Diss Caroline

Diss. ETHZ No.
17544
Molecular and phenotypic diversity of wheat

(Triticum aestivum L.) for winter hardiness
A dissertation submitted to the

ETH ZURICH
for the degree of
DOCTOR OF SCIENCES
presented by
CAROLINE PLASSE
M.Sc. in Agronomical Sciences, INPL Nancy, France
born 12.07.1978
Citizen of France
accepted on the recommendation of

Prof. Dr. P.Stamp, examiner
Prof. Dr. B. Keller, co-examiner
Dr. J. Leipner, co-examiner
Zurich, 2007
“The tools of genome research may finally
unleash the genetic potential of our wild
and cultivated germplasm resources
for the benefit of the society”
(Tanksley and McCouch 1997)
Table of Contents
Summary III
Résumé V
List of abbreviations VII
1 General Introduction 1
1.1 Frost-induced damage and cellular response to low temperature ................................ 1
1.2 Cold acclimation and winter hardiness of wheat ......................................................... 2
1.3 Determination of frost tolerance .................................................................................. 3
1.4 Genetic aspects of frost tolerance in wheat.................................................................. 4
1.5 Use of genetic resources for wheat improvement ........................................................ 5
1.6 Contribution of genomic research and molecular markers to crop improvement........ 6
1.7 Aim of the study........................................................................................................... 7
2 Phylogenetic analysis of wheat (Triticum aestivum L.) accessions by microsatellite
markers and parametric genetic mixture analysis 8
2.1 Abstract ........................................................................................................................ 8
2.2 Introduction .................................................................................................................. 8
2.3 Material and Methods .................................................................................................. 9
2.3.1 Plant material...................................................................................................... 9
2.3.2 Microsatellite analysis ...................................................................................... 10
2.3.3 Genetic diversity assessment ............................................................................ 12
2.4 Results ........................................................................................................................ 13
2.4.1 Microsatellite polymorphism............................................................................ 13
2.4.2 Estimation of the number of genetic clusters and assignment of individuals to
populations........................................................................................................ 14
2.4.3 Within and between population diversity ......................................................... 16
2.4.4 Causes of the observed population structure .................................................... 17
2.5 Discussion .................................................................................................................. 19
3 Analysis of winter hardiness of divergent wheat material under field conditions
using chlorophyll fluorescence analysis 22
3.1 Abstract ...................................................................................................................... 22
3.2 Introduction ................................................................................................................ 22
3.3 Material and Methods ................................................................................................ 24
3.3.1 Plant material and growth conditions ............................................................... 24
3.3.2 Phenotype assessment....................................................................................... 24
3.4 Results ........................................................................................................................ 26
I
3.4.1 Temperature conditions .................................................................................... 26
3.4.2 Comparison of tested accessions with standard lines....................................... 27
3.4.3 Effect of experimental season on winter survival ............................................ 27
3.4.4 Time course of Fv/Fm and leaf greenness throughout the winter season .......... 28
3.5 Discussion .................................................................................................................. 32
4 Analysis of the promoter region of the transcription factor TaCBF12 in wheat
accessions of contrasting winter hardiness 35
4.1 Abstract ...................................................................................................................... 35
4.2 Introduction ................................................................................................................ 35
4.3.1 Primer design.................................................................................................... 37
4.3.2 DNA analysis.................................................................................................... 37
4.3.3 Data analysis..................................................................................................... 38
4.4 Results ........................................................................................................................ 38
4.4.1 Sequence variability ......................................................................................... 38
4.4.2 Identification of transcription regulatory elements .......................................... 40
4.5 Discussion .................................................................................................................. 41
5 Identification of sequence variant associated with freezing tolerance in wheat by
candidate gene-based and genome-wide association analyses 45
5.1 Abstract ...................................................................................................................... 45
5.2 Introduction ................................................................................................................ 45
5.3.1 Plant material and growth conditions ............................................................... 46
5.3.2 Sequence analysis ............................................................................................. 46
5.3.3 Population structure and association mapping ................................................. 47
5.3.4 False discovery rate control .............................................................................. 47
5.4 Results ........................................................................................................................ 47
5.4.1 Comparison of haplotypes ................................................................................ 47
5.4.2 Population structure.......................................................................................... 48
5.4.3 Candidate gene based association mapping...................................................... 50
5.4.4 Genome wide association mapping .................................................................. 51
5.5 Discussion .................................................................................................................. 52
6 General Conclusions 55
7 References 58
8 Appendix 69
Acknowledgements 77
Curriculum vitae 79
II
Summary
Wheat (Triticum aestivum L.) is cultivated on more than 240 million hectares, a larger area
than for any other crop. Furthermore, the trade in wheat worldwide is greater than for all the
crops combined. The intraspecific reduction of wheat genetic diversity caused by the
development of high-yielding cultivars enhances the risk of loss of adaptation to abiotic stress
such as frost, which periodically accounts for significant losses in the production of winter
wheat. The use of genetic resources for improving wheat is considered to be the most
sustainable way conserving valuable genetic material for the future. In the recent past,
genomics emerged as the result of technical advances in molecular biological techniques and
in bioinformatics. Genomic research can contribute to the use of genetic resources for wheat
adaptation to winter hardiness as it is possible to identify alleles useful for wheat
improvement. This project aimed to survey genetic resources for wheat winter hardiness
improvement by investigating genetic and phenotypic diversity and by determining the
genetic basis of frost tolerance in wheat by association mapping.
The plant material was a set of 320 wheat accessions provided by the genebank of Agroscope
Changins-Wädenswil (Switzerland). This material originated from 40 countries and each
accession was genotyped at 32 loci with microsatellite (SSR) markers. The genetic diversity
study detected a high genetic diversity. A parametric genetic mixture analysis was conducted
to analyze the stratification. This analysis identified twelve subpopulations. Many of the
populations consisted mainly of accessions from a certain geographic area or of a particular
growth type.
A subset of 103 accessions was grown under field conditions without snow cover in Jura in
two consecutive winters. Maximum quantum efficiency of PSII primary photochemistry
(Fv/Fm) and leaf greenness were determined throughout the season, and winter survival and
shoot dry weight were assessed at the end of the winter. Due to low temperatures, as low as
-29 °C in both seasons, frost damage occurred in the less winter hardy accessions. The
determination of Fv/Fm and leaf greenness enabled a classification of the accessions with
respect to winter hardiness and revealed large phenotypic variation within the studied wheat
accessions.
In order to investigate the genetic basis of wheat adaptation to frost, a candidate gene-based
and a genome-wide association study was performed in a collection of 95 wheat accessions.
The gene TaCBF12, which codes for a transcription factor of the AP2 type, was used as
III
candidate gene due to its positional association with the Fr-A2 locus, which is located on
chromosome 5A and is known to be the major locus for frost tolerance in wheat. The
sequencing of the promoter region of TaCBF12 revealed nine completely associated single
nucleotide polymorphisms (SNPs) resulting in two haplotypes. The promoter region was
found to contain several cis-acting elements of low temperature regulation. The SNPs caused
that the two haplotypes differed in the presence, respectively absence, of two cis-acting
elements, which are probably involved in the acclimation to low temperature. Therefore, the
two haplotypes were tested for an association with the variation in winter hardiness. No
association was found, suggesting a minor effect of TaCBF12 on phenotypic variation in frost
tolerance. However, a highly significant association was found between the marker Xcfa2173
on chromosome 4D and variation in the fluorescence parameter Fv/Fm at the beginning of the
winter. The identified alleles may be useful in the selection for frost tolerance during winter
hardening of wheat.
IV
Résumé
Avec plus de 240 millions d’hectares, le blé est la culture occupant la plus vaste surface dans
le monde. Ces échanges sur le marché mondial sont plus importants que ceux des autres
cultures réunies. Le développement de cultivars à hauts rendements a entraîné une baisse de la
variabilité génétique des variétés cultivées ce qui augmente le risque d’un manque
d’adaptation aux stress abiotiques. Parmi ces stress, le gel est régulièrement responsable
d’importantes pertes de rendement chez le blé. La caractérisation des ressources génétiques
est un pré-requis pour leur intégration future en amélioration végétale et la restauration de la
diversité génétique de cette espèce. Ces dernières années, la génomique a émergé grâce aux
avancées conjointes des techniques moléculaires et bioinformatiques. La recherche
génomique qui permet l’identification d’allèles utiles à l’amélioration du blé, détient le
potentiel de contribuer à l’utilisation des ressources génétiques pour l’adaptation du blé au
gel. L’objectif de ce projet est d’évaluer, chez le blé, les ressources génétiques pour la
tolérance au gel par l’étude de la diversité phénotypique et par la détermination des bases
génétiques de la tolérance au gel au moyen de la génétique d’association.
Un panel de 320 accessions de blé d’origines diverses fourni par la banque de gènes de
l’Agroscope de Changins-Wädenswil (Suisse) a été utilisé. Pour évaluer la diversité génétique
de ce panel, chaque accession a été évaluée au moyen de marqueurs microsatellites au niveau
de 32 loci. Une grande diversité génétique a été mise en évidence. Une analyse d’hybridation
génétique a été menée afin de mettre en évidence la stratification. Cette analyse a permis
l’identification de douze sous-populations. Un certain nombre de sous-populations
rassemblaient des individus d’une origine géographique donnée ou d’un type particulier de
blé (hiver ou printemps).
Un sous-ensemble de 103 accessions a été cultivé en conditions de champ, sans couverture
neigeuse, dans le Jura pendant deux hivers consécutifs. Le rendement quantique maximum de
la photochimie de PSII (Fv/Fm) et la verté des feuilles ont été mesurés durant la saison
hivernale ; la survie et le poids sec de la partie foliaire ont été évalués à la fin de l’hiver. Des
températures atteignant -29°C pendant les deux hivers ont occasionnés des dégâts liés au gel
sur les blés les moins tolérants. La détermination du rapport Fv/Fm et de la verté ont permis
une classification des accessions en fonction de leur degré de tolérance et ont révélé une
considérable variation phénotypique parmi les génotypes de blé étudiés.
V
Afin d’étudier les déterminants génétiques de l’adaptation du blé au gel, des études
d’association par les approches gène-candidat et «génome-scan» ont été menées chez une
population de 95 accessions de blé. Le gène TaCBF12, qui code un facteur potentiel de
transcription de type AP2, a été choisi comme gène-candidat à cause de son association
positionnelle avec le locus Fr-A2, cartographié sur le chromosome 5A et connu comme étant
le locus majeur de tolérance au gel chez le blé. Le séquençage de la région promotrice de
TaCBF12 a mis en évidence neuf polymorphismes simples nucléotides (SNPs) complètement
associés entre eux, générant deux haplotypes. Des éléments cis-régulateurs de régulation en
basses tenpératures étaient visibles dans la région promotrice. Les SNPs ont engendré la
présence de deux éléments cis-régulateurs, probablement impliqués dans l’acclimatation au
froid, différenciant les deux haplotypes. Ces deux haplotypes ont ensuite été testés pour leur
association avec la variation phénotypique. Aucune association n’a été trouvée suggérant un
effet mineur de TaCBF12 sur la variation phénotypique de la tolérance au gel. Toutefois, une
association fortement significative a été trouvée entre le marqueur Xcfa2173 sur le
chromosome 4D et la variation du paramètre de fluorescence Fv/Fm au début de l’hiver. Les
allèles identifiés pourraient être utiles en sélection pour la tolérance au gel pendant la phase
d’endurcissement du blé.
VI
List of abbreviations
bp Base pair
CBF C-repeat binding factor
cM Centimorgan
COR Cold-regulated
DRE/CRT Drought-responsive element/C repeat
DREB Drought-responsive element binding protein
Fr-A2 Frost tolerance locus on chromosome 5A
Fv/Fm Maximum quantum efficiency of Photosystem II primary photochemistry
GEVES French group of varieties and seeds study and control
GLM General linear model
ICE Inducer of CBF expression
INRA French national institute of agronomical research
LD Linkage disequilibrium
MLM Mixed linear model
PAM Pulse amplitude modulation fluorometer
PCR Polymerase chain reaction
PSII Photosystem II
QTL Quantitative trait locus
RAC Federal station of agronomical research of Changins
Rpm Rotation per minute
SNP Single nucleotide polymorphism
SPAD Soil plant analyses development
SSR Simple sequence repeats
VII
Chapter 1
1 General Introduction
Wheat (Triticum aestivum L.) was one of the first domesticated food crops and has been the
major staple in Europe, North Africa and central Asia for 8000 years. It is still one of the most
important food crops. Wheat is cultivated on more than 240 million hectares, which is the
largest area of any crop. The most suitable latitudes for wheat cultivation are between 30° and
60° N and between 27° and 40° S (Nuttonson 1955). Wheat grows from 0 to 3,000 m a.s.l.
The optimum growing temperature is 25 °C with a minimum of 3 to 4 °C and a maximum of
30 to 32 °C (Briggle 1980). Precipitations for wheat cultivation range between 250 and 1750
mm (Leonard and Martin 1963). World trade in wheat is greater than for all the other crops
combined. In 2005, worldwide production of wheat reached 625 million tons (FAOSTAT, see
http://faostat.fao.org/). The world population is predicted to increase to 7.9 billion by 2025
(United States Census Bureau, see http://www.census.gov/ipc/www/idb/worldpopinfo.html).
Assuming that wheat consumption remains stable, 786 million tons of wheat will be required
by 2025. The only way to meet this demand is to develop marginal lands for wheat
production. Frost is a major factor that limits the expansion of wheat and it periodically
accounts for significant reductions in plant productivity. Making use of the genetic diversity
in genetic resources of wheat, improving frost tolerance is the most sustainable way of
supporting food security. In the last decade, tremendous progress has been made in wheat
genomic research, which has the potential to solve the major problems associated with the
genetic basis of frost tolerance.
1.1 Frost-induced damage and cellular response to low temperature

Low temperature reduces the velocity of many enzymatic reactions and, in particular, inhibits
certain enzymes in the dark reaction of photosynthesis. In contrast, photosynthetic electron
transport is affected only slightly by temperature (Fracheboud and Leipner 2003). Under these
conditions, chlorophyll still absorbs light energy but can not use this energy for
photosynthesis. This excess of excitation has to be dissipated as heat, because pigments that
remain in an excited state pose the risk of generating free radicals, which lead to oxidative
stress (Hurry et al. 2000). This production of reactive oxygen species contributes to
membrane damage (Mc Kersie and Bowley 1997). When temperature drops below 0 °C, ice
formation is initiated in the intercellular spaces; the extracellular fluid has a higher freezing
point than the intracellular fluid due to its lower solute concentration. The formation of
1
General Introduction
extracellular ice results in the movement of water from inside the cell to the intercellular
spaces, which result in severe dehydration of the plant cell. The accumulation of ice in the
intercellular spaces can cause physical disruption of the cell (Levitt 1980). Moreover, low
temperature triggers protein denaturation, which could potentially harm the cell (Guy and Li
1998), and induces lipid transformations (Steponkus et al. 1993; Uemura and Steponkus
1997).
The strategy of plants to avoid frost-induced injury seems to depend mainly on achieving: (i)
membrane stability, (ii) inhibition of ice formation, (iii) prevention of dehydration and (iv)
macromolecular stability. Membrane stability seems to be the result of the action of lipids and
proteins. In particular, an asymmetry of membrane lipids contributes to stability (Sung et al.
2003). Similarly, amphipathic α-helical regions which form by late embryogenesis abundant
(LEA) polypeptides stabilize membranes against damage caused by freezing (Thomashow
1999). Furthermore, proteins encoded by cold-regulated (COR) genes seem to play a role in
the stabilization of the chloroplast membrane (Crosatti et al. 1999). The inhibition of
intracellular ice formation is achieved by antifreeze proteins (AFP) (Smallwood et al. 1999;
Griffith et al. 2005; Tremblay et al. 2005). Dehydrins prevent dehydration (Fu et al. 2000).
Moreover, sugars such as sucrose, glucose, fructose, raffinose and stachyose have a
cryoprotectant effect (Castonguay et al. 1995), and proline, glycine, betaine and sorbitol act as
osmoprotectants by increasing the osmotic pressure in the cytoplasm (Rudolph et al. 1986).
Protection from protein denaturation is achieved by molecular chaperones (Wang et al. 2003).
1.2 Cold acclimation and winter hardiness of wheat

Many plant species have the potential to cold acclimate, acquiring an enhanced tolerance to
negative temperature when exposed to a period of low but positive temperature. Cold
acclimation is a reversible process, which is suppressed when temperatures exceed 0 °C, for
example during a spell of mild weather or in spring. In a second phase of hardening, exposure
to negative but non injurious temperatures can confer to plants an increased tolerance to
severe frost (Trunova 1965; Olien 1984; Castonguay et al. 1993; Castonguay et al. 1995;
Livingston 1996). Winter wheat is less frost tolerant than rye but is more tolerant than barley
(Hömmö 1994). The acquired frost tolerance results from a combination of developmental,
genotypic and environmental factors. According to Lecomte et al. (2003), the main factors
that influence the acquired frost tolerance of wheat are growth stage, hardening conditions,
the length of cold spells, sequences of frost and defrost, snow cover, maximum tolerance,
2
Chapter 1
speed of hardening, and the ability to maintain tolerance. The growth stage is important
because at early developmental stages (e.g. first leaf stage), wheat seedlings can withstand
temperatures only as low as -12 °C. To achieve a good frost tolerance, a growth period of
three to five weeks at temperatures below 15 °C is necessary; the plants can accumulate
reserves. Negative temperatures favor a high and sustainable frost tolerance, but severe frost
near the tolerance threshold of the variety causes a loss of tolerance. Furthermore a succession
of frost and warm periods leads to a progressive decrease in frost tolerance. Snow cover has
an insulating and, therefore a protective effect even when the snow layer is less than 5 cm.
In wheat, the maximum frost tolerance is around -12 °C for sensitive varieties and about
-32 °C for the most tolerant varieties. However, as mentioned above, the maximum resistance
can be expressed only when the plant has reached a sufficient developmental stage and when
the conditions for hardening have been met. The time required to reach the maximum
tolerance is between three and five weeks, depending on the variety. This difference in
acclimation speed can play a role during early cold spells, as fast acclimating varieties are
better able to tolerate these cold spells. Furthermore, the ability of a variety to maintain cold
hardiness contributes to its general winter hardiness when late cold spells occur after a warm
period at the end of winter.
1.3 Determination of frost tolerance

There are a number of approaches to studying the frost tolerance of plants. Under field
conditions, winter survival is usually determined or frost damage is visually assessed and
quantified as the percentage of yellow leaf area after strong frost events. In the laboratory,
frost-induced leaf damage is often determined by measuring electrolyte leakage. The
measurement of electrical conductivity permits the assessment of the temperature at which 50
% of the electrolytes had leaked from a leaf or a plantlet (LT50) and, therefore, expresses the
degree of frost hardiness. A similar method is the measurement of the triphenyl tetrazolium
chloride-reduction (TTC-reduction) capacity, which provides the degree of frost hardiness of
the sample expressed as the temperature at which the amount of formazan formed after TTC-
reduction is 50 % of that formed in control leaves. For many years, the chlorophyll
fluorescence has been routinely used for the non-invasive assessment of photosynthetic
performance of plants.
The analysis of chlorophyll fluorescence is a very powerful tool for accessing the plant’s
tolerance to abiotic stress factors (Fracheboud and Leipner 2003). Many parameters of the
3
chlorophyll fluorescence are strongly affected by temperature and can be used to determine
frost tolerance. Exposure of plants to low temperature in the light results in an energy
imbalance that can lead to photoinhibition (Osmond 1994). This decrease in the maximum
quantum efficiency of PSII primary photochemistry (Fv/Fm), which can occur due to freezing
stress, indicates a change in the PSII reaction center, from a functional to a down-regulated or
non-functional reaction center (Powles 1984; Krause 1988). The measurement of Fv/Fm has
an advantage over the other fluorescence parameters under conditions at which frost stress
must be evaluated at fluctuating temperature, Fv/Fm per se is temperature-independent since
the efficiency of energy transfer at the PSII is a quantum tunneling effect. Beside Fv/Fm, the
quantum yield of electron transport at photosystem II (φPSII) has been reported to allow to
differentiate Triticum species with different cold tolerance (Rekika et al. 1997).
1.4 Genetic aspects of frost tolerance in wheat

Hexaploid wheat presumably originated in Iran, southwest of the Caspian Sea, as a result of
the hybridization between tetraploid wheat (ssp. Dicoccon or ssp. Parvicoccum, AABB
genome) and the diploid Aegilops tauschii (DD genome) followed by chromosome doubling
(Bonjean and Angus 2001). In wheat, at least ten of the 21 chromosome pairs seem to be
involved in a complex inheritance of frost tolerance (Cahalan and Law 1979; Sutka et al.
1986). The group 5 chromosomes and the chromosomes 2B and 4B were reported to be
important in determining frost tolerance, and it has often been suggested that chromosome 4D
is involved in frost tolerance. Furthermore, a quantitative trait locus (QTL) for frost tolerance
was detected on chromosome 1D (Båga et al. 2007). The chromosome 5A carries two loci for
frost tolerance Fr-A1 (formerly Fr-1) and Fr-A2. In Triticum monococcum, these loci are
separated by a distance of 30 cM. (Sutka and Snape 1989; Vágújfalvi et al. 2003). Fr-A1, the
gene for frost resistance is closely linked to gene Vrn-A1, which controls vernalization
(Galiba et al. 1995; Sutka et al. 1999). Chromosome 5B carries two loci for frost tolerance
orthologous to Fr-A1 and Fr-A2 named Fr-B1 and Fr-B2 (Tóth et al. 2003), and chromosome
5D carries the orthologous loci for frost tolerance Fr-D1 (formerly Fr-2) and Fr-D2 (Snape et
al. 1997). A cluster of CBF genes was mapped on the Fr-Am2 locus of Triticum monococcum
(Miller et al. 2006). The CBF genes encode cold-responsive transcription factors of the AP2
type. In Arabidopsis, the CBF3 was shown to play a key regulatory role in freezing tolerance
(Liu et al. 1998). Overexpressing this gene in Arabidopsis enhanced freezing tolerance (Jaglo-
4
Chapter 1
Ottosen. et al. 1998; Kasuga et al. 1999). Therefore, the CBF genes seem to be a potential
target for dissecting genetic variation in frost tolerance.
1.5 Use of genetic resources for wheat improvement

