Journal of Antimicrobial Chemotherapy (2008) 62, 504 513 doi:10.

1093/jac/dkn217 Advance Access publication 28 May 2008

Efux-mediated response of Staphylococcus aureus exposed to ethidium bromide

Isabel Couto1,2, Soa Santos Costa1, Miguel Viveiros1, Marta Martins1,3 and Leonard Amaral1,3*
Unidade de Micobacterias, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa (UNL), gicos (CREM), Faculdade de Cie ncias e Tecnologia, UNL, Portugal; Portugal; 2Centro de Recursos Microbiolo 3 UPMM, Instituto de Higiene e Medicina Tropical, UNL, Portugal
Received 21 January 2008; returned 27 February 2008; revised 17 April 2008; accepted 21 April 2008 Objectives: By adapting an antibiotic-susceptible Staphylococcus aureus strain to increasing concentrations of ethidium bromide, a known substrate of efux pumps (EPs), and by phenotypically and genotypically analysing the resulting progeny, we characterized the molecular mechanisms of S. aureus adaptation to ethidium bromide. Methods: S. aureus ATCC 25923 was grown in increasing concentrations of ethidium bromide. The MICs of representatives of eight classes of antibiotics, eight biocides and two dyes against ATCC 25923 and its ethidium bromide-resistant progeny ATCC 25923EtBr were determined with or without six efux pump inhibitors (EPIs). Efux activity in the presence/absence of EPIs was evaluated by realtime uorometry. The presence and expression of eight EP genes were assayed by PCR and quantitative RT PCR (qRT PCR), respectively. Mutations in grlA, gyrA and norA promoter regions were screened by DNA sequencing. Results: Compared with its parental strain, ATCC 25923EtBr was 32-fold more resistant to ethidium bromide and also more resistant to biocides and hydrophilic uoroquinolones. Resistance to these could be reduced by the EPIs chlorpromazine, thioridazine and reserpine. Increased efux of ethidium bromide by ATCC 25923EtBr could be inhibited by the same EPIs. qRT PCR showed that norA was 35-fold over-expressed in ATCC 25923EtBr, whereas the remaining EP genes showed no signicant increase in their expression. Sequencing of the norA promoter region revealed a 70 bp deletion in ATCC 25923EtBr. Conclusions: Exposure of S. aureus to quaternary compounds such as ethidium bromide results in decreased susceptibility of the organism to a wide variety of compounds, including quinolones and biocides through an efux-mediated response, which for strain ATCC 25923 is mainly NorA-mediated. This altered expression may result from alterations in the norA promoter region. Keywords: staphylococci, efux pumps, NorA, overexpression
1

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Introduction
Staphylococcus aureus is one of the most common human pathogens, being responsible for a wide variety of infections, many of which can be life-threatening. Besides its pathogenic potential, this bacterium also shows many different mechanisms of resistance towards antibiotics. Several of these mechanisms are well known, and have been characterized: resistance to b-lactam antibiotics mediated by PBP2a, encoded by the mecA gene, or resistance to uoroquinolones resulting from mutations

in either topoisomerase IV or gyrase genes.1 On the other hand, antibiotic resistance based on efux systems capable of extruding the drug or other noxious agents from the cell is less well characterized for these bacteria. To date, more than 10 efux pumps (EPs) have been described for S. aureus.2 Most of these pumps belong to the major facilitator superfamily, namely the chromosomally encoded NorA, NorB, NorC, MdeA and SdrM as well as the plasmid-encoded QacA/B pumps.3 8 Other types of pumps have also been described for S. aureus such as MepA, a member of

.....................................................................................................................................................................................................................................................................................................................................................................................................................................

*Correspondence address. Unidade de Micobacterias, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa, Rua da Junqueira 96, 1349-008 Lisbon, Portugal. Tel: 351-21-3652652; Fax: 351-21-3632105; E-mail: lamaral@ihmt.unl.pt
.....................................................................................................................................................................................................................................................................................................................................................................................................................................

504
# The Author 2008. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Ethidium bromide-induced efux in S. aureus

the multidrug and toxic compound extrusion family, as well as Smr, which belongs to the small multidrug resistance (SMR) family, and SepA.9 11 Although these pumps show different substrate specicity, most of them are capable of extruding compounds of different chemical classes, thus providing the cell with the means to develop a multidrug resistance (MDR) phenotype or to survive in a hostile environment. In order to nd specic inhibitors of these pumps or simply to demonstrate the presence of efux activity, different compounds have been tested for their ability to hinder the activity of S. aureus EPs, including the proton motive force uncoupler carbonyl cyanide m-chlorophenylhydrazone (CCCP), the alkaloid reserpine, as well as different members of the phenothiazines, among others.12 16 In this work, a fully antibiotic-susceptible S. aureus strain was challenged with increasing concentrations of a well-known substrate of EPs, ethidium bromide, and the mechanisms by which the cells adapted to this compound were evaluated by different methods. This experimental approach allowed us to study for the rst time the response of an S. aureus strain that is forced to cope with high concentrations of a noxious pump substrate, in particular, to evaluate the efux system(s) preferentially used by the cells under such conditions.

Biocides and dyes

Ethidium bromide, benzalkonium chloride, berberine, dequalinium chloride, 40 ,6-diamidino-2-phenylindole dihydrochloride, pentamidine isothionate salt and tetraphenylphosphonium bromide were purchased from Sigma-Aldrich. The biocides chlorhexidine and cetyltrimethylammonium bromide were purchased from Fluka Chemie GmbH and rhodamine from Merck (Darmstadt, Germany). All solutions were prepared on the day of the experiment and kept protected from light.

