Вы находитесь на странице: 1из 653

ORGANISATION INTERNATIONALE DE LA VIGNE ET DU VIN

RECUEIL
DES METHODES
INTERNATIONALES
DANALYSE DES
VINS ET DES MOUTS
EDITION 2012

VOLUME 2

INCLUSES:
Rsolutions adoptes Porto (Portugal)
9me A.G. 24 juin 2011
OIV - 18, RUE DAGUESSEAU - 75008 PARIS

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Avant-propos

Avant-propos
Le Recueil des mthodes internationales danalyse des vins a t publi pour la
premire fois en 1962. Il a t rdit en 1965, en 1972, en 1978, en 1990 et
nouveau en 2000, intgrant chaque fois les textes complmentaires approuvs par
lAssemble gnrale et tablis annuellement par la Sous-commission des
mthodes danalyse.
La prsente dition du Recueil des mthodes internationales danalyse des vins et
des mots comprend tous les textes approuvs par lAssemble gnrale des
reprsentants des gouvernements membres de lOIV, rviss et mis jour depuis
2000.
Le Recueil joue un grand rle pour lharmonisation des mthodes danalyse.
Beaucoup de pays viticoles ont introduit dans leur propre rglementation ses
dfinitions et ses mthodes.
Par ailleurs, certains accords bilatraux relatifs au commerce du vin reconnaissent
que les mthodes danalyse publies par lOIV, prvalent comme mthodes de
rfrence pour la dtermination de la composition analytique du vin dans le cadre
des operations de contrle.
Le rglement CE no 479/2008 prvoit que les mthodes danalyse permettant
dtablir la composition des produits relevant dudit rglement et les rgles
permettant dtablir si ces produits ont fait lobjet de traitements en violation des
pratiques nologiques autorises sont celles qui sont recommandes et publies
par lOIV dans le Recueil des mthodes internationales danalyse des vins et des
mots de lOIV. Dans le rglement CE no 606/2009 pour assurer une meilleure
transparence, il a t tabli de publier au niveau communautaire (Journal officiel de
lUnion europenne, srie C) la liste et la description des mthodes danalyses
dcrites dans le Recueil des mthodes internationales danalyse des vins et des
mots de lOIV qui sont applicables pour le contrle des produits vitivinicoles. De
cette faon lUE reconnat les mthodes qui font lobjet de ce Recueil, leur confre,
un caractre obligatoire dans tous les tats-membres et consacre la collaboration
troite qui sest tablie entre lUE et lOIV.
Ainsi, le Recueil, par son rle minent dans lharmonisation des mthodes
danalyse contribue faciliter les changes internationaux. Avec le Code
International des Pratiques Oenologiques et le Codex Oenologique International,
il constitue un ensemble dont lintrt scientifique, juridique et pratique est vident.

OIV-MA-INT-01

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires

Plan gnral du Recueil


Table des matires

Avant-propos

ANNEXE A METHODES D'ANALYSE DES VINS ET DES MOUTS


SECTION 1 DEFINITIONS ET PRINCIPES GENERAUX
SECTION 2 ANALYSES PHYSIQUES
SECTION 3 ANALYSES CHIMIQUES
SECTION 3.1 COMPOSS ORGANIQUES
SECTION 3.1.1 SUCRES
SECTION 3.1.2 ALCOOLS
SECTION 3.1.3 ACIDES
SECTION 3.1.4 GAZ
SECTION 3.1.5 AUTRES COMPOSS ORGANIQUES
SECTION 3.2 COMPOSS NON ORGANIQUES
SECTION 3.2.1 ANIONS
SECTION 3.2.2 CATIONS
SECTION 3.2.3 AUTRES COMPOSS NON ORGANIQUES
SECTION 4 ANALYSES MICROBIOLOGIQUES
SECTION 5 AUTRES ANALYSES
ANNEXE B - MODELES DE CERTIFICATS D'ANALYSE
ANNEXE C - LIMITES MAXIMALES ACCEPTABLES DE DIVERS ELEMENTS
ANNEXE D AVIS
ANNEXE E ASSURANCE QUALITE DANS LES LABORATOIRES
ANNEXE F - METHODES SPECIFIQUES POUR LANALYSE DU SUCRE DE
RAISIN (MOUTS DE RAISIN CONCENTRES RECTIFIES)

OIV-MA-INT-00-2012

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires

NB: La rfrence de chaque mthode se trouve entre parenthse (rsolutions, mthodes de


rfrence du Recueil des mthodes internationales danalyse des vins et des mot 1990 =
Recueil OIV ed. 1990; mthodes du Recueil des mthodes internationales danalyse des
vins 1978 = A et chiffre i.e. A1, A2 )
Titre

- Table des matires

Rfrence

Type de
mthode

OIV-MA-INT-00

VOLUME 1

- Avant-propos

OIV-MA-INT-01

- Mode rdactionnel dune mthode danalyse OIV

OIV-MA-INT-04

ANNEXE A METHODES D'ANALYSE DES


VINS ET DES MOUTS
SECTION 1 DEFINITIONS ET PRINCIPES
GENERAUX
- Remarques gnrales (eco 3/2003)
OIV-MA-AS1-02
- Classification des mthodes danalyse (oeno 9/2000) OIV-MA-AS1-03
Effet matrice pour le dosage des mtaux (oeno
5/2000)
OIV-MA-AS1-04
SECTION 2 ANALYSES PHYSIQUES

- Masse volumique (A 1, rvision par 377/2009)


- Masse volumique (A 1, rvision par 377/2009)
Evaluation de la teneur en sucres des mots, des
- mots concentrs et du raisin par rfractomtrie
(Recueil OIV ed. 1990, rvision par 377/2009)
Extrait sec total (gravimtrie) (A 3, rvision par
377/2009 et 387/2009)
Extrait sec total (densimtrie) (A 3, rvision par
377/2009 et 387/2009)
- Cendres (A 6, rvision par 377/2009)

OIV-MA-AS2-01A

OIV-MA-AS2-01B

IV

OIV-MA-AS2-02

OIV-MA-AS2-03A

OIV-MA-AS2-03B

IV

OIV-MA-AS2-04

- Alcalinit des cendres (A 7, rvision par 377/2009)


- Potentiel d'oxydorduction (oeno 3/2000)

OIV-MA-AS2-05

IV

OIV-MA-AS2-06

IV

- Caractristiques chromatiques (A0 mod.)


Caractristiques chromatiques (A0 revised by
377/2009)

OIV-MA-AS2-07A

Supprime

OIV-MA-AS2-07B

IV

OIV-MA-INT-00-2012

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires
-

Turbidit des vins (Oeno 4/2000, rvision par


377/2009)
Mouillage - rapport isotopique 18O/16O (Oeno
2/96)
Indice de Folin-Ciocalteu (Recueil OIV ed. 1990,
rvision par 377/2009)
Caractristiques chromatiques (Oeno 1/2006)
Dtermination du rapport isotopique 18O/16O de leau
(Oeno 353/2009)
Dtermination de la taille des morceaux de bois de
chne par tamisage (Oeno 406-2011)

OIV-MA-AS2-08

IV

OIV-MA-AS2-09

Supprime

OIV-MA-AS2-10

IV

OIV-MA-AS2-11

OIV-MA-AS2-12

II

OIV-MA-AS2-13

SECTION 3 ANALYSES CHIMIQUES


SECTION 3.1 COMPOSS ORGANIQUES
SECTION 3.1.1 SUCRES

- Substances rductrices (A 4, rvision par 377/2009)


- Sucres rducteurs (clarification) (type IV)

OIV-MA-AS311-01A

IV

OIV-MA-AS311-01B

Supprime

- Sucres rducteurs (A 4) (titrimtrie) (type II)


