Вы находитесь на странице: 1из 156

UNIVERSIDAD DE COLIMA

Doctorado en ciencias: rea Ciencias Agrcolas y Forestales




Especiacin recombinacional y relaciones filogenticas en Satureja
macrostema var. laevigata.



TESIS
Que para obtener el Grado de
Doctor en Ciencias
rea Ciencias Agrcolas y Forestales
Presenta:


Jos Mario Aguilar Ramrez


Asesores:

Dr. Vctor M. Villalobos Armbula
Dra. Martha I. Vergara Santana
Dr. Rafael Salgado Garcglia
Dr. Alfonso Pescador Rubio
Dr. Sebastin Lemus Jurez
Dr. Roberto Lezama Gutirrez



Tecomn, Colima, Mxico. Octubre del 2002


UNIVERSIDAD DE COLIMA
FACULTAD DE CIENCIAS BIOLGICAS Y AGROPECUARIAS



OFICIO No. 593/2002.
C. JOSE MARIO AGUILAR RAMIREZ
EGRESADO DEL DOCTORADO EN CIENCIAS
AREA: CIENCIAS AGRICOLAS Y FORESTALES PRESENTE.


Con fundamento en el dictamen emitido por el jurado revisor del colegiado del
rea: de Ciencias Agrcolas y Forestales de esta Facultad a mi cargo, de su trabajo de
tesis de Doctorado y en virtud de que efectu las correcciones y acat las sugerencias
que le haban indicado los integrantes del mismo, se le autoriza la impresin de la tesis "
Especiacin recombinacional y relaciones filogenticas en Satureja macrostema
var. laevigata ", misma que ha sido dirigida por los C.C.Dr. Vctor M. Villalobos Armbula,
Director de la oficina de Asuntos Internacionales de la SAGARPA, Mxico, D.F. y el Dr.
Rafael Salgado Garciglia, Profesor Investigador de la UMSNH.

Este documento reuni todas las caractersticas apropiadas como requisito parcial
para obtener el grado de Doctor en Ciencias; rea: Ciencias Agrcolas y Forestales y fue
revisado en cuanto a forma y contenido por los C.C. Dr. Sebastin Lemus Jurez, la Dra.
Martha Imelda Vergara Santana , Dr. Roberto Lezama Gutirrez y el Dr. Alfonso Pescador
Rubio, Profesores Investigadores de la Universidad de Colima.

Sin otro particular de momento, me despido de usted muy cordialmente.

C.P. EXPEDIENTE ACADEMICO DEL ALUMNO
C.C.P. EXPEDIENTE CORRESPONDIENTE.
C.C.P. ARCHIVO. Of. No. 593/2002.
VMD/Lety**



Km 40 Autopista Colima-Manzanillo Tecomn, Colima, Mxico CR 28100
Tel. 01 (313) 322 94 05 Ext. 52251 Fax 52252 fcba@tecoman.ucol.mx




DEDICATORIA


A mi esposa e hijos:




Adriana



Mario Alberto


Y


Michele Ekatherin




Fuente de alegras y satisfacciones
Razn de mi ser y la fuerza que me impulsa en el logro de mis ms grandes
anhelos.





















AGRADECIMIENTOS


Al INIFAP por todas las facilidades brindadas.

Al Dr. Jos Luis Hernndez Mendoza. por la oportunidad que nos otorg de
estudiar en el PICAF.

Al Dr. Vctor M. Villalobos Armbula, por su apoyo y disposicin cuando lo
necesite.

Mi profunda gratitud al Dr. Rafael Salgado Garcglia, quien siempre mostr su
disposicin y apoyo incondicional y porque desde el principio y hasta el final me
respaldo.

Especial agradecimiento a la Dra. Martha I. Santana Vergara, por sus enseanzas
tericas y constante estmulo, que permitieron el logro de esta meta y que sin
duda quedaron plasmadas en el documento.

Al Dr. Abraham Garca Chvez, por su colaboracin en el laboratorio de Biologa
Molecular del CINVESTAV-lrapuato por todos sus comentarios y apoyos
bibliogrficos


Mi reconocimiento a cada uno de mis asesores por sus valiosas sugerencias, Dr.
Alfonso Pescador Rubio, Dr. Sebastin Lemus Jurez y al Dr. Roberto Lezama
Gutirrez.

A mis compaeros del PICAF

A mis compaeros de trabajo, especialmente a los C. Ing. Jess Muoz Flores e
Ing. Miguel ngel Hernndez Lpez, por hacerme fuerte en los momentos de
apuro.


Finalmente a todos mis amigos y familiares de quienes solo recib su apoyo, por el
sacrificio de su amistad.








CONTENIDO
Pgina
NDICE DE CUADROS i
NDICE DE FIGURAS iii
RESUMEN iv
SUMMARY i
I INTRODUCCIN 1
II REVISIN DE LITERATURA 5
2.1 Evolucin 5
2.1.1 Teora del equilibrio puntuado 13
2.1.2 Especiacin 16
2.1.3 Filognesis y Filogenia 20
2.1.4 Marcadores moleculares 30
2.1.4.1 Marcadores moleculares en plantas 31
2.1.4.2 Caracteres moleculares 32
2.1.4.3 Secuencias 33
2.1.4.4 La regin de ITS del ADN Ribosomal del ncleo (nrADN) 33
2.1.4.5 La regin de los espaciadores internos transcritos (ITS) del
nrADN en angiospermas y gimnospermas
35
2.1.4.6 ITSs en angiospermas 36
2.1.5 Satureja macrostema (Labiatae) como modelo de estudio 39
2.1.6 Clasificacin botnica de Satureja macrostema (Benth) Briq 41
2.1.6.1 Descripcin de la especie Satureja macrostema (Benth) Briq 41
2.1.6.2 Distribucin geogrfica 42
2.1.6.3 Importancia, usos y propiedades curativas del t nurite(S.
macrostema).
43
2.1.6.4 Usos actuales y potenciales. 43
III PROBLEMA ESPECFICO, HIPTESIS Y OBJETIVOS 45
IV MATERIALES Y MTODOS 47
4.1 Colecta e Identificacin del material vegetal. 47
4.2 Extraccin y limpieza del ADN 48
4.3 Extraccin del ADN 48
4.4 Determinacin de la concentracin del ADN 51
4.5 Determinacin de la calidad del ADN 51
4.6 Espacios transcritos internos (ITS). 51
4.7 Primera amplificacin del ADN. 52
4.8 Limpieza. 52
4.9 Segunda amplificacin 53
4.10 Purificacin de ADN. 53
4.11 Secuenciacin 54
4.12 Alineacin de secuencias. 55
4.13 Bsqueda y reporte de secuencias en el GenBank. 55
4.14 Determinacin de la distancia gentica. 57
4.15 Determinacin de la distancia gentica y filogenia por medio de




cladogramas. 57
4.16 Filogenia de las secuencias obtenidas. 58

V

RESULTADOS

59
5.1 Extraccin del ADN
5.2 Amplificacin 60
5.3 Secuencias 61
5.4 Recorte de secuencias 62
5.5 Alineacin 63
5.6 Comparacin con algunos Gneros de la misma Familia 80
5.7 Dendrogramas 83
5.8 Nmeros de accesin en el GenBank 84

VI

DISCUSIN

85

VII

CONCLUSIONES

108

VIII

LITERATURA CITADA

110




























i
NDICE DE CUADROS

Cuadro Pgina
1 Caractersticas de las localidades donde se colect
material botnico
de S. macrostema.
47
2 Ejemplares de S. macrostema utilizados en el estudio. 48
3 Secuencias obtenidas por espcimen de Satureja
macrostema con los
primers ITS1-4.


61
4 Longitud del ITS1, 5.8S e ITS2; promedio y contenido de
G+C.
63
5 Nmero de veces que aparecen las "Palabras" formadas
por Trinucletidos y Dinucletidos en los ITS1 e ITS2 al
comparar SATIN contra SATIB

64
6 Nmero y porciento de purinas (adeninas-ti minas) y
piridiminas
(citosinas-guaninas), de SATIN-SATIB y SATSJ-SATPA.
65
7 Comparacin entre secuencias SatIN contra SatIB 66
8 Comparacin entre secuencias SatSJ contra SatIB 67
9 Comparacin entre secuencias SatSJ contra SatPA 68
10 Comparacin entre secuencias SatIN contra SatPA 69
11 Comparacin entre secuencias SatIN contra SatSJ 70
12 Comparacin entre secuencias SatPA contra SatIB 71
13 Porciento de emparejamiento, alineamiento, deleciones,
inserciones y
mutaciones (transversiones y transiciones)
72

14 Tipo de mutacin (transversin-transicin) y n de sitio
por ITS
73
15 Reporte de alineamiento del gene 5.8S de Satureja
macrostema
74
16 Porciento de Similaridad y Divergencia del Gene 5.8S de
S.
Macrostema
75

17 Reporte de alineamiento del espaciador ITS1 de S.
macrostema
76
18 Reporte de alineamiento del espaciador ITS2 de S.
macrostema
77
19 Reporte de alineamiento de la regin ITS1-5.8s-ITS2 de
S. macrostema
78






ii

20 Porciento de Similaridad y Divergencia de la regin ITS1-5.8s-
ITS2 de
S. macrostema
79
21 comparacin de Satureja con otras especies de otros gneros 82
22 Porcentajes de divergencia y similitud entre plantas de Satureja
y
otras especies de otros Gneros
84








































NDICE DE FIGURAS



Figura Pgina
1 Distribucin del te nurite (S. macrostema) en el Estado de
Michoacn
42
2 Gel 1 Electroforesis del DNA de diferentes especimenes de S.
Macrostema
60
3 Gel 2 Amplificacin de la regin ITS1-5.8s-ITS2 con los primers
ITS 1
60
4 rboles filogenticos del alineamiento del gene 5.8 S de S.
Macrostema
75
5 rboles filogenticos del alineamiento de la regin ITS1-5.8s-
ITS2 de
S. macrostema.
79
6 Fenograma de distancias genticas usando Meg Align de
DNASTAR Software, entre gneros de Labiatae, usando a
Ipomea y a Heliopsis como grupos externos. La filogenia de
Satureja macrostema se resalta con las lneas negras ms
intensas. Los nmeros de la lnea inferior indican el porciento
de disimilitud entre los ITSs de las diferentes especies
83
7 Cladograma de mxima similitud usando Meg Align de
DNASTAR Software. Los nmeros de la linea inferior indican el
tiempo de divergencia entre los ITSs de las diferentes especies
en decenas de miles de aos.
83
8 Relaciones evolutivas y distancia gentica de S. macrostema
en
Estudio
91
9 Prediccin del posible ARNm que formaran las secuencias
ITS1-2 de
las especies de S. macrostema en estudio y reportadas del
Genebank
97












iv


RESUMEN

Especiacin recombinacional y relaciones filogenticas en Satureja
macrostema var. laevigata.

Jos Mario Aguilar Ramrez

Facultad de Ciencias Biolgicas y Agropecuarias de la Universidad de
Colima, Apartado postal N 36, C.P. 28100, Tecomn, Colima, Mxico.

La evolucin es un cambio gentico que sufre una poblacin de organismos en el
transcurso del tiempo, o "descendencia con modificacin", y la teora del equilibrio
puntuado propone que el registro fsil refleja la manera en que ocurri la
evolucin, con largos periodos de rpida especiacin, los resultados obtenidos en
el presente estudio sugieren que S macrostema var. laevigata, se encuentra
actualmente en perodo de especiacin rpida (hbrida o recombinacional), la cual
es de tipo puntuado y el anlisis de las secuencias de la regin de los ITS de S.
macrostema var. laevigata sugiere que las plantas en estudio pueden ser
consideradas como especies. La gran utilidad de las tcnicas moleculares es que
permiten observar diferencias directamente en el ADN, es decir en la molcula
qumica que contiene toda la informacin gentica del organismo, este es el
mximo nivel de resolucin posible y as pueden inferirse las relaciones
filogenticas en especies y subespecies.

Palabras Clave: Evolucin, Especiacin, Secuencias, ADN.




v

SUMMARY

Recombinational speciation and phylogenetic relationships in
Satureja macrostema var. laevigata.

Jos Mario Aguilar Ramrez

Facultad de Ciencias Biolgicas y Agropecuarias de la Universidad de
Colima, Apartado postal N 36, C.P. 28100, Tecomn, Colima, Mxico.



The evolution is a genetic change that a population of organisms suffers in the
course of the time, or "descendant with modification", and the theory of the
punctuated balance intends that the fossil registration reflects the way in that
happened the evolution, with long periods of quick speciation. The results obtained
in this study suggest that S macrostema var. laevigata, is at the moment in period
of quick speciation (hybrid or recombinational) which is of punctuated type. The
analysis of the sequences of the region of the ITS of S. macrostema var. laevigata
suggests that the plants in study can be considered as species. The great utility of
the molecular techniques is that they allow to observe differences directly in the
DNA, that is to say in the chemical molecule that contains all the genetic
information of the organism, this it is the maximum leve) of possible resolution and
the phylogenetic relationships can be inferred this way in species and
subspecieses.

Key Words: Evolution, Speciation, Sequences, DNA.


1
I. INTRODUCCIN

El concepto de evolucin, es esencial en el desarrollo de las ciencias de la
vida, y ha aportado nuevas y revolucionarias maneras para responder a las
preguntas que el hombre se ha planteado durante siglos, de las cuales las ms
importantes son: "porqu estoy aqu, cul es el propsito de la existencia
humana?", y "en que consiste la naturaleza del mundo de vida que nos rodea? "
(Dobzhansky, 1982).

Actualmente la llamada "Teora Sinttica de la Evolucin" se apoya en la
"Teora Darwinista de la Seleccin", en los conocimientos de la gentica y del
tratamiento matemtico de la dinmica de poblaciones, abarcando la teora del
gen, la teora cromosmica, y la evolucin molecular. Las investigaciones
evolucionistas se desarrollan principalmente en dos direcciones: por una parte la
biologa evolucionista especial (relativo al concepto de especie), que trata de
explicar la filognesis y el parentesco de grupos de especies ms o menos
grandes y por la otra la biologa evolucionista general (Ayala et al., 2000).

Tras establecerse esta nueva gran sntesis de gentica de poblaciones se
plante la cuestin de s los procesos filogenticos ms importantes como son, el
proceso evolutivo y la formacin de nuevas especies, quedaban explicadas por
esta teora (Ayala et al. 2000; Filchak et al., 2000), o si se requeran otras
explicaciones complementarias, dicho de otro modo: son suficientes los tres
mecanismos (mutacin, seleccin y aislamiento) propuestos por la Teora Sinttica
de la Evolucin, para explicar cualquier fenmeno evolutivo, o por el contrario,
proponer otros posibles mecanismos?

Los tres mecanismos estudiados se han promovido como respuesta al gran
desafo de la biologa evolutiva: el entender los procesos genticos involucrados
en la formacin de especies, ya que estos procesos son responsables de la
diversidad biolgica existente. Estos procesos han sido difciles de estudiar por los
distintos

2
mecanismos de especiacin que se han reportado. Cada uno con rasgos nicos
que dificultan su estudio (Rieseberg y Ungerer, 1999).

Entre otras teoras surgidas con la finalidad de aportar explicacin a
mecanismos evolutivos se encuentra la "Teora del Equilibrio Puntuado", la cual a
travs del registro fsil propone que la evolucin ocurre con largos periodos de
rpida especiacin (surgimiento de una o ms especies), estos periodos de rpida
especiacin pueden ser causados por grandes cambios en el ambiente, cuando se
rompe el equilibrio por la acumulacin de mutaciones (Sheldon, 2000)

Un reflejo o manifestacin del proceso de evolucin, puede ser observado a
travs de la ubicacin de los organismos en el llamado "rbol de la vida", que es
un grfico que representa las relaciones filogenticas entre los diferentes taxones,
resultando en una hiptesis sobre las relaciones filogenticas de un taxn
(Christoffersen, 1995; Bush, 2001), construidos mediante semejanzas de
secuencias y basados en mtodos de distancias (Swofford et al., 1996). As, la
filogenia, ocupa un lugar central en la sistemtica y en la taxonoma, al ayudar a
resolver problemas de ubicacin y nomenclatura de organismos (Forey, 1992),
entre los mtodos empleados para inferir filogenia, los que consideran la obtencin
de datos moleculares proporcionan registros indirectos de los eventos de
especiacin y ofrecen un enorme potencial para la investigacin de las causas
generales y las tasas de especiacin dentro de clados (Barraclough y Nee, 2001).

La tcnica de anlisis molecular que permite el estudio de la regin de los
espaciadores internos transcritos (ITS) ha sido considerada como una fuente muy
til de caracteres para estudios filogenticos en angiospermas (Baldwin et al.
1995). Dado que los ITS se encuentran altamente representados en el genoma, se
pueden amplificar con cantidades pequeas de ADN y las secuencias altamente
conservadas dentro de la mayora de los genes del nrADN son muy tiles en el
diseo de oligonucletidos ("primers") "universales", lo que facilita la amplificacin
de los ITS mediante el uso de la reaccin en cadena de la polmerasa (PCR)
(Liston 1992;

3
Planta Y Rau, 1999). Los espaciadores internos transcritos son la parte ms
variable de la regin de los ITS, la regin de los ITS comprende el ITS2, la
subunidad 5.8S y el ITS1, debido a que se encuentran flanqueando a la subunidad
5.8S, que es ms conservada y se posibilita la alineacin no ambigua de esta
regin (Baldwin et al., 1995).

La regin de los espaciadores internos transcritos (ITS) ha sido
ampliamente usada para el esclarecimiento de las relaciones entre taxa a niveles
inter e intragenricos, as como intraespecficos en angiospermas (Hamby y
Zimmer, 1992; Baldwin et al., 1995; Buckler y Holtsford 1996; Liston et al., 1996).

Respecto al proceso de especiacin, se han reportado diferentes
modalidades del mismo, entre estas, la especiacin simptrica (en que las nuevas
especies surgen sin el aislamiento geogrfico es decir, en el mismo lugar
geogrfico) es el origen de dos o ms especies de una sola poblacin local
(Kondrashov y Kondrashov, 1999; Dieckmann y Doebeli, 1999), puede ocurrir
cuando el flujo gentico es eliminado entre las poblaciones y se forman especies
nuevas, por rangos de distribucin, dado que se genera aislamiento en el mismo
sitio por variacin de nichos (Mousseau y Olvido, 2001), e Incluye la poliploida e
hibridizacin que son mecanismos importantes de especiacin en plantas
(Rieseberg, 1999, Widmer y Baltisberger, 1999; Rieseberg y Ungerer, 2001)

El mecanismo de hibridacin o "recombinacin" puede dar origen a nuevas
especies, y se seala que la "especiacin recombinacional" utiliza este mecanismo
para tal fin, al hibridizarse especies paternales divergentes gentica o
cromosmicamente; adems la teora predice que este modo de especiacin es
puntuada, pero ha sido poca la evidencia emprica generada para apoyarla
(Ungerer et. al., 1998). Los estudios de especiacin pueden ser estudiados en
plantas sujetas a seleccin artificial, como es el caso de Satureja macrostema.




4
McVaugh y Schmid (1967) mencionan que existen dos variedades dentro
de Satureja macrostema y son; S. macrostema var. macrostema y S. macrostema
var. laevigata sealando que ambas variedades se han reportado para el estado
de Michoacn, y que quizs actualmente se traslapan en algunas reas del centro
de la entidad, por lo que cabra la posibilidad de que ambas hibridicen, asimismo
mencionan que algn flujo de genes entre las dos variedades parece probable.

El gnero Satureja ha sido tradicionalmente usado como estimulante,
estomtico, carminativo, expectorante y afrodisaco. El aceite esencial ha
demostrado actividad antimicrobial y antidiarreica por los compuestos fenlicos
que contiene y ha sido usado en el tratamiento contra el cncer (Simon, et al.,
1984; http://www.hort. purdue.edu. Newcrop /med.aro/savory.), como antioxidante
(Lagouri y Boskou, 1996); tambin ha mostrado actividad contra los virus HSV-1 y
VSV (Abad et al., 1999) y actividad anti-HIV-1 (Yamasaki et al., 1998).

Con base en lo anterior, Satureja macrostema var. lavgata fue considerado como
modelo de estudio para determinar las relaciones filogenticas entre cuatro
poblaciones de esta variedad presentes en el estado de Michoacn, e inferir el
proceso de especiacin que podra estar en desarrollo.












5
II. REVISIN DE LITERATURA

2.1. Evolucin.

Para Dobzhansky (1982), la evolucin es un hecho histrico completamente
establecido, y pregunta qu factores son responsables del cambio evolutivo?, y
menciona que la evolucin es ante todo un proceso gentico, y la gentica de
poblaciones es la disciplina biolgica que suministra los principios tericos de la
evolucin. Para Mayr (1997), la evolucin no es solamente un cambio en la
frecuencia gentica sino una mejor respuesta de la capacidad de adaptacin. La
evolucin es la transformacin hereditaria de los organismos, a travs de las
generaciones y las especies, por cambios en el material gentico. Dado que los
organismos interactan con su ambiente, los cambios de ste influyen directa o
indirectamente en el curso de la evolucin (Myers y Knoll, 2001).

Para Stebbins (1999), la evolucin es un proceso de dos pasos que
requiere de la variacin gentica inicial dentro de las poblaciones, as como de la
modelacin de esta variacin va la recombinacin del gen y de la seleccin
natural, y una de sus preguntas de estudio es la aplicacin indiscriminada de
insecticidas y herbicidas a las poblaciones de plantas con el propsito de la
eliminacin de pestes y cizaas esta induciendo su evolucin hacia la resistencia a
las mismas?, y menciona que la crisis bitica y la prdida de la biodiversidad estn
afectando los procesos de evolucin.

Resumiendo, la evolucin es la teora que explica la diversidad de los seres
vivos, se ocupa de los mecanismos que producen cambios en los organismos y
del mismo cambio, as como la repercusin que para los organismos suponen
estos cambios (Reznick, 2000; Sheldon, 2000,Callahan, 2001).



6
La biologa moderna se construye actualmente alrededor de dos
paradigmas centrales 1) la evolucin como centro de un gran rango de disciplinas
(como la sistemtica, ecologa, paleontologa, historia natural y gentica), y 2) la
expresin del gen (enfoque de la bioqumica, biologa molecular, biologa celular,
fisiologa, biologa del desarrollo y gentica); la unin de estos dos grandes
paradigmas es lo que constituye actualmente la ltima sntesis (Schneider, 1999).

La era genmica revolucion la biologa evolucionarla, y algunas de sus
preguntas actuales son: cunta de la diversidad genmica y fenmica en la
naturaleza es adaptada y procesada por la seleccin natural?, cul es el origen y
evolucin de los procesos de adaptacin y especiacin bajo variables ambientales,
espacio temporales macro y microgeogrficas? (Nevo, 2001); otras grandes
preguntas son: cunto de la diversidad del genoma codificado y no codificado
afecta los procesos de adaptacin y especiacin?, y cunta de esta diversidad
codificada y no codificada contribuye a la regulacin y adaptacin diferencial de
los organismos y est sujeta a la seleccin natural?, qu proporcin de la
diversidad gnica y no gnica observada es mantenida por la seleccin?, cunta
de la diversidad no codificada en el ADN est adaptada y regula la expresin del
gen, la transcripcin, translacin, recombinacin y reparacin? (Nevo, 2001),
cmo surgen o se originan nuevas especies? (Korol, 2000); cmo el ambiente y
las interacciones ecolgicas influyen en la formacin de nuevas especies?
(Schneider, 2000), se agregan las preguntas de Francis y Kingston (2001): Cmo
puede el mismo gen recordar que esta apagado en un linaje celular y encendido
en otro?. Estas preguntas de la biologa evolucionarla esperan respuestas.

Respecto al problema de la diversidad, Darwin lo estudia y en su obra "El
origen de las especies", Darwin propuso la explicacin a ese problema. Sin
embargo, de acuerdo con Harder (2001), el problema no es solo explicar la
diversidad de la vida as como el nmero de especies y la variedad de sus
fenotipos.


7
La teora cientfica aceptada actualmente para explicar la evolucin, fue
propuesta por Darwin en su obra "On the Origin of species" (Bowler 1999; Reznik,
2000; Filchak et al., 2000) y puede ser resumida en los siguientes principios:

(1) Los individuos dentro de una especie y toda poblacin biolgica pueden tener
genes similares, pero an as, diferirn en las caractersticas del fenotipo y en su
comportamiento debido a las diferencias existentes tambin en el genotipo y a las
respuestas ambientales, este es el principio de la "variacin" (Harrison, 2000).

(2) Las variaciones pueden ser transmitidas de una generacin a la siguiente, y la
progenie de los individuos que presentan una variacin particular, tendern a tener
esa misma variacin, ese es el principio de la "herencia" (Harrison, 2000).

(3) Algunas de estas variaciones le dan a los poseedores de la misma una ventaja
en su vida ( impiden una desventaja, lo que en trminos relativos es lo mismo),
permitiendo que el organismo obtenga ms alimento, escape ms eficientemente
de sus predadores, utilice los recursos de su medio ambiente con mayor eficacia,
etc.. Esta progenie, debido al principio de la herencia, tiende a poseer las mismas
variantes benficas que sus predecesores, lo que hace que a travs del tiempo, la
frecuencia de estas variaciones ventajosas se incremente. Este es el principio de
la "seleccin natural" (Harrison, 2000; Reznik, 2000).

Estos principios se combinan para formar el ncleo del modelo evolutivo (Bowler,
1999). El punto de vista Darwiniano tradicional afirma que pequeos cambios
incrementales en la estructura y comportamiento de los organismos, ocasionados
por la seleccin natural de las variaciones, producen, luego de un largo periodo de
tiempo, organismos tan diferentes a sus ancestros, que ya no son ms los mismos
organismos, y deben ser entonces clasificados como especies diferentes (Ayala et
al., 2000).




8
La teora de la evolucin biolgica ve en las poblaciones y en las especies
las unidades bsicas de la evolucin. El cambio evolutivo se realiza mediante:
mutaciones genticas, cambios en la estructura y nmero de los cromosomas,
mutaciones de los portadores extranucleares de la herencia, recombinacin,
seleccin, aislamiento, hibridacin y alteraciones casuales de las frecuencias
gnicas en poblaciones pequeas o por fluctuaciones del tamao de la poblacin
(Johnston, 1999; Ennis, 2000; Bazzaz, 2001; Cupples, 2001).

Por otro lado, la palabra "mutacin" trmino de origen latn mutare -
cambiar, fue usado para indicar un cambio hereditario por el botnico holands y
bilogo evolutivo Hugo De Vries (Johnston 1999). Es decir cualquier alteracin del
material gentico heredable, incluye fenmenos diversos tales como: cambios en
el nmero de cromosomas, cambio en la estructura de conjunto de los
cromosomas y cambios dentro de los genes mismos (Harrison 2000). La pregunta
fundamental acerca de la naturaleza de las mutaciones, es qu mecanismos y
que factores controlan y tasan la mutagnesis? Esta pregunta ha estado en el
centro de un intenso estudio durante las ltimas dcadas, los Investigadores que
han trabajado sobre la mutagnesis han realizado estudios para comprender los
orgenes de las mutaciones y sus efectos en los procesos biolgicos como la
carcinognesis y la evolucin. (Harrison 2000; Ennis 2000; Cupples 2001).

De Vries "descubridor" de Mendel, public "Die mutations theorie", y concluy en
gran parte que la evolucin se efecta por medio de cambios discretos repentinos,
o "mutaciones", como l las llam aunque sus ideas fueron inaceptables como una
teora evolutiva general, y muchos de los cambios repentinos que observ
resultaron que no eran debido a las mutaciones, sino debido a la redistribucin de
la variacin gentica existente por la recombinacin (Johnston, 1999). De Vries
reconoci la importancia de la mutacin como un proceso gentico fundamental.
En realidad, la mutacin es la fuente principal de toda nueva variacin gentica y
sin ella no habra sido posible la evolucin (Johnston, 1999). "La causa principal
de variabilidad que hace posible el proceso evolutivo de la vida son las
mutaciones, que no son sino
9
alteraciones espontneas del material hereditario (Grant y Shoemaker, 2000;
Harrison, 2001).

En relacin con lo anterior se reconocen varios tipos de mutaciones, la ms
comn es la llamada "mutacin puntiforme" causada por un cambio dentro del gen
al nivel molecular (Ennis, 2000), en contraste con las mutaciones que resultan de
una prdida o delecin (deficiencia) de una porcin de un cromosoma. La mayora
de las mutaciones puntiformes son mutaciones espontneas. Estas mutaciones a
menudo son reversibles en el sentido del que el gen puede mutar en retroceso, o
sea, regresar a su condicin original mientras que las mutaciones por delecin o
deficiencia no pueden invertirse (Johnston, 1999). Las mutaciones tambin
pueden originarse por la transferencia y readhesin de un segmento cromosmico
u otro cromosoma, fenmeno conocido como "translocacin" cromosmica (Ennis,
2000). La situacin particular en la que un cromosoma se rompe en uno o ms
segmentos, se reconstituye pero en orden diferente se le llama "inversin" y puede
ocasionar tambin mutaciones (Harrison, 2001; Cupples, 2001).

Otro aspecto importante es la variabilidad gentica, que se puede definir
como: "la habilidad gentica para variar", y por lo tanto, es tener la capacidad para
responder tanto a variaciones de ndole ambiental como a cambios en los
objetivos de seleccin, por lo que la variabilidad gentica constituye la base del
progreso gentico (Rochambeau et al., 2000). En una especie determinada, la
variabilidad puede representarse de tal modo que las diferencias entre individuos
sean graduales y en este caso se habla de variabilidad continua y estas
diferencias pueden ser debidas a factores ambientales que solo afectan al fenotipo
y que por tanto no son heredables (Burd, 2000). La variabilidad discontinua, en
cambio, es brusca y se debe a cambios que no responden a las leyes de la
herencia, es decir, que aparecen de forma espontnea en el seno de una
poblacin y estos cambios se llaman mutaciones (Reeve y Sherman, 1999). La
variacin es la materia prima sobre la cual la seleccin acta (Ayala et al., 2000).
El resultado, a travs del tiempo, de la interaccin de ambos procesos es la
evolucin y "La variacin hereditaria es el
10
producto de la mutacin, el paso de material gentico entre poblaciones y la
recombinacin de factores genticos, unidos con una seleccin que moldea el
patrn de la variacin (Barton y Keightley, 2002; Reznick, 2000).