Efux pump inhibitors (EPIs)

CCCP, thioridazine, chlorpromazine, verapamil and reserpine were purchased from Sigma-Aldrich. Ouabain was purchased from Fluka Chemie GmbH. Solutions of thioridazine, chlorpromazine, verapamil and ouabain were prepared in deionized water; reserpine was prepared in DMSO and CCCP in 50% methanol (v/v). All solutions were prepared on the day of the experiment and kept in darkness.
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Drug susceptibility testing

Antibiotics. MICs were determined by the broth microdilution method, as per the guidelines of CLSI20 and carried out in triplicate. Results were evaluated according to the CLSI breakpoints, except for nalidixic acid, for which there are no dened breakpoints. Kirby Bauer antibiotic susceptibility assays were conducted as outlined by the CLSI standards and performed in triplicate. The zones of inhibition were measured in millimetres and analysed by the CLSI breakpoints, except for fusidic acid, which was analysed by the BSAC standards21 and nalidixic acid, for which there are no dened breakpoints. Biocides and dyes. MICs were determined by the broth microdilution method. Briey, cultures were grown overnight in TSB, at 378C, diluted in PBS and the suspension turbidity adjusted to a 0.5 McFarland standard. Twenty microlitres of this suspension were then transferred to each well of 96-well plates containing 2-fold dilutions of each agent to be tested, diluted in MHB. The plates were then incubated at 37C for 18 h and the MIC values, corresponding to the lowest concentration of compound that inhibited visible growth, recorded. Each MIC determination was carried out in triplicate. Efux pump inhibitors. Each EPI employed in this study was evaluated for its ability to reduce or reverse antibiotic resistance to given antibiotics and biocides, both of which are characteristics that dene the agent as an inhibitor of efux pump activity.22 The evaluation of an agent for EPI activity was conducted at a concentration of the agent that did not inhibit the growth of the organism in a medium containing varying concentrations of an antibiotic or biocide and a bacterial inoculum corresponding to the one used for MIC determination. Parallel cultures were tested in media containing no EPI and varying concentrations of the antibiotic or biocide. The cultures were incubated for 18 h and their contents (growth) evaluated visually; minimum bactericidal concentrations were determined by counting colony-forming units. The nal concentrations of the EPIs used, which correspond to half of the MIC determined for each EPI unless otherwise stated, were: thioridazine (12.5 mg/L), chlorpromazine (25 mg/L), verapamil (200 mg/L), reserpine (20 mg/L), ouabain (100 mg/L) and CCCP (0.18 mg/L). The MIC of each EPI was determined by the broth microdilution method, as described above. All assays were performed in triplicate.

Materials and methods

Bacterial strains
The study was conducted with S. aureus strain ATCC 25923, a clinical isolate collected at Seattle in 1945, fully antibiotic-susceptible, b-lactamase-negative, with an ethidium bromide MIC of 6.25 mg/L. This strain was initially grown in 5 mg/L of ethidium bromide and incubated at 37C. When visible growth was obtained, the culture was transferred to new media, containing increasing concentrations of ethidium bromide (5, 10, 20, 40, 60, 80 and 100 mg/L). During an 82 day period, 7 cultures were obtained, with MICs of ethidium bromide varying between 6.25 and 200 mg/L. The nal, most resistant culture was named ATCC 25923EtBr. This method of adaptation of a bacterial species to a given agent has been described previously.17 19

Growth conditions
Cultures were grown in tryptic soy broth (TSB) or agar (TSA) (Oxoid Ltd, Basingstoke, UK) at 378C. When necessary, the strain ATCC 25923EtBr was grown in a medium supplemented with 50 mg/L of ethidium bromide. For determination of the MICs of the agents employed in this study, cultures were grown in a Mueller Hinton broth (MHB), and for Kirby Bauer antibiotic susceptibility assays, in Mueller Hinton agar, at 378C.

Antibiotics
Antibiotics in powder form were purchased from different sources, as follows: nalidixic acid, erythromycin, tetracycline, rifampicin and chloramphenicol were purchased from Sigma-Aldrich (St Louis, USA); noroxacin was purchased from ICN Biomedicals Inc. (OH, USA) and ciprooxacin from Fluka Chemie GmbH (Buchs, Switzerland). KirbyBauer discs containing nalidixic acid (30 mg), noroxacin (10 mg), ciprooxacin (5 mg), tetracycline (30 mg), oxacillin (1 mg), gentamicin (10 mg), cefotaxime (30 mg), penicillin (10 U) and fusidic acid (10 mg) were acquired from Oxoid Ltd.

505

Couto et al.
Preparation of chromosomal DNA
Genomic DNA was extracted with the QIAamp DNA minikit (QIAGEN, Hilden, Germany), with an additional step of 30 min digestion with lysostaphin (Sigma) (200 mg/L) prior to extraction.

RNA extraction
Total RNA was extracted from the parent ATCC 25923 strain unexposed to ethidium bromide and the ATCC 25923EtBr strain grown in TSB supplemented with 50 mg/L of ethidium bromide with the Rneasy Mini Kit (QIAGEN), as per the manufacturers instructions. Before extraction of total RNA, the cultures were treated with an RNAprotect bacterial reagent (QIAGEN). The extracted RNA was treated with RNAse-free DNAse (QIAGEN) for 2 h at room temperature and re-puried using the same kit.

Macrorestriction analysis
Cultures were typed by pulsed-eld gel electrophoresis (PFGE) analysis, using well-established protocols. Briey, agarose discs containing intact chromosomal DNA were prepared as described previously23 and restricted with SmaI, according to the manufacturers recommendations (New England Biolabs, Ipswich, MA, USA). Restriction fragments were then resolved by PFGE, which was carried out in a contour-clamped homogeneous electric eld (CHEF) apparatus (CHEF-DRII, Bio-Rad, Hercules, CA, USA), as described previously.23

PCR amplication of efux pump genes

Separate fragments of DNA internal to each of eight EP genes previously described for S. aureus were amplied by PCR, using the primers described in Table 1. The reaction mixture (50 mL) contained 2.5 U of Taq Polymerase (Fermentas Inc., Ontario, Canada), 1 Taq buffer (Fermentas), 25 pmol of each primer, 200 mM dNTP and 1.75 mM MgCl2. The PCRs were conducted in a thermocycler Mastercycler personal 5332 (Eppendorf AG, Hamburg, Germany). Amplication conditions were as follows: DNA was denatured at 948C for 4 min, followed by 35 cycles of denaturation at 948C for 30 s, annealing at 458C (norA) or 538C (norB, norC, mdeA, mepA
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Preparation of plasmid DNA

The QIAprep Spin Miniprep kit (QIAGEN) was used, with the following modication: prior to extraction, cells were incubated with lysostaphin (35 mg/L) at 378C for 90 min, as described previously.24 Table 1. Primers used in this study Primer QacA/B_Fw QacA/B_Rv SMR_Fw SMR_Rv NorA_Fw NorA_Rv NorA_RT(Fw) NorA_RT(Rv) NorAp_Fw NorAp_Rv NorB_Fw NorB_Rv NorC_Fw NorC_Rv MepA_Fw MepA_Rv MepA_RT(Fw) MepA_RT(Rv) MdeA_Fw MdeA_Rv MdeA_RT(Fw) MdeA_RT(Rv) SepA_Fw SepA_Rv 16S_27Fw 16S_519Rv GrlA_Fw GrlA_Rv GyrA_Fw GyrA_Rv Sequence (50 30 )