Glucose et fructose (mthode enzymatique) (rvision
par 377/2009)
- Dosage des sucres par CLHP (Oeno 23/2003)
- Stabilisation des mots en vue de la recherche du
saccharose (A 5)
- Dtermination de la rpartition du deutrium dans
- l'thanol issu de mots de raisins ferments, mots
de raisins concentrs, sucre de raisin (mots de
raisins concentrs rectifis) et de vins par rsonance
magntique nuclaire (SNIF-NMR / RMN-FINS)
(Oeno 426-2011)
- Polyols drivant des sucres (Oeno 9/2006)
Glucose et fructose (pHmtrie) (Oeno 10/2006,
rvision par 377/2009)
- Glucose, fructose et saccharose (pHmtrie) (Oeno
11/2006, rvision par 377/2009)

OIV-MA-AS311-01C

Supprime

OIV-MA-AS311-02

II

OIV-MA-AS311-03

II

OIV-MA-AS311-04

OIV-MA-AS311-05

II

OIV-MA-AS311-06

IV

OIV-MA-AS311-07

III

OIV-MA-AS311-08

IV

SECTION 3.1.2 ALCOOLS


- Titre alcoomtrique volumique (pycnomtrie,
rsonateur de flexion, balance hydrostatique) (A2;
8/2000; 24/2003 ; rvision par 377/2009)
- Titre alcoomtrique volumique (hydromtre,
rfractomtrie) (A2, rvision par 377/2009)
- Tables de conversion (A2)

OIV-MA-AS312-01A

OIV-MA-AS312-01B

IV

- Mthanol (CG) (A 41, rvision par 377/2009)

OIV-MA-AS312-03A

OIV-MA-INT-00-2012

OIV-MA-AS312-02
IV

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires
-

Mthanol (colorimtrie) (A 41, rvision par


377/2009)
Glycrol et butane-2,3-diol (A 21, rvision par
377/2009)
Glycrol (mthode enzymatique) (Recueil OIV ed.
1990, rvision par 377/2009)
Dtermination du rapport isotopique de l'thanol
(Oeno 17/2001)
Glycrol (mthode GC-C-IRMS ou HPLC-IRMS)
(OIV-Oeno 343-2010)

OIV-MA-AS312-03B

IV

OIV-MA-AS312-04

IV

OIV-MA-AS312-05

IV

OIV-MA-AS312-06

II

OIV-MA-AS312-07

IV

- Acidit totale (A 10, rvision par 377/2009)


- Acidit volatile (A 11, rvision par 377/2009)

OIV-MA-AS313-01

OIV-MA-AS313-02

- Acidit fixe (A 11, rvision par 377/2009)


Acides organiques (mthode gnrale HPLC)
(Recueil OIV ed. 1990, rvision par 377/2009)
Acide tartrique (gravimtrie) (A 12, rvision par
377/2009)
- Acide tartrique (colorimtrie) (A 12)

OIV-MA-AS313-03

OIV-MA-AS313-04

IV

SECTION 3.1.3 ACIDES

OIV-MA-AS313-05A

IV

OIV-MA-AS313-05B

Supprime

- Acide lactique - mthode chimique (A 27)


Acide lactique -mthode enzymatique (Recueil OIV
ed. 1990, rvision par 377/2009)
- Acide citrique - mthode chimique (A 29)
Acide citrique - mthode enzymatique (Recueil OIV
ed. 1990, rvision par 377/2009)
- Acide malique total (A 33, rvision par 377/2009)
Acide L-malique : mthode enzymatique (Recueil
OIV ed. 1990, rvision par 377/2009)
Acide D-malique : mthode enzymatique (Oeno
6/98, rvision par 377/2009)
- Acide D-malique - mthode enzymatique faibles
teneurs (Oeno 16/2002, rvision par 377/2009)
Acide L-ascorbique (spectrofluorimtrie) (A 28,
rvision par 377/2009)
- Acide L-ascorbique (spectrophotomtrie) (A 28)
Acide sorbique (spectrophotomtrie) (A 30, rvision
par 377/2009)
- Sorbic Acid (GC ) (A 30, rvision par 377/2009)

OIV-MA-AS313-06

Supprime

OIV-MA-AS313-07

II

OIV-MA-AS313-08

IV

OIV-MA-AS313-09

II

OIV-MA-AS313-10

IV

OIV-MA-AS313-11

II

OIV-MA-AS313-12A

II

OIV-MA-AS313-12B

IV

OIV-MA-AS313-13A

IV

OIV-MA-AS313-13B

Supprime

OIV-MA-AS313-14A

IV

OIV-MA-AS313-14B

IV

- Sorbic Acid (TLC) (A 30, rvision par 377/2009)

OIV-MA-AS313-14C

IV

- pH (A 31, rvision par Oeno 438-2011)


- Acide organique : chromatographie ionique (Oeno
23/2004)
- Acide shikimique (Oeno 33/2004)

OIV-MA-AS313-15

OIV-MA-AS313-16

IV

OIV-MA-AS313-17

II

OIV-MA-INT-00-2012

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires
- Acide sorbique (lectrophorse capillaire) (Oeno
4/2006)
- Acides organiques et sulphates (lectrophorse
capillaire) (Oeno 5/2006 et Oeno 407-2011)
- Acide sorbique, benzoque, salicylique (Oeno
6/2006)
- Acide mtatartrique (Oeno 10/2007)
- Dosage simultan de l'acide L-ascorbique et de
l'acide D-isoascorbique par HLPC (Oeno 11/2008)
- Identification de lacide L- tartrique (Oeno 12/2008)
SECTION 3.1.4 GAZ
- Dioxyde de carbone (A 39 modifie par Oeno
21/2003 et complte par la rsolution Oeno 3/2006,
rvision par 377/2009)
- Mthode de mesure de la surpression des vins
effervescents (Oeno 21/2003)
- Dtermination du rapport isotopique 13C/12C du CO2
dans les vins mousseux (Oeno 7/2005)
- Dioxyde de carbone (mthode manomtrique) (Oeno
2/2006)

OIV-MA-AS313-18

IV

OIV-MA-AS313-19

II et III

OIV-MA-AS313-20

IV

OIV-MA-AS313-21

IV

OIV-MA-AS313-22

II

OIV-MA-AS313-23

IV

OIV-MA-AS314-01

II

OIV-MA-AS314-02

OIV-MA-AS314-03

II

OIV-MA-AS314-04

II

OIV-MA-AS315-01

IV

VOLUME 2

SECTION
3.1.5

AUTRES
COMPOSS
ORGANIQUES
Ethanal (A 37, rvision par 377/2009)
Actate d'thyle (GC) (Recueil OIV ed. 1990,
rvision par 377/2009)
Actate d'thyle (titrimtrie) rvision par 377/2009
Diglucoside de malvidol (A 18, rvision par
377/2009)
Carbamate d'thyle (Oeno 8/98, rvision par
377/2009)
5-(Hydroxymthyl)furfural (colorimtrie) (A 19,
rvision par 377/2009)
Hydroxymethylfurfural (HPLC) (A 19, rvision par
377/2009)
Drivs cyans (oeno 4/94, rvision par 377/2009)
Edulcorants de synthse (TLC: saccharine,
cyclamate, dulcin et P-4000) (A 36, rvision par
377/2009)
Edulcorants de synthse (TLC: saccharine,
cyclamate and Dulcin) (A 36, rvision par

OIV-MA-INT-00-2012

OIV-MA-AS315-02A

IV

OIV-MA-AS315-02B

IV

OIV-MA-AS315-03

IV

OIV-MA-AS315-04

II

OIV-MA-AS315-05A

IV

OIV-MA-AS315-05B

IV

OIV-MA-AS315-06

II

OIV-MA-AS315-07A

IV

OIV-MA-AS315-07B

IV

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires
377/2009)

- Colorants de synthse (A 43, rvision par 377/2009)


