PCR was
completed and I had run the samples on an agarose gel, I only minipreped and sequenced
the colonies that had large inserts. The sequencing was done in-house by the GeneCore
facility, using the capillary electrophoresis method.
 138

4.7 Generation of labeled probes

For WMISH I generated probes labeled with either digoxygenin or fluorescein (Dig and
Flour for short). These epitopes are attached through a linker to UTP molecules, and are
incorporated into normal RNA every 20 or so normal UTP ribonucleotides. I have used
two methods to obtain the template for in-vitro transcription. First, the pCR II vector
contains two promoters, SP6 and T7. Depending on the orientation of the cloned gene, I
have used Hind III, BamH I or EcoR V, Xho I to linearize the vector, and obtain a DNA
fragment that has the promoter upstream of the 3’ end of the gene. Alternatively, I have
used a special PCR primer that contained a T7 sequence at the 5’ end, to generate a PCR
fragment with the T7 promoter again at the 3’ end of the gene.
The transcription reaction:
- 12.5 µl purified template
- 2 µl transcription buffer (10x)
- 2 µl DTT (0.1 M)
- 1.3 µl of NTP Mix (15.4 mM each, except UTP- 10 mM)
- 0.7 µl Dig-UTP or Fluor-UTP (10 mM)
- 0.5 µl RNA guard (RNase inhibitor cocktail)
- 1 µl polymerase (T7 or Sp6)
Incubate 2.5 h at 37 °C.
- 1 µl DNase I, digest for 30 min to 1 hr
The labeled probe was purified with the RNAeasy kit, using the RNA cleanup protocol. I
checked the quality of the probes by running 1 µl on an agarose gel. For long term
storage, the purified probe was diluted with Hyb Mix to a total volume of 200 µl and kept
at -20 °C.
 139

4.8 Whole-Mount in-situ Hybridization (WMISH)

protocols

I investigated the expression of genes in Platynereis using several variations of the basic
WMISH protocol (Arendt et al. 2001), according to the techniques described by
(Tessmar-Raible et al. 2005). The protocols are identical with regard to the first steps of
embryo rehydration and probe hybridization; they differ in the methods used for signal
formation and amplification.

4.8.1 The basic WMISH protocol in Platynereis

The core Platynereis WMISH protocol is the following. The embryos were kept from
dispersing during washing procedures by using specially designed nets (made by gluing a
nylon net on the bottom of a plastic cylinder). The rehydration was performed in trays
containing around 30 ml of solution, by transferring the embryos (on nets) from one tray
to next. Embryos that have been stored at least overnight in methanol are rehydrated
using a serial dilution of methanol in PTW. They were transferred from 100% methanol
through 75%, 50%, 25% and finally PTW (5 min washes), ensuring a smooth rehydration
that does not produce artifacts. After rehydration, the embryos were digested with
proteinase K solution (100 µg/ml in PTW), for various periods of time according to their
developmental stage. From 24 to 48 hpf I used a 1 min digestion time, for 54 hpf
embryos 1 min and 20 sec, and for 72 hpf a 2 min incubation. The activity of the
proteinase K may vary as much as 50% either way from batch to batch; if the staining of
the embryos looks blurry, a shortening of the digestion time is recommended. After
digestion, the embryos are rinsed twice with freshly prepared glycine solution (2 mg/ml
in PTW) to neutralize the enzyme. The next step is a 20 min fixation with 4% PFA (in
PTW) to ensure the complete inactivation of the proteinase K and to preserve the content
of the cells. The excess PFA is removed through PTW washes, 5x 5min. All the above
 140

steps are performed at room temperature. Alternatively, if the number of embryos was
very small, the same procedure was done using 6 well plates (Nunc).

4.8.2 The hybridization of the embryos with labeled probes and the
washing steps

For hybridization and the subsequent steps, I transferred the embryos to special 1 ml nets
and modified 2 ml tubes, and changed the solution from PTW to hybridization mix (Hyb
Mix). Hyb Mix is a 5xSSC buffer with 50% formamide, 50 µg/ml Heparin, 5 mg/ml
Torula-RNA (Sigma) and 0.1% Tween 20. The embryos were prehybridized for 2 hr at
65 °C in a water bath, or alternatively in a heat block that was covered with an insulating
blanket to prevent condensation. The probes (for double in-situ, two per tube) were
diluted with Hyb Mix (depending on the gene, from 4 to 20 µl of stock) to a final volume
of 200 µl, and denatured for 10 min at 80 °C. The embryos were then incubated overnight
with the probe, at 65 °C. I noticed that a longer incubation time at 65 °C (32 h instead of
12 h) will result in faster staining, irrespective of the gene used. This 3 to 4 time increase
in the staining speed was useful when working with genes that require > 3 days to
develop their full pattern. However, the signal to noise ratio remained unchanged, so it
was not possible to get a “cleaner” staining this way.

The washing steps were performed also at 65 °C, with increasing stringency. First, two
washes with a buffer containing 2xSSC, 50% formamide and 0.1% Tween 20, 2x 30 min.
Second, a 20 min wash with 2xSSCT. And finally, two more 30 min washes with
0.2xSSCT. Increasing the washing times usually resulted in a lower background, but at
the expense of the speed of staining. In preparation for the antibody stainings, the
embryos were blocked for 1-2 hr in 5% sheep serum (PTW), at room temperature.
 141

4.8.3 The formation of a colored precipitate

For the standard in-situ protocol, the next step was the incubation of the embryos with
anti-Dig antibody (Roche) coupled to alkaline phosphatase (diluted 1:2000 in 2.5% sheep
serum/PTW), overnight at 4°C. After incubation, the excess antibody was washed six
times with PTW (20 min each, at room temperature). I transferred the embryos from the
nets to 24 well plates using 2 ml of staining buffer per well. The staining buffer has a pH
of 9.5 and contains 100 mM TrisCl, 100 mM NaCl, 50 mM MgCl2 and 0.1% Tween 20. I
then changed the embryos to the staining solution, containing 337 µg/ml NBT and 175
µg/ml BCIP in staining buffer. The reaction was allowed to develop in the dark, without
shaking. The staining time required differed widely between genes, from as little as 30
min to several days. The reactions were stopped by washing the embryos twice with
PTW. In preparation for bright field microscopy and for long term storage the embryos
were transferred to 87% glycerol, and kept in the dark at 4 °C.

4.8.4 The formation of a colored and a fluorescent precipitate

For the double WMISH, in the hybrid form (the expression of one gene visualized as an
NBT/BCIP precipitate, the other ones’ as a fluorescent precipitate) I followed this
protocol. First of all, the two genes have to be labeled with different epitopes; since the
Dig label was better recognized by the antibodies, I used it for the genes that were to be
visualized fluorescently. Even so, only the strongest genes produced a staining under
these conditions. Because the alkaline phosphatase (AP) staining does not work well after
the fluorescent one, I always did it first. The blocked embryos were incubated with anti-
Fluor AP antibody (Roche) diluted 1:5000 in 2.5% sheep serum/PTW, overnight at 4 °C.
The excess antibody was washed off with 6x 30 min PTW washes. The embryos were
treated as above, and an NBT/BCIP precipitate was formed. The expression of the
weakest genes was not detectable with Flour-labeled probes, however this staining
worked for most genes. After the staining was stopped, I transferred the embryos back to
the nets, for a second round of blocking with 5% sheep serum/PTW. Then the embryos
 142

were incubated (again overnight, at 4 °C) with an anti-Dig antibody (Roche) coupled to
horseradish peroxidase (POD), diluted 1: 100 in 2.5% sheep serum/PTW. DAPI was also
added at a final concentration of 1 µg/ml. The washes were done using the TNT buffer,
6x 10 min at room temperature. It contains 100 mM Tris-HCl, 150 mM NaCl, 0.1%
Tween 20 and has a pH of 7.5. For the fluorescent staining I used the Cyanine 3 TSA
Plus kit (Perkin Elmer): the Cy3 coupled tyramide accumulates at the sites of POD
activity, amplifying the signal. After the TNT washes, the embryos were transferred to
eppendorf tubes and equilibrated with 100 µl of TSA Amplification Diluent Plus. They
were then incubated with 25 µl of Cy3 tyramide, diluted 1:25 in Amplification Diluent,
for 3 hr at room temperature and in the dark.
I stopped the staining by transferring the embryos to 6 well plates and washing twice with
TNT buffer. For fluorescent and confocal laser microscopy, I exchanged them to 87%
glycerol (containing 2 mg/ml DABCO).