Dentro de los elementos que contribuyen a la evolucin de las poblaciones
cuando estas son pequeas, es el azar el cual puede provocar cambios en sus
frecuencias gnicas (Hastings, 2001), sin embargo, en una poblacin muy grande,
los eventos al azar no son importantes para la poblacin en su totalidad, mientras
que en una poblacin pequea, dichos eventos pueden cambiar drsticamente el
pool gnico (Hastings, 2001), y cuando se presenta un aumento o disminucin en
la frecuencia de un gen en generaciones sucesivas de una poblacin que resulta
del azar, se llama deriva gnica, (Ayala et al., 2000).

Otro de los procesos evolutivos es la migracin, que es el movimiento de
organismos de un lugar a otro y puede ser en dos sentidos: cuando los individuos
salen de una poblacin se habla de emigracin; la llegada de individuos a una
poblacin se conoce como inmigracin y permite el cambio evolutivo ya que causa
el movimiento de genes hacia dentro o hacia fuera de una poblacin y a este
fenmeno se llama flujo gnico (Mousseau y Olvido, 2001). La migracin puede
conducir a cambios de las frecuencias de los alelos (Tonsor y Moore, 2001),
cuando implican animales en movimiento o plantas que cambian de ambiente y los
patrones geogrficos de la variacin gentica intraespecfica estn determinados
por la historia de la migracin. (Hagen, 2001).

Sin duda un aspecto bsico de la teora de la evolucin es la seleccin
natural, la cual es consecuencia de la reproduccin diferencial de unas variantes
respecto a otras, es decir, de la seleccin natural la cual acta sobre los dos
principales recursos de la variacin gentica: la mutacin y la recombinacin; esta
accin de la seleccin natural sobre la variabilidad hace posible que sobrevivan
individuos en la poblacin que interaccionen de una manera ms eficiente con el
ambiente (Reznick, 2000). Darwin y Wallace propusieron en 1859 que la
naturaleza produce un nmero

11
excesivo de organismos y luego selecciona las condiciones genticas ms
favorables (Whitlock y Phillips 1999), en esencia, la seleccin natural es
reproduccin diferencial de unas variantes genticas respecto de otras. Se puede
definir de manera ms rigurosa como el proceso que resulta del cumplimiento de
las tres condiciones siguientes: (1) variacin fenotpica entre los individuos de una
poblacin, (2) supervivencia o reproduccin diferencial asociada a la variacin, y
(3) herencia de la variacin. Si en una poblacin de organismos se dan estas tres
condiciones, entonces se sigue necesariamente un cambio en la composicin
gentica de la poblacin por seleccin natural (Reznick 2000; Mitton 2001).

Algunas de las preguntas actuales en seleccin natural son: qu tan fuerte
es la seleccin sobre los rasgos cuantitativos en la naturaleza?, es fuerte la
seleccin direccional comn?, la seleccin de viabilidad es tpicamente ms
fuerte o ms dbil que la seleccin sexual?, est la fuerza de la seleccin
correlacionada con el perodo de tiempo sobre el cual este es medido? (Hoekstra
et al., 2001). Brandon, (1990), menciona que lo que se encuentra bajo discusin,
es el intento de respuesta a las siguientes preguntas: dnde acta la seleccin
natural? o cul es el nivel de accin de la seleccin natural?, ya que los mismos
bilogos estn en desacuerdo al intentar dar respuesta a las interrogantes
anteriores y quiz lo que haga falta es una revisin terica sobre las implicaciones
o consecuencias que se derivan de la teora de la evolucin por seleccin natural
(Brandon, 1990). Las respuestas a stas preguntas y otras similares son
fundamentales para entender cmo la seleccin determina el cambio evolutivo y la
adaptacin (Hoekstra et al., 2001).

La adaptacin, por otro lado, ha sido una idea central en biologa evolutiva
desde Darwin, pero ha sido difcil de caracterizar las adaptaciones en un solo
trmino unificado y contina generando controversia; sin embargo, no hay ninguna
discordancia en que la seleccin natural es el nico proceso que crea las
adaptaciones (Reeve y Sherman 1999; Burd 2000). Los bilogos evolutivos usan
el trmino adaptacin de dos maneras distintas pero relacionadas: la adaptacin
es un proceso evolutivo y un producto de seleccin natural, en ambos casos, la
evolucin


12
se maneja por la seleccin natural. El uso del trmino es dado por Mitton (2001)
de la siguiente manera: (1) 'la adaptacin' es un proceso de evolucin en que los
rasgos en una poblacin son modificados por la seleccin natural para enfrentar
los desafos del ambiente local. (2) 'una adaptacin' es un rasgo del fenotipo
amoldado por la seleccin natural. El rasgo podra ser fisiolgico, de
comportamiento, de desarrollo o morfolgico.

Con la combinacin de la Teora de la Evolucin de Darwin y con los
aportes de la Gentica, se gener lo que se conoce como Neodarwinismo o teora
sinttica de la evolucin (T.S.E.), la que se sustenta en los siguientes principios:

1. La unidad sobre la que acta la evolucin no es el individuo sino otra de
orden superior: la poblacin (Schaal y Olsen, 2000).

2. En las poblaciones hay variabilidad entre los individuos. Esto se observa
en la especie humana y en cualquier otra, si se analiza con detalle (Schaal
y Olsen, 2000). Sobre la variabilidad del contenido gentico, actuaran la
seleccin natural, la mutacin, la migracin y la deriva gentica provocando
cambios en las frecuencias gnicas. (Hoekstra, 2001).

Actualmente la teora sinttica de la evolucin se apoya en la teora
darwinista de la seleccin, en los conocimientos de la gentica y del tratamiento
matemtico de la dinmica de poblaciones abarcando la teora del gen, la teora
cromosmica, la evolucin molecular y las investigaciones evolucionistas se
desarrollan principalmente en dos direcciones: por una parte la biologa
evolucionista especial que trata de explicar la filognesis y el parentesco de
grupos de especies ms o menos grandes y por la otra la biologa evolucionista
general (Ayala et al., 2000).

La mayora de los investigadores interesados en las filogenias asumen
explcitamente dos supuestos (Farris, 1986): 1) La evolucin es "descendencia con
modificacin", 2) Las similitudes observadas son explicables por herencia y
ancestra



13
comn)

La "Teora Sinttica moderna" basada en una concepcin de la transmisin de los
caracteres estrictamente mendeliana, tiene como premisas fundamentales:

1.- La Evolucin es un proceso gradual de sustitucin de alelos en el seno de una
poblacin. La fuente de variabilidad de estos alelos son las mutaciones puntuales
o micromutaciones (Schaal y Olsen, 2000; Harrison, 2001).

2.- El material gentico es slo la materia prima, lo que dirige el proceso evolutivo
es la seleccin (Bowler 1999; Reznick, 2000; Hoekstra et al., 2001).

En "Sobre el Origen de las Especies", Darwin propuso que la seleccin
natural tena un papel fundamental sobre la especiacin, pero este punto de vista
ha disminuido con la aparicin del concepto de la "Teora sinttica de la evolucin"
o "Sntesis moderna" (Bowler 1999; Filchak et al., 2000), fortalecida en el siglo
veinte por Stebbins con su obra "Variacin y evolucin en plantas"; Dobzhansky
con su obra "Gentica y el origen de las especies"; "Sistemtica y el origen de las
especies" de Mayr; y "Modo y tiempo en evolucin" de Simpson (Ayala et al.,
2000).

En 1908, Hardy y Weinberg efectuaron independientemente una deduccin
a partir de las leyes de Mendel que constituira el inicio de la gentica evolutiva y
de poblaciones, la cual se fundamenta en que las frecuencias relativas de los
genes en una poblacin permanecern constantes de una generacin a la
siguiente si: a) La poblacin es grande. b) No hay seleccin en favor o en contra
de un gen o alelo especfico, es decir, si el apareamiento ocurre al azar. c) No hay
mutaciones. d) No hay inmigracin o emigracin en la poblacin. (Hastings, 2001;
Harrison, 1999), y surge la interrogante cmo medir los cambios evolutivos?

2.1.1. Teora del equilibrio puntuado. En 1977, el bilogo francs P. Grass
escriba sobre la comprobacin en la naturaleza de la actuacin de la seleccin




14
natural: "...Es sencillamente la observacin de factores demogrficos, de
fluctuaciones locales de genotipos y de distribuciones geogrficas. A menudo las
especies observadas han permanecido prcticamente sin cambios durante cientos
de siglos!". La constatacin de este fenmeno, se ha plasmado finalmente en la "
Teora del equilibrio puntuado", propuesta en 1972 por los paleontlogos Eldredge
y Gould (Sheldon, 2000). Los dos postulados de esta teora son (Gould y Elredge,
1993):

1.- La estasis: la mayora de las especies no exhibe cambio direccional alguno
durante su estancia sobre la tierra. Aparecen en el registro fsil con una apariencia
muy similar a cuando desaparecen.

El cambio morfolgico es generalmente limitado y no direccional.

2.- La aparicin repentina: en cualquier rea local, una especie no surge
gradualmente por la transformacin constante de sus antecesores, sino que
aparece de una vez.

En la actualidad, las investigaciones evolucionistas se desarrollan
principalmente en dos direcciones: por una parte la llamada biologa evolucionista
especial que trata de explicar la filognesis y el parentesco de grupos de especies
ms o menos grandes, y por otra, la biologa evolucionista general, que investiga
el ulterior desarrollo de la teora de la evolucin, de las fuerzas activas, de la
interaccin de los factores y de las leyes que gobiernan los procesos de
microevolucin y macroevolucin (Reznick, 2000; Sheldon, 2000; Callahan, 2001)

Una de las ms recientes teoras evolutivas es, la teora neutralista de la
evolucin molecular, propuesta por Kimura en 1968 y apoyada por otros autores,
admite que la evolucin de los caracteres morfolgicos, etnolgicos y ecolgicos
est gobernada mayoritariamente por la seleccin natural. Estos autores
proponen, sin embargo, que la evolucin de la mayora de las protenas y de los
genes que las




15
codifican se debe en su mayor parte al azar. Kimura (1983), seala que el carcter
diferenciador del Neodarwinismo es el papel central que da a la seleccin en la
produccin de diferencias genticas entre las especies. Este punto de vista resulta
del todo razonable al considerar el material hereditario como un paquete de genes,
cada uno de los cuales tiene algn papel importante.

Kimura (1983), propone en su teora neutralista que la mayor parte de las
substituciones mutantes no son mantenidas por una seleccin darwiniana positiva
sino que son fijadas aleatoriamente por deriva gentica, aunque este autor no
renuncia a que, una vez fijadas en el tiempo, lleguen a tener importancia cuando
las especies se vean sometidas a cambios ambientales. Kimura ve confirmada su
hiptesis al observar la constancia de la tasa de substitucin encontrada en los
aminocidos de las hemoglobinas y la de los nucletidos de los pseudogenes
(Hasatoshi, 1983), As, Kimura lleg a dos conclusiones:

1 La mayora de las sustituciones de nucletidos son el resultado de la
fijacin al azar de mutantes neutros, o casi neutros, ms que el resultado de una
seleccin darwiniana.

2 Muchos de los polimorfismo protenicos son selectivamente neutros o
casi neutros y su persistencia en la poblacin se debe al equilibrio existente entre
la aportacin de polimorfismo por mutacin y su eliminacin al azar.

Segn Bromham (2001), una consecuencia de la teora neutralista de la
evolucin es la existencia de un reloj molecular aleatorio, segn el neutralismo, el
ritmo en el que se sustituyen las variantes genticas en las poblaciones es
proporcional a la tasa de mutacin neutra, as, cuando dos poblaciones o especies
se separan, el nmero de diferencias genticas que le separan ser proporcional
al tiempo que hace que han divergido las dos especies, de este modo, el nmero
de diferencias que existe entre un conjunto de secuencias correspondientes a
distintas especies puede usarse como un reloj molecular que permite ordenar los
tiempos


16
relativos de divergencia entre esas especies, la idea sera equivalente a utilizar el
nmero de kilmetros de las calles de varias ciudades para predecir el orden
relativo de los tamaos de las ciudades. El reloj molecular es una herramienta muy
til para establecer los tiempos relativos de ramificacin de rboles evolutivos

2.1.2. Especiacin

La especiacin es definida como la formacin de dos o ms nuevas
especies de una especie ancestral (Wood y Rieseberg, 2001). El proceso de
especiacin es el responsable de la basta cantidad de diversidad biolgica que se
encuentra actualmente, sin embargo se conoce poco acerca de los mecanismos
biolgicos de la formacin de especies, debido al largo tiempo de los procesos y a
que son pocas las excepciones que pueden ser observadas en la naturaleza o en
un laboratorio (Wood y Rieseberg, 2001).

Ms de 150 aos despus del origen de la publicacin de "On the Origin of
species" de Darwin, la pregunta del cmo dos especies divergen de una sola
especie ancestral sigue todava vigente, as como cuntos cambios genticos
son necesarios para crear nuevas especies?, todos los genes cambian en una
cantidad pequea?, o la especiacin depende de un solo grupo de genes
conectados con la reproduccin? (Gee, 2000). Por otro lado, la formacin de dos
especies separadas a partir de un solo antepasado y el mantenimiento.
subsecuente de estas nuevas especies sin la hibridacin, es un problema central
en la biologa evolutiva (Gee, 2000b). Una de las preguntas ms persistentes en la
biologa evolutiva es: cmo surgen o se originan nuevas especies? (Korol, 2000).

El entendimiento de la especiacin es un problema fundamental en biologa
(Dieckmann y Doebeli, 1999). Las especies difieren en el nmero y forma de
cromosomas as como en la anatoma, fisiologa y gentica. La reestructuracin
del cromosoma juega un papel importante en la evolucin de especies debido a
como sus genomas se expresan y a los mecanismos de aislamiento reproductor
(Burt,



17
2001). De acuerdo con Otte (2001), las especies pueden surgir por dos
mecanismos: la anagnesis y la cladognesis, sea de una forma o de otra, para
que exista especiacin debe haber divergencia gentica y aislamiento reproductivo
entre dos poblaciones antes relacionadas, estos dos procesos pueden ocurrir de
dos maneras conduciendo a la especiacin aloptrica o a la especiacin
simptrica.

De acuerdo con Rieseberg y Ungerer (2001), la cladognesis es el modo
fundamental de especiacin y el responsable directo de la biodiversidad, la
cladognesis se produce por aislamiento reproductivo de las poblaciones de una
especie y las barreras reproductoras se pueden dividir en precigticas y
postcigticas; las barreras precigticas son mecanismos de aislamiento que tienen
lugar antes o durante la fecundacin y las ms importantes son:

a) La reproduccin que se produce en diferentes pocas del ao.

b) Los mecanismos conductuales que utilizan las especies para
reconocerse entre ellas por ejemplo, el cortejo de muchos animales, o el canto de
numerosas especies de aves; cuya finalidad es la del reconocimiento mutuo entre
los individuos de la misma especie.

c) La incompatibilidad de las estructuras utilizadas en el acoplamiento, por
ejemplo, la genitalia de los insectos, aunque determinadas especies son muy
semejantes exteriormente, su genitalia presenta diferencias que hacen imposible
el acoplamiento de un macho de una especie con una hembra de otra.

d) Aunque algunas especies viven en el mismo hbitat, difieren en el micro
ambiente al que estn adaptados, por ejemplo, determinados parasitoides
(Hymenoptera, Chalcidoidea) que an viviendo juntos parasitan a especies
hospedadoras diferentes y;






18
e) Cuando los gametos no reconocen los de otro a nivel molecular, por
ejemplo, los granos de polen pueden llegar al estigma de diferentes especies pero
slo pueden fertilizar vulos de la suya propia, o de especies muy semejantes.

Mientras que las barreras postcigticas (Howard, 2000), son los abortos
espontneos, esterilidad del hbrido, muerte prematura e hbridos dbiles; el
aislamiento reproductor se produce mediante mecanismos de aislamiento
postcigticos, es decir, posteriores al apareamiento y formacin del cigoto, y por
medio de mecanismos de aislamiento precigticos, esto es, mecanismos que
impiden que se llegue a formar el cigoto.

Por otro lado, la especiacin aloptrica, vicariante o geogrfica, es aquella
que se presenta cuando las poblaciones comienzan a divergir y el flujo de genes
entre ellas se restringe o se ve totalmente interrumpido como una consecuencia
de la dispersin y divergencia en diferentes ambientes (Mousseau y Olvido, 2001).
El aislamiento geogrfico es, a menudo, la primera etapa de este proceso
(Howard, 2000). La separacin espacial durante un largo periodo de tiempo da
lugar a la aparicin de novedades evolutivas en una o en las dos poblaciones
(Wood y Rieseberg, 2001).

Mientras que la especiacin simptrica se refiere a las nuevas especies que
surgen sin el aislamiento geogrfico es decir, en el mismo lugar geogrfico y que
es el origen de dos o ms especies de una sola poblacin local (Kondrashov y
Kondrashov, 1999; Dieckmann y Doebeli, 1999). Puede ocurrir cuando se genera
aislamiento en el mismo sitio por rangos de distribucin, ocasionando que el flujo
gentico sea eliminado entre las poblaciones y se forman especies nuevas
(Mousseau y Olvido, 2001), por variacin de nichos o por el conjunto de
mecanismos que produce una o ms especies nuevas a partir de una especie
ancestral sin segregacin geogrfica de las poblaciones, existe alguna barrera de
tipo biolgico (Wood y Rieseberg, 2001).





19
La especiacin hbrida o "recombinacional" se refiere al origen de nuevas
especies va hibridacin entre especies paternales divergentes cromosmica o
genticamente y de acuerdo con los estudios de simulacin realizados por
Ungerer et. al.,(1998), sugieren que este tipo de especiacin es puntuado, es decir
con largos perodos de estasis, en los cuales la mayora de las especies no exhibe
cambio direccional alguno durante sus estancia, seguido por abruptas transiciones
en las cuales las especies paternales individuales son desplazadas rpidamente
por las neoespecies hbridas (McCarthy, 1995; Ungerer et al., 1998).

En relacin con la formacin de subespecies esta se presenta cuando una
poblacin debilita su entrecruzamiento reproductor con el resto de las poblaciones
de la especie, por encontrarse en periodo de especiacin o cladognesis. Esta
poblacin puede seguir dos caminos diferentes (O'Hara, 1993):

1.- La poblacin debilita sus relaciones reproductoras y posteriormente se
produce una ruptura permanente entre la poblacin y el resto de la especie. En
este caso estaramos ante un verdadero fenmeno de diferenciacin, una
tendencia evolutiva propia que conlleva un destino histrico concreto: la
separacin y formacin de una nueva especie. La tendencia evolutiva propia
implica la adquisicin de novedades evolutivas o, autapomorfas. Es una
subespecie que formar una especie.

2.- La poblacin debilita sus relaciones reproductoras pero posteriormente
es absorbida por el resto de la especie, con lo que la separacin es slo temporal.
Es la misma situacin que en el apartado anterior (diferenciacin de una
poblacin). Sin embargo, tiene un destino histrico diferente en el que no se forma
una nueva especie, debido a la falta de tendencias evolutivas propias. Es una
subespecie que no formar una especie.







20
2.1.3. Filognesis y Filogenia

Dobzhansky declar que "Nada tiene sentido en biologa excepto a la luz de
la evolucin", y un corolario muy particular sobre el tema central de este
documento, es que todo tiene mucho ms sentido a la luz de la filogenia (Soltis y
Soltis, 2000).

Los trminos filognesis y filum fueron acuados por Haeckel en 1866 del
siguiente modo: la filognesis hace referencia a un proceso particular, mientras
que la filogenia es la ciencia que estudia los procesos y sus resultados (Ax, 1987).
Otros autores enfatizan la bifurcacin como el eje central de la filogenia, por
ejemplo, O'Hara (1988) utiliza la siguiente definicin: filogenia es la crnica
evolutiva: la secuencia ramificada del cambio de caracteres en los organismos a
travs del tiempo. De acuerdo con estas ideas, el objetivo de la investigacin
filogentica es descubrir los productos de la filognesis y su ordenacin o relacin
en la secuencia de especiacin en el tiempo, es llamado sistemtica filogentica y
el resultado de este empeo es llamado sistema filogentico (Wagner, 2000). Por
lo tanto, la filogenia se encarga mayoritariamente del estudio de la cladognesis,
esto es: el proceso de origen de nuevos linajes (ramas) como resultado de la
bifurcacin de las especies (Ax, 1987).

La filognesis cubre la gnesis de todas las unidades en la Naturaleza y la
anagnesis es el proceso de cambio evolutivo en los linajes, es decir, el origen de
novedades evolutivas en las poblaciones de especies (Wiley, 1981) Este trmino
es sinnimo de "evolucin filtica" y es el proceso por el cual un carcter gentico
o fenotpico cambia en una especie. No hace referencia a la bifurcacin sino al
cambio gradual de un rgano en el transcurso del tiempo. A nivel de especie las
filogenias inferidas a travs de datos moleculares proporcionan registros indirectos
de los eventos de especiacin que han dirigido la expansin de las especies y
ofrece un enorme potencial para la investigacin de las causas generales y las
tasas de especiacin dentro de clados (Barraclough y Nee, 2001). Una especie
filogentica es un grupo de organismos que comparten rasgos nicos morfolgicos
o genticos que


21
les hacen distintos de otros grupos, estos rasgos compartidos se infieren por ser el
resultado de un linaje comn y este concepto (especie filogentica) tiene sus
races en la rama de biologa evolutiva que se enfoca en reconstruir la historia
evolutiva de los organismos (Wood y Rieseberg, 2001).

La filogenia ocupa un lugar central en la sistemtica y en la taxonoma, al
ayudar a resolver problemas de posicin y nomenclatura (Forey, 1992). El centro
del concepto de la sistemtica filogentica es el uso de caracteres apomrficos o
derivados para reconstruir las relaciones ancestrales ms comunes y la
agrupacin de taxa basadas en el linaje comn. Por qu debemos estar
interesados en este enfoque en el que la sistemtica filogenetica es diferente de la
sistemtica tradicional? la respuesta es simple: las clasificaciones que son
conocidas por no ser filogenticas, son posiblemente artificiales y son por
consiguiente, tiles slo para la identificacin y no para responder a preguntas
acerca de la evolucin (Wiley et al., 1991).

Para la de reconstruccin filogentica, existen los mtodos de distancia y
hay dos grupos importantes de anlisis para examinar lazos filogenticos entre las
secuencias: mtodos fenticos o de distancia y mtodos cladsticos. El principio en
que se fundamentan los mtodos de distancia (fenticos) es que los organismos
ms parecidos deben de ser los filogentica mente ms emparentados, el
problema es que el parecido puede conducir a conclusiones errneas y la solucin
que se ha propuesto es utilizar una gran cantidad de caracteres: algunos sern
influenciados por la seleccin, pero la mayora reflejarn los patrones evolutivos
(Sneath y Sokal, 1973; Hull, 1988).

En los mtodos de distancia calcula un ndice de distancia entre pares de
taxa, tomando en cuenta cules son los caracteres que comparten y, a partir de
ellos, siguiendo una serie de reglas se obtiene un rbol filogentico (Sokal, 1985).
En otras palabras, reducen todos los caracteres analizados a un solo nmero (la
distancia "evolutiva") entre un par de taxa. La eleccin del mtodo para obtener las
distancias evolutivas es importante, ya que los diferentes estimadores de distancia
se


22
construyen a partir de distintos supuestos del proceso evolutivo (Nei, 1987).

Una vez transformada la matriz de caracteres original a una matriz de
distancia entre pares de taxa, se requiere elegir el mtodo de reconstruccin
filogentica para lo cual existen gran cantidad de mtodos, que tienen diferentes
supuestos y diferentes capacidades y entre los ms utilizados se tienen al UPGMA
y al Neighbor-joining (Unin de vecinos), UPGMA (unweigthed pair group method
with arithmetic mean), este fue uno de los primeros mtodos cuantitativos para la
reconstruccin filogentica y fue propuesto originalmente por Sokal y Michener
(Sneath y Sokal, 1973).

Este es uno de los pocos mtodos que presentan directamente una "raz"
(la mitad de la distancia entre la ltima rama y el resto del rbol), y las distancias
de las ramas son simplemente las medias entre las distancias de cada grupo de
organismos. La ventaja ms grande que tiene este mtodo es que es rpido, y
puede ser bastante eficiente en la reconstruccin de la filogenia, si las tasas de
cambio son relativamente constantes (Sokal, 1985). Si existe heterogeneidad en la
tasa de cambio evolutivo entre linajes, el mtodo de UPGMA puede conducir a
errores en la reconstruccin del rbol filogentico (Nei, 1991).

Uno de los mtodos de distancia ms extensivamente usados actualmente
es el de Neighbor-Joining (Unin de vecinos) (Saitou y Nei 1987), ya que es
mucho ms confiable a los problemas de diferencias en las tasas de substitucin
que el UPGMA y otros algoritmos, y es razonablemente rpido en la bsqueda de
la reconstruccin filogentica (Hillis et al., 1994), en este mtodo, se buscan
secuencialmente los taxa ("vecinos") que minimizan el largo total del rbol y cada
vez que une un par de taxa, se vuelve a ajustar el largo de las ramas del rbol
para cada par de nodos, basndose en la divergencia promedio entre los pares de
nodos, por lo tanto no requiere que exista un reloj molecular estricto (Li, 1997). Por
otra parte, se ha demostrado que si se emplea el anlisis de distancia adecuado,
el mtodo de distancia puede ser tan bueno o mejor que los de parsimonia para
encontrar el rbol



23
filogentico verdadero (Nei, 1991; Hillis et al., 1994).

De acuerdo con Simpson (1961), los "fenetistas" analizan los datos
mediante uno o ms programas de ordenador que harn que se agrupen las
OTU's (Unidades Taxonmicas Operativas), concepto introducido por Sneath y
Sokal (1973), en funcin de ndices de semejanza, o de diferencia, global y
producen un diagrama ramificado (dendrograma) denominado fenograma, los
fenogramas son dendrogramas utilizados por el feneticismo y las hiptesis
filogenticas pueden generarse con base en el fenograma que resume los
patrones de similitud total.

De acuerdo con Kumar y Fiplipski (2001), las tcnicas computacionales han
pasado a ser una herramienta fundamental para el manejo y anlisis de la
informacin biolgica. Si bien esto es aplicable a cualquier rea de la biologa, es
particularmente importante en la biologa molecular, esto se evidencia en el
desarrollo, mantenimiento y permanente actualizacin de gigantescas bases de
datos pblicas de secuencias biolgicas tanto de cidos nucleicos (GenBank,
EMBL, JDB, etc.) como de protenas (SwissProt, PIR, PDB, etc.); y en la tendencia
creciente en el uso de herramientas bioinformticas o de biocomputacin como
apoyo a las tcnicas experimentales (Taylor, et al., 1995).

El desarrollo de la bioinformtica y la biocomputacin ha generado tcnicas
de anlisis de secuencias de cidos nucleicos y protenas con mltiples objetivos:
determinacin de homologa, alineamiento de secuencias homlogas, prediccin
de estructura, filogenia, evolucin molecular, diseo de frmacos, entre otros
(Brock, 1994).

Por anlisis de secuencias se entiende el proceso de hacer inferencias
biolgicas a partir de las estructuras primarias de las protenas, el ARN y el ADN;
una de las inferencias ms ambiciosas del anlisis de secuencias es que, a partir
de la estructura primaria (secuencia de aminocidos), se pueda predecir la
estructura y



24
funcin de la protena; o incluso hacer esta prediccin a partir de la secuencia de
bases nitrogenadas del gen codificante (Bodmer, 1995).

Desde la determinacin de la estructura y funcin del ADN por Watson y
Crick, se conoce con detalle cmo se interpreta una determinada secuencia de
bases nitrogenadas para sintetizar la secuencia de aminocidos de una protena,
esto constituye el llamado dogma central de la biologa. Se afirma adems que en
teora es posible determinar las propiedades de una protena a partir de su
secuencia de aminocidos (Welsh y McClelland, 1990).

Sin embargo, esta informacin se conoce, no ha sido posible la
implementacin de mtodos certeros, por medio de los cuales, dada una
secuencia de ADN, se pueda deducir la funcin de la protena para la cual ste
codifica (Steffen, 1995). A pesar de esto, el anlisis de secuencia contina siendo
un rea de mucho inters. A tal punto, que el lograr obtener un mtodo preciso de
anlisis de secuencia se ha convertido per se en un objetivo de la investigacin
cientfica que agrupa a bilogos, matemticos, estadsticos, computistas, fsicos,
etc., (Brock, 1994).

Nei y Kumar (2000), mencionan que el anlisis de secuencias se realiza en una
primera instancia sobre las cadenas de caracteres que representan aminocidos o
nucletidos sin importar a priori su estructura y funcin, de hecho el anlisis de
secuencias biolgicas tiene muchas aplicaciones en el procesamiento de textos en
computacin y por otro lado, el anlisis de secuencia no est siendo utilizado
exclusivamente por aquellos interesados en predecir estructura, tambin es
empleada para determinar relaciones evolutivas entre organismos.

El anlisis de secuencias est siendo empleado por algunos investigadores
para construir nuevos rboles filogenticos que estn revolucionando la
sistemtica de los organismos vivos y es tal vez en esta rea donde el anlisis de
secuencias ha dado los mayores resultados inmediatos (Kumar y Filipski, 2001).
En las secciones



25
siguientes se hacen unas breves descripciones de los conceptos centrales que
implican el trabajo con anlisis de secuencias.

Los proyectos de secuenciamiento de genomas de organismos biolgicos
como el del Genoma Humano, estn generando inmensa cantidad de informacin
de secuencias de cidos nucleicos y aminocidos. Esta informacin es
almacenada en Bases de Datos internacionales, a las cuales los investigadores
envan las secuencias una vez que son determinadas (Taylor, et al., 1997).

El explosivo crecimiento de la informacin genmica y las complejas
relaciones a travs de las cuales debe ser relacionada, est exigiendo a las
ciencias de la computacin el desarrollo de cada vez ms sofisticados esquemas
de diseo y administracin de bases de datos y se puede decir que en los ltimos
aos la informacin biomdica est "empujando" el desarrollo de las bases de
datos. (Waldrop, 1995).

Estas bases de datos son esfuerzos coordinados, que intentan en lo
posible, almacenar la informacin de una manera no-redundante. Existen
principalmente dos bases de datos de este tipo en el mundo, para secuencias de
ADN: El Genbank en el National Center for Biotechnology Information de los
Estados Unidos y el EMBL en el European Bioinformatics Institute de Europa. Del
mismo modo, existen diversas bases de datos de secuencias de protenas a nivel
mundial, como el PIR, SwisProt y PDB (Taylor, et al, 1997).