The intraspecific reduction caused by the development of high-yielding cultivars enhances the
risk of losing adaptation to abiotic stress such as frost, which periodically accounts for
significant reductions in wheat productivity. The use of genetic resources to improve wheat is
considered to be the most sustainable way of conserving valuable genetic resources for the
future. Genetic resources are all the material that is available for improving a cultivated plant
species (Becker 1993) and are divided into four gene pools. The primary gene pool consists of
species (including the target species), which are easily crossed to the target species. The
secondary gene pool is made up of related species; their crossing with the targeted species
often results in a low percentage of viable seeds and partially sterile progenies. The tertiary
gene pool is defined by species, which can be used only by applying techniques such as
embryo rescue or protoplasm fusion. Today a fourth class exists: isolated genes, which cross
all the boundaries of plants, animals or microorganisms.
Worldwide, more than 1500 genebanks are registered in the WIEWS (World Information and
Early Warning System on PGR) and SIS (Seed Information System) databases. They
conserve more than five million accessions belonging to more than 18000 species. The
WIEWS facilitates the exchange of information among member countries on their gathered
information on plant genetic resources. In Europe, many genebanks exist in which Triticum
aestivum accessions are held under the following statuses like wild, weedy, traditional cultivar
or landrace, breeder’s line or advanced cultivar. In Switzerland, three institutes hold 4386
Triticum aestivum accessions from various countries. Among these institutes, the Agroscope
Changins-Wädenswil, a governmental institute, is engaged in plant genetic resources
activities and holds an ex situ collection of plant genetic resources with 4331 Triticum
aestivum accessions (2000 traditional cultivars/landraces, 1700 breeder’s lines and 631
undefined accessions) (FAO see http://apps3.fao.org/wiews/). The cereal activities of the
Agroscope Changins-Wädenswil are conservation, characterization, utilization and plant
breeding.
5
1.6 Contribution of genomic research and molecular markers to crop

improvement
In the last few years, genomics has emerged from the technical advances made in molecular
biological techniques and bioinformatics. Genomics aims at examining all genes and their
functions of an organism. It has the potential for using genetic resources for the adaptation of
wheat adaptation to frost as genes which can be used to improve wheat are identified.
Genomic regions for a trait of interest can be identified by quantitative trait loci (QTL)
analysis using a segregating population from two inbred lines. However, long stretches of
chromosomes, in linkage disequilibrium (LD), because of a low number of generations after
maximum LD is reached in the F1, lead to large confidence intervals for QTLs. In comparison
with QTL analyses, association studies have the potential to mine directly the allelic diversity
of genetic resources and to identify alleles that are beneficial for the trait of interest. For an
association study, a random population sample of unrelated individuals is required. Because
population structure can lead to false associations, it must be controlled. Such spurious
associations can arise from extensive interchromosomic LD caused by an admixture of
populations with different allele frequencies. Consequently, significant trait-marker
associations can be found with markers, even if they are not in the very close proximity of
trait loci. Two strategies have been developed for association mapping (Oraguzie and Wilcox
2007). One is based on candidate genes: the candidate gene is sequenced within germplasms
showing phenotypic variation in order to detect polymorphism in the gene, which is
potentially associated with the phenotype. The second strategy consists of genotyping the
genome with evenly distributed markers. A significant association can be detected if the
chosen markers are in LD with genes controlling the phenotypic variation (Haussmann et al.
2004).
In order to avoid spurious associations due to population structure, the genetic stratification of
the sample population is analyzed by means of molecular markers. They are an efficient tool
in diversity studies for identifying the degree of genetic similarity. Due to their high rate of
polymorphism, co-dominant character, selective neutrality, distribution across the genome
and cost and labor efficiency, microsatellites or simple sequence repeats (SSRs) are suitable
markers for detecting allele frequency within the population and for assessing population
structure. The SSRs are tandemly repeated motifs of one to six bases. Polymorphism is
created by the loss or gain of repeats. Three mechanisms may be responsible for the
occurrence of new alleles at SSR loci: replication slippage, unequal crossing-over and genetic
recombination. Replication slippage seems to be responsible for affecting the repeat number
6
Chapter 1
of short tandem arrays (Tachida and Lizuka 1992) whereas unequal crossing-over affects long
tandem arrays (Harding et al. 1992).
In association mapping, in particular candidate gene-based association mapping, single
nucleotide polymorphisms (SNP) are attractive markers because of their high frequency, low
mutation rate and amenability to automation. SNPs are individual differences in nucleotides
between two DNA sequences. SNPs are produced by mutations in part due to errors during
DNA replication. The mutation frequency is not random between two bases; it depends on the
nature of the base, the sequence in the vicinity and the methylation status of the DNA.
1.7 Aim of the study

To achieve a sustainable agriculture under changing climatic conditions, wheat varieties are
required, which are characterized by a high degree of winter hardiness and a low demand of
vernalization. Therefore, the long-term aim is to better understand the response of wheat to
frost and its genetic background in order to develop methods to improve its winter hardiness.
For this purpose, it is important to use the genetic resources of wheat and to study the genetic
and molecular mechanisms of frost tolerance.
The focus of this thesis is on three major areas in research of the use of genetic resources for
improving wheat with regard to frost tolerance: (i) investigation of genetic and phenotypic
diversity of the wheat genetic resources available at Agroscope Changins-Wädenswil, (ii)
testing the chlorophyll fluorescence analysis for assessing winter hardiness and (iii) the
determination of the genetic basis of frost tolerance in wheat by association mapping.
7
Phylogenetic analysis of wheat
2 Phylogenetic analysis of wheat (Triticum aestivum L.)

accessions by microsatellite markers and parametric
genetic mixture analysis
2.1 Abstract
The investigation of the genetic diversity of wheat germplasm in order to broaden genetic
variation in future wheat breeding is necessary to face biotic and abiotic threats. In order to
assess the genetic diversity of a sample of 320 accessions of hexaploid wheat (Triticum
aestivum L.), originating in 40 countries, each accession was genotyped at 32 loci with
microsatellite (SSR) markers. The average allele number per SSR locus was 10.3. The highest
gene diversity was detected among southern American accessions. A parametric genetic
mixture analysis was used to facilitate the identification of subpopulations. This analysis
identified 12 subpopulations. One population showed considerably higher gene diversity
compared to the populations as a whole. Most of the populations consisted mainly of
accessions from certain regions or of a particular wheat variety.
2.2 Introduction
Knowledge of germplasm diversity has a significant impact on the improvement of crops. The
development of genetically homogeneous wheat cultivars and the promotion of only a few
widely adapted wheat varieties contributed to a sharp intraspecific reduction of genetic
diversity. This narrow genetic diversity is problematic for breeding for biotic and abiotic
stress tolerance. Therefore, the investigation of genetic diversity in wheat germplasm is
necessary in order to broaden genetic variation in future wheat breeding programs.
An assessment of genetic diversity can be based on morphological traits, but their expression
is environmentally dependent. Molecular markers are a solution to evaluating genetic
diversity. Molecular markers such as RAPDs (random amplification of polymorphic DNAs),
RFLPs (restriction fragment length polymorphisms), AFLPs (amplified fragment length
polymorphisms), STS (sequence-tagged sites) and SSRs (simple sequence repeats) have
already been used to study the genetic diversity of wheat (Joshi and Nguyen 1993; Chen et al.
1994; Siedler et al. 1994; Nagaoka and Ogihara 1997; Barrett and Kidwell 1998; Burkhamer
et al. 1998; Kim and Ward 2000). However, low polymorphism was revealed by most of these
marker systems for wheat cultivars (Chao et al. 1989; Devos and Gale 1992). SSRs were an
exception. They are suitable markers for assessing the genetic variation of wheat because
8
Chapter 2
SSRs are multiallelic, chromosome specific and are evenly distributed along the chromosome
(Röder et al. 1998a; Röder et al. 1998b). SSR markers were shown to be highly polymorphic
in diploid species, in the tetraploid wild wheat Triticum dicoccoides, in the D-genome donor
of wheat, Aegilops tauschii, and in hexaploid wheat (Plaschke et al. 1995; Donini et al. 1998;
Hammer et al. 2000; Pestsova et al. 2000; Prasad et al. 2000; Stachel et al. 2000; Fahima et al.
2002). Furthermore, SSRs have been successfully used in wheat for QTL identification
(Parker et al. 1998), resistance gene tagging (Peng et al. 1999; Börner et al. 2000b), marker-
assisted selection (Korzun et al. 1998; Huang et al. 2000) and for investigating the genetic
stability of genebank accessions (Börner et al. 2000a). The use of SSRs has facilitated the
identification of subtle population subdivisions by focusing on the distribution of ancestry
proportions, which can provide additional information about admixture processes (Falush et
al. 2003).
There is a great potential for improving abiotic stress tolerance, e.g. winter hardiness, by
integrating seed material from gene banks in the actual breeding material. However, the
genetic resources stored in gene banks are often poorly analyzed in respect to their
physiological potential as well as their genetic background. Therefore, the investigation of the
genetic diversity in wheat is a prerequisite for identifying genetic resources with high stress
tolerance. Thus, the objective of the present study was to assess the genetic diversity of a
large number of hexaploid wheat germplasms. Furthermore, this study was the basis for
further physiological and molecular biological analyses.
2.3 Material and Methods

2.3.1 Plant material
Two hundred ninety-eight wheat (Triticum aestivum L.) accessions were provided by
Agroscope Changins-Wädenswil (Switzerland). Furthermore, 22 accessions were supplied by
INRA Dijon (France). The accessions originated from 40 countries (Fig. 2.1) and consisted of
released and unreleased cultivars, breeding lines and local variety/landraces (Table Appendix
1). The material consisted of 153 winter, 72 spring and 3 intermediate wheat types; the growth
habit of the remaining 92 accessions was not catalogued in the European Wheat Database
(EWDB) (see http://genbank.vurv.cz/ewdb/).
9
25
3
90 54 1
24 26 2 1
1
3 2 2
3
1
15
4
3
1 14
11 3
4 7 15+1 4
4 1 4 24
17
33 13 14 9 3
25 2
6
14 11
6 6 3
Figure 2.1: Origin of investigated wheat accessions. Number of accessions from each
country, and for four European regions is given above the country. Dark blue, North America;
dark red, South America; light blue, northern Europe; dark-green, western Europe; red,
southern Europe; green-yellow, Eastern Europe (countries of the Warsaw pact including the
former Yugoslavia but excluding the former Soviet republics Kazakhstan and Armenia); grey,
Africa; yellow, Asia; turquoise, Oceania.
2.3.2 Microsatellite analysis

For DNA extraction, wheat plants were grown in growth chambers at 18/16°C (day/night) in
0.75-l pots under a 12-h photoperiod (300 μmol photons m-2 s-1) and at a relative humidity of
60/70 % for 30 days. The plants were watered and fertilized with Wuxal nutrient solution as
required. From five-week-old plants, approximately 5 g of leaf tissue were collected and
frozen in liquid N2. Samples were ground in liquid N2, added to 15 ml of CTAB and
incubated at 65°C for 90 minutes. An equal volume of dichloromethan:isoamylalcohol was
added. The mixture was centrifuged at 3500 rpm for 15 minutes (Megafuge 2.0, Heraeus,
Osterode, Germany). The precipitate was added to 15 ml dichloromethan:isoamylalcohol,
mixed well and centrifuged at 3500 rpm for 15 minutes. 75 µl RNase A were added to the
supernatant and the mixture was incubated for 30 to 45 minutes. The DNA was then
precipitated with 10 ml of isopropanol. The pellet was hooked up by sterile pipettes and
washed in wash solution 1 (76% ethanol, 200 mM sodium acetate) and wash solution 2 (76%
ethanol, 10 mM ammonium acetate). Finally, the pellet was air-dried and the DNA was
suspended in 1 ml TE-buffer (10 mM Tris/HCl pH 8.0, 1 mM EDTA).
Twenty-three microsatellite markers, detecting 32 loci, were selected for genotyping on the
10
Chapter 2
basis of their chromosomal location. Markers that representatively cover the genome were
identified (Table 2.1): 12 Xgwm markers, developed at IPK Gatersleben (Institute of Plant
Genetics, Germany) (Röder et al. 1998b; Pestsova et al. 2000), 3 Xwmc markers from the
Wheat Microsatellite Consortium (Gupta et al. 2002), 1 Xbarc marker developed at USDA-
ARS (Beltsville, USA), 5 Xcfa markers developed at INRA Clermont-Ferrand, France
(Guyomarc'h et al. 2002b; Sourdille et al. 2003), 1 Xcfd marker (Guyomarc'h et al. 2002a) and
1 Xgdm marker (Pestsova et al. 2000; Paillard et al. 2003; Somers et al. 2004). The marker
was also tested on nullisomic-tetrasomic stocks in order to determine the wheat chromosome
which it was assigned. Two methods were used for polymerase chain reactions (PCR):
protocol A and B (Table 2.1). The PCR of protocol A was performed in 10 µl in a PTC-200
(MJ Research) Peltier 9600 thermal cycler. The reaction buffer contained 16.25 ng template
DNA, 0.125 mM of each deoxynucleotide, 10 nM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM
MgCl2, 0.05 µM labeled primer (IRD700 or 800), 0.2 µM unlabelled primer and 0.5 U Taq
DNA polymerase. Twenty-four to 35 cycles of 1 minute between 50 to 60°C (depending on
the primer combination, see Table 2.1) and 1 minute at 94°C were performed, followed by
two-minute elongation step at 72°C. Fragment analysis was carried out on a LI-COR 4200
DNA analyzer (Licor, Lincoln, NE, U.S.A.). Fifteen μl of formamide tracking dye
(Amersham) was added to each PCR sample and the PCR product was separated on 8%
acrylamide gels. A pattern diversity analysis was performed by visual scoring. For protocol B,
the reaction mixture (10 µl) contained 16.25 ng of template DNA, 2.5 mM dNTP, 1 µM M13-
tailed forward primer, 10 µM reverse primer, 100 mM Tris-HCl, 500 nM KCl, 15 mM MgCl2,
0.75 U Taq polymerase (Sigma) and 10 µM one of three fluorophores (6FAM, NED or VIC).
The PCR conditions were as follows: an initial denaturation step of 4 minutes at 94°C,
followed by 35 cycles of 1 minute at 94°C, 1 minute at Tm temperature (see Table 2.1), 2
minutes at 72°C followed by an extension step of 10 minutes at 72°C and a final step of 30
minutes at 60°C. Amplified products were detected on a DNA sequencer (ABI PRISM 3730
Genetic Analyzer, Applied Biosystems, Foster City, U.S.A.). Samples were prepared by
adding 1 µl of PCR product to 11.95 µl of HiD formamide and 0.15 µl of CIDR size standard.
Pattern diversity analysis was performed using GeneMapper software v4.0 (Applied
Biosystems, Foster City, U.S.A.). When markers produced more than one band, the bands
with clearly separated size ranges were scored independently as a different locus.
11
Table 2.1: Name, loci, repeat motif, allele number and gene diversity of the 23 tested
microsatellite markers. The annealing temperature (Tm) and the number of PCR cycles as well
as the protocol are given.
Name Locus Repeat motif a Allele Gene Tm Cycles Protocol

number diversity
Xbarc133 3B (CT)24 9 0.502 55 29 A

Xcfa2141 a 5A (GA)18 14 0.885
} 55 30 A
Xcfa2141 b 5D 3 0.196
Xcfa2153 1A (CT)27 20 0.920 55 35 B
Xcfa2163 5A (TC)16 11 0.439 55 35 B
Xcfa2173 4D (CA)28 16 0.841 55 24 A
Xcfa2174 a 7A (CT)15(GT)14 15 0.792
} 60 35 B
Xcfa2174 b 7B 6 0.515
Xcfd223 3D (TG)18 10 0.733 50 35 B
Xgdm132 6D (CT)24 15 0.854 60 35 B
Xgwm190 5D (CT)22 4 0.706 60 35 B
Xgwm234 a 5A (CT)16(CA)20 3 0.117
} 55 28 A
Xgwm234 b 5B 14 0.866
Xgwm311 a 2D (GA)29 13 0.861
} 60 35 B
Xgwm311 b 6B 14 0.274
Xgwm335 5B (GA)14(GCGT)3 19 0.865 55 35 B
Xgwm357 1A (GA)18 12 0.764 55 34 A
Xgwm37 7D (AG)8GG(AG)21 7 0.509 60 35 B
Xgwm526 a 2A (CT)16 7 0.624
} 55 35 B
Xgwm526 b 2B 4 0.148
Xgwm538 4B (GT)6T(GT)10 8 0.472 60 29 A
Xgwm570 6A (CT)14(GT)18 13 0.865 60 35 B
Xgwm624 4D (GT)26 11 0.816 50 35 B
Xgwm642 1D (GT)14 8 0.602 60 35 B
Xgwm779 3A (CA)31(GA)33 25 0.865 60 35 B
Xwmc150 a 5A (GT)21 5 0.640
Xwmc150 b 5D 4 0.506
} 50 33 A
Xwmc150 c 6A 10 0.794
Xwmc150 d 7D 6 0.609
Xwmc216 a 1B (GT)22 3 0.373
} 60 30 A
Xwmc216 b 1D 7 0.342
Xwmc232 4A (CA)11 8 0.454 55 30 A
a
Repeat motifs are based on the sequence of the variety Chinese Spring
2.3.3 Genetic diversity assessment

The gene diversity, which corresponds to the polymorphic information content (PIC)
(Anderson et al. 1993), was computed according to Nei (1973) as:
k
1 m k 2
Gene diversity = 1 − ∑ p 2j , for a single locus and 1- ∑∑ p ij for several loci,
j=1 m i =1 j=1
where pij is the frequency of the jth of k alleles for the ith of m loci.
12
Chapter 2
The genetic diversity of the wheat accessions was analyzed by clustering the accessions by
applying a parametric genetic mixture analysis implemented in the software structure version
2.2 (Pritchard et al. 2000). A number of genetic clusters (K) ranging from 1 to 20 were tested
using the linkage model in conjunction with the correlated allele frequency model (Falush et
al. 2003). The distances of all markers were obtained from the Wheat Composite 2004
(GrainGenes 2.0) with the exception of Xcfa2141 at 5D and Xwmc150 at 6A whose distances
originate from the Wheat Consensus SSR 2004 (Somers et al. 2004). For each K, 20
independent runs were implemented. For each run, 10 000 burn-in periods followed by 10 000
Markov chain Monte Carlo (MCMC) were found to be sufficient. The number of genetic
clusters (K) was estimated using the graphical method of Evanno et al. (2005) with minor
modifications.
2.4 Results
2.4.1 Microsatellite polymorphism
A total of 330 alleles were detected with an average allele number of 10.28 per locus and a
gene diversity of 0.617. The number of alleles ranges from 3 to 25 with the lowest gene
diversity, which is also called polymorphic information content (PIC), for Xgwm234a at
chromosome 5A and the highest for Xcfa2153 at 1A (Table 2.1). The highest number of
alleles per locus was detected in the A genome with 11.92, compared to 9.63 and 9.08 for
Table 2.2: Comparative analysis of genetic diversity among homologues groups and genomes
by the average allele number per locus and the gene diversity.
Group Average allele number Gene diversity
All 10.28 0.617
Genome
A 11.92 0.680
B 9.63 0.502
D 9.08 0.631
Homologues group
1 10.00 0.600
2 7.40 0.544
3 14.67 0.700
4 10.75 0.646
5 9.22 0.580
6 13.00 0.697
7 8.25 0.606
13
genomes B and D, respectively (Table 2.2). The corresponding gene diversity ranged from
0.502 for the B genome to 0.680 for the A genome. The highest allele number per locus
among the seven homologous groups was observed in chromosomal group 3 and the lowest in
group 2 which was also reflected by the gene diversity for these two groups which was 0.700
and 0.544, respectively (Table 2.2).
2.4.2 Estimation of the number of genetic clusters and assignment of individuals to

populations
The number of genetic clusters (K) was estimated from the rate of change in the log
probability of data between successive K values (ΔK) obtained from 20 independent runs
under the linkage model (Fig. 2.2). The mean likelihood L(K) over 20 runs decreased slightly
until K = 8 but increased strongly at higher K; at K > 12 the increase in L(K) became
K K
2 4 6 8 10 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20
-11000 400
-11500
A B 300
200
-12000
100
L'(K)
L(K)
-12500
0
-13000
-100
-13500 -200
-14000 -300
C D
500
1.5
400
|L''(K)|
ΔK
300 1.0
200
0.5
100
0 0.0
2 4 6 8 10 12 14 16 18 20 2 4 6 8 10 12 14 16 18 20
K K
Figure 2.2: Determination of the number of genetic clusters (K) using the graphical method
of Evanno et al. (2005). (A) Mean L(K) ± SD over 20 runs for each K value. (B) Rate of
change in the mean likelihood distribution calculated as L'(K) = L(K) - L(K-1). (C) Absolute
values of the second order rate of change in the mean likelihood distribution calculated as
|L''(K)| = |L'(K+1) - L'(K)|. (D) ΔK calculated as ΔK = |L''(K)|/SD[L(K)].
14
Chapter 2
considerably less (Fig. 2.2 A). Plotting |L''(K)|, which reflects the second order rate of change
in L(K) with respect to K, against K resulted in a peak at around K = 13 (Fig. 2.2 C). Dividing
|L''(K)| by the standard deviation of L(K) resulted in ΔK with a peak value for K = 12 (Fig. 2.2
D). Consequently, the number of genetic clusters (K) of the investigated plant material was
assumed to be K = 12.
The individual analyses of the 20 independent runs under the assumption of K = 12 revealed
that 7 out of the 12 populations were consistent among all the runs (D to G and I to K). The
populations A and B were joined to one population in 7 runs. For the assignment of the
individuals to one of the 12 populations, the p̂ max (the maximum proportional membership to
one of the 12 populations of each individual) of the Q matrices was taken from the run which
showed the highest mean p̂ max over all individuals. The comparative analysis of the mean of
p̂ max (corrected with p̂ max for maximum possible admixture) between successive K supported
the estimation of K by ΔK; the average p̂ max increased until K = 12 and remained constant at
higher K.
The value of α, which reflects the relative contribution of population k to the genetic material
in the sample, was α = 0.377 ± 0.026 (n = 20) at K = 12 suggesting that ancestry of many
accessions originated from admixed populations. Individual proportions of membership in
each group estimated are in agreement with the existence of a genetic stratification
(population structure) in the sample. Furthermore, the estimated value of the α-parameter is
consistent with the distribution of the proportional membership of individual accessions (Fig.
2.3).
1.0 A
B
0.8 C
D
0.6 E
F
0.4 G
H
0.2 I
J
0.0 K
L
Fig. 2.3: Barplot of the proportional membership of individual accessions within each of the
twelve inferred populations ( p̂ ). Each accession is represented by a vertical bar composed of
different colors representing the admixture to the twelve populations.
15
2.4.3 Within and between population diversity

The twelve populations consisted of 21 (populations C and D) to 31 (populations B, E and J)
individuals. The average allele number was ranged from about 4.1 and 5.3 which
corresponded to a gene diversity of 0.463 to 0.600 and an FST of 0.858 to 0.480 (Table 2.3).
The least dispersed population was population D. Population J had a higher gene diversity
than the whole set of 320 accessions (see for comparison Table 2.2); consequently, FST was
very low for population J (Table 2.3).
Table 2.3: Comparative analysis of genetic diversity among the populations, homologue
groups and genomes by means of the average allele number per locus and the gene diversity
as well as the standard measure of genetic distance, FST, for each population.
Population n Average allele number Gene diversity FST
A 24 5.00 0.539 0.594

B 31 4.97 0.529 0.467
C 21 4.81 0.544 0.743
D 21 4.06 0.463 0.858
E 31 4.75 0.468 0.763
F 28 4.53 0.488 0.651
G 25 4.81 0.539 0.619
H 25 4.69 0.502 0.708
I 29 5.31 0.600 0.480
J 31 7.44 0.662 0.012
K 29 5.06 0.553 0.557
L 25 4.94 0.559 0.610
The distances among populations were analyzed by the allele frequency divergence among
populations computed by the program structure using point estimates of P (Fig. 2.4). There
was a high allele frequency divergence between population J and all the other populations.
Furthermore, this analysis revealed that populations B, D, F and K were distinct from the
other populations.
16
Chapter 2
A
A
H
H
L
L
E
E
G
G
C
C
II
JJ
B
B
F
F
D
D
K
K
0.02
Fig. 2.4: Tree representing the distances among populations. The divergence in allele
frequency among the populations was computed using point estimates of P. The tree was
constructed using MEGA 3.1.
2.4.4 Causes of the observed population structure

Among the 12 populations which captured the relevant subdivisions of the samples, origin
seemed to play a role in the population structure observed. This is exemplified by the fact that
42.3 % of the southern European accessions were classified in population G (Fig. 2.5 A). In
this population a considerable number of the South American accessions was present. The
largest part of the South American material was classified in population H and made up one
third of the accessions of this population. The material from western Europe was classified in
all the populations, with population B consisting of 58.1 % of western European accessions,
for the most part from France. Population E also had a high percentage of western European
material (32.3 %). However, the special characteristic of this population was the high
percentage of northern European material; 48 % of the northern European accessions were
classified in population E.
17
N-America
40 A S-America
N-Europe
W-Europe
30 E-Europe
S-Europe
Africa
20 Asia
Oceania
10
0
Winter wheat
40 B
Number of accessions
Spring wheat
Intermediate
nd
30
20
10
0
albidum milturum
40 C alborubrum turcicum
barbarossa velutinum
erythroleucon nd
30 erythrosperum
sub-erythrospermum
ferrugineum
20 sub-ferrugineum
graecum
hostianum
10 lutescens
meridionale
sub-meridionale
0
A B C D E F G H I J K L
Population
Fig. 2.5: Origin (A), type (B) and variety (C) of the 320 accessions comprised in the 12
populations (A-L).
It was also possible to identify type-related causes of the populations. Indeed, wheat of the
winter type made up the predominant part of the populations D, E, F and, in particular B (Fig
2.5 B). The spring wheat type was distributed among the remaining populations, in particular
in K and L. A similar distribution was observed in respect to the varieties. The var. lutescens
was found mainly in population E (Fig 2.5 C). In contrast, populations H and K consisted of
52.0 and 44.8 % of var. erythrospermum, respectively. A considerable part of var.
ferrugineum was found in populations A, I and L.
18
Chapter 2
A comparative analysis of microsatellite diversity among the nine geographical regions

revealed that the accessions from South America exhibited more genetic diversity than those
from the other regions. In contrast, the northern European material showed the lowest
diversity (not considering Africa because of the low number of accessions from that
continent) (Table 2.4).
Table 2.4: Comparative analysis of genetic diversity among regions analyzed by the average
allele number and gene diversity.
Region n Average allele number Gene diversity
S-America 55 6.66 0.611

