Journal of Genetics and Genomics

(Formerly Acta Genetica Sinica)

April 2007, 34(4): 331-338


Received: 2006-06-30; Accepted: 2006-08-08
This work was supported by the Major Research Program on Technology of Agricultural Structure Adjustment (No. 05-01-05B) and
Jiangsu High Technology Program (No. BG2004301, BG2004304, and BG2005301).
Corresponding author. E-mail: clwang@jaas.ac.cn
www.jgenetgenomics.org
Research Article
Physiological Character and Gene Mapping in a New Green-
revertible Albino Mutant in Rice
Tao Chen
1,2
, Yadong Zhang
2
, Ling Zhao
2
, Zhen Zhu
2
, Jing Lin
2
, Suobing Zhang
1,2
, Cailin Wang
2,
1. College of Agriculture, Nanjing agricultural University, Nanjing 210095, China;
2. Institute of Food Crops, Jiangsu Academy of Agricultural Sciences, Jiangsu High Quality Rice R&D Center, Nanjing 210014, China
Abstract: A green-revertible albino mutant-Qiufeng M was found from the japonica rice (Oryza sativa L. ssp. japonica) Qiufeng in
the field. The first three leaves of the mutant were albino with some green. The leaf color became pale green since the fourth leaf
and the glume had the same phenomenon as the first three leaves. The measuring data of the pigment content confirmed the visually
observed results. It truly had a remarkable changing process in the leaf color in Qiufeng M. Comparison of the main agronomic
characters between Qiufeng and Qiufeng M indicated that the neck length and grain weight showed significant difference at the 1%
level, and other characters were not different. Genetic analysis showed that the green-revertible albino trait was controlled by a sin-
gle recessive nucleic gene. Using 209 recessive mutant individuals in the F
2
population derived from the cross Peiai 64S Qiufeng
M, a gene, tentatively named gra
(t)
, was located between the SSR markers of RM475 and RM2-22 on the long arm of chromosome
2. The genetic distance were 17.3 cM and 2.9 cM respectively.
Keywords: rice; green-revertible albino mutant; gene mapping; SSR marker


In plant chloroplasts, chlorophyll is an important
pigment in photosynthesis. Its significant change al-
ways results in the difference of leaf color, so chloro-
phyll-deficient mutation is also called leaf color mu-
tation. Many chlorophyll-deficient mutants have been
discovered in a large number of plants, such as
Arabidopsis thaliana, rice (Oryza sativa L.), maize
(Zea mays L.), barley (Hordeum vulgare L.), wheat
(Triticum aestivum L.), and rape (Brassica napus
L.)
[1-6]
.
A great deal of study has been made systemically
on chlorophyll-deficient mutants from the 1930s, es-
pecially in Arabidopsis thaliana and barley. The
mechanism of leaf color mutation is very complicated,
which is associated with chlorophyll biosynthesis and
degradation, chloroplast development, the common
synthesis pathway of tetrapyrrole in heme, siroheme,
and phytochromobilin, and signal transduction in
plant disease resistance
[7-13]
.
At least 70 leaf color mutants have been identi-
fied in rice and some of them have been mapped on
chromosomes or linkage groups
[14]
. Mutated genes
encoding some enzyme are mostly related to chloro-
phyll biosynthesis. Jung et al. (2003), have cloned the
OsCHLH gene on chromosome 3 that encodes chlo-
rophyll Mg-chelatase H subunits with T-DNA gene
trap
[15]
. Lee et al. (2005), have cloned a chlorophyl-
lide a oxygenase gene (CAO) that encodes the key

