Toxicon 83 (2014) 22–34

Contents lists available at ScienceDirect

Toxicon
journal homepage: www.elsevier.com/locate/toxicon

Construction of a single chain variable fragment antibody

(scFv) against tetrodotoxin (TTX) and its interaction with TTX
Rongzhi Wang a,1, Ailing Huang b,1, Licai Liu a, Shuangshuang Xiang a,
Xiufeng Li a, Sumei Ling a, Lei Wang a, Tun Lu b, **, Shihua Wang a, *
a
Key Laboratory of Pathogenic Fungi and Mycotxins of Fujian Province, The Ministry of Education Key Laboratory of Biopesticide and
Chemical Biology, School of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China
b
Bioengineering and Bioscience Department, Fuzhou University, Fuzhou 350108, China

a r t i c l e i n f o a b s t r a c t

Article history: Tetrodotoxin (TTX) is a small molecular weight neurotoxin that occludes voltage-gated
Received 24 November 2013 sodium channels in nerve and muscle tissue, resulting in respiratory paralysis and
Received in revised form 20 February 2014 death. A high affinity antibody that can neutralize the toxicity of TTX is still lacking, so it is
Accepted 25 February 2014
very important to prepare an antibody for TTX therapy and detection. In the present study,
Available online 5 March 2014
a chemical method was used to prepare the tetrodotoxin complete antigen, and a small
amount, repeatedly immunity way was carried to immunize 4 mice. The amplified genes
Keywords:
encoding monoclonal antibodies against TTX were used to construct the phage display
Tetrodotoxin (TTX)
scFv
library. After six rounds of biopanning, an antibody named scFv-T53 was characterized
Computer modeling from clones showing high affinity and specific to TTX, and its affinity constant was
Mutation 1.1
106 L/mol. Three dimensional structure of the scFv-T53 was constructed by computer
modeling, and TTX was docked to the scFv-T53 model to obtain the structure of the
binding complex. Two predicted essential amino acids, K183 and I189, were mutated to
verify the theoretical model. Both mutants lost binding activity significantly against TTX as
predicted by the theoretical model. Hence, the above results will be useful for screening
the high affinity anti-TTX scFv mutants.
Ó 2014 Published by Elsevier Ltd.

1. Introduction neurotoxin that occludes voltage-gated sodium channels

Tetrodotoxin (TTX) is the major toxic component of the
Tetraodontidae family contained in puffer fish. Despite the
potent toxicity, puffer fish has long been regarded as one of
the most delicious fish in east and southeast Asia, and 30–
50 cases of intoxications were reported every year
(Noguchi and Ebesu, 2001; Wan et al., 2007). Tetrodotoxin
(TTX) is a small molecular weight (M.W ¼ 319.3)
* Corresponding author. Tel./fax: þ86 591 87984471.
** Corresponding author. Tel./fax: þ86 591 22866277.
E-mail addresses: lvtun@yahoo.com (T. Lu), wshyyl@sina.com (S.
Wang).
1 it may be used as a therapeutic agent for pain (Dib-Hajj
These authors contribute equally to the work.
thereby impeding ion conductance (Narahasi, 2001;
Fozzard and Lipkind, 2010; Chulanetra et al., 2012), lead-
ing to respiratory paralysis even to death. Tetrodotoxin
(TTX) was named for the family of puffer fish in which it
was first discovered, and a bevy of less toxic analogs
(Yasumoto and Yotsu-Yamashita, 1996; Yasumoto et al.,
1988; Yotsu-Yamashita, 2001; Chulanetra et al., 2011) have
been documented from many disparate taxa (Miyazawa
and Noguchi, 2001; Noguchi and Arakawa, 2008;
Yasumoto et al., 1989). TTX has been extensively used to
elucidate the role of specific voltage-gated sodium chan-
nels (VGSCs) subtypes, and prevent the influx of Naþ so-
dium (Naþ) channels with remarkably high specificity, and