Asia 13 4.38 0.603
E-Europe 53 6.91 0.593
N-America 27 5.38 0.590
S-Europe 26 5.25 0.580
W-Europe 90 7.72 0.571
Oceania 27 5.19 0.568
N-Europe 25 4.53 0.509
Africa 3 1.84 0.324
2.5 Discussion
A set of 23 microsatellite (SSR) markers detecting 32 loci was used to characterize 320
accessions of hexaploid wheat. The SSR markers displayed a high level of polymorphism.
According to Huang et al. (2002), the number of alleles can be used to evaluate genetic
diversity because of the significant correlation between gene diversity and the number of
alleles. There was an average allele number of 10.3 per SSR locus in the investigated wheat
material whereas RFLP analyses revealed 4.7 polymorphisms per probe/enzyme combination
of the 81 European wheat cultivars (Siedler et al. 1994). Even fewer polymorphisms were
found with RAPDs primers; they generated only 1.8 polymorphisms per primer among the 15
investigated wheat cultivars (Joshi and Nguyen 1993). These findings support the finding of
Huang et al. (2002) who showed that SSR markers in wheat are more informative than RFLPs
and RAPDs. Similarly to the present results, Röder et al. (2002) found an average of 10.5
alleles per microsatellite locus by genotyping 500 European wheat varieties with a set of 20
SSR markers. Breseghello and Sorrells (2006) found an average number of 4.8 alleles per
SSR locus in 149 elite soft wheat cultivars. A similar number of alleles was found for 60
wheat cultivars from eastern Europe, genotyped at 42 SSR loci (Stachel et al. 2000). Other
19
estimates of mean allele number per locus in studies using SSR markers on diverse germplasm
were: 5.6 alleles at 70 loci on 58 Triticum durum cultivars of diverse geographical origins,
including old cultivars (Maccaferri et al. 2003) and 18.1 alleles at 26 loci on 998 accessions of
wheat from the genebank of IPK Gatersleben, Germany (Huang et al. 2002). The latter study
suggests a much larger genetic diversity than that found in the studied 320 accessions.
However, in respect to gene diversity (PIC), the difference between the gene diversity found
in the present study (0.62) and that found in the 998 accessions of the genebank of IPK
Gatersleben (0.77) (Huang et al. 2002) is smaller than the difference in the average number of
alleles. The gene diversity of the B genome was found to be considerably lower than the gene
diversity of the genomes A and D. This is consistent with the fact that the B genome is quite
different from A and D genomes whereas the A and D genomes are more similar (Bonjean
and Angus 2001). Huang et al. (2002) compared the gene diversity between wheat accessions
from northern and southern Europe and found lower gene diversity in varieties from northern
Europe than in those from southern Europe. The present study led to a similar finding. The
gene diversity of the northern European accession was 0.509, much lower than that of the
accessions from southern Europe (0.580).
In order to analyse the genetic stratification of the material, the genetic diversity of the 320
wheat accessions was analyzed by clustering the accessions by means of a parametric genetic
mixture analysis (Pritchard et al. 2000). The model-based clustering method of this analysis
was chosen to use mutilocus genotype data, to infer populations and to assign individuals to
these populations. It was assumed that SSRs frequencies correlated among populations as it is
often more effective than the independent frequencies model at detecting subtle population
structure (Falush et al. 2003). This method is also known to be more suitable for explanatory
data analysis than distance-based methods, because it is easier to assess the validity of explicit
modeling assumptions than to compare the relative merits of more abstract quantities such as
distance measures and graphical representations (Pritchard et al. 2000). The analysis of the
genetic stratification of the 320 accessions suggested a large admixture history between close
and distant relatives, gene flow between cultivated species and mutations, which contributed
to allele frequency modifications. The clustering method was successful because the gene
diversity in the obtained groups was lower than in the whole population. Furthermore,
clustering reflected the geographic origin of the material. Nevertheless, none of the clusters
was made up of varieties of just one origin. This can be easily explained when exchanges of
wheat material from one region to another is considered, which homogenized the wheat pool
and results in similar allele frequencies. For example, a relatedness was found between wheat
20
Chapter 2
accessions from South America and wheat from southern Europe. This relatedness can be
historically explained by the fact that Spaniards brought wheat to Mexico in 1529 from where
it was distributed to South America (Bonjean and Angus 2001).
In summary, a study of the genetic diversity of 320 wheat accessions based on 32 SSR loci
revealed a high genetic diversity among these wheat accessions. The linked model-based
diversity analysis identified twelve subpopulations. This genetic diversity survey will help to
broaden genetic variation in future wheat breeding.
21
Analysis of winter hardiness
3 Analysis of winter hardiness of divergent wheat

material under field conditions using chlorophyll
fluorescence analysis
3.1 Abstract
Tolerance to frost is an important goal in wheat cultivation to expand the growth area and to
reduce pre-harvest losses. The goals of this work were to characterize wheat accessions with
contrasting frost tolerance and to investigate the suitability of chlorophyll fluorescence and
leaf greenness traits as selection criteria for winter hardiness. One hundred three wheat
accessions were grown under field conditions without snow cover at the altitude station of
INRA Dijon in Chaux des Prés (France). Maximum quantum efficiency of PSII primary
photochemistry (Fv/Fm) and leaf greenness were determined throughout two winter seasons.
Winter survival and shoot dry weight were assessed at the end of the winter. There was a
large variation in winter hardiness within the investigated material. The determination of
Fv/Fm in combination with leaf greenness permitted a differentiation of the accessions in
respect to their winter hardiness already at the beginning of the winter. A distinct grouping of
the investigated plants with regard to their ability to maintain frost tolerance was revealed by
an analysis of the time course of Fv/Fm .
3.2 Introduction
Breeding programs for winter hardiness have been traditionally empirical. Classical selection
for winter hardiness takes account of winter survival and frost damage or focuses on the yield
per se as a final integrator of all the processes occurring during the life of the plant. However,
meeting the challenges to increase winter hardiness will depend on a better understanding of
the underlying physiological processes of winter hardiness. As well as the cold acclimation
process sensu stricto, which permits an enhanced tolerance to subzero temperatures when
plants are submitted to a period of low but positive temperatures, the second phase of
hardening confers increased tolerance to negative temperatures by exposure to negative but
non injurious temperatures (Livingston 1996). In wheat, temperatures as low as -12 °C can be
tolerated by sensitive varieties, while tolerant genotypes can withstand temperatures of
-32 °C. However, at early developmental stages, seedlings can hardly tolerate temperatures
below -12 °C. Good winter hardiness requires a sufficiently long growth period for the plant
to accumulate reserves. Furthermore, it requires a mean daily temperature below 15 °C and
22
Chapter 3
between 3 and 5 weeks of low temperature (Lecomte et al. 2003). As well as the temperature
during the phase of cold acclimation, light intensity also plays an important role in acquiring
maximal frost tolerance (Öquist and Huner 2003). The freezing tolerance of winter wheat can
be increased when plants develop under a higher light intensity (Pocock et al. 2001). Hereby,
the excitation pressure seems to be of great importance, because a large number of genes,
which are induced at low temperature, can also be induced by light (Ndong et al. 2001).
Therefore, the response of the photosynthetic apparatus to low temperature seems to play a
major role in cold acclimation.
In order to determine the effects of environmental factors on the functioning of the
photosynthetic apparatus, chlorophyll fluorescence analysis has a great potential (Fracheboud
and Leipner 2003). Many authors evaluated frost tolerance by this method (Sundbom et al.
1982; Barnes and Wilson 1984; Lindgren and Hällgren 1993; Öquist et al. 1993). In
particular, the ratio of variable to maximal fluorescence (Fv/Fm), which reflects the maximum
efficiency of PSII primary photochemistry, appeared to be a reliable parameter to quantify
damage to the photosynthetic machinery (Björkman and Demmig 1987). After exposure of
cereals to freezing stress, Fv/Fm per se as well as the frost-induced decrease in Fv/Fm (ΔFv/Fm)
show a high correlation with electrolyte leakage (Clement and Van Hasselt 1996; Pocock et
al. 2001; Rizza et al. 2001). Moreover, long-term cold stress results in a decrease of Fv/Fm in
particular when the cold stress was combined with high light intensity or/and when spring
wheat was exposed to these conditions instead of winter wheat (Hurry et al. 1992). Similar
results were obtained when the Fv/Fm of winter wheat was analyzed throughout the winter
season (Groom and Baker 1992). Furthermore the study of Hurry et al. (1992) revealed that
long-term cold stress under high light intensity leads to a reduction of the chlorophyll content.
To improve winter hardiness, the selection efficiency could be increased if specific attributes
related to frost tolerance could be identified and used as selection criteria for complementing
traditional plant breeding. The objective of this study was to examine the suitability of
chlorophyll fluorescence analysis in combination with the determination of leaf greenness as
selection criterion for winter hardiness within a selection of germplasm grown under field
conditions and to describe this material in terms of winter hardiness.
23

3.3.1 Plant material and growth conditions
One hundred three wheat Triticum aestivum L. accessions from 34 countries distributed
worldwide were provided by Agroscope Changins-Wädenswil (Switzerland) (Table Appendix
1). These genotypes were bred to perform well as crops in contrasting winter climates from
continentally cold to subtropical cool; thus they present contrasting level of winter hardiness.
The varieties consisted of 66 winter, 24 spring, 3 intermediate and 10 non-determined wheat
varieties. The varieties were selected based on their degree of unrelatedness to obtain a
diverse test set of germplasm. Plants were grown at INRA Dijon altitude station at Chaux des
Prés, Département Jura, France (46° 30' N, 5° 52' E, 875 m a.s.l.). The plants were grown
without snow cover by employing a movable shelter which was controlled by a snow sensor;
during snow fall the plot was covered by the shelter while for the rest of the time plants were
exposed to ambient conditions. Experiments were carried out over two seasons (winter
2004/05 and winter 2005/06). Sowing was implemented on the first week of October (5
October 2004 and 6 October 2005). To ensure regular sowing, seeds were attached to a strip
of paper with 2.5 cm between the seeds. Sowing depth was 2.5 cm. Thirty plants of a given
accession were sown in each row. The rows were 75 cm long with a inter-row distance of 10
cm. A replication was done in each year in the same shelter. Root damage due to freeze-thaw
cycles of the soil were minimized by adding peat to the soil every two years. The pre-winter
growth conditions were chosen to fulfill the requirements for hardening and so that all the
accessions reached their maximum tolerance before the first frost.
3.3.2 Phenotype assessment

Each accession was graded (1 to 9) to express the degree of freezing tolerance based on a set
of nine standard lines (Lecomte et al. 2003). The resistance of the standard lines is well
known and corresponds to a grade of the official scale of the French group of varieties and
seeds study and control (GEVES) (Table 3.1). The standard lines were described, after each
cold spell (two to three weeks after the leaves had defrosted) by damaged foliar surface
percentage and at the end of winter by their survival percentage (comparing the surviving
plants with the number of emerged plants). The survival counting were performed on 7 and 8
April 2005 and on 30 and 31 March 2006. The foliar damage of the tested plants was graded
by comparing them with the closest standard lines after each cold spell. They were annotated
using the closest standard line name, using if necessary "+" or "-" in the case a given variety is
more damaged than a standard line but less than the standard line of inferior tolerance coming
24
Chapter 3
Table 3.1: Range of frost sensitivity of standard lines. The sensitivity threshold corresponds
to temperature at appearance of the first foliar necrosis, performed at the INRA altitude
station of Chaux des Prés at optimally frost hardened plants.
Cultivar Sensitivity threshold Mark
Rex -12 °C 1
Magali -14 °C 2
Champlein -15 °C 3
Cappelle -18 °C 4
Capitole -21 °C 5
Moisson -24 °C 6
Arminda -26 °C 7
Comtal -28 °C 8
Cheyenne -32 °C 9
immediately after it in the range. The survival percentage was determined similarly to the
standard lines. The final mark was attributed by comparison with the closest standard line first
considering the survival percentage and the extent of foliar damage. To determine the shoot
dry matter during re-growth, the shoots of ten plants of each accession in winter 2004/05 and
five plants in winter 2005/06 were collected in March, dried at 60 °C for one week and
weighed. The photoinhibition was estimated by the maximum quantum efficiency of PSII
primary photochemistry (Fv/Fm) measured with a pulse amplitude modulation fluorometer
(PAM-2000, Walz, Effeltrich, Germany). The measuring light modulation frequency was set
at 600 Hz to determine the minimum fluorescence (Fo) and at 20 kHz to measure the
maximum fluorescence (Fm). To induce Fm, a saturating pulse of approximately 8000
µmol m-2 s-1 PPFD for 0.8 s was applied. The Fv/Fm was calculated as (Fm-Fo)/Fm. The
chlorophyll fluorescence measurements were done monthly throughout the winter season on
the middle part of the second leaf with five measurements for each accession in each plot. The
Fv/Fm measurements were carried out at nightfall in order to let the plants adapt to the dark
for at least 20 minutes. The greenness of the leaves was assessed using a SPAD-502
chlorophyll meter (Minolta, Osaka, Japan). Measurements were done on the middle part of
the second leaf. Five measurements were done for each accession and values were averaged
by the SPAD-502 chlorophyll meter.
25
3.4 Results
3.4.1 Temperature conditions
The first winter of experiment (2004/05) was characterized by a warm autumn (no frost in
October) and no strong cold observed until the 22 December (Fig. 3.1). January was rather
warm with a sharp decrease in temperatures for the last week of the month to -20 °C for 2
days and -24 °C on 30 January. The beginning of February was cold and the end of the month
2004/05
20
10
Temperature (°C)
-10
-20
max. air temp.
min. air temp. -28.4 °C
-30 min. soil temp.
-32.1 °C
x x x x
01.10.
01.11.
01.12.
01.01.
01.02.
01.03.
01.04.
Date
2005/06
20
10
Temperature (°C)
-10
-20
max. air temp.
min. air temp. -28.9 °C
-30 min. soil temp. -31.1 °C
x x x x
01.10.
01.11.
01.12.
01.01.
01.02.
01.03.
01.04.
Date
Figure 3.1: Daily maximum and minimum air temperature (at 2 m above ground) and
minimum soil temperature (at soil surface) during the growth season in winter 2004/05 and
2005/06. The minimum air and soil temperatures in each growth season are given. The dates
on which physiological parameters were determined are marked by "x".
26
Chapter 3
was very cold (-26 °C on 25 and 26 February). The first week of March was very cold and the
lowest temperatures of the season, -28.4 °C and -32.1 °C at soil level, were measured on 1
March. There was an abrupt increase in temperature from 15 March. The second winter
season (2005/06) was characterized by a warm autumn (no severe frosts until 15 November).
December was very cold; -20 °C at the beginning and -28.9 °C at the end. The soil surface
was -31.1 °C on 30 December, the lowest temperature of the winter. Until the last 10 days of
March, there were frequent temperature drops below -20 °C and only a few days with no
frost.
3.4.2 Comparison of tested accessions with standard lines

The 103 wheat accessions were classified according to winter hardiness in comparison to nine
standard lines (Fig. 3.2). Accessions from Australia, South America and southern Europe
were characterized by low winter hardiness grades compared to accessions from North
America, eastern Europe and northern Europe. There was a highly significant linear
correlation for winter hardiness grades between the two plots (r2 = 0.978 in 2004/05 and r2 =
0.954 in 2005/06) and between both winter seasons (r2 = 0.906) (see Fig. 3.3).
9 North America Cheyenne

South America
8 North Europe Comatal
West Europe
7 South Europe
Arminda
East Europe
6 Asia
Moisson
Mark
Oceania
5 Africa
Capitole
4 Cappelle
3 Champlein
2 Magali
1 Rex
Accession
Figure 3.2: Classification of the 103 wheat accessions graded for winter hardiness, based on
the winter hardiness of nine standard lines. The accessions are colored according to the
geographic origin. Values are means ± SD of four replications (two plots in each of the two
winter seasons).
3.4.3 Effect of experimental season on winter survival

All 103 investigated wheat accessions behaved very similarly in relation to the nine standard
lines in both winter; the grades for winter hardiness were closely related between the two
27
Mark Survival (%) Shoot dry weight (g plant-1)

100 1.0
9
A B C
8
80 0.8
7
2005/06
6 60 0.6
r ² = 0.635
5
4 40 r ² = 0.826 0.4
3
20 0.2
2 r ² = 0.906
1 0 0.0
1 2 3 4 5 6 7 8 9 0 20 40 60 80 100 0.0 0.1 0.2 0.3 0.4 0.5
2004/05
Figure 3.3: Relationship of winter hardiness grades (A), winter survival (B) and shoot dry
weight after re-growth (C) between the two experimental seasons (2004/05 and 2005/06) in
the 95 investigated wheat accessions. Values are means of the two plots.
experimental seasons (Fig. 3.3 A). Looking on the survival rate, however, a considerable
difference was observed between the two experimental seasons. In 2004/05 a larger number
of accessions survived the winter than in 2005/06 (Fig. 3.3 B). In particular, accessions which
showed a moderate winter survival in 2004/05 had a very low survival rate in 2005/06. This
effect was also reflected in the shoot dry weight after re-growth (Fig. 3.3 C).
3.4.4 Time course of Fv/Fm and leaf greenness throughout the winter season
The Fv/Fm of the wheat plants was 0.726 (2004/05) and 0.747 (2005/06) at the beginning of
winter (Table 3.2). There was a considerable effect of year and leaf greenness. While in
Table 3.2: Mean, minimum and maximum of Fv/Fm and SPAD of the investigated wheat
accessions in winter 2004/05 and winter 2005/06. Values are derived from means of ten
measurements for each genotype.
Fv/Fm SPAD
mean min max mean min max
2004/05
Nov 0.726 0.658 0.766 38.3 29.9 44.6
Dec 0.723 0.586 0.775 37.9 26.6 48.2
Jan 0.390 0.111 0.630 35.4 11.3 51.3
Feb 0.214 0.000 0.683 25.5 4.0 54.7
2005/06
Nov 0.747 0.632 0.784 48.6 39.4 56.7
Dec 0.523 0.116 0.697 45.7 29.0 54.3
Jan 0.162 0.000 0.556 28.9 1.9 54.4
Feb 0.011 0.000 0.391 1.0 0.0 36.0
28
Chapter 3
Table 3.3: Temperature conditions before and during determination of Fv/Fm.
Date min. temp. average temp.

before meas. during meas.
2004/05
09.11. -9.0 °C 2.1 ± 1.4
20.12. -10.2 °C 3.8 ± 1.1
21.12. -10.5 °C -2.6 ± 1.5
26.01. -17.3 °C -3.2 ± 1.1
27.01. ditto -3.0 ± 1.2
24.02. -26.4 °C 2.8 ± 1.7
25.02. ditto 1.9 ± 1.9
2005/06
19.11. -10.3 °C -0.3 ± 0.8
10.12. -19.7 °C -1.5 ± 1.9
08.01. -28.9 °C 2.1 ± 2.0
04.02. -28.9 °C -3.8 ± 0.6
November 2004/05 the SPAD value was on average 38.3, it was 48.6 in November 2005/06.
When the temperature was lower than -15 °C (see Table 3.3), both Fv/Fm and SPAD started to
decrease. At the end of winter 2005/06, most of the wheat accessions exhibited strong
necroses and, consequently, Fv/Fm and leaf greenness were close to zero.
There was a positive correlation between leaf greenness (SPAD) and Fv/Fm from the time
when starting to discriminate for these traits (Fig. 3.4). When minimum temperature was
frequently below -10 °C (see Table 3.3), The Fv/Fm of sensitive genotypes declined and leaves
got slightly paler. The Fv/Fm of all wheat accessions declined further when the temperature
dropped down to a minimum of -20 °C. This decline was much more pronounced on wheat
accessions which showed a poor rate of winter survival. The decrease in leaf greenness was
seemingly retarded compared to the decline in Fv/Fm as it can be seen from the data of
January 2005 and December 2005 (Fig. 3.4). At this time, a good discrimination between the
frost-tolerant and frost-sensitive genotypes could be done based on the combined
measurements of leaf greenness and Fv/Fm. The discrimination between accessions was even
more pronounced as the winter progressed and strong frost events were more severe.
Furthermore, there was a high linear correlation for leaf greenness between the two replicates
at this time: r2 = 0.679 (February 2005) and r2 = 0.835 (January 2006). The correlation
between both replicates was noticeably the same when considering SPAD as well as Fv/Fm
(data not shown). However a variance analysis of Fv/Fm and SPAD showed a small but
29
significant difference between the replications in each year with p values of 0.0016 (2004/05)
and 0.0467 (2005/06).
The discrimination between the accessions was more marked in the second year of experiment
(2005/06) than in the first year (2004/05) at a given month. The genotypes with a higher level
of tolerance were affected by the cold sooner during the second year of experiment. The
ANOVA test indicated that differences among genotypes were highly significant (p = 2.10-16).
However, there was no genotype × year interaction (p = 0.2245) indicating that genotypes
responded to the environment in the same way in each winter season.
The accessions could be assigned by hierarchical cluster analysis in six groups according to
their response of Fv/Fm throughout the two experimental seasons (Fig. 3.5). Two of the six
groups consisted of a few (F) or only one accession (C). Group A consisted of accessions
which showed a low winter survival in both winters. Most of the members of this group were
spring wheat accessions from South America (in particular Brazil) and from Australia. The
standard line "Rex" was a member of this group as well. Genotypes with moderate winter
0.8
Nov 04 Dec 04 Jan 05 Feb 05
0.6
Fv/Fm
0.4
0.2 100 % Survival

50 % Survival
0 % Survival
0.0
Nov 05 Dec 05 Jan 06 Feb 06
0.6
Fv/Fm
0.4
0.2
0.0
0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 60
SPAD SPAD SPAD SPAD
Figure 3.4: Relationship between leaf greenness (SPAD) and maximum quantum efficiency
of PSII primary photochemistry (Fv/Fm) in the 103 wheat accessions throughout the two
winter seasons. The accessions were color-coded according to their winter survival rate for
the corresponding year. Values are means of 10 measurements (5 from each plot, with the
exception of November 2004 with only one plot and 5 replications).
30
Chapter 3
survival in 2004/05 and low winter survival in 2005/06 were based on the Fv/Fm analysis
classified in group B. The decline in Fv/Fm of the genotypes from this group was less strong
than that of the group A accessions. Most of the accessions in group B were from Argentina
and Chile but also from western Europe, in particular from France. Groups D and E consisted
of genotypes with a high winter survival in both winters. Both groups contained accessions
from western and eastern Europe and northern Europe, the latter especially in group E, which
was also characterized by a very high percentage of North American accessions. These two
groups were distinct in the decline of Fv/Fm in winter 2004/05; the Fv/Fm of group E
genotypes was clearly higher in February 2005 than the Fv/Fm of group D (Fig. 3.5). The
2004/05 2005/06 2004/05 2005/06