Size (bp) 628 285 620 246 449 213 216 718 198 677 155 103 492 339 394

Reference 45 24 46; this work this work this work this work this work this work this work this work 6 this work 47 48 this work

GCTGCATTTATGACAATGTTTG AATCCCACCTACTAAAGCAG ATAAGTACTGAAGTTATTGGAAGT TTCCGAAAATGTTTAACGAAACTA TTCACCAAGCCATCAAAAAG CTTGCCTTTCTCCAGCAATA TCGTCTTAGCGTTCGGTTTA TCCAGTAACCATCGGCAATA TGTTAAGTCTTGGTCATCTGCA AGCAGCAACAAGTAACCCTAAA AGCGCGTTGTCTATCTTTCC GCAGGTGGTCTTGCTGATAA AATGGGTTCTAAGCGACCAA ATACCTGAAGCAACGCCAAC ATGTTGCTGCTGCTCTGTTC TCAACTGTCAAACGATCACG TGCTGCTGCTCTGTTCTTTA GCGAAGTTTCCATAATGTGC AACGCGATACCAACCATTC TTAGCACCAGCTATTGGACCT GTTTATGCGATTCGAATGGTTGGT AATTAATGCAGCTGTTCCGATAGA GCAGTCGAGCATTTAATGGA ACGTTGTTGCAACTGTGTAAGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG TGCCAGATGTTCGTGATGGT TGGAATGAAAGAAACTGTCTC TCGTGCATTGCCAGATGTTCG TCGAGCAGGTAAGACTGACGG

Primers used in the qRTPCR experiments are indicated by the RT label. Fw, forward primer; Rv, reverse primer. For norB, norC and sepA, the same set of primers was used for both PCR and qRTPCR.

506

Ethidium bromide-induced efux in S. aureus

and sepA) for 30 s and extension at 728C for 1 min, followed by a nal extension at 728C for 5 min. The PCRs for genes qacA/B and smr were conducted under the following conditions: DNA was denatured at 958C for 1 min, followed by 30 cycles of denaturation at 958C for 1 min, annealing at 408C (qacA/B) or 488C (smr) and extension at 728C for 1 min, followed by a step of nal extension at 728C for 5 min. The amplication products were visualized in 1% agarose gel electrophoresis. in a Rotor-Gene 3000TM thermocycler using real-time analysis software (Corbett Research). For the accumulation of ethidium bromide, cultures were grown in TSB medium at 378C and 150 rpm to an OD600 of 0.6, centrifuged and washed twice in PBS. The OD600 of the cellular suspension was then adjusted to 0.3 in PBS. The conditions used to maximize accumulation were: incubation with 3 mg/L ethidium bromide and 25 mg/L chlorpromazine, the most active EPI, at 258C, and in the absence of glucose, for a 60 min period. The ethidium bromide and chlorpromazine concentrations were used at half MIC for the cultures in order to ensure that no effect was produced on the viability of the cells. For the efux assay, the ethidium bromide-loaded cells were collected by centrifugation and re-suspended in PBS to an OD600 of 0.3. Glucose to a nal concentration of 0.4% was added to a set of microtubes containing an aliquot of 1 mL of cellular suspension. One microtube was left without glucose, to which 25 mg/L chlorpromazine was added. Afterwards, aliquots of 95 mL were transferred to 0.2 mL microtubes. Aliquots of 5 mL from aqueous stock solutions of the EPIs chlorpromazine, thioridazine and reserpine were added to the PCR microtubes in order to achieve nal concentrations of: 5, 10, 15 and 25 mg/L; 5, 10 and 12.5 mg/L; and 20, 40, 60 and 100 mg/L, respectively. Replicate tubes without glucose and/ or without EPI were also used as controls. The efux assays were then conducted in the Rotor-Gene 3000TM at a temperature of 37C, and the uorescence of ethidium bromide was measured at the end of every cycle of 60 s, for a total period of 25 min. Each assay was performed at least in triplicate and the viability of the cells was checked at the end of the assay by plating dilutions of the culture in TSA. The raw data obtained was then normalized against data from non-efuxing cells (cells from the control tube with 25 mg/L chlorpromazine and no glucose) at each point, which were considered to be the maximum uorescence values that could be obtained during the assay. The relative uorescence thus corresponds to the ratio of uorescence that remains per unit of time relative to the ethidiumbromide-loaded cells.

Screening of mutations in the norA promoter region

A 449 bp region upstream of norA was amplied using primers NorAp_Fw and NorAp_Rv (Table 1). The amplication conditions were the same as used for norB amplication. Amplication products were puried and sequenced in both strands. Sequences were analysed and aligned using programs BioEdit, version 7.0.8.0, and ClustalW, respectively.

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Screening of mutations in grlA and gyrA genes

Fragments internal to the grlA and gyrA genes were amplied using the primers GrlA_Fw/GrlA_Rv and GyrA_Fw/GyrA_Rv, described in Table 1. The amplication conditions were as follows: DNA was denatured at 948C for 4 min, followed by 35 cycles of denaturation at 948C for 30 s, annealing at 508C for 30 s and extension at 728C for 1 min, followed by a nal extension at 728C for 5 min. Amplication products were puried and sequenced in both strands. Sequences were analysed and aligned using the programs BioEdit and ClustalW, respectively.

qRT PCR protocol

Quantitative RTPCR (qRTPCR) was performed in triplicate using a QuantiTect SYBR Green RTPCR Kit (QIAGEN). The primers used in these assays are described in Table 1. The relative quantity of mRNA from the eight efux pumps was determined by the comparative threshold cycle (CT) method25 in a Rotor-Gene 3000TM thermocycler with real-time analysis software (Corbett Research, Sydney, Australia). The method was applied to the analysis of three assays conducted with three independent total RNA extractions. Negative controls and a genomic DNA contamination control were included. 16S rRNA was used as an endogenous control.