http://dx.doi.org/10.1016/j.toxicon.2014.02.021
0041-0101/Ó 2014 Published by Elsevier Ltd.
 R. Wang et al. / Toxicon 83 (2014) 22–34
et al., 2010; Nieto et al., 2012). These ion channels are, in
part, responsible for the initiation and propagation of ac-
tion potentials in most membrane structure (Hille, 2001;
Narahashi, 1972; Kao, 1986, 1972). The current model of
the interaction between TTX and voltage-gated sodium
(Naþ) channels is that the positively charged guanidinium
group and six hydroxyl groups (C4, C6, C8, C9, C10 and C11)
forms complex electrostatic bonds with two charged rings
of amino-acid residues in the outer pore of the sodium ion
channel and cause the channel blockade (Geffeney and
Ruben, 2006; Lipkind and Fozzard, 1994, 2000; Lee and
Ruben, 2008; Fozzard and Lipkind, 2010).
TTX was first separated in 1950 as a crystalline prism
from toxic puffer fish by Yokoo (Yokoo, 1950), and its
structure for the first time was illustrated by three groups
in 1964 (Tsuda et al., 1964; Woodward, 1964; Goto et al.,
1965). The range of lethal potency of TTX is about 5000–
6000 MU/mg [1 MU (mouse unit) is defined as the amount
of toxin required to kill a 20 g male mouse within 30 min
after intraperitoneal administration], and the minimum
lethal dose (MLD) for adult humans is approximately
10,000 MU (z2 mg) (Noguchi and Ebesu, 2001). Various
TTX derivatives have so far been isolated from puffer fish or
some other TTX-bearing organisms (Yotsu-Yamashita,
2001; Jang and Yotsu-Yamashita, 2007). TTX is not pro-
duced by puffer fish but by certain species of marine bac-
teria (Choudhary et al., 2003), and some reports have
shown that the accumulation of TTX in puffer fish is from
the food chain, consisting of several steps and starting with
marine bacteria as a primary source of TTX.
As TTX is a hapten antigen, it is ineffective in bringing on
the body immune response, and the problem is further
aggravated since TTX have highly toxic. To obtain a high
serum titer antibody, it is necessary to prepare the TTX
complete immune antigen. Hybridoma technology has
been used to generate monoclonal antibodies against TTX,
but hybridoma clones tend to lose their antibody-secreting
ability over time (Frame and Hu, 1990; Kessler et al., 1993).
Recently, recombinant DNA has made it possible to clone
desired antibody genes by using phage display technology
and to produce a single-chain variable fragment (scFv)
antibody in bacterial culture (Coia et al., 2001). Compared
to monoclonal antibody technology, the cost of scFv pro-
duction is very low, and scFv can be fused with a marker
molecule for immunological detection effectively (Wang
et al., 2006). In 2012, Chulanetra prepared a HuscFv by
phage display system that could rescue the intoxicated
mice from the TTX mediated lethality, and this provided a
safe, effective and specific therapeutic remedy for TTX
intoxication in humans (Chulanetra et al., 2012). Therefore,
the objective of the present study was to construct a high
affinity recombinant antibody (scFv) against TTX, and it
may be provide a guarantee for toxin poisoning treatment
and detection.
ScFv developed for small molecule therapy and detec-
tion usually suffered from their low binding affinity
comparing to those for macromolecular antigens. The
study of the binding mechanism of scFv with antigen can
help to improve their binding affinities. The normal
approach for studying protein-ligand binding mechanism
is by crystal experiment which is time consuming. With
23
the progress of computational biology, it has been possible
to study the protein ligand interaction on silicon. Anti-
bodies possess a highly conserved framework region (FR)
and several non-conserved CDR regions, but the folds
adopted by most of CDR loops are restricted to few main-
chain conformations, which called canonical structures
(Chothia and Lesk, 1987). A large number of antibody
crystal structures are now available, which could be used
as templates for modeling a target antibody. Previous re-
searches (Morea et al., 2000; Tramontano, 2006; Arcangeli
et al., 2008) had confirmed that the molecular models of
the immunoglobulin could be built with a reasonably high
level of confidence by homology method. The binding
conformation and binding interactions of the ligand with
the antibody could be modeled by docking programs
when structures are available (Feng et al., 2013). There
have been several successful reports on antibody affinity
maturation based on artificial intelligent design, a prom-
ising, fast and efficient technique to enhance the affinities
of antibodies.
2. Materials and methods
2.1. Materials
Tetrodotoxin (TTX) was purchased from Hebei Aquatic
Science and Technology Development Company (Hebei,
China); Keyhole limpet hemocyanin (KLH), Bovine serum
albumin (BSA), Ampicillin, Kanamycin sulfate, Isopropyl b-
D-thiogalactopyranoside (IPTG) were purchased from
Sigma–Aldrich Co. LLC. (St Louis, MO, USA); DNA restric-
tion Enzymes, mRNA isolation kit, and Reverse transcrip-
tion kit were bought from Promega (Madison, WI, USA).
Taq DNA polymerase, and T4-DNA ligase were from
TakaRa (Dalian, china). HRP conjugated goat anti-mouse
IgG antibody was from Boster biotechnology Co. (Wuhan,
China). All other regents used were of analytical-reagent
grade.
2.2. Preparation of tetrodotoxin complete antigen
To prepare complete antigen, formaldehyde (HCOH)
was used to connect TTX with vector protein by chemical
reaction method (Nagashima et al., 1993). First, 10 mg
carrier protein (KLH or BSA) and 1 mg TTX were dissolved
in 2 mL and 1 mL phosphate buffer saline solution (PBS)
separately. Then 37% formaldehyde was added into the
above mixture to the total concentration of 1%. Finally,
these mixtures were incubated at 37  C for 72 h under dark
and vibration. After incubation, the products were dialyzed
in 1000 mL PBS at 4  C for 72 h, and the PBS was changed
per 12 h to remove the TTX which is not connected to the
carrier protein. Dialyzed products were freeze-dried,
quantified and stored at 20  C for further use. Fourier
transform infrared (FT-IR) transmittance spectroscopy and
gel electrophoresis were used to verify the synthesis of the
complete antigen. One milligram of BSA, KLH, TTX–BSA or
TTX–KLH was milled with KBr respectively to form a very
fine powder, and this powder was then compressed into a
thin pellet which could be analyzed using the intelligent
FT-IR spectrometer.
24 R. Wang et al. / Toxicon 83 (2014) 22–34
2.3. Immunoassay
After conjugating, the complete antigen TTX–KLH was
used to immunize 4 Balb/c mice (the first dose of immu-
nization is 50 mg/mouse, the follow-up dose of immuniza-
tion is 30 mg/mouse) for 7 times, 10 d apart. Blood from both
control and immunized mice were obtained 3 d after the
7th immunizations, and the serum titer was detected by
indirectly ELISA (TTX–BSA as the detection antigen). Once
high serum titer was obtained, the animal was sacrificed
and the spleen was obtained. Total mRNA was extracted
from the spleen of immunized Balb/c mice according to the
method of Trizol (Promega biotech).
2.4. Construction of phage displayed anti-TTX scFv library
First strand cDNA was synthesized through RT-PCR with
the above mRNA as template, and the variable regions of
heavy chain (VH) and light chain (VL) were amplified from
the first-strand cDNA through the primary PCR amplifica-
tion. A special linker DNA fragment encoding a short flex-
ible peptide, (Gly4Ser)3 was used to assemble scFv gene
fragments by overlap extension PCR (SOE-PCR) (molecular
ratio of VH to VL to linker DNA is 3:3:1). The assembled scFv
gene products were subsequently amplified with primers
which attach Sfi I and Not I restriction sites. After gel pu-
rification, the amplified scFv products were digested (with
Sfi I and Not I restriction enzymes), purified, and then
cloned into the same enzymes digested phage plasmid
vector pCANTAB-5E. The ligation mixture was transformed
into Escherichia coli TG1 competent cells by electroporation,
and then the transformed cells were transferred immedi-
ately into separate tubes containing 900 mL of LB-AG me-
dium and incubated for 1 h at 37  C with shaking at 250 r/
min. Transformed cells (10 mL) were took out from one of
the separate tubes, and plated onto the SOB-AG plates (also
plated 10 mL of untransformed TG1 cells as a negative
control), and incubated at 37  C for overnight. The helper
phage M13KO7 was used to rescue the recombination
phagemid, and the recombinant clones on SOB-AG plates
were selected for further analysis (Wang et al., 2012).
2.5. Biopanning of phage display library
To enhance the efficiency of biopanning, the phage
particles displaying scFv were precipitated with poly-
ethylene glycol (PEG)-NaCl on ice for 1 h and collected by
centrifugation at 10,000 g for 20 min at 4  C. A 96-wells
micro titer plate was coated with detection antigen (TTX–
BSA) diluted to 2.5 mg/mL in PBS (100 mL/well), and incu-
bated at 4  C for overnight. At the same time, a negative
control was performed (uncoated with detection antigen).
The plate was washing with PBS for 3 times and blocked
with PBS containing 4% non-fat milk. The diluted recom-
binant phage particles were added into the plate (100 mL/
well), and then the plate was incubated at 37  C for 2 h. The
plate was washed 10 times with PBS and 10 times with PBS
containing 0.05% Tween-20 to remove the unbound