4.8.5 The formation of two different fluorescent precipitates

And finally, I used this protocol for the double fluorescent WMISH. The two probes were
labeled again with Dig and Fluor; the difference was that in this case I labeled the one
against the stronger gene with the Fluor epitope. The blocked embryos were incubated
overnight at 4 °C with the anti-Dig POD antibody, diluted 1:100 in 2.5% sheep
serum/PTW. They were subsequently washed with TNT and stained with the Cy3
fluorophore as described above. After stopping the reaction, I inactivated the POD
enzyme by incubating 20 min (room temperature, in the dark) with 1% H2O2/TNT, and
then I washed the excess H2O2 with several more TNT washes. The embryos were
blocked again with 5% sheep serum/PTW in preparation for the second antibody
incubation. I used the anti-Fluor POD (Roche) diluted 1:50, again overnight at 4 °C.
The excess antibody was washed off with TNT, and the expression of the second gene
was revealed using the Fluorescein coupled tyramide (1:25 in Amplification Plus
Diluent). After two more TNT washes, I transferred the embryos to 87% glycerol with 2
mg/ml DABCO (free radical scavenger, anti-bleaching reagent).
 143

4.9 Antibody and histochemical stainings

Thanks to the discovery that NBT/BCIP precipitates were giving a very strong signal in
reflection confocal laser microscopy (Jekely and Arendt, 2007) I was able to combine
antibody stainings (against α-acetylated tubulin or serotonin) with WMISH.
The acetylated tubulin counterstaining greatly increased the value of the basic WMISH,
since it provided a reference frame for the CNS as well as the various ciliary bands. It
was integrated into the protocol like this: together with the anti-Dig AP or anti-Fluor AP,
I added the anti-α acetylated tubulin antibody (Sigma) in a 1: 500 dilution. After the
staining was stopped, the embryos were blocked with 5% sheep serum/PTW. The
secondary antibody, anti-mouse FITC conjugated (Jackson Immunoresearch) was added
at a 1: 250 dilution, and was incubated at 4 °C overnight. The excess antibody was
washed with PTW, 3x 30 min, and the embryos were transferred to 87% glycerol with
DABCO. The quality of this staining degrades somewhat with prolonged storage. The
anti-serotonin antibody was added in a similar fashion, together with the anti-Dig AP
(1:500). As for the secondary antibody, I used an anti-rabbit Cy5 (Jackson
Immunoresearch) in a 1:250 dilution.

The muscles were stained with a special reagent, Rhodamine- conjugated phalloidin.
However, the binding site for phalloidin disappears if the embryos are treated with
methanol, so this staining was incompatible with WMISH. Instead I managed to combine
it with antibody stainings against serotonin and acetylated tubulin. The acetylated tubulin
and serotonin counterstainings were possible for double WMISHs too; also, a nuclear
staining such as DAPI or Hoechst proved to be a helpful addition to acetylated tubulin for
the description of the neural plate region.

And finally, there was the acetylcholine esterase staining. It used acetylthiocholine iodide
(ACTI) as a substrate to produce a copper based precipitate. The embryos fixed in
ethanol (as described above) were treated for 3 hr with a special staining solution, at 37
 144

°C. The staining solution was made from 500 µg/ml ACTI, 65 mM Maleate, 5 mM
trisodium citrate, 3 mM CuSO4 and 500 µM K3(Fe(CN)6). To stop the reaction, the
embryos were treated with increasingly high concentrations of ethanol: 50%, 75% and
100%. For microscopy they were transferred to 87% glycerol.

4.10 Special nets and modified 2 ml tubes

For large scale WMISH, it becomes difficult to do all the washing steps using 6 well
plates or normal Eppendorf tubes. In order to ensure that embryos are not lost during
washing steps, I have designed a special net from basic laboratory plasticware. To make a
net, cut the first 8 mm of 1 ml disposable tip, and keep the remaining portion. Also cut
the middle portion of a Qiagen mini column to obtain a tapered plastic cylinder. Jam the
1 ml tip into the cylinder, according to the best fit between the two truncated cones. If
done correctly, there should be about 2 mm of the tip protruding from the end of the
cylinder. Using a burner, carefully melt the edge of the plastic tip (without melting that of
the cylinder in the process). Quickly press the melted part onto a nylon net (100 µm hole
diameter) and allow it cool. Trim the excess net around the tip of the net. Then cut the
other end of the plastic tip, to obtain a net of about 3 cm in length. Because normal 2 ml
Eppendorf tubes have a conical bottom, the volume needed to cover the net is excessive.
To make a flat eppendorf tube, cut the bottom (about 3 mm) and keep both pieces. Melt
carefully in a flame the (now open) bottom of the tube, until the hole increases in size by
about 50%. Press the melted bottom onto the small tip that was cut previously (conical tip
towards the inside of the tube). If necessary, trim any excess plastic that exceeds the
diameter of the tube. It is advisable to check if the new tube does not leak, before using it
for in-situ hybridizations.
 145

4.11 Cyclopamine inhibitions

Hh signaling is likely to play an important role (on evolutionary grounds) in Platynereis.

This led to the establishment of an inhibition assay (by Kristin Tessmar-Raible) using
cyclopamine to downregulate the signaling pathway. I have used two different
approaches with regard to cyclopamine inhibition. The first one is to do it powerful
(maximum 35 µM) but short: around 10 hr long, between 22 hpf and 32 hpf. This has the
advantage that the embryos can tolerate considerably higher levels of inhibitor without ill
effects, and also this is the time when many genes assumed to be under Hh regulation
start to be expressed. On the other hand, it is not clear if the time is long enough to
overcome all inertia in the pathway. The other approach I tried was to incubate the
embryos for 24 hr, between 24 and 48 hpf. In this way, any delayed effects should
become apparent. However, they can only tolerate about 40% of the cyclopamine levels
possible during shorter incubations, and also there seem to be many side effects that
complicate the phenotype. In both cases, 2-3 healthy batches were split into controls and
inhibited, and then further aliquoted into 24 well plates (about 100-200 embryos/ml).
Cyclopamine procured from Toronto Research Canada (TRC) was diluted with 95%
ethanol to a final concentration of 2.4 mM. From this stock solution I have added from 1
to 15 µl to embryos swimming in 1 ml of NSW. The final concentrations were in the
range of 2 to 35 µM; the controls received only an equivalent volume of 95% ethanol.
After inhibition, the embryos were fixed as described above, in preparation for WMISH.

4.12 BMP4 treatment of larvae

To simulate the effects of ectopic BMP4 expression in Platynereis, the larvae were
soaked with recombinant zebrafish BMP4 between 24 hpf and 48 hpf. The experimental
setup was similar to the one already described for cyclopamine inhibitions: the embryos
were distributed in 24 well plates and exposed to various concentrations of protein. The
maximum concentration that could be tolerated by the embryos was 500 ng/ml. An
important point is that the activity of BMP4 decreased significantly after a single freeze/
thaw cycle: in practice, 500 ng/ml of thawed protein produced a similar effect to that of
 146

about 300 ng/ml of freshly reconstituted one. I performed two kinds of experiments: first
a large scale screen including 26 genes, with the high concentration of 500 ng/ml. This
allowed me to find several interesting targets. These I analyzed in more detail, using
several lower concentrations. With the help of Gaspar Jekely, I have also assembled a
scale of relative effects that ranges from “No expression remaining” to “Normal” and to
“Strong ectopic expression”. The number of embryos that I have sorted for each gene and
concentration (in the 70-110 range) are sufficient to ensure the results are quite robust
and do not suffer from sampling bias.

4.13 Bright field and confocal laser microscopy

After WMISH or antibody staining the embryos were equilibrated in 87% glycerol, and if
a fluorescent staining was also present I used glycerol with 2 mg/ml DABCO, a free
radical scavenger (Sigma). The embryos were mounted on specially prepared slides, with
several layers of tape. For the 24 hpf stage I used two layers, for the 48 and 54 hpf I used
slides with two layers on one side of the slide and three on the other, and for 72 hpf
embryos I used three layers of tape. The volume of glycerol added varied from 65 to 95
µl, depending on the number of tape layers on the slide. The chamber was completed
with a coverslip.

For bright field images I have used a Zeiss Axiophot microscope with DIC optics.
Depending on the stage I used 20x and 40x oil-immersion objectives, and the pictures
were recorded with a digital camera in the “.tiff” format. For each embryo I recorded a
stack of five to six pictures taken at different depths, usually starting at the surface of the
ventral plate and moving towards dorsal. The images were rotated, cropped and adjusted
for brightness and contrast using the Adobe Photoshop software.

For confocal microscopy I have used a Leica TCS SP2 as well as a Leica TCS SPE, with
either 40x or 63x oil-immersion objectives. For visualizing the expression of genes I have
mostly used the wholemount reflection CLSM (Jekely and Arendt, 2007). Briefly, the
 147

technique consists of shining a laser line at 100% power on the NBT/BCIP precipitate
and recording the reflected light by placing the detection window at the same wavelength
as the laser. This requires the use of a confocal microscope where the detection range can
be user defined. Because longer wavelengths penetrate deeper in the embryo and generate
less noise I have used the 633 nm laser line. Alternatively I have used the standard
method of fluorescence microscopy, where the fluorophore was excited with the
appropriate laser line and the emitted light was detected at a longer wavelength. These
two techniques were combined for the double WMISH pictures, as well as for the
acetylated tubulin counterstaining of single gene WMISH stainings.

The volume scanned was usually around 183x183x81 µm; I have used two different
resolutions: the scans intended for ventral projections had a step size of around 1 µm on
Z axis, and those intended for 3D reconstruction had a step size of 0.4 µm. Ventral
projections were generated from the raw data was using the ImageJ program (freeware).
For 3D reconstruction and virtual cross-sections I have used the Imaris software
(Bitplane).
 148

5 REFERENCES
 149

Aguinaldo, A. M., Turbeville, J. M., Linford, L. S., Rivera, M. C., Garey, J. R., Raff,
R. A. & Lake, J. A. 1997 Evidence for a clade of nematodes, arthropods and
other moulting animals. Nature 387, 489-93.