Dithylneglycol (Recueil OIV ed. 1990, rvision
par 377/2009)
Ochratoxine A (Oeno 16/2001, rvision par Oeno
349-2011)
- Dtermination par CLHP de neuf Anthocyanes
principales dans le vin rouge et ros (Oeno 22/2003,
Oeno 12/2007)
- Matires protiques dorigine vgtale (Oeno
24/2004)
- Polychlorophnols et polychloroanisoles (Oeno
8/2006)
- Dtermination du lysozyme par HPLC (Oeno 8/2007
- Dtermination du 3-Methoxypropane-1,2-diols et des
glycrols cycliques (Oeno 11/2007)
- Dosage du 2,4,6-trichloroanisole relargable dans le
vin (Oeno 296/2009)
- Recherche et dosage des polychlorophenols et des
polychloroanisoles (Oeno 374/2009)
Analyse des amines biognes par HPLC (Oeno
346/2009)
- Dosage du glutathion (Oeno 345/2009)
- Dtermination des composes -dicarbonyls du vin
par HPLC aprs drivation (Oeno 386A-2010)
- Dtermination des composes -dicarbonyls du vin
par GC aprs drivation (Oeno 386B-2010)
- Dosage de la carboxymethylcellulose dans les vins
blancs (Oeno 404-2010)
- Quantification des rsidus potentiellement
allergniques de protines de collage dans le vin
(Oeno 427-2010)

OIV-MA-AS315-08

IV

OIV-MA-AS315-09

IV

OIV-MA-AS315-10

II

OIV-MA-AS315-11

II

OIV-MA-AS315-12

IV

OIV-MA-AS315-13

Supprime

OIV-MA-AS315-14

IV

OIV-MA-AS315-15

II

OIV-MA-AS315-16

IV

OIV-MA-AS315-17

IV

OIV-MA-AS315-18

II

OIV-MA-AS315-19

IV

OIV-MA-AS315-20

IV

OIV-MA-AS315-21

IV

OIV-MA-AS315-22

IV

OIV-MA-AS315-23

criteria

- Brome total (A 23, rvision par 377/2009)


- Chlorures (A 15, rvision par 377/2009)

OIV-MA-AS321-01

IV

OIV-MA-SA321-02

II

- Fluorures (A22 ; Oeno 22/2004)


- Phosphore total (A 16, rvision par 377/2009)

OIV-MA-AS321-03

II

OIV-MA-AS321-04

IV

- Sulfates (gravimtrie) (A 14, rvision par 377/2009)


- Sulfates (titrimtrie) (A 14)

OIV-MA-AS321-05A

II

OIV-MA-AS321-05B

Supprime

SECTION 3.2 COMPOSS NON ORGANIQUES


SECTION 3.2.1 ANIONS

OIV-MA-INT-00-2012

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires
SECTION 3.2.2 CATIONS

- Ammonium (A 20, rvision par 377/2009)

OIV-MA-AS322-01

IV

- Potassium (SAA) (A 8, rvision par 377/2009)

OIV-MA-AS322-02A

II

Potassium (photomtrie de flamme) (A 8, rvision


par 377/2009)
OIV-MA-AS322-02B
- Potassium (gravimtrie) (A 8, rvision par 377/2009) OIV-MA-AS322-02C
- Sodium (SAA) (A 25, rvision par 377/2009)
OIV-MA-AS322-03A
Sodium (photomtrie de flamme) (A 25, rvision par
377/2009)
OIV-MA-AS322-03B
- Calcium (A 26, rvision par 377/2009)
OIV-MA-AS322-04

III
Supprime
II
III
II

- Fer (AAS) (A 9, rvision par 377/2009))


- Fer (colorimtrie) (A 9, rvision par 377/2009)
Cuivre (Recueil OIV ed. 1990, rvision par
377/2009)
- Magnsium (A 26)

OIV-MA-AS322-05A

IV

OIV-MA-AS322-05B

IV

OIV-MA-AS322-06

IV

OIV-MA-AS322-07

II

- Zinc (A 45)
Argent (Recueil OIV ed. 1990, rvision par
377/2009)
Cadmium (Recueil OIV ed. 1990, rvision par
377/2009)
- Plomb

OIV-MA-AS322-08

IV

OIV-MA-AS322-09

IV

OIV-MA-AS322-10

IV

OIV-MA-AS322-11

Supprime

- Plomb (critres pour mthodes) (Oeno 7/2006)

OIV-MA-AS322-12

II

SECTION 3.2.3 AUTRES COMPOSS NON


ORGANIQUES
Arsenic (SAA) (Oeno 14/2002, rvision par
377/2009)
OIV-MA-AS323-01A
- Arsenic (SAA) (A 34, rvision par 377/2009)
OIV-MA-AS323-01B
- Arsenic (colorimtrie) (A 34)
OIV-MA-AS323-01C

- Azote total (A 40, rvision par 377/2009)


Azote total - Mthode Dumas (Oeno 13/2002,
rvision par 377/2009)
- Bore (A 44, rvision par 377/2009)
Dioxyde de soufre (titrimtrie) (A17, rvision par
377/2009)
Dioxyde de soufre (Iodomtrie) (A17, rvision par
377/2009)
Dioxyde de soufre (mthode moleculaire) (A17,
rvision par 377/2009)
- Dioxyde de soufre - jus de raisin (A17, rvision par
OIV-MA-INT-00-2012

IV
IV
Supprime

OIV-MA-AS323-02A

IV

OIV-MA-AS323-02B

II

OIV-MA-AS323-03

IV

OIV-MA-AS323-04A

II

OIV-MA-AS323-04B

IV

OIV-MA-AS323-04C

IV

OIV-MA-AS323-05

IV

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires
377/2009)
Mercure - Fluorescence atomique (Oeno 15/2002,
rvision par 377/2009)
- Analyse multi-lmentaire par ICP-MS (Oeno 3442010)

SECTION 4 ANALYSES
MICROBIOLOGIQUES
Analyse microbiologique (Oeno 206-2010)
Recherche des antiseptiques et des inhibiteurs de
fermentation (Test de fermentescibilit) (A35; Oeno
6/2006 ; rvision par 377/2009)
Recherche des antiseptiques et des inhibiteurs de
fermentation (Recherche des acides sorbique,
benzoque, p chlorobenzoque, salicylique, p
hydroxybenzoque et ses esters) (A35; Oeno 6/2006 ;
rvision par 377/2009)
Recherche des antiseptiques et des inhibiteurs de
fermentation (Recherche des drivs monohalogns
de l'acide actique) (A35; Oeno 6/2006 ; rvision par
377/2009)
Recherche des antiseptiques et des inhibiteurs de
fermentation (Recherche et dosage du pyrocarbonate
d'thyle) (A35; Oeno 6/2006 ; rvision par 377/2009)
Recherche des antiseptiques et des inhibiteurs de
fermentation (Recherche de l'acide dhydroactique)
(A35; Oeno 6/2006 ; rvision par 377/2009)
Recherche des antiseptiques et des inhibiteurs de
fermentation (Azothydrate de sodium par HPLC)
(A35; Oeno 6/2006 ; rvision par 377/2009)
Numration des Levures de lespce Brettanomyces
bruxellensis par qPCR (Oeno 414-2011)

SECTION 5 AUTRES ANALYSES


- Diffrentiation des mistelles et des vins de liqueur
doux (rvision par 377/2009)

OIV-MA-AS323-06

IV

OIV-MA-AS323-07

II

OIV-MA-AS4-01

IV

OIV-MA-AS4-02A

IV

OIV-MA-AS4-02B

IV

OIV-MA-AS4-02C

IV

OIV-MA-AS4-02D

IV

OIV-MA-AS4-02E

IV

OIV-MA-AS4-02F
OIV-MA-AS4-03

IV
IV

OIV-MA-AS5-01

ANNEXE B - CERTIFICATS D'ANALYSE

- Rgles d'application des mthodes d'analyse

OIV-MA-B1-01

- Modles de certificats d'analyse

OIV-MA-B1-02

ANNEXE C - LIMITES MAXIMALES


ACCEPTABLES
- Limites maximales acceptables de divers lments
contenus dans le vin

