MUTATIONS

AND
DNA REPAIR

Mutations alter the DNA sequences

Mutations are heritable alterations in the genetic material of any organism
Single strand of normal -globin gene
GTGCACCTGACTCCTGAGGAG

Single strand of mutant -globin gene

GTGCACCTGACTCCTGTGGAG

Single nucleotide change (mutation)

- Single nucleotide change
produces a -globin that
differ from normal globin only by a change
from Glu to Val at the
sixth amino acid position.
- The mutation causes the
disease sickle-cell anemia

The major types of mutation

Base substitution: one base is replaced by another base

Insertion: one or more bases are inserted into the DNA sequence
Deletion: one or more bases are deleted from the DNA sequence
Inversion: a segment of DNA is inverted, but remains at the same overall
location
Duplication: a segment of DNA is duplicated; the second copy usually
remains at the same location as the original
Translocation: a segment of DNA is transfer from its original location to
another position either on the same DNA molecule or on the different DNA
molecule

The nature of mutations

Transitions: pyrimidine-to-pyrimidine and purineto-purine substitutions, such as T to C and A to G

Transversions: pyrimidine-to-purine and purineto-pyrimidine substitutions, such as T to A or G

and A to T or C

- Base substitutions (transitions and transversions), Insertions and Deletions are

simple mutations. Other kinds of mutations might be caused by transposon or
recombination process
- Mutations that alter a single nucleotide are called point mutations

Slippage during DNA replication creates small

insertions or deletions

In human, slippage of trinucleotide (CGG and CAG) repeats causes disease

(fragile X syndrome and Huntingtons disease)

Some Inherited Syndromes with Defects in DNA Repair

Sources of mutation

Inaccuracy in DNA
replication

Chemical damage to
the genetic material

Consequences
1) permanent changes to the DNA (mutation)
2) prevent DNAs use as a template for replication and
transcription
* The cell must scan the genome to detect error in synthesis and
damage to the DNA;
** The cell must mend the lesions do so in that way that, if
possible, restores the original DNA sequence.

REPLICATION ERROR AND

THEIR REPAIR

Proofreading of DNA synthesis

- DNA synthesis: approximately 1 mistake in every 1010 base pair added.

Proofreading allows these mistakes to be corrected.
- DNA polymerase has an error-correcting activity (proofreading exonuclease).
- In palm domain, there are DNA replication site (P) and Exonuclease site (E).
- When a mismatched base pair is detected, the primer:template juntion slides
away from P site and into E site. After the incorrect base pair is removed, the
primer:template junction slides back in to P site and DNA synthesis can continue.

Some replication errors escape proofreading

If the misincorporated nucleotide is not detected and replaced, the sequence

change will become permanent (mutation) in the genome after second round
replication.

DNA mismatch repair system removes errors that

escape proofreading

Mismatch repair pathway for the repair of replication errors

MutS scans the DNA and

detects mismatch

- MutL activates MutH, an enzyme that cause a nick on

one strand near the site of mismatch
-A specific helicase (UrvD) unwinds the DNA, and the
exonuclease progressively digest the mismatch region
- The gap is then filled by DNA polymerase and sealed
with DNA ligase.

Crystal structure of the MutS-DNA complex

How does the cell know which of the two mispaired

bases was the wrong one?

- In E. coli, the parental strand of DNA

is identified by methylation.
-The enzyme Dam methylase converts
Adenine in the sequence GATC to
Methyladenine
- Immediately after DNA replication, the
old strands will be methylated but the
new strands of DNA will not (Hemimethylated)
- The newly synthesized strand is
marked (non-methylated) and is checked
for errors before methylation occurs

Directionality in mismatch repair: exonuclease

removal of mismatched DNA

Different exonucleases are used to remove single stranded DNA between the nick
created by MutH and the mismatch, depending on whether MutH cuts the DNA
on the 5 or 3 side of the misincorporated nucleotide.

