Вы находитесь на странице: 1из 7

BIOLOGA CELULAR: SOLEMNE I

1)Al colocar glbulos rojos en una solucin hier!nica:"


Ca!egor#a
a$ %abr& 'lujo ne!o (e agua hacia el in!erior celular
b$ No habr& )o*i)ien!o (e agua
c$ Ingresar& agua )e(ian!e inoci!osis
($Habr flujo neto de agua hacia el exterior celular
2)Una sus!ancia e+ue,a - no olar a!ra*iesa las )e)branas
biolgicas or:
" Ca!egor#a
a$Difusin simple.
b$ .i'usin 'acili!a(a or canales
c$ /ransor!e ac!i*o or bo)bas
($ .i'usin 'acili!a(a or carriers0
3)1u2 sus!ancia ue(e cu)lir3 en las c2lulas3 las 'unciones (e
en4i)a3 )ol2culas !ransor!a(ora - rece!or (e se,ales5" Ca!egor#a
a$ Un oligosac&ri(os
b$Un glucol#i(o
c$Una protena.
($ Agua0
!)Una En4i)a acelera una reaccin )e!ablica or+ue:"
Ca!egor#a
a$ 6er)i!e +ue (icha reaccin ocurra eson!&nea)en!e
b$ Au)en!a la energ#a inicial (e la reaccin0
c$ .is)inu-e la energ#a 'inal (e la reaccin
($"aja la energa de acti#acin
.$)7Cu&l (e las siguien!es carac!er#s!icas correson(e a los
.es)oso)as5
Ca!egor#a
a$%n#olucran a los filamentos intermedios.
b$ In*olucran a )ol2culas (e ac!ina
c$ E+ui*alen a los 6las)o(es)os
($ 6er)i!e el asaje (e sus!ancias a !ra*2s (e sus oros0
&)las ro!einas se 'or)an a ar!ir (e: "
Ca!egor#a
a$ olisacari(os
b$aminoacidos
c$ nucleo!i(os
($ nucleosi(os
')la sacarosa se 'or)a or:
Ca!egor#a
a$ glucosa - glucosa
b$glucosa ( fructosa
c$ 'ruc!osa - 'ruc!osa
($ es un a4ucar no co)ues!o0
))un aci(o graso insa!ura(o es a+uel +ue:
Ca!egor#a
a$ solo !iene enlaces (obles en su ca(ena carbona(a
b$ solo !iene enlaces si)les en su ca(ena carbona(a
c$puede tener enlaces simples o dobles en su cadena carbonada
($ solo !iene un enlace (oble en su ca(ena carbona(a
*)Co)o se (is!ribu-en los aci(os grasos en una )icela en una
solucin acuosa
Ca!egor#a
a$dejando las cabe+as hacia afuera ( las colas hacia dentro
b$ (ejan(o las cabe4as hacia (en!ro - las colas hacia a'uera
c$ (ejan(o in(is!in!a)en!e las colas o cabe4as hacia (en!ro o hacia
a'uera
($ no 'or)a )icela0
1,)el nu)ero a!o)ico (e un ele)en!o correson(e a: "
Ca!egor#a
a$ al nu)ero (e neu!rones +ue es igual al nu)ero (e elec!rones
b$al numero de protones -ue es igual al numero de electrones
c$ al nu)ero (e neu!rones
($ al nu)ero (e neu!rones +ue es igual al nu)ero (e ro!ones
11)Un enlace en el +ue ca(a a!o)o aor!a un elec!rn +ue(an(o la
caa (e *alencia con (os elec!rones0 Es!e enlace correson(e a:
Ca!egor#a
a$ enlace e!#(ico
b$ enlace ionico
c$enlace co#alente
($ enlace or uen!es (e hi(rogeno
12)or +ue el hielo 'lo!a en una solucion acuosa:
Ca!egor#a
a$ or +ue el hielo es )as li*iano +ue el agua
b$ or +ue el hielo es )as (enso +ue el agua
c$ por -ue el hielo es menos denso -ue el agua.