phages. Phage particles which specifically bind to TTX–BSA
were eluted with 10 mL of triethylamine for 10 min, and
then 10 mL of Tris–HCl (pH 7.4) was added into the wells to
neutralize the reaction. The log phase E. coil TG1 cells were
infected with the eluted phages, and then plated onto SOB-
AG plates for screening of individual colonies. The bio-
panning process was repeated for 6 rounds.
Each clone of the enriched clones was transformed to a
separate tube for rescuing with M13KO7, and was assayed
for specific binding activity by phage-ELISA. First, a 96 wells
plate was coated with the detection antigen (TTX–BSA)
diluted to 2.5 mg/mL in PBS (100 mL/well), blocked and
washed, and an uncoated well was performed as a negative
control. Second, phage particles dissolved in PBS containing
4% non-fat milk were added into every well and incubated
at 37  C for 2 h. Third, these phages that were not bind to
detection antigen were washed out, and the bound phages
were detected with a anti-M13 monoclonal antibody (1:
4000 dilution) and HRP conjugated goat anti-mouse IgG
monoclonal antibody (1:5000 dilution). Fourth, TMB
(100 mg/mL) was added to the wells for 30 min, and the
reaction was stopped with 2 mol/L H2SO4. Last, the OD450
value was measured. The binding activity was evaluated by
S/N (OD450 value of sample/negative) ratio. The positive
clone was selected when the S/N value was higher than 2
(S/N > 2), and then identified by PCR, Sfi I/Not I enzyme
digestion, and DNA sequencing.
2.6. Specificity analysis of anti-TTX scFv
To determine the specificity of anti-TTX scFv antibody
clone, the indirect phage ELISA was performed. KLH, BSA,
CTX–KLH (Conotoxin–KLH conjugates), CIT–KLH (Cit-
reoviridin–KLH conjugates), and TTX–BSA were coated in
96-wells plate in triplicate (2.5 mg/mL, 100 mL/well) at 4  C
for overnight, and then blocked with 4% PBSM. The re-
combinant phage particles displaying scFv were added to
the reaction wells and incubated at 37  C for 2 h, and the
specificity of scFv clone was detected with anti-M13
monoclonal antibody and HRP conjugated goat anti-
mouse IgG monoclonal antibody. Subsequently, the
enzyme reaction was performed with TMB as the substrate
and the color development was stopped with 2 M H2SO4,
and the absorbance was measured by a microplate reader
at 450 nm.
To further identify the specificity of the selected clone to
TTX, a competitive ELISA was performed. TTX, Conotoxin
(CTX), Citreoviridin (CIT), Deoxynivalenol (DON), and
Fumonisin B1 (FB1) were diluted to a serious of concen-
tration (0.0625, 0.125, 0.25, 0.5, 1.0, 2.5, 5.0, 10.0, 25.0, 50.0,
75.0, 100.0 ng/mL). The detection antigen (TTX–BSA) was
coated at the concentration of 2.5 mg/mL, and the other
steps were corresponding to the above, but the phage
antibody and different toxin molecular must be mixed with
equal amount, then added to the reaction wells. Finally, the
inhibitory rate was obtained.
2.7. Soluble expression and affinity assay
To analyze the activity of soluble anti-TTX antibody, the
log-phase HB2151 cells were infected with the strongest
positive recombinant phage particle, and then diluted by
1:100 into 100 mL fresh 2
YT medium containing 100 mg/
mL ampicillin, and the IPTG (1 mmol/L) was added to the
 R. Wang et al. / Toxicon 83 (2014) 22–34
medium when the OD600 reached 0.7 to induce the pro-
duction of the soluble scFv antibody. The culture was
incubated at 28  C with shaking at 200 r/min for at least 6 h
followed by centrifugation at 2000 g for 20 min, and the
anti-TTX scFv antibody existing in periplasmic was extrac-
ted by standard osmotic shock method (Sonoda et al.,
2011). The cell culture pellet was resuspended in 10 mL
ice-cold PPB buffer (0.2 mol/L Tris–HCl, pH 8.0, 0.5 mmol/L
EDTA, 0.5 mmol/L sucrose) and incubated on ice for 30 min
followed by centrifugation at 12,000 r/min for 20 min at
4  C. The supernatant was carefully discarded, and the
pellet was dissolved in 2 mL MgSO4 (5 mmol/L) and incu-
bated at 25  C for 10 min. After centrifugation at 12,000 r/
min for 20 min, the supernatant was analyzed for the
presence of soluble antibody by ELISA and SDS–PAGE.
The affinity constant (Kaff) of the scFv clone against TTX
was determined using the equation Kaff ¼ (n  1)/(n
[Ab2]  [Ab1]) as described previously (Wang et al., 2012;
Beatty et al., 1987), where [Ab1] and [Ab2] represent the
scFv concentrations required to achieve 50% of the
maximum absorbance of the two different concentrations
of coated antigen ([Ag1] ¼ n[Ag2], n is the dilution factor of
the concentrations of antigen used).
2.8. Sequence of scFv gene and homology modeling
The positive clone was identified by PCR and enzyme
digestion, and sequenced using vector specific primer. The
sequence of scFv gene was blasted with known murine
genes for homology analysis from the Genbank/EMBL
database, and the scFv-T53 DNA sequence has submitted to
NCBI database (GenBank accession number KF673353.1).
The svFv sequence was searched against the PDB database
to retrieve homology antibody sequences. The structure of
scFv was generated by Modeller9v7 (Sali and Blundell,
1993) using homology modeling method. The 3D struc-
ture of SARS neutralizing antibody 80R (PDB 2GHW) was
used as the template for scFv homology modeling (Berman
et al., 2002). An ensemble of models of the scFv at atomic
scale was generated for the target scFv by the software with
the highest level of optimization setting. The produced
models were ranked by the molecular probability density
function values, and the best model was picked for further
study.
The structural model was further refined by the AMBER
software package (Case et al., 2005) with the amberff03
force field (Duan et al., 2003; Hornak et al., 2006). The first
stage was to minimize the initial system to remove any bad
contacts and create the coordinates. The system was then
energy minimized by 2000 steps of steepest-descent
minimization before switched to 2000 steps of conjugate-
gradient minimization. MD simulation used Born implicit
solvent model was performed for 250 ps at 300 K.
2.9. Docking of TTX and scFv
TTX coordinates were constructed by Chemoffice
(Zielesny, 2005) and refined by Gaussian (Frisch and Trucks,
2003). The docking software AutoDock4.0 was used to
predict the binding model of antibody-TTX complex (Huey
et al., 2007; Goodsell et al., 1996; Poelarends et al., 2013).
25
The 3D structure of scFv and TTX were prepared as the
input for the software according to the default protocols.
The energy scoring grid was set as 80
60
60 Å3,
centered at the scFv. The embedded solvation parameters
were assigned to the complex. The Lamarckian genetic al-
gorithm (Morris et al., 1998) was used as the search pro-
tocol, and the default parameters were used except for the
maximum number of energy evaluations which was set to
250 million. The population size of the genetic algorithm
was retained at 150. The docking procedure was composed
of to 15 genetic algorithm runs of 250 million energy
evaluations.
2.10. Molecular dynamics (MD) simulations
The best docked mode generated by Autodock was
refined by the molecular dynamic simulation software
AMBER11 using Amberff03 force field for scFv and Gaff
force field (Wang et al., 2004) for small molecular TTX.
Energy minimization and MD simulations of TTX/scFv
complex was carried out using implicit born solvation
model. The time step was set to 1.0 fs without a cutoff for
the non-bonded interactions. The system was heated to
300 K in 2 ps and equilibrated for 50 ps before ran into the
final 4 ns MD data collection phase. In the data-collection
stage, the trajectory was recorded at the interval of 1 ps.
2.11. Binding free energy calculation
The binding free energy of TTX and scFv was calculated
and the key amino acid residues of the antibody responsible
for binding were analyzed. Binding complex model of the
docking result after optimization was used to do the
computation. The binding free energy (DGbinding) of the
complex was calculated from the free energies of the com-
plex, the ligand and the receptor according to the equation:
DGbinding ¼ Gcomplex  Gligand  Greceptor ¼ DEinternal þ
DEelectrostatic þ DEvdW þ DGsolvation  TDS, where Einternal is the
internal energy which represent the strain energy in bonds,
angles and torsion angles caused by their deviation from the
equilibrium values; Eelectrostatic and EvdW are the electrostatic
and van der Waals interaction energies, respectively; T is the
temperature, DS is the change of the entropy; DGsolvation was
the solvation free energy. Bind free energy was computed by
the MMGBSA module of AMBER11 using GB model for the
solvent (Srinvasan et al., 1998; Chong et al., 1999; Bashford
and Case, 2000). The decomposition of the binding free
energy to each residue was also computed by the MMGBSA
module of AMBER11.
2.12. Point mutation of scFv
To evaluate the accuracy of the computer model of scFv-
TTX binding complex, two amino acids, Lys183 and Ile189,
which contribute most to the binding energy by prediction
were mutated to Alanine. Primers including EcoR I and Hind Ⅲ
restriction enzymatic sites (scFv-F: 50 -ATA-
GAATTCAATGGCCGTCCAACTGCAGGAGTC-30 and scFv-R: 50 -
CTGGC AAGCTTCCGTTTTATTTCCAACTTTGTCCC -30 ) were
used to amplify the target scFv, and the amplified PCR product
was cloned into pACYC-Duet-skp vector. Oligonucleotide-
26 R. Wang et al. / Toxicon 83 (2014) 22–34