OIV-MA-C1-01

OIV-MA-INT-00-2012

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires

ANNEXE D AVIS

- Acide gluconique (oeno 4/91)


OIV-MA-D1-01
- Caractrisation des vins issus du surpressurage (oeno
5/91)
OIV-MA-D1-02
- Teneur en ions chlorures et en ions sodium des vins
(oeno 6/91)
OIV-MA-D1-03
ANNEXE E ASSURANCE QUALITE DANS
LES LABORATOIRES
- Principe de validation (oeno 7/98)

- Etude collaborative
- Fidlit des mthodes (oeno 5/99)
- Protocole pour la planification, la conduite et
linterprtation des tudes de performance des
mthodes danalyse (oeno 6/2000)
- Estimation limite de dtection et limite de
quantification (oeno 7/2000)
- Contrle interne de qualit dans les laboratoires
d'analyse (oeno 19/2002)
- Guide de validation (oeno 10/05)
- Recommandations pour la validation par un seul
laboratoire (Oeno 8/05)
- Recommandations sur lincertitude de mesure (Oeno
9/05)
- Recommendations sur le taux de recouvrement
(392/2009)

ANNEXE F - METHODES SPECIFIQUES


POUR LANALYSE DU SUCRE DE RAISIN
(MOUTS DE RAISIN CONCENTRES
RECTIFIES
Conductivit (Oeno 419A-2011)
Hydroxymethylfurfural (HMF) par la mthode par
chromatographie liquide haute performance (Oeno
419A-2011)
Dtermination du titre alcoomtrique volumique
acquis (TAV) des mouts concentres (MC) et du
sucre de raisin (mouts concentres rectifies, MCR)
(Oeno 419A-2011)
Saccharose (chromatographie liquide a haute
performance) (Oeno 419A-2011)
Acidit totale (Oeno 419A-2011)
pH (Oeno 419A-2011)
Dioxyde de soufre (Oeno 419A-2011)
Caractristiques chromatiques (Oeno 419A-2011)

OIV-MA-INT-00-2012

OIV-MA-AS1-05
OIV-MA-AS1-07
OIV-MA-AS1-08

OIV-MA-AS1-09
OIV-MA-AS1-10
OIV-MA-AS1-11
OIV-MA-AS1-12
OIV-MA-AS1-13
OIV-MA-AS1-14
OIV-MA-AS1-15

OIV-MA-F1-01

IV

OIV-MA-F1-02

IV

OIV-MA-F1-03

IV

OIV-MA-F1-04
OIV-MA-F1-05
OIV-MA-F1-06
OIV-MA-F1-07
OIV-MA-F1-08

IV
IV
IV
IV
IV

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Table des matires

OIV-MA-INT-00-2012

10

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Ethanal

Mthode OIV-MA-AS315-01

Mthode Type IV

thanal
1. Principe de la mthode
Lthanal est dos dans le vin, dcolor au charbon, grce la coloration allant du vert
au violet quil donne avec le nitro pentacyanoferrate II de sodium et la pipridine et
dont lintensit est mesure 570 nm.
2. Appareillage
Spectrophotomtre permettant les mesures dabsorbance la longueur donde de 570
nm avec des cuves de 1 cm de trajet optique.
3. Ractifs
3.1 Solution de pipridine (C5H11N) 10 p. 100 (v/v).
A prparer extemporanment avant chaque dosage en mlangeant 2 ml de
pipridine avec 18 ml deau distille.
3.2 Solution nitroprussiate de sodium 0,4 p. 100.
Dans une fiole jauge de 250 ml, faire dissoudre 1 g de nitroprussiate de sodium,
Na2 [Fe(CN)5 NO].2H2O, pulvris. Complter au trait avec de leau distille.
3.3 Charbon actif
3.4 Acide chlorhydrique dilu 25 p. 100 (v/v), (environ 102 g/l)
3.5 Solution alcaline
Faire dissoudre 8,75 g dacide borique dans 400 ml de solution M dhydroxyde de
sodium. Complter A l de leau distille.
4. Mode opratoire
4.1 Dosage
A 25 ml environ de vin placs dans une fiole conique de 100 ml, ajouter 2 g de
charbon actif. Agiter nergiquement pendant quelques secondes, laisser reposer 2
min. et filtrer sur un filtre pliss lent pour obtenir un filtrat limpide.
A 2 ml de filtrat incolore placs dans une fiole conique de 100 ml, ajouter en
agitant 5 ml de solution de nitroprussiate de sodium et 5 ml de solution de
pipridine, mlanger et placer immdiatement le mlange dans la cuve de 1 cm de
trajet optique dun spectrophotomtre. La coloration produite, qui varie du vert au
violet, est mesure par rapport la couche dair quivalente sur la longueur donde
570 nm. Cette coloration augmente pour diminuer ensuite rapidement; choisir
comme valeur dfinitive la valeur maximale de labsorbance qui est obtenue aprs
environ 50 secondes.

OIV-MA-AS315-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Ethanal

La teneur en thanal contenue dans le liquide analys est dduite dune courbe
dtalonnage.
Remarque : Si, titre exceptionnel, le liquide analyser contenait de lthanal
libre non combin, il serait ncessaire, avant dentreprendre la dtermination de
lthanal total, de le faire passer pralablement ltat de combinaison avec le
dioxyde de soufre. Pour ce faire, additionner une partie du liquide analyser dun
petit excs de dioxyde de soufre libre et labandonner pendant quelques heures
avant de procder au dosage.
4.2. Etablissement de la courbe dtalonnage
4.2.1 Solution mre dthanal combin au dioxyde de soufre
Prparer une solution titrant 5 6 p. 100 (m/v) en dioxyde de soufre et dterminer
son titre exact au moyen dune solution titre diode 0,05 M.
Dans une fiole jauge de 1 l, placer le volume de cette solution qui correspond
1500 mg de dioxyde de soufre. Introduire dans la fiole, au moyen dun entonnoir, 1
ml environ dthanal frachement distill et recueilli dans un mlange rfrigrant.
Porter au litre avec de leau distille. Mlanger et abandonner pendant une nuit.
La teneur exacte de cette solution mre en thanal combin doit tre dtermine
comme suit :
Placer dans une fiole conique de 500 ml de la solution mre et y ajouter 20 ml
dacide chlorhydrique dilu et 100 ml deau. Oxyder le dioxyde de soufre libre par
la solution 0,05 M diode en prsence dempois damidon, en arrtant le virage au
bleu faible.
Ajouter 100 ml de la solution alcaline, la coloration bleue disparat. Titrer le
dioxyde de soufre combin lthanal par liode 0,05 M jusqu coloration bleue
faible : soit n ml le volume vers.
La solution mre dthanal combin SO2 contient donc 44,05 n mg dthanal par
litre.
4.2.2 Prparation de la gamme
Dans les fioles jauges de 100 ml placer successivement 5-10-15-20 et 25 ml de la
solution mre. Porter au trait de jauge avec de leau distille. Ces solutions
correspondent des teneurs en thanal voisines de 40-60-120-160 et 200 mg/l. La
teneur exacte des dilutions doit tre calcule partir de la teneur en thanal de la
solution mre dtermine prcdemment.
Procder au dosage de lthanal sur 2 ml de chacune de ces dilutions comme il est
indiqu plus haut. La reprsentation graphique des absorbances de ces solutions en
fonction de la teneur en thanal est une droite qui ne passe pas par lorigine.

BIBLIOGRAPHIE
REBELEIN H., Deutsche. Lebensmittel. Rundschau., 1970, 66, 5-6.

