JCMB V7N1 V8N2

Volume 7 No 2 & Volume 8 No 1 June 2010
http://jcmb.halic.edu.tr
Journal of Cell and
Molecular Biology
Sensitivity of the human chromosomes to EMS
Y chromosome microdeletions in spontaneous abortions
Genetic diversity of Penicillium species

stanbul-TURKEY

Journal of Cell and
Molecular Biology

Volume 7 No 2 & Volume 8 No 1
June 2010

Hali University
Faculty of Arts and Sciences
Journal of Cell and Molecular Biology
Founder
Gndz GEDKOLU
President of Board of Trustee
Rights held by
Sait SEVGENER
Deputy Rector

Correspondence Address:
The Editorial Office
Hali niversitesi
Fen-Edebiyat Fakltesi,
Kaptan Paa Mah. Darlaceze Cad. No: 14 34384
Okmeydan-ili, stanbul -Turkey
Phone: +90 212 220 96 96
E-mail: jcmb@halic.edu.tr
Journal of Cell and Molecular Biology is
indexed in ULAKBIM, EBSCO, DOAJ,
EMBASE, CAPCAS, EMBiology, and
Index COPERNICUS
ISSN 1303-3646
Printed at MART Printing House
Journal of Cell and
Molecular Biology
Published by
Hali University
Faculty of Arts and Sciences
Editor
Nagehan ERSOY TUNALI
Associate Editor
Mehmet Ali TFEK
Editorial Board
Baki YOKE
Burcu Irmak YAZICIOLU
Krat ZDLL
Asl BAAR

Advisory Board
Adil Meri ALTINZ, stanbul, Turkey
Tuncay ALTU, stanbul, Turkey
Canan ARKAN, Munich, Germany
Aglaia ATHANASSIADOU, Patras, Greece
ehnaz BOLKENT, stanbul, Turkey
Nihat BOZCUK, Ankara, Turkey
A. Nur BUYRU, stanbul, Turkey
Kemal BYKGZEL, Zonguldak, Turkey
Hande ALAYAN, stanbul, Turkey
smail AKMAK, stanbul, Turkey
Adile EVKBA, stanbul, Turkey
Beyazt IRAKOLU, stanbul, Turkey
Fevzi DALDAL, Pennsylvania, USA
Zihni DEMRBA, Trabzon, Turkey
Mustafa DJAMGZ, London, UK
Aglika EDREVA, Sofia, Bulgaria
nal EGEL, Bursa, Turkey
Deniz ERGE, stanbul, Turkey
Nermin GZKIRMIZI, stanbul, Turkey
Ferruh ZCAN, stanbul, Turkey
Fsun GMEL, stanbul, Turkey
Candan JOHANSEN, stanbul, Turkey
Asm KADIOLU, Trabzon, Turkey
Maria V. KALEVITCH, Pennsylvania, USA
Valentine KEFEL, Pennsylvania, USA
Meral KENCE, Ankara, Turkey
Uur ZBEK, stanbul, Turkey
Sevtap SAVA, Toronto, Canada
Mge TRET SAYAR, stanbul, Turkey
smail TRKAN, zmir, Turkey
Mehmet TOPAKTA, Adana, Turkey
Meral NAL, stanbul, Turkey
Selma YILMAZER, stanbul, Turkey
Ziya ZYLAN, stanbul, Turkey

CONTENTS Volume 7 No 2 & Volume 8 No 1 June 2010
Review Article

DNA repetitive sequences-types, distribution and function: A review
S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA
1
Research Articles
Genetic diversity of Penicillium species isolated from various sources in Sarawak,
Malaysia
H.A. ROSLAN, C.S. NGO and S. MUID

13
The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS)
S. BUDAK-DLER and M. TOPAKTA
25
Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate
induced renal oxidative damage in rats
M.M. AHMED and S.E. ALI
35
Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases
G. KO, K. ULUCAN, D. KIRA, D. ERGE, T. TARCAN and A.. GNEY
45
Do simple sequence repeats in replication, repair and recombination genes of
mycoplasmas provide genetic variability?
S. TRIVEDI
53
Software Review
Tcoffee : Multipurpose sequence alignments program
A. MANSOUR
71
UCSC: Genome Browser for genomic sequences
A. MANSOUR
75
Dotlet: powerful and easy strategy for pairwise comparisons
A. MANSOUR
81
Instructions for Authors 85

Journal of Cell and Molecular Biology 7(2) & 8(1): 1-11, 2010 Review Article
Hali University, Printed in Turkey.
DNA repetitive sequences-types, distribution and function: A review
Satyawada Rama RAO
*,1
, Seema TRIVEDI
2
, Deepika EMMANUEL
2
, Keisham MERITA
1

and Marlykynti HYNNIEWTA
1

1
Cytogenetics and Molecular Biology Laboratory, Department of Biotechnology and Bioinformatics, North-
Eastern Hill University, Permanent Campus, Mawkynroh, Umnsing,
Shillong- 793022, Meghalaya (INDIA)
2
Department of Zoology, Jai Narain Vyas University, Jodhpur- 342005, Rajasthan (INDIA)
(* author for correspondence; srrao22@yahoo.com)
Received: 21 September 2009; Accepted: 14 May 2010

Abstract
The development and use of molecular markers for the detection and exploitation of DNA polymorphism is
one of the most significant developments in the field of molecular genetics. DNA based molecular markers
have acted as versatile tools and have found their own position in various fields like taxonomy, physiology,
embryology, genetic engineering etc. A major step forward in genetic identification is the discovery that
about 30-90% of the genome is constituted by regions of repetitive DNA which are highly polymorphic in
nature. Microsatellites are multilocus probes creating complex banding patterns and are usually non-species
specific occurring ubiquitously. They form an ideal marker system and are dominant fingerprinting markers
and co-dominant STMS (sequence tagged microsatellites) markers. Microsatellites markers have been used
successfully to determine the degree of relatedness among individuals or groups of accessions to clarify the
genetic structure or partitioning of variation among individuals, accessions, populations and species.
Repetitive sequences have been widely used for examining genome and species relationships by in situ and
by Southern hybridization.
Keywords: Satellites, microsatellites, minisatellites, retroposons and proretroviral transposons
Tekrarl DNA dizileri-tipleri, dalmlar ve fonksiyonlar
zet
DNA polimorfizmlerinin tayini ve kullanlmas iin molekler belirtelerin gelitirip kullanlmas molekler
genetik alanndaki en nemli ilerlemelerden bir tanesidir. DNA tabanl molekler belirteler ok amal
kullanm aralardr ve taksonomi, fizyoloji, embriyoloji, genetik mhendislii gibi eitli alanlar arasnda
kendi yerlerini bulmulardr. Genetik tayine doru en byk adm, genomun hemen hemen %30-90nn
tekrarlanan, doada yksek oranda polimorfik olan DNA dizilerinden olutuunun kefidir. Mikrosatelitler
kompleks erit paterni oluturan multilokus problardr ve genellikle ska bulunup tre spesifik olmazlar.
Bunlar ideal belirte sistemini olutururlar ve dominant parmakizi belirteleri ve kodominant STMS
belirteleridirler (sequence tagged microsatellitesdizi iaretli mikrosatelitler). Mikrosatellit belirteler,
bireyler arasnda veya katlan gruplar arasnda genetik yapnn ya da bireyler, gruplar, populasyonlar ve trler
arasndaki varyasyonun gruplandrlmasnn aydnlatlmas iin, yaknlk derecesinin saptanmas amal
olarak baar ile kullanlmtr. Tekrarlanan diziler, genom ve trlerin ilikilerinin in situ ve Southern
hibridizasyonu ile incelenmesi iin yaygn olarak kullanlmaktadr.
Anahtar Szckler: Satelit, mikrosatelitler, minisatelitler, retropozonlar ve proretroviral transpozonlar

Satyawada Rama RAO et. al. 2

Introduction
The analysis of genetic diversity and relatedness
between or within different species, populations
and individuals is a central task for many
disciplines of biological science. Classical
strategies of evaluating genetic variability are
comparative anatomy, morphology, embryology
and physiology. These are complemented by
analysis of chemical constituents like plant
secondary compounds or with specific characteriza-
tion of macromolecules and allozymes. In recent
years, focus has been shifted to the development of
molecular markers based on DNA or protein
polymorphism. The importance of these studies lies
in exploitation of uniqueness of DNA sequences
that facilitate research in diverse disciplines such as
taxonomy, phylogeny, ecology, genetics and plant
breeding.
Establishing an individual's identity is one of
the uses of DNA sequence information that
highlight uniqueness of a particular sample. The
methodology focuses on ways to reduce complexity
of DNA into simple patterns that are representative
of the sample. This type of analysis is called
fingerprinting, profiling, genotyping or identity
testing. Jeffreys et al. (1985) introduced this term to
describe a method for the simultaneous detection of
variable DNA loci by hybridization of specific
multilocus probes with electrophoretically sepa-
rated restriction fragments. DNA fingerprinting is
useful for forensic identification, determination of
family relationship, linkage mapping, antenatal
diagnosis, localization of disease loci, determina-
tion of genetic variation, molecular archaeology
and epidemiology (Watkins, 1988; Donis-Keller et
al., 1987; Landegren et al., 1988; Paabo, 1989;
Golenberg et al., 1990). Molecular markers have
been used for identification of individuals, clones,
close relatives, paternity testing or in studies of
reproductive behavior and mating success.
Repetitive sequences as molecular markers
A repeat is recurrence of a pattern whereby DNA
exhibits recurrence of many features. The number
of occurrences of a pattern is called copy number.
The number of copies in a particular tandem repeat
region is termed region copy number. The term
genome copy number refers to number of copies of
tandem or interspersed repeats in genome.
The repetitive DNA family(ies) may be widely
distributed in a taxonomic family or a genus, or
may be specific for a species or chromosome.
Repeats may occur in specific locations in a
genome, e.g. in telomeric regions or scattered
throughout the genome. They may acquire large
scale variation in the sequence and copy number
over evolutionary time-scale. The repetitive
elements are under different evolutionary con-
straints as compared to the genes. Hybrid
polyploids are excellent models for studying
evolution of repetitive sequences (Kubis et al.,
1998). These variations are the basis of utilization
of repetitive sequences for taxonomic and
phylogenetic studies (Smith and Flavell, 1974).
There are many classifications of repetitive
DNA based on characteristics measured by
different techniques but consolidation of these
systems defines five broad classes: satellites,
microsatellites and minisatellites, retroposons and
proretroviral transposons. The classification
scheme makes a distinction between repetitive
regions exhibiting tandem repetition and inter-
spersed repetition but is not precise since each class
retains the characteristics of both. Some of these
repeats are described as follows:
Moderately repetitive DNA includes reiterations
of genes like tRNA, rRNA, hemoglobin etc. that
retain similar or nearly similar sequences due to
duplication. Some of these duplications result in
pseudogenes and may have many copies in the
genome. Some repetitive DNA sequences are
transposable elements since they ct not to enhance
the success of the cell (or organism) they reside in,
behave selfishly and also accumulate to the levels
restricted only by the resources available to them.
The selfish DNA hypothesis of Doolittle and
Sapienza, (1980) assumes that repetitive DNA can
behave in a selfish manner because it is not
functional. Indeed, there is some evidence that its
presence can result in losses of fitness of the host
cell due to mutations caused by transposable
elements. However, some moderately-repetitive
DNA has functions for example, in directing
chromosome movement in eukaryotes (Vogt,
1990). Variations in selfish DNA have the potential
for evolutionary changes, especially when it
changes without having any deleterious effects on
the organism (Flavell et al., 1977). Susumo Ohno
(1970) asserted that "natural selection merely
modified while redundancy created". Duplication
of genes can thus be internal source of novelty in
DNA repetitive sequences

3
the genome. If repetitive DNA is transposable, it
may create novel genes. Repetitive DNA is
therefore the "Research & Development"
laboratory of genome, creating both redundancy
and novel sequences that may prove valuable for
genome. However, these repetitive sequences are
generally not used for DNA fingerprinting.
Tandem and interspersed repeats
Tandem repetitions are consecutive head-to-tail,
direct, repetition of a pattern due to local
duplication. Interspersed repetitions are recurrence
of patterns that may or may not be proximal,
formed by either non-local duplication or multiple
introductions of the same or similar extraneous
DNA segments. These repeats are dispersed
throughout the genome and have no restriction on
the relative positions of identical occurrences
occurring in tandem locations. Research indicates
that interspersed repeats are inserts since they
resemble either processed RNAs i.e. retroposons, or
viruses i.e. proretroviral transposons. In addition, a
suspected target sequence for insertion occurs at
both ends of these repeats as expected for a circular
DNA crossover insertion. Furthermore, some
repeats actively move within the genome, such as
jumping genes in maize.
DNA repeat patterns also classify as direct,
indirect, complement, reverse complement or
palindrome. A direct or forward repeat is the
recurrence of a pattern on the same strand in the
same nucleotide order; e.g. ACCG recurs as
ACCG. An indirect, inverse or reverse repeat recurs
on the same strand but the order of the nucleotides
is reverse, e.g. the indirect recurrence of ACCG is
GCCA. Complement repeats are repeats where the
nucleotides are complemented according to Watson
Crick pairing, e.g. the complement of ACCG is
TGGC. A reverse complement repeat recurs on the
same strand but, the nucleotides are complemented
and the order of the nucleotides is reversed; e.g. the
reverse complement of ACCG is CGGT. In DNA,
most repetitions occur as forward or reverse
complement repeats and rarely as reverse or
complement repeats (Grumbach and Tahi, 1994).
Palindrome is a combination of two consecutive
occurrences in opposite orientations and read the
same when read from left to right or vice-versa.
Repetitive DNA sequences, divided into high-
repeat satellite DNA which replicates thousands or
millions of times and "moderate-repeat" mini-
satellite and microsatellite DNA which replicates
tens to perhaps a thousand times, account for
varying proportions of the genome of multicellular
eukaryotes. An example of representa-tive data
from eukaryotes has been given in Table 1.
Prokaryotes contain little or no repetitive
sequences. Noncoding repetitive DNA varies from
one group of organisms to another; individual to
individual and therefore used as DNA finger-
printing tool.
.

Table 1. Proportion of repetitive sequences of genomic DNA in different eukaryotes.
Drosophila Xenopus Mouse Tobacco
High repeat
Moderate repeat
Non repetitive
13%
13%
74%
3%
43%
54%
10%
20%
70%
5%
65%
30%
Tandem repeats and Satellite DNA
As repeats were discovered in different locations
exhibiting different copy numbers, new terms arose
such as satellite, minisatellite and microsatellite.
Some researchers refer to all types of satellites as
tandem repeats and describe a specific tandem
repeat region according to its location within the
genome, its periodicity, pattern structure and copy
number. These repeats were first identified on a
cesium chloride buoyant density gradient as peaks
separate from the primary DNA peak. The separate
or satellite peaks were composed of array of highly
conserved tandem repeats localized to hetero-
chromatic regions of chromosomes like
centromeres (Schueler et al., 2001). The structure
of a tandem repeat region has well-conserved
pattern but varies in size from less than 20 bp to
several thousand bp.
Structural and functional roles
Tandem repeats play significant structural and
functional roles. They occur in abundance in
structural areas such as telomeres, centromeres and
histone binding regions. They play a regulatory role
near genes and perhaps even within genes.
Transcription
The precise role of tandem repeats in transcription
regulation is not known. Since nucleosomes can
repress or enhance transcription initiation and
elongation (Hartzog and Winston, 1997; Kornberg
and Lorch, 1999) repeats may influence
transcription by affecting nucleosome positioning
and stability. Tighter bonds between the histone
complex and repeats restrict access for RNA
polymerase and regulatory proteins (Dai &
Rothman-Denes, 1999). This may happen by
changing the degree and direction of DNA
supercoiling or forming alternative DNA structures
such as cruciforms and hairpins (Shlyakntenko et
al., 1998; Ohyama, 2001). Tandem repeats having
an alternating purine (R=A or G) pyrimidine (Y=C
or U/T) pattern forms Z-DNA (Yang et al., 1996)
and repeats with a RRY or a YRY pattern form
triplex DNA structures (Grabcyzk and Usdin,
2000). The degree of repression is directly
proportional to repeat length.
Centromeric and subtelomeric satellite DNA
families
The tandem satellite DNA sequences exhibit
characteristic chromosomal locations, usually at
subtelomeric (or intercalary repetitive sequences)
and centromeric regions (Heslop-Harrison et al.,
2003; Jiang et al., 2003). Satellite DNA families
may arise de novo due to molecular mechanisms
like unequal crossing over, rolling circle
amplification, replication slippage and mutation.
Satellite DNA have variable repeat unit length
(sometimes equivalent to micro or minisatellite
length), often forming arrays spanning up to 100
Mb (Charlesworth et al., 1994; Kubis et al., 1998;
Schmidt and Heslop-Harrison, 1998; Vergnaud and
Denoeud, 2000). However, satellite repeat
monomer lengths of 140 180 bp and 300 360
bp, corresponding to the length of the mono and
dinucleosomes are most the common (Hemleben,
1990; Traut, 1991; Macas et al., 2002).
Centromeric tandem repeats ranging from 150-
200 bp in length (Henikoff et al., 2001) are
essential components of a functional centromere. A
functional centromere has been defined as the DNA
sequence which interacts with the kinetochore
where the interaction between centromere-kineto-
chore appears to be mediated by DNA-protein
recognition process (Jiang et al., 2003). The core
sufficient for centromeric function is an alpha
satellite about 3 Mbp long having a 171 bp pattern
recurring in a tandem fashion. (Schueler et al.,
2001; Zhong et al., 2002).
A highly repetitive 180 bps centromeric satellite
DNA family constituting between 2-5% of the
Arabidopsis thaliana genome is the key component
of its centromere/kinetochore complex (Nagaki et
al., 2003a,b). These repeats are occasionally
interrupted by the Athila retrotransposons, although
the latter are mainly clustered in pericentromeric
regions (Heslop-Harrison et al., 1999; Nagaki et al.,
2003a,b). Similarly, centromeric DNA in several
plants species including rice, maize, wheat, Beta
species and Zingeria biebersteiniana mainly
contain satellite sequence repeats and retro-
transposons (Gindullis et al., 2001; Kishii et al.,
2001; Kumekawa et al., 2001; Saunders and
Houben, 2001; Cheng et al., 2002; Nagaki et al.,
2003a,b). A high monomer divergence is observed
within several centromeric repetitive DNA families
thereby indicating presence of chromosome
specific variant sequences (Harrison and Helsop-
Harrison, 1995; Nagaki et al., 1998; Helsop-
Harrison et al., 2003). For example, chromosome
specific 180 bp satellite repeat variants in
Arabidopsis thaliana may be explained by the
possibility that either the repeat sequences on each
chromosome have been homogenizes independent-
ly or specific variants of the satellite sequence have
been amplified on each chromosome (Heslop-
Harrison et al., 1999).
The subtelomeric regions also contain repetitive
sequences (review in Pryde et al., 1997). Not all
species have the same structure but all have
structures containing tandem repeats, interspersed
repeats or both (Pryde et al., 1997). Degenerate
TTAGGG repeats enable alignment other sub-
telomeric regions allowing sequence exchange
between subtelomeres (Flint et al., 1997).


5
Minisatellite and Microsatellite DNA
Hypervariable regions, also known as variable
number of tandem repeats (VNTRs) classified as
minisatellites and microsatellites are regions that
contain a variable copy number. These repeats are
found throughout the genome (Vogt, 1990) but
rarely within genes. Most regions contain short to
moderate region copy number (Jeffreys, 1985).
DNA fingerprinting capitalizes on the differences
between alleles at specific VNTR loci. Various
human diseases are attributed to high copy numbers
associated with some VNTR locus.
Minisatellites are characterized by moderate
length patterns, usually less than 50 bp (Jeffreys,
1985) with an array of 0.5 - 30kb. Two types of
variability are observed, viz., one displays copy
number variation with each replication event
whereas the other displays distinct alleles within a
population such that different alleles contain
different copy numbers.
Microsatellites, also known as simple sequence
repeats (SSRs) or simple tandem repeats (STRs)
have a short well-conserved pattern length of 2 to 6
bp and region copy number of 10 to 40 pattern
copies. Microsatellites have been found in non-
centromeric regions, many of them being located
either near or within genes.
Automatic identification and characterization of
tandem repeats is crucial as genome projects
generate an ever-increasing quantity of sequence
data. Tandem repeats increase the complexity of
genome sequence analysis algorithms. For instance,
the process of generating full chromosome
sequences often utilizes the sequence assembly
procedure; a procedure that stitches short, similar
fragments together to reconstruct a larger sequence.
The consecutive recurrence of a pattern associated
with tandem repeats confuses this process. Some
commercially available algorithms avoid
assembling tandem repeat regions. Others often
assemble moderate-sized tandem repeat regions
improperly. At present, algorithms are being
developed for handling tandem repeat regions.
The mechanism responsible for minisatellite and
simple sequence polymorphisms
Minisatellites and simple sequences are often
characterized by high mutation rates (up to 5%),
which may involve either internal heterogeneity of
repeats or their number. Mutation rates also show
positive correlation with the total size of the array
of repeats. In accordance with these observations,
high molecular weight bands within a multilocus
fingerprint are often more variable than bands
occurring in the low molecular weight range. The
molecular basis of both minisatellites and simple
sequence variability is still debatable. Possible
mechanism include replication slippage, trans-
position, recombinational events and/or unequal
exchange between sister chromatids or between
homologous chromosomes and gene conversion
(reviewed by Jarman and Wells, 1989; Jeffreys et
al., 1990; Richards and Sutherland 1992; Wolff et
al., 1991.)
The slippage hypothesis implicates mispairing
of slipped-strand during the replication process.
Strand slippage may happen due to shift in origin of
replication especially during lagging strand
synthesis. Strand slippage and mismatch appear to
be nucleotide specific. Differential activities of
mismatch pair of (CAG)
n
repeats occur but not of
(CTG)
n
repeats. Certain factors like the length of
the repeats and replication direction play a role in
destabilizing (CAG)
n
(CTG)
n
repeat. Such
positioning effects results in loop formation due to
stand slippage and results in expansion or reduction
of repeat during replication.
Several lines of evidence have lent support to
the recombination hypothesis:
A variety of minisatellite core sequences
share homology of the bacterial recombi-
nation signal chi.
Minisatellite - like sequences have been
found at sites of meiotic crossing over.
Both minisatellite and macrosatellites
behave as recombinational hot spots in
transfected mammalian cells.
Wolff et al., (1991) observed no exchange of
flanking markers in a newly created minisatellite
allele, thus ruling out unequal exchange between
homologous chromosomes as a mutational mecha-
nism. In human minisatellite locus, MS32
(reviewed by Jeffreys et al., 1985), 5 end of the
array has a strong mutation bias, suggesting
existence of a mutational hot spot. Some mutant
alleles contain segments from both parental alleles,
providing evidence for interallelic exchange. It is
suggested that the major mutational process
involves nonreciprocal transfer of repeats from a
donor allele to the 5 end of a recipient allele.
Therefore, recombinational processes as well as
replication slippage may contribute to the creation
of minisatellite and simple sequence variability.
However, other (yet unidentified) mechanisms may
also be involved, especially in case of the explosive
amplification of microsatellite like trinucleotide
repeats associated with human genetic diseases and
polymorphism. Structural analysis of mutated vs.
parental alleles may help to gain more information
about the mutational mechanisms. In this respect,
transgenic systems will be informative, since
successive deletion of the flanking DNA will allow
precise location of mutational hot spots.
Retroposons
Retroposons resemble processed RNAs and
transpose passively via RNA intermediate (Weiner,
1986). Each element is composed of an A-rich tail
at the 3' end and short target site duplications
(direct repeats of 5-21 bp) flanking the repeat
(Rabin, 1985). Two main subclasses dominate this
class:
Short Interspersed Elements (SINEs)
These are distributed throughout the non-
centromeric regions of genome (over 100,000
copies per genome) (Weiner, 1986). A SINE
contains one or more RNA polymerase III,
promoter sites and an A-rich region. One subfamily
is composed of a head-to-tail catenation of two
promoter site, A-rich region pairs (Weiner, 1986).
Both subfamilies are flanked by short direct repeats
of 5 to 21 bp. Primate specific Alu sequence (5 to 9
kbp) is a SINE with two promoter sites and a
dimer. The uniqueness of Alu sequences provides a
wonderful tool for separating primate DNA from
that of other species. SINEs present challenges to
sequence assembly due to their high genome copy
number (300,000 to 500,000 copies) (Rogers,
1985).
Long Interspersed Elements (LINEs)
LINEs are composed open reading frames (ORFs)
followed by a 3' A-rich region having 20,000 to
50,000 copies per genome (Hutchison et al., 1989;
Weiner, 1986). Direct repeats of 6-15 bp flank the
element. L1 family (primary LINE family) is 6 to 7
kbp long. The consensus structure of the family is
well defined but not well conserved because L1
element can deviate significantly from the structure
such that entire structural components are deleted
or duplicated (Weiner, 1986).

Proretroviral transposons
Proretroviral transposons are mobile elements that
transpose via RNA intermediate (Varmus and
Brown, 1989). Their structure and content
resembles integrated viruses and often contain
genes encoding viral products, e.g. protease,
reverse transcriptase and integrase (Boefe and
Corces, 1989). The LTRs contain transcriptional
signals for initiating and terminating transcripts, a
promoter, an enhancer and a polyadenylation signal
(Temin, 1985; Schmid et al., 1990). Inverse repeats
exist at the ends of each LTR and always begin
with the bases, TG, and end with CA (Temin,
1985). The two LTRs and the genes are flanked by
4 to 6 bp direct repeats.
Other recurring genetic features
DNA contains many recurring features that do not
classify as tandem or interspersed repeat. A gene
cluster is a group of proximal genes having similar
sequence and often, similar structure but, different
function. There may be requirement for multiple
copies of functional genes tRNA or rRNA genes.
Copies of promoters and other regulatory regions
associated with many genes also do not classify as
repetitive DNA.
Telomeres
Telomeric DNA is G-rich consisting of the
3overhang and adjacent tandem repeat with wide
variation in length across species (reviewed in
Blackburn, 1991; Hemann and Greider, 1999). For
example, length of telomere TTAGGG repeats in
humans is 5 to15 kbp but in mouse (Mus musculus)
it is ~50 kbp. Yeast, Saccharomyces cerevisiae, has
irregular pattern of TG1-3 and repeat length of
~300 bp. A recent model suggests that this region
does a d-loop-t-loop by having the 3 overhang
invade the tandem repeat (Griffith et al., 1999).
This invasion forms a triplex DNA structure, d-
loop, and encloses a large segment of duplex DNA
in a terminal loop or t-loop. Telomere length and
size of loops is species specific (Shore, 2001).
Universal presence of this structure across species
is not clear though there may be telomeres that are
unable to form a t-loop (Griffith et al., 1999).


