Psychiatry Research 169 (2009) 124131

Contents lists available at ScienceDirect

Psychiatry Research
j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / p s yc h r e s

Comparative effectiveness of biomarkers and clinical indicators for predicting outcomes of SSRI treatment in Major Depressive Disorder: Results of the BRITE-MD study
Andrew F. Leuchter a,b,, Ian A. Cook a,b, Lauren B. Marangell c, William S. Gilmer d, Karl S. Burgoyne b,e, Robert H. Howland f, Madhukar H. Trivedi g, Sidney Zisook h, Rakesh Jain i, James T. McCracken b, Maurizio Fava j, Dan Iosifescu j, Scott Greenwald k
a

Laboratory of Brain, Behavior, and Pharmacology, Semel Institute for Neuroscience and Human Behavior at UCLA, Los Angeles, CA, United States Department of Psychiatry and Biobehavioral Sciences, David Geffen School of Medicine at UCLA, Los Angeles, CA, United States c Department of Psychiatry, Baylor College of Medicine, Houston, TX, United States d Department of Psychiatry, Northwestern University, Chicago, IL, United States e Department of Psychiatry, Harbor-UCLA Medical Center, Los Angeles, CA, United States f Western Psychiatric Institute and Clinic, University of Pittsburgh, Pittsburgh, PA, United States g Department of Psychiatry, University of Texas Southwestern Medical School, Dallas, TX, United States h Department of Psychiatry, UCSD, San Diego, CA, United States i Psychiatry, RD Clinical Research, Houston, TX, United States j Department of Psychiatry, Massachusetts General Hospital, Boston, MA, United States k Neuroscience, Aspect Medical Systems, Norwood, MA, United States
b

a r t i c l e

i n f o

a b s t r a c t
Patients with Major Depressive Disorder (MDD) may not respond to antidepressants for 8 weeks or longer. A biomarker that predicted treatment effectiveness after only 1 week could be clinically useful. We examined a frontal quantitative electroencephalographic (QEEG) biomarker, the Antidepressant Treatment Response (ATR) index, as a predictor of response to escitalopram, and compared ATR with other putative predictors. Three hundred seventy-ve subjects meeting DSM-IV criteria for MDD had a baseline QEEG study. After 1 week of treatment with escitalopram, 10 mg, a second QEEG was performed, and the ATR was calculated. Subjects then were randomly assigned to continue with escitalopram,10 mg, or change to alternative treatments. Seventy-three evaluable subjects received escitalopram for a total of 49 days. Response and remission rates were 52.1% and 38.4%, respectively. The ATR predicted both response and remission with 74% accuracy. Neither serum drug levels nor 5HTTLPR and 5HT2a genetic polymorphisms were signicant predictors. Responders had larger decreases in Hamilton Depression Rating Scale (Ham-D17) scores at day 7 (P = 0.005), but remitters did not. Clinician prediction based upon global impression of improvement at day 7 did not predict outcome. Logistic regression showed that the ATR and early Ham-D17 changes were additive predictors of response, but the ATR was the only signicant predictor of remission. Future studies should replicate these results prior to clinical use. 2009 Elsevier Ireland Ltd. All rights reserved.

Article history: Received 15 January 2009 Received in revised form 1 June 2009 Accepted 11 June 2009 Keywords: Major depression Escitalopram Predictors of treatment response Genetic polymorphisms Quantitative electroencephalography Antidepressant Treatment Response (ATR) index

1. Introduction Major Depressive Disorder (MDD) is a leading cause of disability with total costs to society in excess of $80 billion annually; approximately two-thirds of these costs reect the enormous disability associated with MDD (Greenberg et al., 2003; Kessler et al., 2006, 2003, 1994). One reason for these high costs is the length

Corresponding author. Laboratory of Brain, Behavior, and Pharmacology, Semel Institute for Neuroscience and Human Behavior at UCLA, Department of Psychiatry and Biobehavioral Sciences, David Geffen School of Medicine at UCLA, 760 Westwood Plaza, Rm. 37-452, Los Angeles, CA 90024-1759, United States. Tel.: +1 310 825 0207; fax: +1 310 825 7642. E-mail address: a@ucla.edu (A.F. Leuchter). 0165-1781/$ see front matter 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.psychres.2009.06.004

of time it takes for patients to recover. Although controlled efcacy trials suggest that most patients respond to treatment within 8 weeks (Papakostas et al., 2007), the Sequenced Treatment Alternatives to Relieve Depression (STARD) trial found that fewer than 50% of patients responded to the rst trial of a serotonin selective reuptake inhibitor (SSRI) antidepressant (citalopram) and fewer than one-third achieved remission (Trivedi et al., 2006). Under standard care, the proportion of patients responding and remitting usually is even lower (Katon et al., 1996, 1999; Trivedi et al., 2004). Consequently, achieving response or remission with an initial medication remains a challenge for most patients with MDD and their physicians. At present, there is no reliable method for predicting whether a medication will lead to response or remission other than watchful waiting. Methods to predict which medication would most likely

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131

125

benet an individual patient could reduce patients' suffering. Such tools might include clinical features, biomarkers such as brain-imaging ndings, or genetic polymorphisms (Bearden and Freimer, 2006). Clinical characteristics have the advantage of being relatively easy to determine, but generally have not been useful for predicting response to particular medications. Symptom clusters such as anxiety or melancholia are associated with the overall likelihood of recovery but have not been shown to be reliable predictors of response to a specic medication for an individual patient (Fava et al., 2008; Rush, 2007; Small et al., 1995; Trivedi et al., 2006). Brain imaging also has been shown to have some promise for predicting response to treatment. Data suggest that pretreatment cerebral metabolism, white-matter lesions, or atrophy may be associated with outcome (Konarski et al., 2007), but the burden and cost of these procedures have limited their clinical adoption. Some genetic biomarkers, most notably genetic polymorphisms in the serotonin system, have been shown to inuence the outcome of SSRI treatment. Two common and promising candidate polymorphisms are those in the promoter region of the serotonin transporter (5HTTLPR) and in the 5HT2a postsynaptic receptor, which in some studies have been associated with treatment response (Anguelova et al., 2003; McMahon et al., 2006). One biomarker that has promise as a predictor of treatment response is quantitative electroencephalography (QEEG). QEEG power in the theta and alpha frequency bands (Knott et al., 1996; Ulrich et al., 1994, 1988) may identify patients who are most likely to respond to tricyclic antidepressants (TCAs) or SSRIs. Recent studies found that QEEG changes in the prefrontal region may reliably identify antidepressant medication responders within the rst week of treatment (Cook et al., 2002; Leuchter et al., 1999). These ndings are consistent with the fact that rhythmic midline prefrontal EEG activity has been shown to reect the activity of the anterior cingulate and midline prefrontal cortex (Asada et al., 1999), brain areas implicated in mood regulation and the pathogenesis of depression. Renement of this method might permit use of a limited electrode array in the prefrontal region (Iosifescu et al., 2006; Leuchter et al., 2005; Poland et al., 2006) that would be practical for routine clinical use. The Biomarkers for Rapid Identication of Treatment Effectiveness in Major Depression (BRITE-MD) study was designed to evaluate several possible biomarkers and clinical measures that might be useful to help direct antidepressant medication decisions. The protocol assessed the predictive value of a frontal QEEG parameter, the Antidepressant Treatment Response (ATR) index (Aspect Medical Systems; Norwood, MA), which incorporates several EEG features determined from previously collected EEG datasets to be associated with response and/ or remission during antidepressant treatment (Cook et al., 2002; Iosifescu et al., 2006; Leuchter et al., 2008). In this initial report from BRITE-MD, we tested the primary hypothesis that the ATR at 1 week after initiation of treatment with the SSRI escitalopram would predict response and remission after 7 weeks of treatment. We further tested the hypothesis that early changes in depressive symptom ratings, 5HTTLPR and 5HT2a genetic polymorphisms, and escitalopram serum levels, as well as investigator predictions based upon clinical impression, also would predict treatment response and remission.
2. Methods