332 Journal of Genetics and Genomics Vol.34 No.4 2007
www.jgenetgenomics.org
enzyme for chlorophyll b formation with correspond-
ing gene in Arabidopsis. This gene had two copies
and was located in the same bacterial artificial chro-
mosome (BAC) of chromosome 10. They are com-
pletely different in expression pattern, although
OsCAO1 and OsCAO2 have high sequence similar-
ity
[16]
.
Green-revertible albino mutant is a new type of
leaf color mutant in rice. The leaf color is albino in
the seedling stage, but it has a green-revertible albino
process and thus guarantees the mutant to be able to
grow normally. Some green-revertible albino mutated
genes have been introduced into the thermo-photope-
riod-sensitive genic male-sterile lines (TPGMS) or
cytoplasmic male sterility (CMS) along with corre-
sponding maintainer lines, and have been applied in
hybrid rice production, such as Yutu S, Baifeng A,
Quanlong A and their maintainer lines Baifeng B, and
Quanlong B. Some highly heterotic combinations
have been obtained
[17-19]
.
Qiufeng M, a new green-revertible albino mutant
was studied in this study. The main agronomic traits,
pigment content, relationship of the green-revertible
albino mutation with temperature, and inheritance of
the mutant were investigated. The gene controlling
the mutation was mapped on a chromosome with mo-
lecular markers. The results from this study provide
some theoretical basis for the fine mapping, map-
based cloning of the mutated gene, and its utilization
in breeding of the mutant.
1 Materials and Methods
1. 1 Plant materials
Qiufeng M is a green-revertible albino sponta-
neous mutant derived from the japonica rice cultivar
Qiufeng. The F
1
hybrids and F
2
populations were ob-
tained from the reciprocal crosses between Qiufeng
and Qiufeng M, and from the cross between TPGMS
Peiai 64S and Qiufeng M.
1. 2 Observation of the process of green-reverti-
ble albino in the seedling stage and examin-
ation of the agronomic characters
The period of green-revertible albino and head-
ing data of parents were recorded. Five plants ran-
domly selected from Qiufeng and Qiufeng M were
examined for phenotypic traits at maturity, including
plant height, neck length, panicle length, number of
primary branches, secondary branches, spikelets per
panicle, seed setting rate, and 1,000-grain weight.
1. 3 Detection of pigment contents
Pigment contents of the five leaves at different
positions were measured. Extraction, mensuration,
and calculation were carried out following the method
described by Arnon
[20]
and Li et al
[21]
.
1. 4 Dated sowing and treatment with tempera-
ture in laboratory
Qiufeng and Qiufeng M were sown on different
dates (3/15, 5/15, and 7/15) in 2005. Temperature
treatment was performed in an illuminated incubator
at a temperature from 15 to 35 with an interval of
5 according to Shu et al
[22]
. The change of leaf
color was observed from the first leaf to the fourth
leaf.
1. 5 Genetic analysis of the green-revertible al-
bino trait in Qiufeng M
In November 2005, F
1
hybrids and F
2
popula-
tions derived from the reciprocal crosses between
Qiufeng and Qiufeng M, and from the cross between
TPGMS Peiai 64S and Qiufeng M were planted in
Sanya, Hainan Province. Segregation ratios of the leaf
color were examined in F
2
populations at the three to
four-leaf stage.
1. 6 Gene mapping of the target gene on chro-
mosome
1.6.1 DNA extraction and SSR analysis
The F
2
recessive mutant population from the
cross Peiai 64S Qiufeng M was used as the map-