($ or +ue el hielo es !an li*iano co)o el agua0
13)la en!osa +ue 'or)a el A.N es:
Ca!egor#a
a$ la desoxirribosa
b$ la ribosa
c$ la (eso8iglucosa
($ la he8osa
1!)las bases ni!rogena(as +ue 'or)an el gruo (e las iri)i(inas son:
Ca!egor#a
a$uracilo. timina ( citosina
b$ uracilo3 guanina - ci!osina
c$ guanina3 a(enina - !i)ina
($ !i)ina3 guanina - uracilo
1$)un nucleosi(o es!a 'or)a(o or:
Ca!egor#a
a$ base nitrogenada ( a+ucar
b$ base ni!rogena3 a4ucar - 'os'a!o
c$ 'os'a!o - a4ucar
($ base ni!rogena(a - 'os'a!o

1&)la abre*iacion (e una le!ra correson(ien!e a glu!a)ina es:
" Ca!egor#a
a$ L
b$ G
c$ /
($ N
1')la 'or)acin (e la es!ruc!ura an!iaralela (el A.N se osibili!a or
la resencia (e:
Ca!egor#a
a$ enlaces co*alen!es
b$ enlaces ionicos
c$ por puentes de hidrogeno
($ 'uer4as elec!ros!&!icas
1)) en cuan!o a la 'or)acion (e los uen!es (isul'uro3 es!os se
'or)an en!re resi(uos (e:
Ca!egor#a
a$ leucina
b$ cisteina
c$ alanina
($ isoleucina
1*) la insulina es:
Ca!egor#a
a$ una proteina
b$ un 'os'ol#i(os
c$ un aci(o graso
($ un rece!or
2,)algunas en4i)as re+uieren (e una coen4i)a ara !ener ac!i*i(a(
biologica0 7Al resec!o3 +ue es la coen4i)a5
Ca!egor#a
a$ una )olecula inorganica
b$ una molecula organica
c$ una ro!eina
($ una en4i)a
21)el sis!e)a (e )an!encin (e la concen!racin (e So(io - Calcio
in!ra - e8!racelular correson(e a:
Ca!egor#a
A$ un sistema de transporte denominado 0ntiporte
b$ un sis!e)a (e !ransor!e (eno)ina(o Si)or!e
c$ un sis!e)a (e !ransor!e (eno)ina(o coor!e
($ un sis!e)a (e !ransor!e (eno)ina(o (i'usion 'acili!a(a

22)el roceso (e 'agoci!osis correson(e a:
Ca!egor#a
a$ el ingreso de material solido al interior de la celula
b$ el ingreso (e )a!erial soluble al in!erior (e la celula
c$ la sali(a (e )a!erial soli(o (es(e la celula
($ la sali(a (e )a!erial soluble (es(e la celula
23) si cen!ri'uga un ho)ogeni4a(o celular a 9:0::: g3 7+ue esera
encon!rar en el recii!a(o5
Ca!egor#a
a$fraccion enri-uecida en mitocondrias
b$ 'raccion enri+ueci(a en n;cleos
c$ 'raccion )icroso)al
($ 'raccion enri+ueci(a en golgi - re!iculo
2!)El coles!erol resen!e en las )e)branas es:
Ca!egor#a:
a$ <un(a)en!al ara el reconoci)ien!o celular0
b$ I)or!an!e co)o reser*a (e energ#a
c$ Co)onen!e 'un(a)en!al (e los Ne8us
($ 0mortiguador de la fluide+ de las biomembrana
2$)la glicosilacin (e ro!einas ocurre en el Re!iculo en(olas)ico -
signi'ica la a(icion (e oligosacari(os sobre un resi(uo (e:
Ca!egor#a:
a$1
b$ .