7
Nucleosomes
Periodicity of di-nucleotides (TATA-tetrads) or
tandem repeat with a 10 bp pattern of 5
TATAA(A/C)CG(T/C)C 3 band DNA and form
association with histone proteins (Widlund et al.,
1997). However, tandem repeats may increase or
decrease nucleosome stability. For example, a
tandem repeat having a CAG (=CTG) pattern
located close to a nucleosome increases its stability
(Wang et al., 1994; Wang and Griffith, 1995;
Godde and Wolffe, 1996). On the other hand,
tandem repeat CGG (=CCG) has no impact unless
it is methylated. Methylated CGG (=CCG) with a
limited copy number increase the nucleosome
stability while those with large copy numbers
decrease nucleosome stability (Godde et al., 1996;
Wang and Griffith, 1996).
Tandem repeats in genes
Tandem repeat hypervariability enables
identification of genes e.g. antifreeze gene and
several degenerative diseases. Repeats may help in
stability of transcripts or proteins but repeat
expansions and instability (particularly of
trinucleotide repeats) lead to neurological disorders
and cancer (Ashley and Warren, 1995; Mitas,
1997). Long stretch of CAG repeats translated into
polyglutamine tracts result in a gain-of-function,
possibly a toxin (Perutz et al., 1994; Baldi et al.,
1999). CGG, AGG and TGG repeats form
quadriplex and GAA repeats form triplex structures
that can block or reduce transcription and DNA
replication (Sinden, 1999). CGG repeats also
destabilize nucleosomes (Sinden, 1999) due to CpG
hypermethylation leading to promoter repression
and lack of gene expression (Nelson 1995, Baldi et
al., 1999). On the other hand, CTG repeats stabilize
nucleosomes and block replication forks in E. coli
(Sinden, 1999).
Evolution
Repeats have a role in genome evolution and
possibly in C-value paradox. Variation in nuclear
DNA amount in higher plants species exemplifies
this. The variation (>2500 fold) in 1C DNA content
in angiosperms ranges from 0.05 picograms in
Cardamine amara to 127.4 picograms in Fritillaria
assyriaca (Bennett, 1985). Part of such variation is
due to the numerical changes in chromosomes but
in many, there is substantial variation resulting
from amplification or deletion of DNA sequences.
Chromosomes of many monocot and dicot species
contain fast reassociating highly repetitive fraction,
slow reassociating middle repetitive fraction and
single copy sequences (Britten and Kohne, 1968;
Smith and Flavell, 1974; Flavell et al., 1977;
Katsiotis et al., 2000). These sequences may be
dispersed repetitive sequences including transpose-
able elements or tandem repeats. The retroelement
class forms sometimes upto 50% component of
plant genomes (Guidet et al., 1991; Heuros et al.,
1993; Kubis et al., 1998; Bennetzen, 2000;
Katsiotis et al., 2000; Linares et al., 2000; Ananiev
et al., 2002).
References
Ananiev EV, Vales MI, Phillips RL and Rines HW.
Isolation of A/D and C genome specific
dispersed and clustered repetitive DNA
sequences from Avena sativa. Genome. 45: 431-
441, 2002.
Ashley CT and Warren ST. Trinucleotide repeat
expansion and human disease. Annu Rev Genet.
29: 703-728, 1995.
Baldi P, Brunak S, Chauvin Y and Pedersen AG.
Structural basis for triplet repeat disorders: a
computational analysis. Bioinformatics. 15:
918-929, 1999.
Bennett MD. Interspecific variation in DNA
amount and the nucleotypic dimension. In Plant
genetics (UCLA symposium on molecular and
cellular biology), Freeling M (Ed). New York:
Alan R. Liss. 283-302, 1985.
Bennetzen JL. Transposable element contributions
to plant gene and genome evolution. Plant Mol
Biol. 42: 251-269, 2000.
Blackburn EH. Telomeres. Trends Biochem Sci. 16:
378381, 1991.
Boefe JD and Corces VG. Transcription and
reverse transcription of retroposons. Annu Rev
Microbiol. 43: 403-434, 1989.
Britten RJ and Koehne DE. Repeated sequences in
DNA. Science. 161: 529-540, 1968.
Charlesworth B, Sniegowski P and Stephan W. The
evolutionary dynamics of repetitive DNA in
eukaryotes. Nature. 371: 215-220, 1994.
Cheng Z, Dong F, Langdon T, Ouyang S, Buell
CR, Gu M, Blattner FR and Jiang J. Functional
rice centromeres are marked by a satellite repeat
and a centromere-specific retrotransposon.
Plant Cell. 14: 1691-1704, 2002.
Dai X and Rothman-Denes LB. DNA structure and
transcription. Curr Opin Microbiol. 2: 126-130,
1999.
Donis-Keller H, Green P, Helms C, Cartinhour S,
Weiffenbach B, Stephens K, Keith TP, Bowden
DW, Smith DR, Lander ES , Botstein D, Akots
G, Rediker KS, Gravius T, Brown VA, Rising
MB, Parker C, Powers JA, Watt DE, Kauffman
ER, Bricker A, Phipps P, Muller-Kahle H,
Fulton TR, Ng S, Schumm JW, Braman JC,
Knowlton RG, Barker DF, Crooks SM, Lincoln
SE, Daly MJ and Abrahamson J. A genetic
linkage map of the human genome. Cell. 51:
319-337, 1987.
Doolittle WF and Sapienza C. Selfish genes, the
phenotype paradigm and genome evolution.
Nature. 284: 601-603, 1980.
Flavell RB, Rimpau J and Smith DB. Repeated
sequence DNA relationships in four cereal
genomes. Chromosoma. 63: 205-222, 1977.
Flint J, Bates GP, Clark K, Dorman A, Willingham
D, Roe BA, Micklem G, Higgs DR and Louis
EJ. Sequence comparison of human and yeast
telomeres identifies structurally distinct
subtelomeric domains. Hum Mol Genet. 6:
1305-1314, 1997.
Gindullis F, Desel C, Galasso I and Schmidt T. The
large-scale organization of the centromeric
region in Beta species. Genome Res. 11: 253-
265, 2001.
Godde JS and Wolffe AP. Nucleosome assembly
on CTG triplet repeats. J Biol Chem. 271:
15222-15229, 1996.
Godde JS, Kass SU, Hirst MC and Wolffe AP.
Nucleosome assembly on methylated CGG
triplet repeats in the fragile X mental retardation
gene 1 promoter. J Biol Chem. 271: 24325-
24328, 1996.
Golenberg EM, Giannasi DE, Clegg MT, Smiley
CJ, Durbin M, Henderson D and Zurawski G.
Chloroplast DNA sequence from a miocene
Magnolia species. Nature. 344: 656-658, 1990.
Grabczyk E and Usdin K. Alleviating transcript
insufficiency caused by Friedreichs ataxia
triplet repeats. Nucl Acids Res. 28: 4930-4937,
2000.
Griffith JD, Comeau L, Rosenfield S, Stansel RM,
Bianchi A, Moss H and de Lange T.
Mammalian telomeres end in a large duplex
loop. Cell. 97: 503-514, 1999.
Grumbach S and Tahi F. A new challenge for
compression algorithms: genetic sequences. J
Inform Process Management. 30: 875-886,
1994.
Guidet F, Rogowsky PM, Taylor C, Song W and
Langridge P. Cloning and characterization of a
new rye-specific repeated sequence. Genome.
34: 81-87, 1991.
Harrison GE and Heslop-Harrison JS. Centromeric
repetitive DNA in the genus Brassica. Theor
Appl Genet. 90: 157-165, 1995.
Hartzog GA and Winston F. Nucleosomes and
transcription: recent lessons from genetics. Curr
Opin Genet Dev. 7: 192-198, 1997.
Hemleben V. Molekularbiologie der Pflanzen.
UTB. Gustav Fischer Verlag, Stuttgart. 1990.
Hemann MT and Greider CW. G-strand overhangs
on telomeres in telomerase deficient mouse
cells. Nucl Acids Res. 27: 3964-3969, 1999.
Henikoff S, Ahmad K and Malik HS. The
Centromere Paradox: Stable inheritance with
rapidly evolving DNA. Science. 293: 1098-
1102, 2001.
Heslop-Harrison JS, Murata M, Ogura Y,
Schwarzacher T and Motoyoshi F.
Polymorphisms and genomic organization of
repetitive DNA from centromeric regions of
Arabidopsis chromosomes. Plant Cell. 11: 31-
42, 1999.
Heslop-Harrison JS, Brandes A and Schwarzacher
T. Tandemly repeated DNA sequences and
centromeric chromosomal regions of
Arabidopsis species. Chromosome Res. 11: 241-
253, 2003.
Hueros GY and Ferrer E. A structural and
evolutionary analysis of a dispersed repetitive
sequence. Plant Mol Biol. 22: 635-643, 1993.

9
Hutchison III CA, Hardies SC, Loeb DD, Shehee
WR and Edgell MH. LINEs and related
retroposons: Long interspersed repeated
sequences in the eukaryotic genome. In Mobile
DNA. Berg DE and Howe MM (Ed). American
Society for Microbiology, Washington D.C.,
593-617, 1989.
Jarman AP and Wells RA. Hypervariable
minisatellites, recombinators or innocent
bystanders? Trends Genet. 5: 367-371, 1989.
Jeffreys AJ, Wilson V and Thein SL. Hypervariable
minisatellite regions in human DNA. Nature.
314: 67-73, 1985.
Jeffreys AJ, Neumann R and Wilson V. Repeat unit
sequence variation in minisatellites: a novel
source of DNA polymorphism for studying
variation and mutation by single molecule
analysis. Cell. 60: 473-485, 1990.
Jiang J, Birchler JA, Parrott WA and Dawe RK. A
molecular view of plant centromeres. Trends
Plant Sci. 8: 570-575, 2003.
Katsiotis A, Loukas M and Heslop-Harrison JS.
Repetitive DNA, genome and species
relationships in Avena and Arrhenatherum
(Poaceae). Ann Bot. 86: 11351142, 2000.
Kishii M, Nagaki K and Tsujimoto H. A tandem
repetitive sequence located in the centromeric
region of common wheat (Triticum aestivum)
chromosomes. Chromosome Res. 9: 417-428,
2001.
Kornberg RD and Lorch Y. Twenty-five years of
the nucleosome fundamental particle of the
eukaryote chromosome. Cell. 98: 285-294,
1999.
Kubis S, Schmidt T and Heslop-Harrison JS.
Repetitive DNA elements as a major component
of plant genomes. Ann Bot. 82: 45-55, 1998.
Kumekawa N, Hosouchi T, Tsuruoka H and Kotani
H. The size and sequence organization of the
centromeric region of Arabidopsis thaliana
chromosome 4. DNA Res. 8: 285290, 2001.
Landegren U, Kaiser R, Caskey CT and Hood L.
DNA diagnostics-molecular techniques and
automation. Science. 242: 229-237, 1988.
Linares C, Irigoyen ML and Fominaya A.
Identification of C-genome chromosomes
involved in intergenomic translocations in
Avena sativa L., using cloned repetitive DNA
sequences. Theor Appl Genet. 100: 353-360,
2000.
Macas J, Meszaros T and Nouzova M. PlantSat: a
specialized database for plant satellite repeats.
Bioinformatics. 18: 28-35, 2002.
Mitas M. Trinucleotide repeats associated with
human disease. Nucl Acids Res. 25: 2245-2254,
1997.
Nagaki K, Song J, Stupar RM, Parokonny AS,
Yuan Q, Ouyang S, Liu J, Hsiao J, Jones KM,
Dawe RK, Buell CR and Jiang J. Molecular and
cytological analyses of large tracks of
centromeric DNA reveal the structure and
evolutionary dynamics of maize centromeres.
Genetics.163: 759-770, 2003a.
Nagaki K, Talbert PB, Zhong CX, Dawe RK,
Henikoff S and Jiang J. Chromatin
immunoprecipitation reveals that the 180-bp
satellite repeat is the key functional DNA
element of Arabidopsis thaliana centromeres.
Genetics. 163: 1221-1225, 2003b.
Nagaki K, Tsujimoto H and Sasakuma T. A novel
repetitive sequence of sugar cane, SCEN
family, locating on centromeric regions.
Chromosome Res. 6: 295-302.
Nelson DL (1995). The fragile X syndromes.
Seminars in Cell Biology. 6: 5-11, 1998.
Ohyama T. Intrinsic DNA bends: an organizer of
local chromatin structure for transcription.
BioEssays. 23: 708715, 2001.
Paabo S. Ancient DNA: extraction,
characterization, molecular cloning, and
enzymatic amplification. Proc Natl Acad Sci
U.S.A. 86(6): 1939-1943, 1989.
Perutz MF, Johnson T, Suzuki M and Finch JT.
Glutamine repeats as polar zippers: their
possible role in inherited neurodegenerative
diseases. Proc Natl Acad Sci U.S.A. 91: 5355-
5358, 1994.
Pryde FE, Gorham HC and Louis EJ. Chromosome
ends: all the same under their caps. Curr Opin
Genet Dev. 7: 822-828, 1997.
Rabin M. In "Discovering Repetitions in Strings,"
Combinatorial Algorithms on Words.
Apostolico and Galil (Ed). NATO ASI Series.
12: 279-288, 1985.
Richards RI and Sutherland GR. Simple repeat
DNA is not replicated simply. Nat Genet. 6:
114-116, 1994.
Rogers JH. Long interspersed sequences in
mammalian DNA: Properties of newly identi-
fied specimens. Biochim Biophys. 824: 113-120,
1985.
Saunders VA and Houben A. The pericentromeric
heterochromatin of the grass Zingeria
biebersteiniana (2n = 4) is composed of
Zbcen1-type tandem repeats that are
intermingled with accumulated dispersedly
organized sequences. Genome. 44: 955-961,
2001.
Schmid CW, Wong EF and Deka N. Single copy
sequences in galago DNA resembles a repetitive
human retrotransposon-like family. J Mol Evol.
31: 92-100, 1990.
Schmidt T and Heslop-Harrison JS. Genomes,
genes and junk: the large-scale organization of
plant chromosomes. Trends Plant Sci. 3: 195-
199, 1998.
Schueler MG, Higgins AW, Rudd MK, Gustashaw
K and Willard HF. Genomic and genetic
definition of a functional human centromere.
Science. 294: 109-115, 2001.
Shlyakhtenko LS, Potaman VN, Sinden RR and
Lyubchenko YL. Structure and dynamics of
supercoil-stabilized DNA cruciforms. J Mol
Biol. 280: 61-72, 1998.
Shore D. Telomeric chromatin: replicating and
wrapping up chromosome ends. Curr Opin
Genet Dev. 11: 189-198, 2001.
Sinden RR. Human genetics 99: trinucleotide
repeats - Biological implications of the DNA
structures associated with disease-causing
triplet repeats. Am J Hum Genet. 64: 346-353,
1999.
Smith DB and Flavell RB. The relatedness and
evolution of repeated nucleotide sequences in
the genomes of some Gramineae species.
Biochem Genet. 12: 243-256, 1974.
Susumu O. Evolution by gene duplication.
Springer-Verlag, New York, NY. ISBN 0-04-
575015-7, 1970.
Temin HM. Reverse transcription in the eukaryotic
genome: retroviruses, pararetroviruses, retro-
transposons, and retrotranscripts. Mol Biol Evol.
2: 455-468, 1985.
Traut W. Chromosomen Klassische and molekulare
Cytogenetik. Springer-Verlag, Berlin, 1991.
Varmus HE and Brown PO. Retroviruses. In
Mobile DNA. Berg D E and Howe M M (Ed)
ASM Publications, New York. 35-56, 1989.
Vergnaud G and Denoeud F. Minisatellites:
Mutability and genome architecture. Genome
Res.10: 899-907, 2000.
Vogt P. Potential genetic functions of tandem
repeated DNA sequence blocks in the human
genome are based on a highly conserved
chromatin folding code. Hum Genet. 84: 301-
336, 1990.
Wang YH, Amirhaeri S, Kang S, Wells RD and
Griffith JD. Preferential nucleosome assembly
at DNA triplet repeats from the myotonic
dystrophy gene. Science. 265: 669-671, 1994.
Wang YH and Griffith J. Expanded CTG triplet
blocks from the myotonic dystrophy gene create
the strongest known natural nucleosome
positioning elements. Genomics. 25: 570-573,
1995.
Wang YH and Griffith J. Methylation of expanded
CCG triplet repeat DNA from fragile X
syndrome patients enhances nucleosome
exclusion. J Biol Chem. 271: 22937-22940,
1996.
Watkins PC. Restriction Fragment Length
Polymorphism (RFLP): application in human
chromosome mapping and genetic disease
research. Biotechniques. 6: 310-320, 1988.
Weiner AM, Deininger PL and Efstratiadis A.
Nonviral retroposons: genes, pseudogenes, and
transposable elements generated by the reverse
flow of genetic information. Annu Rev Biochem.
55: 631-661, 1986.
Widlund HR, Cao H, Simonsson S, Magnusson E,
Simonsson T, Nielsen PE, Kahn JD, Crothers
DM and Kubista M. Identification and
characterization of genomic nucleosome-
positioning sequences. J Mol Biol. 267: 807-
817, 1997.

11
Wolff RK, Plaeke R, Jeffreys AJ and White R.
Unequal crossing over between homologous
chromosomes is not the major mechanism
involved in the generation of new alleles at
VNTR loci. Genomics. 5: 382-384, 1991.
Yang CF, Kim JM, Molinari E and DasSarma S.
Genetic and topological analyses of the bop
promoter of Halobacterium halobium:
stimulation by DNA supercoiling and non-B-
DNA structure. J Bacteriol. 178: 840-845,
1996.
Zhong CX, Marshall JB, Topp C, Mroczek R, Kato
A, Nagaki K, Birchler JA, Jiang J and Dawe
RK. Centromeric retroelements and satellites
interact with Maize kinetochore protein
CENH3. Plant Cell. 14: 2825-2836, 2002.

12

Journal of Cell and Molecular Biology 7(2) & 8(1): 13-23, 2010 Research Article
Genetic diversity of Penicillium species isolated from various sources
in Sarawak, Malaysia
Hairul Azman ROSLAN
*, 1
, Chua Suk NGO
1
and Sepiah MUID
2
1
Department of Molecular Biology, Faculty of Resource Science and Technology, Universiti Malaysia
Sarawak, 94300 Kota Samarahan, Sarawak Malaysia
2
Department of Plant Sciences and Environmental Ecology, Faculty of Resource Science and
Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak Malaysia
(* author for correspondence; rhairul@frst.unimas.my )
Received: 26 December 2008; Accepted 30 December 2009

Abstract
Borneo Island is one of the megadiversity centres of the world and contain vast amount of flora and fauna.
The Penicillium species are among the most commonly occurring and economically important members of
micro-fungi family. In this study, morphological and random amplification polymorphic DNA (RAPD)
molecular methods were used to group and determine genetic variability and relationship among twenty
Penicillium isolates from various locations in Western part of Borneo Island that was maintained in the pure
culture collection of University Malaysia Sarawak. Comparison between morphological and molecular
method using M13 and OPD10 primers were undertaken and showed that in some cases, the groupings of
isolates based on morphological method were consistent with molecular groupings with a few exceptions.
Molecular analysis also indicated genotype variability between the isolates with little correlation with either
the origin of soil or geographical location.
Keywords: Penicillium species, morphology, RAPD, M13, variation
Malezya Sarawakta Farkl Kaynaklardan Elde Edilen Penicillium Trlerinin
Genetik eitlilii
zet
Borneo adas dnyann en ok eitlilie sahip merkezlerinden bir tanesidir ve byk miktarda flora ve
faunaya sahiptir. Penicillium (kf) trleri mikro-mantar ailesinin en sk rastlanan ve ekonomik olarak nemli
yeleri arasndadr. Bu almada Borneonun bat blgelerinden elde edilip Malezya Sarawak
niversitesindeki saf kltr koleksiyonlarnda muhafaza edilen yirmi Penicillium izolatn gruplamak ve
aralarndaki genetik eitlilii ve ilikiyi belirlemek iin, morfolojik ve polimorfik DNAnn rastgele
amplifikasyonu (RAPD) metodu kullanlmtr. M13 ve OPD10 primerleri kullanlarak morfolojik ve
molekler metodlar arasnda kyaslama yaplm ve birka istisna ile baz durumlarda, izolatlarn morfolojik
metodlara dayanarak gruplandrlmalarnn molekler gruplandrlmalar ile uyumlu olduu gsterilmitir.
Molekler analiz ayn zamanda izolatlar arasnda, topran kayna veya corafi blge ile az korelasyon
gstermesine ramen, genotip varyasyonu gstermitir.
Anahtar Szckler: Penicillium trleri, morfoloji, RAPD, M13, varyasyon

Hairul Azman ROSLAN

et al. 14

Introduction
Fungi and bacteria are the principal decomposers
that release carbon, nitrogen and other elements
that otherwise would become tied up in organic
matter (Carlile et al., 2001). Fungi play an
important role in decomposing forest litter or dung,
fruits or other organic materials. Farms fruits and
crops are vulnerable to fungal attack and 10% to
50% of the worlds harvested fruit is lost each year
due to fungal attack (Campbell and Reece, 2002).
However, fungi also have a number of practical
uses for humans. The distinctive flavours of certain
kinds of cheeses, including Roqueorti and blue
cheese, come from the fungi used to ripen them.
The soft drink industry uses Aspergillus niger to
produce citric acid. Beside that, a family of
unicellular fungi, Saccharomyces cerevisiae is the
most important fungi used in the food industries
such as in baking, alcohol brewing and wine
making. Apart from food industries, fungi are
medically valuable as antibiotic producers used to
treat infections (Thom, 1945). The Penicillium spp
are among the most commonly occurring and
economically important members of microfungi
family. Although much is known about Penicillium
physiology and mycotoxin chemistry, one of the
main challenges is in the area of rapid and reliable
identification of Penicillium in many settings
including community health care, occupational
health and food safety (Scott, 1977; Cruz-Perez et
al., 2001; Meklin et al., 2004; Portnoy et al., 2004).
Sarawak is one of the centres of mega- if not giga-
diversity region and possesses a vast potential of
undiscovered organisms including Penicillium spp.
We have isolated a number of Penicillium from
various location and sources within Sarawak. Here
we report the genotyping of Penicillium spp from
UNIMAS pure culture collections.
Materials and Methods
Collection and maintenance of fungal isolates
Twenty Penicillium isolates were obtained from
Universiti Malaysia Sarawak (UNIMAS) culture
collection. The fungi collection was isolated from
various sources in Sarawak such as from mangrove
soil, leaf litter, peat soil, soy sauce, karas and
rambutan (Table 1). A map of Sarawak state is
shown in Figure 1, indicating the sampling
locations. Fungi from stock culture were re-
cultured on Malt Extract Agar (MEA) and Czapek
Yeast Agar (CYA) in Petri dishes. Each isolate was
inoculated at three-points on each media in petri
dishes. The inoculated plates were kept at room
temperature (22-25C) for seven days.

Figure 1. Map of Sarawak state in Malaysia indicating sampling sites. 1: Karangas
Forest, 2: Mixed Dipterocarp Forest, 3: Riverine Forest, Samunsam; 4: Sematan; 5:
Kuching; 6: Kampung Bako; 7:Bako Island; 8: Kota Samarahan; 9: Bintulu

Genetic diversity of Penicillium species in Sawarak, Malaysia 15
Table 1 List of fungal collection, the substrate it was extracted from and location of the fungal (*numbers in
superscript indicate origin of isolate corresponding to Figure 1)
Fungal
isolates
UFI
(Unimas Fungi Index)
Substrate Origin
P1 1433 Mangrove soil
6
Kampung Bako
6
Kampung Bako
P3 0646 Leaf litter
1
Karangas Forest, Samunsam
P4 0687 Karas
8
Samarahan
P5 1439 Soy sauce
8
Samarahan
P6 1443 Soy sauce
8
Samarahan
6
Kampung Bako
P8 1440 Soy sauce
5
Kuching
P9 0338 Leaf litter
2
Mixed Dipterocarp Forest, Samunsam
P10 1445 Karas
8
Samarahan
P11 1446 Peat soil
8
Samarahan
4
Sematan
P13 1438 Soy sauce
8
Samarahan
P14 0630 Leaf litter
1
Karangas Forest, Samunsam
P15 1437 Peat soil
9
Bintulu
P16 0650 Leaf litter
3
Riverine Forest, Samunsam
7
Bako Island
P18 1447 Rambutan
8
Samarahan
7
Bako Island
P20 1444 Soy sauce
5
Kuching
Morphological study
A small tuft of mycelium and conidiophores were
lifted from a fairly young section of the colony and
placed on a drop of acid fuschin on a glass slide. A
cover slip was gently lowered on the specimen.
Slides were sealed with Canada balsam.
Identification of the fungi was based on culture
characteristics and conidiophore structure. Cultural
characteristics such as colony colour, texture,
colony growth, exudates, odour, zonation and
pigmentation were examined. Conidiophore
structure that includes its length, phialides, branch-
ing system and conidia were also examined. Images
were taken by using Nikon digital camera. Notes of
International Mycological Institute (IMI)
descriptions were used as reference for the
identification.
Molecular study
Isolation of DNA
DNA was extracted using a rapid extraction method
as introduced by Taylor and Natvig (1987). Genetic
material was also taken directly from mycelia
growing on CYA using clean, autoclaved tips. The
genetic materials were then mixed with 25-30l of
Tris-EDTA (TE) buffer and then vortexed. The
DNA was kept in -20C until required.
RAPD-PCR amplification
Two PCR primers, M13 (5-
TTATGTAAACGACGGCCAGT -3) and OPD10
(5-GTGATCGCAG-3), were used to amplify 20
Penicillium isolates. A negative control was
included in each amplification process. The PCR
mixture used for the RAPD in this study consisted
of 2.5l of 10X PCR buffer (Vivantis), 2.5l of
2mM dNTPs (Vivantis), 10 pmol/l M13 or 5
pmol/l OPD-10, 2 U Taq polymerase (Vivantis)
and 2.5l DNA template. Sterile distilled water was
added to total up the PCR reaction volume to 25 l.
Amplification was conducted using Biometra T-
Gradient (Biometra) with the following temperature
profile (Table 2):

Hairul Azman ROSLAN

et al. 16

Table 2. PCR amplification parameters using the M13 primers and OPD-10
Parameters Temperature and Reaction time
Initial denaturation 94C for 3 minutes
Denaturation 84C for 30 seconds
Annealing 46C / 30C for 1 minute (M13 /
OPD10)
Extension 72C for 2 minutes
Number of cycles 35
Final extension 72C for 7 minutes
Separation of DNA fragments by gel
electrophoresis
The amplicons were separated using 1.3 % (w/v)
agarose gel electrophoresis in 1X TAE (Tris-Acetic
acid-EDTA) buffer. The electrophoresis was
performed at 100V for 90 minutes. The gel was
visualised using ethidium bromide under UV
transilluminator and documented using Gel
Documentation System (BioRad).
Construction of phylogenetic relationships
Each individual RAPD band was considered as
equivalent independent characters and all the bands
were scored as present or absent for each isolate.
Banding patterns were converted into binary tables.
The data was analyzed using genetic data analysis
software, Numerical Taxonomy and Multivariate
Analysis System (NTSYSpc) version 2.2. The data
was quantified by similarity index, Jij = Cij / (ni +
nj Cij), where Jij= the number of individuals i and
j, ni= the number of bands in individual i, nj= the
number of bands in individual j. A dendogram was
generated using Unweighted Pair-Group Method
with Arimethrical Averages (UPGMA) as
described by Sneath and Sokal (1973).
Results and Discussion
Morphological groupings of Penicillium isolates
All the isolates were initially identified based on
the cultural characteristics and structure of
conidiophores using stereo and compound
microscopes. Among the 20 isolates, 4 isolates
were grouped as Clade 1, 2 isolates were grouped
as Clade 2, 3 isolates were grouped as Clade 3, 2
isolates were grouped as Clade 4, 4 isolates were
grouped as Clade 5, 2 isolates were grouped as
Clade 6, and one isolate each for Clade 7, Clade 8
and Clade 9 respectively. Table 3 shows the clades
based on morphological characters, isolate name,
substrate it was found and origin of the isolates.
The detailed morphological classifications of
selected isolates are presented in Figures 2 to 7
below representing Clade 1 to Clade 6.


Table 3 Morphological groupings of Penicillium isolates.
Clade Fungal isolates Substrate Origin
1 P1 Mangrove soil Kampung Bako
P7 Mangrove soil Kampung Bako
P14 Leaf litter Karangas Forest, Samunsam
P16 Leaf litter Riverine Forest, Samunsam
2 P2 Mangrove soil Kampung Bako
P12 Mangrove soil Sematan
3 P3 Leaf litter Karangas Forest, Samunsam
P9 Leaf litter Mixed Dipterocarp Forest,
Samunsam
P15 Peat soil Bintulu
4 P4 Karas Samarahan
P13 Soy sauce Samarahan
5 P5 Soy sauce Samarahan
P8 Soy sauce Kuching
P17 Mangrove soil Bako Island
P19 Mangrove soil Bako Island
6 P6 Soy sauce Samarahan
P20 Soy sauce Kuching
7 P10 Karas Samarahan
8 P11 Peat soil Samarahan
9 P18 Rambutan Samarahan

Figure 2. Clade 1 Penicillium P7 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA colour, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore
structure (Bi-Asymmetrical), (f) Conidia globose shape

Hairul Azman ROSLAN

et al. 18

CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at
100X magnification (Monoverticillata), (f) Conidia globose shape

100X magnification, arrow showing swollen apex, (f) Conidiophore structure at 40X
magnification (Monoverticillata), (g) Conidia globose shape


100X magnification (f) Conidiophore structure at 40X magnification (Bi-asymmetrical), (g)
Conidia globose shape

100X magnification, arrow showing lanceolate phialides, (f) Conidiophore structure at 40X
magnification (Bi-asymmetrical), (g) Conidia globose shape

Hairul Azman ROSLAN

et al. 20

40X magnification (Terverticillata), (f) Conidia elliptical shape.

Molecular groupings of Penicillium isolates
Single, simple repetitive PCR primers have been
designed to amplify the microsatelite regions of
chromosomal DNA. In most applications these
primers have provided similar levels of specificity
to those seen with RAPD, and the results have been
used to group fungi at species level (Meyer et al.,
1992; Schlick et al., 1994; Bridge et al., 1997).
Two sets of primers were used, M13 and OPD-10
primers to analyse the variations between the 20
isolates of Penicillium spp. Six isolates were
excluded from the molecular study because either
the DNA could not be isolated or amplification was
not reproducible. Each sample was repeated at least
two times to determine its reproducibility and
consistency. Bands were scored for each primer
based on the presence (1) or absence (0) of
amplicon migration in the gel. Figure 8 and Figure
9 represent the RAPD profile of M13 and OPD-10
respectively. Figure 10 is a dendogram generated
from M13 data.


Figure 8. RAPD band profile generated using M13 primer visualized on 1.3% (v/v) agarose. The
lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas) and
Lane N: 100bp DNA ladder (Seegene)

Figure 9. RAPD band profile generated using OPD10 primer visualized on 1.3% (v/v) agarose
gel. The lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas)
and Lane N: 100bp DNA ladder (Seegene)
Hairul Azman ROSLAN

et al. 22

Figure 10. Dendrogram showing relationships among 14 isolates of Penicillium species. Genetic
distances were obtained using M13 primer.