Tao Chen et al.: Physiological Character and Gene Mapping in a New Green- revertible Albino Mutant in Rice 333
www.jgenetgenomics.org
ping population. Genomic DNA was isolated from the
leaves following a method as described by Dellaporta
et al
[23]
. Microsatellite primer sequences were adopted
from Temnykh et al.
[24]
and McCouch et al.
[25]
and
synthesized by Shanghai invitrogen company. A 10
L of PCR reaction mixture was composed of DNA
(10 ng/L) 1 L, 10 Buffer 1 L, MgCl
2
(25
mmol/L) 0.6 L, primers (4 pmol/L) 0.8 L, dNTP
(2.5 mmol/L) 0.2 L, Taq (5 U/L) 0.1 L, and
ddH
2
O 6.3 L. PCR reaction was performed as de-
scribed by Chen et al.
[26]
, and amplification products
were visualized in 8% polyacrylamide gels.
1.6.2 Development of new SSR markers
SSR sequences in BACs near the target gene
were searched using SSRHUNTER
[27]
, and primers
were designed with Primer Premier 5.0. Those SSR
markers that exhibited polymorphism between Peiai
64S and Qiufeng M were applied in F
2
mapping
population.
1.6.3 Data analysis and linkage mapping
MAPMAKER/EXP3.0b
[28]
was used to analyze
the molecular data. The band types being identical
with that of Peiai 64S, Qiufeng M, and F
1
were re-
corded as 1, 2, and 3 respectively. Linkage map was
constructed with MAPDRAW2.1
[29]
.
2 Results
2. 1 Expression of the green-revertible albino in
Qiufeng M
The expression of the green-revertible albino in
Qiufeng M was different from that of the other
green-revertible albino mutants reported. The trait of
Qiufeng M could be described as follows: the coleop-
tile was albino when sprouting. The first three leaves
were also albino in the edge with some green in the
midst or at the base. These leaves did not convert to
green until senescence. And the color of all the leaves
in the main stem and tillers had become pale green
compared to normal plants since the fourth leaf. Be-
cause the first three leaves were albino, the seedlings
became weak when planted. The color of the glume
was also virescent at the heading stages (Fig. 1).
2. 2 Effects of mutated gene on the agronomic
characters
The comparison of the major agronomic charac-
ters between Qiufeng and Qiufeng M showed that
there were no difference except for the neck length
and 1,000-grain weight (Table 1).
The plant height components (the percentage of
the internode length of its plant height) in Qiufeng
and Qiufeng M were also analyzed, because the neck
length of Qiufeng M was significantly shorter than
that of Qiufeng (data not shown). The result indicated
that the plant height components of Qiufeng M
showed no significant difference from those of
Qiufeng.
2. 3 Comparison of pigment content between
Qiufeng and Qiufeng M at different
growth stages
To further investigate the change of leaf color in

Fig. 1 Phenotype of Qiufeng and Qiufeng M in different stages (A and B) and color of glume (C)

334 Journal of Genetics and Genomics Vol.34 No.4 2007
www.jgenetgenomics.org
Table 1 Comparison of major agronomic traits between Qiufeng and Qiufeng M
Cultivar
Heading
date
(Month/day)
Plant
height
(cm)
Neck
length
(cm)
Panicles
Panicle
length(cm)
No. of
primary
branches
No. of
secondary
branches
Spikelets/
panicle
Seed set-
ting rate
(%)
1,000-grain
weight
(g)
Qiufeng 9/8 107.63 3.55 5.33 17.10 11.31 48.89 172.47 94.03 25.98
Qiufeng M 9/9 105.97 2.26 4.67 17.90 12.12 45.10 182.35 89.30 24.28
Difference 1 1.66 1.29
**
0.66 0.8 0.81 3.79 9.88 4.73 1.7
**

** represent significant difference at 1% levels.

Table 2 Comparison of pigment contents in rice leaves in different growth stages (mg/g)
3rd leaf 4th leaf Upper 3rd leaf Upper 2nd leaf Flag leaf
Types
Chla Chlb Carot Chla Chlb Carot Chla Chlb Carot Chla Chlb Carot

Chla Chlb Carot
Qiufeng 1.83 0.59 0.48 1.88 0.67 0.65 2.05 0.72 0.56 1.94 0.62 0.54 2.17 0.76 0.59
Qiufeng
M
0.57 0.14 0.16 0.89 0.50 0.55 0.93 0.44 0.46 1.23 0.44 0.41 1.46 0.51 0.47
Differ-
ence
1.26
**
0.45
**
0.32
**
0.99
**
0.17
**
0.10
**
1.12
**
0.28
**
0.10
**
0.71
**
0.18
**
0.13
**
0.71
**
0.25
**
0.12
**
** represent significant difference at 1% levels.