c$ G
($ 1
2&) calne8ina - calre!iculina er)i!en el correc!o lega)ien!o ro!eico
or
Ca!egor#a
a$ guiar la formacion correcta de puentes disulfuro entre cisteina
b$ guiar la 'or)acion correc!a (e uen!es (e hi(rogeno
c$ guiar la 'or)acion correc!a (e uen!es (isul'uro en!re leucinas
($ or in!erac!uar con la se,al (e reconoci)ien!o =SR6
2')la union (e anclaje celula a celula +ue u!ili4a los 'ila)en!os (e
ac!ina correson(e a:
Ca!egor#a
a$ bandas de adhesin
b$ (es)oso)as
c$ GA6
($ he)i(es)oso)as
2))union en!re celula - celula en la +ue ar!ician los 'ila)en!os
in!er)e(ios3 correson(e a: "
Ca!egor#a
a$ desmosomas
b$ ban(as (e a(hesin
c$ he)i(es)oso)as
($ uniones (e oclusin
2*)cone8iones en!re celula - celula +ue se 'or)an or ca(erinas3
correson(e a: "
Ca!egor#a
A $ desmosoma
b$ he)i(es)oso)a
c$ ban(as (e a(hesin
($ las)o(es)os
3,) las uniones en hen(i(ura ar!ician (e:
Ca!egor#a
a$ la comunicacion entre los citoplasmas de dos celulas
ad(acentes
b$ la 'ijacion (e (os celulas a(-acen!es
c$ la 'ijacion (e las celulas con la )a!ri4 e8!racelular - )e)brana
basal
($ la co)unicacion (e las celulas con el esacio e8!racelular
31)In(i+ue la ocin +ue or(ene en 'or)a crecien!e los ni*eles (e
organi4acin en los siguien!es eje)los: "
Ca!egor#a
a$ 2arbono3aminocido3protena3#irus3bacteria3epitelio3pulmn.
b$ A)ino&ci(o"*irus carbono"ei!elio"ro!e#na"bac!eria"ul)n0
c$ 6ul)n"ei!elio"bac!eria"*irus"ro!e#na"a)ino&ci(o"carbono0
($ Bac!eria"ei!elio"carbono"ro!e#na"*irus"ul)n0
32)la oclu(ina 'or)a la siguien!e union en!re celulas a(-acen!es >
Ca!egor#a
a$tight junction
b$ GA6 junc!ion
c$ (es)oso)a
($ ban(a (e a(hesin
33)Se (ice +ue la )e)brana las)&!ica es un ?)osaico 'lui(o@
or+ue:"
Ca!egor#a:
a$ Se 'un(e
b$ 4s una estructura dinmica cu(os componentes se mue#en
libremente sobre ella.
c$ Las ro!e#nas eri'2ricas (e )e)brana se ue(en asociar o
(isociar (e ella libre)en!e
($ La )e)brana las)&!ica es er)eable
SOLEMNE II
32)la oclu(ina 'or)a la siguien!e union en!re celulas a(-acen!es >
Ca!egor#a
a$tight junction
b$ GA6 junc!ion
c$ (es)oso)a
($ ban(a (e a(hesin
2')la union (e anclaje celula a celula +ue u!ili4a los 'ila)en!os (e
ac!ina correson(e a:
Ca!egor#a
a$ bandas de adhesin
b$ (es)oso)as
c$ GA6
($ he)i(es)oso)as
2))union en!re celula - celula en la +ue ar!ician los 'ila)en!os
in!er)e(ios3 correson(e a: "
Ca!egor#a
a$ desmosomas
b$ ban(as (e a(hesin
c$ he)i(es)oso)as
($ uniones (e oclusin
2*)cone8iones en!re celula - celula +ue se 'or)an or ca(erinas3
correson(e a: "
Ca!egor#a
A $ desmosoma
b$ he)i(es)oso)a
c$ ban(as (e a(hesin
($ las)o(es)os
3,) las uniones en hen(i(ura ar!ician (e:
Ca!egor#a
a$ la comunicacion entre los citoplasmas de dos celulas
ad(acentes
b$ la 'ijacion (e (os celulas a(-acen!es
c$ la 'ijacion (e las celulas con la )a!ri4 e8!racelular - )e)brana
basal
($ la co)unicacion (e las celulas con el esacio e8!racelular
$)7Cu&l (e las siguien!es carac!er#s!icas correson(e a los
.es)oso)as5
Ca!egor#a
a$%n#olucran a los filamentos intermedios.
