BIOL4320: Molecular Biology !

INSTRUCTOR !! Name: Sang-Hyuk Chung, Ph.D.! E-mail: schung@uh.edu! Phone: 832-842-8181! Fax: 713-743-0634! Ofce: SERC, Rm3008! !

Textbook !

Authors:! Jocelyn E. Krebs, ! Elliott S. Goldstein, ! Stephen T. Kilpatrick! Publisher:! Jones and Bartlett Learning Burlington, MA

Class & Course Rules !

1." 2." 3." Turn off cell phones during class and exam.! Attend all class sessions & read covered chapters.! There will be 4 exams and a nal. The lowest of 4 exam scores will be dropped and each exam will account for 20% of total grade. The nal will be comprehensive and account for 40% of grade. !

4." Academic honesty policy: Cheating could result in receiving a zero for an exam or a grade of F for the course. ! 5." Lecture slides will be uploaded in Blackboard.! !

Molecular Biology !
" Warren Weaver coined the term in 1938 to describe a research approach in which physics and chemistry are used to address fundamental biological problems.!

(Reverse transcriptase)! (DNA polymerase)! (RNA polymerase)!

(RNA polymerase)! (Ribosome)! (protein)!

" Double strand must be separated for replication and transcription.!

Chapter 1 Genes Are DNA

Hereditary Information Is Carried by DNA or RNA

" Genome: a sequence of DNA or RNA that provides the complete set of hereditary information " Chromosome: a physical unit of the DNA genome " Gene: a functional unit of the genome, a sequence of DNA that encodes an RNA that may encode a protein

Human genome: 23 chromosome pairs

1.2. DNA Is the Genetic Material of Bacteria, Viruses, and Eukaryotic Cells
Frederick Griffith, 1928

Figure B1.1 Read Historical Perspectives.

Transformation

What is the transforming principle?

" Protein is a sequence of 20 amino acids; higher complexity " DNA is a sequence of 4 nucleotides; too simple

1.2. DNA Is the Genetic Material of Bacteria, Viruses, and Eukaryotic Cells
!" AveryMacLeodMcCartys experiments determined that DNA is the transforming principle but not protein (1944). !" DNA purified from S bacteria transformed R bacteria into S form. "" Purified material retained transforming ability after treatment with enzymes that degrade protein, RNA, or carbohydrate. "" DNA-degrading enzyme (DNase I) destroyed transforming potential of purified material.

1.2. DNA Is the Genetic Material of Bacteria, Viruses, and Eukaryotic Cells
Hershey & Chase, 1952

!" Phage is a virus that infects bacteria. " DNA was labeled with radioactive phosphorus (32P) and protein with radioactive sulfur (35S). " E. coli was infected with radiolabeled phage T2. " The progeny phage particles contained ~30% of the original 32P label but less than 1% of 35S.
!" Some viruses use RNA as the genetic material.

Figure 1.3

1.2. DNA Is the Genetic Material of Bacteria, Viruses, and Eukaryotic Cells
Transfection !" When DNA is introduced to eukaryotic cells, they gain a new trait. !" Thimidine kinase (TK) is essential for thymidine biosynthesis # TK-deficient cells die in culture media without thymidine; TK-deficient cells transfected with TK gene can grow in media lacking thymidine.

Figure 1.4

1.3. Polynucleotide Chains Have Nitrogenous Bases Linked to a SugarPhosphate Backbone

Base Nucleoside = base + sugar* Nucleotide = base + sugar* + phosphate *sugar: deoxyribose for DNA ribose for RNA Nucleotide

Base

Chemical moieties for glycosidic bond with 1 carbon on sugar Chemical moieties for sugar-phosphate backbone (phosphodiester bond)

Nucleoside

1.3. Polynucleotide Chains Have Nitrogenous Bases Linked to a SugarPhosphate Backbone

" A polynucleotide is a long chain of nucleotides linked by 5 to 3 phosphodiester linkages. " The bases stick out from the backbone. " One end of the chain has a free 5! end and the other end has a free 3! end. " DNA contains the four bases: " Adenine (A) " Guanine (G) " Cytosine (C) " Thymine (T) " RNA has uracil (U) instead of thymine.
Figure 1.5

1.3. Polynucleotide Chains Have Nitrogenous Bases Linked to a SugarPhosphate Backbone

" Nucleic acids are named for the type of sugar: DNA has 2-deoxyribose and RNA has 2-ribose (see purple rings below). " RNA contains the four bases: adenine (A), guanine (G), cytosine (C), and uracil (U) " DNA has thymine (T) instead nucleoside of uracil. " The only difference between uracil and thymine is a methyl H 3C group (CH3) at position C5 (see 4 4 3 3 red rings on left). 6 6 1
1

Glycosidic bond
H

nucleotide

1.3. Polynucleotide Chains Have Nitrogenous Bases Linked to a SugarPhosphate Backbone

DNA Base
Adenine Guanine Cytosine Thymine Uracil
*Deoxynucleoside-5-monophosphate

RNA Nucleotide*
Deoxyadenosine-5triphosphate (dATP) Deoxyguanosine-5triphosphate (dGTP) Deoxycytidine-5-triphosphate (dCTP) Deoxythymidine-5triphosphate (dTTP) Uridine Uridine-5-triphosphate (UTP)

Nucleoside
Deoxyadenosine Deoxyguanosine Deoxycytidine Deoxythymidine

Nucleoside
Adenosine Guanosine Cytidine

Nucleotide#
Adenosine-5triphosphate (ATP) Guanosine-5triphosphate (GTP) Cytidine-5-triphosphate (CTP)

(dNMP); deoxynucleoside-5-diphosphate (dNDP) #Nucleoside-5-monophosphate (NMP); nucleoside-5-diphosphate (NDP)

" DNA and RNA sequences are shown as the name of the base (i.e, A, G, C, T, or A, G, C, U).