Interview (MINI) (Sheehan et al., 1997), were enrolled in the study. All subjects had a Quick Inventory of Depressive Symptomatology-Self Rated version (QIDS-SR16) (Rush et al., 2003) score 12, were in good physical health (i.e., free of any medical condition sufciently serious to affect brain function), and had no history of seizures, brain surgery, skull fracture, signicant head trauma, or previous abnormal EEG. All subjects gave informed consent prior to assessment or any study procedures. Subjects were excluded from the study if they could not give informed consent, were pregnant or refused to use medically acceptable birth control during the study, met criteria for bipolar or psychotic disorder or substance dependence or abuse within the past 6 months, suffered from cognitive disorder, or met criteria for Axis II cluster A or B diagnosis sufciently severe to interfere with completion of the protocol. Subjects also were excluded if they had failed to benet from an adequate trial of treatment or failed to tolerate either of the study medications during the current episode, had a course of ECT within the past 6 months, had a contraindication for use of either of the study drugs, had been treated with uoxetine or a monoamine oxidase inhibitor (MAOI) within the past 4 weeks, were clinically stable on current antidepressant medication(s) or had started specic psychotherapy for depression (i.e., CBT, IPT) within the past 2 months. Subjects were tested and excluded for use of illicit substances or certain other central nervous system active medications within 1 week prior to enrollment, including antidepressants, anticonvulsants/mood stabilizers, anticholinergics, antipsychotics, migraine medications, Parkinsonism medications, barbiturates, benzodiazepines, herbal preparations, muscle relaxants, psychostimulants, and systemic corticosteroids. Medications acceptable for occasional use (not within 48 h of a QEEG) included non-sedating antihistamines, codeine- or oxycodone-containing compounds, over-the-counter cold remedies, cough suppressants, and non-prescription sleep aids. After complete description of the study to the subjects, written informed consent was obtained. 2.3. Treatment Study medications were administered in an open-label manner. Subjects received escitalopram, 10 mg daily, for 1 week, after which time they were randomized either to continue escitalopram, 10 mg (ESC; primary study arm), switch to bupropion XL, 300 mg (BUP), or combine escitalopram, 10 mg, with bupropion XL, 300 mg (COMB). For this initial report, we present only the results for the ESC group through the primary endpoint because this was the group that received continuous treatment with a single agent throughout the trial, and for which the clinical symptom changes in the rst week of treatment would be most interpretable. Treatment continued at this dosage through 7 weeks (day 49) (1 week of initial treatment with escitalopram plus 6 weeks after randomization), the primary study endpoint (Fig. 1). If reduction in dose was clinically indicated, the subject was removed from the study. If the subject achieved remission at the primary endpoint, the escitalopram was continued at the same dosage, but if the 17-item Hamilton Depression Rating Scale (Ham-D17) score remained N7, escitalopram could be increased to 20 mg qd no later than day 53 and dosage continued as tolerated through 91 days of treatment (total 13 weeks). At the end of week 13, the Ham-D17 and IDS scores were assessed. 2.4. Assessment All subjects underwent diagnostic assessment with the MINI. Subjects over 60 also were assessed with the Mini Mental State Examination (MMSE) (Folstein et al., 1975) and those with an MMSE 24 were evaluated by a study physician using a DSM-IV checklist for dementia. Eligibility for the study also was determined using the QIDS-SR16 as described above. The primary efcacy measure was the Ham-D17 (Hamilton, 1960) assessed at 7 weeks (day 49). Response was dened as a decrease in the Ham-D17 50% from the baseline value and remission as a Ham-D17 7. Severity of depression at baseline also was assessed using the Inventory of Depressive Symptomatology-Clinician-rated (IDSC30) (Rush et al., 1996) and the Ham-D17 to measure core diagnostic and commonly associated symptoms of depression. The IDS-C and Ham-D17 were administered using a combined structured interview guide (www.ids-qids.org). Severity of illness also was assessed using the Clinical Global Impression Scale (CGI) (Guy, 1976), and at day 7 a study physician used a modied CGI to make a clinical prediction of the likely degree of benet that each subject would obtain from 6 weeks of escitalopram treatment: 0 = no signicant predicted benet, 1 = predicted improvement but not response, 2 = predicted response but not remission, and 3 = predicted remission. 2.5. EEG biomarker methods

2.1. Overview The BRITE-MD study (ClinicalTrials.gov NCT00289523) was conducted at nine sites (departments of psychiatry at Baylor College of Medicine, Harbor-UCLA Medical Center, Massachusetts General Hospital, Northwestern University, UCLA Westwood, UCSD, University of Pittsburgh, and University of Texas Southwestern, as well as RD Clinical Research, a freestanding research facility). Institutional Review Boards approved the methods of the study. 2.2. Subjects Three hundred seventy-ve subjects, 1875 years of age, who met the DSM-IV criteria for Major Depressive Disorder, based on the Mini International Neuropsychiatric EEG data were collected using Aspect Medical Systems' NS-5000 system. This consisted of a PC-compatible laptop computer connected to a four-channel EEG acquisition device (BIS4) that performed digitization as well as signal ltering and conditioning, connected through a shielded cable to six self-prepping electrodes (Zipprep) (Aspect Medical Systems; Norwood, MA) applied at four recording sites on the forehead (Fpz, FT7, FT8, ground) and two on the earlobes (A1, A2) (Fig. 2). EEG data were recorded while the subject rested in a reclining chair during two 6-min eyesclosed segments, separated by a 2-min eyes-open segment. Following rejection of artifact, power spectra of the EEG (A1-Fpz, A2-Fpz) were calculated using 2-s epochs of an eyes-closed resting period. Values were calculated separately for each channel in each epoch and then averaged for the two channels. ATR is a non-linear weighted combination of three EEG features, measured at baseline and 1