mutant, the pigment content between Qiufeng and
Qiufeng M was compared at different growth stages.
The results showed that the contents of chlorophyll a,
chlorophyll b, and carotenoid in the third leaf of
Qiufeng M were about one-third of those in Qiufeng,
which were the lowest in all the stages tested. How-
ever, the pigment contents increased rapidly since the
fourth leaf. The contents of chlorophyll a, chlorophyll
b, and carotenoid were 47.3%, 74.6%, and 84.6%
compared with those in Qiufeng, respectively. The
pigment contents of the last three leaves also had
similar proportions with the fourth leaf (Table 2).
Qiufeng M contained one-third pigment content
compared with that of Qiufeng, in spite of albino in
the third leaf. It was not only the important reason
that the seedlings of Qiufeng M kept on growing
normally when the nutrition of the seed was ex-
hausted, but also the trait to distinguish Qiufeng M
from other mutants. These results were consistent
with the change of the leaf color in Qiufeng M ob-
served in the field.
2. 4 Stability of green-revertible albino muta-
tion under the natural and artificial tem-
perature condition
The appearance of green-revertible albino had no
relation to temperature that only influenced the
growth of the seedlings. Because the first three leaves
could not carry on the photosynthesis normally, the
mutant grew slowly under low temperatures. With the
temperature rising, the fourth leaf grew quickly and
the time to resume normal growth was shortened, thus
it was advantageous to the mutant growth. This mu-
tated gene that was insensitive to the temperature
could be transferred into the male sterile line to en-
sure purity of hybrid rice seeds.
2. 5 Genetic analysis and molecular mapping
The F
1
plants of Qiufeng Qiufeng M, Qiufeng
M Qiufeng, and Peiai 64S Qiufeng M showed
normal green. The segregation ratios in the three F
2

populations were fitted to 3:1 (Table 3). These results
indicated that the green-revertible albino trait was
controlled by a recessive gene and not affected by
cytoplasm.
One hundred and fifty one microsatellite primers
well-distributed on 12 chromosomes in rice were used
to screen the genomic DNA of parents, Peiai 64S and
Qiufeng M. The results indicated that the ratio of
polymorphism is only 19.9%. It may be attributed to
the close relationship of parents between japonica
(Qiufeng M) and javanica (Peiai 64S).

Tao Chen et al.: Physiological Character and Gene Mapping in a New Green- revertible Albino Mutant in Rice 335
www.jgenetgenomics.org
Table 3 Segregation of the green-revertible albino trait in the progenies of Qiufeng M
F
1
F
2

Cross
Normal green
seedlings
Green-revertible
albino seedlings
Normal green
seedlings
Green-revertible
albino seedlings

2

(3:1)
P
Qiufeng Qiufeng M 37 0 196 59 0.38 0.50-0.75
Qiufeng M Qiufeng 21 0 118 46 0.66 0.25-0.50
Peiai 64S Qiufeng M 44 0 2,543 813 1.03 0.25-0.50

A mapping population consisting of 28 recessive
individuals was analyzed to confirm the linkage rela-
tion between markers and mutated gene. The band
types of RM318, RM530, and RM406 on chromo-
some 2 distorted to that of Qiufeng M, the segregation
ratios of Peiai 64S homozygote, heterozygote, and
Qiufeng M homozygote derived from the cross
Peiai 64SQiufeng M were 1:19:8, 2:17:9, and
6:12:10. This result implied that this mutated gene
was located on rice chromosome 2.
On the basis of the experiment above, six pairs
of SSR markers were detected, which were polymor-
phic, from 42 pairs of SSR markers published on a
website (www.gramene.org) or developed by the
laboratory here (Table 4). The green-revertible albino
gene was located between two SSR markers, RM475
and RM2-22 (Fig. 2) on the long arm of chromosome
2, using 209 recessive mutant individuals from F
2

population from the cross Peiai 64S Qiufeng M.
The genetic distances were 17.3 cM and 2.9 cM, re-
spectively (Fig. 3). This novel green-revertible albino
gene in rice is tentatively designated as gra
(t).