Un ejemplo de la tendencia a que el uso de estas bases de datos sea
sencillo e integrado directamente con la informacin bibliogrfica, lo muestra el
National Center for Biotechnology Information, que administra dos bases de datos
distintas, una de cidos nucleicos y otra de aminocidos; y junto con el Medline, la
base de datos de citas bibliogrficas de la literatura biomdica de la National
Library of Medicine, conforman un sistema integrado de datos de genomas
biolgicos. Para la navegacin fluida a travs de esta data, el NCBI cre el Entrez,
un sistema de



26
navegacin entre las tres bases de datos, que permite un fcil acceso de toda la
informacin relativa a determinada secuencia (Waldrop, 1995).

Si bien el diseo de estas bases de datos y su sistema de navegacin
resulta atractivo, algunos autores consideran que los tipos de bsquedas que
pueden hacerse sobre ellos son muy limitadas (Waldrop, 1995)

De acuerdo con Taylor et al., (1997), estas son slo algunas de las bases
de datos existentes para biologa molecular, existen otros tipos de servidores ms
especficos, tanto para ADN como para protenas, por ejemplo, servidores de
dominios de protenas, de oligonucletidos, de enzimas y sus sitios de restriccin,
de mutaciones, entre otras. Estas bases de datos pretenden actualizar
mutuamente su informacin, de tal modo que solicitar o enviar una secuencia a
una de ellas sea prcticamente lo mismo que hacerlo a otra. Sin embargo esto no
siempre es as, por lo cual es conveniente familiarizarse con sus interfaces, y
hacer las solicitudes de secuencias a todos ellos.

BLAST y FASTA se han convertido en los algoritmos estndares de
comparacin de secuencias problema en la Intemet, la operacin de ejecutar
comparaciones con estos organismos tambin es llamada "bsqueda de similitud
de secuencias" (sequence similarity searches). Estos dos algoritmos,
suficientemente probados y mejorados desde su creacin, emplean distintos
enfoques estadsticos al momento de comparar secuencias.

Sus diferencias estriban principalmente en velocidad y precisin. Un
enfoque es conectarse a servidores remotos de BLAST, de FASTA y obtener a
partir de ellos los resultados de inters. Ms an, cuando este acceso es gratuito y
mundialmente actualizado (Waldrop, 1995)

BLAST fue desarrollado por Altschul et al., (1990) y es el algoritmo ms
empleado por el NCBI (National Center for Biotechnology Information). Los
usuarios




27
del GenBank, tienen la posibilidad inmediata de emplear el BLAST al hacer all las
bsquedas de sus secuencias (Brock, et al, 1995).

La principal caracterstica del BLAST es su velocidad, pudiendo tomar
pocos minutos cualquier bsqueda en la totalidad de la Base de Datos. De hecho,
los resultados del BLAST ejecutados a travs de la pgina Web del NCBI se
presentan en pantalla inmediatamente despus de calculados (aunque tambin
pueden ser recibidos por correo electrnico).

Adems de velocidad, el BLAST posee otras fortalezas, en primer lugar las
bases de datos que emplea, por ejemplo la nr (non redudant) que posee los
registros no redundantes entre las dos bases de datos principales a nivel mundial:
GenBank en USA y EMBL en Europa (Taylor, et al, 1997).

FASTA, desarrollado por Lipmann y Pearson en 1985, es empleado
mayormente por el EMBL - EBI (European Molecular Biology Laboratories -
European Bioinformatics Institute), resulta notablemente ms lento, empleando
para bsquedas equivalentes hasta varias horas. Por esta razn, sus resultados
slo pueden recibirse va correo electrnico. Sin embargo este algoritmo posee
algunas ventajas:

a) Posibilidad de comparacin contra secciones del GenBank como de
secuencias de Mamferos, Plantas, Bacterias, etc.

b) Mayor precisin bajo ciertas configuraciones iniciales de sus parmetros.

El FASTA resulta conveniente para bsquedas avanzadas de mayor
precisin, ambos algoritmos proveen como primer resultado una medida
cuantitativa de la similaridad de la secuencia problema contra cada una de las
secuencias de la bases de datos. BLAST y FASTA son adems herramientas de
alineamiento local por pares (pairwise), que dan como resultado un alineamiento
de nuestra secuencia problema con cada una de las secuencias resultantes de
alta similitud. Este segundo resultado


28
es una medida cualitativa de la similitud de la secuencia problema con las
secuencias de las bases de datos (Gaeta, 1995).

De acuerdo con Kumar y Filipski (2001), el alineamiento es una herramienta
cualitativa que permite dar los primeros pasos hacia la conclusin de que dos o
ms secuencias son homlogas y consiste en hacer coincidir las secuencias en
aquellas regiones en las que se repitan el mayor nmero de monmeros
(caracteres) posibles, como se muestra a continuacin.

ATCGGGCATGCATTACGCTG
| | | | | | | | | | | | | |
ACAGGCAGTGCATTACGCCC

Esta tcnica, aparentemente sencilla se hace ms compleja en la medida
en que el tamao de las secuencias a comparar es mayor y ms an, cuando se
comparan ms de dos secuencias, por ello se emplean computadores y distintos
programas que dadas las secuencias, generan el mejor alineamiento (Kumar y
Filipski, 2001).

El alineamiento global intenta hacer coincidir las secuencias en el mayor
nmero posible de caracteres, a lo largo de toda la banda, en cambio, el
alineamiento local busca conseguir pequeas regiones de secuencias consenso.
El alineamiento local, adems de ser ms efectivo desde el punto de vista
computacional, tiene mayor sentido biolgico, pues es sabido que slo una regin,
relativamente pequea de la secuencia de aminocidos de una protena es la que
constituye su sitio activo y por ende la que le confiere su funcin, los algoritmos
BLAST y FASTA, as como la mayora de los programas de alineamiento emplean
el enfoque de alineamiento local (Gaeta, 1995)

Como el nombre lo indica, el alineamiento por pares, consiste en hacer coincidir
un par de secuencias. El alineamiento mltiple lo hace con un conjunto de
secuencias mayor de dos. Los algoritmos BLAST y FASTA, slo producen


29
alineamientos por pares de la secuencia problema con cada una de las
secuencias de la base de datos con las que muestra alta similitud.

El alineamiento mltiple resulta provechoso para encontrar secuencias
consenso entre un grupo de genes distintos. En algunos casos estas secuencias
consenso pueden orientar hacia la exploracin de nuevas estructuras relacionadas
con cierta funcin o para aplicaciones prcticas como la de encontrar secuencias
comunes para su donacin en organismos transgnicos (Gaeta, 1995)

La complejidad en la realizacin de un alineamiento mltiple es funcin
geomtrica del nmero de secuencias sumadas al proceso; por lo cual se
requieren programas especializados ms exigentes en cuanto a capacidad de
cmputo que aquellos que slo realizan alineamientos por pares. Una vez
obtenidas las secuencias similares a la de estudio, resulta importante realizar un
alineamiento mltiple entre todas ellas, en busca de secuencias consenso. Existen
diversas herramientas en Internet disponibles para ello, as como un buen nmero
de herramientas comerciales. Una de las herramientas estndares ms
empleadas para la generacin de alineamientos mltiples es el CLUSTAL-W
(Thompson et al, 1994) disponible gratuitamente para fines acadmicos va FTP
en el URL: http://www.csc.fi/molbio/progs/clustalwlclustalw.html .

sta es una aplicacin que debe ser instalada localmente y que requiere
como datos de entrada, las secuencias (en formato FASTA) que se desean
alinear. CLUSTAL-W genera adems los datos necesarios para dibujar un rbol
filogentico entre los organismos estudiados respecto a la secuencia comparada.
El rbol no es dibujado por CLUSTAL W, slo genera los datos necesarios para
hacerlo. Con estos datos, el rbol puede ser dibujado manualmente o con otro
programa, como el PHYLIP (Jeanmougin, 1996).





30
Para comparar dos o ms secuencias, es necesario alinear los residuos
conservados y no conservados de todas las secuencias (la identificacin de
lugares de inserciones y deleciones que han ocurrido desde la divergencia de un
antepasado comn). Estos residuos forman un patrn a partir del cual las
relaciones entre las secuencias puede determinarse con los programas
filogenticos. Cuando las sucesiones se alinean, es posible identificar situaciones
de inserciones o deleciones desde su divergencia de su antepasado comn.
(Kumar y Filipski, 2001); existen tres posibilidades:

1) Las bases se emparejan: esto significa que no hay ningn cambio desde
su divergencia.

2) Las bases desigualan o emparejan mal: esto significa que hay una
substitucin desde su divergencia.

3) Hay una base en una secuencia, ninguna en el otro: hay una insercin o
una delecin desde su divergencia.

Una buena alineacin es importante para el prximo paso: la construccin
de rboles filogenticos. La alineacin afectar las distancias entre las 2 especies
diferentes y esto influir en la filogenia inferida (Stackebrandt, 1998).

2.1.4. Marcadores moleculares

Avise (1994), menciona que el inters de estudio en la evolucin molecular
se puede centrar en dos reas: (a) la caracterizacin de las bases moleculares de
la variacin en sistemas genticos particulares o (b) la aplicacin de datos
genticos a preguntas sobre historia natural y evolucin de organismos y se hace
la pregunta por qu emplear marcadores genticos moleculares? Y responde:
porque la filogenia es "el flujo de la herencia," solo los rasgos genticamente
transmitidos son informativos para la estimacin de la filogenia.




31
Con el descubrimiento de la estructura de DNA y el RNA, los pasos en la
sntesis de las protenas y otros grandes descubrimientos de la biologa molecular,
se revolucion el estudio de las plantas a todos los niveles desde las clulas a los
ecosistemas, con el uso de las tcnicas moleculares se estn descubriendo
muchas respuestas y mecanismos que no fueron accesibles en el pasado (Filipski,
2001). Ahora es posible identificar con precisin genes particulares responsables
de algunos rasgos o caractersticas, introducir o eliminar genes, alterar la
taxonoma presente y la filogenia, el hombre puede crear nuevas especies
(Bazzaz, 2001). Y las bases de ello se encuentran en los cidos nucleicos como a
continuacin se describe:

2.1.4.1. Marcadores moleculares en plantas. Las tres grandes reas de
aplicacin de la sistemtica molecular son: 1) la estructura gentica de
poblaciones (como variacin geogrfica, heterocigosidad), 2) delimitacin de
especies (incluyendo hbridos) y 3) inferencia filogentica (Baverstock y Moritz,
1996). El uso de marcadores moleculares para resolver problemas taxonmicos
en plantas se inici en la dcada de los setenta con tcnicas de electroforesis de
enzimas (Gottlieb, 1971), y hacia los ochenta las tcnicas de manipulacin y
anlisis de ADN y ARN haban avanzado lo suficiente como para poder estudiar la
variacin (Moritz y Hillis, 1996; Filipski, 2001).

La popularidad de estos mtodos se basa en que cualquier carcter utilizado para
un anlisis sistemtico debe reflejar cambios genticos. La eficacia sistemtica del
carcter utilizado ser mayor si no es el resultado de la influencia del medio sobre
el fenotipo, por lo que el uso directo del material gentico debe aportar los
caracteres ms fundamentales para una clasificacin (Crawford, 1990), con la
ventaja adicional de que el nmero de datos que se pueden obtener est limitado
slo por el tamao del genoma (Lafontaine y Tollervey, 2001b). Estos datos,
debido en parte al gran nmero de caracteres involucrados, se analizan por
mtodos de distancia, parsimonia o mxima similitud con los que se obtiene una
filogenia (Swofford et al.,
1996).


32
La incorporacin de nuevos tipos de datos, particularmente los caracteres
moleculares, han sido necesarios en taxa donde los caracteres morfolgicos, por
s solos, no han resuelto los problemas taxonmicos. Estos datos pueden provenir
de biomolculas como protenas y cidos nucleicos, e incluyen reacciones
inmunolgicas, isoenzimas, las secuencias de protenas, la hibridacin de ADN,
las enzimas de restriccin del ADN ("RFLPs" [polimorfismo en la longitud de los
fragmentos de restriccin] y mapas gnicos), los "RAPDs" (polimorfismo del ADN
amplificado al azar), el "fingerprinting" (huella digital) del ADN y las secuencias de
genes particulares. Los mritos intrnsecos del uso de este tipo de datos en
sistemtica ya se ha discutido en la literatura (Buth, 1984; Pauterson, 1987; Hillis y
Moritz, 1990; Bruns et al., 1991; Soltis et al., 1992; Doyle, 1993).

Para Sunnucks (2000), tres componentes importantes han venido ha
eficientizar los estudios sobre gentica de poblaciones: 1) tcnicas eficientes para
examinar los segmentos informativos del DNA, 2) estadsticas para analizar datos
del DNA y 3) la disponibilidad de paquetes computacionales de fcil uso, con lo
cual se podr dar respuesta a las preguntas biolgicas ms eficientemente. El
progreso de la gentica evolucionaria, es una novedad cientfica en la cual se
asume que el desarrollo del control de genes, es el aspecto principal de los
cambios evolucionarios en la morfologa y comprendiendo la filogenia del
desarrollo del control de genes se podr comprender la forma de la evolucin de
plantas y animales (Theissen et al., 2000).

2.1.4.2. Caracteres moleculares. En los ltimos aos el uso de caracteres
moleculares en estudios taxonmicos ha aumentado considerablemente y las
tcnicas ms comnmente utilizadas provienen de las enzimas de restriccin y la
secuenciacin de genes o regiones particulares de ADN (Wats 2000). El estudio
de las secuencias de genes presentan potencialmente ventajas sobre otros
caracteres moleculares. Entre los procedimientos para secuenciar, destacan la
aplicacin generalizada de los mtodos enzimticos y la tendencia hacia el uso de
marcadores



33
no radiactivos, as como la secuenciacin automatizada (Kumar y Filipski, 2001).
Algunas de las razones para usar secuencias gnicas en estudios sistemticos
son:

1) Representan una fuente abundante de caracteres (potencialmente cada
nucletido de la secuencia);
2) tienen diferentes propiedades estructurales y funcionales y
3) presentan diferentes tasas evolutivas.

Estas tres propiedades se han podido observar tanto en plantas como en
animales (Ritland y Clegg, 1987; Field et al., 1988; Soltis et al., 1990; Giannasi et
al., 1992).

2.1.4.3. Secuencias. Los recientes adelantos espectaculares en las
tecnologas y estrategias para la secuenciacin del ADN han acelerado el anlisis
detallado del genoma de miradas de organismos, el ms notablemente, el
humano (Green, 2001). El uso de secuencias es actualmente uno de los mtodos
ms comnmente utilizados, a diferencia de las enzimas de restriccin, con las
que se muestrean partes del genoma, las secuencias analizan todas las unidades
bsicas de informacin de un organismo (Hillis et al., 1996; Lafontaine y Tollervey,
2000).

Los caracteres estn representados por la posicin en la secuencia del gen,
mientras que los estados de carcter son los nucletidos que se encuentran en
esa posicin (Swofford et al., 1996; Dragon y Filipowics, 1999). Por eso es muy
importante alinear las secuencias obtenidas lo mejor posible antes de utilizarlas y
descartar las zonas dudosas (Giannasi et al., 1992; Bult y Zimmer, 1993).

2.1.4.4. La regin de ITS del ADN Ribosomal del ncleo (nrADN). Los
genes ribosomales y sus regiones espaciadoras asociadas, que en conjunto son
llamados ADN ribosomal nuclear (nrADN) tienen un amplio rango de aplicacin,
desde el origen de la vida hasta los eventos evolutivos ms recientes (Hllis y
Dixon, 1991; Lafontaine y Tollervey, 2000). El nrADN ha sido ampliamente
utilizado, ya que


34
permite la inferencia de relaciones filogenticas entre taxa muy distantes, debido a
que presentan secuencias de bases altamente conservadas con tasas de
evolucin muy lentas (Hillis y Dixon, 1991; Hamby y Zimmer, 1992; Baldwin et al.,
1995; Lafontaine y Tollervey, 2000).

De acuerdo con Hillis y Dixon (1991); Baldwin et al., (1995) y Planta y Rau
(1999), el arreglo del ADN ribosomal nuclear (nrADN) de un genoma eucaritico,
tpicamente consiste de algunos cientos de copias repetidas en tndem. Cada una
de estas copias se compone de la unidad transcrita y de la regin de los
espaciadores externos no transcritos (Planta y Rau, 1999).

En procariontes existen de una a varias copias de genes de ADN ribosomal
y estos genes pueden estar organizados en un opern nico (junto a cada gen
bacteriano existe un segmento de ADN conocido como promotor). Este es el lugar
sobre el cual la ARN polimerasa, enzima responsable de la produccin de ARNm,
se adhiere al ADN e inicia la trascripcin. Entre el promotor y el gen existe con
frecuencia otro segmento de ADN que recibe el nombre de operador, donde otra
protena -el represor- puede adherirse. Cuando el represor se une al operador,
detiene el desplazamiento de la ARN polimerasa a lo largo del cromosoma y la
produccin de ARNm, por lo tanto el gen se inactiva (Baldwin et al., 1995).

Sin embargo, la presencia en la clula de una sustancia qumica
determinada puede provocar que el represor se separe y el gen se active. Otras
sustancias pueden afectar el grado de actividad del gen al alterar la capacidad de
la ARN polimerasa de unirse al promotor. Un gen que recibe el nombre de
regulador produce la protena represora. En las bacterias, varios genes pueden
estar controlados de forma simultnea por un promotor y uno o ms operadores.
El sistema completo se denomina entonces operon) o pueden estar dispersos por
todo el genoma (Planta y Rau, 1999).

En eucariontes, generalmente existen tres o cuatro subunidades de nrADN (18S,




35
5.8S 26S (tres) en plantas; 18S, 5S y 28S (tres) en animales y 16S, 5S, 5.8S y
25S (cuatro) en Hongos, por lo que se dice que hay 3 o 4 subunidades en
eucariotes). Estas subunidades son caracterizadas por su velocidad de
sedimentacin que se representa por la letra S (S, por Svedburg), y consisten en:
a) la subunidad larga cuyo rango en tamao va desde 16S (alrededor de 1500
nucletidos) hasta 28S (mas de 4000 nucletidos); b) la subunidad pequea 5.8S
(de 160 nucletidos); c) la subunidad 18S (1800 nucletidos); y en algunos
organismos d) la subunidad 5S (con 120 nucletidos). En eucariontes, dos
espaciadores internos transcritos (ITS) separan las subunidades 18S, 5.8S y 28S
(o sus homlogos), el ITS1 y el ITS2. Copias adyacentes de la unidad repetida de
nrADN ("nrDNA repeat") son separadas por la regin del espaciador no transcrito
(NTS), tambin llamado espaciador intergnico (IGS) por algunos autores.

La de los ITS contiene elementos que sirven como estimuladores de la
transcripcin (Hillis y Dixon, 1991; Baldwin et al., 1995; Planta Y Rau, 1999). La
regin de los espaciadores internos transcritos (ITS) ha sido ampliamente usada
para el esclarecimiento de las relaciones entre taxa a niveles inter e
intragenricos, as como intraespecficos en angiospermas (Hamby y Zimmer,
1992; Baldwin et al., 1995; Buckler y Holtsford 1996; Liston et al., 1996).

2.1.4.5. La regin de los espaciadores internos transcritos (ITS) del
nrADN en angiospermas y gimnospermas. Las copias de nrADN en el genoma
de las plantas, estn distribuidas en uno o varios loci cromosmicos denominados
regiones organizadoras nucleares (NORs) (Hamby y Zimmer, 1992; Brown et al.,
1993; Planta Y Rau, 1999; Shaw, 1999). El nmero de NORs determina de
alguna manera la velocidad de los procesos de homogenizacin. En angiospermas
se encuentran entre uno y dos, mientras que el nmero de NORs en algunas
gimnospermas es de 10 a 12 (Karvonen y Savolainen, 1993). La familia de genes
repetidos experimenta una homogenizacin rpida en sus secuencias de bases,
un proceso conocido como evolucin concertada (un mecanismo gentico no
mendeliano) y cuyos mecanismos principales lo constituyen el entrecruzamiento



36
desigual y la conversin gnica (Baldwin et al., 1995, Wendel et al., 1995). La
evolucin concertada y la recombinacin sexual tienden a promover la uniformidad
de los ITS dentro de individuos y entre individuos de poblaciones (Hillis et al, 1991;
Soltis y Kuzoff, 1993; Shaw, 1999), por lo que en teora basta muestrear solo
algunos individuos para establecer las relaciones filogenticas entre distintas
especies, debido a que la regin de los ITS se encuentra relativamente
homognea dentro del genoma, por lo que puede decirse que una sola secuencia
sirve para caracterizar a los individuos de una determinada especie (Baldwin et al.,
1995; Planta y Rau, 1999).

La variacin en las secuencias de genes en familias multignicas y su
distribucin entre y dentro de poblaciones es determinada por las tasas de
mutacin y el efecto de fuerzas evolutivas (flujo gnico, seleccin natural, deriva
gnica y sistemas de apareamiento), que actan a nivel poblacional
(Charlesworth, et al., 2001). Sin embargo, el proceso de evolucin concertada, un
mecanismo gentico no Mendeliano, afecta la variabilidad de las familias
multignicas a nivel molecular. La tasa de homogenizacin de las unidades
repetidas del nrADN mediante evolucin concertada, depende del nmero de
copias, el nmero de loci y cromosomas en los cuales se encuentran las copias de
estos genes, la localizacin de los loci en los cromosomas y la tasa de intercambio
dentro y entre cromosomas (Hillis et al., 1991; Suh et al., 1993; Wendel et al.,
1995; Lafontaine y Tollervey, 2000). Se conocen poco los factores que afectan la
evolucin de los ITS en gimnospermas, pero la evidencia encontrada en pinos
(Pinus spp) sugiere que tanto el nmero de copias del nrADN como de loci es
mayor que en angiospermas, por lo que se espera encontrar tasas de
homogenizacin relativamente bajas en gimnospermas (Karvonen y Savolainen,
1993).

2.1.4.6. ITSs en angiospermas

La filogenetica molecular de las angiospermas se ha efectuado a partir de la
inferencia de tres genes (rbcL, atpB, 18S rDNA) lo que ha permitido una



37
reclasificacin de las angiospermas y esta reclasificacin es quizs lo ms
importante que ha sucedido en la taxonoma de las angiospermas en los ltimos
200 aos (Soltis y Soltis, 2000).

La regin de los ITS ha sido considerada como una fuente muy til de
caracteres para estudios filogenticos en angiospermas (Baldwin et al. 1995),
dado que los ITS se encuentran altamente representados en el genoma, se
pueden amplificar con cantidades pequeas de ADN y las secuencias altamente
conservadas dentro de la mayora de los genes del nrADN son muy tiles en el
diseo de oligonucletidos ("primers") "universales", lo que facilita la amplificacin
de los ITS mediante el uso de la reaccin en cadena de la polmerasa (PCR)
(Liston 1992; Planta Y Rau, 1999). Los espaciadores internos transcritos (ITS)
son la parte ms variable de la regin de los ITS, la regin de los ITS comprende
el ITS2, la subunidad 5.8S y el ITS1, debido a que se encuentran flanqueando a la
subunidad 5.8S, que es ms conservada y se posibilita la alineacin no ambigua
de esta regin (Baldwin et al., 1995)

Una limitacin en la utilidad de los ITS en la sistemtica de angiospermas,
es que este locus presenta una cantidad relativamente pequea de nucletidos.
En angiospermas, los ITS tienen de 565 a 700 pares de bases (bp) en longitud
(Baldwin el al.. 1995). Puesto que la subunidad 5.8S (163-164 bp) exhibe niveles
muy bajos de variacin en su secuencia, solamente los 400-535 bp del ITS1 y el
ITS2 son tiles para la reconstruccin filogentica entre gneros y especies
relacionadas.

En contraste, la regin de los ITS de gimnospermas es considerablemente
ms larga y tiene un mayor rango de variacin que va desde 750 bp en
Welwitschia mirabilis hasta 3125 bp en Pcea abies (Qu et al., 1993; Liston et al.,
1996). Recientemente se realiz un estudio detallado sobre la variacin en la
longitud de la regin de los ITS en gimnospermas, incluyendo 32 especies de
gimnospermas, en catorce familias y cuatro rdenes, y se construyeron mapas de
sitios de restriccin de los ITS amplificados con PCR (PCR-RFLP) (Liston et al.,
1996). El anlisis de los


38
sitios de restriccin indica que el ITS2 junto con la subunidad 5.8S est compuesto
de 350-425 bp, y es relativamente constante para todas las especies estudiadas.
Por lo tanto el ITS1 es el responsable de la mayor parte de la variacin en la
longitud de los ITS en gimnospermas.





























39
2.1.5. Satureja macrostema (Labiatae) como modelo de estudio.

El propsito de utilizar modelos de estudio es obtener conocimiento
partiendo de lo general, a lo particular, y para ello se utilizan ciertos organismos
especficos como modelo de todos los dems. As, Mendel us chcharos, Morgan
us Drosophila; Anand (1992) menciona que casi toda la informacin disponible
sobre cmo es fsica y genticamente el genoma de los hongos proviene de
estudios realizados usando levaduras o ascomicetos como modelos.

El Proyecto Genoma Humano tiene como objetivo descubrir y localizar los
ms de 30.000 genes del hombre y poner toda esta informacin a disposicin de
la comunidad de investigadores en biomedicina y paralelamente, se estn
secuenciando otros organismos modelo (ratn, bacterias, levadura), como ayuda
al desarrollo de tecnologa y a la interpretacin de la funcionalidad de los genes
humanos. http://biotic.isciii.es/informacion/biosalud/biosalud.html. En la mayora de
los estudios sobre evolucin y diversidad floral, se han utilizado las plantas de
Arabidopsis thaliana que son miembros de la familia Brassicaceae (Coen y
Meyerowitz, 1991).

Kellogg y Shaffer (1993), argumentan que utilizar organismos modelo es
prctico dado que no se tiene el tiempo ni recursos para estudiar todas las
especies, y para muchas interrogantes, sera una prdida de recursos innecesaria.
Sealan, que la meta principal de la mayora de los estudios en biologa: es
entender los procesos de cmo funciona el organismo y las partes que lo forman,
por lo tanto, cualquier organismo puede ser utilizado como modelo de estudio. De
acuerdo con estos autores, un organismo puede ser elegido si en l se pueden
cumplir al menos las siguientes causas:

a) Que sea accesible, es decir que exista disponibilidad y variabilidad.
b) Que sea de fcil manejo tanto en laboratorio como en ciertas condiciones
especiales.



40
c) Que sea fcil de generalizar a otros organismos.

Con base en las consideraciones anteriores, en el presente estudio se eligi
a Satureja macrostema como organismo modelo para realizar estudios de
especiacin y relaciones filogenticas cuando la planta se desarrolla en hbitat
naturales pero con intervencin del hombre, manifestada a travs de la actividad
de recoleccin, funcionando sta ltima como una fuerza de seleccin artificial.

Por evidencias empricas reportadas, como las de McVaugh y Schmid
(1967) quienes mencionan que hay dos especies en Mxico pertenecientes a la
seccin Gardoquia: S. macrostema y S. jaliscana y una especie asociada con
bosques en barrancas es descrita como nueva. Mencionan tambin que existen
dos variedades aloptricas, reconocibles por las diferencias en pubescencia y son;
S. macrostema var. macrostema y S. macrostema var. laevigata, sin embargo los
rangos de distribucin de las dos variedades se aproximan una a otra y quizs
actualmente se traslapan en algunas reas del centro de Michoacn, ya que
algunos especimenes parecen ser tpicamente de la var. laevigata y otros que se
han referido dudosamente a la var. macrostema, porque las ramillas son
escasamente hirsutas, pero considerablemente menos que algunos especimenes
del Valle de Mxico. En otros individuos de Michoacn las hojas jvenes y las
ramillas son escasamente vellosas, ms de lo usual que en la var. laevigata, pero
menos que macrostema. Estos mismos autores sugieren que ms trabajo de
campo es necesario en las reas donde las dos variedades se traslapan (se
aproximan tanto que se mezclan) y no es improbable que las dos hibriden donde
ellas estn ocurriendo juntas y los individuos de Michoacn pueden ser indicativo
de esto. Tambin mencionan que algn flujo de genes entre las dos variedades
parece probable.

S. macrostema, ya ha sido utilizado como organismo modelo en estudios de
variacin gentica (Aguilar, 2001), fenologa, (Aguilar, 2001), organognesis y
embriognesis somtica (Aguilar, 2001), y en la determinacin de nuevas
propiedades y usos de S. macrostema (Aguilar, 2001).



41
2.1.6. Clasificacin botnica de Satureja macrostema (Benth) Briq.
Reino
Divisin
Vegetal
Espermatofitas

Magnoliophyta
Subdivisin II
Clase
Angiosperma
Dicoteledneo

Magnoliopsida
Subclase Asteridae
Orden Tubiflorales Labiales
Familia Labiateaeo Lamiaceae
Genero
Especie
Satureja
macrostema

(Watson and Dallwitz, 1992)
(http://biodiversity.uno.edu/delta/.)

2.1.6.1. Descripcin de la especie Satureja macrostema (Benth) Briq.
(Calamintha macrostema Benth.) Planta arbustiva, con olor a menta al estrujar, de
1 a 2 (3) m de alto; tallos erectos, ramas arqueadas, pubescentes; hojas con
pecolos de 2 a 5 mm de largo, limbo ovado u oblongo a lanceolado, de 1 a 4cm
de largo por 0.6 a 1.5 cm de ancho, pice agudo, aserradas, base redondeada;
flores solitarias o en grupos de 2 a 3 en las axilas de las hojas, pedicelos de 2 a
6(10) mm de largo, pubescentes; cliz 5-dentado, bilabiado, de 7 a 10 mm de
largo con la garganta pilosa; corola roja o anaranjada (cambiando a blanquecina o
rosada en el secado), de 2 a 3.5 cm de largo; estambres exsertos, tecas de las
anteras divergentes; estilo saliente de la corola; mericarpios ovoides, lisos o
reticulados. (Rzedowski, 1985).

Nombre vulgar o comn que recibe: Nurite, tabaquillo, hierba del borracho,
tuche, Garaona, t de monte, Atchietl, poleo, Cuencuenzpatli (Nhuatl), Guie-
zaa (Oaxaca, Zapoteco), Nurhitini t (purpecha), Tragorigano quauhnahuacense,
toronjil, Tunch, tarepe, etc. "T de monte", "tabaquillo", "toronjil".