126

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131

Fig. 1. Study ow chart. week after the start of treatment, that previously were identied as being associated with antidepressant outcome (Cook et al., 2002; Iosifescu et al., 2006; Poland et al., 2006). These three features are relative combined theta and alpha power (312 Hz), alpha1 absolute power (8.512 Hz), and alpha2 absolute power (911.5 Hz). Relative combined theta and alpha power (312 Hz) is calculated as the ratio of absolute combined theta and alpha power divided by total power (220 Hz). The ATR is a weighted combination of the relative theta and alpha power at week 1, and the difference between alpha1 power at baseline and alpha2 power at week 1, scaled to range from 0 (low probability) to 100 (high probability of response). The ATR was evaluated in the BRITE-MD through a split-half data analysis design specied a priori in the protocol. The initial weighted combination of the features in the ATR (version 4.0) was determined based upon previous datasets collected with multiple different recording systems and electrode placements. The BRITE protocol specied that an interim analysis would be performed at the study midpoint to assess the accuracy of the ATR 4.0 in predicting treatment response with the new electrode placements and recording system used in this study. Based upon the interim analysis, the combination was adjusted (version 4.1) to maximize accuracy on the rst half of the dataset. ATR 4.1 then was tested independently on the second half of the dataset without further modication, and subsequently on the entire dataset. The results reported here were calculated using ATR 4.1 on the entire dataset. Further details regarding the calculations of the ATR, including results of the split-half analyses, are reported separately in Appendix A. 2.6. Serum drug levels Escitalopram and desmethylescitalopram plasma levels were determined using high performance liquid chromatography. Assays were performed in a commercial laboratory (Pacic Toxicology Laboratories, Inc.; Chatsworth, CA) using samples drawn after 1 week of treatment with escitalopram. 2.7. Genotyping DNA was extracted from whole blood following Gentra DNA collection procedures. The sequence of DNA at the HTR2A rs7997012 (G/A) single nucleotide polymorphism (SNP) was amplied using primer sequences TCTAATCTAACTTCTGCATACTCAGAACAG and CTCAGAGGATGTTCTCCTTGGAGGCACAGC designed from the sequence listed by the National Center of Biotechnology Information (NCBI) (rs7997012.22) (McMahon et al., 2006). The PCR assay was performed using Qiagen HotStarTaq solution kit (Qiagen USA; Valencia, CA) and a PCR program of 95 C for 15 min, 35 cycles of 95 C (30 s), 59 C (30 s), and 72 C (30 s), followed by 72 C (10 min). The product (383 bps) was digested by 10 U of PacI (New England Biolabs; Ipswich, MA) with corresponding buffer at 37 C for 3 h. The enzyme selectively digested the A allele, yielding two fragments of 104 and 179 bps. Gels including relevant molecular weight standards and controls of known genotype were scored by two readers. Genotypes were assessed for HardyWeinberg (HW) equilibrium with the goodness-of-t chi-square test using SAS PROC ALLELE. 5HTTLPR primer sequences (forward: 5-GGC GTT GCC GCT CTG AAT GC-3; reverse: 5-GAG GGA CTG AGC TGG ACA ACC AC-3) were used to generate a 484/528-bp fragment. PCR was performed in a mixture containing 10 buffer, Q solution, 200 mol/l of each dATP, dCTP, dTTP, and GTP,1 mol/l of each primer, 0.6 units of Qiagen HotStarTaq, 50 ng genomic DNA, and buffer. Amplication occurred using a MCJ Tetrad with 40 cycles of 30 s at 95C, 30 s at 61 C, and 1 min at 72 C, followed by 10 min at 72 C; 10 l of product was separated on 2% agarose gels using known marker ladders (Kim et al., 2002). Gels were scored by two readers. Alleles were determined to be in HW equilibrium.

Fig. 2. Sites of electrode placement.

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131 Table 1 Baseline characteristics. Metric Study arm ESC (n = 73) HAMD-17 Age (years) Height (in) Weight (lb) Heart rate (bpm) Systolic blood pressure (mm Hg) Diastolic blood pressure (mm Hg) Gender (% female) Race (%) White Hispanic/Latino Black/African American Asian Other 20.6 4.4 42.7 12.7 66.5 4.3 183.9 48.0 69.5 9.7 122.1 14.4 77.8 7.9 65.8 61.6 21.9 12.3 4.1 0.0 BUP (n = 73) 21.7 4.0 41.6 13.4 66.7 4.1 182.1 54.9 72.7 10.7 122.7 15.3 78.1 8.9 61.6 61.6 21.9 13.7 1.4 1.4 COMB (n = 74) 20.4 4.3 44.4 13.6 66.8 4.5 180.7 40.9 70.8 11.2 121.6 18.6 77.3 10.5 59.5 64.9 14.9 17.6 2.7 0.0 All subjects (n = 220) 20.9 4.3 42.9 13.2 66.7 4.3 182.2 48.1 71.0 10.6 122.1 16.1 77.7 9.1 62.3 62.7 19.5 14.5 2.7 0.5

127

of these subjects did not continue through the primary endpoint for reasons including changes in life circumstances and removal by the investigators for failure to follow the study protocol (i.e., refusal to take medication or complete rating scales). There was no difference in age, gender, or severity of baseline depression between those who completed treatment and those who discontinued prematurely. Of the 282 subjects who completed through the primary endpoint, 62 were excluded from the analysis for ingesting excluded medications (23 subjects), noncompliance (i.e., taking less than 70% of their medication) (4 subjects), not having EEG recordings at specied time points (6 subjects), and EEGs containing excessive electrocardiographic artifact (29 subjects). The ATR algorithm automatically detected and excluded subjects with this artifact in the EEG (~15% of subjects in this sample). The 220 evaluable subjects were divided relatively equally among the three treatment groups (73 ESC, 73 BUP, 74 COMB). The demographic, baseline symptom severity, and physiologic characteristics of the subjects did not differ signicantly among treatment groups, nor between the subjects who could (n = 313) and could not (n = 62) be evaluated (Table 1). 3.2. Outcome of ESC treatment The response and remission rates of the 73 ESC subjects who could be evaluated were 52.1% and 38.4%, respectively. Outcome groups did not differ in their initial Ham-D17 scores or demographic factors (Table 2). There was no signicant difference in response or remission rates as a function of clinical site (data not presented). 3.3. Association between potential clinical predictors and treatment outcome Responders at day 49 showed a larger mean percentage decrease in Ham-D17 scores at day 7 compared with non-responders (38 26% vs. 21 23%, P = 0.005). Subjects who remitted, however, did not show a signicantly greater mean percentage reduction in Ham-D17 scores than those subjects who did not remit (36 28 vs. 26 24, P = 0.12) (Table 2). Clinician prediction at day 7 of the likelihood of response (51%) or remission (59%) was not signicantly associated with outcome at the primary endpoint (P N 0.44). 3.4. Association between biomarkers and treatment outcome Responders and remitters had signicantly higher ATR values than those who did not (Table 2). ROC analysis (Crowell et al., 2006) yielded area under the curve = 0.77, P b 0.001 (Fig. 3). Based upon the ROC analysis, a threshold value (58.6) was selected to maximize accuracy in classication of responders and non-responders to treatment: values above this threshold were designated as a positive biomarker, and below designated as a negative biomarker. The ATR predicted response with 74% overall accuracy, 58% sensitivity, 91% specicity, 88% positive predictive accuracy, and 67% negative predictive accuracy. The ATR also predicted remission with 74%