The study compared the classification
generated from morphological data and molecular
data. Comparison of the two datasets indicated that
the RAPD banding patterns were generally
consistent with morphological data. Combination of
morphological and molecular data can be used to
increase the confidence that the isolates were
grouped correctly. Previous study carried out by
Lutzoni and Vilgalys (1995) integrated molecular
and morphological data sets in order to estimate
fungal phylogenies in lichenized and non-
lichenized Omphalina species. They found that
homogeneity testing of the 28S large subunit
ribosomal DNA sequences and the morphological
characters showed that the two data sets were
sampling the same phylogenetic history. In this
study, the dendrogram generated from
amplification with M13 primer gives approximately
79% correlation with morphological data as 11 out
of 14 isolates were observed to give similar
groupings. As in the case of OPD10, there was
approximately 69% correlation with morphological
data as 9 out of 13 isolates were observed to
correlate with morphological groupings. Molecular
analysis has shown that two isolates that were
initially grouped in different cluster based on the
morphological characterization, appeared to be
identical at the genetic levels when characterized
with RAPD analysis. For isolates P5 (peat soil) and
P19 (mangrove soil), showed minor differences in
their morphological characteristics but showed to
be identical at the genetic levels.
The dendogram generated from M13 primer
(Figure 10) also showed little correlation between
isolates isolated from the same soil type for
example isolates isolated from mangrove soil P1
and P2 are grouped into Clade 1 while P2 and P12
in Clade 5. Apart from that, geographical origin
also showed little correlation as seen in isolates
isolated from soy sauce from Samarahan area P13
and P5 found in Clade 6 and Clade 7 respectively,
indicating a wide variation of Penicillium that can
be found throughout the sampling area. Spatial
variations in microfungi communities is quite
common and have been shown to be attributed to
various factors such as soil chemistry, plant
composition such as the alpine and birch
communities (Lumley et al., 2001; Mclean and
Huhta 2002; Bellis et al., 2007).
Conclusion
In this study, most isolates showed correlation and
consistency in morphological and molecular data.
Molecular analysis was also able to show that in the
instance of P5 and P19 to be genetically identical
when characterized with RAPD compared to
morphological analysis. The study also indicated
that the isolates showed considerable genotypic
variations within Penicillium spp isolated from a
wide area in Sarawak and little correlation to both
the type of soil they originated from and also
geographical location.
Acknowledgement
This work is supported by Unimas Fundamental
Research Grant.
References
Bellis TD, Kernaghan G, Widden P. Plant
community influences on soil microfungal
assemblages in boreal mixed-wood forests.
Mycologia. 99(3):356-367. 2007.
Bridge PD, Prior C, Sagbohan J, Lomer CJ, Carey
M and Buddie A. Molecular characterization of
isolates from locusts and grasshoppers.
Biodiversity and Conservation. 6:177-189.
1997.
Campbell NA, Reece JB. Biology sixth edition. pp
616-630. 2002.
Carlile MJ, Watkinson SC and Graham WG. The
Fungi. Second edition. San Diego, California:
Academic Press; 2001.
Cruz-Perez P, Buttner MP and Stetzenbach LD.
Specific detection of Stachybotrys chartarum in
pure culture using quantitative polymerase
chain reaction. Mol. Cell. Probes. 15 (23), pp.
129138. 2001.
Lumley TC, Gignac LD and Currah RS.
Microfungus communities of white spruce and
trembling aspen logs at different stages of decay
in disturbed and undisturbed sites in the boreal
mixedwood region of Alberta. Canadian J Bot.
79:7692. 2001.
Lutzoni F and Vilgalys R. Integration of
morphological and molecular data sets in
estimating fungal phylogenies. Canadian J Bot.
73(suppl. 1):S49-659. 1995.
Mclean MA and Huhta V. Microfungal community
structure in anthropogenic birch stands in
central Finland. Biology and Fertility of Soils.
35:112. 2002.
Meklin T, Haugland RA, Reponen T, Varma M,
Lummus Z, Bernstein D, Wymer LJ and Vesper
SJ. Quantitative PCR analysis of house dust can
reveal abnormal mold conditions. J. Environ.
Monit. 6 pp. 615620. 2004.
Meyer W, Moraywetz R, Borner T and Kubicek
CP. The use of DNA fingerprint analysis in the
classification of some species. Curr Genet.
21:27-30. 1992.
Portnoy JM, Barnes CS and Kennedy K. Sampling
for indoor fungi. J. Allergy Clin. Immunol. 113
pp. 189198. 2004.
Schlick A, Kuhls K, Meyer W, Lieckfeldt E,
Borner T and Messner K. Fingerprinting reveals
gamma-ray induced mutations in fungal DNA:
implications for identification of patent strains
of Trichoderma harzianum. Curr Genet. 26: 74-
78. 1994.
Scott PM. Penicillium mycotoxins. In "Mycotoxic
Fungi, Mycotoxins, Mycotoxicoses, an
Encyclopedic Handbook. Vol. 1. Mycotoxigenic
Fungi' eds. T.D. Wyllie and L.G. Morehouse.
New York: Marcel Dekker. pp. 283-356. 1977.
Sneath PHA and Sokal RR. Numerical Taxonomy.
W.H. Freeman, San Francisco; 1973.
Taylor JW and Natvig D. Isolation of fungal DNA.
In: Fuller, M.S. and Jaworski, A. (eds)
Zoosporic Fungi in Teaching and Research.
South-eastern Publishing Corporation, Athens,
Georgia. pp. 252-258. 1987.
Thom C. Mycology presents penicillin. Mycologia.
37:460-475. 1945.

24

The sensitivity of the human chromosomes to ethyl methane
sulfonate (EMS)
Songl BUDAK DLER
*,1
, Mehmet TOPAKTA
2

1
University of Nide, Department of Science and Letters, Nide, 51200, Turkey
2
University of Cukurova, Department of Science and Letters, Adana, 01330 Turkey
(* author for correspondence; budakdiler@gmail.com)
Received: 03 March 2009; Accepted 19 March 2010

Abstract
The aim of this study was to determine the chromosomal susceptibility to breakages by the mutagen Ethyl
methanesulfonate (EMS). For this reason, human peripheral blood lymphocytes were treated with varying
concentrations of EMS (5x10
-4
M, 10
-3
M and 2x10
-3
M) for 24 and 48 hours. The percentages of chromosomal
fragmentations in EMS-treated and untreated (control) cells were found to be statistically significant. In
addition, the extent of breakages of the same chromosomes correlated with the concentrations of the chemical.
The chromosomes that were fragmented most as a result of EMS-treatment in descending order were 1, 2, 6,
4, X, 7, 3, 5, 9, and 8.
Keywords: Ethyl methanesulfonate (EMS), human lymphocytes, chromosome damage, lymphocyte culture.
Etil Metansulfonat (EMS)ye nsan Kromozomlarnn Hassasiyeti
zet
Bu almann amac, mutajen Etil metansulfonat (EMS)nin insan kromozomlarnda oluturduu kromozom
krklarn incelemek ve en ok krlan kromozomlar saptamaktr. Bu ama iin hcreler, 5x10
-4
M, 10
-3
M ve
2x10
-3
M konsantrasyonlardaki EMS ile 24 ve 48 saat muamele edilmitir. 24 ve 48 saat EMS ile muamele
edilen insan periferal lenfositlerinde kontrolde ve ayn dozda, farkl kromozomlarda grlen kromozom
krlma yzdeleri bir birleriyle karlatrlm ve aralarndaki farkn istatistik bakmnda nemli olduu
bulunmutur. Ayrca ayn kromozomun farkl dozlardaki krlma yzdeleri kontroldeki krlma yzdeleriyle
karlatrlm, aradaki farkn nemli olduu saptanmtr. EMS ile muamele sonucu en fazla kromozom
krlmas 1., 2., 6., 4., X, 7., 3., 5., 9., ve 8. kromozomlarda tespit edilmitir.
Anahtar Szckler: Etil metansulfonat (EMS), insan kromozomlar, kromozom kr, lenfosit kltr.

Introduction
Ethyl methanesulfonate (EMS) is a colorless liquid.
When heated to decomposition, EMS emits toxic
fumes of sulfur oxides. EMS is reasonably
anticipated to be a human carcinogen based on
sufficient evidence of carcinogenicity in
experimental animals. EMS is used experimentally
as a mutagen, teratogen, and brain carcinogen and
as a research chemical (IARC 1974, IARC 1987,
HSDB 2000, Merck The Merck Index 1989). When
administered as a single intraperitoneal injection,
EMS induced lung tumors in male mice and lung
adenomas in mice of both sexes. Three
intraperitoneal injections of EMS in arachis oil
induced lung and kidney tumors in male mice. In a
similar study, EMS induced renal carcinomas in
Songl Budak DLER and Mehmet TOPAKTA

26
female rats and a variety of benign and malignant
tumors, including lung carcinomas, in rats of both
sexes (Ueo et al., 1981).
The tests sister chromatid exchange (SCE) and
chromosome aberrations (CA) are used to assess
the genotoxicicity of mutagenic and carcinogenic
chemicals (Perry and Evans, 1975). It was also
established that in fish cells, EMS increased SCE
and CA in a concentration dependent manner but
had no effect on their replicative index (RI)
(Maddock et al., 1986). Furthermore, Adhikari and
Grover showed that EMS caused CA in the rat bone
marrow cells (Adhikari and Grover, 1988). In 1990,
it was established that EMS enhanced SCE in the
peripheral leukocytes of humans in a concentration
dependent manner and decreased the RI in a dose-
independent manner (Topakta and Speit, 1990).
The sensitivities and clastogenicities of human
chromosomes with high gene density (1, 19 and 20)
and with low gene density (4 and 18) to
combinations of EMS and cytosine arabinoside
(Ara-C) were measured and the high gene density
chromosomes were found to be sensitive (Surralles
et al.,1997). Human peripheral blood lymphocytes
were treated with EMS (1,5x10
-4
M and 1,5x10
-3
M)
and MMS (1,5x10
-5
M and 1,5x10
-4
M) and the
treatment resulted in enhanced SCE compared to
untreated corresponding cultures (Harish et al.,
1998). it was demonstrated that the chemical EMS
enhanced SCE in whole blood and lymphocyte
cultures (During, 1985). In addition, EMS
treatment at various concentrations (5x10
-4
M, 10
-
3
M and 2x10
-3
M) of human peripheral blood
lymphocytes enhanced CA (Renczoullari and
Topakta, 2000). Therefore, we aimed at
investigating the degree of sensitivity of human
chromosomes to EMS by employing the
mutagenicity tests mentioned above.
Materials and Methods
In this study, we used peripheral blood and
lymphocytes from healthy donors, two males (23
and 24 years old), and two females (23 years old).
EMS (Sigma M-0880) was used as a test substance.
The preparation of chromosome was performed in
accordance with Evans 1984. In addition, this study
was prepared according to IPCS guidelines
(Albertini et al., 2000). Whole blood (0.2 ml) from
four healthy donors (two male and two female,
nonsmokers, aged: 23 and 24) was added to 2.5 ml
chromosome medium B (Biochrom, F5023). The
cultures were incubated at 37C for 72 h. The cells
were treated with concentrations of 5x10
-4
M, 10
-3
M
and 2x10
-3
M of EMS for 24 h (EMS was added 48
h after initiating the culture) and 48 h (EMS was
added 24 h after initiating the culture). The test
substance EMS was dissolved in ethanol (50%).
There was clear evidence that ethanol was not a
bacterial or mammalian cell mutagen in vitro
assays for chromosome aberration. Reported tests
for chromosome aberration induction in vivo were
all negative and only a minority of micronucleus
tests were positive (Phillips and Jenkinson, 2001).
Colchicine (0.06g/ml, Sigma C 9754) was added
for the last 2 h of culture. To collect the cells, the
cultures were centrifuged (1200 rpm, 15 min),
treated with hypotonic solution (0.4% KCl) for 13
min at 37
o
C, and then fixed in cold methanol:
glacial acetic acid (3: 1) for 20 min at room
temperature. The treatment with fixative was
repeated three times. Then the cells were spread on
glass slides and air dried. The slides were stained
with giemsa (5%). Well spread metaphases per
donor were examined 1000 magnification for
occurrence of different types of chromosome
aberration (CA). 100 metaphase cells with
chromosomes aberrations were examined in each
treated groups and control groups. Karyotyping was
performed using Olympus BX50 microscope and
Cytovision 3.00 Windows NT Applied Imaging
software. For statistical analysis, the ONE WAY
ANOVA and DUNCAN test was used and the
results were tabulated.
Results
In this study, the sensitivity of human
chromosomes to EMS was revealed by observing
the chromosomal breakages in each of the
chromosomes. The percentage of chromosomal
fragmentation varied among chromosomes in the
control groups. In the control groups (24h),
chromosomes 1, 2, 6, X, and 4 were found to be
sensitive to first degree fragmentation whilst
chromosomes 22, 20, 19, 18, and 11 were
insensitive (Table 1). In the solvent control groups
(ethanol, 50%) while chromosomes 2, 1, 6, 3 and 4
were sensitive to first degree fragmentation,
chromosomes 22 and 18 were completely
insensitive (Table 1).
In cells that had been treated with 5x10
-4
M of
EMS for 24 h, chromosomes 1 and 2 were the most
sensitive and chromosomes 22, 19 and 20 were the
least sensitive to fragmentation (Table 1). In those
that were treated with 10
-3
M of EMS for 24 h,
chromosomes 1 and 2 were the most fragile while
chromosomes 17, 11, 18, 21, 22, 19 and 20 were
Chromosomal fragmentation by EMS

27
the least sensitive (Table 1) (Figure1). Karyotyping
and fragmentation of human chromosomes 1, 2,
and 10. At the 2x10
-3
M concentration of EMS for
the same duration, chromosomes 6 and 1 were
sensitive to first degree while chromosomes X, 2, 5,
and 4 were less fragile. In the same cultures,
chromosomes 18, 19, 22, 20 and 21 remained
completely insensitive to the chemical (Table 1). In
cultures that had been treated for 24 h with varying
concentrations of EMS, and in all concentrations
tested, the fragmentation observed in chromosomes
2, 5-11, 13 and 16-8 was higher than that in the
control group and in the solvent control group. On
the other hand, the breakages of chromosomes 3, 12
and 19 were significant only in comparison to the
control groups. While the 4th chromosome showed
significant fragmentation at all of the concentra-
tions tested in comparison to the controls, this was
significant only at 5x10
-4
M and 10
-3
M EMS
concentrations in comparison to the solvent
controls. The fragmentation of chromosomes 14, 15
and X at EMS concentrations of 5x10
-4
M and 2x10
-
3
M was significantly higher than the control groups
and the solvent control groups. On the other hand,
there was no increase in breakages of chromosomes
1, 20 22 as a result of EMS treatment (Table 1).
As a result of treatment with EMS for 24 hours, the
chromosomal fragmentation observed in
comparison to control groups and solvent control
groups was found to be dose independent (Table 1).
In the solvent control groups chromosomes 2
and 1 are the most susceptible to breakages. There
was no breakages observed on chromosomes 22, 21,
20, 18 and 17 (Table 2).In cultures that had been
treated with 5x10
-4
M of EMS for 48 h,
chromosomes 1, 2 and 4 were the most sensitive to
fragmentation. The least sensitive were
chromosomes 20, 18 and 17, with chromosome 22
never showing fragmentation (Table 2). There was
no statistical significance in the observed breakages
among chromosomes treated with 10
-3
M of EMS
for 48 h (Table 2, Figure 2). At 2x10
-3
M
concentration of EMS chromosomes 1 and 2 are
susceptible to the first degree, with the least
sensitive being 22 and 20 (Table 2). In cultures
treated with different concentrations of EMS for 48
h, there was significant fragmentation of
chromosomes 10 and 11 while at these concentra-
tions chromosomes 17, 18 and 21 showed more
fragmentation in comparison to the control group.
On the other hand, chromosomes 1-9, 12-14, 19, 20,
22 and X did not any show any significant
fragmentation the control group (Table 2).


28

Figure 1. Karyotyping and fragmentation of Human Chromosomes 1, 2, and 10 (10
-3
M EMS Treatment for
24h,).

29

Table 1. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that
were treated with different concentrations of EMS for 24 h.
Chromoso
me
Control group Solvent Control
group
5x10
-4
M 10
-3
M 2x10
-3
M Sig
1 3.01.0a 3.71.0ab 11.72.0a 9.21.4a 9.02.7ab
_
2 2.50.9abB 4.21.4aB 10.70.9aA 8.71.9aA 8.00.4abcA **
3 1.00.7bcdefB 3.01.4abcdAB 5.00.7bcdA 5.00.4bcdA 4.71.1cdefA *
4 1.70.7abcdC 2.50.5abcdBC 7.01.4bcA 6.70.4bcA 6.50.9abcdAB ***
5 1.50.6abcdeB 1.00.7cdefB 5.01.0bcdA 5.00.7bcdA 6.50.9abcdA **
6 2.20.4abB 3.01.0abcB 7.00.7bA 7.20.4bA 9.20.7aA ***
7 1.20.4abcdeB 2.20.7abcdeB 5.00.7bcdA 6.70.9bcdA 4.20.7defA ***
8 1.20.2abcdeB 1.20.2abcdefB 4.20.4bcdeA 5.50.8bcdeA 3.70.4defA ***
9 1.20.4abcdeB 1.00.7cdefB 4.50.6bcdeA 5.50.6bcdeA 3.50.5defghA **
10 0.20.2efB 0.70.4cdefB 3.70.6bcdefA 4.50.2bcdefA 3.50.9defghA ***
11 0.00.0fC 0.50.5fC 2.20.8efghB 4.70.4efghA 2.70.7efghAB ***
12 0.70.2bcdefB 1.50.5abcdefA
B
3.00.4defgA 4.00.7defgA 3.01.0efghAB *
13 0.50.2defB 1.20.4bcdefB 4.01.2bcdefA 3.50.2bcdefA 5.20.7bcdeA **
14 0.70.4cdefB 0.70.4cdefB 3.71.1cdefA 2.20.6cdefgA
B
3.00.5efgA *
15 0.20.2efB 0.20.2fB 3.00.7defgA 1.20.7defgA
B
3.00.7efgA **
16 1.00.7bcdefB 0.20.2fB 3.50.8defA 3.50.5defA 3.50.2defgA ***
17 0.20.2efB 0.20.2fB 2.00.7efghA 1.50.2efghA 2.00.4efghA **
18 0.00.0fB 0.00.0fB 1.20.6ghA 0.70.2ghA 1.20.2ghjA **
19 0.00.0fB 0.50.2fAB 0.70.2hA 1.00.0hA 1.00.4hjA *
20 0.00.0f 0.20.2f 0.20.2 0.70.2 0.70.4j
_
21 0.20.2ef 1.00.7cdef 1.50.2fgh 2.20.6fgh 0.50.2j
_
22 0.00.0f 0.00.0f 0.70.4h 1.00.5h 0.70.5j
_
X 2.00.5abcdB 1.70.8abcdefB 5.20.6bcdA 6.00.4bcdAB 8.01.0abcA ***
Sig. *** *** *** *** ***
Key: *** P<0.001, ** P<0.01, * P<0.05
_
P>0.05
Small Letter(s): Denote(s) the significance of chromosomal breakage percentages in the controls and
differently treated cultures (same column)
Capital Letter(s): Denote(s) the significance of chromosomal breakage (same row) in the controls and
treated cultures.


30

Figure 2. Karyotyping and fragmentation of human chromosomes 1, 2, 3, 8, 9 and 21 (10
-3
M EMS Treatment
for 48h, ).

31

Table 2. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that
were treated with different concentrations of EMS for 48 h.
Chromosome Control
group
Solvent
Control
group
5x10
-4
M 10
-3
M 2x10
-3
M Sig
1 3.01.0a 4.72.1ab 8.01.9a 8.52.9 10.21.3a _
2 2.50.9ab 5.71.3a 6.72.0a 8.02.8 8.21.8ab _
3 1.00.7bcdef 2.00.7cdefg 3.72.2cde 3.21.4 4.00.9cdef _
4 1.70.7abcd 3.20.4abc 6.51.5ab 5.22.0 5.50.6bcd _
5 1.50.6abcde 2.70.4bcd 4.00.4abcd 2.51.3 3.01.0def _
6 2.20.4abc 3.20.4abc 5.20.7abc 6.02.0 7.20.8abc _
7 1.20.4abcde 1.20.9efghj 4.00.7abcd 3.21.1 3.70.6def _
8 1.20.2abcde 2.00.4bcdef 2.70.2bcde 2.71.1 3.50.2def _
9 1.20.4abcde 1.50.2cdefgh 2.50.2cde 2.50.8 3.20.2def _
10 0.20.2efB 1.20.2cdefgh
AB
1.20.6efgAB 2.51.0A 3.20.4defA *
11 0.00.0fB 1.20.4defgh
AB
1.70.4defA 2.71.1A 3.50.6defA **
12 0.70.2bcdef 0.50.5hj 1.70.4def 2.20.7 2.70.7def _
13 0.50.2def 1.70.4cdefg 2.50.6cdef 3.21.7 4.71.0bcde _
14 0.70.4cdef 1.20.2cdefgh 1.20.6efg 2.21.0 0.30.7def _
15 0.20.2efB 0.20.2jB 1.00.4efgAB 1.00.4AB 2.50.9efgA *
16 1.00.7bcdef
B
0.70.4fghjB 2.70.6cdeA
B
2.50.9AB 4.00.7cdeA *
17 0.20.2efB 0.00.0jB 0.20.2fgB 2.00.7A 2.50.6efgA **
18 0.00.0fC 0.00.0jC 0.20.2fgBC 1.00.4B 2.20.6efgh
A
***
19 0.00.0f 0.50.2fghj 1.00.0efg 1.00.7 1.70.8fgh _
20 0.00.0f 0.00.0j 0.50.5fg 1.00.5 0.70.4h _
21 0.20.2efB 0.00.0jB 1.00.5efgAB 1.50.6A 2.20.4efgh
A
**
22 0.00.0f 0.00.0j 0.00.0g 1.50.6 1.00.7gh _
X 2.00.5abcd 2.20.4bcde 4.71.2abcd 4.71.7 5.00.5bcde _
Sig *** *** ***
_
***


32
Discussion
The sensitivity of human chromosomes to EMS
treatment was measured by determining the
breakages of each chromosome. In cultures treated
with different concentrations of EMS for 24 h and
48 h, the chromosomal breakage percentages were
statistically significant compared to control groups.
In addition, the percentage of fragmentation of each
chromosome at different concentrations of EMS
was significantly higher the controls. 24h EMS
treatment caused more fragmentation than 48h
treatment due to repair of damaged cells after 24h
treatment (Franke et al., 2006). Similar findings
also reported by several groups (akmak et al.,
2004, Renczoullar et al., 2004, Bayram and
Topakta 2008).
In the control groups, chromosomes 1, 2, 6, X,
4 and 5 are susceptible to breakages to the first
degree. As can be seen, those chromosomes that are
tend to (natural) breakages in the control groups are
also susceptible to fragmentation in EMS-treated
cultures.
These results illustrate that the clastogens
cause more fragmentation of those chromosomes
that are prone to natural breakages. It has been
proposed that there may be a correlation between
the length of chromosomes and degree of
susceptibility to breakages. However, in this study,
in cultures treated with EMS, exception to this
assumption was discovered. For instance,
chromosome 3 fell into the second degree
susceptibility category in both untreated and EMS
treated cultures. This finding suggests that
chromosomal susceptibility to fragmentation may
correlate with its length as well as its composition.
Some investigators have discovered mutations
in some of the chromosomes derived from some
malignant cells, which we have found to be
sensitive to EMS treatment. The chromosomes we
found to be susceptible (chromosomes 1, 2, 3, 4, 5,
6, X, 7 and 8) were also found to be sensitive in
other studies. For instance, Bayani et al. showed by
spectral karyotyping that chromosomes 8, 7 and 20
were fragmented and rearranged in bone marrow
malignancies (Bayani et al.,2003). In cell lines
derived from stomach cancers, found that the p arm
of chromosome 17 showed partial deletion whilst
the q arm demonstrated partial duplication (Chun et
al., 2000). Selzer et al. studied neroblastomas and
their cell line derivatives, and discovered that there
was a loss in 3p and 11q whilst 17q showed
enlargement (Selzer et al., 2005). Gorunova et al.
showed that in gull bladder carcinomas,
chromosome 7 was the most frequently rearranged
one, followed by chromosomes 1, 3, 11, 6, 5 and 8.
(Gorunova et al., 1999). Morrissette et al.
discovered aberrations of chromosome 18 in
patients with partial mosaic tiresome (Morrissette et
al., 2005).
From these findings, it can be deduced that the
EMS test may prove to be indicative in some types
of cancer. Honma et al. compared the mutagenic
and cytotoxic response of the p53 tumor suppressor
gene in normal cells (TK6) and in cells with a
mutated p53 gene (WTK-1), both of which were
derived from he same ancestor. These two cell lines
were subjected to treatment with X-rays, EMS,
MMS and MMC. They found that the WTK-1 cells
were more resistant to induced cytotoxicity than the
TK6 cells, whiles their thymidine kinase (tk) gene
was more susceptible to mutation due to loss of
heterozygosity (LOH). These studies shows that
EMS can cause malignancies not only by the
cytogenetically specified chromosomal fragmenta-
tions but also by alterations at the genetic level
(Honma et al., 1997).
In our study EMS caused chromosomal
breakages that are similar to the ones described by
these investigators. It can be argued that EMS may
constitute a risk factor in malignant transformations
due to its effect on chromosomal stability.
Acknowledgments
This study was supported by the C.U. Research
Fund. Project No. FBE2002D117.
References
Adhikari N and Grover IS. Genotoxic effects of
same systemic pesticides: In vivo chromosomal
aberrations in bone marrow cells in rats.
Environmental and Molecular Mutagenesis 12:
235-242, 1988.
Albertini RJ, Anderson D, Douglas GR et al., IPCS
Guidelines for the Monitoring of Genotoxic
Effects of Carcinogenes in Humans. Mutat Res
463: 111-172, 2000.
Bayani J, Zielenska M, Pandita A et al. Spectral
Karyotyping Identifies Recurrent Complex
Rearrangements of Chromosomes 8, 17 and 20

33
in Osteosarcomas. Genes Chromosomes Cancer
36(1): 7-16, 2003.
Bayram S and Topakta M. Confirmation of the
Chromosome Damaging effects of Lamivudine
in in vitro Human Peripheral Blood
Lymphocytes. Environmantal and Molecular
Mutagenesis 49: 328-333, 2008.
akmak T, Topakta M and Kayraldiz A. The
Induction of Chromosomal Aberration by Tetra
Antibiotic in Bone Marrow Cells of Rats in vivo.
Russian Journal of Genetics 40(8): 867-870,
2004.
Chun YH, Kil JI, Suh YS et al. Characterization of
Chromosomal Aberrations in Human Gastric
Carcinoma Cell Lines Using Chromosome
Painting. Cancer Genet. Cytogenet. 119(1): 18
25, 2000.
During R. Vergleichende Untersuchungen zur
Induktion von Schwester-chromatidaustauschen
(SCEs) in Menschlichen Lymphozyten in vitro
Nach Kultivierung von Vollblut oder Isolierten
Lymphozyten. Dissertation zu Erlangung des
Doktorgrades der Medizin der Fakltt fr
Theoretische Medizin der Universitt Ulm, 80s.
1985.
Evans HJ. Human peripheral blood lymphocytes
fort he analysis of chromosome aberrations in
mutagen tests, Handbook of Mutagenicity Test
Procedures: Kilbey, B.J., Legator, M., Nichols,
W., Ramel, C. (eds.), Second edition, Elsevier
Science Publishers, BV. pp. 405-427, 1984.
Franke SI, Pra D, Giulian R et al. Influence of
orange juice in the levels and in the
genotoxicity of iron and copper. Food-Chem-
Toxicol 44(3): 425-35, 2006.
Gorunova L, Parada LA, Limon J et al. Nonrandom
Chromosomal Aberrations and Cytogenetic
Heterogeneity in Gallbladder Carcinomas.
Genes Chromosomes Cancer 26(4): 312-321,
1999.
Harish SK, Guruprasad KP, Mahmood R et al.
Adaptive Response to Low Dose of EMS or
MMS in Human Peripheral Blood Lymphocytes.
Indian J Exp Biol 36: 1147-50, 1998.
Honma M, Hayashi M, Sofuni T. Cytotoxic and
Mutagenic Responses to X-Rays and Chemical
Mutagens in Normal and p53-Mutated Human
Lymphoblastoid Cells. Mutat. Res. 4;374(1):
89-98. 1997.
HSDB Hazardous Substances Data Base. National
Library of Medicine.
http://toxnet.nlm.nih.gov/cgi-bin/sis/htmlgen?
HSDB, 2000.
IARC Same Anti-thyroid and Related Substances,
Nitrofurans and Industrial Chemicals. IARC
Monographs on the Evaluation of Carcinogenic
Risk of Chemicals to Humans, Lyon, France:
International Agency for Research on Cancer,
vol.7. pp 326, 1974.
IARC. Overall Evaluations of Carcinogenicity.
IARC Monographs on the Evaluation of
Carcinogenic Risk of Chemicals to Humans,
Lyon, France: International Agency for
Research on Cancer. Supplement 7. pp 440,
1987.
Maddock ML, Northrup H, Ellingham TJ.
Induction of Sister-Chromatid Exchange and
Chromosomal Aberrations in Hematopoietic
Tissue of a Marine Fish Following n vivo
Exposure to Genotoxic Carcinogens. Mutat Res
29: 145-147, 1986.
Merck The Merck Index, 11th ed. Rahway, NJ:
Merck&Company, Inc. 1989.
Morrissette JJ, Medne L, Bentley T et al. A Patient
with Mosaic Partial Trisomy 18 Resulting From
Dicentric Chromosome Breakage. Am J. Med.
Genet. A. 30;137(2): 208-212, 2005.
Perry P and Evans HJ. Cytological Detection of
Mutagen-Carcinogen Exposure by Sister
Chromatid Exchange. Nature 258: 121-125,
1975.
Phillips BJ and Jenkinson P. Is Ethanol Genotoxic?
A Review of the Published Data. Mutagenesis
16(2): 91-101, 2001.
Renczoullari E and Topakta M. Chromosomal
Aberrations in Cultured Human Lymphocytes
Treated with the Mixtures of Carbosulfan, Ethyl
Carbamate and Ethyl Methanesulfonate.
Cytologia 65: 83-92, 2000.
Renczoullar E, la HB, Kayraldiz A et al. The
Genotoxic Effect of the New Acaricide
Etoxazole. Russian Journal of Genetics 40(11):
1300-1304, 2004.
Selzer RR, Richmond TA, Pofahl NJ et al. Analysis
of Chromosome Breakpoints in Neuroblastoma
at Sub-kilobase Resolution Using Fine-tiling
Oligonucleotide Array CGH. Genes
Chromosomes Cancer 44(3): 305-19, 2005.
Surralles J, Sebastian S and Natarajan AT.
Chromosomes with High Gene Density are
Preferentially Repaired in Human Cells.
Mutagenesis 12: 437-442, 1997.