directed mutagenesis was performed by over-lap PCR as the
screened scFv template with the mutant primers (Primers
scFvK183A-F: 50 -CTTCTCATCGCA-
TATGCTTCTCAATCCATCTCTG-30 and scFvK183A-R: 50 -CAGA-
GATGGATTGAGAAGCATATGCGATGAGAAG-30 for K183A
mutant; Primers scFvI189A-F: 50 -TTCTCAATCCGCATCTGG-
GATCCCCTCCAGGTTC-30 and scFvI189A-F: 50 -GAACCTG-
GAGGGGATCCCAGATGCGGATTGAGAA-30 for I189A mutant),
and the amplified scFv mutants were inserted into pACYC-
Duet-skp vector, respectively. The resultant vectors were
designated as pACYC-Duet-mscFv(K183A)-skp and pACYC-
Duet-mscFv(I189A)-skp, respectively. For scFv expression, the
constructed mutant vectors were transformed into E. coli
BL21 by electroporation, and a single colony from the selec-
tion plate was inoculated into 5 mL LB liquid media con-
taining 34 mg/mL chloramphenicol for expression of the
mutated scFv antibody. The expressed protein contains a
6
His tag at the N-terminal, and the target scFv was purified
using Ni2þ affinity chromatography according to the manu-
facturers’ directions.
2.13. ELISA analysis and affinity determination
After purification, the binding activity of the purified
mutant scFv products was determined by ELISA. The
dialyzed BSA–TTX antigen was used to coat the 96 well
plates at 4  C for overnight. After blocking and washing, the
purified scFv products (10 mg/mL) were added to the re-
action wells and incubated at 37  C for 2 h. Then, the anti-
His6 tag antibody was added to the reaction wells and
incubated at 37  C for 2 h. The binding activity of the pu-
rified mutant scFv was detected by using a HRP conjugated
anti-mouse IgG antibody. The enzyme reaction was then
performed with TMB as a substrate and color development
was terminated with 2 M H2SO4. Absorbance at 450 nm was
measured using a microplate reader. The affinity constant
(Kaff) of the scFv mutants against TTX were determined as
above.
3. Results
3.1. Preparation of tetrodotoxin complete antigen
We had obtained two different kinds of complete anti-
gen, TTX–KLH as immunization antigen and TTX–BSA as
detection antigen. Their final concentrations were about
1 mg/mL. Fourier transform infrared (FT-IR) transmittance
spectroscopy is a measurement of wavelength and in-
tensity of the absorption of IR radiation (Wang et al., 2011).
In our report, the two different kinds of complete antigen