Alvarez, F. J., Villalba, R. M., Zerda, R. & Schneider, S. P. 2004 Vesicular

glutamate transporters in the spinal cord, with special reference to sensory
primary afferent synapses. J Comp Neurol 472, 257-80.

Arber, S., Han, B., Mendelsohn, M., Smith, M., Jessell, T. M. & Sockanathan, S.
1999 Requirement for the homeobox gene Hb9 in the consolidation of motor
neuron identity. Neuron 23, 659-74.

Arendt, D. & Nubler-Jung, K. 1994 Inversion of dorsoventral axis? Nature 371, 26.

Arendt, D. & Nubler-Jung, K. 1997 Dorsal or ventral: similarities in fate maps and
gastrulation patterns in annelids, arthropods and chordates. Mech Dev 61, 7-
21.

Arendt, D. & Nubler-Jung, K. 1999 Comparison of early nerve cord development in

insects and vertebrates. Development 126, 2309-25.

Arendt, D., Technau, U. & Wittbrodt, J. 2001 Evolution of the bilaterian larval
foregut. Nature 409, 81-5.

Arendt, D., Tessmar-Raible, K., Snyman, H., Dorresteijn, A. W. & Wittbrodt, J.

2004 Ciliary photoreceptors with a vertebrate-type opsin in an invertebrate
brain. Science 306, 869-71.

Aza-Blanc, P. & Kornberg, T. B. 1999 Ci: a complex transducer of the hedgehog

signal. Trends Genet 15, 458-62.

Aza-Blanc, P., Lin, H. Y., Ruiz i Altaba, A. & Kornberg, T. B. 2000 Expression of
the vertebrate Gli proteins in Drosophila reveals a distribution of activator
and repressor activities. Development 127, 4293-301.

Bai, L., Xu, H., Collins, J. F. & Ghishan, F. K. 2001 Molecular and functional
analysis of a novel neuronal vesicular glutamate transporter. J Biol Chem
276, 36764-9.

Bertrand, V., Hudson, C., Caillol, D., Popovici, C. & Lemaire, P. 2003 Neural tissue
in ascidian embryos is induced by FGF9/16/20, acting via a combination of
maternal GATA and Ets transcription factors. Cell 115, 615-27.

Bijlsma, M. F., Spek, C. A. & Peppelenbosch, M. P. 2004 Hedgehog: an unusual

signal transducer. Bioessays 26, 387-94.

Boekhoff-Falk, G. 2005 Hearing in Drosophila: development of Johnston's organ

and emerging parallels to vertebrate ear development. Dev Dyn 232, 550-8.
 150

Bossing, T., Udolph, G., Doe, C. Q. & Technau, G. M. 1996 The embryonic central
nervous system lineages of Drosophila melanogaster. I. Neuroblast lineages
derived from the ventral half of the neuroectoderm. Dev Biol 179, 41-64.

Boulland, J. L., Qureshi, T., Seal, R. P., Rafiki, A., Gundersen, V., Bergersen, L. H.,
Fremeau, R. T., Jr., Edwards, R. H., Storm-Mathisen, J. & Chaudhry, F. A.
2004 Expression of the vesicular glutamate transporters during development
indicates the widespread corelease of multiple neurotransmitters. J Comp
Neurol 480, 264-80.

Bourikas, D., Pekarik, V., Baeriswyl, T., Grunditz, A., Sadhu, R., Nardo, M. &
Stoeckli, E. T. 2005 Sonic hedgehog guides commissural axons along the
longitudinal axis of the spinal cord. Nat Neurosci 8, 297-304.

Brankatschk, M. & Dickson, B. J. 2006 Netrins guide Drosophila commissural

axons at short range. Nat Neurosci 9, 188-94.

Briscoe, J., Chen, Y., Jessell, T. M. & Struhl, G. 2001 A hedgehog-insensitive form
of patched provides evidence for direct long-range morphogen activity of
sonic hedgehog in the neural tube. Mol Cell 7, 1279-91.

Briscoe, J. & Ericson, J. 1999 The specification of neuronal identity by graded Sonic
Hedgehog signalling. Semin Cell Dev Biol 10, 353-62.

Briscoe, J. & Ericson, J. 2001 Specification of neuronal fates in the ventral neural
tube. Curr Opin Neurobiol 11, 43-9.

Briscoe, J., Pierani, A., Jessell, T. M. & Ericson, J. 2000 A homeodomain protein
code specifies progenitor cell identity and neuronal fate in the ventral neural
tube. Cell 101, 435-45.

Briscoe, J., Sussel, L., Serup, P., Hartigan-O'Connor, D., Jessell, T. M., Rubenstein,
J. L. & Ericson, J. 1999 Homeobox gene Nkx2.2 and specification of neuronal
identity by graded Sonic hedgehog signalling. Nature 398, 622-7.

Broihier, H. T. & Skeath, J. B. 2002 Drosophila homeodomain protein dHb9 directs

neuronal fate via crossrepressive and cell-nonautonomous mechanisms.
Neuron 35, 39-50.

Bullock, T. H. & Horridge, A. G. 1965 Structure and Function in the Nervous

Systems of Invertebrates.

Burke, R., Nellen, D., Bellotto, M., Hafen, E., Senti, K. A., Dickson, B. J. & Basler,
K. 1999 Dispatched, a novel sterol-sensing domain protein dedicated to the
release of cholesterol-modified hedgehog from signaling cells. Cell 99, 803-15.

Burrill, J. D., Moran, L., Goulding, M. D. & Saueressig, H. 1997 PAX2 is expressed
in multiple spinal cord interneurons, including a population of EN1+
 151

interneurons that require PAX6 for their development. Development 124,

4493-503.

Cai, J., Qi, Y., Hu, X., Tan, M., Liu, Z., Zhang, J., Li, Q., Sander, M. & Qiu, M.
2005 Generation of oligodendrocyte precursor cells from mouse dorsal spinal
cord independent of Nkx6 regulation and Shh signaling. Neuron 45, 41-53.

Caspary, T. & Anderson, K. V. 2003 Patterning cell types in the dorsal spinal cord:
what the mouse mutants say. Nat Rev Neurosci 4, 289-97.

Caspary, T., Larkins, C. E. & Anderson, K. V. 2007 The graded response to Sonic
Hedgehog depends on cilia architecture. Dev Cell 12, 767-78.

Chamoun, Z., Mann, R. K., Nellen, D., von Kessler, D. P., Bellotto, M., Beachy, P. A.
& Basler, K. 2001 Skinny hedgehog, an acyltransferase required for
palmitoylation and activity of the hedgehog signal. Science 293, 2080-4.

Charrier, J. B., Lapointe, F., Le Douarin, N. M. & Teillet, M. A. 2002 Dual origin of
the floor plate in the avian embryo. Development 129, 4785-96.

Charron, F., Stein, E., Jeong, J., McMahon, A. P. & Tessier-Lavigne, M. 2003 The
morphogen sonic hedgehog is an axonal chemoattractant that collaborates
with netrin-1 in midline axon guidance. Cell 113, 11-23.

Cheesman, S. E., Layden, M. J., Von Ohlen, T., Doe, C. Q. & Eisen, J. S. 2004
Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and
regulate motoneuron formation. Development 131, 5221-32.

Chen, J. K., Taipale, J., Cooper, M. K. & Beachy, P. A. 2002 Inhibition of Hedgehog
signaling by direct binding of cyclopamine to Smoothened. Genes Dev 16,
2743-8.

Chen, W., Aoki, C., Mahadomrongkul, V., Gruber, C. E., Wang, G. J., Blitzblau, R.,
Irwin, N. & Rosenberg, P. A. 2002 Expression of a variant form of the
glutamate transporter GLT1 in neuronal cultures and in neurons and
astrocytes in the rat brain. J Neurosci 22, 2142-52.

Chen, W., Burgess, S. & Hopkins, N. 2001 Analysis of the zebrafish smoothened
mutant reveals conserved and divergent functions of hedgehog activity.
Development 128, 2385-96.

Cheng, L., Chen, C. L., Luo, P., Tan, M., Qiu, M., Johnson, R. & Ma, Q. 2003
Lmx1b, Pet-1, and Nkx2.2 coordinately specify serotonergic
neurotransmitter phenotype. J Neurosci 23, 9961-7.

Chizhikov, V. V. & Millen, K. J. 2004 Control of roof plate development and

signaling by Lmx1b in the caudal vertebrate CNS. J Neurosci 24, 5694-703.
 152

Chizhikov, V. V. & Millen, K. J. 2004 Mechanisms of roof plate formation in the

vertebrate CNS. Nat Rev Neurosci 5, 808-12.

Chizhikov, V. V. & Millen, K. J. 2005 Roof plate-dependent patterning of the

vertebrate dorsal central nervous system. Dev Biol 277, 287-95.

Chuang, P. T. & McMahon, A. P. 1999 Vertebrate Hedgehog signalling modulated

by induction of a Hedgehog-binding protein. Nature 397, 617-21.

Conway, M. S. 1998 The Crucible of Creation. The Burgess Shale and the Rise of
Animals.

Cooper, M. K., Porter, J. A., Young, K. E. & Beachy, P. A. 1998 Teratogen-

mediated inhibition of target tissue response to Shh signaling. Science 280,
1603-7.

