You are on page 1of 2

" " ' - t I

o QUE SAO GENES?


A LOCALI ZAO DOS GENES
Emcada clula do corpo humano (imagem
ao alto) existe um ncleo (ressaltado em
vermelho), que contm a informao gentica
para todo o corpo em forma de filamentos
de DNA. Essesfilamentos esto agrupados
em 46 cromossomos, ou melhor, 23 pares de
cromossomos (ilustrao acima). Um gene
o segmento de DNA que, em geral, orienta a
formao de uma ou mais protenas na clula.
Umorganismo s cresce e funciona por que existe um"plano de const ruo" Este est
codificado no cido desoxirribonucleico (ADN ou DNA), que contm as instrues genticas
e formado por microunidades, os genes. Um ser humano possui 23 mil genes que ordenam,
principalmente, a produo de protenas, vitais vida
Por Henning Engeln (TEXTO) e J ochen Stuhrmann e Tim Wehrmann (ILUSTRAES)
....AACTb!,
.CCATTGAGT' l
ACTGAGTAAACA.
CTCTAGGGCCAC' l
CATTTCAGCTATT .\,/TL
lTTATGGGGATGI AGAATAGA' l
~GGTGTCAGAC ;QAAAGGCCTA,
ATGGAGATTCT( AAGAAATCCTTl
~CTGTGACAGr ~TTTTGGAGTAJU
rGCTGTCGT AAAGTAAGCCACA
!AAAAAACT AGCATGATTCCCC.
!AAGAGAAG l' TCC' T GTTATG'
.ATGTCCTGA' . :CAGGGCATTCCA;
.GGGCCATGATGGGA..., ~ATGCCCTCTTCC(.
~GCCAACCAGCATTAACATCA...~ ~TTCTTTCCGA' ~
.TCCCT~;~~ii~gi~~~~g:~i~~g!il ii!i~iiiiii~~~.
G GCCC' ' ' ' CACTTTGCACCC' TI : TC C .AT TATTGAT T~ /
I T AAJ>. GC: CC' l J..;AC \GG~~GCGb,-
:CTGA TC TGGc; .; ,L ~. ..AATACAAA. /
lCCCA G TCTTAG - - ~.e~ G" AGGAi.AATCGCTTGAA.
;GAGGT A TTTTGC' .A rCCAI ,CAAC ~~~.
rc .. CAAACl >T AAAA ~AGTA ~~ii?
,ggA cg~GCATCT~GTTT:r~Ti~i~~i~ ~~~i~~ r~~-- :i~
CATT TTTTGTCCAGAAAGCCAGAAC(ACTCAI ;GGGTT TTATAA TT ~
TCTGATTGACAATTGGTTGAAAGAGTT(rCAATJ lGAATG. ;ATTGTGA TTGTGG
CCAAG~~TCTGTCA AGATGAAGCC N:AGG~ ;GCTTC GATAACAGGTTG TAGTTC
TCAGA( ' TAAGT GGAGACGTAA ,TGAGG rCTGACCTCCACTTCC CATC' :' GAGAC
lTCT ( TAAT~ GTTTGTTC' l ' CTAGT' 3GA " GCCCATGACACTGCCTCAG A TC
3A GC; lTG TGGTCAGGA~ AGCTT( CTATA' TTTTAGGGAG TACJ CAGCC
T ~ AAA fTCTAAGGTCCC AACCAT AATGG ~TTTCTTCTAGGCCA~ :TCTA
ATTGAA. ACC AACATTCCTTTCTAT ATAATA TCAGC GTTGAG CATTCA C ~GCAj
GTGCCAI CCA CAAGGGCTGACTTGA< rACCTG ,GAT<D. CACT GGTGCT ~CCCTG
TGAOOG ACCAGGGGCTG GA( ~CCAG ;CTCT<; GGAG GGTTTGGC' l !CATGT
TG T .GCGTGATGAGCTCTGACAT ' TTGCA' GACGGl - ' GGG ACACCCCAGC .GGAOO
rG AGTGATGGCACAGGGGAAAOO< GCATA. CA T( .CAG CCACTACCTCCl CTGTG
" G G( CA TGGGTCTTCTGCT~ T G CCTCT' fACC C' GCCTCATTC TTOOT
' CAQG, ACC GCTGACAAAAOOGACT' , ' !TGTA CCTGC .CCTG ACACCTGGCTCC. JGGTT
CAGC ,GTGTTTGTTGGGCCAACGAGTG GGA? AAACA:AGACAGAAGGACAGATGGAGA,\TGGT
GTGG :AGAC OOAGTAACT GTG ATG' ATTA3AAATCACAGAAGAGCAG C~lTTTG
AAT? ' GT GTGAGGAGGTG CA~ rc (:;CCCTCCCTCAGAGCCTTCTCC( CTCT
JGT( : CATCCCCTTOOTCGTCCTTG~;GAG :TCA CTTTTGCTCAGCCTATTGTGGCT GC
\G l 3T CA OOCACCAGC GA~ 00 :ATT AGGGCTGAAG~CTCACCAT GG
rGATC r ,GTQGjjI TGGGG<:CTCAGGAGC; oAGAG AC( ACCCTACCTOOCCCp CCTGC JCCT
GTA(:; .~CAGAGGCATGGGGTGJ .JGCAT J ( TCGAGGACCAOOGCCAT CACT<' :CT(
CCA' Z; TGGCTCAGGGGTCTGTCAGJ T(.' AT" JAGC. GAGTTGGAGGTAAOOGCA ~GGTTTG~
!G(' :T GACCAT GGAAGGGG~ iA<" ~GGCClACAAGTGAGG1. TT GT~
-li! G GAGAGAAGCCAGGACAGGT(:r< ::CTGT ~CCTGCAGGCA<ACCCAGGAA ~TC
Ac.:Q CATGCCA\GCCTGCCTAC( .Ar CTC" " C.' !TCATGGACAT<AGAGAAAACC f:AG'
,
~C T TCTGT CCCA GT ,~ Uc. T(' CTCTGCCCTA1 ~ GAGAGG CC
G AAGT lACTGCA GG " !Ac.. P.GAACA TT<rTCTCATGCTC :rT'
\T TTC? ' ACAGTTTTG' "'c- lTGAAAACCA( lGAACCCTGC?
' T GGTC' : TGCTT ' TGTAAGATCl ,CCGCCG (
C' T TTI " ' T' \CTTTGAM' I T AGCTC
ESPERMATOZOI DES
GENTI PO PATERNO
VULOS - GENTI PO
MATERNO
UNI O DOS CROMOSSOMOS
Para procriar, o organismo de um homem
produz espermatozoides que contm
respectivamente apenas um conjunto de 23
cromossomos.
As clulas sexuais da mulher tambm
s contm 23 cromossomos e,