b$ In*olucran a )ol2culas (e ac!ina
c$ E+ui*alen a los 6las)o(es)os
($ 6er)i!e el asaje (e sus!ancias a !ra*2s (e sus oros0
1) El R/"6CR er)i!e a)li'icar:
a$510
b$ .NA
c$RNA - .NA
($ a)inoaci(os
e$ ninguno
2) la (e!eccin (e RNA )e(ian!e !ecnicas (e hibri(acin se (eno)ina:
a$1orthern
b$ Eas!ern
c$ Aes!ern
($ Sou!hern
e$ Ninguna
3) El 6CR en !ie)o real es una !ecnica rincial)en!e:
a$cuantitati#a
b$ cuali!a!i*a
c$ ineseci'ica
($+ue er)i!e )e(ir concen!raciones ro!eicas
e$ninguna
!) El anabolis)o correson(e a: "
a$conjunto de procesos destinados a la formacin de
macromoleculas con gasto de energia
b$conjun!o (e rocesos (es!ina(os a la 'or)acin (e )acro)oleculas
con generacin (e energia
c$conjun!o (e rocesos (es!ina(os a la (egra(acin (e
)acro)oleculas con gas!o (e energia
($conjun!o (e rocesos (es!ina(os a la (egra(acin (e
)acro)oleculas con generacin (e energia
e$conjun!o (e rocesos energe!ica)en!e 'a*orables
$) una reaccin con una energia libre =G )a-or +ue cero$
a$no ocurre espontaneamente
b$ ocurre eson!anea)en!e
c$ocurre solo si se acola a o!ra reaccion en(ergonica
($ ninguna
e$ocurre a *eces
&) una reaccin en(ergnica es a+uella +ue:
a$ consume energia
b$ genera energia
c$no consu)e ni genera energia
($ es eson!anea
e$ ninguna
') El ciclo (el &ci(o ci!rico ocurre en: "
a$la matri+ mitocondrial
b$ el ci!olas)a
c$ el nucleo
($ las cres!as )i!ocon(riales
e$en el esacio in!er)e)branoso )i!ocon(rial
)) la 'ase oscura (e la 'o!osin!esis ocurre en: "
a$el estroma
b$ las granas
c$ los !ilacoi(es
($ el ci!olas)a
e$el esacio in!er)e)branosos (el clorolas!o
*) la 'o!o'os'orilacin no ciclica in*olucra: "
a$a los fotosistemas % ( %%
b$solo al 'o!osis!e)a I
c$solo al 'o!osis!e)a II
($no in*olucra a 'o!osis!e)as
e$ ninguna
1,) la ciclina B ar!icia (e: "
a$la progresin de la fase 6
b$la rogresin (e la 'ase S
c$la rogresin (e G9
($la rogresin (e GB
e$ ninguna
11) La ro!eina Rb es ro(uc!o (e: "
a$un gen supresor de tumores
b$ un oncogen
c$ un ro"oncogen
($ una ciclina
e$ ninguna
12) La ao!osis es un roceso: "
a$0cti#o. tanto fisiologico como patologico
b$Ac!i*o - a!ologico
c$6asi*o - 'isiologico
($6asi*o3 !an!o 'isiologico co)o a!ologico
e$ (esor(ena(o
13) El correc!o or(en (e la e!aas +ue 'or)an un 6CR es: "
a$denaturacin del templado. hibridacin de los cebadores (
polimeri+acin
b$(ena!uracin (el !e)la(o3 oli)eri4acin - hibri(acin (e los
ceba(ores
c$hibri(acin (e los ceba(ores3 oli)eri4acin - (ena!uracin (el
!e)la(o
($oli)eri4acin3 (ena!uracin (el !e)la(o - hibri(acin (e los
ceba(ores
e$ ninguno
1!) Con resec!o a la )i!ocon(ria es incorrecto a'ir)ar +ue: "
a$es un organelo exclusi#o de celulas animales
b$osee su roio geno)a
c$es !an e+ue,o co)o una bac!eria