0.8 0.8
A B
0.6 0.6
0.2 ± 0.8 18.1 ± 25.5
Fv/Fm
Fv/Fm
0.4 0.4
0.2 0.2
4.7 ± 10.9 49.7 ± 37.9
0.0 0.0
C D
0.6 0.6
5.0
Fv/Fm
Fv/Fm
0.4 0.4
0.2 0.2
31.0 93.9 ± 11.2 71.5 ± 26.3
0.0 0.0
E F
0.6 0.6
Fv/Fm
Fv/Fm
0.4 0.4
0.2 0.2
99.5 ± 1.3 86.0 ± 8.9 100.0 ± 0.0 100.0 ± 0.0
0.0 0.0
01.11.
01.12.
01.01.
01.02.
01.11.
01.12.
01.01.
01.02.
01.11.
01.12.
01.01.
01.02.
01.11.
01.12.
01.01.
01.02.
01.03.
Figure 3.5: Time course of Fv/Fm for the 103 wheat accessions. The accessions were assigned
by hierarchical cluster analysis into six groups (A to F) according to their Fv/Fm response.
Values are means of 10 measurements (5 from each plot, with the exception of November
2004 with only one plot and 5 replications). The average winter survival ± SD for each cluster
31
highest winter survival and the smallest decline in Fv/Fm throughout the winters were found
for the accessions in group F. The three accessions were the varieties Ridit (USA) and
Cheyenne (USA) as well as the landrace Wagrein 1371 (Austria).
3.5 Discussion
The climatic conditions of both winter seasons showed some common characteristics. The
warm autumn in 2004 and especially in 2005 allowed for fast growth and early tillering phase
at the beginning of November instead of mid-November when tillering usually occurs at the
experimental site in Chaux des Prés (personal communication Alex Giraud). Frost (about
-10 °C) during this period had no effect on the maximum quantum efficiency of PSII primary
photochemistry (Fv/Fm) or on leaf greenness; only for a few frost-sensitive accessions was a
small reduction in Fv/Fm and leaf greenness observed. A further decrease in temperature to
-20 °C led to a small reduction of Fv/Fm in frost-tolerant accessions and to a strong decrease
in Fv/Fm and leaf greenness in sensitive genotypes. The very low temperatures (below -25 °C)
at the end of February 2005 and end of December 2005 were probably responsible for the
considerable foliar damage. However, there were differences between both winters with
respect to survival despite the very similar minimum temperatures for both winters (-28.4 °C
in 2004/05 and -28.9 °C in 2005/06). This indicates that the temperature history had a great
influence on the frost acclimation of the wheat plants. In the winter 2004/05, temperature
decreased gradually until the absolute minimum temperature for this winter occurred at the
beginning of March. The second winter (2005/06) was characterized by longer periods of
strong frost (at around -25 °C), which began already at the beginning of the meteorological
winter. The amount of foliar destruction at the end of the winter 2005/06 can be explained by
the more sudden decrease in temperature. Several studies showed that a high winter hardiness
is achieved when plants are exposed to below-freezing temperatures but before freezing injury
occurs (Trunova 1965; Olien 1984; Livingston 1996). Furthermore, severe frost in January,
February and March 2006 may be a second factor, which is responsible for the lower winter
survival of many accessions in 2005/06 compared to 2004/05. Lecomte et al. (2003) showed
that the duration of the frost period is the main factor determining the degree of foliar damage.
The results showed that there was a considerable variation in winter hardiness among the
investigated accessions. In both years, winter survival rates were either high or low; only few
accessions were characterized by the survival of some plants but not of others. This indicates
a high homogeneity of the plant material within the accessions as well as of the environmental
32
Chapter 3
conditions. Furthermore, it shows that the winter survival of wheat is all or none. A slightly
different differentiation of the wheat material by the winter survival was achieved by
comparing the survival rates of the both winter seasons. This was done by means of the field-
survival index (FSI) (Fowler and Gusta 1979) which expresses the relative level of cold-
hardiness by comparing different genotypes. Some of the accessions investigated here were
also examined for winter survival in other studies; very similar survival rates were found. For
example, a high winter survival in total as well as in comparison to other wheat varieties was
found for Vakka and Äring II in a field experiment in Finland (Hömmö 1994) and in the study
“Cold resistance in winter wheat” (AG1 41) of the Nordic Gene Bank in 2000 (see
http://www.nordgen.org/sesto/index.php?scp=ngb&thm=matobs&prorecnum=301). In the
latter, the variety Funo from Italy did not survive the winter, similar to the findings of the
experiments at Chaux des Prés. It was surprising that three spring wheat varieties showed a
high winter hardiness. In particular, the variety Porvevir from Uruguay as well as the
Australian variety Seewari 48 and Chinese 166 from the USA were characterized by a high
rate of winter survival and were assigned to cluster E based on the Fv/Fm time course.
According to Wheat Pedigree and Identified Alleles of Genes On Line (Crop Research
Institute Praha, Czech Republic, see http://genbank.vurv.cz/ wheat/pedigree/) the pedigree of
Seewari 48 shows that some of the ancestors were winter wheat varieties. The high frost
tolerance might be due to the fact that the winter wheat varieties Ostka Galicyjska (Poland),
Goldendrop (Great Britain) and Crimean (USA) appear several times in the pedigree of
Seewari 48. In the pedigree of Porvenir, spring types only are present, while Chinese 166 was
derived from Chinese 165, which is a winter wheat and might explain the winter hardiness of
Chinese 166. These varieties seem to be of great interest for regions in which vernalization is
not always guaranteed and with severe frost events in some years.
A better classification of the accessions than that based on winter survival alone was achieved
by comparing then to standard lines and by cluster analysis of the chlorophyll fluorescence
data. Both methods required frequent observation of the plants. Based on the time course of
Fv/Fm, five clearly distinct groups of accessions were revealed. The accessions of group F
were frost-tolerant with a good ability to maintain tolerance over long periods of freezing.
Genotypes from group E had a good ability to harden but could not maintain tolerance over
the prolonged frost stress during the winter 2005/06. Genotypes of group D had a lower
ability to maintain tolerance in the winter of 2004/05 compared to the accessions from group
E. Genotypes of group B had the potential to harden but were not tolerant to severe frost,
33
while genotypes of group A were frost-sensitive and seemed to have a low potential for cold
hardening. Group A consisted mainly of spring wheat.
Using the parameters Fv/Fm and leaf greenness, early discrimination could be made between
the accessions with regard to frost tolerance already at the beginning of winter when the
temperature did not decrease below -20 °C yet. If no stronger frost would occur most of the
accessions would show a high winter survival making this parameter less suitable for
selection. For traits to be used as selection criteria, there must be a real causal effect of the
trait on winter hardiness. However, the presence of phenotypical correlation between winter
hardiness and a specific trait, such as Fv/Fm or leaf greenness, does not guarantee that
selection for that trait will lead to a greater improvement than the selection for winter
hardiness itself, because the relationship may be environment-specific (Ceccarelli et al. 1991)
and/or germplasm-specific (Annichiarico and Pecetti 1995). Furthermore, suitable traits for
selection should have the potential to be evaluated in a rapid routine manner, there must be
genetic variability for the trait, a sufficient knowledge of its inheritance and a correct number
of genotypes used in physiological studies is required, which hinders the validation of results
obtained under wide genetic backgrounds. The selection or screening of genotypes by Fv/Fm
meets these prerequisites. A causal effect of Fv/Fm on chilling tolerance was previously
identified in maize (Fracheboud et al. 2004; Jompuk et al. 2005). Furthermore, it was shown
that Fv/Fm can be evaluated in a rapid routine manner and shows genetic variability (Lee et al.
2002).
In summary, there was considerable variation in freezing tolerance among these accessions.
There were five clearly distinct groups with regard to the frost tolerance of the wheat
seedlings probably explained by the ability to maintain frost tolerance and the potential to re-
harden. To verify this, a test comprising a moderate cold spell after a warming on frost-
hardened sensitive genotypes should allow determining the ability to maintain the tolerance in
sensitive genotypes. Moreover, a test describing a single cold spell on frost hardened
genotypes should allow determining the genotypes, which also have a low ability to re-
harden. Previous studies contributed to the understanding of the cause/effect mechanisms
involving Fv/Fm versus frost tolerance and its genetic correlation with frost tolerance. The
present study validates Fv/Fm as a selection criterion for frost tolerance in wheat with a wide
genetic background. As a future prospect, more knowledge about the heritability of that trait
can be gained and the trait verified either by using near-isogenic lines or by a divergent
selection procedure (Acevedo and Ceccaralli 1989).
34
Chapter 4
4 Analysis of the promoter region of the transcription

factor TaCBF12 in wheat accessions of contrasting
winter hardiness
4.1 Abstract
The members of the family of CBF transcription factor were shown previously to be involved
in the tolerance to low temperature of many plant species. The promoter region of the wheat
homologue of the Triticum monococcum gene CBF12, located on chromosome 5A, was
sequenced in 95 wheat accessions of contrasting winter hardiness. Two haplotypes
(TaCBF12-a and TaCBF12-b) were identified, which differed in nine completely associated
single nucleotide polymorphisms (SNPs). Analysis of the promoter region for cis-acting
regulatory elements revealed MYC, MYB, LTRE, ABRE and DRE/CRT motifs. The two
haplotypes were differentiated by the presence, respectively absence, of one MYB and one
SORLIP motif.
4.2 Introduction
In hexaploid wheat, two loci for frost resistance (Fr-A1 and Fr-A2) were found to be located
on the long arm of chromosome 5A (Vágújfalvi et al. 2000). Comparative mapping revealed
that homologues of Fr-A1 and Fr-A2 were present on the wheat chromosomes 5B (Tóth et al.
2003) and 5D (Snape et al. 1997) as well as in barley (Hordeum vulgare) on chromosome 5H
(Francia et al. 2004). In Triticum aestivum, the frost resistance genes Fr-A1 and Fr-A2 were
found to be associated with the expression of the cold-regulated gene cor14b (Vágújfalvi et al.
2000). Similarly, a QTL for frost tolerance and cor14b transcription level was mapped in
Triticum monococcum at the Fr-A2 locus (Fr-Am2) (Vágújfalvi et al. 2003). Mapping of gene
CBF3, which codes for a C-repeat binding factor of the AP2 family and which was previously
found to be located adjacent to the frost tolerance locus Fr-H1 in barley (Choi et al. 2002),
indicated that this transcription factor was linked to the Fr-Am2 locus (Vágújfalvi et al. 2003).
Further studies of the Fr-Am2 region revealed a cluster of 11 CBF transcription factors at this
locus (Miller et al. 2006). A similar cluster of CBF genes was found at the Fr-H2 locus in
barley (Skinner et al. 2006), and studies of the CBF family in wheat showed that several CBF
genes are located on chromosomes 5 (Badawi et al. 2007).
The CBF genes encode trans-acting factors of the transcription of COR (cold-regulated)
genes. Thereby, the CBF transcription factors bind to the DRE/CRT (drought-responsive
35
Analysis of TaCBF12 promoter region
element/C-repeat) cis-acting element, which is located in the promoter region of the COR
genes. The CBF genes have been identified in different plant species, i.e. hot pepper
(Capsicum annuum) (Kim et al. 2004), sweet cherry (Kitashiba et al. 2004) and rice
(Dubouzet et al. 2003), but most of our knowledge about these transcription factors has been
obtained from studies in Arabidopsis. CBF1 (DREB1B), CBF2 (DREB1C) and CBF3
(DREB1A) were identified in Arabidopsis. They were shown to be responsive to cold and
drought in roots, stems and leaves (Shinwari et al. 1998). Overexpression of CBF1 did not
have an effect on the transcription of CBF3, indicating that the cold-induced expression of
CBF is not subject to autoregulation (Gilmour et al. 1998). However, it was found that CBF2
negatively regulates CBF1 and CBF3 (Novillo et al. 2004). The main factors regulating CBF
expression are the MYC and MYB transcription factors (Miura et al. 2007). It was found that
the CBF3 transcription is activated during cold stress by the inducer of CBF expression 1
(ICE1), a MYC-like basic helix loop helix (bHLH) transcription factor, which binds to the
MYC recognition site in the promoter region of CBF3. The ICE1 gene is constitutively
expressed, but at warm temperature the ICE1 protein is in an inactive form. At low
temperature, ICE1 is conjugated to a small ubiquitin-related modifier (SUMO) by the SIZ1
ligase. As a result, the SUMO-conjugated ICE1 represses MYB15, which is a negative
regulator of CBF transcription, and, therefore, CBF3 transcription is activated (Miura et al.
2007). In the promoter region of the CBF genes in Arabidopsis, several of these MYC and
MYB recognition sites were found (Shinwari et al. 1998).
The importance of the CBF transcription factors for frost tolerance has been supported by
studies in Arabidopsis overexpressing the CBF genes (Gilmour et al. 2004); frost tolerance
increases considerably when CBF genes are expressed. Thus, the regulation of CBF
transcription is of great importance for achieving frost tolerance and might explain differences
in the frost tolerance of different genotypes. Such differences may be caused by variations in
the CBF promoter region. Therefore, the aim was to describe the promoter region of one of
the CBF genes located on chromosome 5A and to identify haplotypes for this gene in a set of
95 wheat accessions of contrasting winter hardiness. The promoter region of the homologue
gene of CBF12 in Triticum monococcum could be identified on chromosome 5A in wheat and
was sequenced in 95 wheat accessions described in the chapter 3.
36
Chapter 4

4.3.1 Primer design
The primer pair for the promoter region of CBF12 was designed based on the information
about the published sequence of CBF12 from Triticum monococcum, GenBank accession
AY951944, (Miller et al. 2006) and employing the FastPCR program, version 4.0.27 (Institute
of Biotechnology, University of Helsinki, Finland). The obtained primers 1B2F (5’-AGT
CCG GAT ACA AGG TTG TCT TGG-3’) and 1B2R (5’-ATA CTC CAT GCA TGC CTA
TGG GCT-3’) were situated at 918 and 360 bp, respectively, upstream from the ATG start
codon of TmCBF12. Using the nullisomic lines N5A, N5B and N5D from Triticum aestivum,
it was demonstrated that the primer pair was specific for chromosome 5A (Fig. 4.1). The
primer pair was used to amplify the CBF12 promoter region of 95 Triticum aestivum
accessions. The corresponding gene was named TaCBF12 (Triticum aestivum CBF12).
4.3.2 DNA analysis

PCR reactions were performed using a PTC-200 (MJ Research) Peltier 9600 thermal cycler
and a Bio-Rad 9600 thermal cycler under the following conditions: 95 °C for 3 min; 30 cycles
of 94 °C for 30 s, 72 °C for 1 min; 72 °C for 10 min and a constant temperature of 20 °C. The
25 µl PCR mixture consisted of 100 ng of DNA, 10 µM of each primer, 10 × PCR buffer
N5D N5A N5B
← 0.5 kb
Figure 4.1: The nullisomic lines N5A, N5B and N5D were amplified by the primer pair
1B2F/1B2R. From left to right: 1Kb molecular weight marker, N5D, N5A, N5B.
37
(Takara Bio, Shiga, Japan), 2.5 µM of each deoxynucleotide triphosphate (dNTP mixture for
PCR Takara Bio, Shiga, Japan), 0.625 units of Takara Ex Taq (Takara Bio, Shiga, Japan) and
milli Q water. Two independent PCR reactions were carried out. PCR products (5 µl) were
analysed by 1 % agarose gel electrophoresis and purified using the Qiarobot (Qiagen,
http://www.qiagen.com). Purified PCR products were cloned using the Promega pGEM-T
Easy Vector System I (Promega, Madison, WI, USA) using 0.5 µl of pGEM-T easy vector,
0.5 µl T4 DNA ligase, 5 µl of 2 × ligation buffer and 80 ng of the purified PCR product. The
strain DH5α of chemically competent cells was transformed by a heat-shock procedure. From
two to ten individual clones were chosen for each cloned PCR product and cultivated in
2XYT medium containing ampicillin. Plasmid DNA was isolated in 96-well plates on a
qiarobot (Qiagen, http://www.qiagen.com). After checking of the presence of the insert, with
a digestion using EcoR1, the miniprep products were sequenced individually. The sequencing
reactions were performed using the ABI PRISM BigDye Terminator version 3.1 cycle
sequencing kit (Perkin-Elmer/Applied Biosystems) and M13 primers according to the
manufacturer’s protocol. The sequencing was done in an ABI 3730 DNA sequencer (Applied
Biosystems, http://www.appliedbiosystems.com).
4.3.3 Data analysis

The 1082 sequence reads from an ABI 3730 sequencer were processed (i.e. mainly vector
removal) using the Staden software package (Staden et al. 2003). Several perl and shell scripts
were written to automate the assembly of the passing 1041 reads into individual consensus
sequences for each wheat variety or each clone respectively. Assemblies were performed with
the PHRAP assembler (version 0.990319, provided by P. Green and available at
www.phrap.org). It resulted in 95 consensus sequences. To align the consensus sequences,
programs from the EMBOSS package (Olson 2002) and ClustalX (Chenna et al. 2003) were
used. The promoter was scanned for cis-acting regulatory elements using the database PLACE
(Prestridge 1991; Higo et al. 1999).
4.4 Results
4.4.1 Sequence variability
Using the primer pair 1B2R/1B2F, a sequence of 580 bp was amplified from the DNA of the
95 wheat accessions. The sequence analysis revealed two haplotypes (TaCBF12-a and
TaCBF12-b), which differed in nine completely associated single nucleotide polymorphisms.
38
Chapter 4
MYB
TaCBF12-A AGTCCGGATACAAGGTTGTCTTGGTATGCTAGTAATTATATTTACTGATGGGCTAAGTG -730
TaCBF12-B AGTCCGGATACAAGGTTGTCTTGGTATGCTAGTAATTATATTTACTGATGGGCTAAGTG -730
TmCBF12 AGTCCGGATACAAGGTTGTCTTGGTATGCTAGTAATTATATTTACTGATGGGCTAAGTG -732
MYB
TaCBF12-A GACCATGACACACCTCGCCCCTCCAGTATCCCTGAGTGACTGTACCTACACGCCTCTGTC -670
TaCBF12-B GACCATGACACACCTCGCCCCTCCAGTATCCCTGAGTGACTGTACCTACACGCCTCTGTC -670
TmCBF12 GACCATGACACACCTCGCCCCTCCAGTATCCCCGAGTGACTGTACCTACACGCCTCTGTC -672
TaCBF12-A GTTTTCTTTGCTTTAGATGATTTGGCAAGCTTGAGGGACTAATTGCGTTCGTAATAGAAA -610

TaCBF12-B GTTTTCTTTGCTTTAGATGATTTGGCAAGCTTGAGGGACTAATTGCGTTCGTAATAGAAA -610
TmCBF12 GTTTTCTTTGCTTTAGATGATTTGGCAAGCTTGAGGGACTAATTGCGTTCGTAATAGAAA -612
MYB, REalpha LTRE
TaCBF12-A AGCAAAAGTCCTTCATAGATCAGGGTTGGTTTTTGTTTGGTACCCGCTGCTCTACCCGAA -550
TaCBF12-B AGCAAAAGTCCTTCATAGATCAGGGTTGGTTTTTGTTTGGTACCCGCTACTCTACCCGAA -550
TmCBF12 AGCAAAAGTCCTTCATAGATCAGGGTTGGTTTTTGTTTGATACCCGCTACTCTACCCGAA -552
SORLIP, INR
TaCBF12-A AAGCACTTAAA-GTTAGTCCCTCCTTAAACTAATATAAAAGCGTTTAGAAAACTAAAGTA -491
TaCBF12-B AAGCACTTAAA-GTTACTCACTCCTTAAATTAATATAAAAGCGTTTAGAAAACTAAAGTA -491
TmCBF12 AAGCACATAAAAGTTACTCCCTTCTTAAACTAATATAAAAACATTTAGAAAACTAAAATA -492
MYB core MYB core, MYC
TaCBF12-A ATAATCTAAACGCTGTTATATTAGTTTACAGAAGGAGTACAACTGATTCAAACAAGGCCA -431
TaCBF12-B ATGATCTAAACACTGTTATATTAGTTTACAGAAGGAGTACAACTGATTCAAACAAGGCCA -431
TmCBF12 ATAATCTAAATACTGTTATATTAGTTTACAGAAGGAGTACAACTGATTCAAACAAGGACA -432
MYC MYC
TaCBF12-A AATGTTGTCACATGGTAGCTAAATACACTTCACCAGCAAAACAAAACGTAAATACACTTT -371
TaCBF12-B AATGTTGTCACATGGTAGCTAAGTACACTTCACCAGCAAAACAAAACGTAAATACACTTT -371
TmCBF12 AATGTTGTCACATGGTAGCTAAATACACTTCACCAGCAAAACAAAACGTAAATACACTTT -372
MYB
TaCBF12-A CACATCACAAGAACACACTGATTTGATGCTAAGATGAAAACGCCGGGAATGGGATACACC -311
TaCBF12-B CACATCACAAGAACACACTGATTTGATGCTAAGATGAAAACGCCGGGAATGGGATACACC -311
TmCBF12 CACATCACAAGAACACACTGATTTGATGCTAAGATGAAAACGCCGGGAATGGGATACACC -312
MYB ABRE DRE, LTRE
TaCBF12-A AACACACCTAAATTAGCAAGTTGGCCGTCACCCACGTTTTCTCGCACCCAGCCGACGAGC -251
TaCBF12-B AACACACCTAAATTAGCAGGTTGGCTGTCACCCACGTTTTCTCGCACCCAGCCGACGAGC -251
TmCBF12 AACACACCTAAATTAGCAAGTTGGCCGTCACCCACGTTTTCTCGCACCCAGCCGACGAGC -252
ABRE, MYB core
TaCBF12-A AC-AAACGCGGTTAAAAAGATACTCCATGCATGCCTATGGGCT -209
TaCBF12-B AC-AAACGCGGTTAAAAAGATACTCCATGCATGCCTATGGGCT -209
TmCBF12 ACAAAACGCGGTTAAAAAGATACTCCATGCATGCCTATGGGCTGTGAGGTGATGGAGGGA -192
TmCBF12 AGCTGCCTTTTCTTTGCTTAACGCTGCAAACCCCCTACACGTCTACACCGAGGAGTCATG -132

DRE-HvCBF2 DRE, LTRE
TmCBF12 CTACACGCGTCGACCGGGGAGCGGTCCAGCGCCGCACACCACAAGCTGTCCCCGCGCCGA -72
TATA-Box
TmCBF12 CGGGCAAAGCCGTCGCATTTCACCGCGTACCGCAAAACTATAAATAAGCACACTCTAGGC -12
SOLIP, MYB ┌─> Start of transcription
TmCBF12 AAGCCACTGGTTTACTGAGTACTCCTAGTCTCATAGGTCATAGCCACCAAGGCAGCAGCC +48
TmCBF12 ATCACGGCTCCTTACTCCAGCCAGCCAACTAGCCTAGCAAAAGTACATACCACCGCCTAG +108

┌─> Start of translation
TmCBF12 CTTGCTCGGCGGAGCGGCAATGGACACGGGCCCGGAGCGCAACTGGAACTCGCCGGC... +165
Figure 4.2: Alignment of the promoter sequences of the CBF12 genes from Triticum
monococcum and the two haplotypes of Triticum aestivum. Number refers to the putative start
of transcription. SNPs are marked by white characters on a black background. The positions
of the following cis-acting elements are indicated: ABRE, yellow highlighted; DRE/CRT (and
DRE-HvCBF2), blue underlined; INR, blue characters; LTRE, cyan highlighted; MYB, red
underlined; MYC, green characters; REalpha, pink characters; SORLIP, green underlined,
TATA-box, black frame.
39
60
A B C A C
50 N-America albidum
S-America alborubrum
40 N-Europe erythrosperum
W-Europe sub-erythrospermum
E-Europe ferrugineum
30 S-Europe graecum
Africa hostianum
20 Asia lutescens
Oceania sub-meridionale
10 milturum
B velutinum
Winter wheat nd
0 Spring wheat
a b a b a b Intermediate
nd
Haplotype
Figure 4.3: Origin (A), type (B) and variety (C) of accessions comprised in the two TaCBF12
haplotypes.
Each of the TaCBF12 haplotypes was represented by 56 and 39 genotypes, respectively. The
positions of the SNPs in relation to the putative transcription initiation site were -285, -292,
-408, -479, -488, -521, -531, -534 and -561. The SNPs were bi-allelic and presented five GpA
and two CpT transitions as well as one CpA and one CpG transvertions. The comparison of
the wheat sequences with Triticum monococcum showed a very high degree of similarity.
Triticum monococcum had 14 SNPs with haplotype TaCBF12-a and 17 SNPs with haplotype
TaCBF12-b (Fig. 4.2). At the positions of the SNPs, which differentiated the two wheat
haplotypes, the Triticum monococcum CBF12 sequence was always identical to the sequence
of one of the wheat haplotypes. There was no clear division of the two haplotypes in respect
to geographic origin, growth type or variety (Fig. 4.3).
4.4.2 Identification of transcription regulatory elements

Analysis of the promoter region with the database PLACE revealed a number of regulatory
cis-acting elements, mainly MYB and MYC elements (Fig. 4.2; Table 4.1). Furthermore, two
low-temperature response elements (LTRE) were identified in the TaCBF12 sequence. One of
these elements, located at position -255 to -259, was linked with a DRE/CRT element. Close
to this position, there were two abscisic acid response elements (ABRE). Two of the nine
SNPs belonged to the regulatory motifs. At position -292, the ApG transition caused a loss of
a MYB element in haplotype TaCBF12-a compared to TaCBF12-b. The CpA transversion at
position -531 and the GpC transversion at position -534 resulted in the TaCBF12-b haplotype,
in the loss of a SORLIP element (sequence over-represented in light-induced promoters) and
an INR (initiator) element.
40
Chapter 4
Table 4.1: Putative role and consensus sequences of transcription regulatory elements found
in the promoter sequence of TaCBF12.
cis-acting Involvement cis-acting element Consensus Sequence in Location (Strand)

element subtype sequence TaCBF12
MYC cold, drought CONSENSUSAt CANNTG CACATG -422 to -417 (+/-)