Es una especie vegetal que crece silvestre en las regiones de clima
templado. Cuajimalpa a Tlalpan y Milpa Alta; Tialmanalco y Amecameca. Alt.
2450-3500 m.


42
Principalmente en bosques de pino, de encino y de oyamel, a veces en matorrales
cercanos a los bosques. Fuera del Valle de Mxico, se le localiza de Jalisco a
Veracruz y Oaxaca. Planta medicinal, utilizada localmente contra algunas
molestias de los conductos digestivos (Rzedowski, 1985).

2.1.6.2. Distribucin geogrfica. En Mxico se le localiza de Jalisco a
Veracruz y Oaxaca (Standley, 1924), a lo largo de la Cordillera Neovolcnica, en
bosques de pino, encino y oyamel en alturas de 2400-3200 m.s.n.m.; en
Michoacn (Figura 1) se distribuye en los Municipios de Uruapan, Paracho, Nuevo
San Juan Parangaricutiro, Zinapcuaro, Zitcuaro, Coalcomn, Aguililla, Charo,
Chiltota, Cd. Hidalgo, Angangueo, Nahuatzen, Ocampo, Ptzcuaro, Salvador
Escalante, Senguio y Tncitaro. De acuerdo con el estudio complementario
realizado como parte de esta investigacin y con base en la temperatura (9 a 16
C); precipitacin (1,200 a 1,600 mm); altura sobre el nivel del mar (2,000 a 3,200
msnm); suelos andosoles y una pendiente del 0 al 35%, se elaboraron mapas
mediante Sistemas de Informacin Geogrfica (SIG), en los cuales se localizan las
reas homogneas y que presentan las mejores condiciones medio ambientales
para la presencia natural o introducida del te nurite (Satureja macrostema) en las
que puede expresar todo su potencial veaetal en el estado de Michoacn (Aguilar,
Indito)


43
2.1.6.3. Importancia, usos y propiedades curativas del t nurite (S.
macrostema). Planta de gran importancia en la medicina tradicional de los
pueblos P'urhpecha, quienes la consideran un smbolo de fertilidad y por ello es
usada en las Bodas; el nurite es utilizado como un eficiente aperitivo si se toma en
ayunas o antes de los alimentos. Se utiliza para combatir las infecciones
intestinales como estomtico, excitante de los movimientos gstricos o
gastrointestinales y favorece la digestin cuando esta es lenta y dolorosa. Es
utilizado como un carminativo poderoso y se utiliza tambin para evitar o eliminar
los clicos. Es un agente digestivo eficaz si se toma despus de los alimentos
tambin se toma el t nurite para eliminar las molestias producidas por a ingestin
de bebidas alcohlicas: agruras y nauseas, de este uso le viene el nombre de
"hierba del borracho". Otro uso que se le d al nurite es el de aliviar un tipo de
diarrea denominada " diarrea de Tierra Caliente"; como remedio y buen tnico
despus de sufrir malaria y otras fiebres. Tradicionalmente se toma un atole de
Nurite para aumentar la fertilidad y lograr la concepcin en algunas mujeres que
padecen cierto tipo de esterilidad, (Martnez, 1986), de este uso se le conoce con
el nombre de "garaona" (Standley, 1924; Rodrguez, 1997; Rezedowski, 1985).

En sntesis, el gnero Satureja ha sido tradicionalmente usado como
estimulante, estomtico, carminativo, expectorante, antidiarreico y afrodisaco. La
esencia del aceite ha demostrado actividad antimicrobial y antidiarreica por los
fenoles del aceite y ha sido usada en el tratamiento del cncer (Simon, et al.,
1984; http://www.hort.purdue.edu.Newcrop/med.aro/savory.), como antioxidante
(Lagouri y Boskou, 1996); tambin ha mostrado actividad contra los virus HSV-1 y
VSV (Abad et al., 1999) y actividad anti-HIV-1 (Yamasaki et al., 1998.

2.1.6.4. Usos actuales y potenciales. En recientes estudios fotoqumicos se ha
encontrado que el "t nurite" contiene una mezcla de compuestos qumicos
llamados flavonoides los cuales han sido extensamente estudiados en los ltimos
10 aos (Catapano, 1997), dado que entran en la conocida categora de los
antioxidantes de origen natural (Maridonneau-Parini, 1986; Chen, 1990; Facino,



44
1990). Entre los antioxidantes mas conocidos estn las vitaminas E y C, que son
los antioxidantes "clsicos" pero en los ltimos aos se han descubierto otros,
tales como los flavonoides, que estn ampliamente distribuidos en los tejidos
vegetales. Satureja incana; S. brevicalix; S. pulchela y S. sericea, son utilizadas en
la etnomedicina andina para tratar las vas respiratorias, como digestivos,
relajantes y antiflatulentos (Chumacero, et al., 2001). Satureja hortensis ha sido
utilizada en el tratamiento de algunos desrdenes gastrointestinales, como
antiespasmdico y antidiarreico (Hajhashemi et al., 2000); S. Thymbra, como
antioxidante y carcingeno (Lagouri y Boskou, 1996); S. boliviana tiene actividad
contra los virus HSV-1 y VSV (Abad et al., 1999); efectos vasodilatorios a partir del
ingrediente activo de S. obovata (Snchez et al., 1999); S. brownwi ha sido
comprobada para ser utilizada contra infecciones respiratorias provocadas por
bacterias Gram positivas como Staphylococcus aureus, Streptoccus pneumoniae y
Streptococcus pyogenes (Cceres et al., 1991). En un estudio de las hierbas de la
familia Labiatae sobre su actividad anti-HIV-1, S. montana, mostr potente
actividad contra anti-HIV-1 (Yamasaki et al., 1998); S. parvifolia, mostr actividad
antimicrobial contra microorganismos Gram positivos y Gram negativos
(Hernndez et al., 2000).

Por lo anterior, Satureja macrostema puede considerarse como una planta
con uso potencial tanto la industria alimentaria como en la farmacutica, que se
desarrolla en las zonas Templado-Fras, por lo que obtener informacin sobre sta
planta, es de gran relevancia, dada la necesidad de contar con modelos de estudio
de los ambientes ecolgicos donde se desarrolla y por otro lado, generar
conocimiento sobre plantas de inters social y econmico. Asimismo, con base en
la literatura sealada, es probablemente que exista hibridacin y flujo gentico
entre poblaciones presentes en el estado de Michoacn, y posiblemente est
presente un proceso de especiacin del modo recombinacional o rpido.






45
III. PROBLEMA ESPECFICO, HIPTESIS Y OBJETIVOS

Problema especfico:

Una pregunta fundamental en biologa evolucionarla es: la especiacin es
gradual o puntuada?, es decir, el proceso evolutivo se presenta de manera gradual
(que ocurre a un ritmo ms o menos constante, y no se observa en la secuencia
de los fsiles porque sta es incompleta),o de manera punteada (cuando el
registro fsil refleja con fidelidad la manera en que ocurri la evolucin: largos
periodos de rpida especiacin y cuando se rompe el equilibrio por la acumulacin
de mutaciones, estos periodos relativamente cortos de evolucin activa son
seguidos por largos periodos de estasis), esta pregunta ha sido difcil de
responder principalmente porque la historia evolucionarla de la mayora de las
especies de plantas y animales es pobremente conocida (Rieseberg y Ungerer,
2001)

As, la biologa evolutiva tiene como un tema de estudio principal el proceso
de especiacin, y como parte del mismo los diferentes mecanismos que participan
en el proceso. En cuanto al modo de especiacin conocida como especiacin
hbrida o "recombinacional" la teora predice que el proceso evolutivo que origina
esta cladognesis es del tipo puntuado, pero a la fecha existe poca evidencia
emprica para apoyarla (Ungerer et. al.,1998). Las tcnicas moleculares aplicadas
a estudios evolutivos permiten la obtencin de datos para apoyar posibles
explicaciones del proceso biolgico (especiacin), as como la propuesta de las
relaciones filogenticas que se han establecido durante el proceso mismo.

Con base en lo anterior, las preguntas planteadas en este estudio fueron:
Qu tipo de especiacin est presente en Satureja macrostema var. laevigata? y
Si la especiacin recombinacional est presente, sta es de tipo puntuada como
lo predice la teora?.
46
Hiptesis

"Es probable que en Satureja macrostema var. laevigata se encuentre presente un
proceso de especiacin recombinacional y que ste sea de tipo puntuado"

Objetivos

1.- Determinar el probable modo de especiacin en poblaciones de Satureja
macrostema var. laevigata presentes en el estado de Michoacn.

2.- Establecer las relaciones filogenticas de poblaciones de Satureja
macrostema var. laevigata presentes en el estado de Michoacn.



















47
IV. MATERIALES Y MTODOS

Para el logro de los objetivos y metas del presente estudio se plantearon
cuatro etapas bien definidas: 1) la colecta e identificacin tradicional del material
vegetativo de Satureja macrostema de las diferentes localidades en estudio, 2)
aplicacin de las diferentes tcnicas de biologa molecular al material vegetal
obtenido, 3) la aplicacin de las tcnicas computacionales para el manejo y
anlisis de las secuencias obtenidas por biologa molecular y 4) la obtencin y
descripcin de los resultados anteriores para inferir la filogenia de los
especmenes en estudio. La primera y cuarta fase se llev a cabo en las
instalaciones del Campo experimental Uruapan del INIFAP en la ciudad de
Uruapan, Michoacn. La segunda y tercera fase se realizaron en los laboratorios
del Centro de Investigacin y de Estudios Avanzados (CIVESTAV-IPN) Unidad
Irapuato, en Irapuato, Guanajuato. El desarrollo de cada fase se describe a
continuacin:

4.1. Colecta e Identificacin del material vegetal

Las colectas de los materiales de la especie S. macrostema se realizaron
en tres localidades de la Sierra Puhrepecha, Estado de Michoacn, Mxico, en el
cuadrol se mencionan las caractersticas generales de las localidades.

Cuadro 1.- Caractersticas de las localidades donde se colect material botnico de
S. macrostema.

Localidad A (m N () W () Exposicin suelo Clima Vegetacin
asociada
Fecha de
colecta
Bosque Pinus Nov 2000 San Juan 2100 102 15" 19 27" E Andosol Templado
subhmedo y Abies sp.
Uruapan 1611 102 11" 19 46" Z Andosol Templado Jardn
botnico
Nov 2000
Paracho 10208' 19 39 S Andosol Templado
subhmedo
Bosque Pinus Nov 2000
y Abies sp

A= Altura sobre el nivel del mar. N= Latitud

Norte. W= Longitud Oeste



48
Se colectaron 5 ejemplares por cada localidad, cada localidad (4) se
consider como representante de una poblacin diferente de S. macrostema y la
denominacin de los ejemplares tratados en este estudio se resumen en el cuadro
2:
Cuadro 2.- Ejemplares de Satureja macrostema utilizados en el estudio
Localidad Nombre comn en la
localidad
Nomenclatura para este
Estudio
INIFAP, Uruapan Blanco T Nurite Blanco (SATIB)
INIFAP, Uruapan Negro Te Nurite Negro (SATIN)
San Juan ? T Nurite San Juan (SATSJ)
Paracho ? T Nurite Paracho (SATPA)
INIFAP= Instituto Nacional de Investigaciones Forestales Agrcolas y Pecuarias.

4.2. Extraccin y limpieza del ADN

De los especmenes colectados, se seleccionaron dos ejemplares al azar por
localidad, con la finalidad de obtener por duplicado los resultados de cada
localidad, y de cada uno de ellos se separaron las hojas para la extraccin de
ADN.

4.3. Extraccin del ADN

Los procedimientos para extraccin de ADN genmico de plantas incluyen
tratamientos que rompen las paredes y membranas celulares para liberar los
constituyentes celulares dentro de un buffer de extraccin que contiene
compuestos para proteger al ADN de la actividad de nucleasas endgenas (Griffin
et al., 1994).

Todas las muestras fueron congeladas con nitrgeno lquido y finamente
maceradas. El ADN total fue aislado de tejido verde de cada una de las
localidades tratadas por el mtodo propuesto por Doyle y Doyle (1990).



49
Se prepararon los siguientes reactivos de acuerdo al protocolo de Doyle y Doyle
(1990).

Soluciones para extraccin de ADN.

Buffer de extraccin: CTAB 2% PN, NaCI 1.4 M, EDTA 20 mM pH 8.0, a
mercaptoetanol 0.2% v/v. ( Doyle y Doyle, 1990. cita al 0.1 %; en el presente caso
se utiliz al 0.2%)

* EDTA0.5MpH8.0
* Tris-HCI 1 M pH 7.5 *cido maleico 1 M *Acetato de sodio 2.5 M
* Fosfato de sodio monobsico
* SDS 20 % (p/v)
* Cloruro de litio 4 M
* Etanol absoluto
* Etanol al 70% (v/v)
* NaCI 5 M
* MgC12 2 M
* N-Lauril-Sarcosina 1 M
* SSC 1Ox pH 7.0 * Tween 20 al 20%
* Citrato de sodio 1 M
* Fosfato de sodio dibsico.

El protocolo se describe a continuacin (Sambrock, 1989; Garca et al., 2001):

1. Moler de 0.5 a 2.0 g de material fresco o congelado con nitrgeno lquido en un
mortero con pistilo, hasta obtener un polvo fino.




50
2. Transferir directamente a un tubo de 30 ml (nalgene o falcon) y esperar a que
todo el nitrgeno se evapore. Agregar 10 ml de buffer de extraccin precalentado
a 60C, mezclar bien, tapar el tubo e incubar por 30 min. a 60C con agitacin
ocasional.
3. Extraer con 10 ml de cloroformo-alcohol isoamlico 24:1, centrifugar a 10,000
r.p.m. por 10 min. y recuperar la fase acuosa (superior).
4. Colocar la fase superior en un tubo eppendorf, agregar 2/3 partes del volumen
de la muestra de alcohol isoproplico y agitar suavemente para precipitar los
cidos nucleicos (se puede dejar precipitar toda la noche a 20C o por 3 horas
mnimo durante el da). Centrifugar a 10,000 r.p.m. por 10 min. y decantar el
sobrenadante (si se forma como hebra este se puede retirar con una asa de
vidrio).
5. Lavar el pastilla con etanol al 80% y dejar secar a temperatura ambiente. (Doyle
menciona realizar un solo lavado, en el presente estudio se realizaron dos)
6. Despus de secar el pastilla, disolverlo en 500 ?l de TE y agregar 4 ?l de
ARNasa (a una concentracin de 10 pg/?l).
7. Incubar a 37C por 1 h con la ARNasa.
8. Centrifugar por 5 min a 12000 r.p.m, y recuperar el sobrenadante.
9. Agregar 10 % de acetato de sodio 3 M pH 5.2 y 2/3 partes del volumen de
isopropanol.
10. Reposar por 5 min.
11. Transferir el ADN a tubos eppendorf.
12. Decantar todo el sobrenadante, dejando solo el ADN en el tubo y luego se deja
secar.
13. Enjuagar con 1 ml de una solucin de etanol al 75% y 10 mM de acetato de
amonio por 1 min.
14. Si se desea se puede dejar a -20C hasta su uso.
(Doyle y Doyle, 1990).

Una vez obtenido el ADN se realiz la limpieza del ADN por el mtodo de
GenClean utilizando los reactivos del Biorad (kit Prep-A-Gene DNA Purification
Systems) y siguiendo las instrucciones citadas por los fabricantes.
51

Las concentraciones de ADN fueron determinadas midiendo la absorbencia
a X260 nm con un espectrofotmetro Cary3 de la Compaa Varan. El ADN se
almaceno a -20C hasta su uso.

4.4. Determinacin de la concentracin del ADN

De acuerdo con Maniatis (1989), para calcular la concentracin de ADN de
tejido fresco se utiliz la ecuacin 1 en donde los resultados se expresan en g/l.

[ ]= Abs 260 nm * Factor de dilucin / 20 1

4.5. Determinacin de la calidad del ADN

El clculo de la calidad del ADN involucra las absorbancias a 260 y 280 nm
y se utiliz la ecuacin 2. Si el resultado est dentro del rango de 1.8 a 1.9,
significa que el ADN es de buena calidad. (Maniatis, 1989)

Calidad = Abs 260 / Abs 280 2

Una vez determinada la concentracin del ADN de cada muestra se
procedi a su amplificacin como se describe a continuacin:

4.6. Espacios transcritos internos (ITS).

El desarrollo de la reaccin en cadena de la polimerasa (PCR) potenci,
entre otras cosas, el uso de secuencias gnicas en el estudio de las relaciones
filogenticas entre poblaciones o especies. Las secuencias gnicas ms utilizadas
actualmente incluyen a los genes ribosomales, en especial a los espaciadores
transcritos internos (ITSs) (Walsh, 1998). Para la amplificacin de estos
espaciadores existe un protocolo ampliamente generalizado y es el que a
continuacin se describe:

52
Para la amplificacin se utiliz el mismo ADN de la seccin anterior
mostrado en la figura 2 y con la limpieza con fenol-cloroformo y el GenClean con
el kit Prep-AGene DNA Purification Systems de BIO-RAD

4.7. Primera amplificacin del ADN

Se mandaron sintetizar a la compaa Gifco BRL los iniciadores ITS1 e
ITS4, que permiten la amplificacin de la regin ITS1-5.8S-ITS2 de los genes
ribosomales de eucariotes. La secuencia de estos iniciadores se muestra a
continuacin:

ITS1 5'tccgtaggtgaacctgcgg 3' 10 nucletidos

ITS4 5'tcctccgcttatttgatatgc 3' 10 nucletidos

Las condiciones de reaccin se muestran a continuacin:

Para preparar 1 reaccin de PCR bajo las condiciones anteriores se
requirieron: 14.8 ?l de H2O mQ, 2.5 l de buffer 1OX+Mg 10x, 0.5 l de dNTP 10
mM, 1 l de iniciador ITS1 10 pM/l, 1 l de iniciador ITS4 10 pM/?l, 0.2 l de Taq
2.5 U/ ?l, 0.5 ?l de DNA geonmico por tubo y 50 ?l de aceite mineral (Williams, et
al., 1995).

Los productos amplificados se aplicaron en geles de agarosa al 1.2 % a 85 V,
luego se visualizaron las bandas en una fuente de luz UV.

4.8. Limpieza

Estos fragmentos se cortaron para someterse a una nueva limpieza con el
kit Prep-A-Gene DNA Purification Systems de BIO-RAD, siguiendo las
instrucciones de los fabricantes, para corroborar que se encontraban limpios y que
la amplificacin corresponda, efectivamente, al fragmento de ITS, ITS1-5.8S-ITS2
y fueron

53
observados nuevamente en un gel de agarosa al 1.2% produciendo nuevamente
fragmentos de 700 pb. Estos fragmentos fueron cortados y limpiados nuevamente
de la misma manera como se describe en prrafo anterior y mandados a
secuenciar.

4.9. Segunda amplificacin

Los productos amplificados se aplicaron en geles de agarosa al 1.2 % a 85
V, luego se visualizaron las bandas en una fuente de luz UV. Antes de ser
secuenciados dichos productos fueron limpiados usando el Kit de Purificacin
Nuclen Phytopure de BIO-RAD, siguiendo las instrucciones provistas por este
kit.

4.10. Purificacin de ADN

protocolo segundo:
? Cortar el fragmento del gel que contiene la banda de DNA deseada y poner en
un tubo de 1.5 ml. No usar ms de 250 ml en cada tubo.
? Adicionar de 2 a 3 volmenes de KI - Nal (500 l) e incubar a 50C por 5' hasta
que se disuelva completamente la agarosa.
? Adicionar 30 l de la suspensin de glass milk (1 l por cada 0.5 pg de DNA) e
incubar a 4C por 10'.
? Centrifugar por 30" (un pulso en la microcentrifuga). Guardar el sobrenadante.
? Lavar la pastilla tres veces con 500 l de la solucin de etanol 50 %,
resuspendiendo la pastilla con una pipeta Pasteur sellada. Para cada lavado
centrifugar 30" y guardar todos los sobrenadantes.
? Resuspender la pastilla final con 30 l de H2O dd para eluir el DNA desde el
glass milk. Esta pastilla fcilmente se resuspende en un volumen de agua que
es igual al volumen de la pastilla. Incubar el tubo a 45-55C por 10' y luego
centrifugar por 30" para producir una pastilla slida. Remover cuidadosamente
el sobrenadante que contiene el DNA eluido y colocar en tubo nuevo (aqu se
obtiene un 70 % de DNA, una segunda elucin libera el 30 % restante).
54
Soluciones: (el kit trae preparadas estas soluciones, si no se pueden preparar
como se describe a continuacin)

* Glass milk.- Se prepara a partir de pipetas Pasteur molidas en un vaso
pulverizador. El polvo resultante se suspende en H2O dd y se deja precipitar en
una probeta de cristal durante 15'. La solucin "lechosa" sobrenadante (las
partculas ms pequeas que no se precipitaron) se pasa a tubos Falcon y se
centrifuga de 2-3' a 3000 rpm. Desechar el sobrenadante y resuspender la pastilla
en un volumen mnimo de H2O dd (20 mi).

* KI.-Se disuelven 180g de KI - Nal en 95 ml de H2O dd caliente filtrada en
papel Whatman No. 1 (...se forman cristales). Se agregan 0.5g de Na SO3 como
antioxidante. La solucin resultante se guarda en la oscuridad a 4C.

* Etanol 50 %.- 50 ml de etanol absoluto en 50 ml de la solucin: Tris HCI
20 mM (1 ml de 1M) pH 7.4, EDTA 1 mM (0.1 mi de 0.5 M) y NaCI 0.1 M (5ml de 1
M). Guardar a -20C (Sambrook, et al., 1989).

4.11. Secuenciacin

Las reacciones de secuenciacin fueron realizadas por amplificacin con
PCR en un volumen final de 20 l usando 100 ng de los productos amplificados de
ITS, 10 pmol de cada iniciador y 9.5 l de DyeTerminators premix part No 402079
de acuerdo al protocolo de Applied Biosystems, para cada muestra. Despus de
calentar a 94C por 2 minutos, la reaccin consisti de 30 ciclos de 94C un
minuto, 55C un minuto y 72C un minuto, con 72C por 7 minutos en el ultimo
ciclo (9600 thermal cycler Perkin Elmer). Se removi el exceso de Dye
Terminators usando columnas Quick Spin (Boehringer Mannheim). Las muestras
fueron directamente secadas en centrfuga al vaco y disueltas con 4 l de EDTA
formamida desionizada a pH 8.0. Las muestras fueron cargadas dentro del
secuenciador ABI Prism TM 377
55
ADN Sequencer y corridas por 12 horas en gel de acrilamida al 4.5% en
condiciones desnaturalizantes. Todas las secuencias se obtuvieron por duplicado,
a partir de dos ejemplares diferentes para cada taxa (White et al., 1990)

4.12. Alineacin de secuencias

Una vez obtenidas las secuencias, estas fueron recortadas individualmente
en la regin 5' del ITS1 y 3' del ITS2, se retiraron las secuencias correspondientes
a los iniciadores decameros usados para su amplificacin en cada extremo y se
uso el gene 5.8s como anclaje, basndose en la secuencia reportada para
Labiatae en el GenBank para este gene.

Para esto se utilizaron los programas DNASIS de DNASIS Inc. y MegAlign
de DNASTAR 3.0 SOFTWARE Co. bajo el mtodo Clustal de mxima parsimonia
(Thompson et al. 1994).

4.13. Bsqueda y reporte de secuencias en el GenBank

Con la finalidad de construir un rbol filogentico y del cual se puedan
realizar inferencias filogenticos ms confiables, se procedi a bajar secuencias
de especies similares reportadas por internet en el Genbank del mismo gnero y
gneros relacionados, las cuales se alineaban entre s para la determinacin de
distancias genticas y su filogenia. El tipo de anlisis empleado fue el de la
bsqueda de similaridad, que consiste en efectuar una comparacin de una
secuencia problema con la totalidad de secuencias existentes en una base de
datos. Estas bsquedas se realizan con distintos programas que aplican
algoritmos de comparacin y como resultado generan un listado de organismos
cuyas secuencias resultan similares a la de estudio. Los algoritmos ms comunes
disponibles en la Internet son el BLAST y el FASTA. En el presente caso se uso el
algoritmo de Blast como se describe a continuacin:

56
* Las bsquedas de similaridad a travs del BLAST del NCBI se hicieron en el
URL: http://www.ncbi.nim.nih.gov/cgi-bin/BLAST/nph-blast?Jform=0

Una vez conectados a este URL se especific lo siguiente:

1. La secuencia problema (cada una de las secuencias obtenidas).
2. El programa a ejecutarse, segn sea el caso de las secuencias a
comparar, entre blastp, blastn, blastx, tblastn, tblastx. (en este caso tblastn).
3. La base de datos contra la cual se desea hacer la comparacin. Se
recomienda para empezar la no-redundante (nr).
4. El formato de los resultados: HTML (con lo cual aparecer el resultado en
pantalla en tanto est listo) o por correo electrnico (para lo cual se
especific nuestra direccin electrnica). En ambos casos, la operacin
puede durar algunos minutos.

Se Introduce cada secuencia y se configuran los parmetros segn sea
cada caso y se pulsa el botn Submitt Query. Con base en lo elegido en el formato
del resultado, apareci el resultado en pantalla o se recibi por correo electrnico.
En ambos casos, se almacenaron los resultados en un archivo local, para anlisis
posteriores.

Las secuencias bajadas- de internet se cargaron en el programa Editseq
de DNASTAR con el propsito de convertirlas en archivos legibles para el
programa MegAlign. El programa MegAlign fue usado para alinear las diferentes
secuencias obtenidas y as obtener la filogenia de tales secuencias por medio del
anlisis Neighbor-Joining y bootstrapping utilizando el mtodo CLUSTAL W
(Thompson et al. 1994).




57
4.14. Determinacin de la distancia gentica

Las distancias genticas fueron calculadas por el programa DNADIST en
PHYLIP v. 3.5 usando el modelo de parmetro'2 de Kimura de base de
substitucin. El anlisis UPGM de la distancia gentica fue tambin realizado
usando el programa DNADIST con el mtodo NEIGHBOR, (Felsenstein, 1993)

4.15. Determinacin de la distancia gentica y filogenia por medio de
cladogramas.

Una de las herramientas ms interesantes en el anlisis de secuencias, es
el dibujo de dendogramas que permitan tener una idea relativa de las distancias y
filogenia que separan a las secuencias estudiadas. En una primera instancia, se
pueden dibujar dendogramas basados en el grado de similaridad entre las
secuencias y un rbol filogentico podr ser dibujado al considerarse un nmero
estadsticamente significativo de caracteres (que para este caso pueden ser varios
nucletidos polimrficos) y contemplar otros factores como genomas completos,
registros fsiles, caractersticas fenotpicas, entre otros, destacando una vez ms
que, un rbol filogentico es una hiptesis que se plantea como primera
aproximacin a la relacin evolutiva entre los organismos estudiados (Thompson
et al. 1994).

El MegAlig, es un programa que permite entre otras cosas, calcular
distancias entre caracteres y dibujar dendogramas basados en estas distancias.
Para lograr esto, el MegAlig requiere como data de entrada un archivo con las
distancias y relaciones entre las secuencias. Este archivo puede ser generado con
herramientas de alineamiento mltiple como el CLUSTAL-W, tal como se seala
en la seccin de anlisis de secuencias. En este estudio se emple el software
Editseq para la generacin de cada archivo correspondiente a cada secuencia en
estudio. (Thompson et al. 1994).

58
4.16. Filogenia de las secuencias obtenidas

El dendrograma fue ilustrado por MegAlign, la longitud de las secuencias, el
contenido de % de GC y el nmero de diferencias de base fue calculado por
EditSeq de DNASTAR 3.0. El software de estos programas est disponible de
manera gratuita en Internet. (el DNASTAR no lo esta, pero los mtodos que usa
como el CLUSTAL s estn en otros software de Internet), (Thompson et al. 1994).
























59
V. RESULTADOS

La determinacin del modo de cmo probablemente se este realizando
algn evento de especiacin en Satureja macrostema var. laevigata en el estado
de Michoacn y el establecimiento de sus relaciones filogenticas fue establecido
con base en la secuenciacin de sus espacios transcritos internos ITS de su ADN
ribosomal, con el cual se defini que se encuentra en un proceso de especiacin
rpida, hbrida o recombinacional, que se refuerza con la inferencia de sus
relaciones filogenticas, las cuales se han realizado en un perodo corto de tiempo
geolgico (20-30,000 aos), observndose adems en sus secuencias internas de
su ADN, que se continan realizando en las plantas actuales mutaciones de punto
(perdida o ganancia de una o dos bases), las cuales a menudo son suficientes
para recorrer la informacin gentica y se encontr que las hay de dos tipos
(transversiones: sustituciones de purina por pirimidina, y transiciones: purina por
purina y pirimidina por pirimidina que son las formas ms simples de mutacin)
(Ennis, 2000).

5.1. Extraccin del ADN.

La calidad del ADN genmico, aislado de tejido fresco, evaluado por electroforesis
en gel de agarosa al 1.2% teido en bromuro de etidio (figura 2) result adecuada
para los anlisis llevados a cabo.

La concentracin total promedio de DNA, medida con la absorbencia en un
espectrofotmetro, estuvo en un rango de 102 a 900 ng/l de solucin, distribuidos
de la siguiente manera: SATIB 102 ng/l, SATPA 295 ng/l, SATIN 430 ng/l y
SATSJ 927 ng/pl de promedio de dos repeticiones.
60

La calidad del ADN result adecuada para los anlisis llevados a cabo. 5.5
Amplificacin.

La amplificacin de la regin de los ITS gener bandas de
aproximadamente 690 pb, visualizados en un gel de agarosa al 1.2%, corrido a 80
volts por una hora, variando la intensidad de las bandas con base en su peso
molecular entre los diferentes individuos representantes de poblaciones diferentes
(Figura 3). Esto podra interpretarse como la variacin gentica existente entre las
plantas en estudio.

61
A pesar de que en la figura 3 no todos los carriles muestran la banda
correspondiente a la amplificacin de la regin ITS1-5.8s-ITS2, con los primers
ITS 1-4 de aproximadamente 700 pb, s se observa que para cada "te nurite" hay
por lo menos un carril con fragmento amplificado.