2.8. Data analysis Statistical analyses were performed using SPSS (SPSS, Inc.; Chicago, IL). Mean ATR values were compared between outcome groups using Student's T-test. Receiver Operating Characteristic (ROC) analysis was used to model the sensitivity vs. (1 specicity) for the ATR as the discrimination threshold for predicting response to escitalopram was varied. A threshold was chosen on the ROC curve that optimized the overall accuracy of the ATR in predicting response versus non-response. The primary hypothesis of the study was that subjects with ATR values above the threshold (i.e., positive biomarker) would have a signicantly higher rate of clinical response and remission at the end of 7 weeks of ESC treatment than those with ATR values below the threshold (i.e., negative biomarker). This hypothesis was tested using a chi-square statistic with ATR biomarker category as the independent variable and response category as the dependent variable. A separate analysis was performed with remission category as the dependent variable. We also compared the predictive accuracy of the ATR with changes in Ham-D17 scores and clinician prediction of the likelihood of medication effectiveness at 1 week. Mean percentage change in Ham-D17 scores at 1 week were compared between outcome groups using Student's T-test. Accuracy of clinician prediction of outcome groups was evaluated using Fisher's Exact Test. In addition, we compared the predictive accuracy of the ATR with the predictive accuracy of serum drug levels at 1 week, and 5HTTLPR and 5HT2a polymorphisms. We hypothesized that the ATR would predict treatment response independently of both serum drug levels and genetic polymorphisms. Analyses of variance (ANOVAs) were performed to assess whether response rate was signicantly different among subjects with different polymorphisms and whether the ATR predicted response independently of polymorphisms. Mean serum drug concentrations were compared between outcome groups using Student's T-test. Candidate predictors were considered both separately and as components of a logistic regression model (backwards conditional selection; Pin = 0.05, Pout = 0.10) that examined the relative contributions that each variable added to accuracy of prediction. P b 0.05 was considered statistically signicant for all statistical tests.

3. Results 3.1. Subject characteristics A total of 375 subjects consented to participate in the study, and 331 met the criteria to participate and entered treatment. Forty-nine
Table 2 Clinical and biomarker characteristics of ESC subjects by outcome group. Mean age M:F ratio 25:48 17:21 8:27 13:15 12:33 Mean initial Ham-D 20.6 4.4 20.7 4.6 20.4 4.2 19.4 3.9 21.3 4.62 Mean nal Ham-D 10.4 6.2 5.8 3.8 15.4 4.2 3.9 1.9 14.5 4.2 Mean Ham-D at day 7 14.4 6.0 12.6 5.4 16.3 6.1 12.2 5.2 15.7 6.1

% Change in Ham-D from baseline to day 7 29.7 25.9 37.9 25.9a 20.9 23.2 35.7 27.8 26.0 24.3

Mean serum drug level 18.4 8.1 17.6 7.8 19.5 8.6 18.0 8.5 18.7 7.9

Mean ATR value 54.6 10.2 59.0 10.2b 49.8 7.8 59.2 10.7c 51.7 8.8

Ratio (%) of AA:AG:GG 5HT2a polymorphism 13:46:41 9:41:50 18:50:32 12:44:44 14:46:40

Ratio (%) of SS:SL:LL 5HTTPLPR polymorphism 23:38:39 31:31:37 15:44:41 27:38:35 21:37:42

All subjects (n = 73) Responder (n = 38) Non-responder (n = 35) Remitter (n = 28) Non-remitter (n = 45)
a b c

42.7 2.7 42.9 11.6 42.4 14.0 44.1 10.5 41.8 13.9

Responders different from non-responders, P = 0.005. Responders different from non-responders, P b 0.001. Remitters different from non-remitters, P = 0.002.

128

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131

Fig. 3. Receiver Operating Characteristic curve for ATR prediction of response to escitalopram treatment.

overall accuracy, 61% sensitivity, 82% specicity, 68% positive predictive accuracy, and 77% negative predictive accuracy. There was no signicant difference in plasma levels of escitalopram+ desmethylescitalopram between those who responded or remitted with escitalopram treatment and those who did not. ANOVA also showed that there was no signicant difference in the proportion of subjects showing different 5HTTLPR and 5HT2a polymorphisms among those who responded or remitted (Table 2). 3.5. Combined model of predictive accuracy of biomarkers and clinical features Predictive accuracy of change in Ham-D17 scores, clinician prediction, 5HTTLPR or 5HT2a polymorphisms, and ATR were compared using stepwise logistic regression. This analysis identied both ATR (P = 0.001) and change in Ham-D17 at 1 week (P = 0.034) as signicant predictors of response. Logistic regression identied only ATR ( P = 0.002) as a predictor of remission. Neither clinician prediction nor any genetic polymorphisms entered the model for predicting either response or remission. 4. Discussion These results are consistent with the hypothesis that change in frontal QEEG after 1 week of treatment with a representative SSRI (escitalopram) is a useful biomarker for predicting 8-week treatment outcome. High ATR values were signicantly associated with lower nal depression scores, and ATR had 74% overall accuracy in predicting response and remission with escitalopram treatment. The ATR was unique among the biomarkers examined here in that neither serum drug levels nor common genetic polymorphisms in the serotonergic system were signicantly associated with response to escitalopram. It is not surprising that serum drug levels were not associated with response because SSRI serum levels have not consistently been associated with response (Rasmussen and Brosen, 2000). While 5HTTLPR polymorphisms have been signicant predictors of response in several studies (Anguelova et al., 2003; Cusin et al., 2002; Peters et al., 2004), and 5HT2a polymorphisms were signicant predictors of response in the STARD sample (McMahon et al., 2006), there has been a lack of reproducibility in many pharmacogenetic studies, probably due both to the fact that large