CAAATG -432 to -427 (+/-)
CAACTG -451 to -446 (+/-)
MYB cold PLANT MACCWAMC GGTTGGTT -586 to -579 (-)
PZm CCWACC GGTTGG -292 to -287 (-)
CORE CNGTTR CGGTTA -243 to -238 (+)
CAACTG -451 to -446 (-)
CTGTTA -478 to -473 (+)
ST1 GGATA GGATA -319 to -315 (+)
TATCC -703 to -699 (-)
GGATA -783 to -779 (+)
ABRE drought RAtCAL MACGYGB AACGCGG -247 to -241 (+)
CCACGTT -279 to -273 (-)
LTRE cold, drought Hvblt49 CCGAAA CCGAAA -554 to -549 (+)
COREATCOR15 CCGAC CCGAC -259 to -255 (+)
DRE/CRT cold, drought HvCBF1 GCCGAC GCCGAC -260 to -255 (+)
REalpha light Lglhcb21 AACCAA TTGGTT -584 to -579 (-)
INR light NtpsaDb YTCANTYY CTCACTCC -534 to -527 (+)
SORLIP light 5At GAGTGAG CTCACTC -534 to -528 (-)
B: C, G or T; D: A, G or T; H: A, C or T; K: G or T; M: A or C; N: A, C, G or T; R: A or G; S: C or G; V: A, C
or G; W: A or T; Y: C or T
4.5 Discussion
Due to the importance of the CBF transcription factors as a central switch for acquiring frost
tolerance, the promoter region of gene TaCBF12 in wheat accessions of contrasting winter
hardiness was compared. The promoter region of TaCBF12 showed a high degree of
similarity to the corresponding sequence in Triticum monococcum (Miller et al. 2006). It may
be that the sequence of TaCBF12 is as similar to TmCBF12 as the promoter regions.
Consequently, TaCBF12 is an additional CBF gene as well as the 15 CBF genes described in
hexaploid wheat (Badawi et al. 2007). The fact that TaCBF12 was found to be located on
chromosome 5A and the observation that TmCBF12 is part of a cluster of CBF genes at the
frost tolerance locus Fr-Am2 (Miller et al. 2006), leads to the assumption that TaCBF12 is also
located within a similar cluster of CBF genes at Fr-A2.
In the promoter region of TaCBF12, nine single nucleotide polymorphisms (SNPs) were
identified, which were completely linked with each other. SNPs are produced by mutations
which can occur due to a shift from one tautomer of a nucleotide base to another tautomer.
41
Seven transitions were observed in the TaCBF12 promoter region whereas only two
transversions were identified. This is consistent with the finding that transition is the most
common form of SNP (Garg et al. 1999; Picoult-Newberg et al. 1999; Deutsch et al. 2001;
Batley et al. 2003). In barley, twice as many transitions than transversions were found
(Soleimani et al. 2003). The nature of the transitions in the TaCBF12 promoter region
suggests a predominance of the TpC transition. The high frequency of the TpC transition was
shown to be due to deamination of methylated cytosine residues (Coulondre et al. 1978).
There was a close similarity between the CBF12 sequences of Triticum monococcum and
Triticum aestivum, but several SNPs were independent of the SNPs of the two hexaploid
wheat haplotypes. The separate history of evolution of Triticum monococcum and Triticum
urartu, the A-donor of Triticum aestivum (Feldman 2001), may explain the observed
discrepancy. However, Triticum monococcum seemed to be phylogenetically closer to the
haplotype TaCBF12-a than to TaCBF12-b. The absolute linkage of the nine SNPs and the fact
that only two haplotypes were detected within the 95 accessions indicates that these SNPs
must have occurred at a similar point in time and that recombination did not occur again
between them. This is also supported by the observation that both haplotypes were not
characterized by accessions of a particular geographic origin, growth type or variety.
Three of the nine SNPs, which differentiated the two haplotypes, were responsible for the loss
of cis-acting elements in the CBF12 promoter of the TaCBF12-a haplotype, respectively, for
the acquisition of additional cis-acting elements in the TaCBF12-b haplotype. Due to the
SNPs at positions -531 and -534, the TaCBF12-b haplotype was characterized by an initiator
(Inr) element at this position, which was found to be a Sequence Over-Represented in Light-
Induced Promoters (SORLIP). Both elements are involved in light-responsive transcription
(Nakamura et al. 2002; Hudson and Quail 2003). Since the interaction of temperature and
irradiance play a crucial role in frost acclimation (Öquist and Huner 2003), the presence of
INR and SORLIP in the TaCBF12-b haplotype might be relevant for acquiring frost tolerance.
The further change in respect to cis-acting elements occurred due to the SNP at position -292.
A MYB recognition site was present in the TaCBF12-b haplotype, which was lacking in the
other haplotype and in Triticum monococcum. This particular sequence was found in maize to
be bound by P, which is a MYB homologue, and activates genes of flavonoid biosynthesis
(Grotewold et al. 1994). Whether the presence or absence of this cis-acting element has a
potential effect on the expression of TaCBF12 is uncertain.
Several other motifs related to MYB and MYC, were found in the TaCBF12 promoter region;
they were identical to those identified in the CBF3 promoter sequence of Arabidopsis
42
Chapter 4
(Shinwari et al. 1998). The MYC motifs were shown to be involved in drought and cold stress
(Simpson et al. 2003; Tran et al. 2004). Chinnusamy et al. (2003) showed that a MYC
recognition site in the promoter of CBF3 is specifically bound by ICE1, a MYC-like bHLH
transcriptional activator, which plays a critical role in acquiring cold tolerance. The several
MYB recognition sequences in the promoter of TaCBF12 indicate that a MYB-related
transcription factor may be involved in the induction of the TaCBF12 gene. In Arabidopsis, it
was shown that a MYB recognition site in the promoters of CBF3 is bound by MYB15, which
is a negative regulator of CBF expression and which by is repressed by ICE1 (Miura et al.
2007).
ABRE-like elements are present in the studied TaCBF12 promoter region. Abscisic acid-
response elements (ABRE) are known to be involved in drought stress (Simpson et al. 2003;
Nakashima et al. 2006). The sequence found here corresponds to an ABRE-related sequence,
which was found in Arabidopsis to be responsive to cytosolic Ca2+ signals (Kaplan et al.
2006). It has been demonstrated that a wide range of stress is accompanied by transient
changes in cytosolic Ca2+ (Sanders et al. 1999). Calcium acts as a second messenger, which is
required for cold-induced gene expression and the development of freezing tolerance in plants
(Sung et al. 2003). Since the ABRE-like element identified in the TaCBF12 promoter region
does not show a high degree of similarity with the pABRE-1, 2 and 3 motif, important for the
ABA-induced gene expression in barley (Straub et al. 1994), it is assumed that TaCBF12
transcription is not regulated by the ABA-dependent pathway.
The core motif of the dehydration-responsive element/C-repeat (DRE/CRT) was identified in
the wheat promoter of TaCBF12. This cis-acting element is present in the promoter region of
cold-induced genes and is the target of AP2 domain transcription factors like CBF factors.
The presence of a DRE in the promoter region of TaCBF12 contradicts earlier results
suggesting that CBF expression is not appear autoregulated in Arabidopsis (Gilmour et al.
1998). However, CBF2 was reported to be a negative regulator of CBF1 and CBF3 expression
in Arabidopsis (Novillo et al. 2004). At positions -260 to -255, the TaCBF12 promoter
sequence contains a DRE with a GCCGAC sequence, which is a binding site of HvCBF1
(Xue 2002). Analysis of the remaining CBF12 promoter sequences in Triticum monococcum
revealed a second DRE of this type. Furthermore, the CBF12 promoter sequence of Triticum
monococcum holds a DRE, which was found in barley to be a binding site for HvCBF2 (Xue
2003). The CBF2 of barley is also expressed under non-stress conditions but binds to this
particular DRE only at low temperature and then induces the transcription of low temperature-
43
responsive genes (Xue 2003). Taking these results into account, it is assumed that the
transcription of TaCBF12 is regulated by other TaCBF transcription factors.
Two low temperature response elements (LTRE) were detected in the TaCBF12 promoter
region. LTREs have been reported to be involved in cold-, drought- and ABA-regulated gene
expression (Baker et al. 1994). One LTRE of the LTRE-2 type (Jiang et al. 1996) was part of
the DRE sequence, which was found to be the binding site of HvCBF1. The other LTRE, at
position -554 to -549, was of the LTRE-1 type. Those sequences have been shown to be the
binding site of a low-mobility nuclear protein complex within a low-temperature-responsive
promoter sequence in barley (Dunn et al. 1998).
In summary, two haplotypes, defined by nine SNPs, were detected in the promoter region of
TaCBF12. The analysis of the TaCBF12 promoter for cis-acting elements revealed that one
MYB and one INR (including a SORLIP sequence) were present in the accessions of the
TaCBF12-b haplotype, which were inexistent in the haplotype TaCBF12-a. Since the CBF
genes in Arabidopsis are negatively regulated by MYB15, a difference in the frost response
between the two haplotypes is expected. Cis-acting elements have been identified in the
TaCBF12 promoter; This indicates a regulation of TaCBF12 by other AP2 transcription
factors which are known to respond to low temperature. However, expression analyses using
transgenic wheat containing a fusion gene with the promoter of TaCBF12 and the GUS
reporter gene would be necessary to prove the importance of the identified cis-acting elements
for cold-induced TaCBF12 expression. Deletion analysis of the MYB element of the
haplotype TaCBF12-b could show whether the MYB element is involved in the regulation of
cold-responsive genes. Furthermore, mutant analysis of TaCBF genes followed by a
transcriptome study of stressed and control plants may provide further information about the
role of each TaCBF gene. The investigation of the role of TaCBF12 can be further studied for
functional causes of association between the haplotypes and the phenotype using this sample,
because this set of wheat accessions shows neither geographic nor other causes for the
haplotypes.
44
Chapter 5
5 Identification of sequence variant associated with

freezing tolerance in wheat by candidate gene-based
and genome-wide association analyses
5.1 Abstract
In order to investigate the genetic basis of wheat adaptation to frost, a candidate gene-based
and a genome-wide association study was performed in a collection of 95 wheat accessions,
which were previously evaluated for winter hardiness traits under severe frost in Jura
(France). The TaCBF12 gene was chosen as a candidate gene. The sequence polymorphisms
in the promoter region of this gene did not show an association with the traits analyzed,
indicating that the genetic variation in TaCBF12 plays only a minor role. For the genome-
wide association study, a set of 32 SSR loci was analyzed for linkage disequilibrium (LD)
with genes potentially involved in the genetic variation of frost tolerance. A significant
association was found between the marker Xcfa2173-4D and the degree of photoinhibition
(Fv/Fm) in November 2005. The alleles potentially useful for selection were identified.
5.2 Introduction
Low temperature is one of the most important limitations of the expansion of wheat. Wheat
improvement and a preservation of its valuable resources with regard to frost tolerance
implies the characterization of the genetic resources. Wheat geneticists have been focusing on
the identification and cloning of quantitative trait loci (QTL) for frost tolerance by use of
conventional map-based strategies (Vágújfalvi et al. 2000; Båga et al. 2007). QTLs are
genomic regions comprising many loci with varying degrees of effect upon the observed
phenotype. QTL mapping analyses use segregating populations derived from crosses between
two inbred lines, implying a low number of meioses and consequently long stretches of
chromosomes in linkage disequilibrium (LD). The main drawback of this long LD extent is a
large confidence interval for QTL locations, between 10 and 20 cM (Darvasi et al. 1993).
Furthermore, classical QTL analysis is valid only for the particular population under study.
Association mapping was developed to overcome these shortcomings. This method does not
require the generation of segregating populations and a large number of progeny (Rafalski
2002). By means of a diverse population of individuals, all historic recombination events are
used, which leads to a higher resolution of the genetic map. Thus, association mapping can
complement current map-based cloning methods. Association mapping can be investigated
45
Association mapping for winter hardiness
using two strategies. The first one relies on the identification of a candidate gene. The
sequencing of the candidate gene in a large genetic background population enables the
identification of polymorphisms which may be associated with phenotypic variation
(Oraguzie and Wilcox 2007). The other strategy detects marker/trait associations by means of
a set of evenly distributed markers across the genome, which is in LD with genes controlling
the trait variation. To date, association mapping studies in hexaploid wheat have focused on
the size of the kernels and milling quality (Breseghello and Sorrells 2006), the quantity of
high-molecular-weight glutenin (Ravel et al. 2006) and Stagonospora nodorum blotch
resistance (Tommasini et al. 2007). Association mapping for abiotic stress was conducted
only for drought tolerance in barley (Ivandic et al. 2003). The locus Fr-A2 is a major QTL for
winter hardiness in wheat and comprises a cluster of CBF transcription factor genes (Miller et
al. 2006). The role of the CBF genes in the genetic variation of winter hardiness is still poorly
understood. Therefore, the TaCBF12 was chosen as a candidate gene and its involvement in
the genetic variation of winter hardiness was analyzed by an association study in a set of 95
wheat accessions. In addition to the candidate gene-based strategy, a genome-wide association
study was implemented, analyzing a set of 32 SSR loci for LD with genes potentially
controlling frost tolerance variation.

5.3.1 Plant material and growth conditions
The 103 wheat Triticum aestivum L. accessions described in Chapter 3 were grown under
field conditions during two consecutive winters (2004/2005 and 2005/2006) at Chaux des
Prés. Leaf greenness (SPAD), maximum quantum efficiency of PSII primary photochemistry
(Fv/Fm), winter survival, the grade for frost hardiness and shoot dry weight after re-growth
were determined (see Chapter 3).
5.3.2 Sequence analysis

The sequence of the promoter region of TaCBF12 of the 103 wheat accessions (see Chapter 4)
was analyzed. A definite sequence was obtained for 95 wheat accessions and was used for
association mapping.
46
Chapter 5
5.3.3 Population structure and association mapping

The genetic diversity of the 95 wheat accessions was analyzed by clustering the accessions by
applying a parametric genetic mixture analysis implemented in the software structure version
2.2 (Pritchard et al. 2000) as described in section 2.3.3. Two to 15 genetic clusters (K) were
tested using the linkage model in conjunction with the correlated allele frequency model
(Falush et al. 2003). For each run, 10 000 burn-in periods were computed followed by 10 000
Markov chain Monte Carlo (MCMC).
The estimated Q matrix was used in the subsequent association mapping carried out by the
TASSEL program, version 2.0.1. The general linear model (GLM) method was employed
considering a population structure within the sample (Bradbury et al. 2007).
5.3.4 False discovery rate control

The control of the proportion of falsely rejected null hypotheses was performed according to a
sequential Bonferroni-type procedure (Benjamini and Hochberg 1995). For each family
hypothesis (one trait, all the markers), the test was implemented as follows:
i
P(i) ≤ × q * with m indicating the number of hypotheses (q* = 0.05).
m
5.4 Results
5.4.1 Comparison of haplotypes
The maximum quantum efficiency of PSII primary photochemistry (Fv/Fm) decreased
throughout both winters; in 2005/06, to a much greater extent than in 2004/05 (Table 5.1). A
t-test comparison of the two haplotypes, without considering the population structure, gave
significantly lower for the Fv/Fm of haplotype TaCBF12-a compared to haplotype TaCBF12-b
in November and December 2005. For TaCBF12-a, the values for leaf greenness (SPAD) in
January and February 2005 were lower but those for shoot dry weight after re-growth after
winter 2004/05 higher compared to the haplotype TaCBF12-b. However, these differences
were below the significance threshold. In winter 2005/06, both haplotypes did not differ
significantly with regard to the determined traits.
47
Table 5.1: Statistics of traits of the haplotypes grown during the winter of 2004/05 and
2005/06 at Chaux des Prés. A t-test was used to calculate the p values of the comparison
between the haplotypes.
Trait Environment Mean ± SD p-value
Winter Month TaCBF12-a TaCBF12-b
Fv/Fm 2004/05 Nov 0.721 ± 0.023 0.732 ± 0.022 0.032 *

Dec 0.712 ± 0.041 0.733 ± 0.036 0.015 *
Jan 0.401 ± 0.130 0.382 ± 0.128 0.479
Feb 0.228 ± 0.211 0.202 ± 0.181 0.539
2005/06 Nov 0.745 ± 0.029 0.747 ± 0.026 0.763
Dec 0.521 ± 0.126 0.526 ± 0.126 0.846
Jan 0.161 ± 0.153 0.168 ± 0.158 0.842
Feb 0.012 ± 0.073 0.007 ± 0.051 0.718
SPAD 2004/05 Nov 38.3 ± 2.5 38.5 ± 3.5 0.722
Dec 38.1 ± 3.8 37.8 ± 5.0 0.790
Jan 34.4 ± 8.2 36.5 ± 7.9 0.219
Feb 23.5 ± 14.5 27.3 ± 13.7 0.203
2005/06 Nov 48.7 ± 3.5 48.7 ± 3.3 0.956
Dec 45.7 ± 4.9 45.7 ± 4.7 0.949
Jan 29.1 ± 14.8 29.0 ± 14.6 0.962
Feb 01.1 ± 6.7 00.8 ± 6.3 0.869
Shoot DW 2004/05 0.174 ± 0.105 0.145 ± 0.142 0.270
g plant-1 2005/06 0.196 ± 0.215 0.167 ± 0.190 0.500
Survival 2004/05 59.8 ± 42.4 65.5 ± 41.7 0.516
% 2005/06 41.6 ± 40.3 43.0 ± 39.9 0.871
Mark 2004/05 5.6 ± 3.0 5.8 ± 2.8 0.742
2005/06 5.3 ± 3.1 5.6 ± 3.0 0.721
* indicate significance at α = 0.05.
5.4.2 Population structure

The likelihood values and the variance were plotted against K in order to determine the
optimal K value (Fig 5.1). The method for determining K from Evanno et al. (2005) resulted
in two distinct peaks for ΔK: K = 5 and at K = 10 (Fig. 5.1 B). The barplots of the proportional
membership of individual accessions at K = 5 showed a high proportion of admixtures and a
less clear sectioning of the accessions into clusters for the majority of the 20 runs. This was
not the case for K = 10 and, therefore, the number of populations was assumed to be ten; the
population structure was obtained from the run at K = 10 showing the highest value for L(K).
48
Chapter 5
-3000 2.0
A B
1.5
-3500
1.0
L(K)
ΔK
-4000
0.5
-4500
0.0
-5000
2 4 6 8 10 12 14 2 4 6 8 10 12 14
K K
Figure 5.1: Determination of the number of genetic clusters (K) based on the graphical
method of Evanno et al. (2005). (A) Mean L(K) ± SD over 20 runs for each K value. (B) ΔK
calculated as ΔK = |L''(K)|/SD[L(K)].
This run was also characterized by a relatively low proportion of admixtures (Fig. 5.2). The
average p̂ max of all the accessions was the fourth lowest of the 20 runs.
For the 10 populations it was possible to identify origin-related as well as type- and variety-
related causes of the population structure (Fig. 5.3). Populations B and F consisted mainly of
western European material, especially from France. Groups with high FST were E (FST =
0.703) and G (FST = 0.787). While group G consisted of spring wheat from South America,
group E consisted of winter wheat of the variety lutescens mainly from northern Europe. The
low FST of group A (FST = 0.004) was also reflected by its composition; accessions from all
the regions were represented.
1.0 A
B
0.8 C
D
0.6 E
F
0.4 G
H
0.2 I
J
0.0
Fig. 5.2: Bar plot of the proportional membership of individual accessions within each of the
10 inferred populations ( p̂ ). Each accession is represented by a vertical bar of different
colours representing the admixture to the 10 populations. Data are values for the run with the
highest L(K) at K = 10.
49
25 N-America
A S-America
20 N-Europe
W-Europe
E-Europe
15 S-Europe
Africa
Asia
10 Oceania
0
Winter wheat
B
Spring wheat
20 Intermediate
nd
15
10
0
albidum
C alborubrum
20 erythrosperum
sub-erythrospermum
ferrugineum
15 graecum
hostianum
lutescens
10 sub-meridionale
milturum
5 velutinum
nd
0
A B C D E F G H I J
Population
Fig. 5.3: Type (A), origin (B) and variety (C) of the 95 accessions comprised in the 10
populations (A-J).
5.4.3 Candidate gene based association mapping

As shown in Chapter 4, the nine SNPs in the promoter region of TaCBF12 were completely
associated. Thus, these polymorphic sites constitute a suite of polymorphisms that display
absolute linkage disequilibrium with each other. Using the general linear model (GML), an
association of Fv/Fm measured in December 2004 with the identified SNPs could be identified
(Table 5.2). However, the false discovery rate control indicated that this association might be
a false positive. Almost identical results were obtained with the mixed linear model (MLM),
which considers kinship within the tested samples.
50
Chapter 5
Table 5.2: Comparison-wise p-values of association of the nine SNPs of the TaCBF12
promoter region with Fv/Fm, leaf greenness, grade for frost tolerance, survival rate and shoot
dry weight after re-growth determined during winter 2004/05 and 2005/06 at Chaux des Prés.
Environment p-value
Winter Month Fv/Fm SPAD Mark Survival Shoot DW
2004/05 Nov 0.288 0.607

Dec 0.039 * 0.487
} 0.585 0.476 0.611
Jan 0.739 0.551
Feb 0.803 0.385
2005/06 Nov 0.768 0.835
Dec 0.844 0.892
Jan 0.487 0.989 } 0.729 0.629 0.696
Feb 0.501 0.578
all 0.707 0.646 0.519 0.385 0.910
* indicate significance at α = 0.05.
5.4.4 Genome wide association mapping