Los fragmentos que amplificaron fueron cortados y limpiados con
GenClean, tal y como se describe en la seccin de materiales y mtodos, y
secuenciados, esto es: el tratamiento de GenClean permiti obtener ADN limpio,
sin residuos de carbohidratos y RNA; al ser cortados resultaron aptos para
secuenciacin.

5.3. Secuencias.

La secuenciacin de los 4 fragmentos correspondientes a los ADN de
diferentes plantas, se muestra en la cuadro 3. En todos los casos se obtuvieron las
secuencias ITS1, 5.8S e ITS2, as como sus reversos y complementos (estos
ltimos no mostrados).
Cuadro 3.- Secuencias obtenidas por espcimen de Satureja macrostema con los
primers ITS1-4.
ITS1 SATIB (253 b)
cctgcaaagcagaccgccgaacacgttcaacacaaaacccggcgccgcggagtgggggcgaccccccggccggcgtgtgcgctcgcgtcgcgtcc
gtgtcggtctaacaaacttgggcgcggcgcggaatgcgcgcaaggaaatcgaaaattgagcatccccctccccagacgcgcccggttcgcgggcgac
ggggagacaggatgcctatcgaaatgtctaaacgactctcggcaacggatatctggctctc
ITS1 SATIN (250 b)
cctgcaaagcagaccgcgaacacgttcaaacacaaaacccggcgccgcggagtgggggcgacccccccgccggcgtgtgcgctcgcgtcgcgccg
tgcggtctaacaaacttgggcgcggcgcggaatgcgccaaggaaaacgaaattgagcatccccctccccgacgcgccccgttcgcggggcgacggg
gagaaagggatgcctatcgaatgtctaaacgactctcggcaacggatatctcggctctc
ITS1 SATPA (254 b)
cctgcaaagcagaccgccgaacacgttcaacacaaaacccggcgccgcggagtgggggcgacccccccgccggcgtgtgcgctcgcgtcgcgtccg
tgtcggtctaacaaacttgggcgcggcgcggaatgcgcgcaaggaaatcgaaaattgagcatccccctccccagacgcgccccgttcgcgggcgacg
gggagacagggatgcctatcgaaatgtctaaacgactctcggcaacggatatctggctctc
ITS1 SATSJ (252 b)
cctgcaaagcagaccgccgaacacgtttcaaacacaaaacccggcgccgcggagtgggggcgacccgcccgccggcgtgtgcgctcgcgtcgcgc
cgtgcggtctaacaaacttgggcgcggcgcggaatgcgccaaggaaaacgaaattagcatccccctccccgacgcgccccgttcgcggggcgacgg
ggagaaagggatgcctatcgaaatgtctaaacgactctcgacaacggatatctcggctctc
5.8S SATIB (166 b)

62
Gcatcgatgaagaacgtacgaaatgcgatacttggtgtgaattgcagaatcccgtgaaccatcgagtcttagaacgcaagttgcgcccgaagccatt
agcccgagggcacgcctgcctgggcgtcacgcatcgcgtcgccccctcctcccactcgactaactccgg
5.8S SATIN (166 b)
gcatcgatgaagaacgtacgaaatgcgatacttggtgtgaattgcagaatcccgtgaaccatcgagtctttgaacgcaagttgcgcccgaagccatta
ggccgagggcacgcctgcctgggcgtcacgcatcgcgtcgccccctcctcccactcgactaactccgg
5.8S SATPA (166 b)
Gcatcgatgaagaacgtacgaaatgcgatacttggtgtgaattgcagaatcccgtgaaccatcgagtcttagaacgcaagttgcgcccgaagccatt
agcccgagggcacgcctgcctgggcgtcacgcatcgcgtcgccccctcctcccactcgactaactccgg
5.8S SATSJ (166 b)
gcatcgatgaagaacgtacgaaatgcgatacttggtgtgaattgcagaatcccgtgaaccatcgagtctttgaacgcaagttgcgcccgaagccatta
ggccgagggcacgcctgcctgggcgtcacgcatcgcgtcgccccctcctcccactcgactaactccgg
ITS2 SATIB (190 b)
gagaaggcggggccggagattggccccgggccggcccaaatgcgatcctcggcggcgcacgtctcgaccagtggtggttgaacgatcaactcgc
gtgctgtcgtgcctcaaggcgccgccgtcagggaaatcgaagccgtccggagaagaccgcaggacccaacggagcgatcccgcaacgctccca
cga ITS2 SATIN (192 b)
gggaaggcgggggcggagattggccccccgccggcccaaatgcgatcctcggcggcgcacgtcacgaccagtggtggttgaacgatcaactcgc
gtgcttcgtgcctcaaggcgccgccgtcagggaaatcgaaggccgtccggagaagaccgcaaggacccaacggagcgatcgcgcatcgctccca
cga ITS2 SATPA (190 b)
gggaaggcggggccggagattggcccccggccggcccaaatgcgatcctcggcggcgcacgtcacgaccagtggtggttgaacgatcaactcgc
gtgctgtcgtgcctcaaggcgccgccgtcagggaaatcgaagccgtccggagaagaccgcaggacccaacggagcgatcccgcaacgctccca
cga
ITS2 SATSJ (194 b)
Gggaaggcgggggcggagattggcccccggccggcccaaatgcgatcctcggcggcgcacgtcacgaccagtggtggttgaacgatcaactcg
cgtgctgtcgtgcctcaaggcgccgccgtcagggaaatcgaaggccgtccggagaaagaccgcaaggacccaacggagcgatcgcgcattcgct
cccacga


La longitud de las secuencias obtenidas de la regin ITSI-5.8S-ITS2 vari de entre
658 pb para SATIN hasta 661 pb de SATPA, que indica nuevamente la
variabilidad existente entre las plantas en estudio.

5.4. Recorte de secuencias

Una vez ubicado el gen 5.8S en las secuencias obtenidas se procedi a
"quitar" los decmeros correspondientes a los iniciadores en los extremos 5' y 3'de
cada secuencia, esto provoc una disminucin en la longitud de las secuencias,
que al ser recortadas para su correcta alineacin, quedaron de la siguiente
manera: SATIB 609 pb, SATIN 608 pb, SATSJ 612 pb y SATPA 610 pb,
observndose que la variacin en la longitud de las cuatro secuencias vari de
608 a 612 pb.

La longitud del ITS1, 5.8S e ITS2 se observa en el cuadro 4, la variacin
significativa en la longitud del ITS1 ocurri de 250 a 254 bases y la relacin G+C
en
63
el ITS1 vari de 64.3 a 65.2 % con un promedio de 64.6%; La longitud del gen
5.8S fue constante en el nmero de bases de 166 pb y la relacin G+C tambin
fue constante de 58.4 %, mientras que el ITS2 vari de 190 a 194 pb con una
relacin G+C que vari de 67.0 a 67.9%, con un promedio de 67.5 %; mientras
que el promedio de ITS1-5.8S-ITS2 vario de 63.2 a 63.8%. lo que corrobora
nuevamente la variabilidad existente entre las plantas en estudio.

5.5. Alineacin

Las secuencias presentaron una longitud de 620 pb por planta (cuadro 19);
comparando nicamente los ITS1 e ITS2 de la manera siguiente: la comparacin
SATIN contra SATIB (cuadro 7); en el cuadro 8, SATSJ contra SATIB; en el
cuadro 9, SATSJ contra SATPA; en el cuadro 10, SATIN contra SATPA; en el
cuadro 11, SATIN contra SATSJ y en el cuadro 12, SATPA contra SATIB.

Cuadro 4.- Longitud del ITS1, 5.8S e ITS2; promedio y contenido de G+C.

ITS1 pb % G+C 5.8S pb % G+C ITS2 pb % G+C Total pb Promedio G+C
IB 253 64.4 166 58.4 190 67.4 609 63.4
IN 250 65.2 166 58.4 192 67.7 608 63.8
PA 254 64.6 166 58.4 190 67.9 610 63.6
SJ 252 64.3 166 58.4 194 67.0 612 63.2
Promedio G+C 64.6 58.4 67.5

En los cuadros 7 a 12 se presentan las secuencias ITS1 e ITS2 alineadas
por planta y su comparacin entre s, marcndose los residuos comunes con una
barra vertical, y donde no son comunes, es decir, que existe delecin o insercin
en alguna de las secuencias se indica con rectngulos verticales de color verde o
azul y con rectngulos de color rojo las mutaciones (transversiones/transiciones),
las cuales se indican en los cuadros 7 a 12 en azul y violeta, observndose en el
cuadro 7, tambin el uso de "palabras (una palabra es un conjunto de residuos
contiguos en la misma posicin que se consideran como una unidad y su longitud
es variable).
64
En el cuadro 5 se observan entre otras, las palabras; "AGA" (color rojo),
que se presenta 2 veces en IN y 3 veces en IB; "AAA" (color negro), se, presenta
11 veces en SATIN y 8 veces en SATIB; "CTC" se presenta 9 veces en SATIN y 9
veces en SATIB; "CCG" se presenta 13 veces en SATIN y 13 veces en SATIB;
"CGC" se presenta 18 veces en SATIN y 16 veces en SATIB, y "CG" (color violeta
dentro de rombos rojos), que se presenta 62 veces en SATIN y 61 en SATIB, y
que en realidad son, "motivos" es decir, series de repeticiones de secuencias
cortas de nucletidos no codificantes, de los cuales no se tiene clara su origen y
funcin. Su variabilidad es alta y difieren de un individuo a otro, por lo que con el
anlisis de estas regiones es posible identificar individuos.

En el cuadro 6 se observa el nmero y porcentaje de purinas (adeninastiminas) y
piridiminas (citosinas-guaninas), de SATIN-SATIB y SATSJ-SATPA.

Cuadro 5.- Nmero de veces que aparecen las "palabras" formadas por trinucletidos y
dinucletidos en los ITS1 e ITS2 al comparar SATIN contra SATIB.

AGA % AAA % CTC % CCG % CGC % CG %
ITS1 IN 1 2 10 12 5 6 6 8 12 15 35 28
ITS2IN 1 2 1 2 4 7 7 11 6 10 27 29
TOTAL 2 11 9 13 18 62
ITSI IB 2 3 7 9 5 6 6 8 11 13 35 28
ITS2IB 1 2 1 2 4 7 7 11 5 8 26 28
TOTAL 3 8 9 13 16 61

observndose que el nmero de Adeninas, Timinas, Guaninas y Citocinas es muy
variable por ITS, pero se acenta ms en los ITSI-ITS2 de PA, sin embargo en
cuanto a porcentaje son muy similares. La relacin GC vari de 63.3 a 67.9 %. Lo
anterior permite establecer diferencias entre las secuencias, las cuales al
analizarse por su distancia gentica permiten establecer sus divergencias y
similitudes.
65
En los cuadros 11 y 12 se observa que precisamente el mayor porcentaje
de emparejamiento de las secuencias se da entre las plantas ms estrechamente
relacionadas de acuerdo al rbol filogentico resultante, tenindose para la
relacin SATIN-SATSJ un 97 y 98 % de emparejamiento de bases en sus ITS1 e
ITS2 respectivamente y un nmero de solo 9 mutaciones de nucletidos; mientras
que la relacin SATPA-SATIB muestra un 98% de emparejamiento y tan solo 6
cambios, lo que define ms lo estrechamente relacionados que se encuentran. Sin
embargo dichos cambios son indicadores de un probable evento de especiacin y
el rbol generado a partir de estos datos es indicativo de ello, al separar a las
plantas en estudio como descendientes de un ancestro comn.

Cuadro 6.- Nmero y porcentaje de purinas (adeninas-timinas) y piridiminas
(citosinas-guaninas), de SATIN-SATIB y SATSJ-SATPA.

A % T % G % C % G+C
ITS 1 I N 54 21.6 33 13.2 78 31.2 85 34 65.2
ITS2 IN 39 20.3 23 12 67 34.9 63 32.8 67.7
TOTAL 93 21 56 12.7 145 32.8 148 33.5 63.3
ITS1 IB 54 21.3 36 14.2 79 31.2 84 33.3 64.4
ITS2 IB 39 20.5 23 12.1 65 34.2 63 33.2 67.4
TOTAL 93 21 59 13.3 144 32.5 147 33.2 65.7
ITS1 SJ 56 22.2 34 13.5 77 30.6 85 33.7 64.3
ITS2 SJ 39 20.5 22 11.6 65 34.2 64 33.7 67.9
TOTAL 95 21.5 56 12.7 142 32.1 149 33.7 65.8
ITS1 PA 39 17.9 39 17.9 66 30.3 74 33.9 64.2
ITS2 PA 40 20.6 24 12.4 68 35 62 32 67
TOTAL 79 19.2 63 15.3 134 32.5 136 33 65.5

66
67
68

69

70
71

72
En el cuadro 13 se observa, el por ciento de emparejamiento con respecto a la
secuencia consenso resultante de alinear todas las secuencias, y el nmero de
deleciones, mutaciones e inserciones por comparacin; aclarando que la primera
Cuadro 13.-Porcentaje de emparejamiento, alineamiento, deleciones,
inserciones y mutaciones (transversiones y transiciones)


Planta % IN-IB SJ-IB SJ-PA

IN-PA

IN-SJ
PA-IB

IN ITS1 94
IB ITS1 94
M I
INITS2 95
IB ITS2
SJITSI
IB ITS1
SJITS2
IB 1TS2
SJITS1
PAITS1
SJITS2
95
93
93
94
94
94
94
96
PAITS2 96
INITS1 95
PAITS1 95
INITS2 96
PAITS2 96
INITSI 97
SJITS1 97
INITS2 96
SJITS2 98
PAITS1 98
IBITSI 98

PAITS2 98
IBITS2 96
Total 7
D D
7
4
0
2
M

4

7





















24
1

7

0
D




7

0


















7
D





6

4
M





4

5

















26
1





7

0
D







6

0















6
D








4

4
M








4

2














20
1








6

0
D











7

0











7
D









3

2
M









2

4








18
1









7

0
D











3

2






5
D












1

0
M












2

1





9
1












3

2
D















0

0


0
D
















1

0















2

3
6















0

0
% de emparejamiento y alineamiento. D= delecin. M= mutacin. 1= insercin.






73
columna de deleciones siempre pertenece a la primera planta en comparacin y la
segunda delecion pertenece a la segunda planta en comparacin.

Por otro lado, en el cuadro 14 se observan los sitios en los cuales se
presentaron mutaciones puntuales de tipo transversin (purina por pirimidina) y
transicin (purina por purina pirimidina por pirimidina), por ITS, observndose
para la comparacin SATIN-SATIB, 11 sitios polimrficos de los cuales 4 estn en
ITS1 y 7 en el ITS2, tratndose por. lo tanto de las plantas ms divergentes y ms
distantes, siguindole en ese orden la relacin SATSJ-SATPA con 6 sitios
polimrficos, que permiten establecerse como especies derivadas de un ancestro
comn de acuerdo al rbol filogentico resultante (figura 6).
Cuadro 14.- Tipo de mutacin (transversin-transicin) y su nmero de sitio por ITS.

Nmero de sitio Tipo de transversin Tipo de transicin
70 CxG
145 AxT
ITS 1 SATIN-SATIB 180 C x G
202 A x C
2 GxA
13 GxC
28 CxG
ITS2 SATIN-SATIB 29 C x G
64 AxT
176 G x C
181 TxA
67 GxC
ITS1 SATSJ-SATPA 146 A x T
203 A x C
238 A x G
ITS2 SATSJ-SATPA 13 G x C
177 GxC
74
En el cuadro15 se observa el reporte de alineamiento del gen 5.8S de las
cuatro plantas de Satureja macrostema, observndose, como se esperaba, que se
trata de una regin conservada, con excepcin de los sitios 71 y 100 (rombo color
violeta) en los cuales se observan inserciones de Adenina y Citosina
respectivamente y solamente presentes en el gen de las plantas correspondientes
a SATIB y SATPA.

En el rbol filogentico (figura 4), obtenido para este gen 5.8S con ClustalW
y Jotun Hein, se observan los mismos valores de similaridad y divergencia de 98.8
y 100% y 1.2 respectivamente (Cuadro 16), separando en dos pares de clados a
cada una las secuencias obtenidas.


75

En el cuadro 17 se observa el reporte del alineamiento del ITS1 de las
cuatro plantas de Satureja, en el cual existen 20 sitios polimrficos, mientras que
en el cuadro 18 se observa el alineamiento del ITS2 de las cuatro plantas de
Satureja en el cual solo existen 11 sitios polimrficos lo que manifiesta la
variabilidad gentica entre las plantas en estudio, mostrando un mayor
polimorfismo los ITS1 uno que los ITS2.


76

En el cuadro 19 se reporta el alineamiento de la regin ITS1-5.8s-ITS2 de
Satureja macrostema, en el cual se observan los mismos cambios descritos
anteriormente de el ITS1 e ITS2 con la nica salvedad de que el nmero de sitio
cambia, ya que se inserto el gene 5.8S el cual muestra cambios de recorte por
motivo de lograrse el mejor alineamiento posible, de tal manera que en el sitio 265
existe delecin de Guanina en SATIN, SATPA e SATIB y en el sitio 278 existe
delecin de Guanina en SATPA e SATIB que no aparecen en el alineamiento del
5.8S; en el sitio 331 y 360 se observan las transversiones correspondientes a los
sitios 71.

Tambin en el cuadro 19 se observa el alineamiento de las secuencias de
las cuatro plantas en estudio, detectndose un total de 36 sitios polimrficos, de
los cuales algunos son coincidentes, los coincidentes son regiones de variacin de
77
reciente aparicin y donde seguramente sigue el evento de
divergencia/especiacion, y por tanto las no coincidentes son regiones conservadas
que, s presentan un cambio, este debe tener mayor tiempo; por planta se tienen
las siguientes mutaciones: 8 para SATSJ; 5 para SATPA; 4 para SATIN y 10 para
SATIB; los Indels (deleciones/inserciones) se consideraron aparte debido a que
estos son necesarios solo para lograr la mejor alineacin y lograr obtener el rbol
ms parsimonioso y para SATI B se necesitaron 11; para SATI N, 12; para
SATPA, 11; y para SATSJ, 7, de tal manera que SATSJ necesito menor nmero
de Indels ya que sus secuencias tienen mayor nmero de bases (612), mientras
que las secuencias de menor nmero de bases (SATIB-SATPA) de 609 y 608
pares de bases necesitaron el mismo nmero de Indels y SATIN fue el que
necesit mayor numero (12) porque es el que tiene el menor nmero de bases
(608).
En la figura 5 se observan los rboles resultantes de este alineamiento y en
el cuadro 20 sus porcientos de similaridad y divergencia.

78

79















80
5.7. Comparacin con algunos Gneros de la misma Familia.

En el cuadro 21, se aprecia la comparacin de las plantas de Satureja
macrostema contra siete especies de otros gneros de la misma familia y
Heliopsis longipes como organismo externo (familia Asteraceae) y son; Faradaja
Iehuentei; Ipomea pestidigris; Nepeta sibirica; Oxera rugosa; Oxera vanuctensis;
Sideritis algarviensis y Stachys hirta. Al comparar las plantas de Satureja con otras
especies de otros gneros de la misma familia y con Helipss longipes como
organismo externo para comparacin; se observan bsicamente las inserciones,
deleciones y mutaciones descritas anteriormente en Satureja, pero adems, un
mayor nmero de Indels que son necesarios para alinear satisfactoriamente a
todas las secuencias, observndose en los sitios 14 y 15 deleciones en todas las
especies excepto en Heliopsis longipes; lo que sugiere que esta ausencia de
bases es caracterstica de la familia Lamiaceae; en el sitio 20 sucede lo mismo; en
los sitios 53 y 54 hay dos deleciones en todas las especies excepto en Heliopsis
longipes; en los sitios 68 a 73 sucede lo mismo; en los sitios 78 al 82 hay delecin
en Satureja lo que sugiere que esta ausencia de bases puede ser caracterstica
del gnero Satureja; en los sitios 98 y 99 hay delecin en todas las especies
excepto en Heliopsis longipes; en los sitios 112 a 120 se observa lo mismo;
igualmente en los sitios 147 a 149; en el sitio 167 se observa insercin de Guanina
solo en IB y PA.

En el sitio 201 a 205 se observa la palabra "AGACG" en SATIB y SATPA y la
palabra "GACD" en SATIN y SATSJ que puede ser utilizada como marcador
especifico para las especies de Satureja y para elaborar uprimers de las mismas;
lo mismo sucede con la palabra "AGA" del lugar 222 a 224, caracterstico de
Satureja; en el sitio 452 al 454 se observa la palabra "ACT" caracterstico solo de
Satureja; en los sitios 487 al 505 se observan deleciones muy particulares solo de
las Satureja en los sitios 603 al 606 se presenta la palabra "TCAG" solo en
Satureja; en el sitio 600 al 604 se presenta la palabra "AATCG" solo en Satureja;
en el sitio 523 al 527 se observa la palabra "TCCGG" solo en Satureja; en el sitio
529 al 531 se observa la palabra "GAA" solo en Satureja; la palabra "GA" se
81
observa solo en Satureja en los sitios 633 a 634; "CG" en los sitios 636 a 637; en
los sitios 644 al 649 se observa la palabra "ACCCAA" solo en Satureja.

En los sitios 652 al 654 y 656 al 658, se observan las palabras "GAG" y
"GAT" respectivamente y en los sitios 662 al 665 las palabras "GCAA" para IB Y
PA y las palabras "GCAT' para SATIN y SATSJ; estas ltimas pueden ser
utilizadas para la identificacin de la Satureja SATPA-SATIB y SATIN-SATSJ
especficamente. Las palabras anteriores sirven para identificar exclusivamente a
Satureja, y se encuentran dentro del cuadro de color violeta.

En el cuadro 22, se observan los porcentajes de similitud (97.5 y 93.6%)
entre las plantas de Satureja comparadas, observndose que las de mayor
porcentaje corresponden precisamente a las ms estrechamente relacionadas de
acuerdo con el fenograma de la figura 6, adems de que las mismas plantas
(SATPA-SATIB y SATIN-SATSJ) respectivamente, tambin muestran los
porcientos de divergencia entre ellas solo en una cantidad menor de (0.7 y 0.5%),
corroborndose lo estrechamente relacionadas que se encuentran. Tambin se
observan los porcentajes entre Satureja al compararse contra otras ocho especies
de otros gneros de la misma familia Labiatae, usando a Ipomea y a Heliopsis
como grupos externos.

Es necesario sealar que entre ms especies sean comparadas ms se
fortalecer el rbol filogentico resultante, ya que la secuencia consenso es la mas
cercana al origen, hasta completar el Arbol de la vida.







84

83
5.7 Dendrogramas.

El rbol filognetico obtenido con base en las secuencias reportadas en el
cuadro 21, de acuerdo al programa MegAling y bajo el mtodo de Clustal, se
muestra en la Figura 6, en el cual se observa con ms claridad la distancia
gentica y la filogenia entre las diferentes especies y en la figura 7 el cladograma
resultante.


84

5.8 Nmeros de accesin en el GenBank

Las secuencias generadas en el presente estudio fueron enviadas para ser
indexadas al GenBank (NCBI, USA) por medio del software Sequin y en respuesta
se les dieron los nmeros de accesin que abajo se describen y aparecieron en el
mes de mayo del 2002, y se encuentran en la Web para su uso y consulta a partir
del 6 de mayo de 2002.

Nmeros de accesin.
AY094152 al ITS1 de SATIB, AY094153 al ITS2 de SATIB
AY094154 al ITS1 de SATIN, AY094155 al ITS2 de SATIN
AY094156 al ITS1 de SATPA, AY094157 al ITS2 de SATPA
AY094158 al ITS1 de SATSJ, AY094159 al ITS2 de SATSJ

85
VI. DISCUSIN

Uno de los principios centrales en biologa evolutiva sostiene que toda la
biodiversidad comparte una historia evolutiva comn; esto significa que existe una
sola genealoga para todos los organismos y todos los individuos existentes y
extintos estn unidos por relaciones de descendencia en un patrn jerrquico de
grupos anidados en otros grupos ms inclusivos (Wiley, 1981).

De acuerdo con Dobzhanzky (1982), la evolucin consiste en una serie de
de transformaciones parciales o completas e irreversibles de la composicin
gentica de las poblaciones, basadas principalmente en interacciones con el
ambiente, mientras que actualmente Eldredge y Gould (1972), postulan en su
teora del equilibrio puntuado, que la anagnesis (los cambios morfolgicos
experimentados por un mismo linaje) y la cladognesis (la divi sin de una especie
en dos) estn relacionadas, y mantienen adems, que se da una breve
aceleracin del cambio morfolgico precisamente cuando una poblacin de censo
reducido diverge de su especie original para formar otra nueva, con largos
periodos de rpida especiacin (surgimiento de una o ms especies). Estos
periodos de rpida especiacin pueden ser causados por grandes cambios en el
ambiente, cuando se rompe el equilibrio por la acumulacin de mutaciones. La
nocin contraria, que los puntualistas atribuyen a la teora sinttica, consiste en
que el cambio morfolgico gradual lleva consigo su divisin en razas y
subespecies mucho antes de que pueda afirmarse que han surgido especies
nuevas.

Por otro lado, la especiacin hbrida o "recombinacional" se refiere al origen
de nuevas especies va hibridacin entre especies paternales divergentes
cromosmica o genticamente y de acuerdo con los estudios de simulacin
realizados por Ungerer et. al., (1998), sugieren que este tipo de especiacin es
puntuado, es decir con largos perodos de estasis, en los cuales la mayora de las
especies no exhibe cambio direccional alguno durante sus estancia, seguido por
abruptas transiciones en las
86
cuales las especies paternales individuales son desplazadas rpidamente por las
neoespecies hbridas (McCarthy, 1995; Ungerer et al., 1998).

Con base en los resultados obtenidos en el presente estudio, se sugiere que el
tipo de especiacin presente en Satureja macrostema var. laevigata es
recombinacional de tipo puntuado, y sus relaciones filogeneticas tambin apoyan
esta sugerencia ya que los perodos de divergencia entre las plantas en estudio es
de relativamente pocos aos, que podran ser insignificantes respecto al tiempo
geolgico, lo que sugiere que actualmente esta ocurriendo una especiacin rpida
en esta especie.

Con la determinacin de la variabilidad genmica de S. macrostema por medio de
un anlisis filogentico, utilizando para ello los genes ribosomales y sus
espaciadores, fue posible detectar las regiones variables informativas, los
marcadores moleculares para la identificacin y resolucin entre diferentes
especimenes de S. macrostema a distintos niveles, la filogenia, sus relaciones de
parentesco y el tipo de especiacin.

Con relacin a la regin de los ITS, sta ha sido considerada como una fuente
muy til de caracteres para estudios filogenticos en angiospermas (Baldwin et al.,
1998), dado que los ITS se encuentran altamente representados en el genoma y
se pueden amplificar con cantidades pequeas de ADN (White et al., 1990) En
este estudio, cantidades tan pequeas como 100 a 300 ng/ml resultaron
adecuadas para la amplificacin de los ITS.

Las secuencias altamente conservadas dentro de la mayora de los genes del
nrADN son muy tiles en el diseo de oligonucletidos (iniciadores) "universales",
lo que facilita la amplificacin de los ITS mediante el uso de la reaccin en cadena
de la polmerasa (PCR) (Thompson, et al., 1997). Los espaciadores internos
transcritos son la parte ms variable de la regin de los ITS, debido a que se
encuentran flanqueando a la subunidad 5.8S, que es ms conservada y se
posibilita la alineacin

87
no ambigua de esta regin (Walsh, et al., 1997). El hecho de que se presenten
cientos de copias por clula de los nrDNA, facilita su amplificacin con los
iniciadores especficos, por esta razn la amplificacin de la regin ITS1-5.8s-ITS2
por medio de los iniciadores especficos ITS1 e ITS4 se llev a cabo sin dificultad,
una vez encontradas las condiciones adecuadas para la reaccin en cadena de la
polimerasa.

Hershkovitz y Zimmer (1996) proponen que el espaciador ITS2, contiene la
informacin suficiente para diagnosticar linajes a diferentes niveles jerrquicos y
argumentan que el anlisis de la composicin de las bases muestra que el ITS2 de
las angiospermas es rico en GC, lo cual coincide con lo encontrado en las
secuencias de este trabajo; no as la proporcin de Timina, la cual mencionan
estos autores como muy variable. La situacin anterior est ausente en Satureja
en donde la proporcin de timina se comporta de manera constante (cuadro 6).
Los autores antes sealados proponen como modelo general al ITS2 de
angiospermas, sin embargo, lo encontrado en Satureja y los ITSs2 de las plantas
con las que se compararon (cuadro 7) se concluye que no se puede generalizar su
uso, al menos es inadecuado para las especies aqu reportadas.

Por otro lado, con la utilizacin de algoritmos estndares para la
comparacin de las secuencias obtenidas en aquellos segmentos de alta similitud
se logr un correcto alineamiento de las mismas. El alineamiento es una
herramienta cualitativa que permite dar los primeros pasos hacia la conclusin de
que dos o ms secuencias son homlogas; permitiendo detectar el polimorfismo
presente (Swofford, 1999). Todo esto con la finalidad de realizar los anlisis
relacionados con el ensamblaje, edicin, alineamiento global, bsqueda de
secuencias homlogas, relaciones filogenticas, deteccin de motivos, (series de
repeticiones de secuencias cortas de nucletidos), anlisis de uso de codones,
comparacin de la secuencia problema con las publicadas en las bases de datos,
(Genebank), etc. (Panero, et al., 1999), como se observa en el cuadro 7.


88
Esta tcnica, aparentemente sencilla se hace ms compleja en la medida
en que el tamao de las secuencias a comparar es mayor y, ms an, cuando se
comparan ms de dos secuencias. Por ello se emplean computadores y distintos
programas que dadas las secuencias, generan el mejor alineamiento, y por lo
tanto resultados ms confiables (Panero, et al., 1997).

Los resultados obtenidos de divergencia y disimilitud, sugieren que hay al
menos dos especies estrechamente relacionadas SATPA-SATIB e SATIN-SATSJ,
lo cual se corrobora con los valores del cuadro 15 y figura 4, donde se observa
que las secuencias de SATPA-SATIB e SATIN-SATSJ son en este gene 5.8S, 100
similares, mientras que SATIN-SATIB, SATIN-SATPA y SATSJ-SATPA son
solamente similares en 98.8 % y 1.2 % divergentes, valor suficiente para algunos
autores para considerarlas como especies diferentes, ya que el 5.8S es un gen
altamente conservado y la mas mnima variacin representa gran variabilidad
gentica (Panero, et al., 1999).