OIV-MA-AS315-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Actate d'thyle

Mthode OIV-MA-AS315-02A

Mthode Type IV

Actate dthyle
1. Principe des mthodes
Lactate dthyle est dtermin par chromatographie en phase gazeuse sur le
distillat du vin en prsence dun talon interne.
2. Mthode de rfrence
2.1 Appareillage (voir chapitre Mthanol).
2.2.Mode opratoire
Prparer une solution hydroalcoolique 1 g par litre de ltalon interne
(4mthylpentan2ol), dans lthanol 10% vol.
Prparer la solution doser en ajoutant 5 ml de cette solution 50 ml de
distillat de vin obtenu comme il est indiqu au chapitre Titre alcoomtrique.
Prparer une solution de rfrence dactate dthyle 50 mg/l dans lthanol
10% vol. Ajouter 5 ml de solution de ltalon interne 50 ml de cette solution.
Injecter dans le chromatographe 2 l de la solution doser et de la solution de
rfrence, additionnes de ltalon interne.
La temprature du four est de 90 C et le dbit du gaz vecteur de 25 ml par
minute.
2.3 Calculs
S
Sx
i
I

= la surface du pic de lactate dthyle dans la solution de rfrence.


= la surface du pic de lactate dthyle dans la solution doser.
= la surface du pic de ltalon interne dans la solution doser.
= la surface du pic de ltalon interne dans la solution de rfrence.

La teneur en actate dthyle, exprime en milligrammes par litre, est donne


par la relation :

S
50 x I x
i S

OIV-MA-AS315-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Actate d'thyle

Mthode OIV-MA-AS315-02B

Mthode Type IV

Actate dthyle
1. Principe des mthodes
Lactate dthyle est spar par distillation partir du vin amen pH 6,5. Aprs
saponification et concentration convenable en milieu alcalin, le distillat est acidifi
et soumis lentranement la vapeur deau pour sparer lacide actique libr par
la saponification; cet acide est dos par une solution alcaline titre.
2. Mthode
2.1 Ractifs
2.1.1 Solution M dhydroxyde de sodium
2.1.2 Solution tampon de pH 6,5
Dihydrognophosphate de potassium, KH2PO4 .......... 25 g
Solution M dhydroxyde de sodium ...................... 50 ml
Eau q.s.p. ......................................... . 1 litre
2.1.3 Acide tartrique cristallis.
2.1.4 Solution 0,02 M dhydroxyde de sodium.
2.1.5. Solution de phnolphthalene, 1 p. 100 dans lalcool neutre 96% vol.
2.2 Mode opratoire
Dans un ballon de 500 ml, introduire 100 ml de vin non dcarboniqu et le
neutraliser laide de n ml de solution M dhydroxyde de sodium, n tant le
volume de solution 0,1 M dhydroxyde de sodium utilis pour le dosage de
lacidit totale de 10 ml de vin. Ajouter 50 ml de solution tampon de pH 6,5 et
distiller. Le distillat doit tre amen laide dun tube effil dans 5 ml de
solution M dhydroxyde de sodium placs dans un ballon fond rond de 500
ml sur lequel on a trac un cercle dlimitant approximativement le volume de
35 ml. Recueillir 30 ml de distillat.
Boucher le ballon et laisser une heure au repos. Concentrer ensuite le contenu
du ballon 10 ml environ en le plaant sur un bain deau bouillante et en
injectant un vif courant dair du ballon. Laisser refroidir. Ajouter 3 g dacide
tartrique. Eliminer le dioxyde de carbone par agitation sous vide. Transvaser le
liquide dans le barboteur dun appareil entranement la vapeur deau en
rinant le ballon deux fois avec 5 ml deau. Recueillir au moins 250 ml de
distillat.

OIV-MA-AS315-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Actate d'thyle

Titrer par la solution 0,02 M dhydroxyde de sodium en prsence de


phnolphtaline.
2.3 Calcul
Soit n le nombre de millilitres de solution 0,02 M dhydroxyde de sodium
verss. 1 ml correspond 1,76 mg dactate dthyle.
Actate dthyle en milligrammes par litre : 17,6 x n

BIBLIOGRAPHIE
PEYNAUD E., Analyse et contrle des vins, Librairie Polytechnique Ch.-Branger,
1958, 272.

OIV-MA-AS315-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Diglucoside du malvidol

Mthode OIV-MA-AS315-03

Mthode Type IV

Diglucoside du malvidol
1. Principe
Le diglucoside du malvidol, oxyd par lacide nitreux, est transform en une
substance prsentant en milieu ammoniacal, en lumire ultraviolette, une vive
fluorescence verte.
Lintensit de la fluorescence du compos form est mesure par comparaison avec
la fluorescence dune solution titre de sulfate de quinine dont lintensit de
fluorescence a t talonne une fois pour toutes avec du diglucoside du malvidol
de rfrence.
Le dioxyde de soufre libre attnuant la fluorescence, doit tre pralablement
combin de lthanal en excs.
2. Recherche qualitative
2.1 Appareillage
2.1.1 Lampe lumire ultraviolette permettant des mesures 365 nm.
2.2 Ractifs
2.2.1 Solution dthanal :
Paraldhyde cristallisable .................................. 10 g
Alcool thylique 96% vol. ............................................ 100 ml
2.2.2 Acide chlorhydrique M
2.2.3 Solution de nitrite de sodium 10 g/l.
2.2.4 Alcool 96% vol. contenant 5 p. 100 dammoniaque concentr
(20 = 0,92 g/ml).
2.2.5 Vin tmoin contenant 15 mg de diglucoside du malvidol par litre.
2.2.6 Vin exempt de diglucoside du malvidol..
2.3 Mode opratoire
Dans un tube essai, introduire :
10 ml de vin,
1,5 ml de solution dthanal.
Attendre 20 min.
Dans un tube centriFugation de 20 ml de capacit, placer :
1 ml de vin trait lthanal,
1 goutte dacide chlorhydrique M,
1 ml de solution de nitrite de sodium.
OIV-MA-AS315-03 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Diglucoside du malvidol

Agiter; attendre 2 min. (5 min. au maximum); ajouter :


10 ml dalcool ammoniacal.
Traiter dans les mmes conditions 10 ml de vin tmoin contenant 15 mg/l de
diglucoside du malvidol. Agiter. Attendre 10 min. et centrifuger.
Dcanter les liquides clairs surnageant dans des tubes essais calibrs.
Observer comparativement la fluorescence verte en lumire ultraviolette 365
nm du vin analyser et du vin tmoin.
Pour les vins ross, on peut augmenter la sensibilit en prenant :
5 ml de vin trait lthanal,
0,2 ml dacide chlorhydrique M,
1 ml de solution de nitrite de sodium,
5,8 ml d'alcool ammoniacal.
Traiter paralllement le vin tmoin.
2.4 Interprtation
Les vins ne donnant pas de fluorescence ou seulement une fluorescence
nettement infrieure celle du tmoin, sont considrs comme ne contenant pas
de diglucoside du malvidol; dans le cas de fluorescence lgrement infrieure,
gale ou suprieure celle du tmoin, une dtermination quantitative doit tre
effectue.
3. Dtermination quantitative
3.1. Appareillage
3.1.1. Appareil pour la mesure de la fluorescence :
longueur donde dexcitation 365 nm,
longueur donde du rayonnement fluorescent 490 nm.
3.1.2. Cuves en quartz de 1 cm de trajet optique.
3.2 Ractifs
3.2.1. Voire recherche qualitative
3.2.2. Solution de sulfate de quinine 2 mg/l.
Prparer une solution contenant 10 mg de sulfate de quinine trs pur dans 100
ml dacide sulfurique 0,1 M. Diluer 20 ml de cette solution 1 litre avec la
solution 0,1 M dacide sulfurique.
3.3 Mode opratoire
Traiter le vin suivant la mthode dcrite Recherche qualitative, la prise
dessai de vin trait lthanal tant dans tous les cas (vins rouges et ross) de
1 ml.
Placer la solution de sulfate de quinine 2 mg/l dans la cuve de mesure et
rgler le fluorescimtre sur la pleine dviation (transmission T, gale 100%)
en agissant sur la largeur de fente ou la sensibilit.
OIV-MA-AS315-03 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Diglucoside du malvidol

Puis remplacer cette cuve par celle contenant le vin tudi : soit T1 la valeur
lue.
Si le pourcentage de transmission, T1 est suprieur 35, diluer le vin avec un
vin exempt de diglucoside du malvidol dont la fluorescence doit tre infrieure
6 p. 100 (sen assurer par un essai pralable).
Remarques :
1. Lacide salicylique (ou le salicylate de sodium) ajout ventuellement au vin en vue
de sa stabilisation pralablement lanalyse, apporte une fluorescence parasite qui
peut tre limine par une extraction lther.
2. Une fluorescence parasite est apporte dans le cas de laddition de caramel.