Results
Adaptation to ethidium bromide
The parent ATCC 25923 strain, susceptible to 6.25 mg/L ethidium bromide, was serially cultured in stepwise increases of ethidium bromide beginning with 5 mg/L ethidium bromide. After 82 days, the resistance of this strain to ethidium bromide was raised from an MIC of 6.25 to 200 mg/L and this ethidium bromide-adapted culture was designated as ATCC 25923EtBr.

Assessment of efux activity

Ethidium bromide agar screening method. Efux activity was rst assayed by the ethidium bromide agar screening method previously described.26 Briey, each culture was swabbed onto TSA plates containing ethidium bromide concentrations ranging from 0.5 to 2.5 mg/L. The plates were incubated at 378C for 16 h after which the minimum concentration of ethidium bromide that produced uorescence under UV light associated with the bacterial mass was recorded. The plates were then incubated at 48C for another 16 h, after which the minimum ethidium bromide concentration that produced uorescence was recorded and compared with the minimal concentration of ethidium bromide that produced uorescence at 378C. Semi-automated uorometric method. A second method, recently developed in our laboratory, was also used for the assessment of efux activity.27 This method is based on the accumulation of a given EP substrate (in this case ethidium bromide) inside the cells, followed by the uorometric measurement of its efux

Contamination control
The parent ATCC 25923 and its adapted ethidiumbromide-resistant progeny, ATCC 25923EtBr, were typed by PFGE analysis. Since the SmaI macrorestriction patterns of both the parental and the ethidium bromide-adapted cultures were identical (data not shown), one can rule out any contaminant being introduced during the process by which the parent strain became resistant to ethidium bromide.

Susceptibility to biocides and dyes

The MIC values of several biocides and dyes against the parental strain and its ethidium bromide-induced-resistant progeny,

507

Couto et al.
Table 2. MICs of biocides and antibiotics in the presence and absence of EPIs MIC (mg/L) in the presence of inhibitor Drug EtBr TPP DC DAPI PT BAC CHX CTAB RD BER CIP NOR Culture ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr ATCC 25923 ATCC 25923EtBr no inhibitor 6.25 200 (32 ) 12.5 100 (8 ) 6.25 50 (8 ) 3 12.5 (4 ) 50 200 (4 ) 0.75 3 (4 ) 0.375 0.75 (2 ) 0.75 3 (4 ) 500 1000 (2 ) 200 . 800 (4 ) 0.25 1 (4 ) 0.5 2 (4 ) TZ 0.75 25 1.5 6.25 1.5 12.5 0.75 1.5 12.5 50 0.18 0.375 0.02 0.375 0.09 0.375 125 62.5 100 400 0.125 0.25 0.125 0.25 CPZ 0.75 12.5 3 6.25 1.5 12.5 1.5 1.5 6.25 50 0.09 0.75 0.09 0.375 0.09 0.375 125 62.5 100 400 0.125 0.25 0.125 0.25 VER 3 100 6.25 50 3 25 1.5 6.25 12.5 100 0.18 1.5 0.09 0.375 0.18 1.5 250 250 50 800 0.125 0.25 0.25 0.5 CCCP 1.5 200 12.5 100 3 25 1.5 12.5 50 200 0.75 1.5 0.375 0.75 0.75 3 500 1000 200 800 0.25 1 0.25 2 RES 1.5 100 3 50 0.75 12.5 0.75 3 12.5 100 0.09 0.75 0.02 0.375 0.09 0.75 250 500 50 800 0.125 0.25 0.25 0.5

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Values in bold type correspond to a decrease of 4-fold or higher on the MIC values in comparison to the ones in the absence of inhibitor. Values in parentheses indicate the MIC increment relative to the one of the original culture. The concentration of each EPI used is dened in the Materials and methods section. EtBr, ethidium bromide; TPP, tetraphenylphosphonium bromide; DC, dequalinium chloride; DAPI, 40 ,6-diamidino-2-phenylindole dihydrochloride; PT, pentamidine; BAC, benzalkonium chloride; CHX, chlorhexidine; CTAB, cetyltrimethylammonium bromide; RD, rhodamine; BER, berberine; NOR, noroxacin; CIP, ciprooxacin; CCCP, carbonyl cyanide m-chlorophenylhydrazone; TZ, thioridazine; CPZ, chlorpromazine; VER, verapamil; RES, reserpine. Additional antibiotics tested included nalidixic acid, tetracycline, erythromycin, chloramphenicol and rifampin, with no alteration in the MICs between the two cultures. The effect of ouabain in the MICs was also tested for EtBr, TPP, DC, DAPI and PT, with no observable effect.

ATCC 25923EtBr, are summarized in Table 2. Briey, the MICs against the ethidium bromide-adapted strain have all increased, especially those of the biocides TPP and dequalinium, for which an 8-fold increase is evident.

Susceptibility to antibiotics
Kirby Bauer assays. The antibiotic susceptibility of the two cultures against different classes of antibiotics was rst screened by Kirby Bauer assays. Whereas the initial parent strain was susceptible to all antibiotics, the adapted strain showed evidence of decreased susceptibility to noroxacin, ciprooxacin and nalidixic acid (with zones of inhibition of 27, 28 and 14 mm for ATCC 25923 and 19, 21 and 11 mm for ATCC 25923EtBr, respectively). However, the diameters of the zones of inhibition for ATCC 25923EtBr still fall within the susceptibility range. MIC determination. The MIC of each antibiotic against the parental and ethidium bromide-adapted strains is shown in Table 2. According to the Kirby Bauer antibiotic disc assay, the

ethidium bromide-adapted strain was 4-fold more resistant than its parental strain to noroxacin and ciprooxacin. No alteration was observed in the MIC of nalidixic acid or any of the other antibiotics tested. For ciprooxacin, the MIC obtained for ATCC 25923EtBr (1 mg/L) equals the breakpoint for distinguishing susceptibility from intermediate resistance, according to the CLSI breakpoint values. However, measured against EUCAST breakpoint values, the MIC of ciprooxacin for this strain would correspond to resistance, thus further illustrating the development of an MDR phenotype in this strain.28

Effect of EPIs on MICs of antibiotics, biocides and dyes

The two strains were then tested for the effect of different EPIs at half or less of their MIC on the MIC of several efux pump substrates. MICs of the different inhibitors were determined in liquid media, and did not differ between the two cultures. MICs were as follows: CCCP, 0.375 mg/L; thioridazine, 25 mg/L; chlorpromazine, 50 mg/L; verapamil, . 200 mg/L; reserpine, . 100 mg/L; and ouabain, . 200 mg/L.