Se destaca el hecho de que al comparar las 4 secuencias de 166 bases del
gen 5.8S se observen solo dos cambios de bases, ya que las secuencias de
SATIB y SATPA, as como SATSJ-SATIN son idnticas, y los dos cambios
detectados entre estos dos pares de secuencias son, que mientras las secuencias
de SATIN y SATSJ presentan una Timina en la posicin 71, IB y PA presentan la
base complementaria Adenina; el otro cambio se da en la posicin 100 con una
Citosina en las secuencias de SATIB y SATPA mientras que SATIN y SATSJ
presentan la complementaria Guanina.

Si se toma como base este argumento se tienen dos especies diferentes, lo
cual se refleja en variabilidad gentica observada que manifiesta Cladognesis y
cuya principal evidencia de especiacin es el cambio en la composicin gentica
observada en los ITS de S. macrostema, y principalmente en el gen 5.8S que es
una secuencia altamente conservada, donde la primera esta formada por las
plantas de SATPA, al presentar entre ellas exactamente la misma secuencia en el
gen 5.8S; y la

89
segunda formada por las plantas de SATIN y SATSJ que de igual manera
presentan entre ellas la misma secuencia. Hay que hacer notar que al alinear las
cuatro secuencias en el MegAling la secuencia consenso resultante es idntica a
las secuencias SATIN y SATSJ, por lo que se puede argumentar que esta es la
especie ms ancestral y que SATIB y SATPA forman una especie de ms reciente
aparicin, lo cual se corrobora con lo observado en los rboles filogenticos (figura
5)

Con los datos obtenidos de la secuencia del gen 5.8S donde se define la
existencia de dos especies, se puede argumentar que de estas dos especies la
ms ancestral es la especie SATIN y la ms reciente es SATIB. A su vez la ms
ancestral (SATIN) da origen a SATSJ y SATPA que origina a SATIB. Tanto SATSJ
como SATIB se pueden considerar como subespecies, pues con base al gen 5.8S,
SATSJ es idntico a SATIN, y SATIB es igual a SATPA; donde ocurre variacin es
en los ITSs, tanto en el ITS1 como el ITS2. Esta variacin, al considerarla
globalmente, arroja una disimilitud de 0.5% entre SATIN y SATSJ y de 0.7% entre
SATPA y SATIB, valores entre el 0.5% y 1 % que es rango comn considerado
para subespecies en angiospermas (Urbatch, et al., 1997).

(Urbatch, et al., 1997) considera un mximo de 1 % de disimilaridad entre
taxa de la misma especie, valores mayores de hasta 5 % de disimilaridad se
pueden considerar especies diferentes y valores superiores indican gneros
diferentes (Urbatch, et al., 1997). Por otro lado, el rango de subespecies esta entre
los valores entre 0.5 y 1 % de disimilaridad y valores menores a 0.5% de
disimilaridad son variedades o isoformas.

El anlisis de tales secuencias est siendo empleado por algunos investigadores
para construir nuevos rboles filogenticos en una gran diversidad de especies, lo
que est revolucionando la sistemtica de los organismos vivos.



90
Se considera que el gen 5.8s es una secuencia altamente conservada, por
lo que ligeras variaciones en su secuencia pueden interpretarse como especies
diferentes (Panero, et al., 1999).

La filogenia obtenida se presenta de la siguiente manera: como se observa
en el rbol filogentico de la figura 4 del gen 5.8s, se infiere que de un ancestro
comn, que representa la secuencia concenso, se originaron las dos lneas de
descendencia hace aproximadamente 20,000 aos, ya que segn Scrotch (1996),
se considera que un cambio de base en el gen 5,8S refleja un aproximado
promedio de divergencia de 10,000 aos y en los ITS1 e ITS2 dependiendo del
lugar varia entre 1000 y 5000 aos, en angiospermas.

Para determinar la divergencia de cada lnea hay que recurrir a la
variabilidad observada en los ITS1 e ITS2. De esta manera la primera lnea form
un ancestro, que dio origen a SATIN. Siendo SATIN la que presenta la secuencia
ms similar a ese ancestro comn, e hipotticamente esto ocurri hace
aproximadamente 30,000 aos por lo que aparece ms cercano a la raz del rbol.
SATSJ presenta mayor disimilitud con ese ancestro comn por lo que aparece
mas alejada de la raz y sera un derivado de SATIN, evento que podra haber
ocurrido hace aproximadamente "18,750" aos, ya que entre SATIN y SATSJ hay
una distancia de 11,250 aos. Estos valores se calculan teniendo el nmero total
de cambios del ITS1 e ITS2 de la especie de mas reciente aparicin (SATIB),
contra la secuencia en dilema SATIN.

Para lograr lo anterior se desarroll la siguiente frmula matemtica:
D=(n12)(p) Donde: d= distancia gentica en aos
n= nmero total de diferencias de nucletidos entre dos
secuencias
p= promedio en aos del rango de sustitucin de nucletidos

Con base en lo anterior, las relaciones que se establecen entre las especies se
observan de manera aproximada en la figura 8, estos valores concuerdan de
91


manera aproximada con los valores obtenidos en la variabiliad del 5.8S (dos bases
= a 20, 000 aos). Ya que la aparicin de SATSJ probablemente ocurri hace
aproximadamente 18,750 aos y la de SATPA hace aproximadamente 22,500
aos.

As, si el ancestro que dio origen a Satureja spp. surgi hace ms de
30,000 aos. Este divergi y dio origen a dos especies: Una linea se dividi hace
30,000
92
aos dando origen por un lado a la especie SATIN, que mantuvo el linaje del
ancestro de Satureja, y por otro lado dio origen a la subespecie, en posible
proceso de especiacin, a SATSJ. La otra linea divergi hace 22,500 aos, dando
origen a la especie SATPA; actualmente esta especie presenta un notable evento
de especiacin que se manifiesta en la aparicin hace aproximadamente 15,000
aos, de su subespecie SATI B.

La figura 7 muestra la estrecha relacin entre SATIN y SATSJ y entre
SATPA y SATIB, grficamente se observa la naturalidad con que estos taxa
pueden estar hibridizados, lo cual es evidenciado tambin por la existencia de
algunos ejemplares que no pueden ser clasificados como S. macrostema var.
laevigata, pero que segn la clave pertenecen a esta variedad, a pesar de no
poderse identificar completamente como tal, dadas las caractersticas
morfolgicas diferentes reportadas por Aguilar (2001). La figura 7 muestra
claramente la diferenciacin en dos "especies", SATIN y SATPA, lo que se apoya
con las diferencias encontradas en el gene 5.8s, lo cual no coincide con la clave
morfolgica de satureja, ya que esta indica que se trata de una sola variedad
(laevigata). La misma figura 7 muestra que SATSJ y SATIB podran haber
evolucionado a partir de SATIN y SATPA respectivamente. El anlisis de los sitios
polimrficos como se mostr arriba tambin conduce a esta conclusin.

Por lo tanto, se argumenta que se tienen dos especies con base a las
diferencias del gen 5.8s y son: SATIN y SATPA; la especie SATIN tiene una
subespecie que es SATSJ y SATPA tambin tiene una subespecie SATIB, Con los
datos observados en el rbol filogentico se resume tericamente que la especie
SATIN es la ms ancestral; en ella esta ocurriendo un evento de especiacin que
da origen a la subespecie SATSJ, tanto la especie SATIN como la subespecie
SATSJ se encuentran en la actualidad; SATSJ por el mayor nmero de cambios
esta divergiendo a mayor velocidad que SATIN, lo que sugiere una especiacin
rpida de tipo puntuado (Eldredge y Gould, 1972).


93
De acuerdo con el cladograma de la figura 7, la especie SATPA es la de
mas reciente aparicin; en ella tambin esta ocurriendo un evento de especiacin
que da por origen a la subespecie SATIB, en esta subespecie el proceso de
especiacin es mas dinmico que el de la subespecie SATSJ, ya que es la que
presenta mayor disimilitud con el ancestro comn (secuencia consenso); tanto la
especie SATPA como la subespecie SATIB se encuentran en la actualidad; SATIB
es el taxa que presenta la mayor divergencia con respecto al ancestro comn.
Esto sugiere que s entre las plantas de Satureja se llevan a cabo procesos de
hibridacin, estos estaran ocurriendo, seguramente, entre la subespecie SATSJ y
su especie SATIN. Esta hibridacin, y por tanto flujo gentico entre las plantas en
estudio, explicara la estabilidad y similitud de secuencias que a pesar del tiempo,
y por tanto eventos de diversificacin gentica, mantiene a las secuencias
altamente similares y homogneas (Avise, 1994).

Para el caso de SATPA se encuentra, evolutivamente hablando, en un
punto intermedio, ya que presenta similaridades genticas con los dems taxa y
presenta un gene 5.8S idntico al de SATIB (misma especie), pero sus ITSs son
variables y al comparar sus secuencias, SATPA mantiene mas similaridad con el
ancestro comn (secuencia consenso) que SATIB, lo que acerca ms a SATPA a
dicho ancestro. SATIN y SATSJ son las que ms se parecen a tal ancestro.

Por otro lado, las plantas en estudio presentan divergencia molecular en
sus secuencias ITS de su ADN, para considerarlas como especies (figura 7);
SATIN con respecto a SATIB presenta 24 cambios; SATSJ-SATIB presenta 26
cambios; SATINSATPA=18; SATSJ-SATPA=20; y los de ms ntima relacin;
SATIN-SATSJ =9 cambios y SATPA-SATIB solamente 6 cambios; y es en estas
dos ltimas relaciones donde surge el dilema cuntas diferencias de nucletidos
se requieren para confirmar la distincin entre especies?; de acuerdo con
Dubouzet y Shinoda (1999), menos de 7 cambios son suficientes para caracterizar
a las subespecies y es el caso de las relaciones ms ntimamente relacionadas
SATIN-SATSJ y SATPA-SATIB; ya que se infiere que SATSJ y SATIB son
subespecies de SATIN y SATPA, sin
94
embargo la evidencia molecular apoya la hiptesis de que se les puede calificar
como especies independientes, derivadas de SATIN y SATPA y no como
subespecies. Leclerc (1997), encontr que en Fucus (Phaeophyceae) dos
especies se diferenciaron por solamente cinco nucletidos.

En otros resultados, al efectuar, la alineacin de la secuencia del gen 5.8S
de S. macrostema la cual se realiz por comparacin de 32 secuencias similares
de Lamiaceae reportadas en el GenBank usando el programa BLAST del
GenBank. Los resultados obtenidos la distancia gentica (que es una medida del
nmero medio de sustituciones de codones por locus gnico, electroforticamente
detectables, que se han acumulado desde que dos poblaciones se han hecho
divergentes a partir de un antepasado comn (Dobzhsansky, 1980), observada en
este estudio, los porcientos de similaridad y divergencia que se dan entre las
diferentes secuencias, obtenidas sobre la base del total de cambios (deleciones,
mutaciones, inserciones, etc) variaron (cuadro 22). Los valores observados son de
93.6 % para SATIN-SATSJ y 97.5% de similaridad para SATPA-SATIB que son
las plantas mas similares o menos divergentes; mientras que las ms divergentes
SATSJ-SATIB muestran (82.9%); SATIN-SATIB (84.4%); SATSJ-SATPA (85.4%);
e SATIN-SATPA (86.8%).

Al observar los datos del cuadro 22 se puede detectar cmo se refleja en el
rbol, las dos especies y su respectiva subespecie de Satureja bien definidas,
incluso en este rbol, el ancestro que dio origen a cada subespecie es
prcticamente la misma especie, esto es, que SATIN dio origen a SATSJ y SATPA
a SATIB.

Al analizar el cuadro de los valores de divergencia, se observa que son de
0.5 entre SATIN y SATSJ y de 0.7 entre SATPA e SATIB, rangos, que a pesar de
integrar otros gneros y varias las secuencias consenso, se mantiene, aun dentro
de los valores considerados para una misma especie, sin embargo al comparar
SATIN y SATPA (que son las especies) su valor de divergencia es de 1.2 valor
suficiente para considerarlas como especies diferentes. Este ltimo valor se
encuentra en el rango de 1 a 5 considerado para especies de un mismo gnero
(Avise, 1994). De hecho es
95
menor al observado entre las dos especies de Oxera donde el valor de divergencia
es de 2.2.

A pesar de que SATIN y SATSJ surgieron primero evolutivamente
hablando, primero hace 30,000 aos que SATPA y SATIB (figura 7), mantienen
desde su surgimiento solo un 0.5% de disimilitud; caso contrario, el valor de
disimilitud mayor observado entre SATPA y SATIB (cuadro 22) es de 0.7% y el
que SATIB sea el taxa de mas reciente aparicin (15,000 aos) indica que est en
un proceso dinmico de especiacn, ajeno a los dems taxa de Satureja
estudiados. Esto se corrobora en la alta cantidad de sitios polimrficos en los ITSs
de este taxn con respecto a los dems.

En las secuencias obtenidas se lograron detectar diversos puntos. El
primero destaca que la cantidad promedio de G y C observada entre todas y cada
una de las secuencias fue del 67%, lo que corresponde con lo reportado por
Maxam y Col. (1977) que han encontrado que la relacin de adenina a timina, y la
relacin de guanina a citosina, estn siempre muy cerca de la unidad para el
cido- cido y de esta relacin el total de G/C es cercano al 60-70 % y de A/T del
30-40%. Lo que significa que la relacin G/C esta dentro de los parmetros
esperados, lo que corrobora que la amplificacin de las secuencias fue correcta y
que no fue debida a polimerizaciones de los "primers" que suelen ser comunes y
que cuando se presentan reflejan un valor menor al 60% de G/C.

El segundo punto destacable es que observndose las denominadas
"palabras" o "motivos" (series de repeticiones de secuencias cortas de
nucletidos), se observa que varias de estas repeticiones son muy caractersticas
y muy especficas para elaborar "primers" de identificacin al separar claramente
al gnero Satureja de los otros gneros, as como a los taxa en estudio, es decir,
se podr lograr la identificacin rpida de los taxa con tan solo utilizar su marcador
especifico o huella gentica.

96
Por otro lado, el polimorfismo observado se manifiesta de manera
especfica; en el ITS1 de SATIN-SATIB (cuadro 7), donde se tuvieron 15 sitios
polimrficos coincidentes y en el ITS2 hubo 9; en la comparacin SATSJ-SATPA,
se tuvieron 14 sitios polimrficos coincidentes en el ITS1 y 6 en el ITS2; el mayor
nmero de deleciones, mutaciones, inserciones (cambios)_ (cuadro 6) se encontr
al comparar las plantas SJ-IB, con 7 deleciones en SJ y 26 cambios en SATIB;
SATIN-SATIB (724); SATSJ-SATPA (6-20); SATIN-SATPA (7-18); SATIN-SATSJ
(5-9) y SATPASATIB (0-6), coincidiendo la mayor variabilidad entre las ms
ancestrales contra las ms recientes y observndose los menores cambios entre
las ms estrechamente relacionadas.

Para confirmar de manera ms especfica la variabilidad existente entre los
taxa en estudio, se, recurri al programa RNA draw 1.1 (http://isis.cbg.ipn.mx/down
tools/Rnadraw.html) para realizar el ejercicio de visualizar la prediccin del posible
RNAm que se formara si las secuencias codificaran, tal como se observa en la
figura 9. En dicha figura se observan las diferencias entre las secuencias de los
ITSs y se plantea la posible estructura terciaria; aunque los ITSs no son
secuencias que transcriben, por lo que la prediccin de su estructura terciaria
(RNAm), es hipottica y nicamente se usa con fines didcticos para visualizar de
manera ms sencilla, las diferencias encontradas entre las secuencias en estudio.
El RNA draw tiene la capacidad de representar cualquier secuencia en forma de
RNAm, prediciendo la estructura ms estable posible desde un punto de vista
molecular y de mxima estabilidad.

En la figura 9 se observa que la estructura terciaria del SATIN es muy
similar a la de SATSJ, lo que corresponde a la secuencia nucleotdica observada y
de donde se sugiere que SATSJ desciende de SATIN. Un caso similar es el de
SATPA y SATIB donde tambin la secuencia nucleotdica evidencia que SATIB
proviene de SATPA y esto se refuerza al observar la figura 9, donde SATPA y
SATIB presentan una estructura casi idntica. Si se considera al tiempo evolutivo
deducido con base en las secuencias nucleotdicas es de esperar mayor similitud
en estructura terciaria
97





















98
entre SATPA y SATIB que entre SATIN y SATSJ, ya que los primeros son de ms
reciente aparicin y su posible estructura tendra, en teora menos tiempo para
adquirir caractersticas estructurales diferentes.

Para el caso de las estructuras correspondientes a los ITS2 se observa el
mismo patrn de similitud entre SATIN y SATSJ y entre SATPA y SATIB, sin
embargo a diferencia de los ITS1, donde se observa una notable diferencia
estructural entre las figuras de sus ITS, en las figuras de los ITS2 se observa una
estructura ms consistente y menos variable entre si.

Es necesario sealar que las mutaciones observadas corresponden a
mutaciones gnicas o puntuales, las cuales se producen espontneamente, es
decir, son debidas a causas naturales, No obstante, la frecuencia de incidencia de
las mutaciones puntuales puede aumentar por exposicin a radiaciones de alta
frecuencia y por tratamiento con una variedad de sustancias qumicas
denominadas mutgenos (Cupples, 2001). Una mutacin puntual se produce
cuando un nucletido es alterado y la nueva secuencia de nucletidos pasa a la
progenie (Johnston, 1999). El cambio puede ser debido a la sustitucin de uno o
ms nucletidos por otros o a la adicin o delecin de uno o ms nucletidos y las
sustituciones que tienen lugar en la secuencia de nucletidos del ADN de un gen
estructural pueden dar como resultado cambios en la secuencia de aminocidos
del polipptido codificado por el gen, si bien ste no es siempre el caso debido al
carcter degenerado del cdigo gentico. Por ejemplo si se considera el triplete
del ADN TCG (que corresponde a AGC en el RNA mensajero) que codifica el
aminocido serina. Si el tercer nucletido cambia y pasa a ser A (U en el RNAm),
el triplte seguir codificando la serina; pero si cambia y pasa a ser C, el codn
resultante (TCC en el ADN, AGG en el RNAm) codificar, en cambio, la arginina
((Cupples, 2001).

De acuerdo con Ennis (2000) y Cupples (2001), las sustituciones de punto ms
simples son las llamadas transiciones y transversiones. Las primeras son
sustituciones de una pirimidina por otra pirimidina (T o C) o una purina por otra
purina
99
(A o G) y las transversiones que tambin son relativamente sencillas y que
consisten en el reemplazo de una purina (A o G) por una pirimidina (T o C), como
las encontradas en S. macrostema (cuadro 14)

Sin embargo, Knight (2002), menciona que actualmente y aunque todava son los
das tempranos de la nueva biologa, las comparaciones de sucesiones de las
especies diferentes sugieren que los eventos como los estallidos de actividad de
"genes saltadores", duplicaciones genticas y fusiones del cromosoma juegan un
papel importante en la evolucin y Los elementos mviles conocidos como
transposons estn entre las fuerzas ms poderosas que forman la evolucin del
cromosoma. stos "genes saltadores' llevan las instrucciones para su propia
excision, duplicacin e insercin en el genoma. Parece que, en ciertos perodos en
la historia evolutiva, la actividad del transposon hizo extenderse como los
acordeones a los cromosomas. Como resultado, la mayora de los cromosomas
est ahora lleno con los remanentes silenciosos de transposons. Transposons no
son el nico tipo de ADN que puede reproducirse. Si hay una cosa buena es que
el ADN est copindose. Y como resultado, las duplicaciones que van de los
centenares de bases al complemento entero de la clula de cromosomas han
figurado pesadamente en la evolucin de los genomas modernos. Las
duplicaciones ms simples producen sucesiones repetidas adyacentes que son
todos orientadas de la misma manera. Las longitudes de stos 'tndem repetidos'
puede variar grandemente, y a menudo se reproducen los genes enteros. La copia
extra puede aumentar las mutaciones entonces; a menudo stos lo darn intil,
pero una nueva y til funcin tambin puede surgir. Y por ltimo se ha encontrado
que los Pericentromeros y subtelomeros pueden ser las incubadoras para los
nuevos genes y las duplicaciones pueden ayudar generar la variacin gentica.

Por otro lado en el informe cientfico sobre el desciframiento del genoma humano,
(Nature, 2001) est plagado de trminos como "misterioso", "funcin
desconocida", "enigma no resuelto"... A sus autores les resultan sorprendentes las
"ms de doscientas secuencias de origen bacteriano" que han encontrado, as
como las

100
evidencias de transferencia horizontal de genes "relativamente frecuentes ", es
decir, genes "transmitidos por vectores como virus". Tambin han resultado
sorprendentes las enormes cantidades de elementos mviles (transposones y
retrotransposones), secuencias genticas que pueden "saltar" de una parte a otra
del genoma, bien mediante insercin directa en otra zona, o bien mediante una
duplicacin previa de su secuencia. Este ltimo fenmeno es el responsable de
una enorme cantidad de secuencias repetidas (que constituyen el 45% del
genoma) y que antes se consideraban "ADN basura", pero que segn la opinin
de los autores del informe: "Como agentes activos, las repeticiones han
remodelado el genoma causando reordenamientos, creando genes enteramente
nuevos, modificando y barajando genes existentes y modulando el contenido total
de Guanina-Citosina ".

En diciembre del ao 2000, Nature public "el primer genoma completo de
una planta que se libera a la comunidad cientfica": Arabidopsis thaliana. Una
herbcea elegida por su genoma pequeo (5cromosomas), pero con un nmero
de genes prximo a los 25.000, de los que casi el 80% estn duplicados. Adems
de la existencia de una gran cantidad de "elementos mviles", se ha podido
constatar que cerca del 60% de los genes de Arabidopsis los comparte con otras
plantas, animales y hombre (entre estos el "famoso" gen BRCA2, considerado
"uno" de los responsables del cncer de mama). Y es slo el primer genoma
vegetal "liberado" por las empresas privadas a la comunidad cientfica.

Con base en todo lo anterior, se puede hipotetizar que se esta llevando a
cabo una especiacin "recombinacional" o hbrida, la cual se refiere al origen de
nuevas especies homoploides va hibridacin entre especies paternales o
maternales divergentes cromosmica o genticamente (Ungerer, 1998), Este
modo es puntuado (largos periodos de stasis es decir, donde la mayora de las
especies no presenta cambio direccional alguno durante su estancia y es seguido
por abruptas transiciones en las cuales las especies paternales o maternales
individuales son desplazadas rpidamente por las nuevas especies hbridas
(McCarthy, 1995). La especiacin recombinacional representa solamente uno de
los varios o sospechosos caminos
101
conocidos para una especiacin rpida (Avise, 1994). Adems, de acuerdo con
Setoguchi y Wuatanabe (2000), la hibridacin y la introgresin entre varias
especies, frecuentemente ocurre en las regiones de simpatra (formacin de
nuevas especies por rangos de distribucin, aislamiento en el mismo sitio y por
variacin de nichos) o en los lmites de las zonas donde la distribucin de las
especies entran en contacto una con otra. Y Fritsche y Kaltz (2000), mencionan
que muchas de las especies ntimamente relacionadas particularmente en las
plantas, la separacin reproductiva no es completa y la hibridacin ocurre donde
sus rangos geogrficos se traslapan, tal y como ocurre en centro de Michoacn
con S. macrostema.

Condiciones medioambientales en el desarrollo de la filogenia de los
especimenes de S. macrostema

Al observar la filogenia de las cuatro plantas en estudio, destaca el hecho
que los cuatro presentan una historia evolutiva que puede alinearse con los
eventos geolgicos registrados para la regin de colecta de los ejemplares de S.
macrostema. Pero para realizar tal alineacin es necesario describir los eventos
all ocurridos, que se describen a continuacin:
Michoacn desde el punto de vista bitico, es uno de los estados ms diversos del
pas; resultado de su gran diversidad orogrfica y heterogeneidad climtica. El
estado tiene adems una gran variedad de tipos de vegetacin con sus propias
floras, que van desde la tropical selvtica, pasando por las zonas ridas, para
subir a los pastizales y luego a la montaa con sus pinares y bosques espesos de
abetos. (Moreno, 1998)

Gran parte de esta riqueza bitica es debida a la especial configuracin que
presenta el Eje Neovolcnico Transversal o Faja Volcnica Transversal. Se sabe
que la Faja Volcnica Transversal es una regin del centro de Mxico con una
historia geolgica reciente. Se trata de una zona altamente volcnica en la que
predominan una serie de cuencas endorreicas que dieron lugar a la formacin de
grandes extensiones lacustres y en donde la vegetacin predominante la
constituyen los
102
bosques de pino y encino. Adems, en esta regin, importantes culturas
prehispnicas se desarrollaron (Albert y col., 1987) .

A partir del anlisis de los registros palinolgicos que se han realizado
diversos estudios en diferentes puntos de la Faja Volcnica Transversal, se
establecen en este trabajo las tendencias climticas del fin del Pleistoceno y
Holoceno.

Segn Boer (1994) hace unos 70 000 aos antes del presente (AP) se inici
la glaciacin de Wisconsin, el ltimo gran avance glacial del Cuaternario, el cual
lleg a su mximo desarrollo aproximadamente hace 20 000 aos AP. Durante
este largo perodo, las masas de hielo fluctuaban, avanzando y retrocediendo al
tiempo que oscilaba el clima y el nivel del mar. Este ltimo, al acumularse grandes
casquetes de hielo que cubran parte de la tierra, bajaba notablemente, pero en
cambio suba cuando, durante pocas ms templadas (interglaciares), se derretan
los glaciares; estas oscilaciones modificaban las lneas costaneras y hacan salir o
sumergirse islas o puentes terrestres. La variacin del nivel medio del mar, aunado
a los cambios de temperatura, provoca en todos los continentes una alteracin en
los ecosistemas existentes.

Mientras ms avanzaban los hielos los biomas de tundra y confieras
prevalecan hacia las latitudes meridionales; por el contrario al retroceder las
masas de hielo, provocaban un abatimiento de los bosques de conferas y un
consecuente incremento en las reas con praderas y estepas para las mismas
latitudes (Boer, 1994).

Para el centro de Michoacn se han identificado evidencias
geomorfolgicas y estatigrficas de dos glaciaciones ocurridas despus del
pleistoceno tardo; se registran por lo menos en dos ocasiones tales eventos, una
vez entre 40,000 50,000 aos AP y otra vez entre 28,000 10,000 aos AP, en
ambos casos, el nivel de la temperatura descendi de tal modo, que la zona
central de Mxico cambi, progresivamente en ese lapso de tiempo, de ser una
regin principalmente esteparia
103
(con grandes ungulados que pastaban en las planicies) a una regin con
predominancia de bosques de conferas (incluso en valles y mesetas donde los
grandes ungulados no pudieron sobrevivir) (Chcon, 1991). Para los fines de este
trabajo se resaltan las caractersticas del segundo perodo con inicio hace 28,000
aos y una duracin de casi 20,000 aos.

En la regin de la cinega de Zacapu se han encontrado morrenas
originadas hace ms de 11,900 aos (probablemente hacia 12,500 aos AP) y
provenientes del cerro del Tecolote. Tal glaciacin dej huellas en algunas laderas
arriba de 2,6003,200 msnm, y estuvo muy influida por condiciones de relieves
locales. La morfologa de los depsitos sugiere una edad holocnica, y en ciertos
casos sta podra ser de apenas unos miles de aos (Chcon, 1991).

Se sealan climas secos, de fros a templados de 19,000 hasta 13,000
aos AP con la existencia de bosques abiertos de pino y encino. Del final del
Pleistoceno hasta 8,000 aos AP, hay evidencias de aumento de humedad, con el
probable establecimiento de climas hmedos, de semifros a templados. De 8,000
a 6,000 aos AP. La tendencia climtica es hacia climas templados subhmedos.
Entre 6,000 a 4,000 aos AP. los registros indican la existencia de eventos
volcnicos y una probable reduccin en la precipitacin. Finalmente, los ltimos
4,000 aos, adems de registrarse el impacto humano, se percibe una tendencia
hacia climas templados hmedos/subhmedos ( White y Heine 1992)

La comparacin de la secuencia glacial del Tecolote con las elaboradas por
White y Heine para diversas montaas del centro de Mxico (en particular el
Iztacchuatl) permite proponer algunas correlaciones que evidencian, que hace
ms de 12,000 aos AP ocurri un evento climtico (la glaciacin) de
considerables proporciones que, repercuti, seguramente en los organismos
presentes.

Hoy da se sabe que los cambios climticos bruscos son un fenmeno
natural que se ha producido en toda la historia geolgica. Esto provoc las
migraciones de
104
flora y fauna, incluyendo a los homnidos, en el periodo Cuaternario, hacia
regiones ms favorables, y tambin la extincin de especies o su adaptacin a un
ambiente distinto.

Las condiciones actuales del planeta tienen sus antecedentes en un cambio
brusco del clima ocurrido hace 28,000 aos, cuando empez a volverse ms
clido, especialmente en el hemisferio norte. W. Tanner (1983) calcula que los
glaciares retrocedieron durante 10 000 y 15 000 aos, con una velocidad promedio
de 10 cm/ao. Diversos estudios han demostrado una estabilidad climtica en los
ltimos 5,000 aos, aunque, como es natural, con breves periodos ms fros o
clidos y de ascensos y descensos del nivel del mar.

Se ha calculado que los glaciares iniciaron su retroceso, con alternancia de
avances, hace unos 18,000 aos AP. Pero el mximo retroceso se alcanz hace
10,000 aos AP, al inicio del Holoceno. Como resultado del retroceso de los hielos
las tierras habitables se ampliaron y fueron ocupadas gradualmente por vida
vegetal y animal. En los ltimos 10,000 aos AP. ha habido una aparente
estabilidad del clima. La hiptesis sobre el desplazamiento que parece ms lgica
indica que inicialmente el movimiento debi haber sido ms lento, de 3 km/100
aos. El gran retroceso de los hielos debe haber durado unos 2,000 aos, lapso
en que el espesor se redujo hasta en un kilmetro. El retroceso de los hielos se ha
mantenido estable desde hace 8,000 AP. De manera que las condiciones
medioambientales reinantes desde esa poca a la actualidad son relativamente
similares (Milnichuk y Arabagi, 1979)

Hace seis-siete mil aos se produjo un ptimo climtico, esto es, de alta
temperatura. Posteriormente se han dado alternancias de ascenso y descenso,
pero con una tendencia general al descenso de la temperatura (Palmere, 1984)
Si se relaciona el ptimo de temperatura alcanzado hace 7,000 aos AP con los
resultados obtenidos en este trabajo con los ITSs de los especimenes de SATIB y
SATPA, se observa que coincide el tiempo filogentico para la divergencia de
estos ejemplares con el tiempo geolgico de ptima temperatura. Desde el punto
de vista
105
evolutivo las condiciones medioambientales de hace 7,000 aos AP provocaron,
probablemente, la especiacin de S. macrostema, de la que en este trabajo se
detectaron dos casos IB y PA.