Fig. 1. Analysis of carrier protein and complete antigen by infrared scanning detection methods and agarose gels electrophoresis. A and B are the results of IR
absorption spectra. Great changes have occurred between the wave number of 1080 cm1–1360 cm1, which is the absorption peak of –C–N– bond. C and D are
the agarose gels electrophoresis result of the carrier protein and conjugates. The size of carrier protein changed before and after that conjugated with toxin. C
(lane 1): BSA, C (lane 2): TTX–BSA. D (lane 1) KLH; D (lane 2): TTX–KLH.
 R. Wang et al. / Toxicon 83 (2014) 22–34 27

were analyzed by FT-IR scanning detection method. The FT-
IR spectra results indicated that strong absorption wave
number between 1080 cm1–1360 cm1 was the range of
C–N bond vibration range, and the characteristic absorp-
tion wave number of conjugate produced a significant dif-
ference to the carrier protein (Fig. 1A, B). The results
indicated that the functional groups of KLH, BSA and TTX
are contained in TTX–BSA and TTX–KLH, respectively.
Agarose gel electrophoresis was used to analysis the
different charge between the carrier protein and the final
conjugate. As the TTX contains negative charges, and the
carrier protein binds more TTX toxin molecules by chemical
reaction. The conjugated products obtained more negative
charges from TTX, and the net charge of the conjugates
becomes more negative than that of carrier protein. In
nondenaturing gel electrophoresis, the migration speed of
the conjugates was faster than that of carrier protein. The
actual experiment results were consistent with the
reasoning as shown in Fig. 1C, D, which indicated that the
preparation of complete antigen was very successful.
3.2. Immunoassay
After the preparation of antigen, 4 Balb/c female mice
were immunized with the complete immunization antigen
(TTX–KLH), and the serum titer was detected after the 7th
immunization by indirectly ELISA. The detection antigen
(TTX–BSA) was used to coat the 96 wells plate (100 mL/
well, 2.5 mg/mL), and the titer assay of the serum was
shown in Fig. 2A. Compared to the control mice, mice 1 and
mice 2 showed higher antiserum titer (reaching 1:8000).
The results indicated that the immunized mice had high
anti-TTX antibody titer, and could be used for the con-
struction of phage display antibody library.
3.3. Phage-displayed anti-TTX scFv library construction and
biopanning
Total RNA was extracted from spleen lymphocytes of the
immunized mice, and the first chain cDNA were synthe-
sized by RT-PCR kit using total RNA as template. The VH and

Fig. 2. Construction of phage antibody library. A is the result of titer assay of serum. Three mice (1: mouse 1; 2: mouse 2 and 3: control mouse) were selected to
detect the serum titer after 7th time immunization, and the serum titer was evaluated by P/N ratio (sample/negative, P  1.0). B is the PCR products of VH and VL.
Lane 1: the PCR product of VH gene, Lane 2: the product of VL gene, Lane M: the marker DL-2000. C is the amplified fragment of scFv gene. Lane M: DL-2000
Marker, Lane 1–2: The amplified fragment of scFv gene. D is the panning process. In each panning round, the number of input phage was kept constant at
1.5
106 CFU/mL and the phage that did not bind to TTX–BSA was removed by washing with phosphate buffer saline. After three panning round, the number of
elusion phage was kept constant at 1.0
106 CFU/mL.
28 R. Wang et al. / Toxicon 83 (2014) 22–34

VL genes were amplified separately by PCR using the above
cDNA as template, and the lengths of VH and VL DNA frag-
ments were approximately 340 bp and 325 bp, respectively
(Fig. 2B). Then, the VH, VL and linker genes were assembled
into a complete scFv gene through SOE-PCR reaction, and
the size of the assembled scFv fragments was approxi-
mately 750 bp (Fig. 2C). The phage-displayed scFv library
was constructed to 1.5
107 CFU/mL in size, and the input
and elusion of the phage library was shown in Fig. 2D.
About 1.5
106 CFU/mL phage clones were used for bio-
panning in each round, and the elusion phage clones were
maintained at a level of approximately 106 CFU/mL after
the third rounds. Ninety clones were randomly selected
from the SOB-AG plates to estimate the efficiency of phage
display library, and were identified by PCR and restriction
enzyme digestion. The results showed that more than 90%
recombination clones were positive scFv.
3.4. Screening of specific binding clones to TTX
To obtain specific and high-affinity clones against TTX,
phage-ELISA was used to select the single phage clone
displaying scFv fragment. As a negative control, BSA was
coated for panning. After 6 rounds of bio-panning with
antigen TTX–BSA, three positive TTX binding scFv clones
were isolated from the recombination phage display anti-
bodies library. Among of these three phage clones, one
phage clone named scFv-T53 that giving the strongest
signal in ELISA were obtained (Fig. 3A), and this phage
clone was used for the further study.
3.5. Specificity of ScFv-T53 to TTX antigen
To identify the specificity of scFv-53, TTX related antigen
such as KLH, BSA, CTX–KLH, CIT–KLH, TTX–BSA, were used
to detect the specificity of scFv-T53 by indirect ELISA, and
each experiment was tested in triplicate. As seen in Fig. 3B,
the scFv-T53 antibody with a strong signal was detected in
ELISA for TTX–BSA antigen compared to other antigens. The
result showed that the selected scFv-T53 specifically
recognized TTX–BSA antigen with no cross-reaction to
other related antigen proteins. In the result of competitive
ELISA experiment (Fig. 3C), the TTX molecular demon-
strated a very strong competition and the intensity of
competition are positively correlated to the amount of TTX.
Other toxin molecular almost had no competition, so they