34
Topakta M and Speit G. Sister Chromatid
Exchange (SCE) Test Make Use of Detemine in
the Mutagen and Carcinogen. C.U. Salk Bil
Der 5: 73-84, 1990.
Ueo HR, Takaki HY, K. Sugimachi. Mammary
carcinoma induced by oral administration of
ethyl methanesulphonate. Determination of
some of the parameters affecting tumor
induction. Carcinogenesis 2(12): 1223-8, 1981.


Protective effect of pomegranate peel ethanol extract against ferric
nitrilotriacetate induced renal oxidative damage in rats
Mahgoub Mohammed AHMED
*, 1
and Safaa Eid ALI
2

1
Molecular Drug Evaluation Department, National Organization for Drug Control and Research
(NODCAR), Giza, Egypt
2
Food Technology Research Inst., Agricultural Research Center (ARC), Giza, Egypt
(* author for correspondence; dr_mahgoub1@yahoo.com )
Received: 18 December 2009; Accepted: 02 April 2010

Abstract
Pomegranate is an important source of bioactive compounds. The nephroprotective effect of pomegranate
peel ethanol extract against ferric nitrilotriacetate (Fe-NTA)-induced renal oxidative stress was studied. The
results showed that Fe-NTA enhances renal lipid peroxidation with reduction in renal glutathione content,
antioxidant enzymes, viz., glutathione peroxidase, catalase, glutathione reductase and phase-II metabolizing
enzyme, glutathione-S-transferase. It also enhances serum urea and creatinine. Treatment of rats orally with
pomegranate peel extract (100 and 200 mg/kg/day, for seven days) resulted in significant decrease in lipid
peroxidation and serum urea and creatinine levels. Renal glutathione content, glutathione-S-transferase and
antioxidant enzymes were also recovered to a significant level (P<0.05). The obtained data demonstrate that
pomegranate peel ethanol extract is a potent nephroprotective agent and suppresses Fe-NTA-induced renal
oxidative damage in rats.
Keywords: Nephroprotection; Fe-NTA; pomegranate peel ethanol extract; oxidative stress, antioxidant
enzymes, glutathione-S-transferase.
Sanlarda Nar Kabuu Etanol ztnn Ferrik Nitrilotriasetat ile ndklenen
Renal Oksidatif Hasara Kar Koruyucu Etkisi
zet
Nar nemli bir biyoaktif bileke kaynadr. Nar kabuu etanol ztnn ferrik nitrilotriasetat (Fe-NTA) ile
indklenen renal oksidatif hasara kar bbrek koruyucu etkisi allmtr. Sonular Fe-NTAnn renal
glutatyon ieriindeki antioksidan enzimler olan glutatyon peroksidaz, katalaz, glutatyon redktaz ve faz-II
metabolize eden enzim olan glutatyon-S-transferazdaki azalma ile renal lipit peroksidasyonunu artrdn
gsterdi. Ayn zamanda, Fe-NTA serum resini ve keratinini de artrr. Sanlara nar kabuu ztnn oral
muamelesi (100 ve 200 mg/kg/gn, 7 gn boyunca), lipit peroksidasyonunun ve serum re ve keratin
deerlerinin nemli lde dmesi ile sonuland. Renal glutatyon ierii, glutatyon-S-transferaz ve
antioksidan enzimler de nemli lde tekrar geri kazanld (P<0.05). Elde edilen bulgular, nar kabuu etanol
ztnn gl bir bbrek koruyucu ajan olduunu ve sanlarda Fe-NTA ile endklenen oksidatif hasar
baskladn gsterir.
Anahtar Szckler: Bbrek koruyucu; Fe-NTA; nar kabuu etanol zt; oksidatif stres, antioksidan
enzimler; glutatyon-S-transferaz

Mahgoub Mohammed AHMED and Safaa Eid ALI 36

Introduction
Pomegranate (Punica granatum L., Punicaceae), is
one of the oldest known drug. It is mentioned in the
Ebers papyrus of Egypt written in about 1550 BC
(Ross, 1999). Dried fruit peel is used for diarrhea
and to treat respiratory and urinary tract infections.
Also, pomegranate fruit peel exerted diverse
pharmacological functions as antioxidant activity
(Yunfeng et al., 2006 and Thring et al., 2009),
antifertility effect (Gujraj et al., 1960), cytotoxic
activity (Sato, 1990 and Kulkarni et al., 2007),
hepatoprotective activity (Murthy, 2002) and
hypoglycemic activity (Dhawan et al., 1977 and
Hontecillas et al., 2009). Also, pomegranate peel
ethanol extract (500 mg/kg b.wt.) has ameliorative
effect against chlorpyrifos-ethyl-induced oxidative
stress in rats (Ahmed and Zaki, 2009). Pomegranate
peel contains substantial amounts of polyphenols
such as ellagic tannins, ellagic acid and gallic acid
(Naser et al., 1996).
Iron is the most abundant metal in the human
body. Although iron is an essential nutritional
element for all life forms, iron overload may lead to
various diseases (De Freitas and Meneghini, 2001).
The iron complex of the chelating agent
nitrilotriacetic acid is nephrotoxic (Khan and
Sultana, 2005). Intraperitoneal injection of Fe-NTA
induces renal proximal tubular damage associated
with oxidative damage that eventually leads to a
high incidence of renal cell carcinoma in rodents
after repeated administration (Okada and
Midorikawa, 1982). Intraperitoneally injected of
ferric nitrilotriacetate (Fe-NTA) is absorbed into
portal vein through mesothelium and passes into
circulation via the liver (Umemura et al., 1990).
The low molecular weight Fe-NTA is easily filtered
through the glomeruli into the lumen of the renal
proximal tubules where Fe
3+
-NTA is reduced to
Fe
2+
-NTA by the glutathione degradation products
cysteine or cysteinylglycine (Taso and Curthoys,
1980). In the brush border surface of the renal
proximal convoluted tubules, -glutamyl
transpeptidase hydrolyses glutathione to
cysteinylglycine that is rapidly degraded to cysteine
and glycine by dipeptidase (Khan and Sultana,
2005). Cysteinylglycine and cysteine

are the
proposed thiol reductants that reduce Fe
3+
-NTA to
Fe
2+
-NTA. The auto-oxidation of Fe
2+
-NTA
generates superoxide radicals (O
.-
2
) which
subsequently potentiate the iron catalysed Haber-
Weiss reaction to produce hydroxyl radical (OH
.
),
leading to induction of lipid peroxidation and
oxidative DNA damage (Umemura et al, 1990 and
Khan and Sultana, 2005).
For the present study, we prepared the ethanol
extract (80%) of the pomegranate peel which
exerted the highest antioxidant effect in vitro. The
objective of the study was to determine the possible
effect of prophylactic treatment with pomegranate
peel extract on Fe-NTA induced renal oxidative
damage in rats.
Materials and methods
Plant material
Pomegranate fruit peel purchased from local market
was dried and powdered before extraction.
Plant extract
Powdered plant material (500g) was repeatedly
extracted with 2000 ml solvents of increasing
polarity starting with benzene, chloroform, ethyl
acetate, ethanol (80%) and distilled water. The
percolation time for each solvent was 24h. The
extracts were filtered, concentrated and freeze
dried. The residues yielded for each solvent were
stored at 4
o
C. The ethanol extract (80%) was used
for further study after preliminary in vitro tests viz.
lipid peroxidation, deoxyribose and DPPH assays.
Chemicals
Ferric nitrate, NTA disodium salt, reduced
glutathione, 1-chloro-2,4-dinitrobenzene (CDNB),
bovine serum albumin, 1,2-dithio-bis-nitrobenzoic
acid (DTNB) and thiobarbituric acid (TBA) were
obtained from Sigma Chemical (St Louis, USA).
All solvents used were HPLC grade (Merck,
Darmstadt, Germany).
Total phenolics
Total phenolics in the pomegranate peel ethanol
extract were determined according to
Jayaparakashsa et al. (2001) using Folin-Ciocalteu
reagent. Four hundred microlitres of sample were
taken in test tubes; 1.0 ml of FolinCiocalteu
reagent (diluted 10-fold with distilled water) and
0.8 ml of 7.5% sodium carbonate were added. The
tubes were mixed and allowed to stand for 30 min
Pomegranate peel extract against renal oxidative damage 37
and the absorption at 765 nm was measured against
a blank, which contained 400 l of ethanol in place
of sample. The total phenolic content was
expressed as gallic acid equivalents in mg/g of
ethanol extract.
Animals
Albino male rats (17030 g) were used in the
present study. The rats were obtained from the
animal house of the National Organization for Drug
Control and Research (NODCAR), Egypt. The
animals were kept under standard laboratory
conditions of light/dark cycle (12/12h) and
temperature (252C). The rats were allowed food
and water ad libitum. They were provided with a
nutritionally adequate standard laboratory diet.
Animals diet
The basal diet consists of casein 10%, cotton seed
oil 4%, salt mixture 4%, vitamin mixture 1%,
carbohydrates (sucrose, starch 1:1) 80.8% and
choline chloride 0.2% (American Institute of
Nutrition, 1980).
Preparation of Fe-NTA solution
The Fe-NTA solution was prepared as described in
Deiana et al. (2001) and Khan and Sultana (2005),
ferric nitrate and NTA disodium salt were dissolved
in distilled water to form a 300 and 600 mM
solution, respectively. The two solutions were
combined in a volume ratio of 1:2 with magnetic
stirring at room temperature and the pH was
adjusted to 7.4 with sodium bicarbonate.
Experimental design
Thirty albino rats were randomly allocated to five
groups of six rats each:
Group 1 received only saline injection
intraperitoneally at a dose of 10 ml/kg body weight.
Group 2 received only a single intraperitoneal
injection of Fe-NTA solution at a dose of nine mg
Fe/kg body weight (Athar and Iqbal 1998).
Group 3 received pomegranate peel extract by
gavage once daily for seven days at a dose of 100
mg body weight, p.o. (Parmar and Kar, 2008).
Group 4 received pomegranate peel extract once
daily for seven days at a dose of 200 mg/kg body
weight, p.o. (Parmar and Kar, 2008).
After the last treatment with pomegranate peel
extract, the animals of group 2, 3 and 4 received a
single intraperitoneal injection of Fe-NTA at a dose
level of 9mg Fe/kg body weight.
Group 5 received pomegranate peel extract orally
once daily for seven days at a dose of 200 mg/kg
body weight (Parmar and Kar, 2008). We used the
high dose of pomegranate peel ethanol extract (200
mg/kg b.w. p.o.) to study its effect on kidney.
All rats were sacrificed 12 h after the treated
with Fe-NTA. Blood was collected and the
separated serum was used for the estimation of
creatinine (Bartless et al., 1972) and urea (Patton
and Crouch, 1977).
Post-mitochondrial supernatant and microsomal
fraction preparation
Kidneys were removed quickly and washed in cold
isotonic saline. The kidneys were homogenized in
50 mM phosphate buffer (pH 7) using an electronic
homogenizer to prepare 10% w/v homogenate. The
homogenate was centrifuged at 3000 rpm for 10
min at 4
o
C by cooling ultracentrifuge (model Sigma
3K 30) to separate the nuclear debris. The aliquot
so obtained was used at 12000 rpm for 20 min at
4
o
C to obtain post-mitochondrial supernatant
(PMS), which was used as a source of enzymes
(Khan and Sultana, 2005). A portion of the PMS
was centrifuged for 60 min at 34000 rpm at 4
o
C.
The pellet was washed with phosphate buffer (50
mM pH 7).
Estimation of reduced glutathione (GSH) in PMS
Reduced GSH in mitochondria was determined by
measuring the rate of formation of chromophoric
product in a reaction between 5,5-dithiobis-2-
(nitrobenzoic acid) (DTNB) and free sulphydryl
groups, such as GSH, at 412 nm as described by
Ellman (1959).
Estimation of Lipid peroxidation (LPO) in
micrososmal fraction
The measurement of microsomal fraction lipid
peroxide by a colorimetric reaction with
thiobarbituric acid was done as described by
Okhawa et al. (1979), and the determined lipid
peroxide is referred to as malondialdehyde. Briefly,
in a test tube, 2.5 ml of 20% trichloroacetic acid
solution and 1ml of 0.67% thiobarbituric acid
solution were added to the samples. The color of
thiobarbituric acid pigment was developed in a
water bath at 100
C for 30 min. After cooling with

tap water to room temperature, 4ml n-butanol was
added and shaken vigorously. After centrifugation,
the color of butanol layer was measured at 535 nm.
Assay for glutathione-S-transferase (GST) activity
in PMS
Glutathione-S-transferase activity was assayed by
the method of Habig et al. (1974). The method is
based on the rate of conjugate formation between
GSH and 1-chloro-2,4-dinitrobenzene (CDNB).
The absorbance change was recorded at 340 nm
and the enzyme activity calculated as nmol CDNB
conjugates formed/min/mg protein.
Assay for glutathione peroxidase (GPx) activity in
PMS
Glutathione peroxidase activity was assayed by the
method of Mohandas et al. (1984). The change in
absorbance was recorded spectrophotometrically at
340 nm. GPx activity was expressed as nmol
NADPH oxidized/min/mg protein.
Assay for glutathione reductase (GR) activity in
PMS
Glutathione reductase activity was determined by
the method of Carlberg and Mannervik (1975). GR
was assayed by following the oxidation of NADPH
at 340 nm at 37
o
C. GR activity was expressed as
nmol NADPH oxidized/min/mg protein.
Assay for catalase (CAT) activity in PMS
CAT activity measurement in PMS was measured
by the method of Takahara et al. (1960). The
reduction rate of H
2
O
2
was followed at 240 nm for
30 s at room temperature. CAT activity was
expressed in nmol H
2
O
2
consumed/min/mg protein.
Assay for glucose-6-phosphate dehydrogenase
(GPD) activity in PMS
The activity of glucose-6-phosphate dehydrogenase
was determined according to the method of Zaheer
et al. (1965). The changes in absorbance were
recorded at 340 nm and enzyme activity was
calculated as nmol NADP reduced/min/mg protein.
Estimation of protein concentration
The protein concentration in all samples was
determined by the method of Lowry et al. (1951).
Statistical analysis
The results are expressed as MeanSEM. The
collected data were statistically analyzed by the
least significant differences (LSD) at the level 5%
of the probability procedure according to Snedecor
and Cochran (1980).
Results
Effect of pomegranate peel extract on renal toxicity
markers
The effect of pre-treatment of rats with
pomegranate peel extract on Fe-NTA-induced
enhancement in the level of serum creatinine and
urea are shown in Table (1). Fe-NTA treatment
leads to about 147% and 303% enhancement in the
values of creatinine and urea, respectively, as
compared with saline-treated group. Prophylaxis
with pomegranate peel extract at both doses
resulted in 28-45% and 48-88% reduction in the
values of serum creatinine and urea respectively as
compared with Fe-NTA-treated group.
Effect of pomegranate peel extract on glutathione
metabolism
Table (2) shows the effect of pretreatment of
rats with pomegranate peel extracts on Fe-NTA-
mediated renal glutathione content and on the
activities of its metabolizing enzymes, viz,
glutathione-S-transferase and glutathione reductase.
Treatment with Fe-NTA alone resulted in the
depletion of renal glutathione and reduction in the
activities of glutathione-S-transferase and
glutathione reductase by 48%, 55% and 46%
respectively, as compared with saline-treated
group. However, pretreatment of animals with
pomegranate peel extract at 100 and 200 mg/kg
body weight resulted in the recovery by 79-83%,
46-73% and 40-72% respectively, as compared
with Fe-NTA-treated group.


Table 1. Effect of pomegranate peel ethanol extract on Fe-NTA-induced enhancement of serum
creatinine and urea in rats Values MeanSEM (n=6 animals).
a
p<0.05, (Students t test)
significantly different from saline treated group.
b
p<0.05, significantly different from Fe-NTA-
treated group. P.E., pomegranate Extract.
Treatment groups
Creatinine
mmol/L
Urea
mmol/L
Saline 36.25.3 8.92.1
Fe-NTA (9 mgFe/kg b.w.) 89.47.2
a
35.94.1
a
P.E. (100 mg/kg b.w.) + Fe-NTA (9 mg Fe/kg b.w) 64.38.4
b
19.63.9
b
P.E. (200 mg/kg b.w) + Fe-NTA (9 mgFe/kg b.w.) 46.17.2
b
11.52.9
b
P. E. (200 mg/kg b.w.) 38.24.1 8.52.3
Table 2. Effect of pomegranate peel ethanol extract on Fe-NTA-mediated depletion of renal
glutathione (GSH) content and decreased in the activities of glutathione-S-transferase (GST) and
glutathione reductase (GR). Values are MeanSEM (n=6 animals).
a
b
p<0.05, significantly different from Fe-NTA-
treated group. P.E., pomegranate Extract.
Treatment groups GSH
(nmol GSH/g
tissue)
GST
(nmol CDNB conjugated
formed/min/mg protein)
GR
(nmol NADPH
oxidized/min/mg
protein)
Saline 0.5260.03 220.94.9 280.710.9
Fe-NTA (9 mgFe/kg b.w.) 0.2730.02
a
99.89.2
a
151.46.8
a

P.E. (100 mg/kg b.w.) +
Fe-NTA (9 mg Fe/kg b.w) 0.4880.03
b
146.54.6
b
212.615.8
b

P.E.(200 mg/kg b.w) + Fe-
NTA (9 mg Fe/kg b.w.) 0.5010.04
b
172.78.7
b
260.114.6
b

P.E. (200 mg/kg b.w.) 0.5620.02 225.217.2 288.612.3

Effect of pomegranate peel extract on renal
antioxidant enzymes and lipid peroxidation
The effect of prophylactic treatment with
pomegranate peel extract on Fe-NTA-induced
reduction in the activities of renal antioxidant
enzymes and enhancement in microsomal lipid
peroxidation is shown in Table 3. Fe-NTA alone
treatment caused reduction in the activities of renal
antioxidant enzymes such as catalase, glutathione
peroxidase and glucose-6-phosphate dehydrogenase
by 71%, 51% and 54% and enhancement in lipid
peroxidation level by 49% respectively as
compared to saline-treated group. Treatment with
pomegranate peel extract at two doses 100 and 200
mg/kg body weight caused the recovery of the
above enzymes by 117-170%, 62-95% and 55-
108%, and reduction in lipid peroxidation by 23-
33% as compared with Fe-NTA-treated group.


Table 3. Effect of pomegranate peel ethanol extract on Fe-NTA-induced reduction in the activity of
renal antioxidant enzymes (CAT, GPx and GPD) and enhancement in the level of microsomal lipid
peroxidation (LPO) in rats Values are MeanSEM (n=6 animals).
a
b
p<0.05, significantly different from Fe-NTA-treated
group. P.E., pomegranate Extract.
Treatment groups CAT
(nmol H
2
O
2

consumed/min/mg
protein)
GPx
(nmol NADPH
oxidized/min/mg
protein)
GPD
(nmol NADP
reduced/min/mg
protein)
LPO
(nmol MDA
formed/mg
protein)
Saline 172.311.3 250.59.9 50.33.9 4.90.34
Fe-NTA
(9 mgFe/kg b.w.) 50.55.1
a
122.710.8
a
23.24.1
a
7.310.62
a

P.E. (100 mg/kg
b.w.) + Fe-NTA (9
mg Fe/kg b.w) 109.4+6.9
b
199.312.4
b
36.13.1
b
5.60.19
b

P.E. (200 mg/kg
b.w) + Fe-NTA (9
mg Fe/kg b.w.) 136.68.9
b
239.58.6 48.38.8
b
4.90.29
b

P.E. (200 mg/kg
b.w.) 189.217.2 272.317.2 56.54.9 3.80.31

Discussion
Reactive oxygen species (ROS) are generated by
many redox processes that normally occur in
metabolism of aerobic cells. If not eliminated, ROS
can attack important biological molecules, such as
lipids, proteins, DNA, enzymes, and RNA. Thus,
ROS are involved in a number of degenerative
diseases such as cancer, cirrhosis, diabetes, and
Alzheimers Disease (Halliwell and Gutteridge
1986).
Plants, vegetables, herbs and spices used in folk
and traditional medicine have been accepted
currently as one of the main sources of chemo
preventive drug discovery and development
(Aruoma, 2003). It has been observed that many
plant polyphenols, such as ellagic acid, catechins,
and chlorogenic, caffeic and ferulic acids act as
potent antioxidant, antimutagenic and
anticarcinogenic agents (Ayrton et al., 1992 and
Bu-Abbas et al., 1993). Also, carob polyphenols
has nephroprotective effect against cisplatin
(Ahmed, 2010). Nacr et al. (1996) have reported
that pomegranate peel contains ellagic acid,
ellagitannins and gallic acids. The presence of these
polyphenols in the pomegranate peel may be
responsible for antioxidant and anticarcinogenic
effect of peel extracts (Gil et al., 2000). Also, in
this study the ethanol extract had 210.67.3 mg/g
total phenolics, gallic acid equivalents. Hence, it
can be suggested that the observed
nephropreventive activity of pomegranate peel
ethanol extract in our study due to the presence of
these compounds.
The renal antioxidant status, such as GR, CAT,
GPx activities and GSH concentration are
significantly decreased in the Fe-NTA-treated
group of animals compared to saline treated group.
The decline of antioxidant status partially explains
the mechanism of nephrotoxicity induced by Fe-
NTA.
Pomegranate peel ethanol extract ameliorated
Fe-NTA-induced inhibition of the activity of
antioxidant enzymes, viz., GR, CAT, GPx,
activities and phase-II metabolism enzyme GST.
Pomegranate peel extract has established
antioxidant properties that might have counteracted
the oxidant effects of Fe-NTA. Many
environmental toxicants such as pesticides require
metabolism to their fully toxic forms. They are
often metabolized to proximate toxicants by phase I
enzymes, e.g., cytochrome P450 which catalyze
oxidative reactions. The oxidized metabolites of
potentially toxic xenobiotics are then detoxified by
Phase II metabolizing enzymes into the forms that
are relatively inert and more easily excreted
(Talalay et al., 1995).
GSH depletion increases the sensitivity of organ
to oxidative and chemical injury. Studies with a
number of models show that the metabolism of
xenobiotics often produced GSH depletion
(Mitchell et al., 1973 and Ahmed and Zaki, 2009).
The depletion of GSH, also, seems to be the prime
factor that permits lipid peroxidation in the Fe-
NTA treated group. Pretreatment of pomegranate
peel extract reduced the depletion of GSH levels
and provided protection to the kidney. The
protection of GSH is by forming the substrate for
GPx activity that can react directly with various
aldehydes produced from the peroxidation of
membrane lipid. Pomegranate peel extract
pretreatment also reduced the elevated levels of
serum urea and ceatinine that are marker
parameters of kidney toxicity.
In conclusion, we can say that, the high
antioxidant and nephropreventive effect of the
pomegranate peel extract appeared to be attributed
to its high phenolics content. The mechanism of
action of pomegranate peel extract may be through
induction of various antioxidant and phase II
enzymes, and scavenging reactive oxygen species.
Thus our data suggest that pomegranate peel
ethanol extract is a potent nephropreventive agent.
Further work is required for the isolation and
characterization of individual phenolic compounds
present in peel ethanol extract and to determine the
mechanisms involved in the nephropreventive
effect of pomegranate peel extract.
References
Ahmed MM and Zaki NI. Assessment the
ameliorative effect of pomegranate and rutin on
chlorpyrifos-ethyl-induced oxidative stress in
rats. Nature and Science. 7(10): 49-61, 2009.
Ahmed MM. Biochemical studies on
nephroprotective effect of carob (Ceratonia
siliqua L.) growing in Egypt. Nature and
Science. 8 (3): 41-47, 2010.
Ajaikumar K.B, Asheef, M, Babu BH and
Padikkala J. The inhibition of gastric mucosal
injury by Punica granatum L. (pomegranate)
methanolic extract. Journal of Ethnopharma.
96: 171176, 2005.
American Institute of Nutrition. Report of the
American Institute of Nutrition. Ad Hoc
Committee J Nutr. 110: 1340-1348, 1980.
Aruoma OI. Methodological considerations for
characterizing potential antioxidant actions of
bioactive components in plant foods. Mutation
Research. (523-524): 9-20, 2003.
Athar M and Iqbal M. Ferric nitrilotriacetate
promotes N-diethylnitrosamine-induced renal
tumorigenesis in the rat: implications for the
involvement of oxidative stress.
Carcinogenesis. 19 (6):1133-1139, 1998
Ayrton AD, Lewis DF, Waker R. and Ioannides C.
Antimutagenicity of ellagic acid towards the
food mutagen IQ: investigation into possible
mechanisms of action. Food and Chemical
Toxicology, 3D: 289-295, 1992.
Bartles H, Bohmer M and Heieri C. Serum
keratinin bestmmung ohno enteeissen. Clinical
Chimca Acta. 37: 139-197, 1972.
Bu-Abbas A, Clifford MN, Walker R and Ioannides
C. Marker antimutagenic potential of aquous
green tea extracts: Mechanism of action.
Mutagenesis. 9: 325-331, 1994.
Carlberg I and Mannervik B. Glutathione level in
rat brain. J Biological Chemistry. 250: 4480-
4575, 1975.
De Flora S and Ramel C. Mechanism of inhibition
of mutagenesis and carcinogenesis: classifica-
tion and overview. Mutation Research. 202:
285-306, 1988.
De Freitas JM and Meneghini R. Iron and its
sensitive balance in the cell. Mutation Research.
475: 153-159, 2001.
Deiana M, Aruma OI, Rosa A, Crobu V, Piga R
and Derri MA. The effect of ferric-
nitrilotriacetic acid on the profile of
polyunsaturated fatty acids in the kidney and
liver of rats. Toxicol Letters. 123: 125-133,
2001.
Dhawan BN, Patnaik GK, Rastogi RP, Singh KK
and Tandon JS. Screening of Indian plants for
biological activity. Indian J. Exp. Biol. 15: 208-
219, 1977.
Ellman GL. Tissue sulfhydryl groups. Arch
Biochem Biophys. 82: 70-77, 1959.
Gil MI, Tomas-Barberan FA, Hess Pierce B,
Holcroft, DM. and Kader AA. Antioxidant
activity of pomegranate juice and its
relationship with phenolic composition and
processing. Journal of Agricultural and food
chemistry. 48: 4581-4589, 2000.
Goldstein RS and Mayor GH. The nephrotoxicity
of cisplatin. Life Sci. 32: 685-690, 1983.
Gujraj ML, Varma DR and Sareen KN. Oral
contraceptives. Part 1. Preliminary observations
on the antifertility effects of some indigenous
drugs. Indian J Med Res. 48: 46-51, 1960.
Habig WH, Pabst MJ and Jakoby WB. Glutathione-
S-transferase. The first enzymatic step in
mercapturic acid formation. J Biol Chem. 249:
7130-7139, 1974.
Halliwell, B. and Gutteridge, J.M.C. Iron and free
radicals: two aspects of antioxidant protection.
Trends Biochem. Sci. 11: 372-375, 1986.
Hontecillas R, O'Shea M, Einerhand A, Diguardo
M, Bassaganya-Riera J. Activation of PPAR
gamma and alpha by punicic acid ameliorates
glucose tolerance and suppresses obesity-related
inflammation. J Am Coll Nutr. 28(2):184-95,
2009.
Khan N and Sultana S. Chemomodulatory effect of
Ficus racemosa extract against chemically
induced renal carcinogenesis and oxidative
damage response in Wistar rats. Life Sciences.
77(11):1194-210, 2005.
Kulkarni AP, Mahal HS, Kapoor S, Aradhya SM.
In vitro studies on the binding, antioxidant, and
cytotoxic actions of punicalagin. J Agric Food
Chem. 55(4):1491-500, 2007.
Li Y, Guo C, Yang J, Wei J, Xu J and Cheng S.
Evaluation of antioxidant properties of
pomegranate peel extract in comparison with
pomegranate pulp extract. Food Chemistry. 96:
254-260, 2006.
Lowry OH, Roseborough. NJ, Farr AL, and
Randall RL. Protein measurement with phenol
reagent. Journal of Biological Chemistry. 193
(1): 265-275, 1951.
Mitchell JR, Jollow DJ, Potter WZ, Gillete JR and
Brodie BB. Acetaminophen induced hepatic
necrosis. Protective role of glutathione. J.
Pharmacol. Exp. Ther. 187: 211-215, 1973.
Mohandas M, Marshall JJ, Duggin, GG, Hovath JS
and Tiller D. Differential distribution of
glutathione and glutathione related enzymes in
rabbit kidney. Cancer Research. 44: 586-5091,
1984.
Murthy KN, Jayaprakasha GK and Singh RP.
Studies on antioxidant activities of pomegranate
peel extract using in vivo models. J Agri Food
Chem. 50: 4791-4795, 2002.
Nasr CB, Ayed N and Metche M. Quantitative
determination of polyphenolic content of
pomegranate peel. Zeitschrzfi fur lebensmittel
unterschung und forschung. 203: 374-378,
1996.
Ohkawa H, Ohishi N and Nagi K. Assay of lipid
peroxides in animal tissue by thiobarbituric acid
reaction. Anal Biochem. 95: 251-358, 1979.
Okada S and Midorikawa O. Induction of rat renal
adenocarcinoma by ferric nitrilotriacetate (Fe-
NTA). Japanese Archives of International
Medicine. 29: 485-491, 1982.
Parmar HS, Kar A. Medicinal values of fruit peels
from Citrus sinensis, Punica granatum, and
Musa paradisiaca with respect to alterations in
tissue lipid peroxidation and serum
concentration of glucose, insulin, and thyroid
hormones. J Med Food. 11(2):376-381, 2008.
Patton CJ and Crouch SR. Spectrophotometric and
kinetics investigation of the Berthelot reaction
for the determination of ammonia. Analytical
Chemistry. 49: 464-469, 1977.
Ross IA. Medicinal plants of the world. Humana
Press, Totowa, New Jersey. 273-281, 1999.
Sato A. Cancer chemotherapy with oriental
medicine. 1. Antitumor activity of crude drugs
with human tissue cultures, in In vitro
screening. Int J Orient Med. 15 (4): 171-183,
1990.
Snedecor GW and Cochran WG. Statistical
methods. 7th
ed
. IOWA Stat Univ. Press, IOWA,
USA. 420, 1980.
Takahara S, Hamilton BM, Nell JV, Ogura, Y and
Nishimura ET. Hypocatalasemia, a new genetic
carrier state. J Clin Invest. 29: 610-619, 1960.
Talalay P, Fahey JW, Holtzclaw WD, Prestera, T
and Zhang Y. Chemoprotection against cancer
by phase II enzyme induction. Toxicology
Letters. (82-83): 173-179, 1995.
Thring TS, Hili P, Naughton DP. Anti-collagenase,
anti-elastase and anti-oxidant activities of
extracts from 21 plants. BMC Complementary
and Alternative Medicine. 9: 17-27, 2009.
Tsao B and Cuthoys NP. The absolute asymmetry
of prientation of gamma glutamyl
transpeptidase and amino-peptidase on the
external surface of the rat renal brush border
membrane. J Biological Chemistry. 255: 7708-
7711, 1980.
Umemura T, Sai K, Takagi, A, Hasegawa R and
Kurokawa Y. Oxidative DNA damage, lipid
peroxidation and nephrotoxicity induced in the
kidney after ferric nitilotriacetate administra-
tion. Cancer Letter. 54(1-2): 95-100, 1990.
Zaheer N, Tiwari KK and Krishnan PS. Exposure
and solubilization of hepatic mitochondrial
shunt dehydrogenases. Archive of Biochemistry
and Biophysics. 109: 646-648, 1965.