508

Ethidium bromide-induced efux in S. aureus

As evident from Table 2, the two phenothiazines (thioridazine and chlorpromazine), as well as reserpine, reduced the resistance of the ATCC 25923EtBr strain to many of the agents to which resistance had been induced by exposure to increasing concentrations of ethidium bromide. A reduction of the MICs to at least a quarter of their original values in the presence of the EPI was considered as indicative of the presence of efux activity. The resistance to the agents affected by EPIs indicates a role of an efux pump system. uoroquinolone resistance and (ii) the presence and expression of genes coding for several efux pumps. Mutations in the grlA and gyrA genes. The two cultures were screened for mutations in the chromosome most commonly associated with uoroquinolone resistance in S. aureus, namely the ones in the quinolone resistance-determining regions (QRDRs) of both the grlA and gyrA genes.29 31 None of the mutations generally described for these two genes were found in any of the cultures that could be associated with the decrease in uoroquinolone susceptibility observed for ATCC 25923EtBr. Screening of genes coding for S. aureus EPs. Genes that coded for the most common EPs in S. aureus were screened by PCR, using the primers described in Table 1. From the eight genes screened, six (norA, norB, norC, mepA, mdeA and sepA) were detected by PCR amplication. No amplication products were obtained with primers for qacA/B and smr genes. The presence of these plasmid-encoded EPs (QacA/B and Smr) was ruled out by the absence of plasmids in these cultures (data not shown). qRT PCR analysis of the expression level of genes coding for S. aureus EPs. The expression of the six EP genes previously found for the two cultures was then evaluated by a qRT PCR analysis, which showed that norA is overexpressed in the adapted strain (34.38 + 3.36). The remaining genes show much lower variation in their expression: mepA (2.32 + 1.97), norB (1.91 + 1.25), sepA (1.71 + 1.34), mdeA (1.25 + 1.20) and norC (0.82 + 0.16). norA promoter sequencing. In order to understand the reasons for the overexpression of norA of ATCC 25923EtBr, the promoter region of this gene was sequenced in both the parental and the ethidium bromide-adapted cultures. Sequencing of the norA promoter region for both ATCC 25923 and ATCC 25923EtBr revealed that a 70 bp deletion occurred in ATCC 25923EtBr, immediately downstream of 2 10 sequence, that encompasses the majority of the 50 -UTR, the site of the so-called qB mutation, which has been related to increased resistance to
Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Assessment of efux activity

Ethidium bromide agar screening method. Both ATCC 25923 and ATCC 25923EtBr were evaluated for the presence of EP activity by the ethidium bromide agar screening method. While the initial parental culture began to exhibit uorescence at a concentration of 0.5 mg/L ethidium bromide at 378C, the adapted strain began to show uorescence at an ethidium bromide concentration of 2 mg/L (Figure 1). Following transfer to 48C, the minimal ethidium bromide concentration-producing uorescence for the adapted strain decreased to 1 mg/L (Figure 1), whereas the transfer of the parent culture to 48C did not alter the minimal concentration of ethidium bromide that caused the uorescence of the bacterial mass. These results suggest that the adapted strain is expressing a system (or systems) capable of extruding ethidium bromide, a process that has been previously shown to be temperature-dependent.19,26 Semi-automated uorometric method. The semi-automated uorometric method demonstrated that there was no appreciable efux activity in the ATCC 25923 culture (Figure 2a), whereas the ethidium bromide-adapted culture showed pronounced efux activity, which was inhibited by the three EPIs tested, in a concentration-dependent manner (Figure 2b).

Genetic analysis
The two cultures were evaluated for: (i) the presence of mutations in the chromosome generally associated with

Figure 1. Evaluation of efux activity of ATCC 25923 original (left) and ATCC 25923EtBr (right) cultures by the ethidium bromide agar screening method. Cultures were swabbed in TSA plates containing increasing concentrations of ethidium bromide. Following overnight incubation at 37C (upper panels) and after transfer to 4C for 16 h (lower panels) uorescence was detected under UV light.

509

Couto et al.

(a)
Relative fluorescence

1.2 1 0.8 0.6 0.4 0.2 0

0 5 10 15 20 25

(b)
Relative fluorescence

1.2 1 0.8 0.6 0.4 0.2 0

0 5 10 15 20 25

Time (min) No EPI 15 mg/L CPZ 5 mg/L CPZ 25 mg/L CPZ 10 mg/L CPZ No EPI 15 mg/L CPZ

Time (min) 5 mg/L CPZ 25 mg/L CPZ 10 mg/L CPZ

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

1.2 Relative fluorescence 1 0.8 0.6 0.4 0.2 0

0 5 10 15 20 25 Relative fluorescence

1.2 1 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25

Time (min) No EPI 10 mg/L TZ 5 mg/L TZ 12.5 mg/L TZ

No EPI

Time (min) 5 mg/L TZ 12.5 mg/L TZ

10 mg/L TZ

1.2 Relative fluorescence 1 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25 Relative fluorescence

1.2 1 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25

Time (min) No EPI 60 mg/L RES 20 mg/L RES 100 mg/L RES 40 mg/L RES No EPI 60 mg/L RES

Time (min) 20 mg/L RES 100 mg/L RES 40 mg/L RES

Figure 2. Evaluation of ethidium bromide efux activity by the semi-automated screening method for ATCC 25923 (a) and ATCC 25923EtBr (b). Assays were run at 37C, in the presence of glucose, with or without the most active EPIs. The data presented were normalized against the conditions of accumulation (no efux), and the relative uorescence was determined. CPZ, chlorpromazine; TZ, thioridazine; RES, reserpine.

uoroquinolones, and the site of the assigned transcription initiation (Figure 3).32,33

Discussion
The results of this study show that continuous and prolonged exposure of the S. aureus strain ATCC 25923 to increasing concentrations of ethidium bromide results in an impressive increase in resistance to this agent. In parallel, resistance to uoroquinolones as well as to other known EP substrates is also augmented, in particular, to the biocides tetraphenylphosphonium and

dequalinium. The larger increase in resistance to ethidium bromide compared with that observed for the other NorA substrates may be explained by a greater capacity of NorA to extrude ethidium bromide, inasmuch as this pump has been described as conferring only low-level resistance to uoroquinolones.12 However, this difference may also result from increased cell adaptation to ethidium bromide during the 82 day selection with this drug, whereas challenge by the other drugs tested only occurred during the 18 h period of the susceptibility assay. One may further hypothesize that cellular factors other than the pump itself may also play a role, namely the involvement of sensor systems that are specically activated by each class of