Repair mismatch system in eukaryotes

-In eukaryotic cells also repair mismatch and
do so using homologs to MutS (called MSH
proteins for MutS homologs) and MutL
(called MLH and PMS).
- Eukaryotes have multiple MutS-like
proteins with different specificity. For
example, one is specific for simple
mismatch, whereas another recognize small
insertions or deletions resulting from
slippage
- Eukaryotes lack MutH and do not have
hemi-methylation. MSH interacts with the
sliding clamp and recruits mismatch repair
proteins.

DNA DAMAGE

A summary of spontaneous alterations likely to require DNA repair

The sites that are known to be modified by oxidative damage

Hydrolytic attack
Uncontrolled methylation

Depurination and deamination are the most frequent chemical

reaction known to create serious DNA damage in cells

- Depurination: purine bases (A and G) will be lost from DNA

- Deamination: loss of an amino group from cytosine to produce the base uracil

How chemical modifications of nucleotides produce mutations

Deamination

DNA is damaged by alkylation, oxidation

-In alkylation: methyl or ethyl groups are

transferred to reactive sites on the bases and
to phosphate in the DNA backbone
- Oxidation of guanine generates oxoG
(common mutations found in human cancers)

Thymine dimer: UV induces the formation of a cyclobutane ring

between adjacent thymines

These linked bases are incapable of base-pairing and cause the DNA polymerase
to stop during replication

Mutations are also caused by base analogs

Mutations are also caused by intercalating agents

- Intercalating agents are flat molecules containing several polycyclic rings that
bind to the equally flat purine or pyrimidine bases of DNA, just as the bases bind
or stack with each other in the double helix
- Intercalating agents cause the deletion or addition of a base pair or, even few
base pairs

REPAIR OF DNA DAMAGE

Photoreactivation cleaves thymine dimer

In photoreactivation, the enzyme DNA photolyase captures energy from light and
uses it to break the covalent bonds linking adjacent pyrimidine. The damaged
bases are mended directly

Direct reversal of methylated base

The enzyme methyltransferase removes the methyl group from the guanine
residue by transfering it to one of its own Cys residues.

The recognition of an unusual nucleotide in DNA

by base flipping

Structure of a DNA-glycosylase complex

glycosidic
bond

Base excision repair

- An enzyme called glycosylase recognizes
and removes the damaged base by
hydrolyzing the glycosidic bond.
- Glycosylase release the base from the
DNA backbone to leave an AP site (apurinic
or apyrimidic site)
- AP endonuclease and exonuclease cut the
DNA backbone at the 5 and 3 position of
the AP site
- The resulting gap is filled by DNA
polimerase I
- DNA glycosylase are lesion- specific and
cell have multiple DNA glycosylase with
different specificities. A total 8 different
DNA glycosylase have been identified in
human cells.

oxoG:A can be repaired via the base excision pathway

Nucleotide excision repair

UvrC forms a complex
with UvrB and creates
nicks to the 5 and 3 sides
of the lesion
UvrA and UvrB scan the
DNA to identify a
distortion

UvrB melt locally around

the distortion

A comparison of two major DNA repair pathway

Transcription-coupled DNA repair

- RNA polymerase transcribes DNA

normally upstream of the lesion
- Upon encoutering the lesion in DNA,
RNA polymerase stalls and transcription
stops
- RNA polymerase recuits the nucleotide
excision proteins to the site of the lesion
and repairs
- Central to transcription-coupled repair in
eukaryotes is the general transcription
factor TFIIH

Double-strand break (DSB) repair pathway

DSB repair pathway: Non homologous end joining

Three-dimensional structure of a Ku
heterodimer bound to the end of a
duplex DNA fragment

Translesion DNA synthesis enables replication to proceed across

DNA damage

- If cells cannot repair lesions, there is a

fail-safe mechanism that allow the
replication machinery to bypass these
sites of damage. This mechanism is
known as translesion synthesis.
- Translesion synthesis is catalyzed by a
specialized class of DNA polymerase
(UmuC or Y-family DNA polymerase)

DNA repair systems