Abstract

The Alu family of short interspersed repeated DNA elements are distributed
throughout primate genomes. They are the most abundant transponons in the
human genome, accounting for 10% of its mass. It has previously been established
that Alu polymorphisms TPA-25, Angiotensin Converting Enzyme (ACE), YaNBC51a
and YaNBC182 are a useful indicators of genetic variation between individuals and
populations and thus are beneficial in forensic analysis.

The aim of this study is to screen the Forensics DNA analysis class 2008, along with
2 unknown samples, for the insertion/deletion of Alu polymorphisms and to compare
this with external populations. The Alu polymorphisms used are ACE, TPA-25,
YaNBC51, YaNBC182 and AluSTYa.

The Chelex method was used to extract DNA, which was then amplified by PCR and
viewed on a transilluminator. Analysis included calculations of allele and genotype
frequencies, heterzygosities, match probabilities and discriminative probabilities,
profile frequencies and likelihood ratios, and an evaluation of the Hardy-Weinberg
Equilibrium (HWE).

In the class population only ACE polymorphism did not exist in HWE, whereas all
markers in the pooled population were in HWE. Both class and pooled data had a
discrimination power of 0.98 which concludes that there is a potential power of 98%
to discriminate between two individuals chosen at random. Sample 39, with a profile
frequency of 0.026 was the most common with a likelihood ratio of 39 to 1. This
concludes that within our class a higher percentage of people will have a similar
profile frequency as sample 39.

Alus are found to be useful in forensic analysis as they are less laborious and
therefore cheaper to use, they have a low mutation making them a unique event
polymorphism.

Introduction

A677310, A657895, A671788, A672415

Alu polymorphisms are the most abundant transposable elements in the human
genome, accounting for approximately 10% of the total genome (Watkins, Rogers,
Ostler et al., 2003). Bi-allelic and 300 base pairs (bp) long, they arise by transposing
into a new location and are a member of the short interspersed nuclear elements
family (SINE). Their name is derived from the presence of a single recognition site
for endonuclease AluI (Kass, 2003).

In forensic analysis, Alu polymorphisms are preferred over VNTRs and RFLPs as
unlike the latter two, Alus are PCR able. The low mutation rate of Alus makes them
unique event polymorphisms and robust markers, making them useful in forensics
analysis (Gasper, 2004). They are also less laborious and cheaper to use than other
polymorphisms.

The most commonly studied Alus areTPA-25 and ACE, both of which are human
specific (Batzer et al. 1996) and belong to the Ya5/8 subfamilies (Roy et al. 2000).
As they have retroposed relatively recently they have not yet been fixed at specific
loci on chromosomes (Batzer et al. 1994).

TPA-25 is a tissue plasminogen activator gene, located on chromosome 8, which

has one 400bp allele for insertion of the element and one 100bp allele for deletion.
As it is highly dimorphic amongst humans and the allele frequencies of TPA-25 vary
in different human populations, this gene is particularly useful in forensic analysis
(Kass, 2003). Characterized by the presence or absence of a 287-bp AluI-repeat
sequence inside intron 16 (Feng, et al., 2002), the ACE gene is situated on
chromosome 17 and converts angiotensin-I to angiotensin-II.

Determination of gender from human DNA samples is important in forensic analysis.

This can be done by the identification of X-Y homologous Alu insertions method
which relies on the fixed nature of elements and the amplification of the DNA
material as part of the PCR process of Alu detection. AluSTRya primers have been
shown to be accurate markers for gender determination (Hedges et al, 2002). For
this reason AluSTRYa primers will be used to amplify Alu-filled site fragments of
528bp for the Y chromosome and an Alu empty site of 199bp for the X chromosome.
Additionally, it is also recommended that AluSTXa on the X chromosome is used
(Mastana, 2008), however will not be for this study.

