Вы находитесь на странице: 1из 12

10/14/2014

Transcription maschine

MOLECULAR BIOLOGY
Part II

Airin Aldiani PD-A 2009 (0910710030)

10/14/2014

Content
Translation
Mutation
DNA repair system
Manipulation on DNA and protein

Translation

the whole process by which the nucleotide


sequence of an mRNA is used to order and to
join the amino acids in polypeptide chain.
chain.

COMPONENTS OF
TRANSLATION

TRANSLATION

mRNA
carries the genetic information transcribed
from DNA in the form of a series of codons.
codons.
2. tRNA.
Each AA has its own subset of tRNAs, which
bind the AA and carry it to the growing end of
a polypeptide chain if the next codon in the
mRNA calls for it. Each specific tRNA molecule
contains anticodon
anticodon,, that can basebase-pair with
its complementary codon in the mRNA
1.

Component of
Translation:
-mRNA
-tRNA
-Ribosom

Airin Aldiani PD-A 2009 (0910710030)

10/14/2014

tRNA
- a hairpin structure
- amino site at (3 end)
- anticodon site, that bind with
codon in mRNA
There are 61 type tRNA in cell

3. rRNA
- associates with a set of protein to form
ribosomes - move along an mRNA molecule,
catalyze the assembly of AA into polypeptide
chains..
chains
- Ribosomes are composed of a large and
small subunit, each of which contains its own
rRNA molecules.

Airin Aldiani PD-A 2009 (0910710030)

10/14/2014

Translation Proses

Initiation
Elongation
Termination

INITIATION

Airin Aldiani PD-A 2009 (0910710030)

Binding of mRNA on
small subunit
ribosom
Binding of tRNA
inisiator at the P site
of ribosom
Binding of big
subunit ribosom

10/14/2014

ELONGATION

TERMINATION

- Codon
recognition
- Peptide bond
formation
- translocation
THE LAST STEP OF TRANSLATION
RIBOSOME (SITE A) REACH STOP CODON
(UAA UAG UGA)

Airin Aldiani PD-A 2009 (0910710030)

10/14/2014

MUTATION

In eukaryotic cells, protein synthesis occurs in the


cytoplasm, where three types of RNA molecules come
together to perform different but cooperative functions:

MUTATION,
Type of mutation:
1.Base pair (nucleotide pair) substitutions
2.Frameshift mutations
3.spontaneous mutation

Airin Aldiani PD-A 2009 (0910710030)

1.Base pair (nucleotide pair)


substitutions
-transitions
(purine to purine or pyrimidine to
pyrimidine)
-transversions
(purine to pyrimidine or pyrimidine to
purine).

10/14/2014

The consequences of base


substitution mutations

silent M,
M,
not resulting in a new aa (amino acid) in
the protein sequence,
sequence, eg. GCA
GCA or GCG
GCG.
2. missense mutation
mutation..
result in an aa substitution
substitution ex. CT
CTCCAC
in the DNA sense strand (glutamate
(glutamatevaline).
1.

3. a nonsense mutation
mutate an amino acid codon to a
termination codon or vice versa.
versa.
4. Mutation occurs in promoters or 5'
regulatory regions of genes or in introns
may affect their transcription, translation,
or splicing.
splicing. Ex.
Ex.beta
beta--thalassemias, result of nonnon-

structural mutations affect the level of expression of the


globin genes.

Ex.in the betabeta-globin protein chain causing sickle


sickle--cell
anemia,, hemoglobin C or no phenotype.
anemia

2.Frameshift mutations

3.Spontaneous mutation

Spontaneous frameshift mutations 5'


ex. AG
AGTCAATCCATGAAAAAATCAG
TCAATCCATGAAAAAATCAG 3'
3'TCAGTTAGGTACTTTTTTAGTC 5'
frameshifts are the result of "slipped
"slipped
mispairing"" between the template
mispairing
DNA strand and the newly
synthesized strand during DNA
replication

Airin Aldiani PD-A 2009 (0910710030)

- DNA replication errors and polymerase


accuracy
Mistakes in DNA replication where an incorrect
nucleotide is added will lead to a mutation in the
next round of DNA replication of the strand with
the incorrect nucleotide

- Base alterations and base damage


The bases of DNA are subject to spontaneous
structural alterations called tautomerization
tautomerization::

10/14/2014

cont
spontaneous base degradation.
degradation.
The deamination of cytosine to uracil.
spontaneous DNA damage via alkylation
the addition of alkyl (methyl, ethyl, occasionally
prophyl) groups to the bases or backbone of
DNA.
Alkylation can occur through reaction of
compounds such as SS-adenosyl methionine with
DNA. Alkylated bases may be subject to
spontaneous breakdown or mispairing
mispairing..

Airin Aldiani PD-A 2009 (0910710030)

REPAIR" mechanisms :

Direct repair
Simple removal of damage.

Excision repair
Recognition by enzyme, followed by
excision. Glycosylases, uracil
glycosylase-glycosylase
--enzyme
enzyme which removes
uracil from DNA, AP endonuclease.

10/14/2014

mutation, repair and tumor


Mutation-Changes in DNA sequence decrease production
Mutationof tumor supressor protein
increase unregulated production or activation of
oncoproteins cancer
cancer..
Most cancer lack one or more DNADNA-repair systems,
systems,
Some repair mechanism introduce errors in the nucleotide
sequence
sequence
oncogenesis
oncogenesis..
Inability of tumor cells to maintain genomic integrity leads
to formation of a heterogenous population of malignant
cells..
cells
Chemotherapy toward a single gene or group of gene ineffective

Airin Aldiani PD-A 2009 (0910710030)

10/14/2014

Inhibitor of protein or RNA


synthesis
MANIPULATING PROTEIN, DNA, RNA

plasmid

RESTRICTION ENDONUCLEASE
Type II restriction endonuclease
Palindromic sequences
Recognition site/cleavage
site/restriction site
Type of cut end

5
5--phosphat extention (Eco
(EcoRI)
RI)
3hydroxyl extention (Pst
(PstI)
I)
Blunt
Blunt--end (Pvu
(PvuII)
II)

Airin Aldiani PD-A 2009 (0910710030)

Def:
Cyclic, selfreplicating
DNA, double
stranded,maintained
in the bacterial cell as
a extrachromosomal
DNA.

10

10/14/2014

Basic
priciples
of DNA
cloning
in
plasmid
vector

Human genomic
DNA lybrary

POLYMERASE CHAIN REACTION

Airin Aldiani PD-A 2009 (0910710030)

11

10/14/2014

Airin Aldiani PD-A 2009 (0910710030)

12