The association of the SSR markers with winter hardiness traits in the presence of population
structure was analyzed by the general linear model (GML). Very similar results were obtained
when the mixed linear model (MLM), which considers kinship within the tested samples, was
employed. The marker Xcfa2173 on chromosome 4D was strongly associated with Fv/Fm in
Xcfa2173 (4D)
0.008
0.004
ΔFv/Fm
0.000
-0.004
-0.008
1 2 4 7
Allele
Figure 5.4: Phenotypic effect of the alleles at locus Xcfa2173 (4D) associated with Fv/Fm in
November 2005. Only phenotypic effects of alleles with a frequency of at least 10 % are
shown.
51
November 2005 (P = 0.001) after the false discovery rate control. The allele effect of this
association was estimated on comparison to the remaining alleles for each locus (Fig. 5.4).
The alleles 1 and 4 were associated with an increase in Fv/Fm in November 2005. Accessions
carrying allele 2 at the Xcfa2173 locus were characterized by a lower Fv/Fm in November
2005 compared to the remaining accessions.
5.5 Discussion
Quantitative trait loci (QTL) analysis have revealed in few independent mapping populations
a major QTL for various winter hardiness traits at the locus Fr-A2 on chromosome 5A of
wheat (Vágújfalvi et al. 2000; Båga et al. 2007). To verify the importance of this locus for
winter hardiness across a large set of wheat accessions, it is beneficial to study the
involvement of this region in the winter hardiness by association mapping. Breseghello et al.
(2006) found an extensive LD of 5 cM in the centromeric region of chromosome 5A. They
attributed this LD to domestication or to artificial selection, which probably generated a
reduction in the allele diversity in this region. The Fr-A2 locus was mapped on the long arm
of chromosome 5A of Triticum monococcum, 40 cM from the centromere (Vágújfalvi et al.
2003). Thus, Fr-A2 is not located in the LD block found by Breseghello et al. (2006). Since
there are no further information about the LD on chromosome 5A, the candidate gene-based
association study is the adequate method for the mentioned aim.
To perform the association analysis, a model which takes into account the structured
association was used. In order to initially analyze the genetic stratification of the material, the
95 studied accessions were clustered with respect to their genetic diversity by applying a
parametric genetic mixture analysis (Pritchard et al. 2000). Multilocus genotype data,
processed through a model-based clustering method, allowed to infer populations and to
assign individuals to these populations. A structure of 10 groups was found for the 95
analyzed wheat accessions. Such a group structure is frequent in collections with a wide
genetic background. For the association analysis per se, the general linear model (GLM) was
selected to achieve the candidate based association mapping. However, it must be considered
that within a population unrelated individuals do not exist (Nordborg and Tavaré 2002).
Therefore, data were also tested with a mixed linear model (MLM), which considers
population structure and takes genome-wide differences in relatedness into account via
estimated pair-wise kinship coefficients. Both models gave similar results. In Contrast to
maize, levels of familial relatedness can be very diverse in wheat. Yu et al. (2006) stated that
52
Chapter 5
methods still have to be found, which prove most useful when evaluating selfing species with
a high degree of population structure. It is shown here that the studied population captured
low familial relatedness and, therefore, the GLM model was suitable. However, pursuing
multiple inferences can lead to a proportion of falsely rejected null hypotheses. The
proportion of errors committed by falsely rejecting null hypotheses (the false discovery rate,
FDR) was controlled here by employing a sequential Bonferroni-type procedure. This
procedure enables to support with appropriate confidence, statements about associations that
result from multiple comparisons (Benjamini and Hochberg 1995).
As candidate gene for winter hardiness, the gene TaCBF12, respectively its promoter
sequence, was chosen (see Chapter 4). The TaCBF12 gene seems to be located at the Fr-A2
locus as Miller et al. (2006) reported that TmCBF12 is located within a cluster of 11 CBF
genes at the Fr-Am2 locus in Triticum monococcum. The results of the association analysis
revealed that the SNPs in the TaCBF12 promoter region do not play a major role in the
natural variation of winter hardiness. Nevertheless, TaCBF12 may play a minor role or may
have an epistatic effect for the genetic variation of winter hardiness in wheat. The results of
the analysis of the TaCBF12 promoter sequence for cis-acting elements indicated that
TaCBF12 is induced by exposure to low temperature (see Chapter 4). All the studied TaCBF
genes of the cluster at the Fr-A2 locus, with the exception of TaCBF9, were shown to be
induced by cold (Miller et al. 2006); however, TaCBF12 was not analyzed. Under drought
stress, TaCBF12 was not expressed in durum wheat (De Leonardis et al. 2007). Results of
studies of barley, however, showed that the homologue gene, HvCBF12, was expressed upon
exposure to low temperature; moreover, the transcript level was higher in the frost-tolerant
variety Nure than in the frost-sensitive variety Tremois (Stockinger et al. 2007).
Informations about the alleles of the SSR markers, which was used originally to analyze the
population structure, was used for a genome-wide association study. The probability of
finding significant associations by this method increases with the LD level in the target
region. So far, LD patterns have been assessed for chromosomes 2D and in the centrometric
region of 5A where LD was lower than 1 cM and about 5 cM, respectively, in a population of
149 wheat accessions (Breseghello and Sorrells 2006). In a population of 44 European wheat
varieties, Tommasini et al. (2007) found a LD of 0.5 cM on chromosome 3B. Since the LD
level can be assumed to be around 1 cM to a few cM long, the probability of finding a
marker/trait association with only 32 loci is rather small. Cahalan and Law (1979) and Sutka
et al. (1986) have suggested that at least 10 of the 21 chromosomes pairs of wheat are
involved in frost resistance. The genome-wide association study showed that the locus
53
Xcfa2173 on chromosome 4D was strongly associated with the degree of photoinhibition

(Fv/Fm) in November 2005. The Xcfa2173 locus is located on the long arm of chromosome
4D. Chao et al. (2007) observed large genetic distances (> 30 cM) remaining in LD on the
long arm of chromosome 4D in a population of 42 US wheat varieties, which was the longest
LD ever measured of wheat. It has often been suggested that chromosome 4D is involved in
frost tolerance. Using a set of chromosome substitution lines of the variety Cheyenne into
Chinese Spring (CS/Ch), genes responsible for the frost resistance of the wheat variety
Cheyenne were found to be located on chromosome 4D (Sutka 1981). Moreover,
chromosome 4D from Cheyenne gave also frost tolerance to the variety Wichita; it increased
crown survival, which was chosen as indicator of frost tolerance (Yazdi-Samadi et al. 2006).
Further analyses of the substitution line CS/Ch 4D showed that the chromosome 4D produced
a transient increase in frost tolerance during the initial stages of hardening (Veisz and Sutka
1989). This observation complies with the fact that, in the present study, the marker/trait
association was also found during the hardening phase.
In summary, a strongly significant association was found between Fv/Fm in November 2005
and the SSR marker Xcfa2173 on chromosomes 4D. The identified alleles may be useful in
selecting for frost tolerance during the winter hardening of wheat. The genetic variation in the
promoter region of TaCBF12 was found to play a minor role in frost tolerance. The
introgression of the TaCBF12-b haplotype into elite breeding material by marker-assisted
backcrossing using allele-specific markers could give more insight into the contribution of the
identified polymorphism to the frost tolerance variation.
54
Chapter 6
6 General Conclusions
Genetic resources are of high interest for breeding varieties with improved tolerance to abiotic
stress. In this thesis, genetic resources available at the research station Agroscope Changins-
Wädenswil (Switzerland) were studied with respect to their genetic variation in winter
hardiness. The project was conducted in three major steps: (i) characterization of a large set of
wheat accessions with respect to their phylogeny, (ii) examination of the winter hardiness of a
selected subset of this wheat material and (iii) implementation of the obtained phenotypic data
in a candidate gene-based and genome-wide association study.
The phylogenetic analysis of the 320 wheat accessions with SSR markers revealed high
genetic diversity, which seemed to be caused by hybridization with close and distant relatives
and gene flow between cultivated species that occurred over centuries of breeding and
cultivating wheat. This was also reflected by the high degree of admixture in the twelve
subpopulations, which were identified by the parametric genetic mixture analysis. In
particular, the accessions from South America were characterized by a high degree of gene
diversity and were consequently found in several of the identified subpopulations. In contrast,
wheat accessions from southern or northern Europe showed less gene diversity and a large
part of each of these geographic groups were assigned to a particular cluster.
The high genetic diversity was also reflected in the wide range of winter hardiness.
Geographic origin was a predominant factor in the winter hardiness determined by comparing
standard varieties. Accessions from Australia, South America and southern Europe were
particularly sensitive to low temperature, while material from northern Europe and North
America showed a high degree of winter hardiness.
Based on analysis of the chlorophyll fluorescence, the wheat material was divided into five
major groups based on the time course of the maximum quantum efficiency of PSII primary
photochemistry (Fv/Fm) during both winters. Since the two experimental seasons were
characterized by different temperature courses, these groups were attributed to different frost
response types. The ability to acclimate to different levels of frost and the capability of
withstanding long periods of strong frost were revealed. In conjunction with the determination
of leaf greenness, the analysis of Fv/Fm also allowed to discriminate among the wheat material
with regard to winter hardiness early in winter before lasting damage to the plant had
occurred. Therefore, this method gave a better characterization of wheat material compared to
55
General Conclusions
observations of winter survival only, especially in regions with less severe frost where
genotypes with a low level of winter hardiness are able to survive.
The studied wheat material is characterized by a high degree of genetic diversity and a strong
variation in winter hardiness, making it suitable material for association mapping. The gene
TaCBF12 was chosen for the candidate gene-based association study. This gene codes for a
putative stress responsive transcription factor localized at the Fr-A2 locus, a major locus for
frost tolerance in wheat. The sequence analysis of the TaCBF12 promoter region revealed two
haplotypes, which differed in nine completely associated SNPs indicating that these SNPs
occurred at the same time and that recombination did not occur again in this region. Only two
haplotypes were found, which were widely distributed in the wheat material, leading to the
assumption that the SNPs are ancient and that the promoter region of TaCBF12 is a conserved
region in the genome.
The TaCBF12 promoter contains cis-acting elements, which are potentially involved in the
low-temperature response. The presence of CRT/DRE elements indicates that TaCBF12
expression can be regulated by other CBF transcription factors or even by itself. The two
TaCBF12 haplotypes differed in the presence/absence, of a MYB cis-acting element and a
cis-acting element, which is involved in light-regulated gene expression. Since MYB15 has
been shown to be negative regulator of CBF genes in Arabidopsis (Argawal et al. 2006) and
since excitation pressure plays a crucial role in acquired frost tolerance (Pocock et al. 2001),
the two haplotypes were tested for association with variation in frost tolerance. The
association analysis based on the GML procedure did not reveal an association between the
haplotypes and the winter hardiness. This indicates that the SNPs in the promoter region of
TaCBF12 are not responsible for genotypic variation in the winter hardiness of wheat. The
role of TaCBF12 in acquiring frost tolerance is still largely unknown. Although the promoter
region of TaCBF12 contains cis-acting elements, which are known to be involved in low-
temperature-induced gene expression, induction of TaCBF12 due to cold or freezing has not
been demonstrated yet. Furthermore, the TaCBF12 gene has not yet been sequenced and,
therefore, it is not known whether other haplotypes for this gene exist and which might be
involved in the genotypic variation of winter hardiness.
The genome-wide association study revealed a highly significant association between the
marker Xcfa2173 on chromosome 4D and Fv/Fm at the beginning of the winter. Chromosome
4D is known to harbor a locus for frost tolerance (Sutka 2001) and probably the vernalization
locus VRN-2 too (Snape et al. 2001). The association of Xcfa2173 with Fv/Fm was only
transient and seems, therefore, to be involved in the acclimation process rather than to play a
56
Chapter 6
central role in winter survival. Conducting QTL analyses, in particular for the region that is in
LD with Xcfa2173, could bring new insight into the involvement of chromosome 4D in winter
hardiness.
This work might contribute to a better use of genetic resources and might provide new insight
into the response of wheat to frost stress. It showed that a combination of physiological and
genetic analysis enables the identification of genes important for the genetic variation of
winter hardiness in wheat. The introduction of new traits can be assisted by molecular
markers, which will evolve progressively from anonymous linked sequences to sequences of
the genes of interest. Furthermore, the increased knowledge of plant processes provided by
genomic studies will lead to new tools to assist the breeding of cultivars that are better
adapted to harsh climatic conditions.
57
7 References
Acevedo R, Ceccaralli S (1989) Role of physiologist-breeder in a breeding program for