Fig. 3. Screening of specific binding clones to TTX and specificity analysis of the selected clone. A: Three positive clones were obtained, and one clone (scFv-T53)
with the highest affinity was selected for further study. B: The specificity analysis of scFv-T53 using indirectly ELISA. Different associated antigen such as KLH,
BSA, CTX–KLH, CIT–KLH and TTX–BSA were coated at the same concentration, and the selected clone only recognized TTX–BSA antigen with no cross-reaction to
other related antigen proteins. C: TTX molecular inhibited the combination of the phage antibodies to the detection antigen, but other toxin molecular could not.
 R. Wang et al. / Toxicon 83 (2014) 22–34
did not inhibit the binding of the phage antibodies to the
detection antigen. All these indicated that the selected
clone scFv-T53 had high specificity to identify TTX.
3.6. Soluble expression and affinity determination of scFv-T53
To determine the affinity constant of scFv-T53, the anti-
TTX scFv antibody was expressed in soluble form in scFv-
T53 infected E. coli HB2151 cells in presence of IPTG in-
duction. As shown in Fig. 4A, a protein of about 29 kDa was
expressed as expected by analysis of SDS–PAGE, and the
expressed scFv antibody gave a strong detection signal in
ELISA assay (data not shown). The affinity constant of the
anti-TTX scFv-T53 antibody was determined by ELISA using
the described protocol. The result revealed was shown in
Fig. 4B, and the affinity constant of scFv-T53 was 1.1
106 L/
mol.
3.7. Homology modeling of scFv-T53 structure
The nucleotide of scFv-T53 clone was sequenced, and
the scFv had 729 nucleotides encoding 243 amino acids
(Fig. 5A) including a flexible amino acid linker of (Gly4Ser)3.
Amino acid number and complementary determining re-
gion (CDR) of the VH and VL domains were determined
according to the method provided by Kabat (Kabat et al.,
1991). The sequence of scFv-T53 was aligned to that of
template antibody R80 (A known scFv 3D structure). Three
dimensional models of scFv-T53 were constructed by
Modeller9v7, and Modeller9v7 generated a pool of theo-
retical structure models for the target scFv. The best
structure model was selected from the pool by several
evaluation criteria. The best model (Fig. 5B) was that with
the lowest value of the DOPE assessment score and the
highest GA341 assessment score (John and Sali, 2003). The
quality of the model structure was first evaluated by
inspecting its backbone conformation by the aid of the Psi/
Fig. 4. Soluble expression and affinity determination. A: SDS–PAGE analysis of the expressed and purified products. M: Molecular weight of marker proteins;
Lanes 1: negative control; Lane 2: the supernatant of induced scFv; Lane 2–3: the dialyzed products of scFv by chemical osmotic shock. B is the affinity constant of
the anti-TTX scFv-T53 antibody determined by ELISA using the protocol described. The concentration of coated antigen is 5, 2.5, 1.25, 0.625 mg/mL, respectively.
29
Phi Ramachandran plot obtained from PROCHECK (http://
www.ebi.ac.uk/thornton-srv/software/PROCHECK/). As
shown in the Ramachandran plots of Fig. 5C, the distribu-
tion of the Psi/Phi angles of the model was mostly inside
the allowed regions and only 1.6% residues has disallowed
conformation. These residues with unfavorable backbone
conformation were mostly resided inside the linker region
of the scFv which had no proper crystal structure as ho-
mology modeling template. The Verify_3D method which
determines the compatibility of a 3D protein model with its
own amino acid sequence (1D) was also used to further
validate the model. The method used the author defined
3D-1D score to judge the quality of a model, and a 3D-1D
score above 0.2 was considered to be the indicator of a high
quality model. The result of Verify_3D gave that 87.66% of
the residues had an averaged 3D-1D score greater than 0.2
(Bowie et al., 1991). To further relax the structure, the ob-
tained scFv-T53 3D model was refined by 4000 cycles of
energy minimization optimization and 250 ps MD simu-
lation. In the process, the potential energy maintained
around 3.3
103 kcal/mol.
3.8. Docking of TTX and scFv
To study the binding mechanism of TTX to scFv-T53, we
docked TTX into scFv-T53 using Autodock4.0. AutoDock
reported the best docking solution (lowest docked free
energy) for each GA run and also performed a cluster
analysis by which the total number of clusters and the rank
of each docking mode were reported. We selected the
lowest energy docking mode from 15 docking models after
15 GA runs. The best model has the docking score of
7.29 kcal/mol. Fig. 5D showed the conformation of TTX
inside the binding pocket of the scFv-T53 of the result
docking model. The binding pocket was found to be in the
cleft between LFR2 and HCDR3 regions of the antibody,
with hydrophobic ILE189 and LEU180 formed the base of
Fig. 5. Bioinformatics analysis of the scFv. A: Nucleotide and amino acid sequences of the scFv-T53 fragment. Complementarity-determining regions are
underlined. B: 3D model of scFv. Variable heavy chain (VH red) and light chain (VL yellow) of the antibody were connected by a polypeptide linker
(GGGGSGGGGSGGGGS, green). C: Ramachandran plot of the scFv model. The most favored regions are colored red, additional allowed, generously allowed, and
disallowed regions are indicated by yellow, light yellow and white colors, respectively. D: The binding pocket of the antibody scFv with ligand TTX. The residues
contribute most to the binding energy was represented as sticks model and labeled. (For interpretation of the references to color in this figure legend, the reader
is referred to the web version of this article.)
 R. Wang et al. / Toxicon 83 (2014) 22–34 31