510

Ethidium bromide-induced efux in S. aureus

ATCC25923_norApromoter ATCC25923EtBr_norApromoter TAGTATGATTACTTTTTTGCAATTTCATATGATCAATCCCCTTTATTTTA 50 TAGTATGATTACTTTTTTGCAATTTCATATGATCAATCCCCTTTATTTTA 50 ************************************************** ATATGTCATTAATTATACAATTAAATGGAAAATAGTGATAATTACAAAGA 100 ATATGTCATTAATTATACAATTAAATGGAAAATAGTGATAATTACAAAGA 100 **************************************************

ATCC25923_norApromoter ATCC25923EtBr_norApromoter

-35
ATCC25923_norApromoter ATCC25923EtBr_norApromoter

-10

AAAAAATATTGTCAAATGTAGCAATGTTGTAATACAATATAGAAACTTTT 150 AAAAAATATTGTCAAATGTAGCAATGTTGTAATACAATA----------- 139 *************************************** TACGAATATTTAGCATGAATTGCAATTTGTCGTGGAAAAGAAGAATAACA 200 --------------------------------------------------

ATCC25923_norApromoter ATCC25923EtBr_norApromoter

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

SD
ATCC25923_norApromoter ATCC25923EtBr_norApromoter

NorA

GATTTAAGAATGACATGGAGAAAAAAGAGGTGAGCATATGAATAAACAGA 250 ---------ATGACATGGAGAAAAAAGAGGTGAGCATATGAATAAACAGA 180 ***************************************** TTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTA 300 TTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTA 230 **************************************************

ATCC25923_norApromoter ATCC25923EtBr_norApromoter

Figure 3. Alignment of the norA promoter sequences in ATCC 25923 and ATCC 25923EtBr. The consensus sequences 2 10, 2 35 and Shine-Dalgarno (SD) for ATCC 25923 are indicated, as well as the initiation codon. The asterisk marks the nucleotide (T) of the qB mutation. The cardinal marks the site of transcription initiation assigned for ATCC 25923.

substrate recognized by MDR EPs, such as NorA. Recently, we have documented such interplay between EP activity, their regulation and altered cell permeability to antibiotics in Escherichia coli.34 The demonstration that the ethidium bromide-resistant strain has a more active, energy-dependent, efux system was provided by the agar assay as well as by the semi-automated uorometric method. The latter protocol has been recently developed in our laboratory and allows the assaying of efux activity by a simple and reproducible procedure, which is here applied for the rst time to Gram-positive bacteria. The extrusion of ethidium bromide from S. aureus cells has been associated with the EPs NorA, NorB, MdeA, MepA, SepA and SdrM, whose genes are localized in the chromosome.4,6,7,9,10,13 Other S. aureus pumps that are plasmid-encoded have also been linked to ethidium bromide extrusion, namely QacA/B, Smr, QacG, QacED1 and QacH.11,35 38 Since no plasmids were detected in this work, we studied the expression of the genes coding for the other, chromosomally located, ethidium bromide-extruding pumps, except SdrM, due to its low extruding capacity for this substrate.7 NorC was also included in our study because of its high homology with NorB, which also extrudes ethidium bromide, and because others have suggested that the two pumps act in a concerted manner.5,39 In the case of ATCC 25923EtBr, qRTPCR allowed us to correlate the higher efux activity of these cells with an increased expression of the gene that codes for NorA. Many alterations have been described for the promoter region of norA, including single base pair mutations such as the qB mutation, as well as deletions and insertions32,39 42 that have been related to an increased transcription of norA and/or increased stability of the mRNA molecule.33,39,42 In our study, a 70 bp deletion was detected in the promoter region of ATCC 25923EtBr. DeMarco et al. 39 have previously described a 15 bp deletion in this same region, which the authors propose to be

associated with alterations in the half-life of the norA mRNA. In the case of ATCC 25923EtBr, this 70 bp deletion contains the adenine residue, which is normally situated 7 bp downstream of the 10 sequence, to which the transcription start is assigned. The specic assignment of the new norA transcription start in ATCC 25923EtBr strain and its relation to the increased expression of this gene would require additional studies. Additional sequencing of the QRDRs of grlA and gyrA for both ATCC 25923 and ATCC 25923EtBr revealed none of the mutations most commonly associated with uoroquinolone resistance in S. aureus, namely the mutations D79V, S80F, S80Y, S81P and E84K in GrlA; or S84L, S85P or E88K in GyrA, thus further supporting the suggestion that the decreased susceptibility towards uoroquinolones of the ethidium bromide-adapted culture results from its extrusion from the cells.29 31 However, one cannot exclude the possibility that other chromosomal mutations may have occurred during the adaptation process, which may contribute to the increased phenotypic resistance of ATCC 25923EtBr. Efux-based resistance can be reversed or reduced by agents that are known to inhibit the activity of EPs of MDR bacteria.22 Among the several inhibitors tested, the phenothiazines as well as reserpine, all of which have been described as inhibitors of NorA, were the ones showing the highest effect in reducing the MICs of several drugs against ATCC 25923EtBr.13,16,32 On the other hand, verapamil was less efcient in reducing ethidium bromide-induced resistance towards some of the drugs, and neither ouabain nor CCCP altered the susceptibility of the ethidium bromide-adapted strain to any of the agents employed. Since several S. aureus EPs, including NorA, use the proton motive force to promote the transport of their substrates, we were expecting to observe some effect of CCCP, as noted by others, in assays of uoroquinolone accumulation by S. aureus.3,32,43 However, the CCCP concentrations used in those studies (100 mM) were far greater than the one used here