Cornell, R. A. & Ohlen, T. V. 2000 Vnd/nkx, ind/gsh, and msh/msx: conserved

regulators of dorsoventral neural patterning? Curr Opin Neurobiol 10, 63-71.

Darras, S. & Nishida, H. 2001 The BMP/CHORDIN antagonism controls sensory

pigment cell specification and differentiation in the ascidian embryo. Dev
Biol 236, 271-88.

Dasen, J. S., Liu, J. P. & Jessell, T. M. 2003 Motor neuron columnar fate imposed
by sequential phases of Hox-c activity. Nature 425, 926-33.

Davis, G. K., D'Alessio, J. A. & Patel, N. H. 2005 Pax3/7 genes reveal conservation
and divergence in the arthropod segmentation hierarchy. Dev Biol 285, 169-
84.

de Jong, D. M., Hislop, N. R., Hayward, D. C., Reece-Hoyes, J. S., Pontynen, P. C.,
Ball, E. E. & Miller, D. J. 2006 Components of both major axial patterning
systems of the Bilateria are differentially expressed along the primary axis of
a 'radiate' animal, the anthozoan cnidarian Acropora millepora. Dev Biol
298, 632-43.

Denes, A. S., Jekely, G., Steinmetz, P. R., Raible, F., Snyman, H., Prud'homme, B.,
Ferrier, D. E., Balavoine, G. & Arendt, D. 2007 Molecular architecture of
annelid nerve cord supports common origin of nervous system centralization
in bilateria. Cell 129, 277-88.

Dewel, R. A. 2000 Colonial origin for Emetazoa: major morphological transitions

and the origin of bilaterian complexity. J Morphol 243, 35-74.

Dickson, B. J. & Gilestro, G. F. 2006 Regulation of commissural axon pathfinding

by slit and its Robo receptors. Annu Rev Cell Dev Biol 22, 651-75.
 153

Ding, Y. Q., Marklund, U., Yuan, W., Yin, J., Wegman, L., Ericson, J., Deneris, E.,
Johnson, R. L. & Chen, Z. F. 2003 Lmx1b is essential for the development of
serotonergic neurons. Nat Neurosci 6, 933-8.

Dorresteijn, A. W. C., O'Grady, B., Fischer, A., Porchet-Henere, E. and Boilly-

Marer, Y. 1993 Molecular specification of cell lines in the embryo of
Platynereis (Annelida). Roux's Arch. Dev. Biol. 202, 264-273.

Dorsett, D. A. 1965 Overlapping sensory fields of Nereis, and their possible role in
locomotion. Proc. Roy. Soc. B 164, 615-623.

Eiden, L. E. 1998 The cholinergic gene locus. J Neurochem 70, 2227-40.

Eisen, J. S. 1998 Genetic and molecular analyses of motoneuron development. Curr

Opin Neurobiol 8, 697-704.

Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S., Kawakami, A., van
Heyningen, V., Jessell, T. M. & Briscoe, J. 1997 Pax6 controls progenitor cell
identity and neuronal fate in response to graded Shh signaling. Cell 90, 169-
80.

Erwin, D. H. & Davidson, E. H. 2002 The last common bilaterian ancestor.

Development 129, 3021-32.

Esmaeili, B., Ross, J. M., Neades, C., Miller, D. M., 3rd & Ahringer, J. 2002 The C.
elegans even-skipped homologue, vab-7, specifies DB motoneurone identity
and axon trajectory. Development 129, 853-62.

Farese, R. V., Jr. & Herz, J. 1998 Cholesterol metabolism and embryogenesis.
Trends Genet 14, 115-20.

Fernandez-Chacon, R., Konigstorfer, A., Gerber, S. H., Garcia, J., Matos, M. F.,
Stevens, C. F., Brose, N., Rizo, J., Rosenmund, C. & Sudhof, T. C. 2001
Synaptotagmin I functions as a calcium regulator of release probability.
Nature 410, 41-9.

Ferrier, D. E., Brooke, N. M., Panopoulou, G. & Holland, P. W. 2001 The Mnx
homeobox gene class defined by HB9, MNR2 and amphioxus AmphiMnx.
Dev Genes Evol 211, 103-7.

Filippi, A., Tiso, N., Deflorian, G., Zecchin, E., Bortolussi, M. & Argenton, F. 2005
The basic helix-loop-helix olig3 establishes the neural plate boundary of the
trunk and is necessary for development of the dorsal spinal cord. Proc Natl
Acad Sci U S A 102, 4377-82.

Finnerty, J. R. 2003 The origins of axial patterning in the metazoa: how old is
bilateral symmetry? Int J Dev Biol 47, 523-9.
 154

Finnerty, J. R., Pang, K., Burton, P., Paulson, D. & Martindale, M. Q. 2004 Origins
of bilateral symmetry: Hox and dpp expression in a sea anemone. Science
304, 1335-7.

Fischer, A. & Dorresteijn, A. 2004 The polychaete Platynereis dumerilii (Annelida):

a laboratory animal with spiralian cleavage, lifelong segment proliferation
and a mixed benthic/pelagic life cycle. Bioessays 26, 314-25.

Fremeau, R. T., Jr., Voglmaier, S., Seal, R. P. & Edwards, R. H. 2004 VGLUTs
define subsets of excitatory neurons and suggest novel roles for glutamate.
Trends Neurosci 27, 98-103.

Fuccillo, M., Joyner, A. L. & Fishell, G. 2006 Morphogen to mitogen: the multiple
roles of hedgehog signalling in vertebrate neural development. Nat Rev
Neurosci 7, 772-83.

Garstang, W. 1928 The morphology of the Tunicata, and its bearing on the
phylogeny of the Chordata. Q. J. Microsc. Sci. 72, 51-187.

Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F. &
Sudhof, T. C. 1994 Synaptotagmin I: a major Ca2+ sensor for transmitter
release at a central synapse. Cell 79, 717-27.

Gerhart, J. 2000 Inversion of the chordate body axis: are there alternatives? Proc
Natl Acad Sci U S A 97, 4445-8.

Gerhart, J., Lowe, C. & Kirschner, M. 2005 Hemichordates and the origin of
chordates. Curr Opin Genet Dev 15, 461-7.

Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert, P. J., Odom, R. &
Johnson, J. E. 2001 Crossinhibitory activities of Ngn1 and Math1 allow
specification of distinct dorsal interneurons. Neuron 31, 219-32.

Gras, C., Herzog, E., Bellenchi, G. C., Bernard, V., Ravassard, P., Pohl, M.,
Gasnier, B., Giros, B. & El Mestikawy, S. 2002 A third vesicular glutamate
transporter expressed by cholinergic and serotoninergic neurons. J Neurosci
22, 5442-51.

Gross, M. K., Dottori, M. & Goulding, M. 2002 Lbx1 specifies somatosensory

association interneurons in the dorsal spinal cord. Neuron 34, 535-49.

Guerrero, I. & Chiang, C. 2007 A conserved mechanism of Hedgehog gradient

formation by lipid modifications. Trends Cell Biol 17, 1-5.

Hadrys, T., DeSalle, R., Sagasser, S., Fischer, N. & Schierwater, B. 2005 The
Trichoplax PaxB gene: a putative Proto-PaxA/B/C gene predating the origin
of nerve and sensory cells. Mol Biol Evol 22, 1569-78.
 155

Harland, R. & Gerhart, J. 1997 Formation and function of Spemann's organizer.

Annu Rev Cell Dev Biol 13, 611-67.

Helms, A. W., Battiste, J., Henke, R. M., Nakada, Y., Simplicio, N., Guillemot, F. &
Johnson, J. E. 2005 Sequential roles for Mash1 and Ngn2 in the generation of
dorsal spinal cord interneurons. Development 132, 2709-19.

Helms, A. W. & Johnson, J. E. 1998 Progenitors of dorsal commissural interneurons

are defined by MATH1 expression. Development 125, 919-28.

Helms, A. W. & Johnson, J. E. 2003 Specification of dorsal spinal cord

interneurons. Curr Opin Neurobiol 13, 42-9.

Herzog, E., Landry, M., Buhler, E., Bouali-Benazzouz, R., Legay, C., Henderson, C.
E., Nagy, F., Dreyfus, P., Giros, B. & El Mestikawy, S. 2004 Expression of
vesicular glutamate transporters, VGLUT1 and VGLUT2, in cholinergic
spinal motoneurons. Eur J Neurosci 20, 1752-60.

Higashijima, S., Mandel, G. & Fetcho, J. R. 2004 Distribution of prospective

glutamatergic, glycinergic, and GABAergic neurons in embryonic and larval
zebrafish. J Comp Neurol 480, 1-18.

Higashijima, S., Masino, M. A., Mandel, G. & Fetcho, J. R. 2004 Engrailed-1

expression marks a primitive class of inhibitory spinal interneuron. J
Neurosci 24, 5827-39.

Holland, N. D. 2003 Early central nervous system evolution: an era of skin brains?
Nat Rev Neurosci 4, 617-27.

Huangfu, D. & Anderson, K. V. 2006 Signaling from Smo to Ci/Gli: conservation

and divergence of Hedgehog pathways from Drosophila to vertebrates.
Development 133, 3-14.

Hudson, C. & Lemaire, P. 2001 Induction of anterior neural fates in the ascidian
Ciona intestinalis. Mech Dev 100, 189-203.