1.4. DNA Is a Double Helix

!" James Watson & Francis Crick proposed the double-helix model in 1953 based on three pieces of evidence.
" X-ray diffraction data collected by Rosalind Franklin & Maurice Wilkins showed that the B-form of DNA is a regular helix, making a complete turn every 34 , with a diameter of ~20 . Since the distance between adjacent nucleotides is 3.4, there must be 10 nucleotides per turn. " The density of DNA suggests that the helix must contain two polynucleotide chains. The constant diameter of the helix can be explained if the bases in each chain face inward and are restricted so that a purine is always paired with a pyrimidine. " Chargaff rule: the proportion of G is always the same as the proportion of C in DNA, and the proportion of A is always the same as that of T.

1.4. DNA Is a Double Helix

" The sugar-phosphate backbones are on the outside and carry negative charges on the phosphate groups. " Bases are positioned inward; they are flat and lie perpendicular to the axis of the helix # bases are stacked above one another (called base-stacking), which forms strong hydrophobic interactions between bases.

Figure 1.6

" G pairs with C and A pairs with T; these are called base pairing. " Base pairing is formed by hydrogen bonds between bases. " G:C pair has three hydrogen bonds and A:T pair has two # G:C pair is stronger. " Paired bases are said to be complementary. " Two strands run in opposite direction: antiparallel.

1.4. DNA Is a Double Helix

!" The double helix exists in multiple conformations and has a major (wide) groove and a minor (narrow) groove. !" B form is the major conformation in cells: 10 bp per turn. !" A form is found in some DNA-protein complexes: 11 bp per turn. " narrower and deeper major groove " broader and shallower minor groove " similar to RNA double helix !" Z form is formed in solution with high concentration of positively charged ions. " left-handed; the others are righthanded.

Figure 1.8

1.4. DNA Is a Double Helix

!" B form is the major conformation in a cell: 10.5 bp per turn. !" A form is found in some DNA-protein complexes: 11 bp per turn. " narrower and deeper major groove " broader and shallower minor groove " similar to RNA double helix !" Z form is formed in solution with high concentration of positively charged ions. " left-handed; the others are right-handed.

1.5. Supercoiling Affects the Structure of DNA

!" Supercoiling occurs only in closed DNA with no free ends. !" Closed DNA is either circular DNA (prokaryotes) or linear DNA (eukaryotes) in which the ends are anchored to a protein scaffold; they are not free to rotate. !" DNA topology (overall conformation of DNA) is crucial for its function. !" Two strands are interwound and can not be separated without breaking covalent bonds. "" Type I topoisomerase: single strand break, do not require ATP "" Type II topoisomerase: double strand break, require ATP "" Topoisomearses usually remove supercoils. " Gyrase (prokaryote-specific type II topoisomerase) introduces negative supercoiling. !" Same DNAs can be different topologically. They are called topoisomers.

1.5. Supercoiling Affects the Structure of DNA

!" Linking number (Lk): number of times one strand has to pass through the other strand for the two strands to be entirely separated; always integer; invariable in closed DNA if there is no break. !" Twist number (Tw): the number of helical turns of one strands !" Writhing number (Wr): the number of crossovers of helical axis !" Tw and Wr are topologically equivalent; interconvertible without the breakage of any covalent bonds !" Negative supercoling is underwound compared to B DNA and positive supercoiling is overwound. !" Negative supercoiling is twisting in the opposite direction to the two strands and positive supercoiling is in the same direction. Lk =Tw + Wr

1.5. Supercoiling Affects the Structure of DNA

!" Linking difference " !Lk = Lk LkO (LkO (# bp/10) is linking number of relaxed closed DNA) " !Lk < 0: negatively supercoiled " !Lk > 0: positively supercoiled !" Biological significance of negative supercoiling " Negative supercoiling can be converted into untwisting of the double helix # strand separation is easier " Thermophilic bacterial DNAs are positively supercoiled #" helps keep the DNA from denaturing at high temperature. " Nucleosomes introduce negative supercoiling in eukaryotes.

Chapter 2
Genes Encode RNAs and Polypeptides

2.10. Several Processes Are Required to Express the Product of a Gene

" DNA consists of two strands; sequence of only one strand is often used to indicate DNAs genetic information.
(coding/sense strand) (template/antisense strand)

Figure 2.12

" Common ways to show the sequence of the DNA above: 5-ATGCCGTTAGACCGTTAGCGGACCTGAC-3 or ATGCCGTTAGACCGTTAGCGGACCTGAC

2.10. Several Processes Are Required to Express the Product of a Gene

" Genetic information flow: DNA # RNA # protein " There are multiple forms of RNA. RNA that produces protein is called messenger RNA (mRNA). Other types of RNA that do not produce a protein include ribosomal RNA (rRNA), transfer RNA (tRNA), and micro RNA (miRNA).

Figure 2.13

" An mRNA consists of an 5 UTR (untranslated region), coding region, and 3 UTR # a gene is usually longer than the sequence encoding a protein.

2.10. Several Processes Are Required to Express the Product of a Gene

!" Bacterial transcription and translation occur in the same place. !" Bacterial translation starts before transcription is complete.

RNA polymerase

Figure 2.14

2.10. Several Processes Are Required to Express the Product of a Gene

!" Eukaryotic transcription occurs in the nucleus and translation in the cytoplasm. !" Eukaryotic genes contain introns and exons; intron-containing RNA is premRNA and introns are removed by splicing. !" Mature mRNA is transported to the cytoplasm and translated. !" Eukaryotic gene expression has more steps for regulation.

Figure 2.15