3 Discussion
Natural leaf color is the result of evolution in
plants, and the change of leaf color can lead to growth
retardation, weakness in competitiveness, decrease of
biomass yield or even death. Green-revertible albino
mutant is an important plant germplasm. The mecha-
nism of green-revertible albino can be illuminated,
through gene mapping, cloning, functional analysis,
expression, and regulation in basic research. This
mutation also has much practical value in rice breed-
ing. On the one hand, the male-sterile lines carrying
this mutated gene grow well without influencing the
seed production. On the other hand, it can be used as
a recessive phenotypic marker for monitoring seed
purity in seed production of hybrid rice, especially in
two-line hybrid rice in which seed purity is usually
affected by temperature.
Expression of the green-revertible albino in
Qiufeng M is not similar to W
1
, W
17
, W
24
, W
25
,
W
29
[30]
, Yutu S, and Baifeng A. The first three leaves
do not convert to green until senescence and the color
of green revertible leaves and glume are virescent.
These characters ensure the purity of hybrids in all
growth stages effectively.
The mutated gene has an influence only on neck
length and 1,000-grain-weight. The neck length of
Qiufeng M is shorter than that of Qiufeng. It is pre-
sumed that it may be because of the multi-effect of
the mutated gene. The lighter grain weight may be the
result of insufficient grain filling because of the pig-
ment deficiency in the mutant
[31]
.
Table 4 Polymorphic SSR markers developed on chromosome 2 of rice
Markers Forward sequences (53) Reverse sequences (53) GenBank No.
Anneal tem-
perature()
Size of amplified
fragment (bp)
RM2-22 TTTACTTTGACTCGTCCTGT CTGATCCAGTGATCCTCC AP004059 51.2 167
RM2-33 TCTTACCTGTTACGGAGTAC GCGTTATGCGATGGAGC AP006168 49.7 144
RM2-37 CACCACCAAACGGAAGG CTGGCAATCACAGCAGTAGC AP006452 53.4 106


336 Journal of Genetics and Genomics Vol.34 No.4 2007
www.jgenetgenomics.org



Fig. 2 The parental polymorphism of SSR marker RM2-22 and its segregation in some F
2
plants
M: 50 bp ladder; P
1
: Peiai 64S; P
2
: Qiufeng M; F
1
: Peiai 64SQiufeng M; Number: the genotype symbols of F
2
plants.


Fig. 3 Genetic linkage map of gra
(t)
on chromosome 2
The sensitivity to environmental factors must be
considered, when the leaf color is selected as a phe-
notypic marker. The occurrence of albino in Qiufeng
M does not associate with temperature. Therefore, in
terms of stability, this mutant meets the requirement
of a potential screening marker
[32]
.
Gene nominated gra in Yutu S was mapped be-
tween the two SSR markers of RM496 and RM590 on
rice chromosome 10 by Zhao et al
[18]
. However, gra
(t)