Hyde, W. T., Crowley, T. J., Baum, S. K. & Peltier, W. R. 2000 Neoproterozoic

'snowball Earth' simulations with a coupled climate/ice-sheet model. Nature
405, 425-9.

Isshiki, T., Takeichi, M. & Nose, A. 1997 The role of the msh homeobox gene during
Drosophila neurogenesis: implication for the dorsoventral specification of the
neuroectoderm. Development 124, 3099-109.

Jekely, G. & Arendt, D. 2007 Cellular resolution expression profiling using confocal
detection of NBT/BCIP precipitate by reflection microscopy. Biotechniques
42, 751-5.
 156

Jen, J. C., Chan, W. M., Bosley, T. M., Wan, J., Carr, J. R., Rub, U., Shattuck, D.,
Salamon, G., Kudo, L. C., Ou, J., Lin, D. D., Salih, M. A., Kansu, T., Al
Dhalaan, H., Al Zayed, Z., MacDonald, D. B., Stigsby, B., Plaitakis, A.,
Dretakis, E. K., Gottlob, I., Pieh, C., Traboulsi, E. I., Wang, Q., Wang, L.,
Andrews, C., Yamada, K., Demer, J. L., Karim, S., Alger, J. R., Geschwind,
D. H., Deller, T., Sicotte, N. L., Nelson, S. F., Baloh, R. W. & Engle, E. C.
2004 Mutations in a human ROBO gene disrupt hindbrain axon pathway
crossing and morphogenesis. Science 304, 1509-13.

Jeong, Y. & Epstein, D. J. 2003 Distinct regulators of Shh transcription in the floor
plate and notochord indicate separate origins for these tissues in the mouse
node. Development 130, 3891-902.

Jessell, T. M. 2000 Neuronal specification in the spinal cord: inductive signals and
transcriptional codes. Nat Rev Genet 1, 20-9.

Jurata, L. W., Thomas, J. B. & Pfaff, S. L. 2000 Transcriptional mechanisms in the

development of motor control. Curr Opin Neurobiol 10, 72-9.

Kamm, K., Schierwater, B., Jakob, W., Dellaporta, S. L. & Miller, D. J. 2006 Axial
patterning and diversification in the cnidaria predate the Hox system. Curr
Biol 16, 920-6.

Karnovsky, M. J., and Roots, L. 1964 A "direct-coloring" thiocholine method for

cholinesterases. J. Histochem. Cytochem. 12, 219-221.

Keleman, K., Ribeiro, C. & Dickson, B. J. 2005 Comm function in commissural

axon guidance: cell-autonomous sorting of Robo in vivo. Nat Neurosci 8, 156-
63.

Kennedy, T. E., Wang, H., Marshall, W. & Tessier-Lavigne, M. 2006 Axon guidance
by diffusible chemoattractants: a gradient of netrin protein in the developing
spinal cord. J Neurosci 26, 8866-74.

Kiehn, O. 2006 Locomotor circuits in the mammalian spinal cord. Annu Rev
Neurosci 29, 279-306.

Kim, I. O., Kim, I. C., Kim, S., Kwon, Y. K., Han, P. L., Jeon, S. H. & Kim, S. H.
2005 CNS midline cells contribute to maintenance of the initial dorsoventral
patterning of the Drosophila ventral neuroectoderm. J Neurobiol 62, 397-405.

Kim, S. H., Kim, H. J., Kim, S. Y., Jeon, S. H. & Kim, S. H. 2007 CNS midline cells
influence the division and survival of lateral glia in the Drosophila nervous
system. Genesis 45, 266-74.

Klingensmith, J., Ang, S. L., Bachiller, D. & Rossant, J. 1999 Neural induction and
patterning in the mouse in the absence of the node and its derivatives. Dev
Biol 216, 535-49.
 157

Kriks, S., Lanuza, G. M., Mizuguchi, R., Nakafuku, M. & Goulding, M. 2005 Gsh2
is required for the repression of Ngn1 and specification of dorsal interneuron
fate in the spinal cord. Development 132, 2991-3002.

Kurokawa, D., Takasaki, N., Kiyonari, H., Nakayama, R., Kimura-Yoshida, C.,
Matsuo, I. & Aizawa, S. 2004 Regulation of Otx2 expression and its functions
in mouse epiblast and anterior neuroectoderm. Development 131, 3307-17.

Kusserow, A., Pang, K., Sturm, C., Hrouda, M., Lentfer, J., Schmidt, H. A.,
Technau, U., von Haeseler, A., Hobmayer, B., Martindale, M. Q. & Holstein,
T. W. 2005 Unexpected complexity of the Wnt gene family in a sea anemone.
Nature 433, 156-60.

Lacalli, T. C. 2001 New perspectives on the evolution of protochordate sensory and

locomotory systems, and the origin of brains and heads. Philos Trans R Soc
Lond B Biol Sci 356, 1565-72.

Landgraf, M. & Thor, S. 2006 Development and structure of motoneurons. Int Rev
Neurobiol 75, 33-53.

Lee, J. D. & Treisman, J. E. 2001 Sightless has homology to transmembrane

acyltransferases and is required to generate active Hedgehog protein. Curr
Biol 11, 1147-52.

Lee, K. J., Dietrich, P. & Jessell, T. M. 2000 Genetic ablation reveals that the roof
plate is essential for dorsal interneuron specification. Nature 403, 734-40.

Lee, S. K., Lee, B., Ruiz, E. C. & Pfaff, S. L. 2005 Olig2 and Ngn2 function in
opposition to modulate gene expression in motor neuron progenitor cells.
Genes Dev 19, 282-94.

Levine, A. J. & Brivanlou, A. H. 2007 Proposal of a model of mammalian neural

induction. Dev Biol.

Lewis, P. M., Dunn, M. P., McMahon, J. A., Logan, M., Martin, J. F., St-Jacques, B.
& McMahon, A. P. 2001 Cholesterol modification of sonic hedgehog is
required for long-range signaling activity and effective modulation of
signaling by Ptc1. Cell 105, 599-612.

Li, W. C., Higashijima, S., Parry, D. M., Roberts, A. & Soffe, S. R. 2004 Primitive
roles for inhibitory interneurons in developing frog spinal cord. J Neurosci
24, 5840-8.

Liu, Y., Helms, A. W. & Johnson, J. E. 2004 Distinct activities of Msx1 and Msx3 in
dorsal neural tube development. Development 131, 1017-28.

Long, H., Sabatier, C., Ma, L., Plump, A., Yuan, W., Ornitz, D. M., Tamada, A.,
Murakami, F., Goodman, C. S. & Tessier-Lavigne, M. 2004 Conserved roles
 158

for Slit and Robo proteins in midline commissural axon guidance. Neuron 42,
213-23.

Lopez, S. L., Paganelli, A. R., Siri, M. V., Ocana, O. H., Franco, P. G. & Carrasco,
A. E. 2003 Notch activates sonic hedgehog and both are involved in the
specification of dorsal midline cell-fates in Xenopus. Development 130, 2225-
38.

Lowe, C. J., Terasaki, M., Wu, M., Freeman, R. M., Jr., Runft, L., Kwan, K., Haigo,
S., Aronowicz, J., Lander, E., Gruber, C., Smith, M., Kirschner, M. &
Gerhart, J. 2006 Dorsoventral patterning in hemichordates: insights into
early chordate evolution. PLoS Biol 4, e291.

Lowe, C. J., Wu, M., Salic, A., Evans, L., Lander, E., Stange-Thomann, N., Gruber,
C. E., Gerhart, J. & Kirschner, M. 2003 Anteroposterior patterning in
hemichordates and the origins of the chordate nervous system. Cell 113, 853-
65.

Lu, Q. R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C. D. & Rowitch, D. H. 2002
Common developmental requirement for Olig function indicates a motor
neuron/oligodendrocyte connection. Cell 109, 75-86.

Lum, L. & Beachy, P. A. 2004 The Hedgehog response network: sensors, switches,
and routers. Science 304, 1755-9.

Mann, R. K. & Beachy, P. A. 2004 Novel lipid modifications of secreted protein

signals. Annu Rev Biochem 73, 891-923.

Marigo, V. & Tabin, C. J. 1996 Regulation of patched by sonic hedgehog in the

developing neural tube. Proc Natl Acad Sci U S A 93, 9346-51.

Martindale, M. Q., Finnerty, J. R. & Henry, J. Q. 2002 The Radiata and the
evolutionary origins of the bilaterian body plan. Mol Phylogenet Evol 24, 358-
65.

Matise, M. P., Lustig, M., Sakurai, T., Grumet, M. & Joyner, A. L. 1999 Ventral
midline cells are required for the local control of commissural axon guidance
in the mouse spinal cord. Development 126, 3649-59.

Matus, D. Q., Pang, K., Daly, M. & Martindale, M. Q. 2007 Expression of Pax gene
family members in the anthozoan cnidarian, Nematostella vectensis. Evol Dev
9, 25-38.

Matus, D. Q., Pang, K., Marlow, H., Dunn, C. W., Thomsen, G. H. & Martindale,
M. Q. 2006 Molecular evidence for deep evolutionary roots of bilaterality in
animal development. Proc Natl Acad Sci U S A 103, 11195-200.
 159

Matus, D. Q., Thomsen, G. H. & Martindale, M. Q. 2006 Dorso/ventral genes are

asymmetrically expressed and involved in germ-layer demarcation during
cnidarian gastrulation. Curr Biol 16, 499-505.