($es un organelo resen!e !an!o en celulas ani)ales co)o en celulas
*ege!ales
e$es!a 'uer!e)en!e asocia(o a los rocesos bioenerge!icos (e una
celula
1$) .el geno)a )i!ocon(rial es incorrecto a'ir)ar +ue: "
a$osee un si!io !e)rano (e 'in (e !ranscricion (esues (e la region
correson(ien!e al !RNA (e Leu0
b$Es un .NA circular (e (oble hebra
c$6osee (is!in!os origenes (e relicacin ara ca(a hebra
($6osee ro)o!ores in(een(ien!es +ue regulan la e8resin genica
(e a)bas hebras
e$ninguna
1&) la ca(ena !ransor!a(ora (e elec!rones se ubica en:
a$la )e)brana in!erna (e la )i!ocon(ria
b$en la )e)brana e8!erna (e la )i!ocon(ria
c$en el espacio intermembrana de la mitocondria
($en la )a!ri4 )i!ocon(rial
e$ ninguna
1') una )olecula (e glucosa +ue es rocesa(a )e(ian!e ciclo (e
Crebs3 generar&: "
a$& 10DH. 2 70DH ( 2 89:
b$B <A.%3 B NA.% - A/6
c$B NA.%3 B <A.% - B G/6
($ solo NA.%
e$ Solo A/6
1)) Cual es el or(en correc!o (e las siguien!es cua!ro e!aas (el
erio(o M =ciclo celular$
a$profase. prometafase. metafase ( anafase
b$ro'ase3 ana'ase3 ro)e!a'ase - )e!a'ase
c$ana'ase3 ro'ase3 ro)e!a'ase - )e!a'ase
($)e!a'ase3 ro)e!a'ase3 ana'ase - ro'ase
e$ro)e!a'ase3 )e!a'ase3 ana'ase - ro'ase
1*) En +ue e!aa (e M3 co)ien4an a )igrar los cro)oso)as hacia los
olos (e la celula: "
a$anafase
b$ !elo'ase
c$ )e!a'ase
($ ro)e!a'ase
e$ S
2,) Una en4i)a (e res!riccin es: "
a$una proteina capa+ de cortar Desoxinucleotidos
b$una ro!eina caa4 (e cor!ar Ribonucleo!i(os
c$una ro!eina caa4 (e cor!ar a o!ras ro!einas
($una ro!eina caa4 (e cor!ar !an!o RNA co)o .NA
e$ ninguna
21) La glicolisis ocurre en: "
a$el citoplasma
b$ la )i!ocon(ria
c$ el clorolas!o
($/an!o en la )i!ocon(ria co)o en el ci!olas)a
e$ ninguna
22) los rinciales si!ios (e con!rol (el ciclo celular es!an en: "
a$0ntes de ; ( en la entrada ( salida de 6
b$solo an!es (e S
c$(esues (e S
($(uran!e M - (uran!e S
e$en la en!ra(a - sali(a (e M
23) Las Ribonucleoro!einas ar!cician (e: "
a$el transporte de 510 fuera del nucleo
b$el !ransor!e (e RNA hacia en nucleo
c$el !ransor!e (e ro!einas 'uera (el nucleo
($el !ransor!e (e ro!einas hacia el nucleo
e$son chaeronas (e o!ras ro!einas
2!) Las ro!einas ejecu!oras (e la ao!osis3 (eno)ina(as casasas3
son: "
a$cisteinas3proteasas
b$ leucinas"ro!easas
c$ alaninas"ro!easas
($ glu!a)inas"ro!easas
e$ son ro!easas ineseci'icas
2$) Con resec!o a la )i!osis es correc!o a'ir)ar +ue: "
a$se generan dos celulas hijas identicas a la madre
b$se generan cua!ro celulas hijas i(en!icas a la )a(re
c$se generan (os celulas hijas (i'eren!es a la )a(re
($se generan cua!ro celulas hijas (i'eren!es a la )a(re
e$ ninguna
2&) la secuencia (el e!i(o se,al (e (es!inacion re!icular =RED
resen!a )uchos resi(uos (e: "