Los 10,000 aos del Holoceno son insignificantes en la escala geolgica,
con respecto del periodo Cuaternario definido precisamente por las glaciaciones.
La opinin ms comn de los especialistas es que la ltima glaciacin no ha
terminado y nos encontramos muy posiblemente en un lapso interglaciar,
consistente en un calentamiento general iniciado hace 18 000 aos y que no
podra durar muchos miles de aos ms, con la gran posibilidad de un nuevo
avance de los hielos, especialmente sobre Europa y Norteamrica, volviendo a las
condiciones del pasado no muy remoto. (Palmere, 1984)

En el periodo Cuaternario se produjeron cuatro grandes glaciaciones que
duraron cada una algunas decenas de miles de aos. Hubo etapas de retroceso
de los hielos que no significaron el fin de la glaciacin en s; duraron algunos miles
de aos para despus volver a condiciones semejantes a las actuales. Es
probable, y esto lo sostienen la mayora de los especialistas, que vivimos una
breve etapa interglaciar y hay quienes afirman que la tendencia es ya al
enfriamiento. Este es un proceso natural que de ser real, se producira el avance
de los hielos sobre las tierras habitadas del norte en decenas de aos, cientos o
miles. Este dinamismo geolgico pudo sustentar el dinamismo filogentico
encontrado en la actualidad en diversas especies, como lo es el caso de los
especimenes de S. macrostema tratados en este estudio, que denotan una
marcada especiacin al presentar cuatro taxa, que a pesar de divergir
recientemente, son genticamente diferentes al presentar un alto
polimorfismo.

Con lo anterior y conociendo los resultados de la filogenia de las Satureja
se pueden hipotetizar algunos eventos:

A) Es posible que el inicio de la ltima glaciacin (hace 28,000 aos AP)
fuera el detonante de la radiacin especiativa observada en las Satureja y cuya
evidencia se observa en al rbol filogentico obtenido con las secuencias de ITS,
donde se
106
observa que un ancestro comn ubicado cerca de esta fecha dio origen a cuatro
taxa diferentes encontrados en el presente.

B) El hecho de que las clades del filograma se separen hace 30.000 aos
AP en dos especies distintas (SATIN y SATPA) y posteriormente cada clade de
especie en dos taxa inferiores hace 18,750 (SATIN y SATSJ) y hace 22,500
(SATPA-SATIB) aos evidencian que el cambio climtico acontecido provoc el
proceso de especiacin que a la fecha no terminado.

C) Es coincidente el hecho que de las tres filognesis observadas (30,000
aos AP (SATIN), SATPA, 22,500, SATSJ, 18,750 y hace 15,000 (PA-IN) en dos
de ellas se den con el inicio y trmino de la etapas interglaciares (hace 28,000 y
18,000 aos AP). Esto dara pauta a pensar que tales eventos potencian, al haber
cambio en el medio ambiente y actuar como selector natural, la diversidad
gentica.

D) Es de destacar que la variabilidad encontrada en cuatro taxa de tan
cercana distribucin y de un hbitat relativamente estable en los ltimos 8,000
aos, indica el gran polimorfismo que se puede encontrar en estas plantas.
Por ltimo, la influencia del hombre a travs de todas sus acciones (prcticas
agrcolas, alimentacin, seleccin de materiales, contaminacin, etc.), han
impactado en mayor o menor grado en la evolucin de las especies, las cuales se
han extinguido a travs de la historia a un ritmo constante o por catstrofes
naturales, sin embargo actualmente, la velocidad a la que las especies se
extinguen es superior al ritmo al que aumenta la evolucin, y Myers y Knoll (2001)
argumentan que las extinciones de especies alteraran no solamente la diversidad
biolgica sino tambin los procesos evolucionarios, los cuales generan diversidad,
y se cuestionan en cuanto a Cmo funcionaran los ecosistemas en un mundo
disminuido de su biodiversidad?,la funcin de los ecosistemas necesariamente
decaer cuando la diversidad decline y si esto es as, como , cuanto y de que
manera?, Puede la biodiversidad y los humanos del mismo modo prosperar en
un mundo donde la mayora de la biodiversidad biolgica ser confinada en
parques y reservas relativamente pequeos?, si la biodiversidad es en realidad
critica para la funcin
107
de un ecosistema hemos conocido suficiente acerca de los principios de la
evolucin para intervenir en los procesos de su recuperacin?, Conocemos lo
suficiente para mitigar la perdida de la biodiversidad biolgica?. A ese respecto
Hedrick (2001) se pregunta Cmo puede la nueva informacin gentica ser
usada en la conservacin?

Todos los indicadores medioambientales sugieren que el medio ambiente
ser ms variable que el presente (el incremento de la temperatura, el aumento
del CO2, etc.), y por lo tanto la relacin genotipo-fenotipo, ser ms complicada ya
que esa interaccin ya no ser ms (G x E) sino que ser mucho ms complicado
y podra ser G x E
1
E2
2
E
3.
E
n
dependiendo de los cambios ambientales que las
plantas experimenten a travs de si ciclo de vida (Bazzaz, 2001).



















108
VII. CONCLUSIONES

Los resultados obtenidos en el presente estudio sugieren que S
macrostema var. laevigata, se encuentra actualmente en perodo de especiacin
rpida la cual es de tipo puntuado, con ello se fortalece la teora de la especiacin
recombinacional y se aporta ms evidencia emprica para apoyar este modo de
especiacin.

El anlisis de las secuencias de la regin de los ITS de S. macrostema var.
laevigata ha permitido vislumbrar que las plantas en estudio pueden ser
consideradas como especies; de aqu que el uso de S. macrostema var. laevigata
para referirse a esta variedad podra ser descontinuado. Los resultados de este
estudio, indican que existe suficiente divergencia molecular entre SATIN y SATPA
para apoyar su establecimiento como especies separadas, al igual que SATSJ y
SATIB, las cuales pueden ser tambin consideradas como especies. Los
resultados indican la validez del anlisis de secuencias cclicas para proveer
huellas moleculares de especies de S. macrostema. Por lo tanto, la tcnica puede
ser usada para determinar la relaciones entre organismos y las secuencias ITS
pueden adems utilizarse para verificar las. relaciones filogenticas obtenidas de
los anlisis morfolgicos tradicionales, y por ultimo los marcadores moleculares
determinados especficamente por cada taxa podrn ser utilizados para su
identificacin molecular.

La gran utilidad de las tcnicas moleculares es que permiten observar
diferencias directamente en el ADN, es decir en la molcula qumica que contiene
toda la informacin gentica del organismo, este es el mximo nivel de resolucin
posible y as pueden encontrarse las diferencias en especies, subespecies o
variedades, que seran idnticas con base en la observacin de las caracteres
fenotpicos.

Con todo lo anterior y con los resultados obtenidos en el presente trabajo se
considera que existe evidencia para argumentar que los especimenes hasta ahora
colectados en Michoacn son de dos especies diferentes y no dos variedades
como
109
se argumenta (McVaugh y Schmid, 1967). Ambas especies presentan un proceso
de especiacin reciente y el que diferentes autores mencionen la posibilidad de
hibridacin se perfilara ms hacia que, dado que es un proceso reciente de
especiacin, ambas especies y sus respectivas subespecies presentan
caractersticas comunes, ya que presentan un ancestro comn de reciente
aparicin.

El hecho que las localidades muestreadas representen 4 poblaciones
diferentes y el que el proceso de especiacin sea dinmico, indica que
probablemente existen ms individuos diferentes, por lo menos a nivel de
subespecie y variedad, presentando a Michoacn como un centro de
diversificacin para estas especies. Por lo que posteriores colectas y estudios
similares son necesarios para completar el proceso de especiacin y divergencia
de estos taxa.

Existe evidencia de la probable presencia de otras especies y subespecies,
en el presente caso se realizaron estudios de marcadores moleculares con ITSs,
los cuales podran complementarse con estudios de hibridacin manual que
permitieran confirmar los resultados obtenidos.












110
VIII. Literatura citada.

Abad MJ, Bermejo P, Gonzlez E, Iglesia I, Irurzun A, Carrasco L. Antiviral activity
of Bolivian plant extracts. Gen Pharmacol 1999. 32(4):499-503.

Aguilar RM. Fenologa del te nurite (Satureja macrostema benth. briq). In: Memoria
de la Reunin Interamericana de Ciencias Hortcolas. .2001;(8)3:284. Morelos.
Mxico.

Aguilar RM, Villalobos AV, Salgado GR y Vidales FI. Organogenesis y
embriogenesis somatica en "te nurite" (Satureja macrostema venta bro.)" In:
Memoria de la Reunin Interamericana de Ciencias Hortcolas. 2001;(8)3:285.
Morelos. Mxico.

Aguilar RM y Bianca SL. Medicina alternativa: nuevas propiedades y aplicaciones
del te nurite (satureja macrostema benth. briq.) en la medicina quntica (electro
acupuntura). In: Memorias del X Congreso (talo-Latinoamericano de Etnomedicina.
2001; 9-10. Isla margarita, Venezuela.

Altschul SF, Gish W, Miller W, Myers E. Basic Local Alignment Search Tool J. Mol.
Biol. 1990;215:403

Albert VA. Chase MW. Mishler BD.. Character weight, ing for cladistic analysis of
protein-coding DNA sequences Annals of the Missouri Botanical Garden
1993;80:752-766.

Aubert A, Grite, R. y Jons J. "Glaciaciones del Cuaternario tardo en el Occidente-
Mexicano". Boletn del Instituto de Geografa, UNAM, 1987;22:25-45.

Anand R. Yeast artificial chromosomes (YACs) and the analysis. of complex
genomes. TIBTECH 1992;10: 35-40.
111

Avise CJ. Molecular markers, natural history and evolution. Chapman & Hall. 1994.
511p.

Ayala FJ, Fithc WM, Cleg TM. Variation and evolution in plants and
microorganisms: Toward a new synthesis 50 years after Stebbins. Proc. NatI.
Acad. Sci. USA 2000; 97: 6941-6944.

Ax, P. The phylogenetic System. John Wiley & Sons. Chichester. 1987.

Ax, P. Multicelular Animals. A New Approach to the Phylogenetic Order in Nature.
Springer-Verlag. Berlin. Buffon, G.L. 1749. Histoire Naturelle. Imprimerie Royale,
Paris. 1996

Baldwin BG. Molecular phylogenetics of Calycadenia (Compositae) based on ITS
sequences of nuclear ribosomal DNA: chromosornal and morphological evolution
examined. Amer J bot 1993; 80:222-238.

Baldwin, BG and Markos S. Phylogenetic utility of the externa) transcribed spacer
(ETS) of 18S-26S rDNA: congruence of ETS and ITS trees of Calycadenia
(Compositae). Molecular Phylogenetics and Evolution 1998;10: 449-463.

Baldwin BG, Sanderson MJ, Porter JM Wojciechowski MF, Campbell CS y
Donoghue MJ. The ITS region of nuclear ribosomal DNA: a valuable source of
evidence on angiosperm phylogeny. Annal Miss Bot Gard 1995;-82:247-277.

Barton NH, Keightley PD. Understanding quantitative genetic variation. Nat Rev
Gen 2002; 3; 11-21.

Barraclough TG, y Nee S. Phylogenetics and speciation. Trends Ecol Evol 2001;
16: 7: 391-399.
112
Baum DA, Sitsma KJ, Hoch De. A phylogenetic anlisis of Epilobum (Onagraceae)
based on nuclear ribosomal DNA-sequences. Syst Bot 1991; 19:363-368.

Baverstock PR, Moritz C. Project design. 1996. 17-27. En: Hillis DM, Moritz C,
Mable BK. Eds. Molecular Systernatics. Segunda Edicin. Sinauer Associates Inc.
Massachusetts

Bodmer W. Where Will Genome Analysis Lead Us Forty Years On Ann. NY. Acad.
Sci. 1995;28: 414=426

Boer L. "Tectonic and eustatic coastal changes during the last 10,000 years
derived from archaeological data." Z. Geomorphol., Suppl. 1994;62:1-29.

Boguski MS. Bioinformatics Current Opinion in Genetics and Development. 1994;4,
383-388

Boyas DC. Situacin actual de la biodiversidad en Mxico. In Simposium
Norteamericano. Proceedings. 1998. SACAR. INIFAP. Mxico.

Brandon, R. N. Adaptation and environment. Princeton University Press. 1990.

Bremer K y Wanntrop HE. Phylogenetics systematics in botany. Taxon
1978;27:317329.

Brooksbank C. Cell division. Don't Shoot now. Nat Rev Mol Cell Biol 2001; 2; 162.

Bromham LD. Molecular evolution: rates. Encyclopedia of Life
Sciences/www.els.net. 2001.

Bruns TD, White TJ. y Taylor J. XV. Fungal molecular systematics. Annu Rev Ecol
Syst 1991; 22:525-564.
113
Buckler ES y Holtsford TP. Zea systematics: ribosomal ITS evidence. Mol Biol Evol
1996; 13:612-622.

Bult CJ, Zimmer EA. Nuclear ribosomal RNA sequences for inferring tribal
relationships within Onagraceae. Syst Bot 1993; 18:48-63.

Burd M. Adaptation and Constraint: Overview. Encyclopedia of Life Sciences/ww
w.els. net. 2000.

Bush RM. Predicting adaptive evolution Nature 2001;2,387-392.

Buth D.G. The application of electrophoretic data in systematic studies. 1984. Annu
Rev Eco/ Syst

Bye R. Una sierra llena de tesoros. Ocelotl. Revista mexicana de la conservacin.
1997: N 6. Pp 18-23. Pronatura. Mxico.

Cceres A, Alvarez AV, Ovando AE, Samayoa BE. Plants used in Guatemala for
the treatment of respiratory diseases. Screening of 68 plants against gram-positive
bacteria. J Ethnopharmacol 1991; 31(2):193-208.

Camin JH y Sokal RR. A method for deducing branching sequences in phylogeny.
Evolution, 1965;19: 311-326

Cantino PD, Harley RM wagstaff, SJ Genera of Labiatae status and clasification.
In: Harley MR, Raynolds T. (Eds) Advances in Labiatae sciencie. Royal botanic
gardens, Kew. 1992: 511-522.

Carlson SJ. Evolution: Investigating the Evidence, Paleontological Society Special
Publication 1999;9.

114
Cavalli-Sforza, L.L. & Edwards, A. W.,. Phylogenetics analysis: models and
estimation procedures. Am. J. Hum. Genet., 1967;19: 233-257.

Chen YT, et al. Flavonoids as superoxide scavengers and antioxidants. Free Radic
Biol Med 1990;9(1):19-21

Cerf V. Meeting future Internet needs Computers in Physics. 1994;374-375

Clark L.G., Zhang W, WendeIJ.F.. A phylogeny of the grass family (Poaceae)
based on ndhF sequence data. Syst Bot 1995; 20:436-460.

Conner JK. How strong is natural selectios? Ecol Evol 2001;16: 215-217

Coen ES, Meyerowitz EM. The war of the whorls: genetic interactions controlling
flower development. Nature 1991;353:31-37.

Cupples CG. Mutagenesis Mechanisms. Encyclopedia of Life
Sciences/www.els.net. 2001.

Crawford D.J. Enzyrne electrophresis and plant systernatics. 1989;146-164. En:
Soltis, D. E., Soltis P. S. Eds. Isozymes in plant biology. Dioscorides Press.
Oregon.

Crawford DJ. Plant molecular systematics, macromolecular approaches. 1990.
John Wiley & Sons. New York.

Crawford DJ, Stuessy TF, Cosner MB, Haines DW, Silva M, Baeza M. Evolution of
the genus Dendroseris (Asteraceae: Lactuceae) on the Juan Fernndez Islands:
evidence from cp and rbDNA. Syst Bot 1992; 17:676-682.


115
Chrstoffersen ML. Cladistic Taxonomy, Phylogenetic Systematics, and
Evolutionary Ranking. Syst. Biol. 1995;44(3): 440-454.

Crow JF. The high spontaneous mutation rate: Is it a health risk? Proc Nat Acad
Sci USA 1997; 94: 8380-8386.

Chacon D. Atlas Nacional de Mxico. (Coordinado por A. Garca Silberman.)
Instituto de Geografa, UNAM, Mxico, 1991.

Charlesworth D, Charlesworth B, Mcvean GAT. Genome sequences and
evolutionary biology, a two-way interaction. Trend Ecol Evol 2001;6:5:235-241.

Chen Y.T, et al. Flavonoids as superoxide scavegers and antioxidants. Free Radic
Biol Med 1990;9(1):19-21

Chicurel M. Why evolution might not favor increased genetic variability. Science
2001; 292 (5523):1826.

Chumacero A, Iparraguirre D, Riofro O, Salas E. El gnero Satureja (Lamiaceae)
en la etnomedicina andina. http://www.unmsm.edu.pelbiologialinvestigacion/est21.
htm.

Davis JI, NIXON KC. Populations, Genetic Variation, and the Delimitation of
Phylogenetic Species. Syst.Biol. 1992;41(4): 421-435.

Day T y Otto SP. Fitness. Encyclopedia of Life Sciences/www.els.net. 2000.

De Haro JJ y Melic A.. Taxonoma,, Sistemtica, Filogenia y Clasificaciones. Bol.
SEA, 1998;23:57-58. http://members.xoom.com/lista_entolindex.htm

Demuth JP, Rieseberg LH. Ring species and speciation. Encyclopedia of Life
Sciences/www. els. net. 2001.
116
De Queiroz, K.. Replacement of an essentialistic perspective on taxonomic
definitions as exemplified by the definition of "Mammalia". Syst. Biol. 1994;43(4):
497-510.

Dieckmann U, Doebeli M. On the origin of species by sympatric speciation. Nature
1999; 400, 353-357.

Dobzhansky T. Genetics and the origin of species. New york; Columbia University
Press. 1982.

Dougherty WG & Carrington JC.Expression and Function of Potyviral Gene
Products Annual Reviews of Phytopatology. 1988;26,123-143

Doyle JJ. DNA, phylogeny, and the fiowering of plant systematics. BioScience.
1993 43:380=389.

Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh
leaf tissue. Phytoch Bull 1987; 19:11-15.

Doyle JJ, Beachy RN. Ribosomal gene variation in soybean (Glycine) and ITSs
relatives. Theor Appl Genet 1985; 70:369-376.

Doyle JJ, Soltis PS, Soltis DE. Ribosomal RNA gene sequence variation: Tolmiea,
Tellima and their intergeneric hybrid. Amer J Bot 1985; 72:1388-1391.

Doyle JJ and JL Doyle. A rapid DNA isolation procedure for small quantities of
fresh leaf material. Phytochemical Bulletin 1989;19: 11-15.

Doyle JJ y Doyle JL. Isolation of plant DNA from fresh tissue. Focus 1990;12:13-
15. Dowling TE, Moritz C, Palmer JD, Rieseberg LH.. Nucleic Acids 111: Analysis
of
117
fragments and restriction sites. 1996; 249-3 17. En: Hillis DM, Moritz C, Mable BK.
Eds. Mol Syst. Segunda Edicin. Sinauer Associates Inc. Massachusetts.

Dragon F, Filipowics W. snoRNAs: Biogenesis, structure and function.
Encyclopedia of Life Sciences/www.els.net 2001.

Duvall, M. R., Clegg MT., Chase MW., Clark, W.D., Kress. J.W., Hilis HG., Eguiarte
L.E., Smith F.J., Gaut B.S., Zimmer EA. y LearnJr. G.H..Phylogenetic hvpothesis
for the Monocotyledons constructed fron rbcL sequence data. Annais of the.
Missouri Botanical Garden. 1993;80:607-619.

Duvall M.R., LeamJr. G.H., Eguiarte LE. y Ciegg M.T. Phylogenetic analysis of
rbcL sequences identifies Acorus calamus as the prima) extant monoctyledon.
Proceedings of the National Academy of Sciences USA 1993;90:4641-4644.

Dubouzet JG y Shinoda K. ITS DNA sequence relationship between Llium
concolor Salisb., L. dauricum Ker-Gawl. And their putative hybrid, L, maculatum
Thunb. Theor Appl Genet 1999; 98:213-218.

Eccardi F y Becerra R. Mxico: primer lugar mundial en diversidad de pinos.
Ocelotl. Revista mexicana de la conservacin. 1997: N 6. Pp 8-17. Pronatura .
Mxico.

Edwards AW. & Cavalli-Sforza LL. The reconstrution of evolution. Ann. Hum.
Genet., 1963,27:104-105.

Edwards AW & Cavalli-Sforza LL.. Reconstrution of evolutionary tree. Systematics
Association Publication. 1964;6: 67-76.

Eldredge N, Cracraft J. Phylogenetic patterns and the evolutionary process. 1980.
Columbia University Press, New York.
118
El-gazzar A. Watson L. A taxonomic study of Labatae and related genera. New
phyt. 1970: 69;451-486.

Egleton P. y Vane-Wrigth RI. Some principies of phylogenetics and their implicatios
for comparative biology. En: Egleton P. y Vane-Wrigth RI. Edrs. Phyl Ecol
Academic Press. London. 1994;345-366.

Ennis DG. Mutagenesis. Encyclopedia of Life Sciences/www.els.net. 2001. Estrada
LE. Plantas Medicinales de Mxico. UACH. Mxico. 1996.

Facino, R. M, et al. phytochemical characterization and radical scavenger activity
of flavonoids from helichrysum italicum G. Don (compositae). Pharmacol res
1990;22(6):709-721.

Farber PL. Finding Order in Nature. Baltimore: 2000. Johns Hopkins University
Press. Farris JS. Method for computing Wagner trees. Syst. Zool 1970; 19:83-92
Farris JS. Phylogenetic analysis under Dollo's Law. Syst. Zool 1977;26: 77-88

Feder ME, Bennett AF, Huey RB. Evolutionary Physiology. Annu Rev. Ecol. Syst.
2000; 31:315-341

Felsenstein J. Evolutionary trees from DNA sequences: a maximum likelihood
approach. J Mol Evol 1981;17: 368-376.

Felsenstein,J.. Numerical methods for inferring evolutionary trees. Quarterly
Review of Biology 1982;57:379-404.





119
Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap.
Evolution 1985;39: 783-791.

Felsenstein J. Phylogenies from molecular sequences: inference and reliability.
Ann Rev Gen 1988;22: 521-565.

Felsenstein J.. Phylogeny Inference Package. 1991. Univ. Wash. Press, Seattle.

Felsenstein J. PHYLIP (Phylogeny Inference Package) version 3.5c Distribuited by
the author. 1993. Department of Genetics, University of Washington, Seattle.

Filchakke KE, Roethele JR, Feder JL. Natural selection and sympatric divergence
in the apple maggot Rhagoletis pomonella. Nature 2000; 407, 739-742.

Field KG, Olsen GJ, Lane DJ, Giovannoni SJ, Ghishelin MT, Raff EC, Pace NR, y
Raff RA. Molecular phylogeny of the animal kingdom. Science. 1988;239:748-753.

Fitch, W. M. & Margoliash, E.,. Constrution of phylogenetic trees. Science,
1967;155: 279-284.

Fitch WM Toward defining the course of evolution: minimun change for a specified
tree topology. Syst. Zool 1971;19: 99-113

Fisher T. A new species of Heliopsis from Baja California Mexico. Madroo
1954;12152-155.

Forey P.L. Formal classification. En: Forey P.L., Humpries C.J., Kitching I.J.,
Scotland R.W., Siebert D.J. y Williams D.W. Edrs. Cladistics. A practica/ course in
systematics. Oxford, Claredon Press 1992, 124-136.


120
Francastel et al. Nuclear compartmentalization and gene activity. Nat Rev Mol Cell
Biol 2000; 1; 137-143.

Francis NJ, Kingston RE. Mechanisms of transcriptional memory. Nat Rev Mol Cell
Biol 2001; 2; 409-421.

Frantz S. DNA repair. Damage control. Nat Rev Mol Cel Biol 2001; 2, 870

Friedberg EC. How nucleotide excision repair protects against cancer. Nat Rev
Cancer. 2001; 1; 22-33

Fritsche F, Kalts O. Is the prunella (Lamiaceae) hybrid zone structured by an
environmental gradient? Evidence from reciprocaltransplant experiment. Am. J.
Bot. 2000-87:995-1003.

Futuyma DJ. Evolutionary Biology, 1998. 3rd edn. Sunderland, MA: Sinauer.

Gargas A and Taylor JW. Polymerase chain reaction (PCR) primers for amplifying
and sequencing 18S rDNA from lichenized fungi. Mycologia 1992;84: 589-592.

Gee H. The (quicker) origin of species. 2000. http:/lwww.nature.com/nsu/000504/0
00504-9. html.

Gee H. The (quicker) origin of species. 2000. http:llwww.nature.com/nsu/0005049.
htm.

Gee H. The chromosome shuff le. 2000 b. http://www.nature.com/nsu/000504-
9.htm.

Giannasi DE, Zurawski G, Learn G y Clegg MT.. Evolutinary relationships of the
Caryophyllidae based on comparative rbcL sequences. Syst Bot 1992; 17:1-15.
121
Gilroy S, trewavas A. Signal processing and transduction in plant cells: the end of
the beginning? Nat Rev Mol Cell Biol 2001; 2; 307-314.

Goldbach R. & Wellink J. Evolution of plus-stranded RNA viruses Intervirology.
1988;29, 260-267

Gosta et al., Conservacin dinmica de los recursos genticos de los rboles
forestales. Recursos genticos forestales 1995; No23 FAO, Roma.

Gottlieb LD, Gel electrophoresis: new approach to the study of evolution.
BioScience 1971;2 1:939-944.

Gould SJ and Eldredge N. Punctuated equilibrium comes of age. Nature 1993;366:
223-227.

Grant D, Shoemaker RC. Plant gene mapping techniques. Encyclopedia of Life
Sciences/www. els. net. 2000.

Green ED, Strategies for the systematic sequencing of complex genomes. Nature
2001; 2, 573 -583.

Hagen AR, Giese H, Brochmann. Trans-Atlantic dispersa) and Pylogeography of
Cerastium arcticum (Caryophyllaceae) inferred from RAPD and SCAR markers.
Ame J Bot 2001;88:103-112.

Hajhasshemi V, Sadraei H, Ghannadi AR, Mohseni M. Antiespasmodic and anti-
diarrhoeal effect of Satureja hortensis L. essential oil. J Ethnopharmacol 2000;
71(12):187-92.

Hamby RK. y Zimmer EA. Ribosomal RNA as a phylogenetic tool in plant
systematics. En: Soltis P. S., Soltis D. E. and DoyleJ.J. Edrs. Mol syst plant. New
York:
122
Chapman & Hall, 1992; 50-9 1.

Hamby RK. y Zimmer EA. Ribosomal RNA sequences for inferring phylogeny
within the grass family. Plant Syst Evol 1998; 160:29-37.

Harder LD, Mode and tempo of species diversification. Ame J Bot 2001;88(9):
17071710.

Harrison RM. Variation, within species: introduction. Encyclopedia of Life
Sciences/www.els.net. 2001.

Harvey P. H. y Pagel M. D.. The comparative method in evolutionary biology. 1991.
Oxford University Press. Oxford.

Hasatoshi N y Koblin RK. Evolutionof genes and proteins. 1983. sinauer. 331 p.

Hastings A. hardy-Weinberg theorem. Encyclopedia of Life Sciences/www.els.net.
2001.

Hayes, B. The World Wide Web. American Scientist. 1994;82, 416-420

Hedrick PW. Conservation genetics: Where are now? Trend ecol evoll
2001;16:11:629-636.

Hennig, W.. Phylogenetic Systematics. 1966.University of Illinois Press, Urbana.

Hernndez NE, Tereschuk ML, Abdala LR. Antimicrobial activity of flavonoids in
medicinal plants from Tafi del Valle (Tucuman, Argentina) J Ethnopharmacol 2000;
73(1-2):317-22.

Hillis DM, Mable BK, Larson A, Davis SK., Zimmer EA. Nucleic Acids IV:
Sequencing
123
and cloning. 1996; 321-378. En: Hillis D.M., Moritz C., Mable B.K. Eds. Mol Syst.
Segunda Edicin. Sinauer Associates Inc. Massachusetts.

Hillis DM y Dixon MT. Ribosomal DNA: molecular evolution and phylogenetic
inference. Quart Rev Biol 1991; 66:4 1 1-453.

Hillis DM, Moritz C, Porter CA. y Baker RJ. Evidence of biased gene conversion in
conceited evolution of ribosomal DNA. Science 1991; 251:308-3 10.

Hillis D.M., Huelsenbeck J.P. y Cunningham C.W.. Application and accuracy of
molecular phylogenies. Science 1994;264:67 1- 677.

Hoekstra HE, Hoekstra JM, Berrigan D, Vignieri SN, Hoang A, Hill CE, Beerli P,
and Kingsolver JG. Strength and tempo of directional selection in the wild. Proc
Natl Acad Sci USA. 2001; 98: 9157-9160.

Howard DJ. Speciation: allopatric. Encyclopedia of Life Sciences/www.els.net.
2001. http:l/www.evotutor.org/selection/S15B.html

http://isis.cbg.ipn.mxldovim_tools/Rnadraw.html

(http://www.sinauer.com/

http://www.whfreeman.com/

http://biotic.isciii.es/informacion/biosalud/biosalud.html

Hull D.L.. Science as a process. 1988.University of Chicago press, Chicago.



124
Instituto Nacional Indigenista. Atlas de las plantas medicinales tradicionales
mexicanas. 1994; Tomo III. INI. Mxico.

INIFAP. Plan nacional de biotecnologa forestal y agropecuaria. Publicacin
especial N 11. Diciembre 1996. SAGAR-INIFAP. Mxico.

Jansen RP. mRNA localization: message on the move. Nat Rev Mol Celi Biol 2001;
2; 247-256.

Jardine N (ed.) History and philosophy of taxonomy. Studies in the History and
Philosophy of Science. 2001;32C: 203-383.

Johnston MO. Mutations and New Variation: Overview. Encyclopedia of Life
Sciences/www.els.net. 2001.