McDonald, J. A., Holbrook, S., Isshiki, T., Weiss, J., Doe, C. Q. & Mellerick, D. M.
1998 Dorsoventral patterning in the Drosophila central nervous system: the
vnd homeobox gene specifies ventral column identity. Genes Dev 12, 3603-12.

Medina, M., Collins, A. G., Silberman, J. D. & Sogin, M. L. 2001 Evaluating

hypotheses of basal animal phylogeny using complete sequences of large and
small subunit rRNA. Proc Natl Acad Sci U S A 98, 9707-12.

Megason, S. G. & McMahon, A. P. 2002 A mitogen gradient of dorsal midline Wnts

organizes growth in the CNS. Development 129, 2087-98.

Miljkovic-Licina, M., Gauchat, D. & Galliot, B. 2004 Neuronal evolution: analysis of

regulatory genes in a first-evolved nervous system, the hydra nervous system.
Biosystems 76, 75-87.

Miller, D. J., Hayward, D. C., Reece-Hoyes, J. S., Scholten, I., Catmull, J., Gehring,
W. J., Callaerts, P., Larsen, J. E. & Ball, E. E. 2000 Pax gene diversity in the
basal cnidarian Acropora millepora (Cnidaria, Anthozoa): implications for
the evolution of the Pax gene family. Proc Natl Acad Sci U S A 97, 4475-80.

Mizutani, C. M., Meyer, N., Roelink, H. & Bier, E. 2006 Threshold-dependent BMP-
mediated repression: a model for a conserved mechanism that patterns the
neuroectoderm. PLoS Biol 4, e313.

Mizutani, C. M., Nie, Q., Wan, F. Y., Zhang, Y. T., Vilmos, P., Sousa-Neves, R.,
Bier, E., Marsh, J. L. & Lander, A. D. 2005 Formation of the BMP activity
gradient in the Drosophila embryo. Dev Cell 8, 915-24.

Moran-Rivard, L., Kagawa, T., Saueressig, H., Gross, M. K., Burrill, J. & Goulding,
M. 2001 Evx1 is a postmitotic determinant of v0 interneuron identity in the
spinal cord. Neuron 29, 385-99.

Muller, T., Anlag, K., Wildner, H., Britsch, S., Treier, M. & Birchmeier, C. 2005
The bHLH factor Olig3 coordinates the specification of dorsal neurons in the
spinal cord. Genes Dev 19, 733-43.

Muller, T., Brohmann, H., Pierani, A., Heppenstall, P. A., Lewin, G. R., Jessell, T.
M. & Birchmeier, C. 2002 The homeodomain factor lbx1 distinguishes two
major programs of neuronal differentiation in the dorsal spinal cord. Neuron
34, 551-62.

Nederbragt, A. J., van Loon, A. E. & Dictus, W. J. 2002 Evolutionary biology:

hedgehog crosses the snail's midline. Nature 417, 811-2.
 160

Nguyen, V. H., Trout, J., Connors, S. A., Andermann, P., Weinberg, E. & Mullins,
M. C. 2000 Dorsal and intermediate neuronal cell types of the spinal cord are
established by a BMP signaling pathway. Development 127, 1209-20.

Niehrs, C. 2004 Regionally specific induction by the Spemann-Mangold organizer.

Nat Rev Genet 5, 425-34.

Niehrs, C. 2005 Axis formation: redundancy rules. Curr Biol 15, R391-3.

Nielsen, C. 1999 Origin of the chordate central nervous system - and the origin of
chordates. Dev Genes Evol 209, 198-205.

Nishimaru, H., Restrepo, C. E., Ryge, J., Yanagawa, Y. & Kiehn, O. 2005
Mammalian motor neurons corelease glutamate and acetylcholine at central
synapses. Proc Natl Acad Sci U S A 102, 5245-9.

Nusse, R. 2003 Wnts and Hedgehogs: lipid-modified proteins and similarities in

signaling mechanisms at the cell surface. Development 130, 5297-305.

Odenthal, J., van Eeden, F. J., Haffter, P., Ingham, P. W. & Nusslein-Volhard, C.
2000 Two distinct cell populations in the floor plate of the zebrafish are
induced by different pathways. Dev Biol 219, 350-63.

Patel, N. H., Kornberg, T. B. & Goodman, C. S. 1989 Expression of engrailed

during segmentation in grasshopper and crayfish. Development 107, 201-12.

Patten, I., Kulesa, P., Shen, M. M., Fraser, S. & Placzek, M. 2003 Distinct modes of
floor plate induction in the chick embryo. Development 130, 4809-21.

Pattyn, A., Simplicio, N., van Doorninck, J. H., Goridis, C., Guillemot, F. & Brunet,
J. F. 2004 Ascl1/Mash1 is required for the development of central
serotonergic neurons. Nat Neurosci 7, 589-95.

Pattyn, A., Vallstedt, A., Dias, J. M., Sander, M. & Ericson, J. 2003 Complementary
roles for Nkx6 and Nkx2 class proteins in the establishment of motoneuron
identity in the hindbrain. Development 130, 4149-59.

Pepinsky, R. B., Zeng, C., Wen, D., Rayhorn, P., Baker, D. P., Williams, K. P.,
Bixler, S. A., Ambrose, C. M., Garber, E. A., Miatkowski, K., Taylor, F. R.,
Wang, E. A. & Galdes, A. 1998 Identification of a palmitic acid-modified
form of human Sonic hedgehog. J Biol Chem 273, 14037-45.

Peterson, K. J. & Eernisse, D. J. 2001 Animal phylogeny and the ancestry of

bilaterians: inferences from morphology and 18S rDNA gene sequences. Evol
Dev 3, 170-205.
 161

Peterson, K. J., Lyons, J. B., Nowak, K. S., Takacs, C. M., Wargo, M. J. & McPeek,
M. A. 2004 Estimating metazoan divergence times with a molecular clock.
Proc Natl Acad Sci U S A 101, 6536-41.

Pfaff, S. L., Mendelsohn, M., Stewart, C. L., Edlund, T. & Jessell, T. M. 1996
Requirement for LIM homeobox gene Isl1 in motor neuron generation
reveals a motor neuron-dependent step in interneuron differentiation. Cell
84, 309-20.

Philippe, H., Lartillot, N. & Brinkmann, H. 2005 Multigene analyses of bilaterian

animals corroborate the monophyly of Ecdysozoa, Lophotrochozoa, and
Protostomia. Mol Biol Evol 22, 1246-53.

Pierani, A., Moran-Rivard, L., Sunshine, M. J., Littman, D. R., Goulding, M. &
Jessell, T. M. 2001 Control of interneuron fate in the developing spinal cord
by the progenitor homeodomain protein Dbx1. Neuron 29, 367-84.

Placzek, M., Dodd, J. & Jessell, T. M. 2000 Discussion point. The case for floor plate
induction by the notochord. Curr Opin Neurobiol 10, 15-22.

Porter, J. A., von Kessler, D. P., Ekker, S. C., Young, K. E., Lee, J. J., Moses, K. &
Beachy, P. A. 1995 The product of hedgehog autoproteolytic cleavage active
in local and long-range signalling. Nature 374, 363-6.

Porter, J. A., Young, K. E. & Beachy, P. A. 1996 Cholesterol modification of

hedgehog signaling proteins in animal development. Science 274, 255-9.

Putnam, N. H., Srivastava, M., Hellsten, U., Dirks, B., Chapman, J., Salamov, A.,
Terry, A., Shapiro, H., Lindquist, E., Kapitonov, V. V., Jurka, J.,
Genikhovich, G., Grigoriev, I. V., Lucas, S. M., Steele, R. E., Finnerty, J. R.,
Technau, U., Martindale, M. Q. & Rokhsar, D. S. 2007 Sea anemone genome
reveals ancestral eumetazoan gene repertoire and genomic organization.
Science 317, 86-94.

Raible, F., Tessmar-Raible, K., Osoegawa, K., Wincker, P., Jubin, C., Balavoine, G.,
Ferrier, D., Benes, V., de Jong, P., Weissenbach, J., Bork, P. & Arendt, D.
2005 Vertebrate-type intron-rich genes in the marine annelid Platynereis
dumerilii. Science 310, 1325-6.

Ramos, C. & Robert, B. 2005 msh/Msx gene family in neural development. Trends
Genet 21, 624-32.

Reiter, J. F. & Skarnes, W. C. 2006 Tectonic, a novel regulator of the Hedgehog

pathway required for both activation and inhibition. Genes Dev 20, 22-7.

Rentzsch, F., Anton, R., Saina, M., Hammerschmidt, M., Holstein, T. W. &
Technau, U. 2006 Asymmetric expression of the BMP antagonists chordin
 162

and gremlin in the sea anemone Nematostella vectensis: implications for the
evolution of axial patterning. Dev Biol 296, 375-87.

Rohatgi, R., Milenkovic, L. & Scott, M. P. 2007 Patched1 regulates hedgehog

signaling at the primary cilium. Science 317, 372-6.

Roth, S. 2003 The origin of dorsoventral polarity in Drosophila. Philos Trans R Soc
Lond B Biol Sci 358, 1317-29; discussion 1329.