the pocket and hydrophilic residues around the entrant of 3.11. Binding activity of the mutated scFvs
the pocket. The amino acids surrounding TTX were:
TYR105 and ASP106 residues of the HCDR3 region, HIS168 To investigate the binding activity of the mutated scFv-
residue in the LCDR1, and LEU180, LYS183, ILE189 and T53 antibodies to TTX, ELISA was performed. As shown in
SER190 in the LFR2 region. There were four H bonds be- Fig. 6B, the wild-type scFv-T53 derived from pACYC-Duet-
tween the TTX and scFv-T53, in which two are between the scFv-skp showed the highest binding activity, while the
two nitrogen atoms of the LYS183 side chain and oxygen binding activity of the two mutated scFv-T53 has decreased
atoms of the TTX, the other two are formed by backbone greatly, showing a very low binding activity to TTX antigen.
SER190 N atom, ASP106 O atom and the TTX. To further identify the interaction between mutated scFv-
T53 and TTX, the affinity of different forms of scFv to TTX
3.9. Prediction of critical residues for binding antigen were determined using ELISA. As shown in Fig. 6C,
the TTX antigen could be recognized by the wild-type scFv-
We performed 4 ns MD simulation on the TTX/scFv-T53 T53, and the binding activity was dose dependent.
complex model. The RMSD values of the TTX atoms Compared to the wild-type scFv-T53, the two mutants,
regarding to its lowest energy conformation during the K183A and I189A nearly not reacted with TTX antigen, and
simulation was less than 1.0 
A which indicated the binding both showed the very low affinity to TTX antigen. The above
conformation was in its local energy minimum. The Auto- result demonstrated that the amino acids 183K and 189I of
dock’s scoring function was not as sophisticated as Amber’s scFv were critical for the interaction between scFv-T53 and
force field, and the small variation of the RMS greatly TTX antigen.
increased the reliability of the docking result when the
force field changed to Amber’s. The 4 ns trajectory was used 4. Discussion
to calculate the binding free energies of the complex and
the contribution of each amino acids of the antibody to the The key of preparing an antibody that can cure or detect
total binding free energy. Table 1 listed the top 9 residues effectively against semi-antigen substances is the synthesis
which contributed most to the binding free energy. These 9 of the immunogen, which directly affects the specificity
residues provided 98.9 percent contribution to the free and sensitivity of antibody. TTX (the molecule weight is
binding energy from the antibody side. The top two amino only 319) is a typical hapten, and must be combined with a
acids on the list, LYS183 and ILE189, contributed 56% en- suitable carrier protein molecule to become a complete
ergy for the binding, therefore these two residues were antigen with immunogenicity (Li et al., 2012). In our report,
mutated to alanine to verify the correctness of our silicon two carrier proteins BSA and KLH were used. BSA has a lot
model. of advantages such as stable, high-lysine, more free amino,
and the coupling product is more stable and soluble at
different pH values and ion concentrations. KLH has more
3.10. Expression and purification of mutated scFv-T53 available lysine (the amount of lysine reaches to 6.9%) than
BSA in theory, so more toxin molecular would be connected
After protein expression, the expressed scFv-T53 prod- to carrier protein. According to our previous research
ucts were purified with Ni2þ affinity chromatography, and experience, TTX–KLH was chosen as immunogen, and TTX–
the purified products were analyzed with SDS–PAGE. As BSA as detection antigen.
shown in Fig. 6A, the scFv-T53 (Lane 2) and mutated scFv In our experiment, Mannich reaction was used to
proteins (Lane 4 and Lane 6) were highly expressed, and the crosslink the TTX molecular with protein carrier, and
target scFv proteins were well purified (Lane 3: scFv, Lane different methods were used to verify the conjugate. The
5: K183A and Lane 7: I189A). The above result demon- Mannich reaction is an organic reaction which consists of
strated that all the forms of scFv were expressed and pu- an amino alkylation of an acidic proton placed next to a
rified successfully, and could be used for further binding carbonyl functional group with formaldehyde and
activity assay and affinity determination. ammonia or any primary or secondary amine. The final
product is a b-amino-carbonyl compound also known as a
Table 1 Mannich base (Mannich and Krösche, 1912). The results of
The decomposition of binding free energy to residues. FT-IR absorption spectrum indicted the increased amount
of C–N bonds in the system. The change of carrier protein
Residue DTotal Dvan der DElectrostatic DSolvation
energy Waals before and after the crosslink was further certified by
TTX 8.62 10.961 38.134 40.475
electrophoresis method, and the result showed that various
LYS183 7.15 1.219 25.286 19.354 number of TTX molecules have connected to the carrier
ILE189 3.137 1.757 3.24 1.86 protein, which changed the charge of carrier protein mol-
TYR105 2.977 2.49 0.719 0.232 ecules. All these results indicated that the conjugation
SER190 2.25 0.948 4.124 2.822
method used in this chapter was feasible, and the TTX-
ASP106 1.551 1.592 5.399 5.441
LEU180 0.486 0.433 0.133 0.186 carrier protein conjugates were successfully obtained.
HIE168 0.378 0.27 0.366 0.258 The way of our immunization treatment of animals is
TYR184 0.213 0.591 0.195 0.574 small amount and many times. The reasons are that TTX is a
Sum of 26.549 19.67 77.135 70.256 potent neurotoxin with a strong lethal effect (Fozzard and
above
Sum of all 26.845 21.907 76.27 71.344
Lipkind, 2010), and its small molecular weight is not easy
to result in the immune response (Zhou et al., 2012). After
32 R. Wang et al. / Toxicon 83 (2014) 22–34

Fig. 6. The binding activity analysis of mutated scFv. A: SDS–PAGE analysis of the expressed and purified scFs. M: Molecular weight of marker proteins; Lanes 1:
negative control (pACYC-Duet); Lane 2, 4 and 6: the expressed products of pACYC-Duet-scFv-skp, pACYC-Duet-mscFv(K183A)-skp and pACYC-Duet-mscFv (I189A)-
skp, respectively. Lane 3, 5 and 7: the purified products of pACYC-Duet-scFv-skp, pACYC-Duet-mscFv(K183A)-skp and pACYC-Duet-mscFv(I189A)-skp, respectively.
B: ELISA assay. TTX antigen was coated on 96-well plates in triplicate (2.5 mg/mL, 100 mL/well), and the different forms (wild-type and mutated) of scFv proteins
were added to the reaction wells after blocking and washing. The binding activities of the wild-type and mutated scFvs were determined using an anti-6
His tag
antibody. C: Affinity assay. Affinity of three different type’s antibodies to TTX was determined by indirectly ELISA.