Karis PO. Heliantheae sensu lato (Asteraceae), clades and classification. Plant
Systematics and Evolution 1993; 188:139-195.

Karis PO and Ryding O. Tribe Heliantheae. In K. Bremer, Asteraceae, cladistics
and classification. Timber Press, Portland, Oregon, USA. 1994;559-624

Karvonen P. y Savolainen 0. Variation and inheiitance of ribosomal DNA in Pinus
sylvestris L. (Scots pine). Heredity 1993; 71:614-622.

KellogE, Shaffer B. Model organism in evolutionary studies. Syst Biol 1993;
42(4):409-414.

Kinoshita K; Honjo T. Linking class-switch recombination with somatic
hypermutation. Nat Rev Mol Cell Biol 2001; 2; 493-503.


125
Kimura M The Neutral Theory of Molecular Evolution. 1983 Cambridge, UK:
Cambridge University Press.

Kim K, Jansen RK and. Tumer BL. Chloroplast DNA evidence for the phylogenetic
relationships among Coreopsideae, Eupatorieae, Gaillardieae, Heliantheae and
Tageteae. American Journal of Botany 77 (supplement): 1990;140-141

Knight J. Evolutionary genetics: AII genomes great and small. Nature. 2002;417,
374 - 376 (2002)
Kitagawa K, Hieter P. Evolutionary conservation between budding yeast human
kinetochores. Nat Rev Mol Cell Biol 2001; 2; 678-687.

Kitching I.J.. Tree building techniques. En: Forey PL., Humpries C.J., Kitching I.J.,
Scotland R.W., Siebert D.J., y Williams D.W. Edrs. Cladistics. A practica) course in
systematics. Oxford: Claredon Press, 1992;44-71.

Kitching L.L., Scotland R.W, Siebert D.J., Williams D.M. Cladistics, a practical
course in systematics. Claredon Press. Oxford.

Kondrashov AS, Kondrashov FA. Interactions among quantitative traits in the
course of sympatric speciation. Nature 1999;400, 351- 354.

Korol A, Rashkovertsky E, lliadl K, Michalak P, Ronin Y, Nevo E. Proc Natl Acad
Sci USA 2000;97:12637-12642.

Kluge AG. y Farris JS. Quantitative phyletics and evolution of anurans. Syst. Zool.,
1969;18(1): 1-32.

Kumar S. Tamura K. y Nei M. MEGA: Molecular Evolutionary Genetic Analysis ,
version 1.0. 1993.Pennsylvania State University, University Park, PA.
126
Kumar S, Tamura K, Jakobsen 1 y Nei M. MEGA: Molecular evolutionary genetics
analyisis. 2001. http://www.megasoftware.net.

Kumar S, Filipski AJ. Molecular phylogeny reconstruction. Encyclopedia of Life
Sciences/www.els.net. 2001.

Lafontaine DLj, Tollervey D. Ribosomal RNA. Encyclopedia of Life
Sciences/www.els.net. 2000

Lafontaine DLj, Tollervey D. The function and synthesis of ribosomes. Nat Rev Mol
Cell Biol 2001b; 2; 514-520

Lagouri V, Boskou D. Nutrient antioxidants in oregano. Int J Food Sci Nutr 1996;
47(6); 493-7.

Leclerc MC, Barriel V, Lecointre G, Reviers B. Low divergence in rDNA sequences
among five species of focus (Phaeophyceae) suggests recent radiation. J Mol Evol
1998;46:115-120.

Li WH Molecular Evolution. 1997. Sunderland, MA: Sinauer.

Lipmann DJ and Pearson WR. Rapid and Sensitive Protein Similarity Searches.
Science 1985;227:1435

Liston A, Robinson WA, Oliphant JM, y lvarez-Buyila ER. Lenght variation in the
nuclear ribosomal DNA interna) transcribed spacers of non-fiowering seed plants.
Syst Bot 1996; 21:1-12.

Liston A. Variation in the chloroplast genes rpoCl and rpoC2 of the genus
Astragalus (Fabaceae): Evidence from restriction site mapping of a PCR-amplified
fragment. Ame J Bot 1992; 79:953-961.
127
Lozoya X Velazquez D y Flores A. La medicina tradicional en Mxico. Experiencia
del programa IMSS-COPLAMAR. 1988. IMSS. Mxico, D. F.

Maclaurin JB. Fitness: Philosophical Problems. Encyclopedia of Life
Scienceslwww.els.net. 2001.

Maddison DR. The discovery and importance of multiple islands of most-
parsimonious trees. Systematic Zoology 1991;40:315-328.

Maddison WP. y Maddison DR. MacClade, version 3.0. 1992. Sinauer, Suderland,
Mass.

Martnez MS. Plantas Medicinales Jardn Botnico Michoacano "Melchor
Ocampo". 1986; Serie Tcnica NO 7, 3ra- Comisin Forestal. Michoacn. Mxico.

Maser RS et al. Mrel 1 complex and DNA replication: Iinkage to E2F and sites of
DNA synthesis. Mol Cell Biol 2001; 21; 6006-6016

Maxam, A.M.; Gilbert, W. 1977. A new method for sequencing DNA. Proc. Acad.
Sci. USA. 74:560-564.

Mayr E. The objectcs of selection. Proc Nat Acad Sci USA 1997; 94 2091-2094.

Mayr E. Cladistic analysis or cladistic classification? Zoology Systeratic Evolution
1974; 12:94-128.

McVaugh R. Flora Novo-galiciana: A descriptive account of the vascular plants of
western Mexico. Michigan, USA, ANN Arbor The University of Michigan Press.
1984


128
McVaugh R. y Schmid R. Novelties in Satureia Sect. Gardoquia (Labiatae).
Britonnia 1967; 19: 261-267.

Merino L. Los bosques de Mxico, una perspectiva general. In: Bosques y
plantaciones forestales. Cuadernos agrarios 14, Nueva poca. CMS. SEMARNAP.
FREDRICH EBERT STIFTUNG. FAL Mac Arthur. 1996:157-162 pp.

Moreno, P. La superficie de la Tierra. Un vistazo a un mundo cambiante. La
Ciencia desde Mxico, 1988;54. Fondo de Cultura Econmica, Mxico,.

Miao B, Turner BL, Mabry TJ. Systematic implications of chloroplast DNA variation
in the subtribe Ambrosiinae (Asteraceae: Helianthae). Amer J Bot 1995; 82:924-
932.

Milnichuk V. y Arabagi M. Leyendas de la Tierra. Biblioteca Cientfica Salvat,
1979;46. Barcelona.

Mitchel A. DNA repair. The replication connection. Nat Rev Mol Cel Biol 2001; 2,
643

Mitchel A. Seeing double. Milestone 03. http://www.nature.com/celidivision/
milestone/full/milestone03.html. 2002.

Mitchel A. DNA repair. A taxing question. Nat Rev Mol Cel Biol 2000; 1, 166.
Mitchel A. DNA repair. Breaking the cycle. Nat Rev Mol Cel Biol 2001; 2, 230.

Mittermeier, R.A.,. Primate diversity and the tropical forest: case studies from Brazil
and Madagascar and the importance of megadiversity countries. En: Wilson, E.O.
(ed). Biodiversity. National Academy Press. Washington.D.C. 1998:145-154 pp.

Mitton JB. Adaptation and Natural Selection: Overview. Encyclopedia of Life
Sciences/www.els. net. 2001.
129
Moritz C., Hillis DM. Molecular sistematics: context and controversies. 1996 1-12.
In: Hillis DM, Moritz C., Mable B.K. Eds. Molecular sistematics. Segunda Edicin.
Sinauer Associates Inc. Massachusetts.

Mosseau TA, Olvido AE. Geographical variation. Encyclopedia of Life
Sciences/www.els.net. 2001.

Myers N, Knoll AH. The biotic crisis and the future of evolution. Natl. Acad. Sci.
USA; 2001; 98: 5389-5392.

Negroni M, Buc H. Retroviral recombination: what drives the switch?. Nat Rev Mol
Cel Biol 2001, 2, 151-155.

Ne M.. Molecular Evolutionary Genetics. 1987. New York:Columbia University
Press.

Nei M.. Efficiencies of different tree-making methods for molecular data. En:
Miyamoto MM. y CracraftJ. Edrs. Phylogenet.ic analysis of DNA sequences.
Oxford University press, New York. 1991;90-128

Nelson G. Outline of a theory of comparative biology. Sist Zool 1970;19:373-384.
Nevo E. Evolution of genome-phenome diversity under environmental stress. Proc.
Natl. Acad. Sci. USA; 2001; 98: 6233-6240.

Nevo E.Speciation: Chromosomal mechanisms. Encyclopedia of Life
Sciences/www.els. net. 2001.

Nguyen VQ et al. Cyclin-dependent kinases prevent DNA re-replication through
multiple mechanisms. Nature 2001; 411; 1068-1073.


130
Nickrent DL, Franchina CR. Phylogenetic relationship on the Santanales and
relatives. J Mol Evol 1990;31: 294-301.

O'HARA RJ. Systematic generalization, historical fate and the species problem.
Syst Biol 1993; 42(3): 231-246.

Olsen GJ. Comparative Analysis and Molecular Phylogeny Department of
Microbiology, University of Illinois. En Bioinformatics: Databases and Computer
Networks in Biology. Workshop Manual. Fundago Tropical de Pesquisas e
Tecnologia "Andre Tosello". Campinas, Brasil. 1994.

Otte D. Species and speciation. Encyclopedia of Life Sciences/www.els.net. 2001.

Palmere YD., El hombre y el clima. Coleccin Lmites de la Ciencia. Ed. Gedisa,
Barcelona,. 1984; 19.

Panero JL., and Jansen RK. Chloroplast DNA restriction site study of Verbesina
(Asteraceae: Heliantheae). American Journal of Botany 1997;84: 382-392.

Panero JL, Jensen RK and Clevinger JA. Phylogenetic relationships of subtribe
Ecliptinae (Asteraceae: Heliantheae) based on chloroplast DNA restriction site
data. American Journal of Botany 1999;86: 413-427.

Panizzi L, Flamini G, Cioni PL, Morelli 1. Composition and antimicrobial properties
of essential oils four mediterranean Lamiaceae. J Ethnopharmacol 1993;
39(3):167-70.

Peer WA, Briggs WR, Langenheim JH. Shade-avoidance responses in two
common coastal redwood forest species, Sequoia sempervirens (Taxodiaceae)
and Satureja douglass (Lamiaceae), ocurring in various Iight quality
environments. Am J Bot 1999;86(5):640.
131
Pfanner N, Geissler A. Veratility of the mitochondrial protein import machinery. Nat
Rev Mol Cell Biol 2001; 2; 339-349.

Pool R. Beyond Databases and E-Mail. Science. 1993;261, 841-843

Qu LH, Xi BQ, Shi SH. y Zhang HD. A characteristic size of the ITS In:
gymnosperm rDNA. En: XV International Botanical Congress Abstracts Yokohama,
Japan: International Union of Biological Sciences. 1993; 201.

Reeck GR, de Hain C, Teller DC, Doolittle RF, Fitch WM, Dickerson RE, Chambon
P, McLachlan AD, Margoliash E, Jukes TH, and Zuckerkandl E. "Homology" in
proteins and nucleic acids: A terminology muddle and a way out of it. Cell 1987;50:
667-667.

Reeve HK, Sherman PW. Adaptations: Meanings. Encyclopedia of Life
Sciences/www.els.net. 1999.

Reznick D. Natural selection. Encyclopedia of Life Sciences/www.els.net. 2001.

Rodrguez JS y Espinosa GJ.. Listado florstico del Estado de Michoacn. Seccin
III. In: Flora del Bajio y de regiones adyacentes. Fasciculo complementario X.
Instituto de Ecologa A. C. Centro Regional del Bajo. Patzcuaro, Michoacn,
Mxico. Conacyt. UMSNH. Conabio. 1996.

Rochambeau H, Fournet-Hanocq F,Khang VT. Measuring and managing genetics
variability in small populatios. Ann Zootech 2000;49;77-93.

Ricart G. Free the Internetl Computers in Physics. 1994;8, 508-510

Ricart, G. How to transfer files on the Internet Computers in Physics. 1994;8, 20-23
Rieseberg LH. Hybrid Speciation. Encyclopedia of Life Sciences/www.els.net.
1999.
132
Rieseberg LH, Ungerer MC. Speciation: genetics. Encyclopedia of Life
Sciences/www.els.net. 2001.

Rieseberg LH, Hanson A, Philbrick CT. Androdioecy is derived frorn dioecy in
Datiscaceae: evidence from restriction site mapping of PCR-amplified chloroplast
DNA fragments. Syst Bot 1992; 17:324-336.

Ritchie MG. Speciation: simpatric and parapatric. Encyclopedia of Life
Sciences/www.els.net. 2001.

Ritland K y Clegg MT. Evolutionary analysis of plant DNA sequences. The
American Naturalist. 1987; 130:874-8100.

Rzedowski J y Rzedowski G. Flora Fanerogmica del Valle de Mxico. Volumen II.
ENCB-INE. 1985; 674 p.

SARH. Inventario Forestal Periodico. SARH. Mxico. 1994.

Saitou N. Nei M. The neighbour joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 1987;6: 514-525.

Sambrook JE, Fritsch F, and Maniatis R. Molecular cloning, a laboratory manual,
2nd ed. Cold Spring Harbor Laboratory Press, Plainview, New York, USA. 1989.

Snchez RVR, Somoza B, Ortega T, Villar AM. Isolation of vasodilatory active
flavonoids from the traditional remedy Satureja obovata. Planta Med 1996;
62(3):2724

Sang T, Crawford DJ, Stuessy TF, Silva OM, ITS sequence and the phylogeny of
the Genus Robinsonia (Asteraceae) Syt Bot 1995; 20:55-64.

133
Sanger F, Nicklen S y Coulson AR. DNA sequencing with chain terminating
inhibitors. Proc. Natl. Acad. Sci. USA. 1977;74:5463-5467.

Sankoff D. Minimal mutation trees of sequences. SIAM J Appl Math, 1975;21: 35-
42.

Schaal BA, Olsen KM. Gene genealogies and population variation in plants. Proc
Natl Acad Sci USA. 2000; 97: 7024-7029.

SEMARNAP (1996): Programa Forestal y de Suelo 1995-2000. SEMARNAP,
MXICO

SEMARNAP. Proyecto de conservacin y manejo sustentable de recursos
forestales en Mxico. PROCYMAF. SEMARNAP. Mxico.
(http://beta.Semarnap.gob.mx/pfnm/ medicinal.html) 2000a

SEMARNAP. Proyectos de productos forestales no maderables no tradicionales.
PFNM. SEMARNAP. Mxico. (http://beta. Semarnap.gob.mxlpfnm/medicinal.html)
2000b

Setoguchi H. Y Watanabe 1. Intersectional gene flow between insular endemics of
Ilex (Aquifolieceae) on the Bonin Islands and the Ryukyu Islands. Am. J. Bot.
2000;87:793-810.

Silic C. monographie der gattungen Satureja L. Calamintha Miller, Micromeria
Bentham, Acinos Miller und Clnopodium L. in der Flora jugoslawien. Zemaljski
Muzej BiH, Sarajevo. 1979.

Simon, J. E., A. F. Chadwick and L. E. Craker. Herbs: An Indexed Bibliography.
19711980. The Scientific Literature on Selected Herbs, and Aromatic and
Medicinal Plants of the Temperate Zone. Archon Books, 1984. 770 pp., Hamden,
CT.
134
Simpson GG. Principies of Animal Taxonomy. 1961. Columbia Univ. Press., New
York, 247 pp.

Schiuter D. Ecology and the origin of species. Trend Ecol Evol 2001; 16:372-380.

Schneider SM. Towards a more synthetic view of evolution. Amer J Bot 1999; 86:
145-148.

Schneider CHJ. Natural selection and speciation.Proc Natl Acad Sci
2000;97:1239812399.

Scotland R.W. Cladistic theory. 1992; 3-13. En: Forey P.L., Humphries C.J. Shaw
PJ. Nucleolus. Encyclopedia of Life Sciences/www.els.net. 2001

Sheldon PR. Punctuated Equilibrium and Phyletic Gradualism. Encyclopedia of Life
Sciences/www.els. net. 2000.

Slavkovska V, Jancic R, Bojovic S, Milosavljevic S, Djokovic D. Variability of
essential oils of Satureja Montana L. and Satureja kitaibelii wierzb. Ex heuff. From
the central part of the Balkan pennsula. Phytochemistry 2001; 57(1):71-6.

Sneath PH. A. & Sokal RR. Numerical Taxonomy. The principies and practice of
numerical classification. Freeman, San Francisco, California. 1973573 pp.

Sokal RR. The continuing search for order. American Naturalist 1985;126: 729-
749.

Soltis ED, Soltis PS. Contributios of plant molecular systematis to studies of
molecular evolution. Plant Mol Biol. 2000; 42(1): 45-75


135
Soltis ED, Soltis PS, Clegg MT y Durbin M. rbcL sequence divergence and
phylogenetic relationships in Saxifragaceae sensu lato. Proc Nat Acad Sci USA
1990; 87:4640-4644.

Soltis PS, Soltis DE y Doyle J. edrs. Molecular Systematics of plants. 1992.
Chapman & Hall, New York.

Soltis PS. y Kuzoff RK. ITS sequence variation within and among populations of
Lomation gray and L. laevigatum. Mol Phylog Evol 1993; 2:166-170.

Stackebrandt E. Phylogeny based on 16S rRNA/DNA. Encyclopedia of Life
Sciences/www.els.net. 1998.

Standley PC. Trees and Shrubs of Mxico. Contributions from the United states
National Herbarium. 1924.Volume 23, part. 4. Smithosian Institution. United States
National Museum. Washington, D.C. USA.

Stebbins GL. A brief summary of my ideas on evolution. Amer. J. Bot. 1999; 86(8):
1207-1208.

Stephan W, Walsh B. repetitive DNA: evolution. Encyclopedia of Life
Sciences/www. els. net. 2000.

Stuessey T. F., 1990. Plant taxonomy. Columbia University Press. New York.

Stevens P. E. Evolutionary classifications in botany, 1960-1985. J Am Arb 1986;
67:313-339.

Stevens PF. History of taxonomy. Encyclopedia of Life Sciences/www.els.net.
2001.

136
Suh Y, Thien LB, Reeve HE. y Zimmer EA.. Molecular evolution and phylogenetic
implications of interna) transcribed spacer sequences of ribosomal DNA in Win
teraceae. Ame J Bot 1993; 80:1042-1055

Sunnucks P. Efficient genetic markers for population biology. Trend Ecol Evol
2000; 15: 5:199-203.

Svejstrup JQ. Mechanismis of transcription-coupled DNA repair. Nat Rev Mol Cel
Biol 2002; 3, 21-29.

Swofford DL y Olsen GJ. Phylogeny reconstruction. In: Hillis D. M. & Moritz, C.
(Eds). Molecular Systematic. Sinauer. (Sunderland, Massachusetts): 1990;411-
501.

Swofford DL.PAUP: phylogenetic analysis using parsimony version 3.1.1. 1993.
Illinois Natural History Survey, champaigne, IL.

Swofford DL, Olsen GJ, Waddell PJ, Hillis DM. Phylogenetic inference. 1996; 407-
510 En: Hillis DM. Moritz C, Mable BK. Eds. Mol Syst Segunda Edicin. Sinauer
Associates Inc. Massachusetts.

Swofford DL. PAUP*: phylogenetic analysis using parsimony (*and other methods),
version 4. Sinauer, Sunderland, Massachusetts, USA. 1999.

Taer T. Geologa de Mxico. La Ciencia desde Mxico. Fondo de Cultura
Econmica, Mxico. 1983; 91:45-47.

The Genome Sequencing Consortium. Initial sequencing and analysis of the
human genome. Nature. 2001;409,860-921.

The Arabidopsis Genome Initiative.. Analysis of the genome sequence of the
flowering plant Arabidopsis thaliana. Nature. 2000;408,796-815.
137
Theissen G, Becker A, Di Rosa A, Kanno A, Kim JT, Munster T, Winter KU,
Saedler H. A short history of MADS-box genes in plants. Plant Mol Biol 2000; 42
(1): 115149.

Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment htrough sequence weighting, position
specific gap penalties and weight matrix choice. Nucleic Acids Res 1994:22:4673-
4680

Thompson JD, Gibson TJ, Piewniak, F, Jeanmougin F, and Higgins DG. The
Clustal X windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Research 1997;24:4876-4882.

Turner BL and Nesom GL. Biogeography, Diversity and Endangered or hreatened
Status of Mexican Asteraceae. Biological Diversity of Mxico: Origins and
Distribution. T. P. Ramamoorthy, R. Bye, A. Lot and J. Fa: 1993;559-575.

Turner R. In search our origins. Milestone 13. http://www.nature.com/celIdlvision/
milestone/fuli/milestonel 3.html. 2002.

Ungerer MC, Stuart JE, Baird JP y Rieseberg LH. Rpid hybrid speciation in wild
sunflowers. Proc. Natl. Acad. Sci. 1998;95:11757-11762.

McCarthy EM, Asmussen MA y Anderson WW. Heredity. 1995;74:502-509.

Urbatsch LE. A preliminary phylogenetic analysis of the Heliantheae subtribe
Engelmannnae (Asteraceae) based on sequences from nuclear ribosomal DNA.
American Journal of Botany (Supplement) 199T;84: 238-239.



138
Urbatsch LE, and Jansen RK. Phylogenetic affinities among and within the
coneflower genera (Asteraceae, Heliantheae), a chloroplast DNA analysis.
Systematic Botany 1995;20: 28-38.

Wagner P. Phylogeny and stratigraphy comparison. Encyclopedia of Life
Sciences/www.els.net. 2000.

Wagner WH. Problems in the classification of ferns. Botany 1961;1: 841-844

Wagner WH. Biosystematics and taxonomic categories in lower vascular plants.
Regnum Vegetabile, 1963;27:63-71

Walsh JB. Genome evolution: overview. Encyclopedia of Life
Sciences/www.els.net. 2000.

Watson L. and Dallwitz MJ.. The Families of Flowering Plants: Descriptions,
Identification, and Information retrieval. (1992 onwards) Version: http://
biodiversity.uno .edu/ delta/.(2002)

Wendel JF, Schnabei A. y Seelanen T.. Bi-directional interlocus concerted
evolution following allopolyploid speciation in cotton (Gossypium). Proc Nat Acad
Sci USA 1995; 92:280-284.

Welsh J and McClelland M. Fingerprinting genomes using PCR with arbitrary
primers. Nucleid Acids Res. 1990;18:7213-7218.

White RE y Heine TL. "Evidencias de levantamiento tectnico con el sismo del 19
de septiembre de 1985 en la regin de Caleta de Campos, Estado de Michoacn."
Revista del Instituto de Geologa, UNAM, 1992;7:106.


139
White TH, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. 1990;315-322. In M Innis, D. Gelfand, J.
Snisky, and T. White (Eds.), PCR protocois: a guide to methods and amplifications,
315-322. Academic Press, San Diego, California, USA.

Whitlock MC, Phillips PC. Drift: Introduction. Encyclopedia of Life
Sciences/www.els. net. 1999.

Wiley EO. The evolutionary species concept reconsidered. Syst. Zool. 1978;27: 17-
26.

Wiley EO. Phylogenetics. The theory and practice of Phylogenetic Systematics.
1981; John Wiley &-Sons, New York.

Wiley EO, Siegel-Causey D, Brooks DR, Funk VA. The Compleat Cladist. A Primer
of Phylogenetic Procedures. The University of Kansas, Museum of Natural History,
Special Publication, 1991; 19158pp

Wilkinson M. Cladistics. Encyclopedia of Life Sciences/www.els.net..2001.

Wilmer A, Baltisberger M. Molecular evidence for allopolyploid speciation and a
single origin of the narrow endemic Draba ladina (Brassicae). Ame J Bot
1999;86:12821289.

Wood TE, Rieseberg LH. Speciation: Introduction Encyclopedia of Life
Sciences/www.els.net. 2001.

World Bank. Natural resources and rural, poverty operations division. Latin
America and the Caribean Regional Office. Mxico Resource Consevation and
Forest Sector Review, 1995:Report N 13114.ME; Washington.

140
Worid Resources Institute. A guide to the global environment; Washington, D. C.
1994.

Yamasaki K, Nakano M, Kawahata T, Mori H, Otake T, Ueba N, Oishi 1, Inami R,
Yamane M, Nakamura M, Murata H, Nakanishi T. Anti HIV-1 activity of herbs in
Labiatae. Biol Pharm bula 1998; 21(8):828-33.

Zhou B-B S Elledge SJ. The DNA damage response: putting checkpoints in
perspective. Nature 2000; 408; 433.439.

Zurawski G. y Clegg M T.. Evolution of higher-plant chloroplast DNA-encoded
genes: Implications for structure-function and phylogenetic studies. Annu Rev Plant
Phys 1987; 38:391-418.




















UNIVERSIDAD DE COLIMA
CENTRO UNIVERSITARIO DE INVESTIGACIN Y
DESARROLLO AGROPECUARIO

Oficio No. 078/02

ING. RODOLFO MORENTIN DELGADO
DIRECTOR DE LA F.C.B.A.
PRESENTE.

En atencin a que el M. C. JOSE MARIO AGUILAR RAMIREZ, alumno e-
osado del Doctorado cn Ciencias, rea de ciencias agrcolas y forestales, ha
rcazado todas las correcciones al manuscrito de tesis que present para su
revisin, me dirijo respetuosamente a usted para informarle que el documento
titulado " Especiaein recombinacional y relaciones iiloger ticas en SaturEja
mRCr~>,Stezna var, laevigara.", rene todas las caractersticas necesarias para
obtener el grado de Doctor en Ciencias.

Sin otro particular aprovecho la oportunidad para enviarle Un cordial saludo.

C.C.P. DR. ROBERTO GOMEZ AGUILAR, SECRETARIO TCNICO DEL PICAF,
UNIVERSIDAD AUTNOMA DE NAYARIT
C.C.P. EXPEDIENTE CORRESPONDIENTE.
C.C.P. ARCHIVO.

APR/Anglica*


UNIVERSIDAD MICHOACANA DE SAN
NICOLS DE HIDALGO
INSTITUTO DE INVESTIGACIONES QUMICO
BIOLGICAS
Lab. de Biotecnologia Vegetal EdHicfo B-3, Clndad Univenitarfa
sal8arcle8a~hotwil oom 58030, M~ Mico. MEXICO.
Tel-Fax.- (443) 3 265788

DR ALFONSO PESCADOR
COORDINADOR DEL POSGRADO (PICAF)
UNIVERSIDAD DE COLIMA
PRESENTE.

Por este conducto me dirijo a Ud. de la manera ms atenta, con el fin de informarle
que he revisado el trabajo escrito de tesis del estudiante Jos Mario Aguilar
Ramrez titulado "ESPECIACIN RECOMBINACIONAL Y RELACIONES
FILOGENTICAS EN Satureja macrostema var. laevigata", con correcciones
menores, el cual para mi opinin est listo para ser defendido ante el examen
doctoral.

Sin otro particular, agradezco su atencin y reciba un cordial saludo.

ATENTAMENTE


UNIVERSIDAD DE COLIMA
CENTRO UNIVERSITARIO DE INVESTIGACIN Y
DESARROLLO AGROPECUARIO


ING. RODOLFO MORENTIN DELGADO
DIRECTOR DE LA F. C. B. A.
PRESENTE.


De la manera ms atenta me dirijo a usted, para informarle que el M. C. JOSE
MARIO AGUILAR RAMIREZ, alumno egresado del Doctorado en Ciencias, ,tres
de Ciencias Agrcolas y Forestales, realiz las correcciones al manuscrito de tesis
que present para su revisin, titulado "Especiacin recombinacional y relaciones
tilogenticas en Sature la rnacrostema var, laevigata, documento que rene los
requisitos para obtener el grado de Doctor en Ciencias.

Sin otro particular, le envio un cordial saludo.

C.C.P. DR. ROBERTO GOMEZ AGUILAR, SECRETARIO TCNICO DEL PICAF,
UNIVERSIDAD AUTONOMA DE NAYARIT
C.C.P. EXPEDIENTE CORRESPONDIENTE.
ARCHIVO.


UNIVERSIDAD DE COLIMA
CENTRO UNIVERSITARIO DE INVESTIGACIN Y
DESARROLLO AGROPECUARIO

ING. RODOLFO MORENTIN DELGADO
DIRECTOR DE LA F. C. B. A.
PRESENTE

En atencin a que el M. C. JOSE MARTO AGUILAR RAMIREZ, alumno egresado
del Doctorado en Ciencias, rea de ciencias agrcolas y forestales, ha realizado
todas las coi-recciones al manuscrito de tesis que present para su revisin, me
dirijo respetuosamente a usted para informarle que el documento titulado
"Especiacin recombinacional y relacio :es filogenticas en Satureja macrostema
var, laevigata,", rene todas las caractcristicas necesarias para obtener cl grado
de Doctor en Ciencias.

Sin otro particular aprovecho la oportunidad para enviarle aun cordial saludo.

C.C.P. DR. ROBERTO GOMEZ AGUILAR, SECRETARIO TCNICO DEL PICAF,
UNIVERSIDAD AUTONOMA DE NAYARIT.
C.C.P. EXPEDIENTE CORRESPONDIENTE
C.C.P. ARCHIVO.
APR/Anglica*


UNIVERSIDAD DE COLIMA
CENTRO UNIVERSITARIO DE INVESTIGACIN Y
DESARROLLO AGROPECUARIO


ING. RODOLFO MORENTIN DELGADO
DIRECTOR DE LA F. C. B. A.
PRESENTE.

De la manera ms atenta me dirijo a usted, para informarle que el M. C.
JOSE MARIO AGUILAR RAMIREZ, alumno egresado del Doctorado en Ciencias.
rea de Ciencias Agrcolas y Forestales, realiz las correcciones al manuscrito de
tesis que present para su revisin, titulado " Especiacin recombinacional y
relaciones filogenticas en Satureja na.:rustemir var. luevigata,' documento que
rene los requisitos para obtener el grado de Doctor en Ciencias.

Sin otro particular, le envo un cordial saludo.



C.C.P. DR. ROBERTO GOMEZ AGUILAR, SECRETARIO TCNICO DEL PICAF.
UNIVERSIDADAUTONOMA DE NAYARIT
C.C.P. EXPEDIENTE CORRESPONDIENTE.
C.C.P. ARCHIVO.