Ruiz-Trillo, I., Riutort, M., Littlewood, D. T., Herniou, E. A. & Baguna, J. 1999
Acoel flatworms: earliest extant bilaterian Metazoans, not members of
Platyhelminthes. Science 283, 1919-23.

Rusten, T. E., Cantera, R., Kafatos, F. C. & Barrio, R. 2002 The role of TGF beta
signaling in the formation of the dorsal nervous system is conserved between
Drosophila and chordates. Development 129, 3575-84.

Ryan, J. F., Mazza, M. E., Pang, K., Matus, D. Q., Baxevanis, A. D., Martindale, M.
Q. & Finnerty, J. R. 2007 Pre-bilaterian origins of the Hox cluster and the
Hox code: evidence from the sea anemone, Nematostella vectensis. PLoS
ONE 2, e153.

Sabatier, C., Plump, A. S., Le, M., Brose, K., Tamada, A., Murakami, F., Lee, E. Y.
& Tessier-Lavigne, M. 2004 The divergent Robo family protein rig-1/Robo3
is a negative regulator of slit responsiveness required for midline crossing by
commissural axons. Cell 117, 157-69.

Salinas, P. C. 2003 The morphogen sonic hedgehog collaborates with netrin-1 to

guide axons in the spinal cord. Trends Neurosci 26, 641-3.

Sasai, Y., Lu, B., Steinbeisser, H. & De Robertis, E. M. 1995 Regulation of neural
induction by the Chd and Bmp-4 antagonistic patterning signals in Xenopus.
Nature 376, 333-6.

Sasaki, H. & Hogan, B. L. 1994 HNF-3 beta as a regulator of floor plate

development. Cell 76, 103-15.

Saueressig, H., Burrill, J. & Goulding, M. 1999 Engrailed-1 and netrin-1 regulate
axon pathfinding by association interneurons that project to motor neurons.
Development 126, 4201-12.

Schafer, M., Kinzel, D. & Winkler, C. 2007 Discontinuous organization and

specification of the lateral floor plate in zebrafish. Dev Biol 301, 117-29.

Schafer, M. K., Weihe, E., Erickson, J. D. & Eiden, L. E. 1995 Human and monkey
cholinergic neurons visualized in paraffin-embedded tissues by
immunoreactivity for VAChT, the vesicular acetylcholine transporter. J Mol
Neurosci 6, 225-35.
 163

Schmid, A., Chiba, A. & Doe, C. Q. 1999 Clonal analysis of Drosophila embryonic
neuroblasts: neural cell types, axon projections and muscle targets.
Development 126, 4653-89.

Seher, T. C., Narasimha, M., Vogelsang, E. & Leptin, M. 2007 Analysis and
reconstitution of the genetic cascade controlling early mesoderm
morphogenesis in the Drosophila embryo. Mech Dev 124, 167-79.

Shimeld, S. 2000 An amphioxus netrin gene is expressed in midline structures

during embryonic and larval development. Dev Genes Evol 210, 337-44.

Shimeld, S. M. 1999 The evolution of the hedgehog gene family in chordates:

insights from amphioxus hedgehog. Dev Genes Evol 209, 40-7.

Siegler, M. V. & Jia, X. X. 1999 Engrailed negatively regulates the expression of cell
adhesion molecules connectin and neuroglian in embryonic Drosophila
nervous system. Neuron 22, 265-76.

Siegler, M. V. & Pankhaniya, R. R. 1997 Engrailed protein is expressed in

interneurons but not motor neurons of the dorsal unpaired median group in
the adult grasshopper. J Comp Neurol 388, 658-68.

Skeath, J. B. 1998 The Drosophila EGF receptor controls the formation and
specification of neuroblasts along the dorsal-ventral axis of the Drosophila
embryo. Development 125, 3301-12.

Skeath, J. B., Zhang, Y., Holmgren, R., Carroll, S. B. & Doe, C. Q. 1995
Specification of neuroblast identity in the Drosophila embryonic central
nervous system by gooseberry-distal. Nature 376, 427-30.

Skinner, F. K. & Mulloney, B. 1998 Intersegmental coordination in invertebrates

and vertebrates. Curr Opin Neurobiol 8, 725-32.

Slack, J. M., Holland, P. W. & Graham, C. F. 1993 The zootype and the phylotypic
stage. Nature 361, 490-2.

Smith, W. C. & Harland, R. M. 1992 Expression cloning of noggin, a new

dorsalizing factor localized to the Spemann organizer in Xenopus embryos.
Cell 70, 829-40.

Soller, M. & White, K. 2004 Elav. Curr Biol 14, R53.

Spemann, H. & Mangold, H. 1924 Über Induktion von Embryonalanlagen durch

Implantation artfremder Organisatoren. Roux's Arch. EntwMech. Org. 100,
599-638.

St Johnston, D. & Nusslein-Volhard, C. 1992 The origin of pattern and polarity in

the Drosophila embryo. Cell 68, 201-19.
 164

Steinmetz, P. R., Zelada-Gonzales, F., Burgtorf, C., Wittbrodt, J. & Arendt, D. 2007
Polychaete trunk neuroectoderm converges and extends by mediolateral cell
intercalation. Proc Natl Acad Sci U S A 104, 2727-32.

Stern, C. D. 2005 Neural induction: old problem, new findings, yet more questions.
Development 132, 2007-21.

Taipale, J., Cooper, M. K., Maiti, T. & Beachy, P. A. 2002 Patched acts catalytically
to suppress the activity of Smoothened. Nature 418, 892-7.

Takahashi, M. & Osumi, N. 2002 Pax6 regulates specification of ventral neurone

subtypes in the hindbrain by establishing progenitor domains. Development
129, 1327-38.

Takebayashi, H., Nabeshima, Y., Yoshida, S., Chisaka, O., Ikenaka, K. &
Nabeshima, Y. 2002 The basic helix-loop-helix factor olig2 is essential for the
development of motoneuron and oligodendrocyte lineages. Curr Biol 12,
1157-63.

Tanabe, Y., William, C. & Jessell, T. M. 1998 Specification of motor neuron identity
by the MNR2 homeodomain protein. Cell 95, 67-80.

Taylor, F. R., Wen, D., Garber, E. A., Carmillo, A. N., Baker, D. P., Arduini, R. M.,
Williams, K. P., Weinreb, P. H., Rayhorn, P., Hronowski, X., Whitty, A.,
Day, E. S., Boriack-Sjodin, A., Shapiro, R. I., Galdes, A. & Pepinsky, R. B.
2001 Enhanced potency of human Sonic hedgehog by hydrophobic
modification. Biochemistry 40, 4359-71.

Teillet, M. A., Lapointe, F. & Le Douarin, N. M. 1998 The relationships between

notochord and floor plate in vertebrate development revisited. Proc Natl
Acad Sci U S A 95, 11733-8.

Tessmar-Raible, K. & Arendt, D. 2003 Emerging systems: between vertebrates and

arthropods, the Lophotrochozoa. Curr Opin Genet Dev 13, 331-40.

Tessmar-Raible, K., Steinmetz, P. R., Snyman, H., Hassel, M. & Arendt, D. 2005
Fluorescent two-color whole mount in situ hybridization in Platynereis
dumerilii (Polychaeta, Annelida), an emerging marine molecular model for
evolution and development. Biotechniques 39, 460, 462, 464.

Thaler, J., Harrison, K., Sharma, K., Lettieri, K., Kehrl, J. & Pfaff, S. L. 1999
Active suppression of interneuron programs within developing motor
neurons revealed by analysis of homeodomain factor HB9. Neuron 23, 675-
87.

Thaler, J. P., Koo, S. J., Kania, A., Lettieri, K., Andrews, S., Cox, C., Jessell, T. M.
& Pfaff, S. L. 2004 A postmitotic role for Isl-class LIM homeodomain
 165

proteins in the assignment of visceral spinal motor neuron identity. Neuron

41, 337-50.

Thaler, J. P., Lee, S. K., Jurata, L. W., Gill, G. N. & Pfaff, S. L. 2002 LIM factor
Lhx3 contributes to the specification of motor neuron and interneuron
identity through cell-type-specific protein-protein interactions. Cell 110, 237-
49.

Thor, S., Andersson, S. G., Tomlinson, A. & Thomas, J. B. 1999 A LIM-

homeodomain combinatorial code for motor-neuron pathway selection.
Nature 397, 76-80.

Thor, S. & Thomas, J. 2002 Motor neuron specification in worms, flies and mice:
conserved and 'lost' mechanisms. Curr Opin Genet Dev 12, 558-64.

Thor, S. & Thomas, J. B. 1997 The Drosophila islet gene governs axon pathfinding
and neurotransmitter identity. Neuron 18, 397-409.

Timmer, J. R., Wang, C. & Niswander, L. 2002 BMP signaling patterns the dorsal
and intermediate neural tube via regulation of homeobox and helix-loop-
helix transcription factors. Development 129, 2459-72.

Valentine, J. W., Jablonski, D. & Erwin, D. H. 1999 Fossils, molecules and embryos:
new perspectives on the Cambrian explosion. Development 126, 851-9.

Vallstedt, A., Muhr, J., Pattyn, A., Pierani, A., Mendelsohn, M., Sander, M., Jessell,
T. M. & Ericson, J. 2001 Different levels of repressor activity assign
redundant and specific roles to Nkx6 genes in motor neuron and interneuron
specification. Neuron 31, 743-55.

van Meyel, D. J., O'Keefe, D. D., Thor, S., Jurata, L. W., Gill, G. N. & Thomas, J. B.
2000 Chip is an essential cofactor for apterous in the regulation of axon
guidance in Drosophila. Development 127, 1823-31.