portanto, apenas uma representao
de cada gene.
Aps a fecundao, o gentipo da
me e do pai se fundem. Por isso,
a criana ter novamente 23 pares de
cromossomos, ou seja, um total de
46 cromossomos.
32GEO www.revist ageo.com.br
o PROGRAMA DA VIDA
- ,
\
j
/'
~.
OS BLOCOS DE
CONSTRUO DO DNA
oDNA formado por apenas 4
blocos qumicos de construo, os
nucleotdeos, que se unem aos
pares. Elessediferenciam entre si
atravs de suas chamadas bases:
adenina (A), citosina (C), guanina (G)
e timina (T). A informao gentica
est codificada em suas sequncias.
Emmdia, um filamento de DNA
constitudo de 125 milhes de pares
de nucleotdeos, o que resulta em 6
bilhes de nucleotdeos para todo o
genoma humano.
Deacordo com as instrues do DNA contido nos
cromossomos, so produzidas, entre outros, as
protenas que soas mais importantes substncias
de construo efuno do organismo. Muitos
no sabem, mas 99,9% do DNA so idnticos
emtodas as pessoas - somente o 0,1%
restante ajuda acaracterizar cada um
individualidade. Caractersticas fsicas,
como acor dos olhos, emgeral so
determinadas por uma combinao de
vrios genes. Qual trao hereditrio
dos pais seimpe depende
da chamada "dominncia" das
respectivas variantes genticas.
O QUE DIFERENCIA OS SEXOS
Oscromossomos sempre ocorrem aos pares, uma vez que herdamos respectivamente
umconjunto de 23 do pai e 23 da me. Mas um desses pares diferente no homem: o dos
cromossomos sexuais. Issoporque, ao lado do chamado crornossomo-X, o homem possui outro
menor, chamado cromossomo-Y (acima, direita), que ele herda do pai, e que determina o
seusexo. As mulheres, por outro lado, possuem dois cromossomos-X (acima, esquerda). Os
cromossomos s apresentam asformas de XeY em uma determinada fase da diviso celular,
quando j seduplicaram e sesto unidos em um nico ponto. No decorrer da fase seguinte
de diviso celular, "X"e"Y" soseparados longitudinalmente edivididos entre as clulas-filhas
resultantes. Dessemodo, assegura-se que asduas clulas recebam a mesma informao gentica.
O PROGRAMA DE
DESENVOLVIMENTO
UM PRODUTO DE GENES
MISTOS
Os genes orientam as divises celulares e o
amadurecimento do embrio em desenvol-
vimento. Nesse processo, a herana gentica
da me e do pai age em conjunto.
O predomnio de uma ou outra
caracterstica dos pais no feto em
desenvolvimento depende da
variante de um gene.
A PRODUO
DE PROTEINAS
A maioria dos genes
fornece instrues para
agrupar aminocidos
(representados como
bolinhas) em uma
sequncia muito precisa para
formar protenas complexas. Estasmantm o
funcionamento das clulas. As protenas formam,
entre outros, suasestruturas, transmitem sinais ou
canalizam substncias para o interior das clulas.
O SER HUMANO
E SEU GENTIPO
o CORPO constitudo de cercade 100trilhes
de clulas. Salvoasexcees, todas contm o
genoma humano, com23.000 genes. As clulas
soas unidades constituintes de tecidos ergos.
Embora todas contenham amesma informao
gentica, seufuncionamento diferenciado,
porque alguns genes soativados eoutros
neutralizados.
OS CROMOSSOMOS, associados amolculas
de protenas, contm, cada um, um longo
filamento de DNA, no qual selocalizamos genes.
Cadaclula do organismo humano possui 23 pares
de cromossomos.
O DNA contm as informaes genticas.
OS GENES soaqueles segmentos do DNAque,
emgeral, orientam aformao de uma ou mais
protenas naclula. Dessemodo, elestambm agem
nadefinio de caractersticas,como acor da pele.
OS NUCLEOTDEOS soos 4 blocos qumicos
de construo que constituem o DNA. Um
nucleotdeo composto por uma base,umacar
e umgrupo fosfato. Umfilamento de DNA
formado, em mdia, por 125 milhes de paresde
nucleotdeos.
GE033