3.4 Calcul
Une intensit de fluorescence de 1 correspond, pour un vin exempt de SO2,
dans les conditions opratoires ci-dessus mais traitement lthanal except,
0,426 mg de diglucoside du malvidol par litre de vin.
Dautre part, les vins rouges et ross, ne contenant pas de diglucoside du
malvidol, peuvent prsenter une lgre fluorescence correspondant une valeur
T de lordre de 6 p. 100.
La teneur du vin en milligrammes du diglucoside du malvidol par litre est donc
de :

(T1 6) 0,426 x

11,5
(T1 6) x 0,49
10

Si le vin a t dilu, multiplier le rsultat par le facteur de dilution.


3.5 Expression des rsultats
La teneur en diglucoside du malvidol est exprime en milligrammes par litre de
vin sans dcimale.

BIBLIOGRAPHIE
DORIER P., VERELLE L., Ann. Fals. Exp. Chim., 1966, 59, 1.
GAROGLIO P.G., Rivista Vitic. Enol., 1968, 21, 11.
BIEBER H., Deutsche Lebensmittel Rundschau, 1967, 44-46.
CLERMONT Mlle S., SUDRAUD P., F.V., O.I.V., 1976 n 586.

OIV-MA-AS315-03 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Carbamate d'thyle

Mthode OIV-MA-AS315-04

Mthode Type II

Carbamate d'thyle
(Rsolution oeno 8/98)
Dosage du carbamate dthyle dans les boissons alcoolises : mthode de dtection
slective par chromatographie en phase gazeuse/spectromtrie de masse.
(Applicable la dtermination du carbamate dthyle pour des concentrations
comprises entre 10 et 200 g/l).
(Attention : Respecter les consignes de scurit pour les manipulations des produits
chimiques, pour lthanol, lactone et les produits carcinognes : carbamate
dthyle et dichloromthane. Se dbarrasser des solvants uss de manire
approprie compatible avec les rgles et les rglements cologiques applicables).
1. Principe de la mthode :
Le Carbamate de propyle est ajout un chantillon comme talon interne, la
solution est dilue avec de leau et est place dans une colonne dextraction en
phase solide de 50 ml. Le carbamate dthyle et le carbamate de propyle sont lus
avec du dichloromthane.
Lluat est concentr laide dun vaporateur rotatif sous vide. Le concentr est
analys par chromatographie en phase gazeuse (CG) la dtection est effectue par
spectromtrie de masse par fragmentomtrie en mode SIM (Selected ions
monitoring).
2. Appareillage et conditions chromatographiques (donns titre dexemple) :
2.1 Chromatogramme en phase gazeuse/spectromtre de masse (CG/SM) et
ventuellement un passeur dchantillons et systme de traitement de donnes
ou quivalent.
Colonne capillaire en silice greffe 30 m * x 0,25 mm int., 0,25 m de film
de type Carbowax 20M.
Mode opratoire : injecteur 180 C, gaz vecteur hlium 1 ml/min. et 25 C,
injection selon la mthode Splitless / split .
Programme de temprature : 40 C pendant 0,75 min., puis programmation
10 C/min. jusqu 60 C, puis 3 C/min. jusqu 150 C **, aller jusqu
220 C puis maintenir pendant 4,25 min. 220 C. Le temps de rtention

*
**

Pour certains vins particulirement riches, il peut savrer souhaitable dutiliser une
colonne capillaire de 50 m de long.
Pour certains vins particulirement riches, il peut savrer souhaitable deffectuer une
programmation de temprature de 2 C par minute.

OIV-MA-AS315-04 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Carbamate d'thyle

spcifique du carbamate dthyle est de 23-27 min., celui du carbamate de


propyle est de 2731 min.
Chromatographe en phase gazeuse/spectromtre (CG/SM) interface : ligne de
transfert 220 C. Paramtres du spectromtre de masse mis au point
manuellement avec de la perfluorotributylamine et optimis pour une
sensibilit de masse plus basse, mode acquisition SIM, dlai solvant et temps
de commencement de lacquisition 22 min., temps de maintien/ion 100 ms.
2.2 Evaporateur rotatif sous vide ou systme de concentration de type Kuderna
Danish. (N.B. le taux de rcupration du carbamate dthyle de lchantillon
test, C(g) doit tre compris entre 90-110% pendant le processus).
2.3 Fiole - en forme de poire, 300 ml, col unique rodage.
2.4 Tube de concentration - 4 ml, gradu, avec un joint pellicule de tflon et
bouchon.
3. Ractifs
3.1 Actone - qualit LC. NB : Vrifier chaque lot avant usage par CG/SM
concernant labsence de rponse pour les ions de m/z 62, 74 et 89.
3.2 Dichloromthane NB : Analyser chaque lot avant usage par CG/SM aprs
concentration 200 fois, concentration pour vrifier labsence de rponse pour
les ions de m/z 62, 74 et 89.
3.3 Ethanol - anhydre.
3.4 Carbamate dthyle (CE) solutions standards :
(1) Solution mre - 1,00 mg/ml. Peser 100 mg CE ( 99% puret) dans
une fiole volumtrique de 100 ml et diluer avec de lactone.
(2) Solution standard de travail - 10,0 g/ml. Transfrer 1 ml de la solution
mre CE dans une fiole volumtrique de 100 ml et diluer avec de
lactone jusquau trait de jauge.
3.5 Carbamate de propyle (CP), solutions standards :
(1) Solution mre - 1,00 mg/ml. Peser 100 mg CP (qualit ractif) dans
une fiole volumtrique de 100 ml et diluer avec de lactone jusquau trait de
jauge.
(2) Solution standard de travail 10,0 g/ml. Transfrer 1ml de la solution
mre CP dans une fiole volumtrique de 100 ml et diluer avec de
lactone jusquau trait de jauge.
(3) Solution standard interne CP - 400 ng/ml. Transfrer 4 ml de solution
standard de travail CP dans une fiole volumtrique de 100 ml et diluer avec
de leau jusquau trait de jauge.
3.6 Solutions standards calibres CE - CP - Diluer les solutions standards de
travail de CE, (d) (2), et CP (e) (2), avec du dichloromthane pour obtenir :
(1) (100 ng CE et 400 ng CP)/ml,
OIV-MA-AS315-04

