Name _________________________ TA ________________________

MCDB 1A Midterm 1
October 23, 2012
Scantron Instructions:
1. Use a #2 pencil to complete the form.
2. Write your name and fill in the appropriate bubbles.
3. Write your perm. number in the ID number box and fill in the bubbles.
4. Fill in the entire rectangle of the answer you choose.
5. Write the color of you exam below the ID box
READ ALL QUESTIONS THOROUGHLY----IN ALL CASES, PICK THE BEST ANSWER
30 Questions - 3 or 4 Points Each - as noted
1 Test Color Question - 1 point
1. Consider the following transcription bubble. If the region of DNA that needs to be
transcribed is to the right of the RNA Polymerase, which strand will be the template? (4
points)
A. bottom strand
B. top strand
C. insufficient information to answer the question
2. Which level of protein structure frequently uses both weak forces and covalent bonds?
(3 points)
A. secondary
B. primary
C. quaternary
D. tertiary
3. How many levels of protein structure (i.e., primary, secondary, tertiary and
quaternary) can involve covalent bonds? (3 points)
A. 1
B. 2
C. 0
D. 4
E. 3
MCDB 1A MT 1 Blue (5) Version: 1 Page: 1
4. How many fatty acids are typically in a phospholipid found in cellular membranes? (3
points)
A. 1
B. 0
C. 3
D. 2
E. some other number
5. Which of the following is part of a typical eukaryotic gene? (3 points)
A. introns
B. exons
C. both exons and introns are found in genes
6. What is the maximum number of amino acids that are loaded on a single tRNA prior to
its arrival at a ribosome? (3 points)
A. a very large number, since proteins can be thousands of amino acids long
B. 2
C. 1
D. 0
7. Which of the following enzymes does not add nucleotides to the growing chain during
replication? (4 points)
A. DNA ligase
B. DNA polymerase III
C. RNA primase
D. DNA polymerase I
E. all of the above add nucleotides to the growing chain
8. Which of the following amino acids is least likely to be found on the surface of a protein
floating freely in the cytoplasm? (3 points)
A. Amino Acid a
B. Amino Acid b
C. Amino Acid c
D. Amino Acid d
E. Amino Acid e
MCDB 1A MT 1 Blue (5) Version: 1 Page: 2
9. Which polymer has the highest molecular weight, i.e., which is the largest? (3 points)
A. an average DNA molecule
B. an average mRNA
C. cellulose
D. lipids
10. Imagine that you are doing the Meselson-Stahl experiment using N14 and N15 to
examine the mechanism of DNA replication. You grow the bacteria for many
generations in N14, spin down the cells and resuspend them in N15 media. Assuming
that replication proceeds by a semi-conservative mechanism, what would you observe
in the CsCl gradient after two rounds of replication? (4 points)
A. tube a
B. tube b
C. tube c
D. tube d
E. none of the above
11. Why do Chargaffs rules (A=T and C=G) hold for DNA but not for RNA? (3 points)
A. RNA is single stranded and DNA is double stranded
B. RNA has U instead of T
C. RNA has ribose instead of deoxyribose
D. RNA is much smaller than DNA
E. Some other reason is responsible for this fact
12. The overall reaction for the metabolic breakdown of glucose is: (4 points)
C
6
H
12
O
6
+6 O
2
--> 6CO
2
+ 6H
2
O
In which stage is the water actually formed?
A. electron transport/oxidative phosphoryation
B. the TCA cycle
C. the pre-entry reaction (pyruvate to acetyl CoA)
D. Glycolysis
E. none is a correct answer because water forms in all stages of metabolism
MCDB 1A MT 1 Blue (5) Version: 1 Page: 3
13. Which of the following polymers have branched chains? MARK ALL THAT APPLY (3
points)
A. cellulose
B. glycogen
C. DNA
D. starch
E. proteins
14. If you had a mutation that caused a codon to change from UAA to UAC, what would
you expect to happen? (4 points)
A. the mutant protein would be the same size as usual, just different in its composition
and perhaps its function
B. the mutant protein that would get synthesized would be longer than the normal
protein
C. the mutant protein that would get synthesized would be shorter than the normal
protein
D. more information is necessary to answer this question
15. Which new strand will be the lagging strand, i.e. which will be assembled
discontinuously? (3 points)
A. strand 1
B. strand 2
C. both strands
D. neither strand
16. Which is true about enzymes? (3 points)
A. enzymes speed up reactions by affecting the thermodynamics of a reaction
B. enzymes speed up reactions by affecting the overall change in the free energy of a
reaction
C. enzymes speed up reactions by affecting the activation energy of a reaction
MCDB 1A MT 1 Blue (5) Version: 1 Page: 4
17. In the 1944 Avery transformation experiment utilizing DNase, RNase and protease,
which of the following observations was the most important in supporting the