was located on chromosome 2 in this study. It was
obvious that they were not the same genes. The action
mechanism of gene gra
(t)
for leaf color and neck
length remains unclear.
References
1 Espineda CE, Linford AS, Devine D, Brusslan JA. The AtCAO
gene, encoding chlorophyll a oxygenase, is required for chloro-
phyll b synthesis in Arabidopsis thaliana. Proc Natl Acad Sci
USA, 1999, 96(18): 1050710511.
2 Yu QB, Jiang H , Mi HL, Zhou GY, Yang ZN. The physiological
character and molecular mapping in rice albino21 mutant. Journal
of Shanghai Normal University (Natural Sciences), 2005, 34(1):
7075 (in Chinese with an English abstract).
3 Schultes NP, Sawers RJH, Brutnell TP, Krueger RW. Maize high
chlorophyll fluorescent 60 mutation is caused by an Ac disruption
of the gene encoding the chloroplast ribosomal small subunit pro-
tein 17. Plant J, 2000, 21(4): 317327.
4 Rzeznicka K, Walker CJ, Westergren T, Kannangara CG, Wett-
stein DV, Merchant S, Gough SP, Hansson M. Xantha-l encodes a
membrane subunit of the aerobic Mg-protoporphyrin IX mono-
methyl ester cyclase involved in chlorophyll biosynthesis. Proc
Natl Acad Sci USA, 2005, 102(16): 58865891.
5 Guo AG, Feng XZ, Zhao LL, Wang PH. Studies on the activity of
translation and transcription in the leaves of wheat albescent line.
Acta Agricultural Boreali-Occidentalis Sinica, 1996, 24(1): 14
(in Chinese with an English abstract).
6 Dong Z, Liu JY, Ma HM, Xu CK, Sun H, Zhang JD. Chlorophyll
contents and chloroplast ultrastructure of chlorophyll deficient
mutant in B. napus. Chinese Journal of Oil Crop Sciences, 2000,
22(3): 2729 (in Chinese with an English abstract).
7 Wettstein DV, Gough S, Kannangara CG. Chlorophyll Biosyn-
thesis. Plant Cell, 1995, 7(7): 10391057.
8 Beale SI. Enzymes of chlorophyll biosynthesis. Photosynth Res,
1999, 6(1): 4373.
9 Eckhardt U, Grimm B, Hortensteiner S. Recent advances in chlo-
rophyll biosynthesis and breakdown in higher plants. Plant Mol
Biol, 2004, 56(1): 114.
10 Sundberg E, Slagter JG, Fridborg l, Cleary SP, Robinson C,
Coupland G. Albino3, an Arabidopsis nuclear gene essential for