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Carbamate d'thyle

(2) (200 ng CE et 400 ng CP)/ml,


(3) (400 ng CE et 400 ng CP)/ml,
(4) (800 ng CE et 400 ng CP)/ml,
(5) (1.600 ng CE et 400 ng CP)/ml.
3.7 Echantillon test - 100 ng CE/ml dans 40 % dthanol. Transfrer 1 ml des
solutions standards de travail CE, (d) (2) dans une fiole volumtrique de 100 ml
et diluer avec 40 % dthanol jusquau trait de jauge.
3.8 Colonne dextraction en phase solide - Matriel jetable, premball contenant
de la terre de diatomes, capacit 50 ml.
NB : Avant analyse, vrifier chaque lot de colonnes dextraction pour la
rcupration du CE et CP et labsence de rponses pour les ions de m/z 62,
74 et 89. Prparer 100 ng CE/ml dchantillon test (g).
Analyser 5,00 ml de lchantillon test comme dcrit dans D(a), E et F. La
rcupration de 90-110 ng de CE/ml est satisfaisante. Des absorbants dont le
diamtre des particules est irrgulier peuvent entraner des dbits trs lents qui
affectent la rcupration du CE et du CP.
Si, aprs plusieurs essais, 90-110 % de la valeur de lchantillon test nest pas
obtenue, changer la colonne ou utiliser une courbe de calibration de rcupration
corrige pour quantifier le CE.
Pour obtenir la courbe de calibration corrige, prparer des solutions standards
comme dcrites dans (f) en utilisant 40 % dthanol au lieu du dichloromthane.
Analyser 1 ml de la solution standard de calibration comme dcrit en D, E et F.
Construire une nouvelle courbe dtalonnage en utilisant le rapport CE/CP des
standards extraits.
4. Prparation de lchantillon test :
Placer le matriel test dans 2 bechers spars de 100 ml en utilisant les quantits
suivantes :
4.1. Vins contenant plus de 14 % vol. dalcool : 5,00 ml 0,01 ml.
4.2. Vins contenant au plus 14% vol. dalcool : 20,00 ml 0,01 ml.
Dans chaque becher, ajouter 1 ml de solution CP dtalon interne, C(e) (3) et
de leau, afin dobtenir un volume total de 40 ml (ou 40 g).
5. Extraction :
Excuter lextraction sous la hotte aspirante avec une ventilation adquate.
Transfrer la prparation ralise en D dans la colonne dextraction.
Rincer le becher avec 10 ml de leau et transfrer leau de rinage dans la colonne.
Laisser le liquide sabsorber dans la colonne pendant 4 minutes - Eluer par 2 x 80
ml de dichloromthane.

OIV-MA-AS315-04

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Carbamate d'thyle

Recueillir lluat dans une fiole conique de 300 ml.


Evaporer lluat jusqu 2 3 ml laide de lvaporateur rotatif au bain-marie
30 C. (N.B. = ne pas laisser vaporer sec).
Transfrer le rsidu concentr dans un tube gradu de 4 ml, laide dune pipette
Pasteur.
Rincer la fiole avec 1 ml de dichloromthane et transfrer le liquide de rinage
dans le tube.
Concentrer lchantillon 1 ml sous un faible courant dazote.
Transfrer ventuellement le concentr dans une fiole du passeur dchantillon
pour lanalyse CG/SM.
6. Analyse CG/SM :
6.1 Courbe de calibration - injecter 1l de chacune des solutions standards
dtalonnage C (f), en CG/SM.
Faire le graphique du rapport des aires CE-CP pour la rponse de lion m/z 62
sur laxe des ordonnes et porter en abscisses la quantit de CE en ng/ml (soit
100,200, 400, 800, 1600 ng/ml).
6.2 CE quantification - injecter 1l dextrait concentr de E dans le systme
CG/SM et calculer le rapport des aires CE-CP pour lion m/z 62. Dterminer la
concen-tration CE (ng/ml) dans lextrait, en utilisant la courbe dtalonnage
standard interne. Calculer la concentration CE dans lchantillon test (ng/ml)
en divisant la quantit de CE (ng/ml) dans lextrait par le volume de
lchantillon test (g).
6.3 Vrification de la puret du CE.
Dterminer si les rponses pour les ions de m/z 62, 74 et 89 apparaissent au
temps de rtention du CE. Ces rponses sont les caractristiques
respectivement des principaux fragments (M - C2H2)+ et (M - CH3)+ et de lion
molculaire (M). La prsence de CE est confirme si les proportions relatives
de ces ions ne dpassent pas 20% des proportions pour le standard en CE.
Lextrait peut avoir besoin dtre reconcentr pour obtenir une rponse
suffisante pour lion de m/z 89.
7. Analyse collaborative :
Le tableau ci-aprs montre les rsultats individuels pour lchantillon
dentranement pratique et pour les deux types de vins.
Lapplication du test de Cochran a eu pour consquence llimination dun seul
couple de rsultats, tant pour le vin dont le titre alcoomtrique est suprieur 14%
vol. que pour le vin dont le titre alcoomtrique est infrieur ou gal 14% vol.,
chacun venant dun laboratoire diffrent.
La reproductibilit relative tend dcrotre avec laccroissement de la
concentration en carbamate dthyle.
OIV-MA-AS315-04

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Carbamate d'thyle

TABLEAU 1
Performance de la mthode pour la dtermination de carbamate dthyle CE dans
les boissons alcooliques par CG/SM.

Echantillon

Moyenne de CE Rcupration de
trouv ng/g
CE ajout %

Sr

SR

RSDr %

RSDR%

Vin de plus
de 14% vol.

40
80
162

89
90

1,59
3,32
8,20

4,77
7,00
11,11

4,01
4,14
5,05

12,02
8,74
6,84

Vin de
moins de
14% vol

11
25
48

93
93

0,43
1,67
1,97

2,03
2,67
4,25

3,94
6,73
4,10

18,47
10,73
8,86

OIV-MA-AS315-04

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


5Hydroxymthyl-furfural

Mthode OIV-MA-AS315-05A

Mthode Type IV

5Hydroxymthyl-furfural
1. Principe des mthodes
1.1 Mthode colorimtrique
Les aldhydes drivs du furanne, dont le principal est le 5hydroxymthylfurfural, ragissent avec l'acide barbiturique et la ptoluidine pour donner un
compos rouge qui est dos par colorimtrie 550 nm.
Lacide sulfureux libre perturbe le dosage; lorsque sa teneur dpasse 10 mg/l, il
faut lliminer au pralable en le combinant lthanal dont un excs ne
perturbe pas la raction.

2. Mthode
2.1. Appareillage
2.1.1. Spectrophotomtre permettant des mesures entre 300 et 700 nm.
2.1.2. Cuves de verre, de trajet optique gal 1 cm.
2.2. Ractifs
2.2.1. Acide barbiturique en solution 0,5 p. 100 (m/v).
Dissoudre 500 mg d'acide barbiturique, C4O3N2H4 dans de l'eau distille en
chauffant lgrement sur bain d'eau 100 C; porter 100 ml avec de l'eau
distille. La solution se conserve environ 1 semaine.
2.2.2. ptoluidine en solution 10 p. 100 (m/v).
10 g de ptoluidine, C6H4(CH3)NH2 sont placs dans une fiole jauge de
100 ml ; ajouter 50 ml d'isopropanol et 10 ml d'acide actique glacial,
(20 = 1,05 g/ml); complter 100 ml avec de l'isopropanol. Cette solution doit
tre renouvele tous les jours.
2.2.3. thanal en solution aqueuse 1 p. 100 (m/v).
prparer extemporanment.
2.2.4. 5Hydroxymthylfurfural, C6O3H6 en solution aqueuse 1 g/l.
Prparer par dilutions successives des solutions titrant 5, 10, 20, 30 et 40 mg/l.
La solution 1 g/l et ses dilutions doivent tre frachement prpares.
2.3. Mode opratoire
2.3.1.Prparation de l'chantillon
Dioxyde de soufre libre infrieur 10 mg/l.
OIV-MA-AS315-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


5Hydroxymthyl-furfural

Oprer le dosage directement sur 2 ml de vin ou de mot, filtr si ncessaire.


Dioxyde de soufre libre suprieur 10 mg/l.
15 ml d'chantillon analyser sont placs dans un ballon jaug de 25 ml avec
2 ml de solution d'thanal. Mlanger. Attendre 15 min. Porter au trait de
jauge avec de l'eau distille. Filtrer si ncessaire. Oprer le dosage sur 2 ml
de la solution.