Aims

A677310, A657895, A671788, A672415

The aim of this study is to screen the Forensics DNA analysis class 2008, along with
2 unknown samples, for the insertion/deletion of Alu polymorphisms and to compare
this with external populations. The Alu polymorphisms used are ACE, TPA-25,
YaNBC51, YaNBC182 and AluSTYa. A class database will be created which can
then be analysed and compared with a pool of the UK Caucasian population.
Unknown samples will also be analysed using the pooled database.

Method

Subjects

The study compromised of 67 undergraduate students from the 2008 Forensic DNA
analysis class at Loughborough University. Each individual was given an ID number,
which was used to label the 1.5ml microfuge tubes. 1 ml of RNAse/DNAse free water
was added into each the microfuge tube using a pipette.
Individuals wiped the inside of their cheek with a cytology cotton swab to dislodge
loose cells. The swab was then rotated vigorously in the microfuge tube, and stirred
periodically for 30 minutes at room temperature to free collected cells. Two 4 x 3mm
diameter punches of the bloodstained filter paper were provided (unknown samples
-see Appendix1).
DNA from collected cells and unknown samples were successfully extracted using
the Chelex method (Appendix 2).

Maximum amount of supernatant was extracted from each sample without disturbing
pellet/filter paper and then transferred into a clean labelled centrifuge tube. 0.2ul
PCR tubes were labelled with ID numbers and corresponding master mix ID. 20µl of
relevant master mix was transferred to the labelled PCR tubes. 5µl of the extracted
DNA were added and gently mixed together.

Genotyping

The samples were then amplified using multiplex PCR, which uses more than one
set of primers in one reaction. Reactions were carried out using the appropriate
mastermixes containing specific primers for the Alu polymorphism being analysed
(Appendix 3). (Mastermixes for PCR reactions can be found in Appendix 4). Two
duplex PCR reactions were used for autosomal loci (one for Alu polymorphisms
3

A677310, A657895, A671788, A672415

ACE/TPA25 and another for 182/51A) and a third reaction amplified the gender
allele. Samples were then placed in a thermal cycler (Appendix 5) for DNA
amplification.

Products of PCR were then separated using gel electrophoresis using a 2% agarose
gel set in a mould containing wells (preparation shown in Appendix 6). Combs were
put in place, and Ethidium Bromide TBE was poured into the electrophoresis tank
covering the gel in 1-2 mm of solution. After the combs were removed, a reference
sample containing the investigated alleles with known fragment sizes was inserted,
creating a ladder to allow for identification of band sizes. 10µl of samples were then
inserted into the wells and electrophoresed for 30 minutes at 100volts. Gels were
then viewed on a transilluminator to visualise the bands.

Class genotypes were scored visually by comparison to a DNA ladder and

transferred to a database.

Materials- 20% Chelex, PCR Master Mix, RNAse/ DNAse free water, Control
Sample, Agarose, Ethidium Bromide/SYBR Safe Dye, Tris Boric EDTA (TBE) buffer
pH8.3

Statistical Analysis

For each polymorphism, allele frequencies were calculated using gene counting
method and are shown with standard errors. Chi square statistics were used to
consider deviations from Hardy-Weinberg. To analyse allele diversity of the class,
observed and expected heterozygosities were calculated. Random match
probabilities were calculated for each database along with discriminative probability,
and compared to the pooled data. To determine the probability of the genotypes
occurring in the pooled and class database, profile frequencies and likelihood ratios
were calculated for the individual samples within our group and our unknown
samples (samples 36-41). However the unknown samples were not included in the
databases constructed as they were unrepresentative of the class population.

Results

A677310, A657895, A671788, A672415

Figure 1 - Band detection of ACE and TPA-25

Participant L 36 37 38 39 40 41
No (unknown) (unknown)
ACE DD II ID ID ID II
TPA25 II DD DD DD DD ID

Figure 2 - Band detection of 182 and 51A

Participant L 36 37 38 39 40 41
No (unknown) (unknown)
182 ID ID - ID - DD
51A DD DD - II - DD

Figure 3 – Band detection for gender

Participant L 36 37 38 39 40 41
No (unknown) (unknown)
Gender F F F F F M
Figures 1-3 show electrophoresis images which show the band detection of the
polymorphisms of four participants and two unknown samples. The table beneath
each displays the genotypes observed in relation to the ladder (L).