samples may be necessary to detect differences and that contributions of individual genes may be small (Malhotra et al., 2004). Decreases in severity of depressive symptoms in the rst week of treatment also predicted response to escitalopram in this study, consistent with previous reports that early symptom changes do occur and augur well for longer-term improvement (Posternak and Zimmerman, 2007). However, the current results indicate that early symptom changes may not be sufcient to direct early antidepressant treatment decisions because they are not closely associated with eventual remission. The current results also indicate that structured rating scales may be needed to detect these changes because expert clinicians, using their global clinical impression, were unable to predict either response or remission beyond chance levels. Importantly, logistic regression indicated that early changes in symptoms were complementary to the ATR biomarker, and only the ATR biomarker was useful for predicting remission. The results of this study should be interpreted within the context of four primary limitations. First, subjects were treated with a xed dose of escitalopram, and those receiving other psychotropic medications within 1 week of the EEG, with active substance abuse, or severe physical illness or major psychiatric comorbidity were excluded. The ndings therefore may not be generalizable to less controlled treatment conditions or entirely naturalistic samples. Second, outcome data from some subjects could not be used because of excessive EEG artifact, and although these subjects could not be distinguished from the overall subject pool on the basis of demographics or symptoms, it is possible that exclusion of data from these subjects affected the results. Third, this study was not blinded to medication and did not include a placebo control group. Those subjects who responded or remitted during treatment therefore are likely to include some subjects who improved because of the treatment milieu as well as because of a pharmacologic response. ATR measurements therefore may be interpreted as representing changes in brain function during treatment that includes medication, but not necessarily entirely a medication effect. Fourth, our primary endpoint was symptom improvement at day 49 of treatment. We cannot draw denite conclusions about the relationship between ATR and longer-term treatment outcome. The ndings of this study are encouraging in several respects. First, they demonstrate that frontal QEEG monitoring using the ATR index predicts whether a representative SSRI (escitalopram) was likely to be effective. This could be of signicant benet to patients awaiting relief from depressive symptoms. Information about the likelihood that a medication would be helpful could be used as one factor in making decisions about whether to continue or switch medications. In addition, information indicating that a medication was likely to prove effective eventually might help encourage adherence during the critical rst weeks of treatment, when the risk of premature discontinuation is greatest. Second, the study demonstrates that a greatly simplied QEEG system can be used to collect clinically useful data. The small number of electrodes utilized all were located outside the hairline, so that recordings were not technically demanding and could be completed in 1015 min. Third, the results indicate that the ATR index provided data that were complementary to clinical information and, if utilized prospectively, might enhance accuracy in early clinical decision making. Further research is needed to replicate these ndings, and determine if the ATR can help direct decision making using antidepressant medications with other mechanisms of action. If the ndings of this study are replicated, frontal QEEG assessment could be considered for integration into clinical management of MDD.
Acknowledgments Aspect Medical Systems provided nancial support of this project. Aspect participated in the design and conduct of the study; collection, management, analysis, and interpretation of the data; and preparation and review of the manuscript. Final approval of the form and content of the manuscript rests with the authors. The authors gratefully acknowledge the clinicians and research coordinators at Baylor College of Medicine, Harbor-UCLA Medical Center, Massachusetts General Hospital, Northwestern University, RD Clinical Research, the Semel Institute for

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131 Neuroscience and Human Behavior at UCLA, UCSD, Western Psychiatric Institute and Clinics at the University of Pittsburgh, and University of Texas Southwestern Medical School for dedication to the completion of this project. We also are grateful to the Neuroscience Clinical Research Team at Aspect Medical Systems for their dedication to and support of this project. A list of other support for each investigator is provided on the last two pages of this article.

129

Appendix A The ATR was calculated from the power spectrum analysis of the EEGs performed at baseline and 1 week following the start of antidepressant treatment, following rejection of muscle, electrocardiographic, and drowsiness artifact. The power spectra (A1-Fpz, A2-Fpz) were calculated using consecutive 2-s epochs of an eyes-closed resting period, by averaging the values calculated separately for each epoch in each channel and then averaging values for the two channels. The ATR is a non-linear weighted combination of relative combined theta and alpha power (312 Hz), alpha1 absolute power (8.512 Hz), and alpha2 absolute power (911.5 Hz). These three EEG features previously were identied as being associated with antidepressant outcome (Cook et al., 2002; Iosifescu et al., 2006; Poland et al., 2006). Relative combined theta and alpha power (312 Hz) is calculated as the ratio of absolute combined theta and alpha power divided by total power (220 Hz). ATR values are calculated according to the formula: ATR = maxf0; min100; fAAPt1 ; b APt1 ; a + BRPt1 ; + + Cgg where ATR is the Antidepressant Treatment Response Index value; max{x, y} and min{x,y} represent the maximum or minimum value, respectively, of variables x and y; AP(t1,b) is the absolute power at week one in an alpha range of 9 - 11.5 Hz; AP(t0,a) is the absolute power at baseline in an alpha range of 8.512 Hz; RP(t1,+) is the relative power at week one in a combined alpha and theta band (i.e., (312 Hz)/(220 Hz)), and A, B, and C are numerical constants. ATR is bounded by values of 0 and 100. The initial weighted combination of the features in ATR (version 4.0) was determined based upon previous datasets that did not always utilize the same montage of recording electrodes. In addition, previous datasets were collected with multiple different recording systems. In order to standardize ATR on the current reduced electrode placements and recording system, the BRITE protocol specied a priori that an interim analysis would be performed at the study midpoint to assess ATR 4.0 accuracy in predicting treatment response. The interim analysis was performed using a split-half approach, with the results of the interim analysis used to adjust the combination of features used to calculate ATR 4.0. The analysis was performed on the rst 35 subjects enrolled in the BRITE-MD study who were randomized to escitalopram treatment. Based upon the interim analysis, the combination of EEG features was adjusted (version 4.1) to maximize accuracy on the rst half of the dataset. ATR 4.1 then was prospectively evaluated on the 38 subjects who completed escitalopram treatment following the interim analysis. The performance metrics of ATR 4.1 measured at 1 week to predict 7week response to escitalopram treatment are tabulated below on the interim, post-interim, and combined BRITE datasets. In addition, Receiver Operating Characteristic (ROC) curves from both halves of the dataset are provided. Subjects whose ATR was a threshold (58.6) were predicted to respond, while those below the threshold were predicted not to respond. ATR was a statistically signicant predictor of response to escitalopram in both halves of the dataset, and there was no signicant difference in the statistical performance metrics.
Specicity (%) 92 91 91

Fig. A1. Interim analysis.

Fig. A2. Post-interim analysis. To facilitate independent replication of the work reported here, Aspect intends to make available a limited number of investigational systems for academic researchers. Please contact Scott Greenwald, Ph.D., at sgreenwald@aspectms.com for further information.