Vinay, L., Brocard, F., Clarac, F., Norreel, J. C., Pearlstein, E. & Pflieger, J. F. 2002
Development of posture and locomotion: an interplay of endogenously
generated activities and neurotrophic actions by descending pathways. Brain
Res Brain Res Rev 40, 118-29.

Voigt, O., Collins, A. G., Pearse, V. B., Pearse, J. S., Ender, A., Hadrys, H. &
Schierwater, B. 2004 Placozoa -- no longer a phylum of one. Curr Biol 14,
R944-5.

von Ohlen, T. & Doe, C. Q. 2000 Convergence of dorsal, dpp, and egfr signaling
pathways subdivides the drosophila neuroectoderm into three dorsal-ventral
columns. Dev Biol 224, 362-72.
 166

Wang, B., Fallon, J. F. & Beachy, P. A. 2000 Hedgehog-regulated processing of Gli3

produces an anterior/posterior repressor gradient in the developing
vertebrate limb. Cell 100, 423-34.

Weiss, J. B., Von Ohlen, T., Mellerick, D. M., Dressler, G., Doe, C. Q. & Scott, M. P.
1998 Dorsoventral patterning in the Drosophila central nervous system: the
intermediate neuroblasts defective homeobox gene specifies intermediate
column identity. Genes Dev 12, 3591-602.

Westfall, J. A., Elliott, C. F. & Carlin, R. W. 2002 Ultrastructural evidence for two-
cell and three-cell neural pathways in the tentacle epidermis of the sea
anemone Aiptasia pallida. J Morphol 251, 83-92.

Wheeler, S. R., Carrico, M. L., Wilson, B. A. & Skeath, J. B. 2005 The Tribolium
columnar genes reveal conservation and plasticity in neural precursor
patterning along the embryonic dorsal-ventral axis. Dev Biol 279, 491-500.

Wilson, L., Gale, E., Chambers, D. & Maden, M. 2004 Retinoic acid and the control
of dorsoventral patterning in the avian spinal cord. Dev Biol 269, 433-46.

Wilson, L. & Maden, M. 2005 The mechanisms of dorsoventral patterning in the

vertebrate neural tube. Dev Biol 282, 1-13.

Wilson, S. I., Graziano, E., Harland, R., Jessell, T. M. & Edlund, T. 2000 An early
requirement for FGF signalling in the acquisition of neural cell fate in the
chick embryo. Curr Biol 10, 421-9.

Wilson, S. I., Rydstrom, A., Trimborn, T., Willert, K., Nusse, R., Jessell, T. M. &
Edlund, T. 2001 The status of Wnt signalling regulates neural and epidermal
fates in the chick embryo. Nature 411, 325-30.

Woods, C. G. 2004 Neuroscience. Crossing the midline. Science 304, 1455-6.

Yu, J. K., Satou, Y., Holland, N. D., Shin, I. T., Kohara, Y., Satoh, N., Bronner-
Fraser, M. & Holland, L. Z. 2007 Axial patterning in cephalochordates and
the evolution of the organizer. Nature 445, 613-7.

Zechner, D., Muller, T., Wende, H., Walther, I., Taketo, M. M., Crenshaw, E. B.,
3rd, Treier, M., Birchmeier, W. & Birchmeier, C. 2007 Bmp and Wnt/beta-
catenin signals control expression of the transcription factor Olig3 and the
specification of spinal cord neurons. Dev Biol 303, 181-90.

Zhao, Z. Q., Scott, M., Chiechio, S., Wang, J. S., Renner, K. J., Gereau, R. W. t.,
Johnson, R. L., Deneris, E. S. & Chen, Z. F. 2006 Lmx1b is required for
maintenance of central serotonergic neurons and mice lacking central
serotonergic system exhibit normal locomotor activity. J Neurosci 26, 12781-
8.
 167

Zinzen, R. P., Cande, J., Ronshaugen, M., Papatsenko, D. & Levine, M. 2006
Evolution of the ventral midline in insect embryos. Dev Cell 11, 895-902.
 168

6 APPENDIX
 169

6.1 Sequence alignments and phylogenetic trees of the

cloned Platynereis genes
The protein sequences were aligned with those from other species using the ClustalX
program, in order to identify the most conserved regions. Within these I have placed
degenerated primers, and cloned short fragments that were later elongated through 3’
amd 5’ RACE reactions. The identity of the obtained sequence was verified by
constructing phylogenetic trees with the software included in the ClustalX package.

6.1.1 The hb9 gene

170
 171

6.1.2 The nk6 gene

172
 173

6.1.3 The dbx gene

174
 175

6.1.4 The gsx gene

176
 177

6.1.5 The msx gene

178
 179

6.1.6 The ChAT gene

180
181
182
 183

6.1.7 The GAD gene

184
185
 186

6.1.8 The VGLUT gene

187
188
 189

6.2 The glossary of species abbreviation

Aca- Aplysia californica

Ago- Aphis gossypii (Aphid)
Ath- Arabidopsis thaliana
Ame- Apis melifera
Amex- Ambystoma mexicanum
Bbe- Branchiostoma belcheri
Bfl- Branchiostoma floridae
Bmo- Bombyx mori
Cau- Carassius auratus
Cbr- Caenorhabditis briggsae
Cca- Capitella capitata
Ccr- Caiman crocodilus
Cel- Caenorhabditis elegans
Cin- Ciona intestinalis
Cli- Columba livia
Csa- Ciona savignyi
Cvi- Crassostrea virginica (Bivalvia)
Dme- Drosophila melanogaster
Dps- Drosophila pseudoobscura
Dvi- Drosophila virilis
Esc- Euprymna scolopes
Hpu- Hemicentrotus pulcherrimus (Sea urchin)
Hma- Hydra magnipapillata
Hmo- Hypnos monopterygium (Ray)
Hsa- Homo sapiens
Hvi- Heliothis virescens (Moth)
Lmi- Locusta migratoria
 190

Lpe- Loligo pealei (mollusc)

Lst- Lymnaea stagnalis
Nmi- Nephasoma minuta (Sipuncula)
Mau- Mesocricetus auratus (hamster)
Mmu- Mus musculus
Mpe- Myzus persicae (Aphid)
Nve- Nematostella vectensis
Odi- Oikopleura dioica (tunicate)
Ola- Oryzias latipes
Omy- Oncorhynchus mykiss (Bony fish)
Pca- Podocoryne carnea (Hydrozoa)
Pex- Perionyx excavatus (Annelida, Oligochaeta)
Pfl- Ptychodera flava (Hemichordata, Enteropneusta)
Pma- Pagrus major (Bony fish)
Ptr- Pan troglodytes
Rra- Rattus rattus
Rno- Rattus norvegicus
Sac- Squalus acanthias (shark)
Sam- Schistocerca americana (grasshopper)
Sdo- Suberites domuncula (Porifera)
Sja- Schistosoma japonicum (Platyhelminthes)
Sko- Saccoglossus kowalevskii
Spo- Schizosaccharomyces pombe
Spu- Strongylocentrotus purpuratus (Echinodermata)
Ssc- Sus scrofa
Tca- Tribolium castaneum
Tni- Tetraodon nirovingis
Toc- Torpedo ocellata
Tru- Takifugu rubripes
Xla- Xenopus laevis
Xtr- Xenopus tropicalis
 191

6.3 Abbreviations

AP Antero-posterior, also alkaline phosphatase

BCIP 5-Bromo-4-chloro-3-indolyl phosphate
bHLH Basic helix-loop-helix (protein domain)
BMP Bone morphogenetic protein
BP Before present
BSA Bovine serum albumine
CNS Central nervous system
C-terminus Carboxy-terminus of a peptide or protein
DABCO 1,4-diazabicyclo[2.2.2]octane
DAPI 4',6-diamidino-2-phenylindole
DMSO Dimethyl sulfoxide
DV Dorso-ventral
EST Expressed sequence tag
EgfR Epidermal growth factor receptor
Fgf Fibroblast growth factor
GABA Gamma-aminobutyric acid
HD Homeodomain (protein domain)
Hh Hedgehog
hpf Hours post-fertilization
INs Interneurons
IPTG Isopropyl β-D-1-thiogalactopyranoside
ISN Intersegmental nerve (Drosophila)
LFP Lateral floor plate
LIM-HD Protein containing both LIM and homeodomains
MFP Medial floor plate
MNs Motoneurons
mRNA Messenger RNA
NBT Nitro blue tetrazolium
 192

NSW Natural sea water

N-terminus Amino-terminus of a peptide or protein
PBS Phosphate buffer saline
Pdu Platynereis dumerilii
PFA Paraformaldehyde
POD Peroxidase
PTW Phosphate buffer saline with 0.1% Tween 20
RACE Rapid amplification of complementary ends
RT Reverse trancriptase
Shh Sonic hedgehog
Shh-N Processed, secreted form of sonic hedgehog
sMNs Somatic motoneurons
SSC Salt sodium citrate
TGFβ Transforming growth factor beta
vMNs Visceral motoneurons
WMISH Whole mount in-situ hybridization