7th immunization, the titer of anti-serum of mice was
enough high to do the next experiment. The repertoires of
VH and VL genes were amplified and joined together by PCR
and then inserted into a phage plasmid pCANTAB-5E vector
(Hoogenboom et al., 1998), and a larger antibody library
(1.5
106 PFU/mL) was obtained. The size of library de-
pends mainly on the transformation efficiency. The greater
the storage capacity, the more the diversity, the greater the
likely hood of getting high affinity clones. The anti-TTX scFv
was expressed on the phage surface, fused with the pIII
protein of the phage, which would help the scFv molecules
to react against the antigen (TTX–BSA) in the process of
biopanning (Wang et al., 2012).
During the biopanning process, TTX-BSA was used as
the detection antigen which is different from the immu-
nogen (TTX–KLH), and this would improve the specificity of
the screened clones and avoid the emergence of false-
positive. We found the input and elusion is almost flat
from the 3rd round, which showed that these non-specific
binding phage antibodies had all been eluted out and the
next rounds were the selective enrichment of the specific
scFv (Wang et al., 2006). After six round screening and
enrichment, most of the positive clones were obtained,
among that three clones exhibited relatively high affinity,
and one clone (scFv-T53) with the highest affinity was
selected to do the further study. Both the results of indi-
rectly ELISA and competitive ELISA indicated that this re-
combinant phage displaying scFv not only identified the
detection antigen but also the small-molecular TTX, and
showed a very high specificity to TTX.
The site specific mutation experimental data agreed
well with the theoretical model we build. It is interesting
that the orientation of TTX in the binding site on the scFv-
T53 is the same as that on the sodium ion channel. The
positive charged amino is placed at the brink of the pocket
near the partial negative charged Tyr105 side chain. It is the
other portion of TTX opposite to the positive amino group
provides most of the binding energy occupying the binding
pocket of scFv-T53. The theoretical model of the binding
complex laid the foundation for future work to improve the
binding specificity and affinity of current antibody by
artificial design (Chen et al., 2013).
In conclusion, we had successfully selected a scFv-T53
against TTX antigen through phage display technology.
 R. Wang et al. / Toxicon 83 (2014) 22–34
The amino acids that contribute the most binding activity
of scFv-T53 were predicted by computer model, and
confirmed by site-specific mutagenesis. Various results
have shown that scFv-T53 had a high specificity and af-
finity. This laid the foundation for the detection of TTX by
scFv and the development of specific drug for TTX
poisoning. In order to achieve high sensitivity detection of
TTX, scFv antibodies with even higher affinity need to be
created and the detailed mechanism of interaction needs to
be investigated further.
Acknowledgments
This work was supported by the National Natural Sci-
ence Foundation of China (31000335 and 21273038), Na-
tional Agricultural Achievements Transformation Fund
(2011GB2C400012), State Key Laboratory of Freshwater
Ecology and Biotechnology (2009FB13), Fuzhou City Sci-
ence and Technology Bureau (2012G106), and Fujian
Province Science and Technology Bureau (2013N5006).
Conflict of interest statement
All authors declare that they have no conflict of interest
statement.
References
Arcangeli, C., Cantale, C., Galeffi, P., Rosato, V., 2008. Structure and dy-
namics of the anti-AMCV scFv(F8): effects of selected mutations on
the antigen combining site. J. Struct. Biol. 164, 119–133.
Bashford, D., Case, D.A., 2000. Generalized born models of macromolec-
ular solvation effects. Annu. Rev. Phys. Chem. 51, 129–152.
Beatty, J.D., Beatty, B.G., Vlahos, W.G., 1987. Measurement of monoclonal
antibody affinity by non-competitive enzyme immunoassay. J.
Immunol. Method 100, 173–179.
Berman, H.M., Battistuz, T., Bhat, T.N., 2002. The protein data bank. Biol.
Crystallogr. Acta Crystallogr. 58, 899–907.
Bowie, J.U., Luthy, R., Eisenberg, D., 1991. A method to identify protein
sequences that fold into a known three-dimensional structure. Sci-
ence 253, 164–170.
Case, D.A., Cheatham, T.R., Darden, T., Gohlke, H., Luo, R., Merz, K.M.,
Onufriev, A., Simmerling, C., Wang, B., Woods, R., 2005. The amber
biomolecular simulation programs. J. Comput. Chem. 26, 1668–1688.
Chen, C., Ke, J.Y., Edward Zhou, X., Yi, W., Brunzelle, J.S., Li, J., Yong, E.L.,
Xu, H.E., Melcher, K., 2013. Structural basis for molecular recognition
of folic acid by folate receptors. Nature. http://dx.doi.org/10.1038/
nature12327.
Chong, L.T., Duan, Y., Wang, L., Massova, I., Kollman, P.A., 1999. Molecular
dynamics and free-energy calculations applied to affinity maturation
in antibody 48G7. PNAS 96, 14330–14335.
Chothia, C., Lesk, A.M., 1987. Canonical structures for the hypervariable
regions of immunoglobulins. J. Mol. Biol. 196, 901–917.
Choudhary, G., Yotsu-Yamashita, M., Shang, L., Yasumoto, T.,
Dudley Jr., S.C., 2003. Interactions of the C-11 hydroxyl of tetrodotoxin
with the sodium channel outer vestibule. Biophys. J. 84, 287–294.
Chulanetra, M., Bangphoomi, K., Sookrung, N., Thanongsaksrikul, J.,
Srimanote, P., Sakolvarvaree, Y., Choowongkomon, K., Chaicumpa, W.,
2012. Human ScFv that block sodium ion channel activity of tetro-
dotoxin. Toxicon 59, 272–282.
Chulanetra, M., Sookrung, N., Srimanote, P., Indrawattana, N.,
Thanongsaksrikul, J., Sakolvaree, Y., Chongsa-nguan, M., Kurazono, H.,
Chaicumpa, W., 2011. Toxic marine puffer fish in Thailand seas and
tetrodotoxin they contained. Toxins. http://dx.doi.org/10.3390/
toxins3101249.
Coia, G., Hudson, P.J., Irving, R.A., 2001. Protein affinity maturation in vivo
using E. coli mutator cells. J. Immunol. Method 251, 187–193.
Dib-Hajj, S.D., Cummins, T.R., Black, J.A., Waxman, S.G., 2010. Sodium
channels in normal and pathological pain. Annu. Rev. Neurosci. 33,
325–347.
33
Duan, Y., Wu, C., Chowdhury, S., Lee, M.C., Xiong, G.M., Zhang, W., Yang, R.,
Cieplak, P., Luo, R., Lee, T.S., Caldwell, J., Wang, J.M., Kollman, P., 2003.
A point-charge force field for molecular mechanics simulations of
proteins based on condensed-phase quantum mechanical calcula-
tions. J. Comput. Chem. 24, 1999–2012.
Feng, J.Y., Guo, H., Li, S., Lu, T., 2013. A study of the mechanism of the
chaperone-like function of an scFv of human creatine kinase by
computer simulation. PLoS One 8, e62147.
Fozzard, H.A., Lipkind, G.M., 2010. The tetrodotoxin binding site is within
the outer vestibule of the sodium channel. Mar. Drugs 8, 219–234.
Frame, K.K., Hu, W.S., 1990. The loss of antibody productivity in contin-
uous culture of hybridoma cells. Biotechnol. Bioeng. 35, 469–476.
Frisch, M.J., Trucks, G.W., 2003. Gaussian 03, Revision B.04. Gaussian Inc,
Pittsburgh PA.
Geffeney, S., Ruben, C., 2006. The structural basis and functional conse-
quences of interactions between tetrodotoxin and voltage-gated so-
dium channels. Mar. Drugs 4, 143–156.
Goodsell, D.S., Morris, G.M., Olson, A.J., 1996. Automated docking of
flexible ligands: applications of Autodock. J. Mol. Recognit. 9, 1–5.
Goto, T., Takahashi, S., Kishi, Y., Hirata, Y., 1965. Tetrodotoxin. Tetrahedron
21, 2059–2088.
Hille, B., 2001. Ionic Channels of Excitable Membranes. Sinauer Associ-
ates; Macmillan, Sunderland, MA, USA.
Hoogenboom, H.R., de Bruin, A.P., Hufton, S.E., Hoet, R.M., Arends, J.W.,
Roovers, R.C., 1998. Antibody phage display technology and its ap-
plications. Immunotechnology 4, 1–20.
Hornak, V., Abel, R., Okur, A., Strockbine, B., Roitberg, A., Simmerling, C.,
2006. Comparison of multiple amber force fields and development of
improved protein backbone parameters. Prot. Struct. Funct. Bio-
inform. 65, 712–725.
Huey, R., Morris, G.M., Olson, A.J., Goodsell, D.S., 2007. A semiempirical
free energy force field with charge-based desolvation. J. Comput.
Chem. 28, 1145–1152.
Jang, J.H., Yotsu-Yamashita, M., 2007. 6,11-Dideoxytetrodotoxin from the
puffer fish, Fugu pardalis. Toxicon 50, 947–951.
John, B., Sali, A., 2003. Comparative protein structure modeling by itera-
tive alignment, model building and model assessment. Nucleic Acids
Res. 31, 3982–3992.
Kabat, E.A., Wu, T.T., Gottesman, K., Foeller, C., 1991. Sequences of Proteins
of Immunological Interest. Diane Publishing Company, Darby, PA,
USA.
Kao, C.Y., 1972. Pharmacology of tetrodotoxin and saxitoxin. Fed. Proc. 31,
1117–1123.
Kao, C.Y., 1986. Structure-activity relations of tetrodotoxin, saxitoxin, and
analogues. Ann. N. Y. Acad. Sci. 479, 52–67.
Kessler, N., Aymard, M., Bertrand, S., 1993. Stability of a murine hybridoma
is dependent on the clone line and culture media in vitro. Cell Dev.
Biol. 29, 203–207.
Lee, C.H., Ruben, P.C., 2008. Interaction between voltage-gated sodium
channels and the neurotoxin, tetrodotoxin. Channels 2, 407–412.
Li, Y.S., Zhou, Y., Lu, S.Y., Guo, D.J., Ren, H.L., Liu, Z.S., 2012. Development of
a one-step test strip for rapid screening of fumonisins B1, B2 and B3 in
maize. Food Control 24, 72–77.
Lipkind, G.M., Fozzard, H.A., 1994. A structural model of the tetrodotoxin
and saxitoxin binding site of the Naþ channel. Biophys. J. 66, 1–13.
Lipkind, G.M., Fozzard, H.A., 2000. KcsA Crystal structure as framework
for a molecular model of the Naþ channel pore. Biochemistry 39,
8161–8170.
Mannich, C., Krösche, W., 1912. Ueber ein Kondensationsprodukt aus
Formaldehyd, Ammoniak und Antipyrin. Arch. Pharm. 250, 647–
667.
Miyazawa, K., Noguchi, T., 2001. Distribution and origin of tetrodotoxin. J.
Toxicol. 20, 11–33.
Morea, V., Lesk, A.M., Tramontano, A., 2000. Antibody modeling: impli-
cations for engineering and design. Methods 20, 267–279.
Morris, G.M., Goodsell, D.S., Halliday, R.S., Huey, R., Hart, W.E., Belew, R.K.,
Olson, A.J., 1998. Automated docking using a lamarckian genetic al-
gorithm and an empirical binding free energy function. J. Comput.
Chem. 19, 1639–1662.
Nagashima, Y., Nagoi, T., Shiomi, K., 1993. Tetrodotoxin associated high
molecular weight substances from toxic pufferfish liver. Nippon Sui-
san Gakkaishi 59, 1177–1182.
Narahashi, T., 1972. Mechanism of action of tetrodotoxin and saxitoxin on
excitable membranes. Fed. Proc. 31, 1124–1132.
Narahasi, T., 2001. Pharmacology of tetrodotoxin. J. Toxicol. Toxin Rev. 20,
67–84.
Nieto, F.R., Cobos, E.J., Tejada, M.Á., Sánchez-Fernández, C., González-
Cano, R., Cendán, C.M., 2012. Tetrodotoxin (TTX) as a therapeutic
agent for pain. Mar. Drugs 10, 281–305.
34 R. Wang et al. / Toxicon 83 (2014) 22–34
Noguchi, T., Arakawa, O., 2008. Tetrodotoxin–distribution and accumu-
lation in aquatic organisms, and cases of human intoxication. Mar.
Drugs 6, 220–242.
Noguchi, T., Ebesu, J.S.M., 2001. Puffer poisoning: epidemiology and
treatment. J. Toxicol. 20, 1–10.
Poelarends, G.J., Serrano, H., Huddleston, J.P., Johnson Jr., W.H.,
Whitman, C.P., 2013. A mutational analysis of active site residues in
trans-3-chloroacrylic acid dehalogenase. FEBS Lett. 587, 2842–2850.
Sali, A., Blundell, T.L., 1993. Comparative protein modeling by satisfaction
of spatial restraints. J. Mol. Biol. 234, 779–815.
Sonoda, H., Kumada, Y., Katsuda, T., Yamaji, H., 2011. Effects of cytoplasmic
and periplasmic chaperones on secretory production of single-chain
Fv antibody in Escherichia coli. J. Biosci. Bioeng. 111, 465–470.
Srinvasan, J., Cheatham, T.E., Cieplak, P., Kollman, P.A., Case, D.A., 1998.
Continuum solvent studies of the stability of DNA, RNA, and
phosphoramidate-DNA helices. J. Am. Chem. Soc. 120, 9401–9509.
Tramontano, A., 2006. The role of molecular modelling in biomedical
research. FEBS Lett. 580, 2928–2934.
Tsuda, K., Ikuma, S., Kawamura, M., Tachikawa, R., Sakai, K., Tamura, C.,
Amakasu, O., 1964. Tetrodotoxin. VII. On the structures of tetrodo-
toxin and its derivatives. Chem. Pharm. Bull. 12, 1357–1374.
Wan, C.K., Tsui, S.H., Tong, H.K., 2007. A case series of puffer fish
poisoning. Hong Kong J. Emerg. Med. 14, 215–220.
Wang, J., Wolf, R.M., Caldwell, J.W., Lollman, P.A., Case, D.A., 2004.
Development and testing of general amber force field. J. Comput.
Chem. 25, 1157–1174.
Wang, R.Z., Fang, S., Wu, D.L., Lian, J.W., Fan, J., Wang, S.H., 2012. Screening
of a single-chain variable-fragment antibody that can neutralize
effectively the cytotoxicity of Vibrio parahaemolyticus TLH. Appl. En-
viron. Microbiol. 78, 4967–4975.
Wang, S.H., Zhang, J.B., Zhang, Z.P., Zhou, Y.F., Yang, R.F., 2006. Construc-
tion of single chain variable fragment (ScFv) and biscFv-alkaline
phosphatase fusion protein for detection of Bacillus anthracis. Anal.
Chem. 78, 997–1004.
Wang, Y., He, C.H., Zheng, H., Zhang, H.B., 2011. Characterization and
comparison of fumonisin B1 protein conjugates by six methods. Int. J.
Mol. Sci. 13, 84–96.
Woodward, R.B., 1964. The structure of tetrodotoxin. Pure Appl. Chem. 9,
49–74.
Yasumoto, T., Yotsu, M., Endo, A., Murata, M., Naoki, H., 1989. Interspecies
distribution and biogenetic origin of tetrodotoxin and its derivatives.
Pure Appl. Chem. 61, 505–508.
Yasumoto, T., Yotsu, M., Murata, M., 1988. New tetrodotoxin analogues
from the new Cynops ensicauda. J. Am. Chem. Soc. 110, 2344–2345.
Yasumoto, T., Yotsu-Yamashita, M., 1996. Chemical and etiological studies
on tetrodotoxin and its analogs. J. Toxicol. Toxin Rev. 15, 81–90.
Yokoo, A., 1950. Chemical studies on pufferfish toxin-separation of
spheroidine. Nippon Kagaku Zasshi 71, 590–592.
Yotsu-Yamashita, M., 2001. Chemistry of puffer fish toxin. J. Toxicol. 20,
51–66.
Zhou, Y., Li, C.Y., Li, S.Y., Ren, H.L., Lu, S.Y., Zhang, J.H., 2012. Monoclonal
antibody based inhibition ELISA as a new tool for the analysis of
melamine in milk and pet food samples. Food Chem. 135, 2681–2686.
Zielesny, A., 2005. Chemistry software package ChemOffice Ultra. J. Chem.
Inf. Model 45, 1474–1477.