Dataset BRITE interim analysis (n = 35) BRITE post-interim analysis (n = 38) All BRITE subjects (n = 73)

Sensitivity (%) 59 56 58

Positive predictive accuracy (%) 93 82 88

Negative predictive accuracy (%) 57 74 67

Classication accuracy (%) 71 76 74

Area under ROC curve (%) 85 69 77

130

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131 Papakostas, G.I., Thase, M.E., Fava, M., Nelson, J.C., Shelton, R.C., 2007. Are antidepressant drugs that combine serotonergic and noradrenergic mechanisms of action more effective than the selective serotonin reuptake inhibitors in treating major depressive disorder? A meta-analysis of studies of newer agents. Biological Psychiatry 62 (11), 12171227. Peters, E.J., Slager, S.L., McGrath, P.J., Knowles, J.A., Hamilton, S.P., 2004. Investigation of serotonin-related genes in antidepressant response. Molecular Psychiatry 9 (9), 879889. Poland, R., Greenwald, S.D., Smith, C.P., Kustak, C., Schulz, J., Rowe, S., Gertstik, L., 2006. Frontal EEG at 1 week predicts response to treatment with citalopram in MDD. Presented as poster at the Annual Meeting of the American Psychiatric Association. Toronto, Canada, May 20-25, 2006. Posternak, M.A., Zimmerman, M., 2007. Therapeutic effect of follow-up assessments on antidepressant and placebo response rates in antidepressant efcacy trials: metaanalysis. British Journal of Psychiatry 190, 287292. Rasmussen, B.B., Brosen, K., 2000. Is therapeutic drug monitoring a case for optimizing clinical outcome and avoiding interactions of the selective serotonin reuptake inhibitors? Therapeutic Drug Monitoring 22 (2), 143154. Rush, A.J., 2007. The varied clinical presentations of major depressive disorder. Journal of Clinical Psychiatry 68 (Suppl 8), 410. Rush, A.J., Gullion, C.M., Basco, M.R., Jarrett, R.B., Trivedi, M.H., 1996. The Inventory of Depressive Symptomatology (IDS): psychometric properties. Psychological Medicine 26 (3), 477486. Rush, A.J., Trivedi, M.H., Ibrahim, H.M., Carmody, T.J., Arnow, B., Klein, D.N., Markowitz, J.C., Ninan, P.T., Kornstein, S., Manber, R., Thase, M.E., Kocsis, J.H., Keller, M.B., 2003. The 16Item Quick Inventory of Depressive Symptomatology (QIDS), clinician rating (QIDSC), and self-report (QIDS-SR): a psychometric evaluation in patients with chronic major depression. Biological Psychiatry 54 (5), 573583. Sheehan, D.V., Lecrubier, Y., Harnett-Sheehan, K., Janavs, J., Weiller, E., Bonara, L.I., Keskiner, A., Schinka, J., Knapp, E., Sheehan, M.F., Dunbar, G.C., 1997. Reliability and validity of the MINI International Neuropsychiatric Interview (M.I.N.I.): according to the SCID-P. European Psychiatry 12, 232241. Small, G.W., Hamilton, S.H., Bystritsky, A., Meyers, B.S., Nemeroff, C.B., 1995. Clinical response predictors in a double-blind, placebo-controlled trial of uoxetine for geriatric major depression. Fluoxetine Collaborative Study Group. International Psychogeriatrics 7, 4153 Suppl. Trivedi, M.H., Rush, A.J., Crismon, M.L., Kashner, T.M., Toprac, M.G., Carmody, T.J., Key, T., Biggs, M.M., Shores-Wilson, K., Witte, B., Suppes, T., Miller, A.L., Altshuler, K.Z., Shon, S.P., 2004. Clinical results for patients with major depressive disorder in the Texas Medication Algorithm Project. Archives of General Psychiatry 61 (7), 669680. Trivedi, M.H., Rush, A.J., Wisniewski, S.R., Nierenberg, A.A., Warden, D., Ritz, L., Norquist, G., Howland, R.H., Lebowitz, B., McGrath, P.J., Shores-Wilson, K., Biggs, M.M., Balasubramani, G.K., Fava, M., STARD Study Team, 2006. Evaluation of outcomes with citalopram for depression using measurement-based care in STARD: implications for clinical practice. American Journal of Psychiatry 163 (1), 2840. Ulrich, G., Haug, H.J., Fahndrich, E., 1994. Acute vs. chronic EEG effects in maprotilineand in clomipramine-treated depressive inpatients and the prediction of therapeutic outcome. Journal of Affective Disorders 32 (3), 213217. Ulrich, G., Haug, H.J., Stieglitz, R.D., Fahndrich, E., 1988. Are there distinct biochemical subtypes of depression? EEG characteristics of clinically dened on-drug responders and non-responders. Journal of Affective Disorders 15 (2), 181185. Andrew Leuchter, M.D., has provided scientic consultation or served on advisory boards for Aspect Medical Systems, Eli Lilly and Company, Novartis Pharmaceuticals, MEDACorp, AstraZeneca, Takeda Pharmaceuticals, and Merck & Co. He has served on a speaker's bureau for Eli Lilly and Company and Wyeth-Ayerst Pharmaceuticals. He has received research/grant support from the National Institute of Mental Health, the National Center for Complementary and Alternative Medicine, Aspect Medical Systems, Eli Lilly and Company, Novartis Pharmaceuticals, Wyeth-Ayerst Pharmaceuticals, Merck & Co., Pzer, Vivometrics, and MedAvante. He also is a minor stockholder in Aspect Medical Systems. Ian A. Cook, M.D., has served as an advisor and consultant for Ascend Media, BristolMeyers Squibb, Cyberonics Inc., and Janssen. He has served on the Speaker's Bureau for Bristol-Meyers Squibb, Medical Education Speakers Network, Pzer Pharmaceuticals Inc., and Wyeth Pharmaceuticals. Dr. Cook receives Research Support from Aspect Medical Systems, Cyberonics Inc., Eli Lilly & Company, Novartis Pharmaceuticals, Pzer, Inc., and Sepracor. Lauren Marangell, M.D., currently is an employee of Eli Lilly and Company, Indianapolis, IN. The work described in this manuscript was performed while she was on the faculty of the Baylor College of Medicine and does not necessarily reect the views of Eli Lilly and Company. She previously served as a consultant for, or received lecture honoraria from, Aspect Medical Systems, Cyberonics, Inc., Medtronics, GlaxoSmithKline, Pzer, Inc., Novartis Pharmaceuticals, and Forest Pharmaceuticals. Dr. Marangell had received research support from Bristol-Myers Squibb Company, Cyberonics, Inc., Neuronetics, National Institute of Mental Health, Stanley Foundation, NARSAD, American Foundation for Suicide Prevention, Aspect Medical Systems, and Sano-Aventis. William S. Gilmer, M.D., has served on the Speaker's Bureau for GlaxoSmithKline and Pzer. He has also received honoraria from GlaxoSmithKline and Pzer, Inc. Additionally, Dr. Gilmer receives Research Support from Abbott, Aspect Medical Systems, Forest Pharmaceuticals, Janssen, the National Institute of Mental Health, Neuronetics, Novartis Pharmaceuticals, and Pzer.