drought resistance conditions. In: FWG Baker (ed) Drought resistance in cereals. CAB
International, Wallingford, pp. 117-139
Anderson JA, Churchill GA, Autriaue JE, Sorrells ME, Tanksley SD (1993) Optimizing
parental selection for genetic linkage maps. Genome 36:181-186
Annichiarico PP, Pecetti L (1995) Morpho-physiological traits to complement grain yield
selection under semi-arid Mediterranean conditions in each of the durum wheat types
mediterraneum typicum and syriacum. Euphytica 86:191-198
Argawal M, Hao Y, Kapoor A, Dong C-H, Fujii H, Zheng Y, Zhu J-K (2006) A R2R3 type
MYB transcription factor is involved in the cold regulation of CBF genes and in acquired
freezing tolerance. Journal of Biological Chemistry 281:37636-37645
Badawi M, Danyluk J, Boucho B, Houde M, Sarhan F (2007) The CBF gene family in
hexaploid wheat and its relationship to the phylogenetic complexity of cereal CBFs.
Molecular Genetics and Genomics 277:533-554
Båga M, Chodaparambil SV, Limin AE, Pecar M, Fowler DB, Chibbar RN (2007)
Identification of quantitative trait loci and associated candidate genes for low temperature
tolerance in cold-hardy winter wheat. Functional & Integrative Genomics 7:53-68
Baker SS, Wilhelm KS, Tomashow MF (1994) The 5'-region of Arabidopsis thaliana cor15a
has cis-acting elements that confer cold-, drought- and ABA-regulated gene expression.
Plant Molecular Biology 24:701-713
Barnes JD, Wilson JM (1984) Assessment of the frost sensitivity of Trifolium species by
chlorophyll fluorescence analysis. Annals of Applied Biology 105:107-116
Barrett BA, Kidwell KK (1998) AFLP-based genetic diversity assessment among wheat
cultivars from the pacific Northwest. Crop Science 38:1261-1271
Batley J, Barker G, O'Sullivan H, Edwards KJ, Edwards D (2003) Mining for single
nucleotide polymorphisms and insertions/deletions in maize expressed sequence tag data.
Plant Physiology 132:84-91
Becker H (1993) Pflanzenzüchtung. Stuttgart: Verlag Eugen Ulmer.
Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and
powerful approach to multiple testing. Journal of the Royal Statistical Society B 57:289-
300
Björkman O, Demmig B (1987) Photon yield of O2 evolution and chlorophyll fluorescence
characteristics at 77 K among vascular plants of diverse origins. Planta 170:489-504
Bonjean AP, Angus WJ (2001) The World Wheat Book. Lavoisier Publishing, Paris
Börner A, Chebotar S, Korzun V (2000a) Molecular characterisation of the genetic integrity
of wheat (Triticum aestivum L.) germplasm after long-term maintenance. Theoretical and
Applied Genetics 100:494-497
Börner A, Röder M, Unger O, Meinel A (2000b) The detection and molecular mapping of a
major gene for non-specific adult-plant disease resistance against stripe rust (Puccinia
striiformis) in wheat. Theoretical and Applied Genetics 100:1095-1099
58
Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES (2007) TASSEL:
software for association mapping of complex traits in diverse samples. Bioinformatics
23:2633-2635
Breseghello F, Sorrells ME (2006) Association mapping of kernel size and milling quality in
wheat (Triticum aestivum L.) cultivars. Genetics 172:1165-1177
Briggle LW (1980) Origin and botany of wheat. In: E Häflige (ed) Wheat. Documenta Ciba-
Geigy, Basel, pp. 6-13
Burkhamer RL, Lanning SP, Martens RJ, Martin JM, Talbert LE (1998) Predicting progeny
variance from parental divergence in hard red spring wheat. Crop Science 38:243-248
Cahalan C, Law CN (1979) The genetical control of cold resistance and vernalisation
requirement in wheat. Heredity 42:125-132
Castonguay Y, Nadeau P, Laerge S (1993) Freezing tolerance and aleration of translatable
mRNAs in alfalfa hardened at subzero temperatures. Plant and Cell Physiology 34:31-38
Castonguay Y, Nadeau P, Lechasseur P, Chouinard L (1995) Differential accumulation of
carbohydrates in alfalfa cultivars of contrasting winter hardiness. Crop Science 35:509-515
Ceccarelli S, Acevedo E, Grando S (1991) Breeding for yield stability in unpredictable
environments: Single traits, interaction between traits, and architacture of genotypes.
Euphytica 56:169-185
Chao S, Sharp PJ, Worland AJ, Warham EJ, Koebner RMD, Gale MD (1989) RFLP-based
genetic maps of wheat homoeologous group 7 chromosome. Theoretical and Applied
Genetics 78:495-504
Chao S, Zhang W, Dubcovsky J, Sorrells M (2007) Evaluation of genetic diversity and
genome-wide linkage disequilibrium among US wheat (Triticum aestivum L.) germplasm
representing different market classes. Crop Science 47:1018-1030
Chen HB, Martin JM, Lavin M, Talbert LE (1994) Genetic diversity in hard red spring wheat
based on sequence-tagged-site PCR markers. Crop Science 34:1628-1632
Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG (2003) Multiple sequence
alignment with the clustal series of programs. Nucleic Acids Research 31:3497-3500
Chinnusamy V, Ohta M, Kanrar S, Lee B-H, Hong X, Agarwal M, Zhu J-K (2003) ICE1: a
regulator of cold induced transcriptome and freezing tolerance in Arabidopsis. Genes &
Development 17:1043-1054
Choi DW, Rodriguez EM, Close TJ (2002) Barley Cbf3 gene identification, expression
pattern, and map location. Plant Physiology 129:1781-1787
Clement JMAM, Van Hasselt PR (1996) Chlorophyll fluorescence as a parameter for frost
hardiness in winter wheat: A comparison with other hardiness parameters. Phyton 36:29-41
Coulondre C, Miller JH, Farabaugh PJ, Gilbert W (1978) Molecular basis of base substitution
hot spots in Escherichia coli. Nature 274:775-780
Crosatti C, Polverino de Laureto P, Bassi R, Cativelli L (1999) The interaction between cold
and light controls the expression of the cold-regulated barley cor14b and the accumulation
of the corresponding protein. Plant Physiology 119:671-680
Darvasi A, Weinreb A, Minke V, Weller JI, Soller M (1993) Detecting marker-QTL linkage
and estimating QTL gene effect and map location using a saturated genetic map. Genetics
134:943-951
59
De Leonardis AM, Marone D, Mazzucotelli E, Neffar F, Rizza F, Di Fonzo N, Cattivelli L,
Mastrangelo AM (2007) Durum wheat genes up-regulated in the early phases of cold stress
are modulated by drought in a developmental and genotype dependent manner. Plant
Science 172:1005-1016
Deutsch S, Iseli C, Bucher P, Antonarakis SE, Scott HS (2001) A cSNP map and database for
human chromosome 21. Genome Research 11:300-307
Devos KM, Gale MD (1992) The use of random amplified polymorphic DNA markers in
wheat. Theoretical and Applied Genetics 84:567-572
Donini P, Stephenson P, Bryan GJ, Koebner RMD (1998) The potential of microsatellites for
high throughput genetic diversity assessment in wheat and barley. Genetic Resources and
Crop Evolution 45:415-421
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2003) OsDREB genes in rice, Oryza sativa L., encode
transcription activators that function in drought-, high-salt- and cold responsive gene
expression. The Plant Journal 33:751-763
Dunn MA, White AJ, Vural S, Hughes MA (1998) Identification of promoter elements in a
low-temperature-responsive gene (blt4.9) from barley (Hordeum vulgare L.). Plant
Molecular Biology 38:551-564
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using
the software STRUCTURE: a simulation study. Molecular Ecology 14:2611-2620
Fahima T, Röder MS, Wendehake K, Kirzhner VM, E N (2002) Microsatellite polymorphism
in natural populations of wild emmer wheat, Triticum dicoccoides, in Israel. Theoretical
and Applied Genetics 104:17-29
Falush D, Stephens M, Pritchard JK (2003) Inference of population structure using multilocus
genotype data: linked loci and correlated allele frequencies. Genetics 164:1567-1587
Feldman M (2001) Origin of cultivated wheat. In: AP Bonjean, WJ Angus (eds) The World
Wheat Book. Lavoisier Publishing, Paris, pp. 3-56
Fowler DB, Gusta LV (1979) Selection for winterhardiness in wheat. I. Identification of
genotypic variability. Crop Science 19:769-772
Fracheboud Y, Jompuk C, Ribaut JM, Stamp P, Leipner J (2004) Genetic analysis of cold-
tolerance of photosynthesis in maize. Plant Molecular Biology 56:241-253
Fracheboud Y, Leipner J (2003) The application of chlorophyll fluorescence to study light,
temperature, and drought stress. In: JR DeEll, PMA Toivonen (eds) Practical Applications
of Chlorophyll Fluorescence in Plant Biology. Kluwer Academic Publishers, Dordrecht,
pp. 125-150
Francia E, Rizza F, Cattivelli L, Stanca AM, Galiba G, Tóth B, Hayes PM, Skinner JS,
Pecchioni N (2004) Two loci on chromosome 5H determine low temperature tolerance in a
'Nure' (winter) × 'Tremois' (spring) barley map. Theoretical and Applied Genetics 108:670-
680
Fu P, Wilen R, Wu G, Robertson A, Gusta L (2000) Dehydrin gene expression and leaf water
potential differs between spring and winter cereals during cold acclimation. Journal of
60
Galiba G, Quarrie SA, Sutka J, Morgounov A, Snape JW (1995) RFLP mapping of the
vernalization (Vrn1) and frost resistance (Fr1) genes on chromosome 5A of wheat.
Theoretical and Applied Genetics 90:1174-1179
Garg K, Green P, Nickerson DA (1999) Identification of candidate coding region single
nucleotide polymorphisms in 165 human genes using assembled expressed sequence tags.
Genome Research 9:1087-1092
Gilmour SJ, Fowler SG, Thomashow MF (2004) Arabidopsis transcriptional activators CBF1,
CBF2, and CBF3 have matching functional activities. Plant Molecular Biology 54:767-781
Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998)
Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional
activators as an early step in cold-induced COR gene expression. The Plant Journal 16:433-
442
Griffith M, Lumb C, Wiseman S, Wisniewski M, Johnson R, Marangoni A (2005) Antifreeze
proteins modify the freezing process in planta. Plant Physiology 138:330-340
Groom QJ, Baker NR (1992) Analysis of light-induced depressions of photosynthesis in
leaves of a wheat crop during the winter. Plant Physiology 100:1217-1223
Grotewold E, Drummond BJ, Bowen B, Peterson T (1994) The myb-homologous P gene
controls phlobaphene pigmentation in maize floral organs by directly activating a
flavonoid biosynthetic gene subset. Cell 76:543-553
Gupta PK, Balyan HS, Edwards KJ, P I, Korzun V, Röder MS, Gautier MF, Joudrier P,
Schlatter AR, Dubcovsky J, De la Pena RC, Khairallah M, Penner G, Hayden MJ, Sharp P,
Keller B, Wang RRC, Hardouin JP, Jack P, Leroy P (2002) Genetic mapping of 66 new
microsatellite (SSR) loci in bread wheat. Theoretical and Applied Genetics 105:413-422
Guy CL, Li QB (1998) The organisation and evolution of the spinach stress 70 molecular
chaperone gene family. The Plant Cell 10:539-556
Guyomarc'h H, Sourdille P, Charmet G, Edwards KJ, Bernard M (2002a) Characterisation of
polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-
genome of bresad wheat. Theoretical and Applied Genetics 104:1164-1172
Guyomarc'h H, Sourdille P, Edwards KJ, Bernard M (2002b) Studies of the transferability of
microsatellites derived from Triticum tauschii to hexaploid wheat and to diploid related
species using amplification, hybridization and sequence comparisons. Theoretical and
Applied Genetics 105:736-744
Hammer K, Filatenko AA, Korzun V (2000) Microsatellite markers - a new tool for
distinguishing diploid wheat species. Genetic Resources and Crop Evolution 47:497-505
Harding R, Boyce A, Clegg J (1992) The evolution of tandemly repetitive DNA:
recombination rules. Genetics 132:847-859
Haussmann BIG, Parzies HK, Presterl T, Susic Z, Miedaner T (2004) Plant genetic resources
in crop improvement. Plant Genetic Resources 2:3-21
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements
(PLACE) database: 1999. Nucleic Acids Research 27:297-300
Hömmö LM (1994) Hardening of some winter wheat (Triticum aestivum L.), rye (Secale
cereale L.), triticale (× Triticosecale Wittmack) and winter barley (Hordeum vulgare L.)
cultivars during autumn and the final winter survival in Finland. Plant Breeding 112:285-
293
61
Huang XQ, Börner A, Röder MS, Ganal M (2002) Assessing genetic diversity of wheat
(Triticum aestivum L.) germplasm using microsatellite markers. Theoretical and Applied
Genetics 105:699-707
Huang XQ, Hsam SLK, Zeller FJ, Wenzel G, Mohler V (2000) Molecular mapping of the
wheat powdery mildew resistance gene Pm24 and marker validation for molecular
breeding. Theoretical and Applied Genetics 101:407-414
Hudson ME, Quail PH (2003) Identification of promoter motifs involved in the network of
phytochrome A-regulated gene expression by combined analysis of genomic sequence and
microarray data. Plant Physiology 133:1605-1616
Hurry V, Strand A, Furbank R, Stitt M (2000) The role of inorganic phosphate in the
development of freezing tolerance and the acclimation of photosynthesis to low
temperatures is revealed by the pho mutant of Arabidopsis thaliana. The Plant Journal
24:383-396
Hurry VM, Krol M, Öquist G, Huner NPA (1992) Effect of long-term photoinhibition on
growth and photosynthesis of cold-hardened spring and winter wheat. Planta 188:369-375
Ivandic V, Thomas WTB, Nevo E, Zhang Z, Forster BP (2003) Associations of simple
sequence repeats with quantitative trait variation including biotic and abiotic stress
tolerance in Hordeum spontaneum. Plant Breeding 122:300-304
Jaglo-Ottosen. K, Gilmour S, Zarka D, Schabenberger O, Thomashow M (1998) Arabidopsis
CBF1 overexpression induces COR genes and enhances freezing tolerance. Science
280:104-106
Jiang C, Iu B, Singh J (1996) Requirement of a CCGAC cis-acting element for cold induction
of BN115 gene from B. napus. Plant Molecular Biology 30:679-684
Jompuk C, Fracheboud Y, Stamp P, Leipner J (2005) Mapping of quantitative trait loci
associated with chilling tolerance in maize (Zea mays L.) seedlings grown under field
conditions. Journal of Experimental Botany 56:1153-1163
Joshi CP, Nguyen HT (1993) RAPD (random amplified polymorphic DNA) analysis based
intervarietal genetic relationship among hexaploid wheats. Plant Science 93:95-103
Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H (2006) Rapid
transcriptome changes induced by cytosolic Ca2+ transients reveal ABRE-related
sequences as Ca2+-responsive cis element in Arabidopsis. The Plant Cell 18:2733-2748
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant
drought, salt, and freezing tolerance by gene transfer of a single stress-inducible
transcription factor. Nature Biotechnology 17:287-291
Kim HS, Ward RW (2000) Patterns of RFLP-based genetic diversity in germplasm pools of
common wheat with different geographical or breeding program origins. Euphytica
115:197-208
Kim S, An CS, Hong Y-N, Lee KW (2004) Cold inducible transcription factor, CaCBF, is
associated with a Homeodomain leucine zipper protein in hot pepper (Capsicum annuum,
L.). Mol. Cells 18:300-308
Kitashiba H, Ishizaka T, Isuzugawa K, Nishimura K, Suzuki T (2004) Expression of a sweet
cherry DREB1/CBF ortholog in Arabidopsis confers salt and freezing tolerance. Journal of
62
Korzun V, Röder MS, Ganal MW, Worland AJ, Law CN (1998) Genetic analysis of the
dwarfing gene (Rht8) in wheat. Part I. Molecular mapping of the Rht8 on the short arm of
chromosome 2D of bread wheat (Triticum aestivum L.). Theoretical and Applied Genetics
96:1104-1109
Krause GH (1988) Photoinhibition of photosynthesis. An evaluation of damaging and
protective mechanisms. Physiologia Plantarum 74:566-574
Lecomte C, Giraud A, Aubert V: Face au gel, quels sont les facteurs de résistance au froid?
Perspectives agricoles (2003).
Lee EA, Staebler MA, Tollenaar M (2002) Genetic variation in physiological discriminators
for cold tolerance-early autotrophic phase of maize development. Crop Science 42:1919-
1929
Leonard WH, Martin JH (1963) Cereal Crops. MacMillan Publishing, New York, USA
Levitt J (1980) Response of Plants to Environmental Stress. Volume II. Water, Radiation, Salt
, and Other Stresses. Academic Press, New York
Lindgren K, Hällgren JE (1993) Cold acclimation of Pinus contorta and Pinus sylvestris
assessed by chlorophyll fluorescence. Tree Physiology 13:97-106
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998)
Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding
domain separate two cellular signal transduction pathways in drought- and low-
temperature-responsive gene expression, respectively, in Arabidopsis. The Plant Cell
10:1391-1406
Livingston DP (1996) The second phase of cold acclimation: Freezing tolerance and fructan
isomer changes in winter cereal crowns. Crop Science 36:1568-1573
Maccaferri M, Sanguineti MC, Donini P, Tuberosa R (2003) Microsatellite analysis reveals a
progressive widening of the genetic basis in the elite durum wheat germplasm. Theoretical
Mc Kersie B, Bowley S (1997) Active oxygen and freezing tolerance in transgenic plants. In:
Plenum (ed) Molecular Biology, Biochemistry and physiology. New York, pp. 203-214
Miller AK, Galiba G, Dubcovsky J (2006) A cluster of 11 CBF transcription factors is located
at the frost tolerance locus Fr-Am2 in Triticum monococcum. Molecular Genetics and
Genomics 275:193-203
Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun D-J,
Hasegawa PM (2007) SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A
expression and freezing tolerance in Arabidopsis. The Plant Cell 19:1403-1414
Nagaoka T, Ogihara Y (1997) Applicability of inter-simple sequence repeat polymorphisms
in wheat for use as DNA markers in comparison to RFLP and RAPD markers. Theoretical
Nakamura M, Tsunoda T, Obokata J (2002) Photosynthesis nuclear genes generally lack
TATA-boxes: a tobacco photosystem I gene responds to light through an initiator. The
Plant Journal 29:1-10
Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2006) Transcriptional regulation of ABI3- and ABA-responsive
genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of
Arabidopsis. Plant Molecular Biology 60:51-68
63
Ndong C, Danyluk J, Huner NPA, Sarhan F (2001) Survey of gene expression in winter rye
during changes in growth temperature and irradiance or excitation pressure. Plant
Molecular Biology 45:691-703
Nei M (1973) Analysis of gene diversity in subdivided populations. Proceedings of the
National Academy of Sciences of the United States of America 70:3321-3323
Nordborg M, Tavaré S (2002) Linkage disequilibrium: what history has to tell us. Trends in
Genetics 18:83-90
Novillo F, Alonso JM, Ecker JR, Salinas J (2004) CBF2/DREB1C is a negative regulator of
CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in stress tolerance
in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of
America 101:3985-3990
Nuttonson MY (1955) Wheat–Climate Relationships and the Use of Phenology in
Ascertaining the Thermal and Photo-thermal Requirements of Wheat. American Institute
of Crop Ecology, Washington DC
Olien CR (1984) An adaptive response of rye to freezing. Crop Science 24:51-54
Olson S (2002) EMBOSS opens up sequence analysis. European Molecular Biology Software
Suite. Briefings in Bioinformatics 3:87-91
Öquist G, Huner NPA (2003) Photosynthesis of overwintering evergreen plants. Annual
Review of Plant Biology 54:329-355
Öquist G, Hurry VM, Huner NPA (1993) Low-temperature effect on photosynthesis and
correlation with freezing tolerance in spring and winter cultivars of wheat and rye. Plant
Physiology 101:245-250
Oraguzie NC, Wilcox PL (2007) An overview of association mapping. In: NC Oraguzie, EHA
Rikkerink, SE Gardiner, HN de Silva (eds) Association Mapping in Plants. Springer, New
York, pp. 1-9
Osmond CB (1994) What is photoinhibition? Some insights from the comparison of shade
and sun plants. In: NR Baker, JR Bowyer (eds) Photoinhibition of Photosynthesis: From
Molecular Mechanisms to the Field. Bios Scientific Publishers, Oxford, pp. 1-24
Paillard S, Schnurbusch T, Winzeler M, Sourdille P, Abderhalden O, Keller B, Schachermayr
G (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.).
Parker GD, Chalmers KJ, Rathjen AJ, Langride P (1998) Mapping loci associated with flour
colour in wheat (Triticum aestivum L.). Theoretical and Applied Genetics 97:238-245
Peng JH, Fahima T, Röder MS, Li YC, Dahan A, Grama A, Ronin YI, Korol AB, Nevo E
(1999) Microsatellite tagging of the stripe-rust resistance gene YrH52 derived from wild
emmer wheat, Triticum dicoccoides, and suggestive negative crossover interference on
chromosome 1B. Theoretical and Applied Genetics 98:862-872
Pestsova E, Ganal MW, Röder MS (2000) Isolation and mapping of microsatellite markers
specific for the D genome of bread wheat. Genome 43:689-697
Picoult-Newberg L, Ideker TE, Pohl MG, Taylor SL, Donaldson MA, Nickerson DA, Boyce-
Jacino M (1999) Mining SNPs from EST databases. Genome Research 9:167-174
Plaschke J, Ganal MW, Röder MS (1995) Detection of genetic diversity in closely related
bread wheat using microsatellite markers. Theoretical and Applied Genetics 91:1001-1007
64
Pocock TH, Hurry V, Savitch LV, Huner NPA (2001) Susceptibility to low-temperature
photoinhibition and the acquisition of freezing tolerance in winter and spring wheat: The
role of growth temperature and irradiance. Physiologia Plantarum 113:499-506
Powles SB (1984) Photoinhibition of photosynthesis induced by visible light. Annual Review
of Plant Physiology and Plant Molecular Biology 35:15-44
Prasad M, Varshney RK, Roy JK, Balyan HS, Gupta PK (2000) The use of microsatellites for
detecting DNA polymorphism, genotype identification and genetic diversity in wheat.
Prestridge DS (1991) SIGNAL SCAN: a computer program that scans DNA sequences for
eukaryotic transcriptional elements. Computer Applications in the Biosciences 7:203-206
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using
multilocus genotype data. Genetics 155:945-959
Rafalski JA (2002) Novel genetic mapping tools in plants: SNPs and LD-based approaches.
Plant Science 162:329-333
Ravel C, Praud S, Murigneux A, Linossier L, Dardevet M, Balfourier F, Dufour P, Brunel D,
Charmet G (2006) Identification of Glu-B1-1 as a candidate gene for the quantity of high-
molecular-weight glutenin in bread wheat (Triticum aestivum L.) by means of an
association study. Theoretical and Applied Genetics 112:738-743
Rekika D, Monneveux P, Havaux M (1997) The in vivo tolerance of photosynthetic
membranes to high and low temperatures in cultivated and wild wheats of the Triticum and
Aegilops genera. Journal of Plant Physiology 150:734-738
Rizza F, Pagani D, Stanca AM, Cattivelli L (2001) Use of chlorophyll fluorescence to
evaluate the cold acclimation and freezing tolerance of winter and spring oats. Plant
Breeding 120:389-396
Röder M, Wendehake K, Korzun V, Bredemeijer G, Laborie D, Bertrand L, Isaac P, Rendell
S, Jackson J, Cooke RJ, Vosmann B, Ganal M (2002) Construction and analysis of a
microsatellite-based database of European wheat cultivars. Theoretical and Applied
Genetics 106:67-73
Röder MS, Korzun V, Gill BS, Ganal M (1998a) The physical mapping of microsatellite
markers in wheat. Genome 41
Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier MH, Leroy P, Ganal MW (1998b) A
microsatellite map of wheat. Genetics 149:2007-2023
Rudolph A, Crowe J, Crowe L (1986) Effect of three stabilizing agents, proline, betine and
trehalose on membrane phospholipids. Arch. Biochem. Biophys 245:134-143
Sanders D, Brownlee C, Harper JF (1999) Communicating with calcium. The Plant Cell
11:691-706
Shinwari ZK, Nakashima K, Miura S, Kasuga M, Seki M, Yamaguchi-Shinozaki K,
Shinozaki K (1998) An Arabidopsis gene family encoding DRE/CRT binding proteins
involved in low-temperature-responsive gene expression. Biochemical and Biophysical
Research Communications 250:161-170
Siedler H, Messmer MM, Schachermayr G, Winzeler H, Winzeler M, Keller B (1994)
Genetic diversity in European wheat and spelt breeding material based on RFLP data.
65
Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K
(2003) Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis
gene function in induction by dehydration stress and dark-induced senescence. The Plant
Journal 33:259-270
Skinner JS, Szűcs P, von Zitzewitz J, Marquez-Cedillo L, Filichkin T, Stockinger EJ,
Thomashow MF, Chen THH, Hayes PM (2006) Mapping of barley homologs to genes that
regulate low temperature tolerance in Arabidopsis. Theoretical and Applied Genetics
112:832-842
Smallwood M, Worrall D, Byass L, Elias L, Ashford D, Doucet C, Holt C, Telford J, Lillford
P, Bowles D (1999) Isolation and characterization of a novel antifreeze protein from carrot.
Biochemical Journal 340:385-391
Snape JW, Butterworth K, Whitechurch E, Worland AJ (2001) Waiting for fine time: genetics
of flowering time in wheat. Euphytica 119:185-190
Snape JW, Semikhodskii A, Fish L, Sharma RN, Quarrie SA, Galiba G, Sutka J (1997)
Mapping frost tolerance loci in wheat and comparative mapping with other cereals. Acta
Agronomica Hungarica 45:265-270
Soleimani VD, Baum BR, Johnson DA (2003) Efficient validation of single nucleotide
polymorphisms in plants by allele specific PCR, with an example from barley. Plant
Molecular Biology Reporter 21:281-288
Somers DJ, Isaac P, Edwards KJ (2004) A high density wheat microsatellite consensus map
for bread making (Triticum aestivum L.). Theoretical and Applied Genetics 109:1105-1114
Sourdille P, Cadalen T, Guyomarc'h H, Snape JW, Perretant MR, Charmet G, Boeuf C,
Bernard S, Bernard M (2003) An update of the 'Courtot x Chinese Spring' intervarietal
molecular marker linkage map for the QTL detection of agronomics traits in wheat.
Stachel M, Lelly T, Grausgruber H, Vollmann (2000) Application of microsatellites in wheat
(Triticum aestivum L.) for studying genetic differentiation caused by selection for
adaptation and use. Theoretical and Applied Genetics 100:242-248
Staden R, Judge D, Bonfield J (2003) Managing sequencing projects in the GAP4
environment. Introduction to Bioinformatics. A theoretical and practical approach
Steponkus PL, Uemura M, Webb MS (1993) A contrast of the cryostability of the plasma
membrane of winter rye and spring oat-two species that widely differ in their freezing
tolerance and plasma membrane composition. In: PL Steponkus (ed) Advances in Low-
Temperature Biology. JAI Press, London, pp. 211-312
Stockinger EJ, Skinner JS, Gardner KG, Francia E, Pecchioni N (2007) Expression levels of
barley Cbf genes at the Frost resistance-H2 locus are dependent upon alleles at Fr-H1 and
Fr-H2. The Plant Journal 51:308-321
Straub PF, Shen Q, Ho T-HD (1994) Structure and promoter analysis of an ABA- and stress-
regulated barley gene, HVA1. Plant Molecular Biology 26:617-630
Sundbom E, Strand M, Hällgren J-E (1982) Temperature-induced fluorescence changes: A
screening method for frost tolerance of potato (Solanum sp.). Plant Physiology 70:1299-
1302
Sung D-Y, Kaplan F, Lee K-J, Guy CL (2003) Acquired tolerance to temperature extremes.
Trends in Plant Science 8:179-187
66
Sutka J (1981) Genetic studies of frost resistance in wheat. Theoretical and Applied Genetics
59:145-152
Sutka J (2001) Genes for frost resistance in wheat. Euphytica 119:167-172
Sutka J, Galiba G, Vágújfalvi A, Gill BS, Snape JW (1999) Physical mapping of the Vrn-A1
and Fr1 genes on chromosome 5A of wheat using deletion lines. Theoretical and Applied
Genetics 99:199-202
Sutka J, Kovacs G, Veisz O (1986) Substitution analysis of the frost resistance and winter
hardiness of wheat under natural and artificial conditions. Acta Agronomica Hungarica
35:227-234
Sutka J, Snape J (1989) Location of a gene for frost tolerance on chromosome 5A of wheat.
Euphytica 42:41-44
Tachida W, Lizuka M (1992) Persistence of repeated sequences that evolve by replication
slippage. Genetics 131:471-478
Tanksley S, McCouch S (1997) Seed banks and molecular maps: unlocking genetic potential
from the wild. Science 277:1063-1066
Thomashow M (1999) Plant cold-acclimation: freezing tolerance, genes and regulatory
mechanisms. Annual Review of Plant Physiology and Plant Molecular Biology 50:571-599
Tommasini L, Schnurbusch T, Fossati D, Mascher F, Keller B (2007) Association mapping of
Stagonospora nodorum blotch resistance in modern European winter wheat varieties.
Tóth B, Galiba G, Fehér E, Sutka J, Snape JW (2003) Mapping genes affecting flowering
time and frost resistance on chromosome 5B of wheat. Theoretical and Applied Genetics
107:509-514
Tran L-SP, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M,
Shinozaki K, Yamaguchi-Shinozaki K (2004) Isolation and functional analysis of
Arabidopsis stress-inducible NAC transcription factor that bind to a drought-responsive
cis-element in the early responsive to dehydration stress 1 promoter. The Plant Cell
16:2481-2498
Tremblay K, Ouellet F, Fournier J, Danyluk J, Sarhan F (2005) Molecular characterization
and origin of novel bipartite cold-regulated recrystallization inhibition proteins from
cereals. Plant and Cell Physiology 56:884-891
Trunova TI (1965) Light and temperature systems in the hardening of winter wheat and the
significance of oligosaccharides for frost tolerance. Fiziologiya i Biokhimiya Kulturnykh
Rastenii 12:70-77
Uemura M, Steponkus P (1997) Effect of cold acclimation on membrane lipid composition
and freeze induced membrane destabilisation. In: P Press (ed) Plant Cold Hardiness:
Molecular, Biology, Biochemistry and Physiology. New york, pp. 171-179
Vágújfalvi A, Crosatti C, Galiba G, Dubcovsky J, Cattivelli L (2000) Two loci on wheat
chromosome 5A regulate the differential cold-dependent expression of the cor14b gene in
frost tolerant and sensitive genotypes. Molecular and General Genetics 263:194-200
Vágújfalvi A, Galiba G, Cattivelli L, Dubcovsky J (2003) The cold-regulated transcriptional
activator Cbf3 is linked to the frost-tolerance locus Fr-A2 on wheat chromosome 5A.
Molecular Genetics and Genomics 269:60-67
67
Veisz O, Sutka J (1989) The relationship of hardening period and the expression of frot
resistance in chromosome substitution lines of wheat. Euphytica 43:41-45
Wang W, Vinocur B, Altman A (2003) Plant responses to drought, salinity and extreme
temperatures: towards genetic engineering for stress tolerance. Planta 218:1-14
Xue G-P (2002) An AP2 domain transcription factor HvCBF1 activates expression of cold-
responsive genes in barley through interaction with a (G/a)(C/t)CGAC motif. Biochimica
et Biophysica Acta 1577:63-72
Xue G-P (2003) The DNA-binding activity of an AP2 transcriptional activator HvCBF2
involved in regulation of low-temperature responsive genes in barley is modulated by
temperature. The Plant Journal 33:373-383
Yazdi-Samadi B, Dashti H, Nabipour A, Sarrafi A (2006) Reciprocal substitution analysis of
freezing resistance in wheat (Triticum aestivum L.). Plant Breeding 125:217-220
Yu J, Pressoir G, Briggs WH, Bi IV, Yamasaki M, Doebley JF, McMullen MD, Gaut BS,
Nielsen DM, Holland JB, Kresovich S, Buckler ES (2006) A unified mixed-model method
for association mapping that accounts for multiple levels of relatedness. Nature Genetics
38:203-207
68
8 Appendix
Table Appendix 1: List of the 320 wheat accessions used for phylogenetic analysis (Chapter
2). In bold, the 103 accessions analysed for winter hardiness. Informations to status, year of
release, variety and growth type are based on the information provided by the European
Wheat Database (see http://genbank.vurv.cz/ewdb/). The assignment to the cluster refers to
Chapter 2.
Name Country Status Year Variety Type Cluster
Northern America
Can. 3843/4553 CAN Landrace nd lutescens nd B
Can. 3847/3310 CAN Breeding line 1971 erythrospermum winter K
Neepawa CAN Cultivar, released 1969 lutescens spring K
Bowie USA Cultivar, (un)rel. 1953 erythrospermum spring J
Cache USA Cultivar, released 1937 lutescens winter A
Carala USA Cultivar, released 1940 lutescens winter H
Cheyenne USA Cultivar, released 1933 erythrospermum winter B
Chiefkan USA Cultivar, released 1935 lutescens winter F
Chinese 166 USA Landrace 1965 erythrospermum spring K
Clarkan USA Cultivar, released 1934 lutescens winter B
Early Blackhull USA Cultivar, released 1928 erythrospermum winter B
Early Premium USA Cultivar, released 1937 lutescens winter C
Gasta USA Cultivar, released 1931 lutescens winter C
Goldcoin USA Cultivar, released 1885 alborubrum nd J
Harvest Queen USA Cultivar, released 1897 lutescens winter K
Hussar USA Cultivar, released 1906 erythrospermum winter L
Kanred USA Cultivar, released 1917 erythrospermum winter C
Mediterranean USA Cultivar, released 1837 ferrugineum winter A
Minter USA Cultivar, released 1948 erythrospermum winter L
Oro USA Cultivar, (un)rel. 1927 erythrospermum winter J
Perdue Oasis USA Cultivar, released 1973 lutescens winter J
Ridit USA Cultivar, released 1923 lutescens winter K
Stw. 56 R 1542 USA nd nd erythrospermum nd K
Tasmania rot begr. USA Cultivar, (un)rel. 1960 ferrugineum winter J
Tenmarq USA Cultivar, released 1932 erythrospermum winter D
Trader USA Cultivar, released 1967 erythrospermum winter B
Southern America
38 M.A. ARG Cultivar, released 1926 erythrospermum winter H
Bahiense Fcs ARG Cultivar, released 1944 erythrospermum spring H
Benvenuto 3085 ARG Cultivar, released 1943 ferrugineum nd F
Buck Austral ARG Cultivar, released 1963 erythrospermum spring C
Buck Bolivar ARG Cultivar, released 1961 erythrospermum spring H
Buck Maipu ARG Cultivar, released 1956 erythrospermum spring C
Buck Quequen ARG Cultivar, released 1942 erythrospermum spring F
Buck Sarmiento ARG Cultivar, released 1946 erythrospermum spring F
Buenos Aires 105 ARG Cultivar, released 1952 milturum spring C
69
Ex Redomon ARG Cultivar, (un)rel. nd ferrugineum nd A

Klein 47 ARG Cultivar, released 1935 erythrospermum spring H
Klein Cometa ARG Cultivar, released 1941 ferrugineum spring L
Klein Lucero ARG Cultivar, released 1950 erythrospermum spring L
Klein Orgullo ARG Cultivar, released 1944 lutescens interm D
Klein Progreso ARG Cultivar, released 1937 erythrospermum spring F
Klein Rendidor ARG Cultivar, released 1954 erythrospermum nd H
Maria Escobar ARG Cultivar, (un)rel. 1963 erythrospermum spring H
Massaux No. 3 ARG Cultivar, released 1946 albidum spring K
Pergamino H 401-2-242151 ARG nd nd erythrospermum nd L
Pergamino H 580-4233 ARG nd nd erythrospermum nd L
Redomon ARG Cultivar, (un)rel. nd erythrospermum spring K
Sureno M.A. ARG Cultivar, released 1948 erythrospermum spring K
Tezanos Pinto 2830 ARG nd nd erythrospermum nd K
Tezanos Pinto 2843 ARG nd nd ferrugineum nd I
Vilela Mar ARG Cultivar, released 1960 erythrospermum spring D
Bage BRA Cultivar, released 1938 erythrospermum spring C
Colonias BRA Cultivar, released 1949 erythrospermum spring C
Fortaleza BRA Cultivar, released 1957 ferrugineum nd I
Frontana BRA Cultivar, released 1930 ferrugineum spring I
Fronteira BRA Cultivar, released 1934 erythrospermum spring I
Garazinko BRA Cultivar, (un)rel. nd ferrugineum spring G
Lavras BRA Cultivar, released 1950 erythrospermum spring H
No. 35 BRA nd nd erythrospermum spring I
Red Hart BRA Cultivar, released 1921 lutescens nd C
Trimes BRA Cultivar, (un)rel. nd erythrospermum nd J
Trintani BRA Cultivar, released 1949 erythrospermum spring I
Baflo RCH Cultivar, released 1954 alborubrum spring A
Castano RCH Landrace nd milturum spring L
Challay RCH Cultivar, released 1958 albidum spring G
Copifen RCH Cultivar, released 1953 milturum spring L
Ex W IV Sch. Nr. 73 RCH nd nd milturum nd D
Licura 1953 RCH nd nd lutescens nd K
Planta Aislada Mininco 1955 RCH nd nd lutescens nd F
Primavera de Osorno RCH Landrace 1914 albidum spring E
Raco RCH Cultivar, released 1956 erythrospermum spring G
Sch. Nr. 32 RCH nd nd erythrospermum nd I
Sch. Nr. 35 RCH nd nd erythrospermum nd J
Sch. Nr. 37 RCH nd nd erythrospermum nd J
Sch. Nr. 38 RCH nd nd erythrospermum nd F
Sch. Nr. 50 RCH nd nd graecum nd A
Vilufen RCH Cultivar, released 1956 graecum spring L
W II Sch. Nr. 71 RCH nd nd milturum nd A
W XI Sch. Nr. 80 RCH nd nd lutescens nd H
3352 V.05 URY nd nd erythrospermum nd G
Porvenir URY Cultivar, released 1933 ferrugineum spring E
Northern Europe
Abed 8-41 DMK Cultivar, (un)rel. 1972 lutescens winter E
70
Lawaetz Alsvede DMK Cultivar, (un)rel. nd lutescens winter E