44

Molecular and cytogenetic evaluation of Y chromosome in

spontaneous abortion cases
Glah KO
1
, Korkut ULUCAN
*,1
, Deniz KIRA
2
, Deniz ERGE
1
, Tufan TARCAN
3

and A. lter GNEY
1
.
1
Marmara University, Faculty of Medicine, Department of Medical Genetics, Istanbul, Turkey.
2
Yeditepe University, Faculty of Medicine, Department of Biochemistry, Istanbul Turkey.
3
Marmara University, Faculty of Medicine, Department of Urology, Istanbul, Turkey.
(* author for correspondence; korkutulucan@hotmail.com)
Received: 21 April 2010; Accepted: 05 May 2010

Abstract
Infertility is defined as not being able to get pregnant despite having frequent, unprotected sex for at least a year.
Several conditions contribute to infertility and 50% is considered to be caused by a male-related factor.
Spontaneous abortion (SAB) is noninduced embryonic or fetal death or passage of products of conception before
the 20th week of pregnancy and is the most common complication of early pregnancy. SAB can occur by
teratogenic factors, advanced maternal age, genetic factors such as Y chromosome microdeletions and
chromosomal anomalies. In order to investigate the etiology of recurrent pregnancy loss (RPL) and to develop an
appropriate therapeutic strategy, it is necessary to ascertain the molecular and cytogenetic basis of these defects. In
this study, we aimed to reveal the relations between male infertility, Y chromosome microdeletions and SAB.
Thirty couples with a spontaneous abortion history and thirty fertile men were recruited to the study. All the
women were 46, XX and men were 46, XY. We couldnt detect any Y chromosome microdeletion that could be the
reason for SAB. In order to evaluate effect of chromosome anomalies and Y chromosome microdeletions on SAB,
further studies with increased number of cases and controls need to be carried on.
Keywords: Infertility, spontaneous abortion, Y chromosome microdeletions.
Spontan dk vakalarnda Y kromozomunun molekler ve sitogenetik incelemesi
zet
iftlerin ocuk sahibi olma isteklerine ve dzenli cinsel ilikiye ramen, bir yl ierisinde gebelik elde
edilmemesine infertilite (ksrlk) ad verilmektedir. nfertiliteye etki eden birok faktr bulunmaktadr ve bunlarn
%50sinde etken erkek infertilitesidir. Gebeliin ilk 20 haftas iinde, dardan herhangi bir mdahale olmadan,
doal nedenlerle, embriyo veya fetus ve eklerinin tamamnn veya bir ksmnn uterus kavitesi dna atlmas
olayna spontan dk (abortus) denilmektedir ve gebeliin erken dneminde en ok gzlenen komplikasyondur.
Spontan dkler, teratojenik faktrler, ileri anne ya gibi nedenlerin yannda, Y kromozomu mikrodelesyonlar ve
kromozomal anomaliler gibi genetik faktrlere bal olarak da oluabilmektedir. Tekrarlayan gebelik kayplarnn
etyolojisini belirlemek ve uygun bir tedavi yntemi gelitirmek iin bu defektlerin molekler ve sitogenetik
temellerinin incelenmesi gerekmektedir. Bu almada, erkek infertilitesi, Y kromozom mikrodelesyonlar ve
spontan dkler arasndaki ilikinin ortaya karlmas amalanmtr. Spontan dk hikayesi bulunan 30 ift ve
fertil 30 erkek almaya dahil edilmitir. almaya dahil olan bireylerin kromozom analizi sonularna gre, tm
kadnlar 46,XX ve erkekler ise 46,XYdir. almamzda spontan dklere neden olabilecek herhangi bir Y
kromozom mikrodelesyonu belirlenememitir. Kromozom anomalilerinin ve Y kromozomu mikrodelesyonlarnn
spontan dkler zerindeki etkisinin deerlendirilebilmesi iin vaka ve kontrol saylarnn arttrlarak baka
almalar yaplmas gerekmektedir.
Anahtar Szckler: nfertilite, spontan dk, Y kromozom mikrodelesyonu.

Glah Ko et. al.

46

Introduction
Infertility is the inability of being pregnant after
one year of unprotected sexual intercourse.
Infertility comprises up to 15% of couples of
reproductive age in which 50% is caused by a male
factor (Noordam and Repping, 2006). Several
factors contribute to male infertility, such as gene
defects, hormonal milieu, chromosomal aberrations
and genital infections (Stipoljev et al., 2006).
Genetic factors are considered to affect almost 30%
of severe male infertility cases (Noordam and
Repping, 2006). The diagnosis of male infertility
include anamnesis, physical examination, semen
analysis, hormonal screening and genetic factors of
somatic cells (Stipoljev et al., 2006).
Spontaneous abortion (SAB) is the expulsion of
an embryo or fetus due to accidental trauma or
natural causes before approximately 22
nd
week of
gestation. It effects up to 15% clinically recognized
pregnancies and considered to be the most common
adverse outcome of pregnancy. Although several
studies tried to explain the etiology of SAB, the
results are still controversial. Beside the teratogenic
factors and advanced maternal age, genetic factors
such as Y chromosome microdeletions and
chromosomal anomalies are considered to be the
main reason of SAB (Dewan et al., 2006; Pryor et
al., 1997).
Y chromosome is essential not only for human
sex determination but also for maintenance of sex
cells and sex cell development. Y chromosome
(Yq) microdeletions represent the most frequent
molecular genetic cause of severe infertility,
observed with a prevalence of 10-15% in non-
obstructive azoospermia and severe oligozoo-
spermia (Sinclair et al.,1990). The regions
responsible for male infertility of Y chromosome
are located on the long arm of chromosome and are
termed as AZFa, AZFb, AZFc (AZF: Azoospermia
Factor) ( Burgoyne, 1998) (Stouffs et al., 2009).
The AZFa locus is located on proximal Yq11
(Yq11.21), while AZFb and AZFc are located on
distal Yq11 (Yq11.23). These AZF genes code
RNA binding proteins and may be involved in the
regulation of gene expression, RNA metabolism,
RNA packaging and RNA transportation from
nucleus to cytoplasm (Li et al., 2008). Deletions of
these regions result in spermatogenic arrest and are
associated with oligozoospermia, azoospermia and
also with a extended testis histological profile range
from Sertoli cell only (SCO), maturation arrest and
hypospermatogenesis (Vollrath, 1992) (Vogt et al.,
1996) (Briton-Jones and Haines, 2000).
The prevalence of the Y chromosome
microdeletions in the proximal AZFc region was
found higher in men from recurrent pregnancy loss
(RPL) couples than from fertile or infertile couples.
Although these patients are from a tertiary referral
center that may not reflect the population
informations, one may consider proximal AZFc
region detecting in the evaluation of RPL couples
when all other tests fail to reveal the etiology
(Dewan et al., 2006).
Before performing a molecular test, cytogenetic
analysis is necessary for an accurate approach to
elucidate the causes of spontaneous abortion.
Chromosomal anomalies which may cause male
infertility can be determined by cytogenetic
techniques. It is also known that approximately
50% of recurrent spontaneous abortions in the first
trimester is caused by chromosomal anomalies.
Besides these, recent data show that Y chromosome
microdeletions can also be a major factor in these
cases. These findings suggest a potential relation
between RPL and microdeletions in AZF regions.
In order to investigate the etiology of RPL and
to develop an appropriate therapeutic strategy, it is
necessary to ascertain the molecular and
cytogenetic basis of these defects. So in this study,
we aimed to reveal the relations between male
infertility, Y chromosome microdeletions and
recurrent spontaneous abortions.
Material and methods
Patient and Control Groups
Thirty couples that applied to Marmara University,
Department of Urology and Kartal Education and
Research Hospital with a spontaneous abortion
history were recruited to the study. Thirty fertile
men, at least having one child, were examined as
the control group. Written informed consent was
taken from all cases.
Chromosome Analyses from Peripheral Blood
Cell Culture
Lymphocytes from 400 l peripheral blood were
cultured for 72 hours at 37C culture medium
containing 8.5 ml RPMI, 1.5 ml fetal bovine serum,

47
200 l L-Glutamin, 20 l penicillin- streptomycin
and 200 l phytohaemagglutinin. After incubation
at 37C for 72 hours, 200 l Colchicine was added
to arrest the cells at metaphase. Following an
additional incubation at 37C for 30 minutes and
centrifugation at 20C for 8 min. at 1500 rpm the
supernatant was removed. The pellet was re-
suspended with up to 10 ml hypotonic solution
(0.4% KCl solution) vortexed immediately. All the
samples were kept at 37C for 20 minutes and
again centrifuged at the same condition. After
removing supernatant from the samples, the pellet
which contains cells at metaphase, was
homogenised. Fixative solution (methanol and
acetic acid mixed with 3:1 ratio) was added and the
tubes were vortexed for the fixation of
chromosomes. Then samples were centrifuged after
adding up to 5 ml of fixative solution. Supernatant
was discarded from the samples and fresh fixative
solution was added to the tubes. This procedure
was repeated until the samples were clarified.
According to the cell density, up to 0.5 ml fixative
solution was added to the samples. Then samples
were homogenized and cells were lied onto slide
glasses, which were kept at 4C in distilled water
till they are used. After spreading the cells on the
slides, the samples were dried at room temperature
and kept overnight at 60C.

Karyotyping
GTG (Giemsa-Trypsin) banding technique was
performed. When the banding of the chromosomes
was not successful, the protocol was repeated.
After staining, at least 20 metaphase plaques were
analysed for each sample (Figure 1).
Detection of Y chromosome microdeletions
DNA isolation from blood
DNA was extracted from 200 l peripheral blood by
using High Pure PCR Template Preparation Kit
(Roche-Germany) according to the manufacturers
protocol.
Multiplex polymerase chain reaction
(multiplex PCR)
For detection of Y chromosome microdeletions,
isolated DNA was amplified by multiplex PCR. AB
ANALITICAThe AZF Extension Kit, which is
recommended by European Andrology Association
was used in multiplex PCR. By using this kit, 13
different regions could be investigated at the same
time by performing 3 multiplex PCRs for each
sample. Three primer sets, each containing primers
that is unique to ZFX/Y locus which also exist in X
chromosome are shown in Table 1.

Table 1. Primers used for multiplex PCR and the length of amplicons.
MIX1 Amlicon
length (bp)
MIX2 Amlicon
length (bp)
MIX3 Amlicon
length (bp)
ZFX/Y 495 ZFX/Y 495 DBY 689
SRY 472 SRY 472 ZFX/Y 495
sY 254 380 sY 95 303 SRY 472
sY 86 320 sY 117 262 sY 84 326
sY 127 274 sY 125 200 sY 134 301
sY 255 120 DFFRY 155

Glah Ko et. al.

48

In addition to the mixtures which are found in
the AZF Extension Kit, 0.3l Taq DNA polymerase
and 8l DNA sample were added to each tube
during multiplex PCR. The conditions of PCR
amplification were as follows: a denaturation step at
94C for 5 min followed by 35 cycles at 94C for 1
min, 60C for 1 min, 72C for 1 min and a final
extension at 72C for 7 min and stop at 4C. After
multiplex PCR, products were electrophoresed on
2% agarose gel.
Results
Karyotyping
After performing lymphocyte cell culture,
metaphase plaques were analyzed for the detection
of karyotypes of patient and control groups.
According to karyotype analyses, all the males and
females were found as 46, XY and 46, XX
respectively in the patient group, whereas all the
males were found as 46, XY in the control group
(Figure 1).
Detection of Y chromosome microdeletions
After multiplex PCR, PCR products were examined
by electrophoresis on 2% agarose gel. Y
chromosome microdeletions were not found in
patient and control groups.

Figure 1. Karyotype analyses of a male (46, XY) patient.


49

Figure 2. Multiplex PCR analyses of Y chromosome microdeletions (M: 50 bp ladder (Fermentas,
Germany); Mix1a, Mix1b and Mix1c: 3 sets of PCR reactions that amplify different loci on Y chromosome
for sample a; Mix1b, Mix2b, Mix3b for sample b; boxes indicate the region and the length of the amplicons.

Discussion
Chromosomal abnormalities, including transloca-
tions and deletions, are higher in infertile men and
are recognized as one of the main causes of
spontaneous abortions with an estimated frequency
of 5070% (Svetlana et al., 2005)
In couples experiencing RPL, the incidence of
chromosomal translocations is higher than the
incidence present in newborn series (De Braekeleer
and Dao 1991). There is also evidence which
indicates that the presence of translocations
changes the spermatogenic process. It has been
found that the incidence of reciprocal translocation
carriers is seven times more than in newborn series.
As a general rule reciprocal translocation carriers
produce more unbalanced sperm than normal or
balanced sperm. The proportion of unbalanced
forms depends on the characteristics of the
reorganization. Also deletions which remove Y
chromosomal genes required for spermatogenesis
may effect infertility and susceptibility of RPL
(Byrne and Ward, 1994) (Simpson, 1981). As the
severity of the spermatogenic defect increases, the
frequency of the microdeletions also increases.
In this study, primarily, cytogenetic evaluation
was performed from peripheral blood samples of
the couples in spontaneous abortion cases. 30
couples who had a spontaneous abortion history
were karyotyped to detect the chromosome
anomalies. According to karyotype analyses, all the
women and men were found to be 46, XX and 46,
XY, respectively. In our study we couldnt detect
any numerical and structural chromosome
anomalies that can be detected by karyotype
analyses. Other genetic abnormalities such as Y
chromosome microdeletions may effect spermato-
genesis, fertilization and post-zygotic metabolism
and may influence male infertility and RPL.
Glah Ko et. al.

50

So we used multiplex PCR for the detection of
microdeletions on the long arm of the Y
chromosome.
In this study, AB ANALITICAThe AZF
Extension Kit used for the analysis of
microdeletions rather than AZF-MX Extension kit.
Diagnostic sensitivity is considered to be the
capacity of the device to correctly identify the
deleted samples with reference to AZF locus under
investigation. The results obtained from an
experimental investigation show that the diagnostic
sensitivity of the system is 100%.
The kit is in premix format as all the reagents
for the amplification are pre-mixed and aliquoted in
single dose tubes in which only additional Taq
polymerase and the extracted DNA should be
added. This premix format allows the reduction of
the manipulation in preamplification steps, with
considerable time saving for the operator, the
repeated freezing/thawing of reagents (that could
alter the products performances) is avoided and,
above all, this form minimizes the risk of sample
contamination and the risk of false positive results.
The amplified regions of the Y chromosome are
not polymorphic and are well known to be deleted
specifically in men affected by oligo/azoospermia
according to the known, clinically relevant
microdeletion pattern (Viswambharan, 2007).
Based on the experience of many laboratories and
the results of external quality control and
considering the multiplex PCR format, the first
choice of STS primers recommended in the first
version of the guidelines remains basically valid.
These primers include the regions:
For AZFa: sY84, sY86
For AZFb: sY127, sY134
For AZFc: sY254, sY255
The usage of this primer set will enable the
detection of almost all the clinically relevant
deletions and of over 95% of the deletions reported
in the literature in the three AZF regions and is
sufficient for routine analysis (Simoni, 2004).
In this study, the set of PCR primers as best
choice for the diagnosis of microdeletion of the
AZFa, AZFb and AZFc region (sY14 (SRY),
ZFX/ZFY, sY84, sY86, sY127, sY134, sY254,
sY255) used in multiplex PCR reactions. We
couldnt detect any Y chromosome microdeletions
in AZFa, AZFb and AZFc regions.

Genes that are located on Y chromosome and
responsible from spermatogenesis have a mosaic
structure at somatic and/or germ cells. When
leukocytes from blood were used, usually the
results can not be suitable for Y chromosome
microdeletion analysis because there may have
been deletions in germ cells (Martin, 2008).
There may be a mosaicism between
seminiferous tubules in terms of the expression of
genetic material. Some seminiferous tubules have
aplasia whereas some tubules can be normal or
mutant arrest at testes. In the identification of
deletions this situation may show different
outcomes when cells from blood or semen were
used. When fibroblasts or leukocytes are used in
genetic analysis, the proportion of a detection of Y
chromosome microdeletion is slightly low because
the deletions occuring in germ line cells have an
independent nature from other tissues.
In this study, we used peripherial blood
leukocytes for the detection of Y chromosome
microdeletions, however we couldnt find any
deletions. But the possibility of having deletions in
germline cells shouldnt be omitted. We are looking
forward to extend our study by adding spermial Y
chromosome microdeletion analysis from the same
individuals.
Dewan et al. (2006) reported the relation
between RPL and proximal AZFc deletions and
found a significant correlation. Although, they
detected proximal Y chromosome AZFc
microdeletions in 14 of 17 patients (82%), they
couldnt find any deletion in control group.
Karaer et al. (2008) reported 43 infertile men
among which 7 of them have sY 220 (AZFb)
deletions (16%) of the 4 examined region, stating
the importance of AZF deletions in the aetiology of
RPL.
In the previous studies, sequenced tagged site
(STS) numbers which were selected for detection
of Y chromosome microdeletions are different from
each other. After physical mapping of Y
chromosome, more than 300 STS were produced. It
was stated that, analysing of low number of STS
can be insufficient for detection of deletion regions
also high number of STS can give false-positive
results as polymorphic regions may identified as
deletions (Simoni, 2001).
One of the most important criteria for the
detection of Y chromosome microdeletions is the
selected STS. For this reason, European Andrology
Association and European Molecular Genetics

51
Quality Network improved a standardization to
distinguish the differences of deletion proportions
between different laboratories. So they proposed 6
STS for detecting of AZFa, AZFb ve AZFc regions.
In the present study, although 13 STS including 6
STS which were suggested by European Molecular
Genetics Quality Network were analyzed, we
couldnt detect any microdeletions on Y
chromosome. We propose the evolution of the
results by increasing the analysed STS.
Due to limited knowledge of the metabolism
and the progress of the genes on Y chromosome,
we can not predict the answers of the questions
including Y chromosome microdeletions effect on
RPL. For this reason researches should be focused
on the relationship of Y chromosome micro-
deletions, male infertility and RPL.
References
Briton-Jones C, Haines CJ. Microdeletions on the
long arm of the Y chromosome and their
association with male-factor infertility. HKMJ
6: 184-9, 2000.
Burgoyne PS. The mammalian Y chromosome: A
new perpective. Bioassays, 20:3636, 1998.
Byrne J.L.B, Ward K. Genetic Factors in Recurrent
Abortion. Clinical Obstetircs and Gynecology,
37 (3): 693-704, 1994.
De Braekeleer M, Dao TN. Cytogenetic studies in
male infertility: a review. Hum Reprod. 6:245-
50, 1991.
Dewan S, Puscheck EE, Coulam CB, Wilcox AJ,
Jeyendran RS. Y-chromosome microdeletions
and recurrent pregnancy loss Andrology
Laboratory Services Inc., Chicago, Illinois,
USA. Fertil Steril.;85(2):441-5, 2006.
Genetics and male infertility. Verh K Acad
Geneeskd Belg.; 71(3):115-39. Review. Dutch.,
2009.
Karaer A, Karaer K, Ozaksit G, Ceylaner S, Percin
EF. Y chromosome azoospermia factor region
microdeletions and recurrent pregnancy loss.
Am J Obstet Gynecol.;199(6):662.e1-5, 2008.
Li Z., Haines CJ., HanY. Micro-deletions of the
human Y chromosome and their relationship
with male infertility. J. Genet. Genomics 35,
193199, 2008.
Martin R.H. Cytogenetic determinants of male
fertility. Human Reproduction Update, 14 (4):
379-390, 2008.
Noordam M.J., Repping S. The human Y
chromosome: a masculine chromosome, Current
Opinion in Genetics & Development, 16: 225-
232, 2006.
Pryor JL, Kent-First M, Muallem A. Prospective
analysis of Y chromosome microdeletions in
200 consecutive male infertility patients. N Engl
J Med 336: 534-539, 1997
Simoni M. Molecular diagnosis of Y chromosome
microdeletions in Europa: state-of-the-art and
quality control. Human Reprod, 16(3): 402-409,
2001.
Simoni M., Bakker E., Krausz C. EAA/EMQN
best practice guidelines for molecular diagnosis
of y-chromosomal microdeletions. international
journal of andrology, 27:240249, 2004.
Simpson J.L. Antenatal Diagnosis of Cytogenetics
Abnormalities. Clinical Obstetrics and
Gynecology, 24: 1024-1039, 1981
Sinclair AH, Berta P, Palmer MS, Hawkins JR,
Griffits BL, Smith MJ. A gene from the human
sex-determining region encodes a protein with
homology to a conserved DNA-binding motif.
Nature, 346:240-4, 1990.
Stipoljev F., Vujisic S., Parazajder J., Hafner D.,
Jezek D., Sertic J. Cytogenetic analysis of
azoospermic patients: karyotype comparison of
peripheral blood lymphocytes and testicular
tissue European Journal of Obstetrics &
Gynecology and Reproductive Biology 124
197203, 2006.
Stouffs K, Vandermaelen D, Tournaye H, Liebaers
I, Van Steirteghem A, Lissens W.
Svetlana G. Vorsanova, Alexei D. Kolotii, Ivan Y.
Iourov, Viktor V. Monakhov, Elena A.
Kirillova, Ilia V. Soloviev, and Yuri B. Yurov.
Evidence for High Frequency of Chromosomal
Mosaicism in Spontaneous Abortions Revealed
by Interphase FISH Analysis Journal of
Histochemistry & Cytochemistry. 53(3): 375-
380, 2005.
Viswambharan N, Suganthi R, Simon A M,
Manonayaki S. Male infertility: polymerase
chain reaction-based deletion mapping of genes
on the human chromosome. Singapore Med J;
48 (11): 1140.2007.
Glah Ko et. al.

52
Vogt, PH, Edelman A, Kirsch S, Henegariu O,
Hirschmann P, Keisewetter. Human Y
chromosome azospermic factors (AZF) mapped
to different subregions in Yq11. Hum Mol
Genet 5: 933-45, 1996.
Vollrath D, Foote S, Hilton A. The human Y
chromosome: A 43 interval map based on
naturally occuring deletions. Science. 258:52-9,
1992.
Do simple sequence repeats in replication, repair and recombination
genes of mycoplasmas providing genetic variability?
Seema TRIVEDI
Computational Biology Lab., Department of Zoology, JN Vyas University, Jodhpur
(Rajasthan), India
(author for correspondence; svtrived@hotmail.com)
Received: 25 December 2009; Accepted: 14 May 2010

Abstract
Simple sequence repeats (SSRs) or microsatellites are mono to hexa-nucleotide tandem repeats of DNA that
are ubiquitous in intergenic regions and coding regions of genomes. SSRs may be essential for any genome
as these repeats are found even in organisms like mycoplasmas (class Mollicutes) that have small genome
size. Mollicutes cause different diseases in vertebrates including humans, insects and plants. Antibiotics have
been developed against membrane proteins and replication related proteins like gyrase and topoisomerase.
However, some pathogens have developed immunity against these drugs. Mycoplasmas can evade host
immune response in which SSRs variations in membrane proteins play an important role. The present study
seeks presence of di- to penta-nucleotide repeats in genes associated with DNA replication, repair and
recombination in thirteen mycoplasma genomes. Association of SSRs with these genes may have potential to
provide variability for evading antibiotics against replication, repair and recombination proteins. In the
present study SSRs are present in few genes but among the repeats found, maximum repeats are present in
methylase, DNA polymerase, excinuclease and topoisomerase genes. Maximum number of repeat types are
dinucleotides but present only in M. pulmonis. Pentanucleotide repeats are present in three mycoplasmas but
tetranucleotide repeats are present in eight mycoplasmas.
Keywords: Microsatellites, Mycoplasma, repair, replication, simple sequence repeats
Mikoplazmann replikasyon, tamir ve rekombinasyon genlerindeki basit dizi tekrarlar
genetik eitlilik mi salyor?
zet
Basit dizi tekrarlar (SSR) veya mikrosatelitler, genomun intergenik blgelerinde ve kodlanan blgelerinde
ska rastlanan, DNAnn birden (mono) altya (hekza) kadar ard arda gelen nkleotit tekrarlardr. Bu
tekrarlar mikoplazma (Mollicutes snf) gibi kk genom byklne sahip bir organizmada bile
bulunduundan, SSRler herhangi bir canl iin elzem olabilir. Mollicutes, insan, bcek ve bitkileri de ieren
omurgallarda eitli hastalklara yol aarlar. Zar proteinlerine ve giraz, topoizomeraz gibi replikasyonla
alakal proteinlerine kar antibiyotikler gelitirilmitir. Ancak, baz patojenler bu ilalara kar baklk
kazanmlardr. Zar proteinlerindeki SSR varyasyonlarnn mikoplazmalarn konak hcrenin baklk
tepkisinden kamalarnda nemli bir rol olabilir. Bu alma, on mikoplazma genomunda DNA
replikasyonu, tamiri ve rekombinasyonu ile ilgili genlerdeki ikiliden (di-) beliye (penta-) kadar olan
nkleotit tekrarlarn aratrr. Bu genlerin SSRler ile ilikisi, replikasyon, tamir ve rekombinasyon
proteinlerine kar gelitirilen antibiyotiklerden kamalar iin eitlilik salamada potansiyele sahip olabilir.
Bu almada, SSRler birka gende mevcuttur, ama bulunan tekrarlar arasnda en fazla tekrar metilaz, DNA
polimeraz, ekzinkleaz ve topoizomeraz genlerinde vardr. Tekrar tiplerinden en fazla sayda bulunanlar
dinkleotitlerdir ancak sadece M. Pulmonisde bulunur. Pentankleotit tekrarlar mikoplazmada, ama
tetrankleotit tekrarlar sekiz mikoplazmada mevcuttur.
Anahtar Szckler: Mikrosatelitler, mikoplazma, tamir, replikasyon, basit dizi tekrarlar