References
Anguelova, M., Benkelfat, C., Turecki, G., 2003. A systematic review of association studies investigating genes coding for serotonin receptors and the serotonin transporter: II. Suicidal behavior. Molecular Psychiatry 8 (7), 646653. Asada, H., Fukuda, Y., Tsunoda, S., Yamaguchi, M., Tonoike, M., 1999. Frontal midline theta rhythms reect alternative activation of prefrontal cortex and anterior cingulate cortex in humans. Neuroscience Letters 274, 2932. Bearden, C.E., Freimer, N.B., 2006. Endophenotypes for psychiatric disorders: ready for primetime? Trends in Genetics 22 (6), 306313. Cook, I.A., Leuchter, A.F., Morgan, M., Witte, E., Stubbeman, W.F., Abrams, M., Rosenberg, S., Uijtdehaage, S.H.J., 2002. Early changes in prefrontal activity characterize clinical responders to antidepressants. Neuropsychopharmacology 27 (1), 120131. Crowell, S.E., Beauchaine, T.P., Gatzke-Kopp, L., Sylvers, P., Mead, H., Chipman-Chacon, J., 2006. Autonomic correlates of attention-decit/hyperactivity disorder and oppositional deant disorder in preschool children. Journal of Abnormal Psychology 115 (1), 174178. Cusin, C., Serretti, A., Zanardi, R., Lattuada, E., Rossini, D., Lilli, R., Lorenzi, C., Smeraldi, E., 2002. Inuence of monoamine oxidase A and serotonin receptor 2A polymorphisms in SSRI antidepressant activity. Int J Neuropsychopharmacol 5 (1), 2735. Fava, M., Rush, A.J., Alpert, J.E., Balasubramani, G.K., Wisniewski, S.R., Carmin, C.N., Biggs, M.M., Zisook, S., Leuchter, A., Howland, R., Warden, D., Trivedi, M.H., 2008. Difference in treatment outcome in outpatients with anxious versus nonanxious depression: a STARD report. American Journal of Psychiatry 165 (3), 342351. Folstein, M.F., Folstein, S.E., McHugh, P.R., 1975. qMini-mental stateq. A practical method for grading the cognitive state of patients for the clinician. J Psychiatry Research 12 (3), 189198. Greenberg, P.E., Kessler, R.C., Birnbaum, H.G., Leong, S.A., Lowe, S.W., Berglund, P.A., CoreyLisle, P.K., 2003. The economic burden of depression in the United States: how did it change between 1990 and 2000? Journal of Clinical Psychiatry 64 (12), 14651475. Guy, W., 1976. ECDEU Assessment Manual for Psychopharmacology. U.S. Government Printing Ofce, U.S. Dept. of Health, Education and Welfare Publication No. 76-338. Superintendent of Documents, Government Printing Ofce, Washington, DC. Hamilton, M., 1960. A rating scale for depression. Journal of Neurology, Neurosurgery & Psychiatry 23, 5662. Iosifescu, D.V., Greenwald, S.D., Smith, C.P., Devlin, P., Alpert, J.E., Hamill, S., Fava, M., 2006. Frontal EEG at week 1 predicts clinical response to SSRI treatment in MDD. Presented as poster #231 at the Annual Meeting of the American Psychiatric Association. Toronto, Canada, May 20-25, 2006. Katon, W., Robinson, P., Von Korff, M., Lin, E., Bush, T., Ludman, E., Simon, G., Walker, E., 1996. A multifaceted intervention to improve treatment of depression in primary care. Archives of General Psychiatry 53 (10), 924932. Katon, W., Von Korff, M., Lin, E., Simon, G., Walker, E., Unutzer, J., Bush, T., Russo, J., Ludman, E., 1999. Stepped collaborative care for primary care patients with persistent symptoms of depression: a randomized trial. Archives of General Psychiatry 56 (12), 11091115. Kessler, R.C., Akiskal, H.S., Ames, M., Birnbaum, H., Greenberg, P., Hirschfeld, R.M., Jin, R., Merikangas, K.R., Simon, G.E., Wang, P.S., 2006. Prevalence and effects of mood disorders on work performance in a nationally representative sample of U.S. workers. American Journal of Psychiatry 163 (9), 15611568. Kessler, R.C., Berglund, P., Demler, O., Jin, R., Koretz, D., Merikangas, K.R., Rush, A.J., Walters, E.E., Wang, P.S., National Comorbity Survey Replication, 2003. The epidemiology of major depressive disorder: results from the National Comorbidity Survey Replication (NCS-R). Journal of the American Medical Association 289 (23), 30953105. Kessler, R.C., McGonagle, K.A., Zhao, S., Nelson, C.B., Hughes, M., Eshleman, S., Wittchen, H.U., Kendler, K.S., 1994. Lifetime and 12-month prevalence of DSM-III-R psychiatric disorders in the United States. Results from the National Comorbidity Survey. Archives of General Psychiatry 51 (1), 819. Kim, S.J., Cox, N., Courchesne, R., Lord, C., Corsello, C., Akshoomoff, N., Guter, S., Leventhal, B.L., Courchesne, E., Cook, E.H., Jr., 2002. Transmission disequilibrium mapping at the serotonin transporter gene (SLC6A4) region in autistic disorder. Molecular Psychiatry 7 (3), 278288. Knott, J., Telner, J.I., Lapierre, Y.D., Browne, M., Horn, E.R., 1996. Quantitative EEG in the prediction of antidepressant response to imipramine. Journal of Affective Disorders 39 (3), 175184. Konarski, J.Z., McIntyre, R.S., Soczynska, J.K., Kennedy, S.H., 2007. Neuroimaging approaches in mood disorders: technique and clinical implications. Annals of Clinical Psychiatry 19 (4), 265277. Leuchter, A.F., Kofol, T., Greenwald, S.D., Devlin, P., Cook, I.A., 2005. Source localization of anterior cingulate activity: comparison of 4 vs. 24 channel EEG techniques. Presented as poster at the Annual Meeting of the American Psychiatric Association. Atlanta, GA, USA, May 21-26, 2005. Leuchter, A.F., Marangell, L.B., Burgoyne, K.S., Sigl, J.C., Jain, R., Zisook, S., McCracken, J.T., Iosifescu, D.V., 2008. Biomarkers for Rapid Identication of Treatment Effectiveness (BRITE): testing symptoms and biomarkers as predictors of response and remission in MDD. Presented as poster at the Annual Meeting of the American Psychiatric Association. Washington, D.C., USA. May 3-8. Leuchter, A.F., Uijtdehaage, S.H., Cook, I.A., O'Hara, R., Mandelkern, M., 1999. Relationship between brain electrical activity and cortical perfusion in normal subjects. Psychiatry Research: Neuroimaging 90 (2), 125140. Malhotra, A.K., Murphy, G.M., Kennedy, J.L., 2004. Pharmacogenetics of psychotropic drug response. American Journal of Psychiatry 161 (5), 780796. McMahon, F.J., Buervenich, S., Charney, D., Lipsky, R., Rush, A.J., Wilson, A.F., Sorant, A.J., Papanicolaou, G.J., Laje, G., Fava, M., Trivedi, M.H., Wisniewski, S.R., Manji, H., 2006. Variation in the gene encoding the serotonin 2A receptor is associated with outcome of antidepressant treatment. American Journal of Human Genetics 78 (5), 804814.