a$leu
b$ lis
c$ ala
($ ro
e$ ninguna
2') es correc!o a'ir)ar con resec!o al roceso (e glicosilacion
ro!eica3 +ue: "
a$se adicionan ( se remue#en residuos sacaridos
b$solo se a(icionan resi(uos sac&ri(os
c$solo se re)ue*en resi(uoa sac&ri(os
($se a(icionan - re)ue*en e!i(os
e$ ninguno
2)) es correc!o a'ir)ar +ue las *esiculas recubier!as con cla!rina: "
a$se forman en el trans 8olgi ( #an hacia los endosomas
b$se 'or)an en el !rans Golgi - *an hacia el RE
c$se 'or)an en el RE - *an hacia Golgi
($se 'or)an en el CIREG
e$ ninguna
;<=4614 %%%
1) La relicacion correson(e a un roceso
a$semi conser#ati#o
b$ conser*a!i*o
c$ seg)en!a(o
($ al a4ar
e$ !o(as
2) (uran!e la relicacin3 el ri)er (e RNA es
a$remo#ido por la D10 pol %
b$re)o*i(o or la ri)asa
c$no se u!ili4an ar!i(ores en la relicacion en eucarion!es
($es )an!eni(o - se hace ar!e (el .NA (e la hebra hija
e$ ninguna
3) con resec!o (e la relicacin es correc!o a'ir)ar +ue:
a$la hebra lider es copiada en el mismo sentido en el cual se
mue#e la or-uilla de replicacin
b$la hebra !ar(#a es coia(a en el )is)o sen!i(o en el cual se )ue*e
la or+uilla (e relicacin
c$la hebra li(er es coia(a en sen!i(o oues!o al cual se )ue*e la
or+uilla (e relicacin
($la hebra li(er - la !ar(#a son coia(as en el )is)o sen!i(o en el cual
se )ue*e la or+uilla (e
relicacin
e$ ninguna
!) con resec!o a la relicacion es correc!o a'ir)ar +ue:
a$la hebra lider se genera mediante un proceso continuo
b$la hebra li(er se genera )e(ian!e un roceso (iscon!inuo
c$la hebra !ar(ia se genera )e(ian!e un roceso con!inuo
($A)bas hebras se generan )e(ian!e un roceso (iscon!inuo
e$ ninguna
$) Es correc!o a'ir)ar +ue:
a$los eucariontes poseen multiples origenes de replicacin
b$los rocarion!es oseen )ul!iles origenes (e relicacin
c$los eucarion!es oseen un unico origen (e relicacin
($los eucarion!es - rocarion!es oseen )ul!iles origenes (e
relicacin
e$ ninguna
&) Es correc!o a'ir)ar +ue: "
a$los eucariontes poseen multiples origenes de replicacin
b$los rocarion!es oseen )ul!iles origenes (e relicacin
c$los eucarion!es oseen un unico origen (e relicacin
($los eucarion!es - rocarion!es oseen )ul!iles origenes (e
relicacin
e$ ninguna
') Es correc!o a'ir)ar +ue: "
a$el operador forma parte del promotor
b$el ro)o!or 'or)a ar!e (el oera(or
c$el oera(or 'or)a ar!e (el reresor
($el oera(or 'or)a ar!e (el ac!i*a(or
e$ ninguna
)) Es correc!o a'ir)ar +ue: "
a$los eucariontes poseen tres 510s :olimerasas >%. %% ( %%%)
b$los eucarion!es oseen una sola RNA 6oli)erasa =I$
c$los rocarion!es oseen !res RNAs 6oli)erasas =I3 II - III$
($los eucarion!es - los rocarion!es oseen !res RNAs 6oli)erasas =I3
II - III$
e$ ninguna
*) con resec!o a la !ra(uccin es correc!o a'ir)ar +ue:
a$la region denominada? codon se ubica en el 510 mensajero
b$la regin (eno)ina(a an!ico(on se ubica en el RNA )ensajero
c$la regin (eno)ina(a co(on se ubica en el RNA (e !rans'erencia
($la regin (eno)ina(a co(on se ubica en el riboso)a
e$ ninguna
1,) el enlace e!i(ico es a+uel +ue
a$se forma entre los aminoacidos -ue conforman una proteina
b$se 'or)a en!re las bases ni!rogena(as +ue con'or)an una ca(ena
nucleo!i(a
c$se 'or)a en!re los a)inoaci(os +ue con'or)an una nucleo!i(ica
($se 'or)a en!re los nucleo!i(os +ue con'or)an una ro!eina
e$ ninguna
11) una (e la rinciales (i'erencias en!re eucarion!es - rocarion!es
es:
a$-ue los eucariontes poseen mensajeros monocistronicos
b$+ue los rocarion!es oseen )ensajeros )onocis!ronicos
c$+ue los eucarion!es oseen )ensajeros olicis!ronicos
($no ha- (i'erencias en!re los )esajeros (e rocarion!es - eucarion!es
e$ ninguna
12) el co(on (e inicio correson(e a
a$0U8
b$ UGA
c$ AAG
($ AGA
e$ AUU
13) los co(ones (e !er)ino son: " Ca!egor#a:
a$U00. U08 ( U80
b$UAA3 AUG - UGA
c$AUG3 UAG - UGA
($UAA3 UAG - AUG
e$UAA3 UAG - AAA
1!) cual (e las siguien!es secuencias resen!a un )arco (e lec!ura
abier!o
a$08U80U822U082U022U220082UU00282
b$ AGUGAUGCCUAGCUACCUCCAAGCUAACGC
c$ AGUGAUGCCUAGCUACCUCCAAGCUAACGC
($ AGUGuUGCCUAGCUACCUCCAAGCUUAACGC
e$ ninguna
1$) el oeron Lac solo se ac!i*a cuan(o:
a$ha( lactosa ( no ha( glucosa
b$ha- lac!osa - ha- glucosa
c$no ha- lac!osa - ha- glucosa
($no ha- lac!osa - no ha- glucosa
e$ ninguna
1&) el i)rin!ing correson(e a:
a$el silenciamiento de uno de los dos alelos de un gen
b$la ac!i*a*ion (e uno (e los (os alelos (e un gen
c$el silencia)ien!o (e los (os alelos (e un gen
($la ac!i*acion (e los (os alelos (e un gen
e$ ninguna
1') la ace!ilacion (e la his!onas es!a asocia(a con: " Ca!egor#a:
a$la formacin de eucromatina ( la acti#acion de la expresin
genica
b$la 'or)acin (e he!erocro)a!ina - la ac!i*acion (e la e8resin
genica
c$la 'or)acin (e eucro)a!ina - la inac!i*acion (e la e8resin genica
($la 'or)acin (e he!erocro)a!ina - la inac!i*acion (e la e8resin
genica
e$ ninguna
1)) la eucro)a!ina correson(e a:
a$la region relajada de la cromatina -ue es transcripcionalmente
acti#a
b$la region relaja(a (e la cro)a!ina +ue es !ranscricional)en!e
inac!i*a
c$la region con(ensa(a (e la cro)a!ina +ue es !ranscricional)en!e
ac!i*a
($la region con(ensa(a (e la cro)a!ina +ue es !ranscricional)en!e
inac!i*a
e$ ninguna
1*) La ri)era (i*isn )eio!ica en la )ujer se co)le!a a ar!ir (e:
a$la pubertad
b$la e!aa 'e!al
c$co)ien4o (e la *i(a se8ual ac!i*a
($luego (e la 'ecun(acin
e$en la in'ancia
2,) la e!aa (e %ierac!i*acin (e los eser)ios ocurre:
a$un aumento en el 09: intracelular ( aumento en la mo#ilidad