Table 1 - comparison of class an pooled data of TPA25

TPA-25 Class (n=67) Pooled (n=138)

A677310, A657895, A671788, A672415

 II ID DD II ID DD
Genotype frequency
0.239 0.493 0.269 0.217 0.435 0.348
I D I D
Allele frequency
0.485 0.515 0.435 0.565
Standard Error 0.043 0.043 0.03 0.03
In Hardy-Weinberg
X2=0.013 X2=1.837
Equilibrium
Df=1, CV=3.84 In HWE In HWE
Observed Heterozygosity 0.493 0.435
Expected Heterozygosity 0.5 0.491
Match Probability 0.372 0.357
Probability of Discrimination 0.628 0.643

Table 2 - comparison of class an pooled data of ACE

ACE Class (n=64) Pooled (n=114)

II ID DD II ID DD
Genotype frequency
0.172 0.25 0.578 0.211 0.482 0.307
I D I D
Allele frequency
0.297 0.703 0.452 0.548
Standard Error 0.04 0.04 0.033 0.033
In Hardy-Weinberg
X2=10.3 X2=0.077
Equilibrium
Df=1, CV=3.84 Not HWE In HWE
Observed Heterozygosity 0.25 0.482
Expected Heterozygosity 0.417 0.495
Match Probability 0.426 0.371
Probability of Discrimination 0.574 0.629

Table 3 - comparison of class an pooled data of 51A

51A Class (n=60) Pooled (n=134)

II ID DD II ID DD
Genotype frequency
0.3 0.383 0.317 0.269 0.433 0.299
Allele frequency I D I D
6

A677310, A657895, A671788, A672415

 0.492 0.508 0.485 0.515
Standard Error 0.046 0.046 0.031 0.031
In Hardy-Weinberg
X2=3.26 X2=2.39
Equilibrium
Df=1, CV=3.84 In HWE In HWE
Observed Heterozygosity 0.383 0.433
Expected Heterozygosity 0.5 0.5
Match Probability 0.337 0.349
Probability of Discrimination 0.663 0.651

Table 4 - comparison of class an pooled data of 182

182 Class (n=57) Pooled (n=135)

II ID DD II ID DD
Genotype frequency
0.193 0.526 0.281 0.185 0.481 0.333
I D I D
Allele frequency
0.456 0.544 0.426 0.574
Standard Error 0.047 0.047 0.03 0.03
In Hardy-Weinberg
X2=0.211 X2=0.032
Equilibrium
Df=1, CV=3.84 In HWE In HWE
Observed Heterozygosity 0.526 0.481
Expected Heterozygosity 0.496 0.489
Match Probability 0.393 0.377
Probability of Discrimination 0.607 0.623

Table 5 – Combined Match Probability and Discrimination of Class and Pooled data

Class Pooled
Combined Match Probability 0.021 0.017
Combined Probability of 0.979 0.983
Discrimination Value
% discriminatory 97.90% 98.30%

Table 6 - Profile Frequency and Likelihood ratio of class and pooled data.