conclusion that DNA is genetic material? (4 points)
A. treatment of the extract with protease prevented transformation of R to S cells
B. treatment of the extract with DNase prevented transformation of R to S cells
C. treatment of the extract with RNase prevented transformation of R to S cells
18. Which part of an amino acid is involved in the hydrogen bonds that lead to the
formation of beta sheets? (3 points)
A. the alpha carbon
B. the R group
C. the core unit
D. some other part
19. Imagine that you have an mRNA molecule that encodes a protein 489 amino acids long.
Now, imagine that some errors occur during transcription. Which of the following
errors is likely to have the most severe consequences for the ability of the resulting
protein to function? (3 points)
A. the error is the deletion of one nucleotide in the 98th codon
B. the error is the replacement of one nucleotide for another in the 42th codon (not
creating a stop codon)
C. the error is the addition of one nucleotide in the 468th codon
D. all of these are equally likely to have severe consequences
20. Which of the following is not a part of the backbone of DNA or RNA? (3 points)
A. sugar
B. phosphate
C. aromatic base
D. all are part of the backbone
21. When a protein denatures, what kinds of bonds are disrupted? (4 points)
A. covalent bonds
B. weak bonds/forces
C. protein denaturation does not involve breaking of bonds
D. both weak bonds/forces and covalent bonds
22. Consider the following mRNA.
5 CAGGUAAAUGCAGGGAAUGCUAAUAUAGUUACCCAG 3
What would be the identity of the 4th amino acid in the encoded protein? (3 points)
A. methionine
B. alanine
C. serine
D. leucine
E. some other amino acid
MCDB 1A MT 1 Blue (5) Version: 1 Page: 5
23. How many amino acids would be in the protein encoded by the RNA in the previous
question? (3 points)
A. 6
B. 3
C. 4
D. 5
E. some other number
24. Is this the correct chemistry for peptide bond formation? (3 points)
A. yes
B. no
25. Which of the following amino acids can engage in disulfide bonding? (3 points)
A. amino acid a
B. amino acid b
C. amino acid c
D. amino acid d
E. amino acid e
26. What is a gene composed of? (3 points)
A. cheese
B. DNA
C. RNA
D. protein
MCDB 1A MT 1 Blue (5) Version: 1 Page: 6
27. THE GENETIC CODE TABLE IS NOT USEFUL FOR THIS QUESTION. THESE ARE
MADE UP DATA.
Imagine you were doing the experiments with bacterial extracts and synthetic RNAs
that were trying to figure out the genetic code. You do the following experiments and
get the following results:
When your synthetic RNA is polyU, you get a long chain of phenylalanine (poly-
phenylalanine).
When your synthetic RNA is polyC, you get a long chain of tryptophan (poly-
tryptophan).
When your synthetic RNA is ACACACACACACACACACACAC.., you get both
poly-serine and poly-leucine
When your synthetic RNA is AGCAGCAGCAGCAGCAGCAGC, you get three
products. One is a repeating polymer of leucine-alanine-proline, another is a repeating
polymer of tyrosine-valine-isoleucine and the third one is a repeating polymer of
asparagine-cysteine-glycine.
Which of the following is a plausible conclusion (4 points)?
A. the genetic code is based on the number 4
B. the genetic code is based on the number 3
C. the genetic code is based on the number 2
D. the genetic code is based on the number 1
E. not enough information to make an educated guess
28. Imagine that you are a hungry cell and acquire a big supply of 1,3-biphosphoglycerate.
How many ATPs can you get from the complete oxidation of each molecule of 1,3-
biphosphoglycerate to CO
2
and water, including from the NADH and FADH
2
that are
generated along the way. (3 points)
A. 17
B. 26
C. 34
D. 13
E. some other number
29. In the Hershey-Chase experiment using radioactive S35 and P32, what did the S35
label? (4 points)
A. protein because S is present in a couple of amino acids
B. protein because S is present in all amino acids
C. DNA because S is present in pyrimidines
D. DNA because S is present in purines
E. none of the above is a correct answer
30. Imagine that you are working on the protein DNA Polymerase, which is synthesized
on ribosomes like all proteins and then gets transported to the nucleus because it has a
nuclear localization signal. What is a nuclear localization signal made of? (4 points)
A. a combination of two of the above answers
B. carbohydrates attached to the protein
C. fatty acids attached to the protein
D. amino acids within the DNA polymerase protein itself
MCDB 1A MT 1 Blue (5) Version: 1 Page: 7
End of Exam. Please return your test and scantron to your TA.
If you don't have a TA, give your exam and scantron to Dr. Bush near to the podium
on stage.
MCDB 1A MT 1 Blue (5) Version: 1 Page: 8


G
e
n
e
t
i
c

C
o
d
e