Seema TRIVEDI

54
Introduction
Simple sequence repeats (SSRs) or microsatellites
are mono to hexa-nucleotide tandem repeats of
DNA that are ubiquitous in all genomes studied
so far. SSRs are present not only in intergenic
regions of a genome, but may also be found in
introns and exons of coding regions (Karlin et al.,
1997; Bachtrog et al., 1999; Bachtrog et al., 2000;
Butcher et al., 2000; Chambers and MacAvoy,
2000; Toth et al., 2000). It is possible that SSRs
are essential part of any genome as these repeats
are present even in organisms like mycoplasmas
that have small genome size (Hancock, 1996a).
These repetitive DNA may be involved in
different functions like chromatin organization,
gene regulation, evading host-immune responses,
recom bination hotspots and facilitating genome
rearrangements, affecting protein structure thus
possibly protein-protein interactions etc. (Mrzek,
2006). Interestingly, it has also been found that
SSRs may provide variability to host for evading
pathogens. This is reported in case of house
finches (Carpodacus mexicanus) that show
multilocus heterozygosity that could result in
reduced susceptibility to Mycoplasma
gallisepticum infection (Hawley et al., 2005).
Similarly, Porcine C3 gene (high homology with
human C3) involved in phagocytosis, inflamema
tion and immunoregulation to destroy infectious
micro-organisms, possess Tn SSR in the
3flanking region which may be helpful in
resisting infections (Mekchay et al., 2003).
Mycoplasmas (class Mollicutes) are parasites
or commensals that may cause different diseases
in vertebrates including humans, insects and
plants. Repetitive sequences like RepMp and
MgPar elements are involved in homologous
recombination of parts of P1, P40, P90 and P110
proteins of Mycoplasma pneumoniae and Myco
plasma genitalium. Recombination events
mediated with help of MPN490- and MG339-
encoded proteins (RecA homo logs) in genes of
immunogenic adhesion proteins result in
variations that may play eminent roles in immune
evasive strategies (Sluijter et al., 2009). Repeated
sequences, DR-1 and DR-2, within the putative
cytadhesin pvpA gene of M. gallisepticum are
present in isolates from Chinese poultry farms.
Approximately 30 or more proline residue repeats
and 7-10 repeats of the tetrapeptide motif may
affect functionality of PvpA as an adhesin molecule
(Jiang et al., 2009). Similarly, insertion sequences
(IS3, IS4 and IS30) in Mycoplasma bovis
(Lysnyansky et al., 2009) and variable-number
tandem-repeats (VNTRs) associated with coding
sequences that can provide genetic diversity are
present in Mycoplasma hyopneumoniae strains,
Mycoplasma agalactiae type strain PG2,
Mycoplasma mycoides subspecies mycoides. These
IS and VNTRs possibly code for amino acid repeats
and can affect cell adhesion and interactions with the
host immune system (de Castro et al., 2006;
McAuliffe et al., 2007; McAuliffe et al., 2008).
Tandem amino acid repeats in M. pneumoniae
RepMP1-containing genes and Myco plasma
pulmonis Vsa proteins may have regulatory functions
(Simmons and Dybvig, 2007; Musatovova et al.,
2008). Amino acid repeats that may affect antigenic
response are present in haemagglutinins (immuno
genic, variably expressed, surface proteins) of M.
synoviae (VlhA) (Bencina, 2002).
Though SSRs have been investigated in
mycoplasmas, the focus of studies has not been
replication, repair and recombination genes. This
study was undertaken to seek answer to questions
like whether replication, repair and recombination
genes in mycoplasmas are associated with SSRs.
How can SSRs association with these genes be
beneficial to these organisms? The present study on
SSRs in replication, repair and recombination genes
in thirteen mycoplasmas may indicate mutational
hotspots that may help these organisms evade
antibiotics against these genes. On the other hand,
these mutational hotspots may prove to be target sites
for developing drugs to prevent such evasive
strategies of the organisms.
Method
Obtaining sequences and genome information
Replication, repair and recombination related gene
sequences (total numbers given in Table-1) of
thirteen myco plasmas (Mycoplasma arthritidis
158L3-1, Mycoplasma capricolum subsp capricolum
California kid ATCC 27343, Mycoplasma
gallisepticum strain R, Mycoplasma genitalium G-37,
Mycoplasma hyopneumoniae 232, Mycoplasma
hyopneumoniae 7448, Mycoplasma hyopneumoniae
J, Mycoplasma mobile 163K, Mycoplasma mycoides
SC PG1, Mycoplasma penetrans HF-2, Mycoplasma
pneumoniae M129, Mycoplasma pulmonis UAB
SSRs in Mycoplasma replication genes

55
CTIP and Mycoplasma synoviae 53) were
downloaded from The Comprehensive Microbial
Resource (CMR http://cmr.jcvi.org/cgi-bin/
CMR/CmrHomePage.cgi). Total genome length,
CG richness, coding percentage and number of
protein coding genes for each Mycoplasma were
downloaded from NCBI (http://www.ncbi.nlM.
nih.gov/sites/entrez?db=genome&cmd=Retrieve&do
pt=Overview&list_uids=) (Table 1).

Table 1. List of mycoplasmas and genome details
Organism
Genome
length
nt
Genome
CG%
Coding
%
Total
protein
genes
Total
replication
and repair
genes
% of
genes
with
repeats
Mycoplasma
arthritidis 158L3-1 820453 30 88 631 32 3.13
Mycoplasma
capricolum subsp
capricolum California
kid ATCC 27343 1010023 23 88 812 45 8.89
Mycoplasma
gallisepticum strain R 996422 31 87 726 30 3.33
Mycoplasma
genitalium G-37 580076 31 90 475 28 3.57
Mycoplasma
hyopneumoniae 232 892758 28 89 691 34 2.94
Mycoplasma
hyopneumoniae 7448 920079 28 85 657 35 2.86
Mycoplasma
hyopneumoniae J 897405 28 87 657 34 2.94
Mycoplasma mobile
163K 777079 24 90 633 39 5.13
Mycoplasma mycoides
SC PG1 1211703 23 81 1016 51 1.96
Mycoplasma penetrans
HF-2 1358633 25 88 1037 76 2.63
Mycoplasma
pneumoniae M129 816394 40 87 689 36 5.56
Mycoplasma pulmonis
UAB CTIP 963879 26 89 782 53 9.43
Mycoplasma synoviae
53 799476 28 88 659 36 8.33

Seema TRIVEDI

56
SSR search
Replication, repair and recombination related
gene sequences of all thirteen mycoplasmas were
subjected to repeat search programme SPUTNIK
(http://espressosoftware.com/sputnik/index.html).
SPUTNIK looks for di-, tri-, tetra- and penta-
nucleotide repeats; tolerates insertions, mismatch
es and deletions but these affect the overall score.
Repeats found through this search were not
grouped i.e. the 5 to 3 or vice-a versa and the
complements were not put together. For example,
dinucleotide repeat CA was not grouped with AC,
TG or GT. Hence, each repeat was treated as
separate motif.
SSR CG richness and length
Length of an SSR was measured in nucleotides
(base pairs). However, repeat length given as
output from SPUTNIK was adjusted to nearest
divisible value i.e. dinucleotide repeat length
should be divisible by 2, trinucleotide by 3,
tetranucleotide repeat by 4 and pentanucleotide
repeat by 5. For example, if repeat length for
dinucleotide repeats was indicated as 11nt by
SPUTNIK output; this was adjusted to 10nt, for
trinucleotide repeats if the length was 14nt it was
adjusted to 15nt or if it was 16nt or 17nt it was
considered as 15nt.
Statistical analysis
For statistical analysis, SPSS (Version 16.0) was
used. One way ANOVA followed by Tukeys
HSD at 95% confidence level was done to seek
significant difference in between the thirteen
species repeat number as well different replica
tion, repair and recombination genes.
Pearsons r two tailed correlation analysis of
genome size and CG richness, sequence lengths
of replication, repair and recombination genes and
CG richness vis--vis repeat numbers, length and
CG richness of total repeats and repeat types was
done.
Results
Total SSRs, repeat types and motifs in thirteen
mycoplasmas replication, repair and recombination
genes
Figure 1 shows total numbers of SSRs and repeat
types present in replication, repair and recombination
genes in genomes of thirteen mycoplasmas where M.
pulmonis has the maximum number of repeats
followed by M. capricolum and M. synoviae (5, 4
and 3 respectively).
Among repeat types, dinucleotides (five) are
present only in M. pulmonis. Maximum numbers of
tri nucleotides are in M. capricolum. Presence of
other repeat types in replication, repair and
recombination genes of mycoplasmas are given in
Figure 1.
There is diversity in repeat motifs found in the
present study among which maximum frequency
(four) is of tetranucleotide repeat ATTT followed by
dinucleotide repeat motifs AG (Table-2).
Total replication, repair and recombination genes
associated with SSRs in mycoplasmas
Methylase genes have maximum number of total
repeats (eight) followed by DNA polymerase,
excinuclease and topoisomerase genes (three in each)
among replication, repair and recombination genes in
thirteen mycoplasmas (Figure 2). Among repeat
types total dinucleotide followed by tetra nucleotide
repeats as well as the motifs AG and ATTT have
maximum frequency (all in methylase genes)
(Figures 2 and 3).
Comparison of total repeats and repeat types in
replication, repair and recombination genes of each
Mycoplasma is given in Figure 4 and motifs in Table
3, where once again methylase genes in M. pulmonis
have maximum repeats.
.


57

Figure 1. Total SSRs and SSR types in thirteen mycoplasmas replication, repair and recombination genes.
Di: Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats.

Figure 2. Total SSRs and SSR types in total replication, repair and recombination genes of mycoplasmas. Di:
Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats.
Seema TRIVEDI

58
Table 2. SSR motifs and motif numbers in total replication, repair and recombination genes of thirteen
mycoplasmas. Di: Dinucleotide, Tri: Trinucleotide, Tetra: Tetranucleotide, Penta: Pentanucleotide.
Repeat
Name
Organism Motifs
AG CA GA
M. pulmonis 3 1 1 Di
Grand Total 3 1 1
AAG AAT AGA GAA TGA TGT
M. arthritidis 1
M. capricolum 1 1 1
M. mobile 1
M. penetrans 1
M. synoviae 1
Tri
Grand Total 1 2 1 1 1 1
AATT ATTT TTTA TTTC
M. capricolum 1
M. genitalium 1
M. hyopneumoniae 232 1
M. hyopneumoniae J 1
M. mobile 1
M. mycoides 1
M. penetrans 1
Tetra
Grand Total 1 4 2 1
AAAAT AAAGC AATTG ACCAA CAAAC
M. gallisepticum strain R 1
M. pneumoniae 1 1
M. synoviae 1 1
Penta
Grand Total 1 1 1 1 1
Length of repeats
Repeats in thirteen mycoplasmas are not very
long as maximum repeat lengths are 28nt and
26nt which are in methylase genes (dinucleotide
CA and GA respectively in M. pulmonis)
followed by 24nt which are in methylase and
gyrase genes (dinucleotide AG in M. pulmonis
and trinucleotide AAG in M. arthritidis
respectively) (Figure 5 and Table 4).
CG richness of SSRs
There is variation (0% to 50%) in CG richness of
SSRs in replication, repair and recombination genes
of mycoplasmas (Table 5). CG% differs in the same
gene group among different Mycoplasma. For
example, DNA polymerase shows different CG
richness in different Mycoplasma (0% in M.
synoviae, 33.33% in M. mobile and 40% in M.
pneumoniae).


59

Figure 3. SSR motifs in total replication, repair and recombination genes in mycoplasmas. legends represent
the motifs as per the bar chart.

Seema TRIVEDI

60

F
i
g
u
r
e

4
.

T
o
t
a
l

S
S
R
s

a
n
d

S
S
R

T
y
p
e
s

I
n

R
e
p
l
i
c
a
t
i
o
n
,

R
e
p
a
i
r

a
n
d

R
e
c
o
m
b
i
n
a
t
i
o
n

G
e
n
e
s

I
n

T
h
i
r
t
e
e
n

M
y
c
o
p
l
a
s
m
a
s
.

D
i
:

D
i
n
u
c
l
e
o
t
i
d
e
s
,

T
r
i
:

T
r
i
n
u
c
l
e
o
t
i
d
e
s
,

T
e
t
r
a
:

T
e
t
r
a
n
u
c
l
e
o
t
i
d
e
s
,

P
e
n
t
a
:

P
e
n
t
a
n
u
c
l
e
o
t
i
d
e
s
,

T
o
t
a
l
:

T
o
t
a
l

R
e
p
e
a
t
s
.


61

Table 3. Number of SSR motifs in replication, repair and recombination genes of thirteen
mycoplasmas.
Organism Motif
C
o
n
s
e
r
v
e
d

H
y
p
o
t
h
e
t
i
c
a
l

P
r
o
t
e
i
n

D
N
A

P
o
l
y
m
e
r
a
s
e

E
n
d
o
n
u
c
l
e
a
s
e

E
x
c
i
n
u
c
l
e
a
s
e

G
y
r
a
s
e

L
i
g
a
s
e

M
e
t
h
y
l
a
s
e

M
e
t
h
y
l
t
r
a
n
s
f
e
r
a
s
e

P
3
5

L
i
p
o
p
r
o
t
e
i
n

H
o
m
o
l
o
g

R
e
p
l
i
c
a
t
i
o
n

I
n
i
t
i
a
t
o
r

S
S
B
P

T
o
p
o
i
s
o
m
e
r
a
s
e

M. arthritidis AAG 1
AGA 1
TGA 1
TGT 1
M. capricolum
TTTA 1
M. gallisepticum ACCAA 1
M. genitalium AATT 1
M. hyopneumoniae 232 ATTT 1
M. hyopneumoniae 7448 ATTT 1
M. hyopneumoniae J ATTT 1
GAA 1
M. mobile
ATTT 1
M. mycoides TTTA 1
AAT 1
M. penetrans
TTTC 1
AAAGC 1
M. pneumoniae
CAAAC 1
AG 3
CA 1 M. pulmonis
GA 1
AAT 1
AAAAT 1 M. synoviae
AATTG 1

Seema TRIVEDI

62

F
i
g
u
r
e

5
.

L
e
n
g
t
h
s

o
f

t
o
t
a
l

S
S
R
s

a
n
d

S
S
R

t
y
p
e

i
n

t
o
t
a
l

r
e
p
l
i
c
a
t
i
o
n
,

r
e
p
a
i
r

a
n
d

r
e
c
o
m
b
i
n
a
t
i
o
n

g
e
n
e
s

o
f

m
y
c
o
p
l
a
s
m
a
s
.

S
S
R

l
e
n
g
t
h
s

i
n

n
u
m
b
e
r

o
f

n
u
c
l
e
o
t
i
d
e
s

(
n
t
)
.


63
Table 4. Repeat lengths (nt) in total SSR types and SSR motifs in replication, repair and recombination genes
of thirteen mycoplasmas. Di: Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta:
Pentanucleotides, Total: Total Repeats.
Gene Organism SSR Motif
SSR
Length
Conserved Hypothetical Protein M. synoviae Penta AATTG 10
M. mobile Tri GAA 12
M. pneumoniae Penta CAAAC 10
DNA Polymerase
M. synoviae Tri AAT 12
Endonuclease M. penetrans Tetra TTTC 12
M. capricolum Tri AGA 12
M. pneumoniae Penta AAAGC 15
Excinuclease
M. synoviae Penta AAAAT 10
Gyrase M. arthritidis Tri AAG 24
Ligase M. genitalium Tetra AATT 12
M. hyopneumoniae 232 Tetra ATTT 12
M. hyopneumoniae 7448 Tetra ATTT 12
M. hyopneumoniae J Tetra ATTT 12
GA 26
CA 28
14
16
Methylase
M. pulmonis Di
AG
24
Methyltransferase M. mobile Tetra ATTT 12
P35 Lipoprotein Homolog M. penetrans Tri AAT 18
Replication Initiator M. capricolum Tri TGT 12
SSBP M. capricolum Tri TGA 12
M. capricolum Tetra TTTA 12
M. gallisepticum Penta ACCAA 10
Topoisomerase
M. mycoides Tetra TTTA 12

.

Seema TRIVEDI

64
Table 5. CG richness of SSRs and motifs in replication, repair and recombination genes in thirteen
mycoplasmas. Di: Dinucleotide, Tri: Trinucleotide, Tetra: Tetranucleotide, Penta: Pentanucleotide
SSR
CG%
Gene Name Repeat Motif Organism
SSR
Number
DNA Polymerase Tri AAT M. synoviae 53 1
Excinuclease Penta AAAAT M. synoviae 53 1
Ligase Tetra AATT M. genitalium G-37 1
Methylase Tetra ATTT
M. hyopneumoniae J 1
Methyltransferase Tetra ATTT M. mobile 163K 1
P35 Lipoprotein
Homolog
Tri AAT
M. penetrans HF-2 1
M. capricolum 1
0
Topoisomerase Tetra TTTA
M. mycoides 1
20 Conserved
Hypothetical Protein
Penta AATTG
M. synoviae 53 1
25 Endonuclease Tetra TTTC M. penetrans HF-2 1
DNA Polymerase Tri GAA M. mobile 163K 1
Excinuclease Tri AGA M. capricolum 1
Gyrase Tri AAG M. arthritidis 158L3-1 1
Replication Initiator Tri TGT M. capricolum 1
33.33
SSBP Tri TGA M. capricolum 1
DNA Polymerase Penta CAAAC M. pneumoniae M129 1
Excinuclease Penta AAAGC M. pneumoniae M129 1
40
Topoisomerase Penta ACCAA M. gallisepticum strain R 1
AG M. pulmonis 3
CA M. pulmonis 1
50 Methylase Di
GA M. pulmonis 1

Discussion
SSRs in genomes of virus, prokaryotes and
eukaryotes are present not only in intergenic
regions but also in introns and exons of coding
sequences (Hancock, 1996a and b; Karlin et al.,
1997; Bachtrog et al., 1999; Bachtrog et al., 2000;
Butcher et al., 2000; Toth et al., 2000; Trivedi,
2003, 2004, 2006; Mrzek et al., 2007). Studies in
different genomes have also shown associations
of SSRs with replication, repair and recombination
genes, housekeeping genes or membrane proteins
(Trivedi, 2003; Mrzek et al., 2007; Guo and
Mrzek, 2008). Antigenic variations facilitated by
SSRs in host-adapted pathogens like mycoplasmas
have been reported (Guo and Mrzek, 2008).
However, studies have so far not focused on

65
association of SSRs with replication, repair and
recombination genes.
Total repeats
Mycoplasmas have small genomes possibly due
to genome reduction. It is possible that some
SSRs may have played a role in Mycoplasma
evolution (Hancock, 1996a; Rocha and
Blanchard, 2002) which could be due to
mutational bias towards SSR reduction instead of
expansion if not maintained by selection (Metzgar
et al., 2002).
The present study shows few repeats in total
replication, repair and recombination genes which
corresponds to studies in whole genome studies
on mycoplasmas (Mrzek et al., 2007) but with
some differences from the reported number of
repeats in these genes in M. hyopneumoniae (Guo
and Mrzek, 2008). This difference is possibly
due to difference in the algorithms used in the
present study and the analysis criteria. ANOVA
does not show any significant difference between
the thirteen mycoplasmas nor between genes of
each Mycoplasma in the present study. Besides
this, present study does not show any correlation
of genome length with any parameter as indicated
in the material and method section. This is
consistent with some studies (Hancock, 2002;
Lim et al., 2004) but contrary to studies done
earlier in eukaryotes and prokaryotes (Hancock,
1996b; Primmer et al., 1997; Achaz et al., 2002;
Trivedi, 2004 and 2006; Mrzek et al., 2007).
Though the focus of present study is on specific
genes, this lack of correlation of genome size may
indicate confirmation of the fact that genome size
is not expanding and possibly SSRs (in total
genomes) that are so few in number are playing a
role in genome reduction in Mycoplasma
(Hancock 1996a; Mrzek et al., 2007; Guo and
Mrzek, 2008).
Genome CG% show significant positive
correlation only with penta nucleotide number
and length. Similarly, significant positive
correlation of average CG% of total replication,
repair and recombination genes with pentanucleo
tide lengths (P< 0.05, 0.587*) is seen in the
present study. There is significant positive
correlation (P< 0.01, 0.931**) of total SSR
number with percentage of total replication, repair
and recombination genes with repeats. Total SSR
numbers show significant positive correlation
with total dinucleotide number (P< 0.01, 0.700**)
and total tetranucleotides show significant
negative correlation with pentanucleotide number
(P< 0.05, -0.659*).
This data is not sufficient to draw conclusion that
positive correlation of percentage of genes having
repeats with total repeats may be an indication of
probable increase in repeat number in these genes in
other pathogens as well. It would be interesting to
investigate repeats in those micro-organisms as well
against which antibiotics are being used. Antibiotic
treatment would alter environment and these
pathogens may develop different strategies to evade
these challenges. These evasive strategies may
involve the membrane proteins or replication, repair
and recombination related genes or gene products
depending on the target proteins of antibiotics.
SSR average length
Many organisms studied so far have shown
differences in not only abundance of SSRs but also in
tolerance for length of SSRs. For example, archaea
like Methanosarcina mazei strain Goe1,
Methanobacterium thermoautotrophicum DH,
Helicobacter pylori have some SSRs that are long
compared to other species (Field and Wills, 1998;
Trivedi, 2006). Among vertebrates, cold-blooded
vertebrates like turtles have long repeats (Chambers
and MacAvoy, 2000); whereas humans have longer
SSRs compared to homologues in chimps (Cooper et
al., 1998).
Long SSRs have not been found in the present
study including other studies in M. penetrans, M.
mobile, and M. synoviae. Short A(n) and T(n) repeats
are abundant in M. hyopneumoniae and M. pulmonis
(Mrzek, 2006). The present study shows significant
positive correlation between total SSR average
length with dinucleotide number and length as well
as tetranucleotide CG% (P< 0.05, 0.563*, 0.563* and
P< 0.01, 1.000** respectively). Dinucleotide average
length has significant positive correlation with total
SSR as well as dinucleotide numbers and CG% of
total SSRs (P< 0.01, 0.700**, 1.000** and 0.870**
respectively). Significant positive correlation of
trinucleotide length is seen with trinucleotide number
but negative correlation with pentanucleotide CG%
(P< 0.05, 0.672* and P< 0.01,-1.000** respectively).
Tetranucleotide average length has positive
correlation with tetranucleotide number but negative
correlation with pentanucleotide number as well as
length (P< 0.01, 1.000**, P< 0.05, -0.659* and P<
0.01, -0.688** respectively). There is positive
correlation of pentanucleotide average length with
pentanucleotide number (P< 0.01, 0.963**).
Seema TRIVEDI

66
Reports have suggested that in prokaryote
genomes, significantly long SSRs are generally
rare but association of long mono-, di-, tri-, and
tetranucleotides are mostly restricted to host-
adapted pathogens. Besides this, a number of long
SSRs are also associated with housekeeping
genes, including rRNA and tRNA genes, genes
encoding ribosomal proteins, amino acyl-tRNA
synthetases, chaperones, and important metabolic
enzymes. Statistically significant associa tions
between SSRs and gene functional classifications
suggest that most long SSRs are not related to a
particular cellular function or process (Guo and
Mrzek, 2008). This conclusion may be true for
many organisms and particularly prokaryotes, but
pilot study on silkworm genes has indicated
biased association of SSRs with genes associated
with replication and repair process though length
of SSRs was not focus of the study (Trivedi,
2003). In Mycobacterium leprae long SSRs are
mostly associated with pseudogenes and may be
contributing to gene loss following the adaptation
to an obligate pathogenic lifestyle. The authors
speculate that LSSRs may have played a similar
role in genome reduction of other host-adapted
pathogens (Guo and Mrzek, 2008). Similarly in
M. gallisepticum SSRs are biased towards
deletion unlike eukaryotic genomes where they
are biased towards expansion (Metzgar et al.,
2002).
Among prokaryotes, it is proposed that the
differences could be due to functional nature of
these repeats or because some of these genomes
lacks mismatch repair (Field and Wills, 1998).
However, the latter reason does not apply to
eukaryotes and particularly to differentces
between chimpanzee and human SSRs.
SSR average CG%
Total SSRs CG% show positive correlation with
total SSR and dinucleotide number (P<0.05,
0.721* and P<0.01, 0.870** respectively). There
is significant negative correlation between
trinucleotide CG% and tetranucleotide CG%
(P<0.01, -1.000**). Pentanucleo tide CG% has
significant negative correlation with trinucleotide
number (P<0.01, -1.000**).
Form the correlations it appears that major
constituents of SSRs are dinucleotide. Studies in
other genomes may confirm whether there is
increase in SSRs CG% and dinucleotide lengths
in replication, repair and recombination genes
with increase in total number of SSRs. There is
also an indication that with increase in
pentanucleotide CG percentage, number of trinucleo
tide repeats may decrease. In the present study
trinucleotide repeats are present only in M. arthritidis
158L3-1, M. capricolum, M. mobile, M. penetrans
HF-2 and M. synoviae. Other studies have reported
trinucleotide repeats GAA (12) in M. gallisepticum
(Metzgar et al., 2002) but not in replication, repair
and recombination genes. Other studies in complete
genomes has shown long tracts of mononucleotide
repeats in non-coding regions and trinucleotide
repeats in both coding and non-coding regions of M.
gallisepticum, M. hyopneumoniae, M. genitalium, M.
pneumoniae etc. (Field and Wills, 1998; Mrzek,
2006). These repeats are AT rich which may not
necessarily show correlation with genome AT
richness (Field and Wills, 1998) which corresponds
with present study as significant positive correlation
of genome CG richness is seen only with
pentanucleotide number. However, study on 19
archaea genomes shows positive correlation of CG
richness of genomes with repeat CG richness
(Trivedi, 2006). Significance of presence of higher
number of dinucleotides in the present study is not
evident and is contrary to studies that show
abundance and tolerance for trinucleotide repeats in
coding sequences of most genomes studied so far
(Hancock and Santibanez-Koref, 1998; Metzgar et
al., 2000; Katti et al., 2001; reviewed in Li et al.,
2002) except some archaea (Trivedi, 2006).
However, trinucleotides are prone to mutations due
to replication slippage (Chambers and MacAvoy,
2000; Hartenstine et al., 2000; Kruglyak et al., 2000;
Fabre et al., 2002). Therefore, it is possible that the
genes associated with the replication process itself
avoid these repeats to ensure few mutations in
mycoplasmas.
In the following sections different gene groups
are discussed.
Methylase
This study shows maximum number of SSRs
association with methylase genes in M.
hyopneumoniae 232, M. hyopneumoniae 7448, M.
hyopneumoniae J and M. pulmonis among thirteen
mycoplasmas. Total five SSRs (all dinucleotides)
found in methylase genes in M. pulmonis is
consistent with other studies (Mrzek, 2006; Guo and
Mrzek, 2008). However, methylase genes in other
mycoplasmas (M. hyopneumoniae 232, M.
hyopneumoniae 7448 and M. hyopneumoniae J) and
in methyltrans ferase gene of M. mobile in the
present study show presence of tetranucleotide

67
repeats. Frame-shift mutations caused in either di-
or tetra-nucleotide (of the present study) repeats
in these genes may facilitate altered methylation
patterns and influence gene expression thus may
indirectly contribute to antigenic variations that
could help in evasion of host immune response
(Rocha and Blanchard, 2002; Mrzek, 2006; Guo
and Mrzek, 2008).
DNA polymerase, excinuclease, gyrase and
topoisomerase
Among replication, repair and recom bination
genes; M. mobile, M. pneumoniae, M. synoviae
have repeats in DNA polymerase. Excinuclease
genes have SSRs in M. capricolum, M.
pneumoniae and M. synoviae and topoisomerase
genes have SSRs in M. capricolum, M.
gallisepticum and M. mycoides. However, gyrase
genes have SSR only in M. arthritidis 158L3-1
and single strand binding proteins (SSBP) only in
M. capricolum. SSRs association with DNA
polymerase, gyrase and SSBP genes besides other
essential as well as housekeeping genes has also
been reported in other prokaryotes including
mycoplasmas. Guo and Mrzek (2008) speculate
that variation in essential genes like replication,
repair and recombination genes (except
methylase) in prokaryotes may not be helpful but
possibly these SSRs affect transcription initiation.
However, there is a possibility that these SSRs
are once again providing most of these pathogens
opportunity to evade antibiotics. This hypothesis
gets its support from the fact that many
prokaryotes including mycoplasmas are becoming
resistant to fluoroquinolones that are broad-
spectrum antibiotics like ofloxacin (OFX),
ciprofloxacin (CFX) and sparfloxacin (SFX)
targeted against proteins like topoisomerase II
family, DNA gyrase and topoisomerase IV. Some
mycoplasmas have developed resistance against
these drugs due to mutations in target regions of
these enzymes (Bbar et al., 1998). Therefore it
is suggested that those drugs would be more
effective that would target at least two
proteins/genes simultaneously to block of slow
down DNA replication. This is because two
mutations simultaneously in two genes to evade
antibiotics would be rare and hence it may be
more effective as it has been suggested in studies
done on Staphylococcus aureus (Fournier et al.,
2000).
Similarly, there are mutants against antibiotics
that target Mycoplasma ribosomes (Pereyre et al.,
2002). It is possible that SSRs in the rRNA genes
(Guo and Mrzek, 2008) (but not part of this study)
may be providing genetic variability to the pathogen
to evade altered living environment due to antibiotics
against their ribosomes.
Functions of SSRs
SSRs may play diverse roles in genomes of different
organisms. Some of these repeats act as contingency
loci in association with families of surface antigens
in pathogens, affect DNA supercoiling, gene
expression or recombination hotspots. M.
gallisepticum major surface protein pMGA
expression switching from pMGA1.1 to pMGA1.2 is
associated with (GAA)(12) repeat and variations in
length (Glew et al., 2000; Liu et al., 2000; Liu et al.,
2002). M. pneumoniae, M. genitalium, Ureaplasma
urealyticum and M. pulmonis have recombination
potentials in different genomic regions. In particular
M. pulmonis has illegitimate recombination at the vsa
locus. M. pneumoniae and M. genitalium adhesins
have large distant repeats that may be responsible for
homologous recombination for variation (Rocha and
Blanchard, 2002). However, M. hyopneumoniae have
fewer repeats compared to other mycoplasma.
Therefore, it is intriguing how M. hyopneumoniae
evades host immune response and establishes chronic
infection in absence of repeats (Minion et al., 2004).
Not all SSRs may be related with these functions.
For example, repeats in M. hyopneumoniae may not
be contingency loci as these appear independent of
location upstream or downstream of genes. Further,
among 3 M. hyopneumoniae strains study shows that
the An and Tn repeats may be rarely involved in
genome rearrangements (Mrzek, 2006).
Conclusion
The diversity of repeat numbers and motifs may be
due to diversity of host environments and selection
pressures that different mycoplasmas live in. It is
also possible that SSRs are present in regions of
those segments where the amino acid coded by SSRs
may help in flexibility of protein fold (disordered
region). This may enable the protein to be more
flexible in terms of protein-protein interactions and
may have multiple partners, hence making them
possible hubs of protein interaction networks
(Mrzek, 2006). However, in the present study, the
possible role of SSRs in these genes/proteins
involves DNA binding capacity. Any mutation in
these SSRs or other regions of the protein may affect
Seema TRIVEDI