Sample Sample Unknown Unknown

Sample 36 Sample 37 38 39 40 41
7

A677310, A657895, A671788, A672415

TPA25 DD II ID ID ID II
ACE II DD DD DD DD ID
51A ID ID - ID - DD
182 DD DD - II - DD
Profile
Freq(Class) 0.003 0.017 0.247 0.026 0.247 0.008

Likelihood
Ratio(Class) 289.428 58.142 4.049 38.932 4.049 133.191

Profile Freq
(Pooled) 0.011 0.009 0.148 0.013 0.148 0.008

Likelihood Ratio
(Pooled) 93.164 106.902 6.769 74.693 6.769 122.215

Gender F F F F F M

Class Data

The most frequent genotype for Alu polymorphism TPA25, 51a & 182 was ID. Whilst
the most frequent for ACE was DD. For all STR's, allele D was most frequent. The
STR whose expected heterozygosity matched closest with observed heterozygosity
was TPA25. For ACE & 51a, the expected heterozygosity was higher than the
observed, whereas for 182 the observed was higher than the expected.
From the χ2 value we can conclude that with 95% confidence, all STRs except ACE
exist on HWE.
The combined match probability is 0.021, giving a probability of discrimination value
0.979. This database can thus be said to be 97.9% discriminatory.
The combined match probability for the class population is 0.021, indicating that
there is a 2.1% chance of two randomly selected individuals sharing the same
genotype for all four polymorphisms. The discrimination power is 0.979 concluding

A677310, A657895, A671788, A672415

that there is a potential power of 97.9% to discriminate between two individuals
chosen at random.

Pooled Data

For every STR, the highest genotype frequency was ID and the most common allele
was D.
Expected heterozygosity was higher than observed heterozygosity for all STRs
however in each case, it was only by a small amount.
All STRs were found to be in HWE as all χ2 values were below the critical value (95%
confidence).
The combined match probability was calculated to be 0.017 giving rise to a combined
probability discrimination value of 0.983. Therefore this database can be said to be
98.3% discriminatory.
Pooled data shows similar results with a combined match probability of 0.017 and a
discrimination power of 0.983, giving a potential power of 98.3% to discriminate
between two random individuals. These high discriminatory values conclude that the
calculations are reliable.

Discussion

Calculations of allele frequencies showed that ACE was the only polymorphism
which did not exist in HWE. For a population to exist in HWE, several assumptions
should be met. These include random mating, no mutation or selection, no migration
and infinitely large population (Goodwin, Linacre, Hadi, 2007).

Our class population violates many of these assumptions. Firstly, it is not a randomly
selected population. Secondly, humans also violate the assumption of random
mating. Our class was also comprised of many individuals who had migrated to this
area. As a result of this, we would not expect our χ2 values to be in HWE. Looking at
our class data however, ACE is the only polymorphism which is not in HWE. This
can be explained due to the fact that our population was so small (n=67) that it was
not a good representation of the proportions of subgroups that it was comprised of.

A677310, A657895, A671788, A672415

All the polymorphisms in the pooled data existed in HWE. This was to be expected
due to the fact that the majority of these individuals belonged to the same population
(UK Caucasian) and this population size was also larger (UK caucasian n=138).

Research has found that there are differences in allele frequencies amongst different
ethnicities (Ishigami, 1995). Our class population is comprised of different ethnicities.
This explains why, for each polymorphism, the difference between observed and
expected heterozygosity varies.

From the pooled results the expected heterozygosity values for the all the
polymorphisms are higher than the observed heterozygosity indicating that these
STRs may be useful as genetic markers in forensics.

From our own samples, sample 38 had the highest profile (0.247) frequency giving a
likelihood ratio of 4 to 1. However this only accounts for two polymorphisms, ACE
and TPA 25, as results for 51a and 182 were inconclusive. If we were to exclude this
sample and look only at fully conclusive samples, sample 39, with a profile frequency
of 0.026 was the most common with a likelihood ratio of 39 to 1. Sample 36 has the
lowest profile frequency 0.003 and a likelihood ratio of 289 to 1. This concludes that
within our class a higher percentage of people will have a similar profile frequency as
sample 39. Within the pooled population, excluding the sample with inconclusive
results, sample 39 has the highest profile frequency (0.013) and therefore a
likelihood ratio of 75 to 1. Sample 37 had the lowest profile frequency (0.009) and a
likelihood ratio of 107 to 1. Three out of four of our known samples had higher
likelihood ratio in the class population compared to pooled population. This could be
the result of analyzing a very small and diverse population. When analyzing the
marker for gender, all our known samples were correctly identified as being female.
This provides us with confidence that the process of determining the gender of
unknown samples was reliable. However the accuracy of gender determination can
be improved by analyzing the markers AluSTXa with AluSTYa. (Mastana, 2007).
Some of the samples did not produce eligible results on the gel electrophoresis for
particular markers. This may have been due to contamination of samples, errors
made while preparing samples or errors made during the preparation of materials for
electrophoresis.