511

Couto et al.
(0.88 mM). Concentrations of CCCP of 100 mM have been recently shown to produce signicant killing of bacteria.27 Ng et al. 32 noted that when working with 1 mM CCCP, reversal of noroxacin accumulation by S. aureus cells corresponded to only 6% 10% of that observed with 100 mM CCCP. The fact that thioridazine, chlorpromazine and reserpine also had some effect on the MICs for the original ATCC 25923 culture towards the same drugs suggests basal intrinsic efux activity, in accordance with that reported by Kaatz and Seo,43 who described low-level expression of NorA in an S. aureus strain not exposed to any drug. This low-level expression may account for the slight decrease in uorescence observable in the uorometric assay for the parental strain, after 18 min incubation in the absence of EPIs (Figure 2a). While this paper was in review, a report by Garvey and Piddock44 was published describing the selection of efuxmediated MDR Streptococcus pneumoniae after exposure to reserpine. Their observations conrm the results in this study that demonstrate the potential for non-antibiotic efux substrates to select for MDR in S. aureus. Since this MDR phenotype was correlated at the genetic level with overexpression of NorA, we infer that, among the several ethidium bromide chromosomally encoded EPs, this is the one that cells use as a rst-line response to extrude this noxious agent. A recent study revealed that among S. aureus clinical isolates showing increased expression of EPs, the majority over-expressed a single EP gene, which for most cases was norA, whereas the remaining strains overexpressed two or more genes, most commonly norB and norC.39 These ndings support the hypothesis made here of the eventual key role played by NorA in multidrug efux by S. aureus. S. aureus ATCC 25923 has several efux systems, of which at least one is expressed at basal levels, and when these cells are challenged with increasing concentrations of a noxious agent that is a substrate of these efux systems, the cells respond by increasing its efux and survive, provided that the initial concentration of the agent is sufciently low. This process may mirror the one that eventually takes place when a patient is infected with a bacterium and is given an antibiotic whose nal concentration is below the one necessary to effectively kill the microorganism. By activating and/or over-expressing the cellular systems of drug efux, the bacteria may be able to survive nonlethal concentrations of the drugs and become refractory to therapy.

Transparency declarations
None to declare.

References
1. Lowy FD. Antimicrobial resistance: the example of Staphylococcus aureus. J Clin Invest 2003; 111: 126573. 2. Poole K. Efux pumps as antimicrobial resistance mechanisms. Ann Med 2007; 39: 16276. 3. Yoshida H, Bogaki M, Nakamura S et al. Nucleotide sequence and characterization of the Staphylococcus aureus norA gene, which confers resistance to quinolones. J Bacteriol 1990; 172: 69429. 4. Truong-Bolduc QC, Dunman PM, Strahilevitz J et al. MgrA is a multiple regulator of two new efux pumps in Staphylococcus aureus. J Bacteriol 2005; 187: 2395405. 5. Truong-Bolduc QC, Strahilevitz J, Hooper DC. NorC a new efux pump regulated by MgrA of Staphylococcus aureus. Antimicrob Agents Chemother 2006; 50: 11047. 6. Huang J, OToole P, Shen W et al. Novel chromosomally encoded multidrug efux transporter MdeA in Staphylococcus aureus. Antimicrob Agents Chemother 2004; 48: 90917. 7. Yamada Y, Hideka K, Shiota S et al. Gene cloning and characterization of SdrM, a chromosomally-encoded multidrug efux pump, from Staphylococcus aureus. Biol Pharm Bull 2006; 29: 5546. 8. Tennent JM, Lyon BR, Gillespie MT et al. Cloning and expression of Staphylococcus aureus plasmid-mediated quaternary ammonium resistance in Escherichia coli. Antimicrob Agents Chemother 1985; 27: 79 83. 9. Kaatz GW, McAleese F, Seo SM. Multidrug resistance in Staphylococcus aureus due to overexpression of a novel multidrug and toxin extrusion (MATE) transport protein. Antimicrob Agents Chemother 2005; 49: 185764. 10. Narui K, Noguchi N, Wakasugi K et al. Cloning and characterization of a novel chromosomal drug efux gene in Staphylococcus aureus. Biol Pharm Bull 2002; 25: 15336. 11. Paulsen IT, Brown MH, Dunstan SJ et al. Molecular characterization of the staphylococcal multidrug resistance export protein QacC. J Bacteriol 1995; 177: 282733. 12. Kaatz GW, Seo SM, Ruble CA. Efux-mediated uoroquinolones resistance in Staphylococcus aureus. Antimicrob Agents Chemother 1993; 37: 108694. 13. Neyfakh AA, Borsch CM, Kaatz GW. Fluoroquinolone resistance protein NorA of Staphylococcus aureus is a multidrug efux transporter. Antimicrob Agents Chemother 1993; 37: 1289. 14. Kristiansen MM, Leandro C, Ordway D et al. Phenothiazines alter resistance of methicillin-resistant strains of Staphylococcus aureus (MRSA) to oxacillin in vitro. Int J Antimicrob Agents 2003; 22: 2503. 15. Kristiansen MM, Leandro C, Ordway D et al. Thioridazine reduces resistance of methicillin-resistant Staphylococcus aureus by inhibiting a reserpine-sensitive efux pump. In Vivo 2006; 20: 3616. 16. Kaatz GW, Mougdal VV, Seo SM et al. Phenothiazines and thioxanthenes inhibit multidrug efux pump activity in Staphylococcus aureus. Antimicrob Agents Chemother 2003; 47: 71926. 17. Viveiros M, Portugal I, Bettencourt R et al. Isoniazid-induced transient high-level resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2002; 46: 280410. 18. Viveiros M, Jesus A, Brito M et al. Inducement and reversal of tetracycline resistance in Escherichia coli K-12 and expression of proton gradient-dependent multidrug efux pump genes. Antimicrob Agents Chemother 2005; 49: 357882.

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

Acknowledgements
We acknowledge the assistance of Clara Leandro in the preparation of the ethidium bromide-adapted culture. The authors nia de Lencastre (Laboratory of are also grateful to Herm Molecular Genetics, ITQB/UNL) for access to PFGE facilities.