Tao Chen et al.: Physiological Character and Gene Mapping in a New Green- revertible Albino Mutant in Rice 337
www.jgenetgenomics.org
chloroplast differentiation, encodes a chloroplast protein that
shows homology to proteins present in bacterial membranes and
yeast mitochondria. Plant Cell, 1997, 9(5): 717730.
11 Kumar AM, Soll. Antisense HEMA1 RNA expression inhibits
heme and chlorophyll biosynthesis in Arabidopsis. Plant Physiol,
2000, 122(1), 4955.
12 Terry MJ, Kendrick RE. Feedback inhibition of chlorophyll syn-
thesis in the phytochrome chromophore-Deficient aurea and yel-
low-green-2 Mutants of Tomato. Plant Physiol, 1999, 119(1):
143152.
13 Ishikawa A, Okamoto H, Iwasaki Y, Asahi T. A deficiency of
coproporphyrinogen III oxidase causes lesion formation in
Arabidopsis. Plant J, 2001, 27(2): 8999.
14 Huang XQ, Zhao HX, Dong CL, Sun YY, Wang PR, Deng XJ.
Chlorophyll-deficit rice mutants and their research advances in
Biology. Acta Botanica Boreali-Occidentalia Sinica, 2005, 25(8):
16851691 (in Chinese with an English abstract).
15 Jung KH, Hur JH, Ryu CH, Choi YJ, Chung YY, Miyao A, Hiro-
chika H, An GH. Characterization of a rice chlorophyll-deficient
mutant using the T-DNA gene-trap system. Plant Cell Physiol,
2003, 44(5): 463472.
16 Lee S, Kim JH, Yoo ES, Lee CH, Hirochika H, An GH. Differen-
tial regulation of chlorophyll a oxygenase genes in rice. Plant Mol
Biol, 2005, 57(6): 805818.
17 Shu QY, Chen SF, Wu DX, Shen SQ, Cui HR, Xia YW. Studies
on breeding of a new type of cytoplasmic male sterile rice line
Quanlong A. Scientica Agricultura Sinica, 2001, 34(4): 349354
(in Chinese with an English abstract).
18 Zhao HJ, Wu DX, Shu QY, Shen SQ, Ma CX. Breeding and
characteristics of photo-thermo sensitive genic male sterile rice
Yutu S labeled with green-revertible albino leaf marker. Chinese
Journal of Rice Science, 2004, 18(6): 515521 (in Chinese with
an English abstract).
19 Shen SQ, Shu QY, Bao JS, Wu DX, Cui HR, Xia YW. Develop-
ment of a greenable leaf colour mutant Baifeng A and its applica-
tion in hybrid rice production. Chinese Journal of Rice Science,
2004, 18(1): 3438 (in Chinese with an English abstract).
20 Arnon DI. Copper enzymes in isolated chloroplasts poly-
phenoloxidase in Beta vulgaris plant. Plant Physiol, 1949, 24(1):
115.
21 Li HS, Sun Q, Zhao SJ, Zhang WH. Principles and Techniques of
Plant Physiological Biochemical Experiment. 1st. Beijing: China
Higher Education Press, 2000, 134137.
22 Shu QY, Liu GF, Xia YW. Temperature-sensitive leaf color mu-
tation in rice (Oryzae sativa L.). Acta Agriculturae Nucleatae
Sinica, 1996, 10(1): 610 (in Chinese with an English abstract).
23 Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation:
Version. Plant Mol Biol Rep, 1983, 1(1): 1921.
24 Temnykh S, Park WD, Ayres NS, Cartinhour N, Hauck L,
Lipovich YG, Cho TI, McCouch SR. Mapping and genome or-
ganization of microsatellite sequences in rice (Oryzae sativa L.).
Theor Appl Genet, 2000, 100(5): 697712.
25 McCouch SR, Teytelman L, Xu YB, Lobos KB, Clare K, Walton
M, Fu BY, Maghirang R, Li ZK, Xing YZ, Zhang QF, Kono I,
Yano M, Fjellstrom R, DeClerrck G, Schneider D, Cartinhour S,
Ware D, Stein L. Development and mapping of 2240 new SSR
markers for rice (Oryza sativa L.). DNA Res, 2002, 9(6):
199207.
26 Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. Development
of a microsatellite framework map providing genome-wide cov-
erage in rice (Oryza sativa L.). Theor Appl Genet, 1997, 95(4):
553567.
27 Li Q, Wan JM. SSRHunter: Development of a local searching
software for SSR sites. Hereditas (Beijing), 2005, 27(5): 808810
(in Chinese with an English abstract)
28 Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. MAPMAKER: an interactive computer package
for constructing primary genetic linkage maps of experimental
and natural populations. Genomics, 1987, 1(2): 174181.
29 Liu RH, Meng JL. MapDraw: A microsoft Excel Macro for
drawing genetic linkage maps based on given genetic linkage data.
Hereditas (Beijing), 2003, 25(3): 317321(in Chinese with an
English abstract).
30 Xia YW, Liu GF, Shu QY, Jiang RH, Xie JH. A preliminary
study induction and identification of chlorophyll mutants of in-
dica type temperature sensitive genic male-sterile rice. Acta Ag-
riculturae Nucleatae Sinica, 1995, 9(3): 129133 (in Chinese
with an English abstract).
31 Sun JX, Tang LH, Zhu QS, Yang JC, Yang YH. Relationship
between chlorophyll content of rice glume and grain filling. Ji-
angsu Journal of Agricultural Sciences, 2001, 17(1): 2427 (in
Chinese with an English abstract).
32 Wu DX, Shen SQ, Cui HR, Xia YW, Shu QY. A novel
thermo/photoperiod-sensitive genic male-sterile (T/PGMS) rice
mutant with green-revertible albino leaf color marker induced by
gamma irradiation. Field Crops Research, 2003, 81(2): 141147.













338 Journal of Genetics and Genomics Vol.34 No.4 2007
www.jgenetgenomics.org




1, 2

2

2

2

1, 2

2

1. 210095
2. 210014
M
M
MM
209
64S M F
2
2 SSR RM475
RM2-22 17.3 cM2.9 cMgra
(t)

; ; ; SSR
(1980-); E-mailchentao19801014@126.com