10

A677310, A657895, A671788, A672415

The advantages of using Alus in forensic analysis compared to other polymorphisms
include that they are less laborious and therefore cheaper to use, they have a low
mutation making them a unique event polymorphism (Gasper, 2004).

Appendices

Appendix 1- Blood Stained Filter Paper (Unknown Samples)

a. You have been provided with 4 x 3mm diameter punches of the bloodstained
filter paper (your unknown sample)
b. Pipette 1ml of RNAse/DNAse free water into the tube.
c. Incubate at room temperature for 30 minutes.
d. Vortex mix for 5 seconds.
e. Centrifuge in a microcentrifuge at 13 000rpm for 2 minutes.
f. Without disturbing the pellet, carefully remove the supernatant, leaving
enough behind (20-30µl) to cover the pellet without disturbing it. If the

11

A677310, A657895, A671788, A672415

 sample is a bloodstain on filter paper/material, leave the filter paper/material
substrate in the tube with the pellet.

Appendix 2 – Chelex Method

a. Use 20% Chelex (w/v) prepared previously. Keep the solutions homogenous
using a magnetic stirrer.
b. Remove and discard the brush from the tube.
c. Vortex the sample for 5 seconds.
d. Centrifuge the sample for 2 mins @ maximum speed. Discard the
supernatant, leaving approx. 20-30µl residual fluid.
e. Add 170ul of 20% Chelex (w/v) to give a final volume of 200µl and incubate
30 mins @ 56°C (water bath).
f. Vortex (10 secs) and place in Dry Block (~ 100 °C) for 8 mins.
g. Vortex again and centrifuge for 3 mins @ max speed (13000 RPM).
h. Label a fresh microfuge tube with your ID number.
i. Remove supernatant to a clean labelled 1.5ml microfuge tube.

Appendix 3 - The oligonucleotide primers used in the duplex PCR reactions.

Alu I.D. Primer 1 (5’-3’) Primer 2 (5’-3’) + - Chr.

Alu Alu No

ACE ctggagaccactcccatcctttct gatgtggccatcacattcgtca 490 190 17

gat

TPA25 gtaagagttccgtaacaggaca ccccaccctaggagaacttct 400 100 8

gct cttt

Ya5NBC51 tttccttacatctagtgcccc cctccaagtaaagctacaccc 652 355 3

Aa t

12

A677310, A657895, A671788, A672415

Ya5NBC18 gaaggactatgtagttgcagaag aacccagtggaaacagaag 563 287 7
2 c atg

AluSTYa catgtatttgatggggatagagg ccttttcatccaactaccactga 528 199 Y

Appendix 4- Mastermix components

Component ACE/TPA25 Master 182/51A Master Mix Gender ID Mix

Mix (AluSTYa)

Buffer 75mM Tris-Hcl buffer pH 8.8

dNTPs 0.2M each of dATP, dCTP, dTTP, dGTP

Taq Taq DNA polymerase enzyme (1.25 units)