68
DNA-protein interaction and hence affect
replication efficiency. Since there are antibiotics
targeted against replication enzymes, these SSRs
may be involved in providing platform for small
mutations that are not large enough to totally
affect functions of DNA replication, repair and
recombination but are efficient enough to evade
the antibiotics.
Acknowledgements
The author is grateful to Department of
Biotechnology (DBT, Ministry of Science and
Technology, India) for funding this work.
References
Achaz G, Rocha EPC, Netter P and Coissac E.
Origin and fate of repeats in bacteria. Nucleic
Acids Res. 30: 2987-2994, 2002.
Bachtrog D, Agis M, Imhof M and Schlotterer C.
Microsatellite varia bility differs between
dinucleotide repeat motifs - evidence from
Drosophila melanogaster. Mol Biol Evol. 17:
1277-1285, 2000.
Bachtrog D, Weiss S, Zangerl B, Brem G and
Schlotterer C. Distribution of dinucleotide
microsatellites in the D. melanogaster
genome. Mol Biol Evol. 16: 602-610, 1999.
Bbar CM, Renaudin H, Charron A, Bov JM,
Bbar C and Renaudin J. Alterations in
Topoisomerase IV and DNA gyrase in
quinolone-resistant mutants of Mycoplasma
hominis obtained In Vitro. Antimicrob Agents
Chemotherapyapy. (42)9:2304-2311, 1998.
Bencina D. Haemagglutinins of pat-hogenic avian
mycoplasmas. Avian Pathol. 6: 535-47, 2002.
Butcher RD, Hubbard SF and Whitfield WG.
2000. Microsatellite frequency and size
variation in the part henogenetic parasitic
wasp Venturia canescens (Gravenhorst)
(Hymen optera: Ichneumonidae). Insect Mol
Biol. 9: 375-384.
Chambers KG and MacAvoy ES. Microsatellites:
Consensus and cont roversy. Comp Biochem
Physio (Part B). 126: 455-476, 2000.
Cooper G, Rubinsztein DC and Amos W.
Ascertainment bias cannot entirely account for
human microsatellites being longer than their
chimpanzee homologues. Hum Mol Genet. 7:
1425-9, 1998.
de Castro LA, Rodrigues Pedroso T, Kuchiishi SS,
Ramenzoni M, Kich JD, Zaha A, Henning
Vainstein M and Bunselmeyer Ferreira H.
Variable number of tandem amino acid repeats in
adhesion-related CDS products in Mycoplasma
hyopneu moniae strains. Vet Microbiol. (4): 258-
69, 2006.
Fabre E, Dujon B and Richard GF. Transcription and
nuclear transport of CAG/CTG trinucleotide
repeats in yeast. Nucleic Acids Res. 30(16): 3540-
7, 2002.
Field D and Wills C. Abundant microsatellite
polymorphism in Saccharomyces cerevisiae, and
the different distributions of micro satellites in
eight prokaryotes and S. cerevisiae, result from
strong mutation pressures and a variety of
selective forces. Proc Natl Acad Sci USA. 95:
16471652, 1998.
Fournier B, Zhao X, Lu T, Drlica K and Hooper DC.
Selective targeting of Topoisomerase IV and
DNA gyrase in Staphylococcus aureus: different
patterns of quinolone-induced inhi bition of DNA
synthesis. Antimicrob Agents Chemotherapy.
44(8): 21602165, 2000.
Glew MD, Browning GF, Markham PF and Walker
ID. pMGA phenotypic variation in Mycoplasma
gallisep ticum occurs in vivo and is mediated by
trinucleotide repeat length variation. Infect
Immun. 68(10): 6027-33, 2000.
Guo X and Mrzek J. Long simple sequence repeats
in host-adapted pathogens localize near genes
encoding antigens, housekeeping genes, and
pseudogenes. J Mol Evol. 67(5): 497-509, 2008.
Hancock JM and Santibanez-Koref MF.
Trinucleotide expansion diseases in the context of
micro- and minisatellite evolu tion. EMBO J. 17:
5521-5524, 1998.
Hancock JM. Genome size and accumulation of
simple sequence repeats: implications of new data
from genome sequencing projects. Genetica. 115:
93-103, 2002.
Hancock JM. Simple sequences and the expand ing
genome. Bioessays. 18: 421-425, 1996b.
Hancock JM. Simple sequences in a minimal
genome. Nat Genet. 14: 14-15, 1996a.
Hartenstine MJ, Goodman MF and Petruska J. Base
stacking and even/odd behavior of hairpin loops
in DNA triplet repeat slippage and expansion
with DNA polymerase. J Biol Chem. 275: 18382-
18390, 2000.

69
Hawley DM, Sydenstricker KV, Kollias GV and
Dhondt AA. Genetic diversity predicts
pathogen resistance and cell-mediated
immunocompetence in house finches. Biol
Lett. 1(3): 326-9, 2005.
Jiang HX, Chen JR, Yan HL, Li XN, Chen ZL
and Zeng ZL. Molecular variability of DR-1
and DR-2 within the pvpA gene in
Mycoplasma gallisepticum isolates. Avian Dis.
53(1): 124-8, 2009.
Karlin S, MrzekJ and Campbell AM. Compo
sitional biases of bacterial genomes and
evolutionary impli cations. J Bacteriol. 179:
3899-3913, 1997.
Katti MV, Ranjekar PK and Gupta VS.
Differential distribution of simple sequence
repeats in eukaryotic genome sequences. Mol
Biol Evol. 18: 1161-1167, 2001.
Kruglyak S, Durrett R, Schug D and Aquadro CF.
Distribution and abun dance of micro satellites
in the yeast genome can be explained by a
balance between slippage events and point
mutations. Mol Biol Evol. 17(8): 1210-1219,
2000.
Li Y, Korol AB, Fahima T, Beiles A and Nevo E.
Microsatellites: genomic distribution, puta tive
functions and mutational mechanisms: a
review. Molec Eco. 11: 2453-2465, 2002.
Lim S, Notley-McRobba L, Lim M and Carter
DA. A comparison of the nature and
abundance of micro satellites in 14 fungal
genomes. Fungal Genet Biol. 41: 1025-1036,
2004.
Liu L, Dybvig K, Panangala VS, van Santen VL
and French CT. GAA trinucleotide repeat
region regulates M9/pMGA gene expression
in Mycoplasma gallisepticum. Infect Immun.
68(2): 871876, 2000.
Liu L, Panangala VS and Dybvig K. Trinucleotide
GAA repeats dictate pMGA gene expression
in Mycoplasma gallisepticum by affect ing
spacing between flanking regions. J Bacteriol.
184(5): 13351339, 2002.
Lysnyansky I, Calcutt MJ, Ben-Barak I, Ron Y,
Levisohn S, Meth BA and Yogev D.
Molecular characterization of newly identified
IS3, IS4 and IS30 insertion sequence-like
elements in Mycoplasma bovis and their
possible roles in genome plasticity. FEMS
Micro Biol Lett. 294(2): 172-82, 2009.
McAuliffe L, Ayling RD and Nicholas RA.
Identification and charac terization of variable-
number tandem -repeat markers for the molecular
epidemiological analysis of Mycoplasma
mycoides subspecies mycoides SC. FEMS Micro
Biol Lett. 276(2): 181-8, 2007.
McAuliffe L, Churchward CP, Lawes JR, Loria G,
Ayling RD and Nicholas RA. VNTR analysis
reveals un expected genetic diversity within
Mycoplasma agalactiae, the main causative agent
of contagious agalactia. BMC Microbiol. 8: 193,
2008.
Mekchay S, Ponsuksili S, Schellander K and
Wimmers K. Association of the porcine C3 gene
with haemolytic complement activity in the pig.
Genet Sel Evol. 35(Suppl 1): S83-96, 2003.
Metzgar D, Bytof J and Wills C. Selection against
frameshift muta tions limits microsatellite
expansion in coding DNA. Genome Res. 10: 72-
80, 2000.
Metzgar D, Liu L, Hansen C, Dybvig K and Wills C.
Domain-level differences in micro satellite distri
bution and content result from different relative
rates of insertion and deletion mutations. Genome
Res. 12(3): 408-13, 2002.
Minion FC, Lefkowitz EJ, Madsen ML, Cleary BJ,
Swartzell SM and Mahairas GG. The genome
sequence of Mycoplasma hyopneumoniae strain
232, the agent of swine mycoplasmosis. J
Bacteriol. 186(21): 7123-33, 2004.
Mrzek J, Guo X and Shah A. Simple sequence
repeats in prokaryotic genomes. Proc Natl Acad
Sci USA. 104(20): 8472-7, 2007.
Mrzek J. Analysis of distribution indicates diverse
functions of simple sequence repeats in
Mycoplasma genomes. Mol Biol Evol. 23(7):
1370-85, 2006.
Musatovova O, Kannan TR and Baseman JB.
Genomic analysis reveals Mycoplasma
pneumoniae repetitive element 1-mediated
recombination in a clinical isolate. Infect Immun.
76(4): 1639-48, 2008.
Pereyre S, Gonzalez P, De Barbeyrac B, Darnige A,
Renaudin H, Charron A, Raherison S, Bbar C
and Bbar CM. Mutations in 23S rRNA account
for intrinsic resistance to macrolides in
Mycoplasma hominis and Mycoplasma
fermentans and for acquired resistance to
macrolides in M. hominis. Antimicrob Agents
Chemotherapy. 46(10): 3142-50, 2002.
Seema TRIVEDI

70
Primmer CR, Raudsepp T, Chowdhary BP,
Moller AP and Ellegren H. Low frequency of
microsatellites in the avian genome. Genome
Res. 7: 471-482, 1997.
Rocha EP, Blanchard A. Genomic repeats,
genome plasticity and the dynamics of
Mycoplasma evolution. Nucleic Acids Res.
30(9): 2031-42, 2002.
Simmons WL and Dybvig K. Biofilms protect
Mycoplasma pulmonis cells from lytic effects
of complement and gramicidin. Infect Immun.
75(8): 3696-9, 2007.
Sluijter M, Spuesens EB, Hartwig NG, van
Rossum AM and Vink C. The Mycoplasma
pneumoniae MPN490 and Mycoplasma
genitalium MG339 genes encode reca
homologs that promote homologous DNA
strand exchange. Infect Immun. 77(11): 4905-
11, 2009.
Toth G, Gaspari Z and Jurka J. Microsatellites in
different eukaryo tic genomes: survey and
analysis. Genome Res. 10: 967-981, 2000.
Trivedi S. Comparison of simple sequence repeats
in 19 Archaea. Genet Mol Res. 5(4): 741-72,
2006.
Trivedi S. Do Microsatellites Have Biased
Associations? The Nucleus. 46(1,2): 61-76,
2003.
Trivedi S. Microsatellites (SSRs): Puzzles within
puzzle. Indian J Biotech. 3: 331-347, 2004.
Journal of Cell and Molecular Biology 7(2) & 8(1): 71-72, 2010 Software Review
Tcoffee : Multipurpose sequence alignments program
Authors: C. NOTREDAME, L. HOLME D.G. HIGGINS, J . HERINGA, O.
O'SULLIVAN, K SUHRE, C. ABERGEL
License: Open source freeware

Tcoffee at a glance
T-Coffee stands for Tree based Consistency
Objective Function for Alignment Evaluation. It is
a recent program for making multiple sequence
alignments. It yields more accurate alignments at
the cost of a slightly longer running time than other
programs. Although it uses a progressive alignment
method like ClustalW, it compares segments across
the entire sequence set, which means aligning all
the sequences at the same time. The main
difference between Tcoffee and ClustalW is that
Tcoffee doesnt directly use substitution matrices to
align sequences. It has many different applications
and modules such as the main EXPRESSO for
aligning sequences and structures, CORE for
evaluating the accuracy of an alignment, Mcoffee
for combining many alternative multiple sequence
alignments into one. Briefly, Tcoffee could be
described as a collection of tools for computing,
evaluating and manipulating multiple alignments of
DNA, RNA and protein sequences and structures.
Tcoffee and its contribution to research
Recently, many researchers in the field of
molecular biology have used Tcoffee modules in
building, computing, evaluating and manipulating
multiple sequence alignments during their original
research. Although Tcoffee has been produced and
developed few years ago, it has been cited in many
peer reviewed articles. However the number of
citations is still not comparable to ClustalW. Beside
its quick ability to produce results, the open source
freeware license and its efficient multifunctional
modules make Tcoffee one of the most useful
programs for making multiple sequence alignments.

Advantages and disadvantages of Tcoffee
Advantages
- It produces more accurate alignments than the
other methods.
- It is equipped with many different tools and
modules such as CORE, Mcoffee and
EXPRESSO for structure alignment, evaluation
and combining alignments.
- Tcoffee can deal with many input formats,
including FASTA, Swiss-Prot and PIR (Protein
Information Resource).
- Tcoffee produces sequence alignment in various
formats so that it can be used as an input for
another program. It also produces a colorized
alignment where every residue appears on a
background that indicates the quality of this
alignment in (.html) and (.pdf) format.
- It can produce true phylogenetic tree in Newick
format by using the Neighbor J oining method.
- It can work with list of DNA, RNA or protein
sequences.
- Tcoffee can evaluate the quality of any multiple
sequence alignments using CORE server.
Disadvantages
- It takes longer time to align multiple sequences
than other programs.
- It has been cited in limited number of peer
reviewed journals compared to ClustalW.
However, this number is increasing rapidly
every day.

72
Software design
T-Coffee is an open source freeware. It can
generate multiple sequence alignment for a given a
set of sequences (Protein, RNA or DNA). The latest
version of T-Coffee is 5.65. It runs on UNIX or
Microsoft Windows/Cywin. Version 2.00 and
higher can combine sequences and structures. It
uses bioperl in the design. The interface is self
explanatory with no complicated terms and
expression. EXPRESSO aligns the structures using
SAP, a program from Taylor and Orengo, and it
aligns sequences and structures using FUGUE, a
threading package from Kenji Mizuguchi
(developed in Tom Blundells lab at Cambridge
University). CORE server on www.tcoffee.org can
evaluate the quality of any multiple sequence
alignments with any of the most common formats
(MSF, ALN, FASTA, and PIR).
Limitations in use
- The input for Tcoffee is limited to a maximum
number of sequences of 50 and the maximum
length of sequences of 2000.
- The data will remain available on the server for
only nine days. Then it will be deleted.
- It is very important to cite the Tcoffee authors
when using its resources. For instance, if you
use the local version of Tcoffee, cite the
following paper:-
Notredame, D. Higgins, J . Heringa . T-Coffee: A
novel method for multiple sequence alignments.
J ournal of Molecular Biology, Vol 302, pp205-
217,2000.
Otherwise, cite the paper that corresponds to the
server you have been using (click on the "cite"
button associated with every server on
www.tcoffee.org).
New features, flavors and tools of Tcoffee
Alignment
TCOFFEE (Regular or advanced): Computes a
multiple sequence alignment and the associated
phylogenetic tree.

EXPRESSO (3DCoffee) (Regular or advanced):
This server computes structure based Multiple
Sequence Alignments.
MCOFFEE (Regular or advanced): Computes a
multiple sequence alignment and the associated
phylogenetic tree by combining the output of
several multiple sequence alignment packages
(PCMA, Poa, Mafft, Muscle, T-Coffee,
ClustalW, ProbCons, DialignT).
COMBINE (Regular or advanced): combines two
(or more) multiple sequence alignments into a
single one.
RCOFFEE (Regular or advanced): Multiple
Sequence Alignment of Non Coding RNA
Sequences using RNAplfold predicted
secondary structures.
Evaluation
CORE (Regular or advanced): evaluates your
Alignment and outputs a colored version where
bad portions are in blue and the good ones in
red. Your alignment must contain at least four
sequences
iRMSD-APDB (Regular or advanced): Evaluates
your Multiple Sequence Alignment using
APDB which estimates the proportion of
columns correctly aligned in a pairwise or a
multiple alignment of sequences with known
structures.
List of Tcoffee servers availability around
the world
- www.tcoffee.org
- http://tcoffee.vital-it.ch/cgi-
bin/Tcoffee/tcoffee_cgi/index.cgi
- http://www.es.embnet.org/Services/MolBio/t-
coffee/
- http://www.ebi.ac.uk/t-coffee/
Ahmed MANSOUR
Genetics Department,
Faculty of Agriculture,
Zagazig University, Egypt
(author for correspondence; amansour@zu.edu.eg)
Received: 27 March 2008; Accepted: 11 December 2009

73
Tcoffee
: ok amal dizi hizalama program

Yazarlar: C. NOTREDAME, L. HOLME D.G. HIGGINS, J. HERINGA, O.
O'SULLIVAN, K SUHRE, C. ABERGEL
Lisans: Ak kaynak, cretsiz yazlm

Tcoffeeye ksa bir bak
T-coffee "Aa Bazl Tutarllk Uyum Ama
Fonksiyonunun Deerlendirilmesi" anlamna
gelmektedir. oklu dizi hizalamas yapmak iin
kullanlan yeni bir programdr. Biraz daha uzun
alma zaman pahasna dier programlardan daha
kesin hizalama salamaktadr. ClustalW gibi
progresif bir program kullanmasna ramen ayn
zamanda hizalanm btn sekanslar ifade eden
btn sekans setiyle karlatrmaktadr. Tcoffee
sekanslar hizalamak iin matris yer deiimini
direkt olarak kullanmamasdr. Tcoffee ve
ClustalW arasndaki ana fark Tcoffee'nin sekanslar
hizalamak iin matris yer deiimini direkt olarak
kullanmamasdr.. Balca dizi ve yaplarn
hizalanmas iin EXPRESSO, bir hizalamann
kesinliini deerlendirmek iin CORE, birok
alternatif oklu dizi hizalamalarn tek olarak
birletirmek iin Mcoffee gibi ok farkl
uygulamalar ve modllere sahiptir. Ksaca, Tcoffee
DNA, RNA ve protein dizileri ve yaplarnn oklu
dizi hizalamasn kullanma, hesaplama ve
deerlendirme iin bir alet topluluuymu gibi
tanmlanabilir.
Tcoffee ve aratrmaya katks
Son zamanlarda, molekler biyoloji alanndaki
birok aratrmac orijinal aratrmalar sresince
oklu dizi hizalamas yapmak, maniple etmek,
hesaplamak ve deerlendirmek iin Tcoffee
modllerini kullanmaktadr. Tcoffee birka yl nce
retilmi ve gelitirilmi olmasna ramen, birok
derlenmi edzey makalede atfta bulunulmutur.
Ancak atf says hala ClustalW ile karlatrla-
maz. Sonular hzl elde etme zelliine ilaveten,
ak kaynak cretsiz yazlm lisans ve ok
fonksiyonlu etkili modlleri, Tcoffeeyi oklu dizi
hizalamas iin en kullanl programlardan biri
yapar.
Tcoffeenin avantajlar ve dezavantajlar
Avantajlar
- Dier metodlardan daha kesin karlatrmalar
ortaya koyar.
- Yap hizalama, hesaplama ve hizalamalar
birletirme iin CORE, Mcoffee ve EXPRESSO
gibi birok farkl aletle ve modlle donatlmtr.
- Tcoffee; FASTA, Swiss-Prot ve PIR (Protein
Information Resource, Protein bilgi kayna) da
dahil birok input formatn dzenlemek iin
aabilir.
- Tcoffee eitli fomatlarda dizi hizalamas yapar.
Bundan dolay baka bir program iin bir input
olarak kullanlabilir. Ayrca (.html) ve (pdf)
formatnda bu hizalamann kalitesini belirten bir
arka plan zerinde her kalntnn grnd
yerde renklendirilmi bir hizalama yapar.
- Neighbor Joining metodunu kullanarak Newick
formatnda doru filogenetik aa oluturabilir.
- DNA, RNA veya Protein dizileri listesiyle
alabilir.
- Tcoffee CORE sunucusunu kullanarak herhangi
oklu dizi hizalamasnn kalitesini deerlendir-
ebilir.
Dezavantajlar
- oklu dizileri karlatrmada dier
programlardan daha uzun zaman alr.
- ClustalWe gre snrl sayda derlenmi
edzey dergide atfta bulunulmutur. Ancak bu
say her gn hzlca artmaktadr.

74
Yazlm Dizayn
T-Coffee bir ak kaynak cretsiz yazlmdr.
Verilen bir dizi seti (Protein, DNA ya da RNA) iin
oklu dizi hizalamas oluturmaktadr. Tcoffeenin
en son versiyonu 5.65tir. UNIX ya da Microsoft
Windows/Cywin ile alr. Srm 2.00 ve zeri
yaplar ve dizileri birletirebilir. Bu dizaynda
Bioperl kullanr. Arabirim karmak olmayan terim
ve anlatmlarla kendiliinden anlalr.
EXPRESSO, Taylor ve Orengo tarafndan yazlan
bir program olan SAP kullanarak yaplar hizaya
sokar. Dizileri ve yaplar Kenji Mizuguchiden bir
dizi paketi (Cambridge niversitesinde Tom
Blundells Laboratuarnda gelitirilen) olan
FUGUEyi kullanarak hizaya sokar.
www.tcoffee.org zerinde CORE sunucusu en
yaygn formatlarn (MSF, ALN, FASTA ve PIR)
herhangi biriyle oklu dizi hizalama kalitesini
deerlendirebilir.
Kullanmda snrlamalar
- Tcoffee iin input maksimum dizi says 50 ve
maksimum dizi uzunluu 2000e kadar
snrlandrlmtr.
- Veriler sunucu zerinde sadece dokuz gn
kullanlabilir olarak kalacaktr. Sonra
silinecektir.
- Kaynaklarn kullanrken Tcoffee yazarlarna
atfta bulunmak nemlidir. rnein,
Tcoffeenin snrl srmn kullanrsanz
belirtilen makaleye atfedin:-
Notredame, D. Higgins, J. Heringa . T-Coffee: A
novel method for multiple sequence alignments.
Journal of Molecular Biology, Vol 302, pp205-
217, 2000.
Aksi takdirde, kullandnz sunucuya karlk
gelen makaleye atfta bulunun
(www.tcoffee.org zerindeki her sunucuyla
alakal cite tuuna tklayarak).
Tcoffeenin aygtlar, belirli zellikleri ve
yeni zellikler

Hizalama
TCOFFEE (normal ya da gelimi dzeyde): oklu
dizi hizalama ve ilikilendirilmi filogenetik
aac hesaplar.
EXPRESSO (3DCoffee) (normal ya da gelimi
dzeyde): Bu sunucu yap temelli oklu Dizi
Hizalamalarn hesaplar.
MCOFFEE (normal ya da gelimi dzeyde):
Birka oklu dizi hizalama paketininin (PCMA,
Poa, Mafft, Muscle, T-Coffee, ClustalW,
ProbCons, DialignT) outputunu (k)
birletirerek oklu dizi hizalama ve iliki-
lendirilmi filogenetik aac hesaplar.
COMBINE (normal ya da gelimi dzeyde): iki
(veya daha fazla) oklu dizi hizalamalarn tek
bir tanesinde birletirir.
RCOFFEE (normal ya da gelimi dzeyde):
RNAplfold tarafndan oluturulan tahmini
ikincil yaplar kullanarak Kodlanmayan RNA
Dizilerinin oklu Dizi Hizalamas.
Deerlendirme
CORE (normal ya da gelimi dzeyde):
Hizalamanz ve kt ksmlarnn mavi iyi
olanlarn krmz olduu renkli ktlarnz
deerlendirir. Hizalamanz en azndan drt dizi
iermelidir.
iRMSD-APDB (normal ya da gelimi dzeyde):
kili olarak doru bir ekilde hizalanm ya da
yaplar bilinen dizilerin oklu hizalamasnda
stunlarn orann tahmin eden APDB
kullanarak oklu Dizi Hizalamasn deer-
lendirir.
Dnya apnda kullanlabilir Tcoffee
sunucular listesi
- www.tcoffee.org
- http://tcoffee.vital-it.ch/cgi-
bin/Tcoffee/tcoffee_cgi/index.cgi
- http://www.es.embnet.org/Services/MolBio/t-
coffee/
- http://www.ebi.ac.uk/t-coffee/
Ahmed MANSOUR
Genetik Blm,
Ziraat Fakltesi,
Zagazig niversitesi, Msr
UCSC: Genome Browser for genomic sequences
Authors: UCSC Genome Bioinformatics Group led by David Haussler and J im Kent,
Center for Biomolecular Science & Engineering, University of California
License: Free for academic, non-profit, and personal use. A license is required for
commercial use.

Genome browser at a glance
Genome Browser is a tool for collecting all relevant
genomic sequence data in one site and provides
rapid, reliable, and simultaneous display of any
requested portion of genomes at any scale in a
graphical design. The UCSC Genome Browser
resource contains the reference (or official) public
DNA sequences and working draft assemblies for
human and a large collection of other genomes.
There are a number of tools within this site that
provides access to the sequences themselves, and
many other useful genome features to add context
to the genomic information. Researchers can use
this site to find genes and gene predictions,
expression information, SNPs and variations, cross-
species comparative data, and many more.
Moreover, the UCSC provide the ability to search
for markers and sequences, to extract annotations
for specific regions or for the whole genome, and to
act as a central starting point for genomic research.
It also provides a portal to the ENCODE project.
UCSC genome browser contribution to
research
Molecular biologists use UCSC genome browser
modules during their original research tools such
"Genome Browser", "Gene Sorter", 'Blat", "Table
Browser", "VisiGene" and "Genome Graphs" all of
which allow the user to navigate, sort, blast,
visualize and analyzes genomic data for reliable
annotation.
Moreover, researchers can learn more about
the object (e.g., known genes, conservation, or
SNPs, etc.) via researching by simply position the
mouse over information line and click, then a new
web page will appear with important details and
information. The Page Index box usually includes
sequences, microarray data, mRNA secondary
structure, protein domain structure, homologues in
other species, gene ontology descriptions, mRNA
descriptions and pathways, etc. This wealth of
information is more than enough for a molecular
biologist as a start point for genomic research.
Colours language in UCSC genome browser
Colors have important meanings in UCSC genome
browser. For instance, the Black color in gene track
indicates a protein data bank (PDB) structure entry
for this genome fragment. Dark blue indicates
NCBI-reviewed sequence, while light blue
corresponds to provisional sequences. In addition,
SNP types are also color-coded. More information
about any specific color representation and
annotation or descriptive information can be
obtained by clicking the hyperlink of the track.
Advantages and disadvantages of UCSC
genome browser
Advantages
- UCSC Genome Browser is very easy to use and
free of charge online.
- UCSC uses the same interface and display for
each of the species listed.
- In addition, UCSC can run on (almost) any
computer that has access to internet and can
return the results online or by e-mail.
- The Genome Viewer page provides several
options to make changes
- Text search strategy can be used by typing in
gene name, gene symbol, or ID, etc.
- "Automatic Zoom" and "Recenter Action" are
handy features to automatically re-center the
image where you click

76
- The Custom Track hyperlink on the UCSC
home page allows the user to create custom
tracks of his data.
Limitations
- The number of available genomes are limited,
especially plant genomes.
- Different species have different annotation
tracks depending on the availability of data
assembly.
- "Automatic Zoom" can only zoom three folds.
- Not all the genes have the same levels of detail,
and not every species has all the information.
- BLAT allows to paste up to 25,000 bases,
10,000 amino acids, and up to a total of 25
sequences in the common FASTA
- Custom tracks are only persistent for 8 h and
needs to be re-done after 8 h if you have not
downloaded the file.
- The configuration options of the output format
offered by Protein Duster program are limited.
UCSC genome viewer tracks
The Genome Viewer section features have the
following tracks:
(1) Mapping and Sequencing Tracks;
(2) Phenotype and Disease Associations;
(3) Genes and Gene Prediction Tracks;
(4) mRNA and EST Tracks;
(5) Expression and Regulation;
(6) Comparative Genomics, Variation, and Repeats;
(7) ENCODE Regions and Genes;
(8) ENCODE Transcript Levels;
(9) ENCODE Chromatin Immunoprecipitation;
(10) ENCODE Chromosome, Chromatin, and DNA
Structure; and ENCODE Comparative.
Different Genome browsers online
UCSC genome browser (http://genome.ucsc.edu/)
Ensembl genome browser
(http://www.ensembl.org)
VISTA (http://genome.lbl.gov)
NCBI MapViewer
(http://www.ncbi.nlm.nih.gov/mapview/)
ECR Browser (http://ecrbrowser.dcode.org)
Combo
(http://www.broad.mit.edu/annotation/argo/)

77

Genomics and ENCODE Variation
UCSC Genome Browser website tools
TOOL NAME FUNCTION
Genome Browser
Zooms and scrolls over chromosomes, showing the work of annotators
worldwide
Gene Sorter
Shows expression, homology and other information on groups of genes
that can be related in many ways.
Blat Quickly maps your sequence to the genome.
Table Browser Provides convenient access to the underlying database
VisiGene
Lets you browse through a large collection of in situ mouse and frog
images to examine expression patterns
Genome Graphs Allows you to upload and display genome-wide data sets

Ahmed MANSOUR
Received: 01 September 2008; Accepted: 11 December 2009

78
UCSC: Genomik diziler iin Genom Taraycs
Yazarlar: David Haussler ve Jim Kent liderliinde UCSC Genom Biyoenformatii grubu,
Biyomolekler Bilim ve Mhendislik Merkezi, Kaliforniya niversitesi
Lisans: Akademik, kiisel ve kar amac gtmeyen durumlarda kullanm cretsizdir. Ticari
amala kullanm iin lisans gereklidir.