Funding
This work was partially funded by Project Ref. Proc. 61056, o Calouste Gulbenkian (Portugal). M. M. was supfrom Fundac a o para a ported by grant SFRH/BD/14319/2003 from Fundac a ncia e a Tecnologia (FCT, Portugal). Cie

512

Ethidium bromide-induced efux in S. aureus

19. Martins A, Couto I, Aagaard L et al. Prolonged exposure of methicillin-resistant Staphylococcus aureus (MRSA) COL strain to increasing concentrations of oxacillin results in a multidrug-resistant phenotype. Int J Antimicrob Agents 2007; 29: 302 5. 20. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Sixteenth Informational Supplement M100-S16. CLSI, Wayne, PA, USA, 2006. 21. Andrews JM for the BSAC Working Party on Susceptibility Testing. BSAC standardized disc testing method (version 4). J Antimicrob Chemother 2005; 56: 60 76. 22. Marquez B. Bacterial efux systems and efux pumps inhibitors. Biochimie 2005; 87: 1137 47. 23. Chung M, Lencastre H, Matthews P et al. Molecular typing of methicillin-resistant Staphylococcus aureus by pulsed-eld gel electrophoresis: comparison of results obtained in a multilaboratory effort using identical protocols and MRSA strains. Microb Drug Resist 2000; 6: 18998. 24. Bjorland J, Sunde M, Waage S. Plasmid-borne smr gene causes resistance to quaternary ammonium compounds in bovine Staphylococcus aureus. J Clin Microbiol 2001; 39: 3999 4004. 25. Langmann T, Mauerer R, Zahn A et al. Real-time reverse transcription-PCR expression proling of the complete human ATP-binding cassette transporter superfamily in various tissues. Clin Chem 2003; 49: 2308. 26. Martins M, Santos B, Martins A et al. An instrument-free method for the demonstration of efux pump activity of bacteria. In Vivo 2006; 20: 65764. o L et al. Demonstration of intrinsic 27. Viveiros M, Martins A, Paixa efux activity of E. coli K-12 AG100 by an automated ethidium bromide method. Int J Antimicrob Agents 2008; 31: 458 62. 28. EUCAST Clinical MIC breakpointsuoroquinolones. EUCAST Website (v2.4). http://www.srga.org/eucastwt/MICTAB/MICquinolones. htm (25 March 2008, date last accessed). 29. Ferrero L, Cameron B, Crouzet J. Analysis of gyrA and grlA mutations in stepwise-selected ciprooxacin-resistant mutants of Staphylococcus aureus. Antimicrob Agents Chemother 1995; 39: 15548. 30. Horii T, Suzuki Y, Monji A et al. Detection of mutations in quinolone resistance-determining regions in levooxacin- and methicillin-resistant Staphylococcus aureus: effects of the mutations on uoroquinolone MICs. Diagn Microbiol Infect Dis 2003; 46: 13945. 31. Hooper DC. Mechanisms of uoroquinolone resistance. Drug Resist Updat 1999; 2: 38 55. 32. Ng EYW, Trucksis M, Hooper DC. Quinolone resistance mediated by norA: physiologic characterization and relationship to qB, a quinolone resistance locus on the Staphylococcus aureus chromossome. Antimicrob Agents Chemother 1994; 38: 1345 55. 33. Fournier B, Truong-Bolduc Q, Zhang X et al. A mutation in the 50 untranslated region increases stability of norA mRNA, encoding a multidrug resistance transporter of Staphylococcus aureus. J Bacteriol 2001; 183: 236771. 34. Viveiros M, Dupont M, Rodrigues L et al. Antibiotic stress, genetic response and altered permeability of E coli. PLoS ONE 2007; 2: e365. 35. Brown MH, Skurray RA. Staphylococcal multidrug efux protein QacA. J Mol Microbiol Biotechnol 2001; 3: 16370. 36. Heir E, Sundheim G, Holck AL. The qacG gene on plasmid pST94 confers resistance to quaternary ammonium compounds in staphylococci isolated from the food industry. J Appl Microbiol 1999; 86: 378 88. 37. Kazama H, Hamashima H, Sasatsu M et al. Distribution of the antiseptic-resistance gene qacED1 in Gram-positive bacteria. FEMS Microbiol Lett 1998; 165: 2959. 38. Heir E, Sundheim G, Holck AL. The Staphylococcus qacH gene product: a new member of the SMR family encoding multidrug resistance. FEMS Microbiol Lett 1998; 163: 49 56. 39. DeMarco CE, Cushing LA, Frempong-Manso E et al. Efux-related resistance to noroxacin, dyes, and biocides in bloodstream isolates of Staphylococcus aureus. Antimicrob Agents Chemother 2007; 51: 32359. 40. Schmitz F-J, Hertel B, Hofmann B et al. Relationship between mutations in the coding and promoter regions of the norA genes in 42 unrelated clinical isolates of Staphylococcus aureus and the MICs of noroxacin for these strains. J Antimicrob Chemother 1998; 42: 561 3. 41. Tanaka M, Wang T, Onodera Y et al. Mechanism of quinolone resistance in Staphylococcus aureus. J Infect Chemother 2000; 6: 131 9. 42. DeMarco CE, Frempong-Manso E, Seo SM et al. Multidrug efux-pump (MDEP) gene expression in geographically diverse Staphylococcus aureus (SA) strains. In: Proceedings of the 47th Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC), Chicago, IL, 2007. Abstract C2-192, p. 113. American Society for Microbiology, Washington, DC, USA. 43. Kaatz GW, Seo SM. Inducible NorA-mediated multidrug resistance in Staphylococcus aureus. Antimicrob Agents Chemother 1995; 39: 26505. 44. Garvey MI, Piddock LJV. The efux pump inhibitor reserpine selects multidrug resistant Streptococcus pneumoniae that overexpress the ABC transporters PatA and PatB. Antimicrob Agents Chemother 2008; 52: 167785. 45. Anthonisen I-L, Sunde M, Steinum TM et al. Organization of the antiseptic resistance gene qacA and Tn552-related b-lactamase genes in multidrug-resistant Staphylococcus haemolyticus strains of animal and human origins. Antimicrob Agents Chemother 2002; 46: 360612. 46. Sierra JM, Ruiz J, Anta MTJ et al. Prevalence of two different genes encoding NorA in 23 clinical strains of Staphylococcus aureus. J Antimicrob Chemother 2000; 46: 1456. 47. Lane DJ. 16S/23S rRNA sequencing. In: Stackebrant E, Goodfellow M, eds. Nucleic Acid Techniques in Bacterial Systematics. London: John Wiley & Sons Ltd, 1991; 115 75. 48. Pan X, Hamlyn P, Talens-Visconti R et al. Small-colony mutants of Staphylococcus aureus allow selection of gyrase-mediated resistance to dual-target uoroquinolones. Antimicrob Agents Chemother 2002; 46: 2498506.

Downloaded from http://jac.oxfordjournals.org/ at Chhatrapati Shahu Ji Maharaj Kanpur University on February 11, 2012

513