MgCl2 2.5mM 2.5mM 1.5mM

Primers

Forward-1 ACE-F 0.18M 182-F 0.1M AluSTYa-F 0.2M

Reverse-1 ACE-R 0.18M 182 –R 0.1M AluSTYa-R 0.2M

Forward-2 TPA25-F 0.18M 51A-F 0.24M

Reverse-2 TPA25-R 0.18M 51A-R 0.24M

Sterile 18MΩ H2O

Precipitant and red dye for electrophoresis

Appendix 5- Thermal Cycling Conditions

Thermal Cycling Conditions

Initial Denature 1 cycle of 3 mins 1 cycle of 3 mins 1 cycle of

@940C @940C
2 mins 30 secs
@940C

Cycles 32 cycles of 32 cycles of 32 cycles of

Denature 1 min @940 C 1 min @940 C 1 min @940 C

Anneal 1 min @550C 1 min @550C 1 min @580C

Extension 1 min @720C 1 min @720C 1 min @720C

13

A677310, A657895, A671788, A672415

Followed by Final 5 min @720C 5 min @720C 10 min @720C
Cycle

Cooling to 40C. Cooling to 40C. Cooling to 40C.

Appendix 6 – 2% Agarose Gel Preparation

Weigh 2g of agarose and place into a 250ml conical flask.

Add 100ml, 1X ethidium bromide -TBE pH8.3 and cover with cling film.

Pierce the cling film and swirl the mixture before placing in a microwave for 1minute.
Remove and swirl again. If the solution has not gone clear then heat for a further 1
minute, checking that the solution has not boiled over.

Allow the agarose to cool to hand hot and gently pour into the mould, with the combs
in place and allow to set (Approximately 30 minutes).

References

Batzer, M.A., Arcot, S.S., Phinney, J.W., Alegria-Hartman, M., Kass, D.H.,
Milligan,S.M., Kimpton, C., Gill, P., Hochmeister, M., Ioannou, P.A., Herrera, R.J.,
Boudreau, D.A., Scheer, W.D., Keats, B.J., Deininger, P.L., Stoneking, M., 1996.
Genetic variation of recent Alu insertions in human populations. Journal of Molecular
Evolution, 42, pp. 22-29.

Batzer, M.A., Stoneking, M., Alegria-Hartman, M., Bazan, H., Kass, D.H., Shaikh,
T.H., Novick, G.E., Ioannou, P.A., Scheer, W.D., Herrera, R.J., 1994. African origin
of human-specific polymorphic Alu insertions. Proceedings of the National Academy
of Sciences of the United States of America, 91(25), pp.12288-12292.

Feng, Y., Niu, T., Chen, C., Li, Q., Qian, R., Wang, G., Xu, X.,2002. Insertion/Deletion
Polymorphism of the ACE Gene Is Associated With Type 2 Diabetes. Diabetes, 51,
pp.1986-1988.

Gasper, P., Seixas, S., Rocha, J., 2004. Genetic Variation in a Compound Short
Tandem Repeat/Alu Haplotype System at the SB19.3 Locus: Properties and
Interpretation. Human Biology, 76(2), pp.277-287.

14

A677310, A657895, A671788, A672415

Goodwin, W., Linacre, A., Hadi, S., An introduction to Forensic Genetics.
Sussex:Wiley.

Hedges, D.J., Walker, G.A., Callinan, P.A., Shewale, G.A., Sinha,

S.K.,Batzer, M,A., 2003. Mobile element-based assay for human gender
determination. Analytical Biochemistry, 312, pp. 77–79.

Kass, D.H., Generation of Human DNA profiles by Alu-based multiplex polymerase

chain reaction. Analytical Biochemistry, 321, pp.146-149.

Mastana, S.S., 2008. Laboratory Protocol. Forensic DNA Analysis.

Roy, A.M., Carroll, M.L., Kass, D.H., Nguyen, S.V., Salem, A.H., Batzer, M.A.,
Deininger, P.L., 1999. Recently integrated human Alu repeats: finding needles in the
haystack. Genetica, 107(1-3), pp.149-161.

Watkins, W.S., Rogers, A.R., Ostler, C.T., Wooding, S., Bamshad, M.J., et al., 2003.
Genetic variation among world populations: Inferences From 100 Alu insertion
polymorphisms. Genome, 13, pp.1607-1618.

15

A677310, A657895, A671788, A672415