Bir bakta Genom Tarayc
Genom tarayc bir genomik dizi ile alakal tm
bilgileri bir sayfada toplayan ve genomun herhangi
bir blgesinin istenilen her lde grsel bir dizayn
ile gvenilir ve hzl bir ekilde grntlenmesini
salayan bir aratr. UCSC genom taraycs
kayna, insan genomu ve dier birok organizma
genomu iin resmi, referans veya taslak DNA
dizilerini iermektedir. Sayfada dizilere eriim
salayan aralarn yan sra bu dizilere dair
genomik enformasyona ilave yapabilen birok
zellik de vardr. Aratrmaclar bu sayfay bilinen
gen dizilerine, tahmini gen dizilerine,
ekspresyonlar ile ilgili bilgilere, trler aras
karlatrmal bilgiye, tek nkleotid
polimorfizmlerine ve varyasyonlarna ve daha
birok bilgiye erimek amacyla kullanabilirler.
UCSC ayrca markr dizi aranmasna, belirli bir
blge veya tm genom hakknda aklama elde
edilmesine olanak salayarak genom
aratrmalarnda balang noktas olarak ilev
grmektedir. ENCODE projesine de balant
salamaktadr.
UCSC Genom Taraycnn Aratrmalara
Katks
Molekler biyologlar UCSC genom tarayc
modllerini dizileri dzenlemeye, BLAST aramas
yapmaya, grntlemeye ve gvenilir bilgi iin
genomik verilerin analiz edilmesine olanak
salayan ''Genome Browser'', ''Gene Sorter'',
''BLAT'', ''Table Browser'',''VisiGene'' ve ''Genome
Graphs'' gibi esas aratrma aralar ile beraber
kullanmaktadrlar. Buna ek olarak aratrmaclar,
aratrma konular ile (rnein; bilinen genler,
korunum, tek nkleotid polimorfizmleri vb) ilgili
ek bilgilere fare imlecinin ''information'' kutusunun
zerine getirilip tklanmasyla alan ve nemli
bilgi ve detaylar barndran yeni sayfa aracl ile
ulaabilirler. Sayfa indeks kutusu genellikle dizileri,
mikroarray verilerini, ikincil mRNA yapsn,
protein yaplarn, dier trlerle olan homolojileri,
gen ontolojisi ile ilgili aklamalar ve aratrlan
gen ile alakal yolaklar ierir. Bu bilgi zenginlii,
genomik aratrmaya balang noktas olarak bir
molekler biyolog iin fazlasyla yeterlidir.
UCSC Genom Taraycda Renklerin Dili
UCSC genom taraycda renklerin nemli anlamlar
vardr. rnein gen girdisindeki siyah renk, protein
bilgi bankasnda (PDB) ilgili genom paras iin
protein yapsna dair bir girdi olduunu belirtir.
Koyu mavi renk NCBI tarafndan onaylanm
dizileri belirtirken ak mavi doruluu
onaylanmam dizileri belirtir. Tek nkleotid
polimorfizmi eitleri de renklerle kodlanmtr.
Belirli bir renk koduna dair bilgi, girdinin st
balantsna tklanarak elde edilebilir.
UCSC Genom Taraycnn Avantajlar ve
Dezavantajlar
Avantajlar
- UCSC Genom Taraycy kullanmak kolay ve
bedavadr.
- Listelenen btn trler iin ayn arayz ve
grnm kullanlmaktadr.
- Ayrca UCSC, internet eriimi olan neredeyse tm
bilgisayarlarda altrlabilir ve sonular internet
zerinden veya e-posta yoluyla elde
edilebilmektedir.
- ''Genome Viewer'' sayfas, deiiklik yapmak iin
birok olanak salamaktadr.
- Gen ismi, sembol veya kodu girilerek metin
aramas yaplabilmektedir.
- "Automatic Zoom" ve "Recenter Action" zellik-
leri tklanan noktada grnty ortalamak iin

79
olduka kullanldr.
- UCSC ana sayfasndaki ''Custom Track'' st
balants kullancya konu ilgili kendi kiisel
girdilerini oluturma imkan vermektedir.
Dezavantajlar
- Eriilebilir genomlarn zellikle de bitki
genomlarnn says olduka snrldr.
- O tre dair bilgilerin eriilebilirliine bal olarak,
farkl trlere ilikin farkl aklama girdileri
bulumaktadr.
- "Automatic Zoom" zellii grnty yalnzca 3
kat yaklatrabilmektedir.
- Her gen iin ayn bilgi detay ve her tr iin btn
bilgiler yoktur.
- ''BLAT'' 25000 baz, 10000 amino asit ve FASTA
formatnda 25 sekansn yklenmesine izin
verebilmektedir.
- Kiisel girdiler yalnzca sekiz saat iin geerlidir
ve dosya indirilmedii takdirde yeniden
oluturulmalar gerekmektedir.
- ''Protein Duster'' yazlm tarafndan sunulan kt
formatlarnn yaplandrma ayarlar snrldr.
UCSC Genom Grntleyici Girdileri
Genom Grntleyici blmnde aadaki girdi
kategorileri bulunmaktadr:
(1) Haritalama ve Dizileme Girdileri;
(2) Fenotip ve Hastalk likileri;
(3) Genler ve Tahmini Gen Girdileri;
(4) mRNA ve EST girdileri;
(5) Ekspresyon ve Reglasyon;
(6) Karlatrmal Genomik, eitlilik ve
Tekrarlar;
(7) ENCODE Blge ve Genleri;
(8) ENCODE Transkript Seviyeleri;
(9) ENCODE Kromatin mmnoprespitasyon;
(10) ENCODE Kromozom, Kromatin ve DNA
yaps; ve Karlatrmal ENCODE
eitli Genom Tarayclar
UCSC genome browser (http://genome.ucsc.edu/)
Ensembl genome browser
(http://www.ensembl.org)
VISTA (http://genome.lbl.gov)
NCBI MapViewer
(http://www.ncbi.nlm.nih.gov/mapview/)
ECR Browser (http://ecrbrowser.dcode.org)
Combo
(http://www.broad.mit.edu/annotation/argo/)

80
UCSC Genom Tarayc web sayfas aralar
ARA LEV
Genome Browser
Kromozom blgelerini yaknlatrmak, gezinmek, aklamalar
grebilmek.
Gene Sorter
eitli ekillerde ilikilendirilebilecek gen gruplarna dair ekspresyon,
homoloji ve dier bilgileri gstermek.
Blat Aratlan diziyi genoma hzl bir ekilde haritalamak.
Table Browser Temel veritabanna eriim salamak.
VisiGene
Ekspresyon kalplarnn incelenebilmesi iin in situ fare ve kurbaa
grntlerini taramak.
Genome Graphs Genom apnda verileri yklemek ve grntlemek.

Ahmed MANSOUR
Genetik Blm,
Ziraat Fakltesi,
Dotlet: powerful and easy strategy for pairwise comparisons
Authors: Marco PAGNI & Thomas JUNIER, form the Swiss Institute of Bioinformatics in
Epalinges, Switzerland.
License: Freeware

Dotlet at a glance
For a molecular biologist, making dot plots are the
simplest means for comparing two sequences. This
is because dot or matrix plots provide an easy and
powerful means of sequence analysis (Junier and
Pagni, 2000). For instance, it is very useful in
searching out regions of similarity between two
sequences and repeats regions within a single
sequence. In this regard, Dotlet is one of the most
user-friendly dot-plot programs available over the
internet. Dotlet program is a very convenient tool
for making dot plots because of it is free of charge,
easy to use, doesnt need any installation, and can
run on any computer that has access to internet.
Recently, it has been extensively used to build
pairwise comparisons in many peer-reviewed
scientific articles.
Dotlet history
The authors described the reason why they wrote
dotlet as they needed a diagonal plot tool during
their practical sessions in bioinformatics, in
December 1998, at the Institute of Biochemistry in
Switzerland. At that time, they needed a program
that would run in a web browser based on the
World-Wide Web. To my knowledge, this program
was the first dot plots software based on the
internet then.
Dotlet contribution to research
Many researchers in the field of Molecular biology
have used Dotlet modules in building Pairwise
Comparisons during their original research. With
many hundreds of citations, Dot let is widely cited
bioinformatic programs in biology. The freeware
license and its efficient modules beside its quick
ability to produce results make it one of the most
popular programs for making Pairwise
Comparisons nowadays.

Advantages and disadvantages of Dot plot
Advantages
- Dotlet is very easy to use and free of charge.
- Dotlet is an internet-based program that runs on
(almost) any computer that has access to the
internet.
- Dotlet is not a server but a Java applet which
means that everything Dotlet does, it does on
your own computer offline.
- Dotlet is safe to use because each sequence you
compare with Dotlet stays on your computer
- Dotlet can compare DNA, RNA and protein
sequences.
Disadvantages
- It needs some training and good experience to
interpret Dotlet results. In other words one must
learn how to fine-tune Dotlet to yield an
informative dot plot
- Dotlet cannot work with long sequences (more
than 10,000 amino acids or nucleotides).
- The speed of the program depends on your own
computer. The faster your computer, the faster
Dotlet runs. Differences become apparent with
sequences longer than 1.000 residues.
Software Design
- Dotlet is an open source freeware. It can
generate pairwise comparison for a given a
couple of sequences of proteins or DNA. It has
been built as a JAVA applet. The Dotlet source
code is available free of charge for academic
users.

82
The distribution is in
ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet.
Limitations in use
Dotlet is an ideal pairwise comparisons tool for
sequences with lengths of less than 10,000 amino
acids or nucleotides. So, it can be helpful for most
proteins sequences but is restricted to small DNA
sequences.
Dotlet availability online
(IBM users): http://myhits.isb-sib.ch/cgi-bin/dotlet
(Mac users):
http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html
Other online dot plot programs
Dnadot
This program can use a range of 100,000 long
characters of either proteins or DNA sequences and
it has been designed using Java language. Dnadot is
available online on the following URL:
http://arbl.cvmbs.colostate.edu/molkit/dnadot/
http://www.vivo.colostate.edu/molkit/dnadot/
Dotter
This program can use as long as 100.000 characters
of either proteins or DNA sequences like Dnadot,
However, it is designed to use Unix, Linux and
Windows as a platform. It is available online on the
following URL:
http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte
r.html
Dottup
Although this program is also using the same range
of DNA as the previous program, it can also be
used for complete genomes. It also uses Unix and
Linux as a platform. It is available online as a
useful integrated module in emboss package.
URL: http://emboss.sourceforge.net/
References
Junier T. and Pagni M. (2000) Dotlet: diagonal
plots in a web browser. Bioinformatics.
16(2):178-9.
Ahmed MANSOUR
Received: 01 September 2008; Accepted: 11 December 2009

83
Dotlet: kili karlatrmalar iin gl ve kolay strateji
Yazarlar: Marco PAGNI & Thomas JUNIER, the Swiss Institute of Bioinformatics,
Epalinges, Switzerland
Lisans: cretsiz

Ksa Bir Bakla Dotlet
Bir molekler biyolog iin, iki diziyi eletirmenin
en basit yolu dot blot yapmaktr. nk dot ya da
matriks blotlar dizi analizini kolay ve gl ekilde
salar. rnein, iki dizi arasndaki benzer
blgelerin ve bir dizideki tekrarlayan blgelerin
aratrlmasnda ok kullanldr. Bu bakmdan
Dotlet internet yoluyla ulalabilen dot-plot
programlarnn en kullanc dostu olandr. Dotlet
program cretsiz ve kolay kullanml olduu,
kuruluma ihtiyac olmad ve internete girilebilen
her bilgisayarda alabildii iin dot plotlar
yapmak iin ok uygun bir aratr. Son gnlerde
ok sayda benzer bilimsel makalede ikili
eletirmeleri yapmak iin yaygn olarak
kullanlmaktadr.
Dotletin Tarihi
Yazarlar, dotlet programn yazmalarnn sebebini
Aralk 1998de sviredeki Biyokimya
Enstitsnde kendi biyoinformatik almalar
srasnda diyagonal bir plota ihtiya duymalar
olarak akladlar. Bu arada world-wide web tabanl
web taraycsnda alabilen bir programa da
ihtiyalar vard. Bildiim kadaryla bu program o
zamanlarda internet tabanl ilk dot plot yazlmyd.
Dotletin Aratrmalara Katks
Molekler biyolojinin bu sahasndaki ou
aratrmac kendi orijinal aratrmalar sresince
ikili karlatrmalarn yaplandrlmasnda Dotlet
modllerini kullanmtr. Yaplan yzlerce atfla
Dotlet biyolojideki biyoinformatik programlar
arasndaki yerini almtr. Bu gnlerde cretsiz
yazlm lisans ve onun etkili modlleri dnda
sonu retme yeteneinin abukluu onu, ikili
karlatrmalar yapmak iin en popler program
haline getirmitir.
Dot Plotn Avantajlar ve Dezavantajlar
Avantajlar
Dotletin kullanm kolay ve cretsizdir.
Dotlet internet tabanl bir program olup
internete balanabilen her bilgisayarda
alabilir.
Dotlet sunucu bir program deildir ama
bilgisayarnz kapalyken Dotletin yapabildii
her eyi yapan bir Java uygulamasdr.
Dotletin kullanm Dotlet ile karlatrdnz
her dizi bilgisayarnzda kald iin gvenlidir.
Dotlet DNA, RNA ve protein dizilerini
karlatrabilir.
Dezavantajlar
Dotlet sonularn yorumlamak iin biraz
altrma ve iyi bir deneyim gerekmektedir.
Baka bir deyile, bilgi verici bir dot plot
salamak iin Dotlete nasl ince ayar
yaplaca renilmelidir.
Dotlet uzun diziler (10,000 amino asit ya da
nkleotitten daha fazlas) ile almayabilir.
Programn hz bilgisayarnza baldr.
Bilgisayarnz ne kadar hzlysa dotlet o kadar
hzl alr. 1000 rezidden daha uzun diziler
ile belirgin farkllklar oluabilir.
Yazlm Dizayn
Dotlet ak kaynakl bedava bir yazlmdr. Verilen
bir ift protein ya da DNA dizisi iin ikili
karlatrmalar retebilir. Java uygula-mac
olarak yaplandrlmaktadr. Dotlet kaynak kodu
akademik kullanclar iin cretsiz olarak
eriilebilir.
84
Datm:
ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet
Kullanm Snrlamalar
Dotlet 10,000 amino asit ya da nkleotitten daha
ksa uzunluktaki diziler iin ideal bir ikili
karlatrma aracdr. Bylece ou protein dizileri
iin yardmc olabilir ama ufak DNA dizileri iin
snrlanmtr.
evrimii Dotlet Eriilebilirlii
IBM users): http://myhits.isb-sib.ch/cgi-
bin/dotlet
(Mac users): http://www.isrec.isb-
sib.ch/java/dotlet/Dotlet.html
Dier evrimii Dot Plot Programlar
Dnadot
Bu program protein ya da DNA dizilerinin 100,000
uzunluundaki bir dizi karakterini kullanabilir ve
Java dilini kullanarak dizayn edilebilir. Dnadota
aadaki URL ile evrimii ulalabilir:
http://arbl.cvmbs.colostate.edu/molkit/dnadot/
http://www.vivo.colostate.edu/molkit/dnadot/
Dotter
Bu program da protein ya da DNA dizilerinin
100,000 uzunluundaki bir dizi karakterini Dnadot
gibi kullanabilir. Bununla birlikte, platform olarak
Unix, Linux ve Windows kullanlarak dizayn
edilebilir. Aadaki URL ile evrimii eriilebilir:
http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte
r.html
Dottup
Bu program nceki program gibi DNAnn ayn
araln kullanmasna ramen tm genom iin de
kullanlabilir. Platform olarak Unix ve Linux
kullanabilir. Emboss paketinde kullanl
birletirilmi bir modl olarak evrimii ulalabilir.
URL: http://emboss.sourceforge.net/
Kaynaklar
Junier T. ve Pagni M. (2000) Dotlet: web
taraycsndaki diyagonal plotlar. Biyoinfor-
matik. 16(2):178-9.
Ahmed MANSOUR
Genetik Blm,
Ziraat Fakltesi,

REVISED
May 17, 2010
85
Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS
(Revised: May 17, 2010)

General
(JCellMolBiol) is an international journal which
covers original works in the field of cell biology,
molecular biology, genetics, microbiology,
neurobiology, bioinforma-tics and related topics.
The official language of the journal is English,
but manuscripts in Turkish are accepted as well.

Manuscripts should be submitted on a CD or by e-
mail to:
Hali University
Faculty of Arts and Sciences,
Department of Molecular Biology and Genetics
Kaptan Paa Mah. Darlaceze Cad. No: 14
Okmeydan-ili 34384, stanbul-TRKYE
Tel: +90 212 220 96 96 Ext. 155
E-Mail: jcmb@halic.edu.tr

Conditions for publication
This journal publishes research articles, review
articles, short communications, book/software
reviews, case reports and letters to the editor.
Research articles: Only original contributions will
be accepted which have not been published
previously. Manuscripts should not exceed 15
papers of printed text, including tables, figures and
references
Review articles: Reviews of recent developments in
a research field and ideas will be accepted.
Manuscripts should not exceed 15 papers of printed
text. Illustrations are encouraged.
Short communications: These include small-scale
investigations or innovative methods, techniques,
clinical trials and epidemiological studies. It should
not exceed 3 pages.
Letters to editor: These include opinions, news and
suggestions. Letters should not exceed 2 papers of
printed text.
Case Reports: These include individual
observations based on small numbers of subjects.
This type of research cannot indicate causality but
may indicate areas for further research.
Book/software reviews: Short but concise
description of the book/software, not exceeding a
page. Book/software reviews are not peer reviewed.
Presentation
Papers should be typed clearly, double-spaced with
3 cm wide margins.
Manuscripts should be prepared using Word
Processor.
Cover Letter: You may briefly explain your work
and its contribution to present knowledge.
Title Page: The first page of your manuscript
should be a title page containing the type of paper;
the title; all authors' full names, and affiliations;
and the corresponding author's contact address
(including phone and fax numbers) and e-mail
address. The title should be as short as possible, but
should give adequate information regarding the
contents. Authors should also state a running title
of no more than 50 characters including spaces.
All pages must be numbered.
Full Paper
The full paper should be divided into the following
parts in the order indicated:

REVISED
May 17, 2010
86
Abstract: A brief, informative abstract, not
exceeding 200 words, should be provided in
English and in Turkish. For authors who are not
native Turkish speakers, JCellMolBiol can provide
the Turkish abstract.
Keywords: Immediately following the abstract,
authors should provide 5 keywords or phrases that
reflect the content of the article.
Introduction should include theory, hypotheses,
prior work
Material and methods may include subheadings
Results: If the study consists of different parts,
subheadings in this section should be consistent
with subheadings in the methods.
Discussion
Acknowledgements should precede the list of
references
References: Papers cited in the manuscript should
be listed in alphabetical order according to the first
author's surname.
Tables and Figures
Tables and figures should be embedded within
the text in their appropriate positions.
Each table should be accompanied by a short
instructive title line plus an explanatory caption at
the top. Indicate footnotes within tables by
superscript letters and type footnotes below the
table.
Electronically submitted figures are preferred
in *.jpg or *.tiff (min. 300 dpi) formats. Each figure
should be supplied with a short instructive title line.
Do not give magnification on scales in the figure
titles; instead draw bar scales directly on the
figures.
All the tables and figures must be referred to
within the text.
Units, Abbreviations and Scientific Names
Only SI units should be used. Current
abbreviations can be used without explanation,
others must be explained.
All acronyms/abbreviations must be explained
in parenthesis after their first occurrence. If many
unfamiliar acronyms/abbreviations are used, please
compile them in an "Abbreviations" section at the
end of the paper.
Latin expressions should be underlined or typed
in italics.
Referencing
Citation in the text should take the form: (Smith
and Robinson,1990).
If several papers are cited by the same author in
the same year, they should be lettered in sequence
(1990a), (1990b), etc. When papers are by more
then three authors they should be cited as (Smith et
al.,1990).
In the list, references must be placed in
alphabetical order. The following models for the
reference list cover all situations. The punctuation
given must be exactly followed.
Redford IR. Evidence for a general relationship
between the induced level of DNA double
strand breakage and cell killing after X-
irradiation of mammalian cells. Int J Radiat
Biol. 49: 611- 620, 1986.
Tccioli CE, Cottlieb TM and Blund T. Product of
the XRCCS gene and its role in DNA repair and
V(D)J recombination. Science. 265: 1442-1445,
1994
Ohlrogge JB. Biochemistry of plant acyl carrier
proteins. The Biochemistry of Plants: A
Comprehensive Treatise. Stumpf PK and Conn
EE (Ed). Academic Press, New York. 137-157,
1987.
Weaver RF. Molecular Biology. WCB/Mc Graw-
Hill.1999.
Brown LA. How to cope with your supervisor. PhD
Thesis. University of New Orleans, 2005.
Web document with no author: Leafy seadragons
and weedy seadragons 2001. retrieved
November 13, 2002, from http:// www.
windspeed.net.au/jenny/seadragons/
Web document with author: Dawson J, Smith L and
Deubert K. Referencing, not plagiarism.
Retrieved October 31, 2002 from http:
//studytrekk.lis.curtin.edu.au/
Only papers published or in press should be
cited in the literature list. Unpublished results,
including submitted manuscripts and those in
preparation, should be indicated as unpublished
data in the text.

REVISED
May 17, 2010
87
Submission Policies and Authorship
Upon submission of a manuscript, it is accepted
that all co-authors have approved the contents of
the manuscript and its submission by the
corresponding author, and that the corresponding
author is authorized to represent all co-authors in
pre-publication discussions with JCellMolBiol.
The corresponding author is responsible for
ensuring that all the contributors to the relevant
work are listed as authors and that all authors have
aggreed to the manuscripts content and its
submission to the JCellMolBiol. In case the Journal
happens to be aware of an authorship dispute,
authorship must be approved in writing by all of the
parties.
Cost
There are no submission fees or page charges.
Criteria for the Selection of Manuscripts
Manuscripts should meet the following criteria: the
study conducted is material is original and ethical,
the writing is clear; the study methods are
appropriate, the data are valid, the conclusions are
reasonable and supported by the data; the
information is important; and the topic is
interesting to our readership.
Editorial Processes
Researchers may request informal feedback from
the editors in a particular manuscript. The
presubmission process aids in the submission
decision for authors
When JCellMolBiol receives a manuscript, the
Editor and Associate Editor will first decide
whether the manuscript meets the formal criteria
specified with Guidelines for Authors and
whether it fits within the scope of the Journal. In
case of doubt on the basis of initial review, the
editor will consult other members of the Editorial
Board.
Manuscripts that are found suitable for peer
review will be assigned to two expert reviewers.
Reviewers may either be Editorial Board members
or external experts selected by the Editorial Board.
The corresponding author is notified by e-mail
when the editor decides to send a paper for review.
The reviewers will have up to three weeks to
review the submitted article. After peer review, the
editor will contact the author. If the author is
required to submit a revised version, the revised
version has to be submitted by the author within
two weeks. Otherwise, the manuscript will be
removed from the manuscript submission queue
and will be considered rejected.
In cases where the referees have requested well-
defined changes to the manuscript, editors may
request a revised manuscript that addresses to
referees concerns. The revised version is sent back
to the original referees for re-review. In cases
where the referees concerns are more wide-
ranging, editors may reject the manuscript. The
revised manuscript should be accompanied by a
cover letter that includes a point-by-point response
to referees comments and an explanation of how
the manuscript has been changed.
As a matter of policy, we do not suppress
referees reports, any comments directed to authors
are transmitted regardless of what we may think of
the content. On rare occasions, we may edit a report
to remove offensive language or comments to
reveal confidentiality.
The final decision to accept or reject a
manuscript will be made by the Editor. If it
becomes apparent that there are serious problems
with the scientific content or with violations of our
publishing policies, the Editor also reserves the
right to reject a paper even after it has been
accepted
After acceptance, the Editor may make further
changes to the text and figures so that the
manuscript is readable and clear. Page proofs will
be sent to the corresponding author via email for
checking before publication. Corresponding authors
are sent proofs and are welcome to discuss
proposed changes with the Editor, but
JCellMolBiol reserves the right to make the final
decision about the style. Corrected proofs should be
sent back to the Editor within three days of receipt,
otherwise the Editor reserves the rights to correct
the proofs himself and to send the material for
publication.
Appeals
Authors have the right to ask the Editor to
reconsider a rejection decision, which is considered
an appeal. Decisions are reversed only if the Editor
is convinced that the original decision was a serious
mistake. If an appeal merits further consideration,
the Editor may send the authors response or the
revised paper to one or more referees, or Editor

REVISED
May 17, 2010
88
may ask one referee to comment on the concerns
raised by another referee.
Advance Online Publication
JCellMolBiol provides Advance Online Publication
of articles, which benefit authors with an earlier
publication date and allows the readers access to
accepted papers several weeks before they appear
in print
Ethical Issues
For manuscripts reporting experiments on live
vertebrates or higher invertebrates, authors must
declare that the study was approved by the
institutional ethics committee. Papers describing
investigations on human subjects must include a
statement that informed consent was obtained from
all subjects.
Plagiarism
If portions of the manuscript have already been
published by the author on other journals or
websites, JCellMolBiol Editorial Board needs to
know which portions of the manuscript have been
previously published and where. The author should
include a note in the cover letter indicating which
portions have been published elsewhere.
In case of any suspicion on scientific misconduct or
dishonesty in research, JCellMolBiol reserves the
right to forward any submitted manuscript to an
appropriate authori-ty for investigation.
Copyright Notice
It is the responsibility of the submitting author to
ensure that the authorship of the paper reflects the
contributions of the authors to the work described,
and that all listed authors have agreed to the
submission of the manuscript in its current form.
Conditions of publication in JCellMolBiol are
that the paper has not already been published
elsewhere; that it is not currently being considered
for publication else-where; all persons designated
as authors should qualify for authorship, and all
those who qualify should be listed. If accepted,
Hali University and JCellMolBiol have the
exclusive license to publish.
JCellMolBiol is freely available to individuals
and institutions. Copies of this Journal and articles
in this journal may be distributed for research or for
educational purposes free of charge. However,
commercial use of articles contained herein is
prohibited without the written consent of the editor.
Publication Agreement
The corresponing author is required to assign the
Publication Agreement Form in order to publish the
submitted manuscript in JCellMolBiol.

Journal of Cell and
Molecular Biology
see page 75 UCSC: Genome Browser for genomic sequences
A. Mansour
see page 81 Dotlet: powerful and easy strategy for pairwise comparisons
A. Mansour
see page 85
Instructions for authors
see page 71 Tcoffee : Multipurpose sequence alignments program
A. Mansour
Software Reviews
see page 53 Do simple sequence repeats in replication, repair and recombination genes of mycoplasmas
provide genetic variability?
S. TRIVEDI
see page 45 Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases
G. KO, K. ULUCAN, D. KIRA, D. ERGE, T. TARCAN and A.. GNEY
see page 35 Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate
induced renal oxidative damage in rats
M.M. AHMED and S.E. ALI
see page 25 The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS)
S. BUDAK-DLER and M. TOPAKTA
see page 13 Genetic diversity of Penicillium species isolated from various sources in Sarawak, Malaysia
H.A. ROSLAN, C.S. NGO and S. MUID
Research Articles
see page 1 DNA repetitive sequences-types, distribution and function: A review
S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA
Review Article

JCMB V7N1 V8N2

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

JCMB V7N1 V8N2

Загружено:

Авторское право:

Доступные форматы

Volume 7 No 2 & Volume 8 No 1 June 2010

C for 30 min. After cooling with

Molecular and cytogenetic evaluation of Y chromosome in

: ok amal dizi hizalama program

Вам также может понравиться