Oetofte 56 DMK Cultivar, (un)rel. 1956 lutescens winter E
Antti FIN Cultivar, released 1955 milturum winter F
Sampo FIN Cultivar, released 1933 velutinum winter I
Vakka FIN Cultivar, released 1953 velutinum winter K
Varma FIN Cultivar, released 1933 velutinum winter K
Hbg Manchurisk NOR Cultivar, (un)rel. nd ferrugineum nd I
Moystad 0944 NOR nd nd milturum nd D
Sigyn II NOR Cultivar, (un)rel. 1954 lutescens winter H
Aering II SWE Cultivar, released nd lutescens winter E
Aering III SWE Cultivar, released nd lutescens winter E
Diana SWE Cultivar, released 1957 lutescens winter E
Ertus SWE Cultivar, (un)rel. 1953 lutescens winter K
Odin SWE Cultivar, released 1949 lutescens winter E
Robur SWE Cultivar, (un)rel. 1949 lutescens winter E
Seba SWE Cultivar, released 1969 lutescens winter D
Standard SWE Cultivar, released 1921 lutescens winter D
Starke SWE Cultivar, released 1959 lutescens winter F
Svalofs - 01700 SWE Breeding line nd lutescens nd E
Svalofs - 59559 SWE Breeding line 1964 lutescens winter E
Svalofs - 60288 SWE Breeding line nd lutescens nd B
Thule SWE Cultivar, (un)rel. 1914 velutinum winter E
Trond SWE Cultivar, released 1960 lutescens winter E
Virtus SWE Cultivar, released 1945 lutescens winter D
Western Europe
Erla Kolben AUT Cultivar, released 1961 lutescens winter K
Innichen 1368 B AUT Landrace nd erythrospermum nd A
Innichen 1381 A AUT Landrace nd nd nd B
Kadolzer AUT Cultivar, (un)rel. 1930 erythrospermum winter J
Kleinarl 1372 A AUT Landrace 1982 ferrugineum winter D
Lassers Septoria Resistenter AUT Breeding line nd milturum nd J
Loosdorfer Bart AUT Cultivar, (un)rel. 1965 erythrospermum winter H
Reichersberger Kolben St. 39 AUT Cultivar, (un)rel. 1952 lutescens winter E
Reichersberger St. 42 AUT Breeding line 1955 lutescens winter H
St. Johann 1376 C 63 Z 3.230 AUT Landrace nd lutescens nd E
St.Johann 1369 A AUT Landrace nd lutescens nd J
Stabil AUT Cultivar, released 1963 lutescens winter C
Tschermaks weisser begrannter AUT Cultivar, (un)rel. 1960 erythrospermum winter H
Marchfelder
Wagrein 1371 A 63 Z 3.220 AUT Landrace nd erythrospermum winter D
Fleuron BEL Cultivar, (un)rel. 1961 lutescens winter B
Leda BEL Cultivar, released 1954 lutescens winter F
Norda BEL Cultivar, released 1965 lutescens winter J
Rustique BEL Cultivar, (un)rel. 1961 lutescens winter F
589/50 CHE Breeding line nd lutescens winter F
Bangerten CHE Cultivar, released 1928 milturum winter D
Guggisberg CHE Landrace nd milturum nd E
Münstertaler CHE Cultivar, (un)rel. 1969 erythrospermum winter J
71
Oerl.121.860 CHE Landrace 1951 milturum winter I

Plantahof CHE Cultivar, (un)rel. 1928 lutescens winter L
Rheinauer CHE Landrace 1941 erythrospermum winter F
Rothenbrunnen 10 CHE Breeding line nd velutinum winter C
Rothenbrunnen 32 CHE Breeding line nd lutescens winter E
Rouge de Pinsec CHE Landrace nd milturum winter D
Rütti 40 CHE Landrace nd milturum winter G
Sarreyer 602 B CHE Landrace nd ferrugineum winter E
Vorenwald 6 CHE Cultivar, (un)rel. 1967 lutescens winter J
44 C H DEU nd nd lutescens nd H
Ägyptischer DEU Landrace nd ferrugineum winter I
Alpine Neuzucht DEU Cultivar, (un)rel. nd lutescens winter E
Berthold DEU Cultivar, released 1962 milturum winter B
Carstens VI DEU Cultivar, released 1940 lutescens winter F
Farmer DEU Cultivar, (un)rel. 1968 lutescens winter L
Firlbecks Wwz1 DEU Cultivar, (un)rel. 1942 lutescens winter B
Gudin DEU Cultivar, released 1962 lutescens winter I
H.S. Siegerländer Neu DEU Cultivar, (un)rel. nd milturum nd F
Hohenheimer Kolben DEU Cultivar, (un)rel. nd lutescens nd I
Kraffts Siegerländer DEU Cultivar, released 1908 milturum winter D
Rimpaus Bastard II DEU Cultivar, released 1939 lutescens winter E
Stauderers Markus DEU Cultivar, released 1937 milturum winter H
Strengs Marschall DEU Breeding line 1972 milturum winter A
Zapfs Neuzucht DEU Cultivar, (un)rel. 1948 milturum winter J
Astuce FRA Cultivar, released 2004 nd winter B
Aurele FRA Cultivar, released 2002 nd winter B
Balance FRA Cultivar, released 2000 nd winter J
Bladette FRA Cultivar, released 1958 alborubrum winter D
Caphorn FRA Cultivar, released 2000 nd winter B
Capnord FRA Cultivar, released 2000 nd winter J
Champlein FRA Cultivar, released 1966 lutescence winter F
Comtal FRA Cultivar, released 1973 lutescens winter I
Equilibre FRA Cultivar, released 2002 nd winter B
Farandole FRA Cultivar, released 2000 nd winter B
Inoui FRA Cultivar, released 2004 nd winter B
Jules Tezier FRA Cultivar, released 1934 erythrospermum winter A
La Fayette FRA Cultivar, (un)rel. 1936 lutescens winter E
Lignee 6695 FRA nd nd lutescens nd B
Limes FRA Cultivar, released 2002 nd winter B
Macro FRA Cultivar, released 2001 nd winter B
Magali FRA Cultivar, released 1962 nd interm C
Melkior FRA Cultivar, released 2004 nd winter B
Nirvana FRA Cultivar, released 2001 nd winter B
P.L.M. FRA Cultivar, (un)rel. nd lutescens winter I
Prieur FRA Cultivar, released 1966 lutescens winter E
Providence FRA Cultivar, (un)rel. 1936 lutescens winter A
Reme FRA nd nd lutescens nd A
Renfort FRA Cultivar, released 1944 lutescens winter A
Rex FRA Cultivar, released 1962 lutescence spring F
72
Rouge Prolifique Barbu FRA Cultivar, (un)rel. 1897 barbarossa spring A

Sankara FRA Cultivar, released 2004 nd winter I
Scorpion 25 FRA Cultivar, released 2002 nd winter B
Toison D'or FRA Cultivar, released 2004 nd winter B
Vercors FRA Cultivar, released 1936 lutescens winter A
Vilmorin 29 FRA Cultivar, released 1929 lutescens nd F
Vulcain FRA Cultivar, released 2000 nd winter B
XXL FRA Cultivar, released 2002 nd winter I
118/1/1965/B GBR nd nd ferrugineum nd I
229/1965/C GBR nd nd lutescens nd A
311/15/30 GBR nd nd ferrugineum nd G
Maris Widgeon GBR Cultivar, released 1964 lutescens winter D
Bonus NLD Cultivar, (un)rel. 1964 albidum winter E
Demeter NLD Cultivar, released 1950 lutescens winter G
Flevina CB 26 NLD Cultivar, released nd lutescens winter C
Juliana NLD Cultivar, released 1921 albidum winter G
Mado NLD Cultivar, released 1953 lutescens winter F
Manella NLD Cultivar, released 1964 lutescens winter A
Nl 96 NLD nd nd lutescens nd K
Southern Europe
Aragon 03 ESP Cultivar, (un)rel. 1967 erythrospermum nd H
Asturie 4'a ESP Landrace nd hostianum nd J
Asturie H'3 ESP Landrace nd hostianum nd G
Ex Cabezorro ESP Cultivar, (un)rel. nd erythrospermum winter G
Involcable Navarro 101 ESP Cultivar, (un)rel. 1967 lutescens winter G
Pane 247 ESP Breeding line 1960 alborubrum spring G
Abbondanza ITA Cultivar, released 1950 lutescens spring I
Campio ITA Landrace 1927 erythrospermum spring K
Edda Sabina ITA Cultivar, (un)rel. nd erythrospermum spring G
Florio ITA Cultivar, (un)rel. 1953 hostianum winter G
Funo ITA Cultivar, released 1944 erythrospermum spring L
Impeto ITA Cultivar, released 1950 lutescens spring L
Inallettabile 3 Vittorio Nicoli ITA Cultivar, (un)rel. nd milturum nd A
J.Bo 1892 ITA nd nd lutescens nd L
NSP ITA Landrace nd lutescens nd B
NSP ITA Landrace nd milturum nd J
S. 10 ITA nd nd ferrugineum nd A
S. 13 ITA nd nd erythrospermum spring A
Todaro ITA Cultivar, (un)rel. nd sub-erythrosper. nd A
Villa Glori ITA Cultivar, released 1913 milturum winter G
Padeira PRT Cultivar, (un)rel. 1967 lutescens spring G
Pirana PRT Cultivar, (un)rel. 1967 erythrospermum spring G
Portugues P.J. 56.204-7 PRT Landrace nd erythrospermum nd C
Portugues P.J. 94.571-14 PRT Landrace nd erythrospermum nd J
Restauracao PRT Cultivar, (un)rel. 1965 alborubrum spring G
Rural PRT Cultivar, (un)rel. 1965 erythrospermum spring G
73
Eastern Europe
Erythrospermum 301 BGR nd nd erythrospermum nd A
Fr. Du Pays BGR Landrace nd ferrugineum nd H
Marica BGR Cultivar, (un)rel. nd erythrospermum nd B
Okerman BGR Cultivar, released 1948 ferrugineum winter L
Rousse 14 BGR Cultivar, (un)rel. nd ferrugineum nd A
Sadovo 1 BGR Cultivar, released 1972 lutescens winter G
Sadovo 1012 BGR nd nd ferrugineum nd L
Sadovo 1670 BGR nd nd ferrugineum nd L
Sadovo 1744-2-D BGR nd nd erythroleucon nd L
Sadovo 1744-2-E BGR nd nd erythrospermum nd L
Sadowka BGR Cultivar, released 1942 erythrospermum winter F
Hodoninska Holice CSK Cultivar, released 1937 milturum winter L
Pilot DDR Cultivar, released 1966 lutescens winter E
Bankuter 1201 HUN Cultivar, released nd erythrospermum winter I
Festetics-Kesztheli 1201 HUN Cultivar, (un)rel. nd erythrospermum nd K
Karcagi 1042 HUN Breeding line 1954 erythrospermum winter H
Kompolti F 169 HUN Cultivar, (un)rel. 1956 erythrospermum winter H
Kompolti R 23 HUN nd nd erythrospermum nd K
Lovaszpatonai 407 HUN Cultivar, (un)rel. 1953 erythrospermum winter J
Magyarovar 3355 HUN nd nd erythrospermum nd K
Szekacs 1055 HUN Breeding line 1930 erythrospermum winter F
Udvaros 8 HUN Cultivar, (un)rel. nd erythrospermum nd K
Kurzeme LVA Cultivar, released 1962 lutescens winter D
Dankowska Selekcyjna POL Cultivar, released 1881 albidum winter E
Olza POL Cultivar, released 1955 lutescens winter G
Podolanka POL Cultivar, released 1920 ferrugineum winter H
Wysokolitewka POL Landrace 1876 albidum winter G
Danubiana Roman ROM Cultivar, (un)rel. nd erythrospermum nd E
Rumanien 3659 ROM nd nd erythrospermum nd H
Sandu Aldea ROM Cultivar, (un)rel. 1935 lutescens winter B
0160/10 RUS nd nd erythrospermum nd F
Barkhatnaya RUS Cultivar, released 1962 velutinum winter H
Bezostaya RUS Landrace nd albidum winter J
Bezostaya 1 RUS Cultivar, released 1959 lutescens winter C
Bezostaya 2 RUS Cultivar, released 1973 lutescens winter I
Bezostaya 4 RUS Cultivar, released 1955 lutescens winter F
Hyb. T. agropyrum No. 1 RUS Landrace nd lutescens nd E
Hyb. T. agropyrum No. 186 RUS Landrace nd lutescens nd F
Kolkhoznisa RUS Cultivar, released 1946 velutinum winter I
L 503 RUS Cultivar, released 1993 lutescens spring E
L 504 RUS Breeding line 1993 albidum spring B
Leningrad 0479 RUS Cultivar, (un)rel. nd albidum winter H
Milturum 321 RUS Cultivar, released 1929 milturum spring J
Moskovskaya 2453 RUS Cultivar, released 1929 ferrugineum winter F
Kooperatorka UKR Cultivar, released 1929 erythrospermum winter K
Lesostepka 75 UKR Cultivar, released 1945 barbarossa winter B
Ukrainka UKR Cultivar, released 1929 erythrospermum winter F
Ukrainka 854 UKR Cultivar, (un)rel. 1929 erythrospermum winter F
74
Cerovac Sumadija YUG Cultivar, released 1969 lutescens winter D

Novi Sad 1437 YUG nd nd erythrospermum nd K
Novi Sad Srebebran YUG Cultivar, (un)rel. nd ferrugineum nd H
Novi Sad U 1 Ozijek YUG nd nd lutescens winter J
Ns-735 YUG Breeding line 1970 lutescens winter G
Vuka YUG Cultivar, released 1964 milturum winter J
Asia
Kutschos AFG Cultivar, (un)rel. nd sub-erythrosper. nd I
Tschardeh AFG Cultivar, (un)rel. nd ferrugineum nd C
Karmir-Slfaat ARM Cultivar, released 1939 ferrugineum winter J
Honan CHN Cultivar, (un)rel. nd sub-ferrugineum nd H
Sazkakewan CHN Landrace nd erythrospermum nd A
Dargin IND Cultivar, (un)rel. nd lutescens nd B
Iran 1307 IRN nd nd sub-meridionale nd C
Iran 2355 IRN nd nd submeridiomale nd C
Iran 2588 IRN nd nd sub-meridionale nd C
Japanischer Wwz. JPN Landrace 1947 ferrugineum winter A
Pseudo-Turcicum Sch. Nr. 55 KZA nd nd turcicum nd I
Aichrianar TUR Cultivar, (un)rel. nd barbarossa nd J
Memlik TUR Cultivar, (un)rel. nd ferrugineum nd F
Oceania
Austral 12 AUS Breeding line nd milturum nd G
Benoubbin AUS Cultivar, (un)rel. nd albidum nd I
Cailloux C 8810 AUS Cultivar, (un)rel. nd albidum nd E
Charter AUS Cultivar, released 1944 albidum spring E
Dirk 48 AUS Cultivar, released 1951 albidum spring D
Dowerin AUS Cultivar, released 1948 albidum spring K
Dundee 48 AUS Cultivar, released 1949 alborubrum spring D
Ex Quadrat AUS Cultivar, released nd alborubrum spring K
Gabo C 14227 AUS Cultivar, (un)rel. 1942 albidum spring K
Gamenya W 2550 AUS Cultivar, (un)rel. nd albidum spring K
Glenwari 48 AUS Cultivar, released 1948 albidum spring I
Hengavi W 2551 AUS Cultivar, (un)rel. nd albidum nd K
Hopps W 2517 AUS Cultivar, released 1957 meridionale spring C
Insignia AUS Cultivar, released 1946 alborubrum spring K
Javelin 48 AUS Cultivar, released 1949 albidum spring D
Kenora W 2516 AUS Cultivar, released 1959 albidum spring I
Koorda AUS Cultivar, released 1942 albidum spring L
Pinnacle AUS Cultivar, released 1946 alborubrum spring L
Quadrat AUS Cultivar, released 1941 alborubrum spring B
Ridley 48 AUS Cultivar, released 1949 albidum spring L
Seewari 48 AUS Cultivar, released 1949 alborubrum spring L
Timvera W 1308 AUS Cultivar, released 1956 graecum winter D
Warigo AUS Cultivar, released 1943 albidum spring J
Wongoondy AUS Cultivar, released 1948 albidum spring J
Fife Tuscan NZL Cultivar, released 1941 albidum interm J
75
Hilgendorf NZL Cultivar, (un)rel. nd lutescens nd C

NSP NZL nd nd lutescens winter J
Africa
Baroota 8.791 DZA Cultivar, released 1962 albidum nd G
Mahon Demias DZA Cultivar, (un)rel. 1966 graecum spring I
NSP DZA Landrace nd alborubrum nd L
76
Acknowledgements
A few years ago, when I was studying at the University of Montpellier, one of my professors
proclaimed: “What is research? Research is… inspiration and perspiration!” Many people
contributed inspiration and perspiration to my doctoral project and I sincerely thank them. I
will make an effort not to leave anyone out.
My professor Peter Stamp, my supervisors Beat Keller and Jörg Leipner contributed
inspiration. Their combined expertise in their respective research areas led to the proposal of
this research topic. They have guided me and showed understanding when it was necessary.
They have continuously been keeping faith in me.
Nabila Yahiaoui, Edith Schlagenhauf, Thomas Wicker, Cyril Groos, Rainer Messmer, Livia
Tommasini, Eligio Bossolini and Peter Bradbury were also inspired. They lavished useful
comments on me which I learned from and I benefited from scientific discussions at very
specific phases of the project.
Dario Fossati from Agroscope Changins-Wädenswil was beneficially inspired. He introduced

us to the experimental station of Chaux des Prés.
Alex Giraud, Véronique Aubert and Ernst Merz took part to the perspiration aspect in the
field. Alex and Véronique brought an important contribution during the field assay in Chaux
des Prés while Ernst contributed to the right course of the seed multiplication assay.
The Jura Unfrozeable Team did not economize on perspiration either. Indeed, Jörg Leipner,
Cyril Groos, André Vogler and Rainer Messmer supplied an entire commitment to the
measurements work at Chaux des Prés. Mme and Mr Paul Lapprand in Chaux des Prés were
always willing to leave an open door of their house to let us warm up after hours of
measurements in the winter cold.
Madeleine Neuhauser and Inge Demetriou were also involved in the perspiration side of the
thesis in their administrative work related to the project.
I wish to name, as well, those I could draw inspiration from when I used to meet them on
evenings, week ends or holidays.
My family, triggering…you know?...those indescribable inspiring things that only families

hold the secret.
77
My féru de nutella: toasts, kougelhopf and homemade funny egg cups, the City Night Line
week ends, the story of the “frelon” and the story of “le plus beau sourire”, the native of
Chiswick’s music, the pique-niques and pique-têtes at the Pfäffikonersee, the good days and
the bad days comforting…
My most Spanish of all Zürcherinnen, Raffaela: Ferragosto days, the Déjà-bu, lettenian swims
on football world cup evenings, the flower power necklace al modo variado spirit…
The Pipistrelli: white, black Candelas and halusky or pumpkin gnocchi at Bang city; winter
movies, birthday cakes and December turkey at Grosswiesenstrasse, Hugostrasse,
Brunwiesenstrasse, Luegislandstrasse…
Los Aché bailadores de salsa, Angelo, Cyril, Peter and Marty
Silvie, Isa, Maurilio, Eliane, Marija, Thomi, Julien and Cristina: the English scrabble word of
the day from Polyterrasse to Lichtraum, going through Schwamendingen, Berlin and
Oberaudorf…
My acknowledgement also goes to the present and former members of the group of
Agronomy and Plant Breeding and present and former members of the group of Molecular
Plant Biology. I loved moving among them, this challenging experience made most certainly
me grow.
This doctoral project was funded by a fellowship from the Plant Science Center Graduate
Research. My sincere thanks go to the Plant Science Center.
Thanks to Geert Kleijer from the Agroscope Changins-Wädenswil for providing the wheat
material.
I am grateful to Jorge Dubkovsky and Andrea Miller for giving me the valuable TmCBF
sequences before their publication.
May I never forget the power of inspiration and perspiration!
78
Curriculum vitae
Name: Caroline Plassé

Date of birth: 12 July 1978
Place of birth: Villeneuve-Saint-Georges, France
Nationality: French
Civil status: Single
1984 - 1989 Primary education at Ecole primaire Mixte II, Petit-Bourg, Guadeloupe
1989 - 1993 Primary education at Collège Félix Eboué, Petit-Bourg, Guadeloupe
1993 - 1996 Secondary education at Lycée Déodat de Séverac, Céret, Lycée Mas-
de-Tesse, Montpellier
1996 Scientific Baccalauréat at Lycée Mas-de-Tesse, Montpellier
1996 - 1997 Landscaping studies at EAP Bordeaux

1997 - 2001 Undergraduate studies of Cell Biology and Plant Physiology at UFR
Sciences et Techniques, Montpellier
2001 B.Sc. in Plant Sciences
2001 - 2002 M.Sc. studies of Agronomical Sciences at INPL, Nancy
2002 M.Sc. in Agronomical Sciences
2002 - 2003 Research assistant ETH Zurich

2003 - 2007 Ph.D. candidate at the Institute of Plant Sciences of the ETH Zurich
79

Diss Caroline

Загружено:

Сведения о документе

Исходное описание:

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Diss Caroline

Загружено:

Авторское право:

Доступные форматы

Diss. ETHZ No.

Molecular and phenotypic diversity of wheat

A dissertation submitted to the

accepted on the recommendation of

1.1 Frost-induced damage and cellular response to low temperature

1.2 Cold acclimation and winter hardiness of wheat

1.3 Determination of frost tolerance

1.4 Genetic aspects of frost tolerance in wheat

1.5 Use of genetic resources for wheat improvement

1.6 Contribution of genomic research and molecular markers to crop

1.7 Aim of the study

2 Phylogenetic analysis of wheat (Triticum aestivum L.)

2.3 Material and Methods

2.3.2 Microsatellite analysis

Name Locus Repeat motif a Allele Gene Tm Cycles Protocol

Xbarc133 3B (CT)24 9 0.502 55 29 A

2.3.3 Genetic diversity assessment

Group Average allele number Gene diversity

All 10.28 0.617

2.4.2 Estimation of the number of genetic clusters and assignment of individuals to

2.4.3 Within and between population diversity

Population n Average allele number Gene diversity FST

A 24 5.00 0.539 0.594

2.4.4 Causes of the observed population structure

A comparative analysis of microsatellite diversity among the nine geographical regions

Region n Average allele number Gene diversity

S-America 55 6.66 0.611

3 Analysis of winter hardiness of divergent wheat

3.3 Material and Methods

3.3.2 Phenotype assessment

Cultivar Sensitivity threshold Mark

3.4.2 Comparison of tested accessions with standard lines

9 North America Cheyenne

3.4.3 Effect of experimental season on winter survival

Mark Survival (%) Shoot dry weight (g plant-1)

Table 3.3: Temperature conditions before and during determination of Fv/Fm.

Date min. temp. average temp.

0.2 100 % Survival

Nov 05 Dec 05 Jan 06 Feb 06

SPAD SPAD SPAD SPAD

2004/05 2005/06 2004/05 2005/06

4 Analysis of the promoter region of the transcription

4.3 Material and Methods

4.3.2 DNA analysis

N5D N5A N5B

4.3.3 Data analysis

TaCBF12-A GTTTTCTTTGCTTTAGATGATTTGGCAAGCTTGAGGGACTAATTGCGTTCGTAATAGAAA -610

TmCBF12 AGCTGCCTTTTCTTTGCTTAACGCTGCAAACCCCCTACACGTCTACACCGAGGAGTCATG -132

TmCBF12 ATCACGGCTCCTTACTCCAGCCAGCCAACTAGCCTAGCAAAAGTACATACCACCGCCTAG +108

4.4.2 Identification of transcription regulatory elements

cis-acting Involvement cis-acting element Consensus Sequence in Location (Strand)

MYC cold, drought CONSENSUSAt CANNTG CACATG -422 to -417 (+/-)

5 Identification of sequence variant associated with

5.3 Material and Methods

5.3.2 Sequence analysis

5.3.3 Population structure and association mapping

5.3.4 False discovery rate control

Trait Environment Mean ± SD p-value

Winter Month TaCBF12-a TaCBF12-b

Fv/Fm 2004/05 Nov 0.721 ± 0.023 0.732 ± 0.022 0.032 *

* indicate significance at α = 0.05.

5.4.2 Population structure

5.4.3 Candidate gene based association mapping