del espermio
b$au)en!o en la )o*ili(a( (el eser)io
c$un au)en!o en el A/6 in!racelular - au)en!o (el acroso)a
($er(i(a (e la cola (el eser)io
e$au)en!o en la )o*ili(a( (el eser)io - au)en!o (el acroso)a
21) los nucleoso)as se 'or)an or in!eraccin (e las his!onas:
a$H!. H3. H2a ( H2b
b$%E3 %F3 %Ba3 %Bb - %9
c$%E3 %F3 %9a - %9b
($%93 %B3 %F - %E
e$ ninguna
22) El .NA enrrolla(o sobre un nucleoso)a correson(e a una
longi!u( (e:
a$1!& pares de bases
b$B:: ares (e bases
c$9:: ares (e bases
($BG: ares (e bases
e$ ninguna
23) la es!ruc!ura (eno)ina(a solenoi(e correson(e a una 'ibra (e:
a$3, nm
b$ 99 n)
c$ F:: n)
($ H:: n)
e$ 9E:: n)
B!) El !a)a,o (e un oro nuclear se (e aro8i)a(a)en!e:
b$ I n)
c$ B n)
($ 9: n)
e$ 99 n)
2$) la se,al (e locali4acin nuclear es rica en resi(uos (e:
a$@
b$ L
c$ A
($ G
e$ 1
2&) con resec!o a la his!ona %9 es 'also a'ir)ar +ue: " a$forma parte
del nucleosoma
b$'or)a ar!e (el solenoi(e
c$)an!iene la union (el .NA - el nucleoso)a
($ue(e ser ace!ila(a o 'os'orila(a ara generar relajacion o
con(ensacin (e la cro)a!ina
e$ ninguna
2') Las Ribonucleoro!einas ar!cician (e
a$el transporte de 510 fuera del nucleo
b$el !ransor!e (e RNA hacia en nucleo
c$el !ransor!e (e ro!einas 'uera (el nucleo
($el !ransor!e (e ro!einas hacia el nucleo
e$son chaeronas (e o!ras ro!einas
2)) El *ulo correson(e un:
a)o#ocito secundario
b$ o*oci!o ri)ario
c$ o*ogonia
($ o*oci!o 'ecun(a(o
e$ ninguna
2*) el acor!a)ien!o (e los !elo)eros es!a asocia(o a: " Ca!egor#a:
a$el proceso de en#ejecimiento celular por efecto de muchas
di#iones celulares
b$ in'ecciones *irales
c$ cancer
($)al 'unciona)ien!o (el riboso)a
e$ !o(as
3,) Con resec!o a la relicacin en rocarion!es es correc!o a'ir)ar
+ue: " Ca!egor#a:SeleccinJMul!ile
a$existen tres D10s polimerasas demoninadas %. %% ( %%%
b$e8is!e solo una .NA oli)erasa
c$e8is!en cinco .NAs oli)erasas (eno)ina(as a3b3c3 ( - e
($ ninguna
e$e8is!e una .NA oli)erasa 'or)a(a or las subuni(a(es a3 b3 bK - g
31) Con resec!o a la !ra(uccion es correc!o a'ir)ar +ue
a$el aminocido se une al extremo 3A del t510
b$el a)ino&ci(o se une al e8!re)o GK (el !RNA
c$el a)ino&ci(o se une a la regin (el an!ico(on (el !RNA
($ ninguna
e$el a)ino&ci(o se une al co(on (el !RNA
32) Con resec!o a la )eiosis es correc!o a'ir)ar +ue:
a$a partir de una celula se generan cuatro celulas hijas con
diferente material genetico (
haploide
b$a ar!ir (e una celula se generan cua!ro celulas hijas con (i'eren!e
)a!erial gene!ico - (iloi(e
c$a ar!ir (e una celula se generan cua!ro celulas hijas con i(en!ico
)a!erial gene!ico - haloi(e
($a ar!ir (e una celula se generan cua!ro celulas hijas con i(en!ico
)a!erial gene!ico - (iloi(e
e$ ninguno