A.F. Leuchter et al. / Psychiatry Research 169 (2009) 124131 Karl S. Burgoyne, M.D., has received Research Support from Aspect Medical Systems. Robert H. Howland, M.D., has received Research Support from Aspect Medical Systems, Bristol-Myers Squibb, Cederroth, Cyberonics Inc., Forest Pharmaceuticals, and Novartis Pharmaceuticals. Madhukar H. Trivedi, M.D., has served as an advisor and consultant for Abbott Laboratories, Akzo (Organon Pharmaceuticals), Bayer, Bristol-Myers Squibb Company, Cephalon, Cyberonics, Inc., Forest Pharmaceuticals, GlaxoSmithKline, Janssen Pharmaceutica Products, Johnson & Johnson PRD, Eli Lilly & Company, Meade Johnson, ParkeDavis Pharmaceuticals, Pzer, Inc., Pharmacia & Upjohn, Sepracor, Solvay Pharmaceuticals, Inc., and Wyeth-Ayerst Laboratories. He has served on the Speaker's Bureau for Akzo (Organon Pharmaceuticals), Bristol-Myers Squibb Company, Cephalon, Inc., Cyberonics, Inc., Forest Pharmaceuticals, Janssen Pharmaceutica Products, LP, Eli Lilly & Company, Pharmacia & Upjohn, Solvay Pharmaceuticals, Inc., and Wyeth-Ayerst Laboratories. He has received Research Support from Bristol-Myers Squibb Company, Cephalon, Inc., Corcept Therapeutics, Inc., Cyberonics, Inc., Eli Lilly & Company, Forest Pharmaceuticals, GlaxoSmithKline, Janssen Pharmaceutica, Merck, Novartis Pharmaceuticals, Pzer, Inc., Pharmacia & Upjohn, Predix Pharmaceuticals, Solvay Pharmaceuticals, and Wyeth-Ayerst Laboratories. Sidney Zisook, M.D., has served as an advisor and consultant for Glaxo-Smith Kline. He has served on the Speaker's Bureau for Glaxo-Smith Kline and Forest Laboratories. Additionally, Dr. Zisook has received Research Support from Aspect Medical Systems, PemLab, and Jed Foundation. Rakesh Jain, M.D., M.P.H., has served as an advisor and consultant for Addrenex Pharmeceuticals, Eli Lilly & Company, Forest Laboratories, Pzer, Impax Laboratories, Shire Pharmaceuticals, and Takeda Pharmaceuticals. He has served on Speaker's Bureaus for Eli Lilly & Company, Pzer, Inc., Shire Pharmaceuticals, and Takeda Pharmaceuticals. He has received Research Support from Abbott Laboratories, Aspect Medical Systems, Merck, Eli Lilly, GlaxoSmithKline, Shire Pharmaceuticals, Pzer, and Forest Pharmaceuticals.

131

James T. McCracken, M.D., has served as an advisor and consultant for Abbott Laboratories, Bristol-Meyers Squibb, Eli Lilly & Company, Janssen, Novartis Pharmaceutical, and Wyeth. He has served on the Speaker's Bureau for Abbott Laboratories and Genentech, Inc. Dr. McCracken receives Research Support from Bristol-Meyers Squibb, Eli Lilly & Company, and Shire. Maurizio Fava, M.D., has served as an advisor and consultant for Aspect Medical Systems, Astra-Zeneca, Bayer AG, Biovail Pharmaceuticals, BrainCells, Inc. BristolMyers Squibb, Cephalon, Compellis, Cypress Pharmaceuticals, Dov Pharmaceuticals, Eli Lilly, EPIX Pharmaceuticals, Fabre-Kramer Pharmaceuticals, Forest Pharmaceuticals, GlaxoSmithKline, Grunenthal GmBH, Janssen Pharmaceutica, Jazz Pharmaceuticals, J & J Pharmaceuticals, Knoll Pharmaceuticals, Lundbeck, MedAvante, Neuronetics, Novartis Pharmaceuticals, Nutrition 21, Organon, PamLab LLC, Pzer, PharmaStar, Pharmavite, Roche, Sano/Synthelabo, Sepracor, Solvay Pharmaceuticals, Somaxon, Somerset Pharmaceuticals, and Wyeth-Ayerst Laboratories. He has served on Speaker's Bureaus for Astra-Zeneca, Boehringer-Ingelheim, Bristol-Myers Squibb, Cephalon, Eli Lilly & Company, Forest Pharmaceuticals, GlaxoSmithkline, Novartis Pharmaceuticals, Organon, Pzer, PharmaStar, and Wyeth-Ayerst Laboratories. He has received Research Support from Abbott Laboratories, Alkermes, Aspect Medical Systems, Astra-Zeneca, Bristol-Myers Squibb, Cephalon, Eli Lilly & Company, Forest Pharmaceuticals, GlaxoSmithKline, J & J Pharmaceuticals, Lichtwer Pharma GmbH, Lorex Pharmaceuticals, Novartis Pharmaceuticals, Organon, PamLab LLC, Pzer, Pharmavite, Roche, Sano/Synthelabo, Solvay Pharmaceuticals, and Wyeth-Ayerst Laboratories. Dan V. Iosifescu, M.D., has provided scientic consultation to Cephalon, Inc., Forest Laboratories, Gerson Lehrman Group, and Pzer Inc. He serves on the Speaker's Bureau for Cephalon Inc., Eli Lilly & Company, Forest Laboratories, and Pzer Inc. He has received research/grant support from Aspect Medical Systems, Forest Laboratories, and Janssen Pharmaceutica. Scott Greenwald, Ph.D., is an employee and a stockholder of Aspect Medical Systems, Inc.