2.3.2. Dosage colorimtrique


Dans 2 flacons a et b de 25 ml bouchant meri, placer 2 ml d'chantillon
prpar comme il est indiqu en 2.3.1. Placer dans chaque flacon 5 ml de
solution de ptoluidine ; mlanger. Ajouter dans le flacon b (tmoin) 1 ml d'eau
distille, et dans le flacon a 1 ml de solution d'acide barbiturique. Agiter pour
homogniser. Transvaser le contenu des flacons dans les cuves de 1 cm de
trajet optique du spectrophotomtre. Le zro de l'chelle des absorbances tant
rgl sur le contenu du flacon b pour la longueur d'onde 550 nm, suivre la
variation de l'absorbance du contenu du flacon a; relever sa valeur maximale A
qui est atteinte entre 2 et 5 min.
Les chantillons dont la teneur en 5hydroxymthylfurfural est suprieure
30 mg/l doivent tre dilus avant l'analyse.
2.3.3. tablissement de la courbe d'talonnage
Dans 2 flacons a et b de 25 ml, placer 2 ml de chacune des solutions de
5hydroxymthylfurfural 5, 10, 20, 30 et 40 mg/l et les traiter comme il a
t dcrit en 2.3.2.
La reprsentation graphique des absorbances en fonction des teneurs en mg/l en
5hydroxymthylfurfural des solutions-talons est une droite passant par
l'origine.
2.4. Calculs
La teneur en 5hydroxymthylfurfural est obtenue en reportant sur la courbe
dtalonnage l'absorbance dtermine sur cet chantillon analyser en tenant
compte des dilutions ventuellement effectues.
Elle est donne en milligrammes par litre (mg/l) avec une dcimale.

OIV-MA-AS315-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


5Hydroxymthyl-furfural

Mthode OIV-MA-AS315-05B

Mthode Type IV

5Hydroxymthyl-furfural
1. Principe des mthodes
Mthode par chromatographie liquide haute performance
Sparation sur colonne en phases inverses et dtermination 280 nm.
Les conditions opratoires dcrites ci-dessous sont donnes titre dexemple.
2. Mthode par chromatographie liquide haute performance
2.1.Appareillage
2.1.1. Chromatographie en phase liquide haute performance quipe :

d'un injecteur boucle de 5 ou 10 l,


d'un dtecteur, spectrophotomtre permettant des mesures 280 nm,
d'une colonne de silice sphrique greffe octadcyl,
d'un enregistreur, ventuellement d'un intgrateur.
Dbit de la phase mobile : 1,5 ml/min.

2.1.2. Dispositif de filtration sur membrane (0,45 m).


2.2. Ractifs
2.2.1. Eau bidistille.
2.2.2. Mthanol distill ou de qualit HPLC.
2.2.3. Acide actique (= 1,05 g/ml).
2.2.4. Phase mobile : eau-mthanol-acide actique pralablement filtrs sur
membrane (0,45 m), (40 - 9 - 1 v/v).
Cette phase mobile doit tre prpare chaque jour et dgaze avant utilisation.
2.2.5. Solution de rfrence de 5hydroxymthylfurfural 25 mg/l (m/v).
Placer, dans une fiole jauge de 100 ml, 25 mg exactement pess de
5hydroxymthylfurfural et complter au volume avec du mthanol. Diluer
cette solution au 1/10e avec du mthanol et la filtrer sur membrane (0,45 m).
Cette solution, place au rfrigrateur en flacon de verre brun, hermtiquement
ferm, se conserve 2 3 mois.

OIV-MA-AS315-05B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


5Hydroxymthyl-furfural

2.3. Mode opratoire


Injecter dans le chromatographe 5 (ou 10) l de l'chantillon analyser et
5 (ou 10) l de solution de rfrence de 5hydroxymthylfurfural. Enregistrer
le chromatogramme.
Le temps de rtention du 5hydroxymthylfurfural est voisin de 6-7 minutes.
2.4. Expression des rsultats
La teneur en 5hydroxymthylfurfural est exprime en milligrammes par litre
(mg/l) avec une dcimale.

OIV-MA-AS315-05B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Drives cyanes

Mthode OIV-MA-AS315-06

Mthode Type II

Drives cyans
(Rsolution oeno 4/94)
1. Principe
L'acide cyanhydrique libre et total du vin est libr par hydrolyse acide et spar
par distillation. Aprs raction avec la chloramine T et la pyridine, le dialdhyde
glutaconique form est dos par colorimtrie grce la coloration bleue qu'il donne
avec l'acide dimthyl1,3 barbiturique.
2. Appareillage
2.1. Appareille de distillation.
Utiliser l'appareil de distillation dcrit pour la dtermination de l'alcool du vin.
2.2. Ballon de 500 ml rodage normalis.
2.3. Bain d'eau, thermostat 20C.
2.4. Spectrophotomtre permettant les mesures d'absorbance la longueur d'onde de
590 nm.
2.5. Cuves de verre ou cuves usage unique de 20 mm de trajet optique.
3. Ractifs
3.1. Acide phosphorique (H3PO4) 25 p. 1000 (m/v).
3.2. Solution de chloramine T(C7H7CINNa O2S, 3H2O) 3 p. 100 (m/v)
3.3. Solution d'acide 1,3-dimthylbarbiturique : dissoudre 3,658 g de l'acide 1,3dimthylbarbiturique (C6H8N2O3) dans 15 ml de pyridine et 3 ml d'acide
chlorhydrique (020 = 1,19 g/ml) et complter 50 ml avec de l'eau distille.
3.4. Cyanure de potassium (KCN).
3.5. Solution d'iodure de potassium (KI) 10 p. 100 (m/v).
3.6. Solution de nitrate d'argent (AgNO3), 0,1 M.
4. Mode opratoire
4.1. Distillation :
Dans le ballon de 500 ml (2.2.) placer 25 ml de vin, 50 ml d'eau distille, 1 ml
d'acide phosphorique (3.1.) et quelques perles de verre.
Mettre immdiatement en place le ballon sur l'appareil distiller.
OIV-MA-AS315-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Drives cyanes

Amener le distillat au moyen d'un tube effil dans une fiole jauge de 50 ml
contenant 10 ml d'eau. La file jauge est immerge dans de l'eau glace.
Recueillir 30-35 ml de distillat (soit environ 45 ml de liquide total dans la fiole
jauge).
Laver le tube effil du rfrigrant avec quelques millilitres d'eau distille,
porter 20C le distillat et amener au trait de jauge avec de l'eau distille.
4.2. Mesure :
Placer 25 ml de distillat dans une fiole conique de 50 ml munie d'un bouchon
rod, ajouter 1 ml de solution de chloramine T (3.2.) et boucher
hermtiquement.
Aprs 60 secondes exactement ajouter 3 ml de solution d'acide dimthyl1,3
barbiturique (3.3.), boucher hermtiquement et laisser au repos pendant 10
minutes.
Ensuite mesurer l'absorbance par rapport au tmoin (25 ml d'eau distille au
lieu de 25 ml de distillat) la longueur d'onde 590 nm dans les cuves de 20
mm de trajet optique.
5. Etablissement de la courbe d'talonnage
5.1. Titrage argentimtrique du cyanure de potassium.
Dans une fiole jauge de 300 ml dissoudre environ 0,2 g de KCN (3.4.)
exactement pes dans 100 ml d'eau distille.
Ajouter 0,2 ml de solution d'iodure de potassium (3.5.) et tirer avec la solution
de nitrate d'argent 0,1 M (3.6.) jusqu' obtention d'une coloration jauntre
stable.
1 ml de solution 0,1 M de nitrate d'argent correspondant 13,2 mg de KCN,
calculer le titre de' l'chantillon de KCN.
5.2. Courbe d'talon.
5.2.1. Prparation des solutions talons :
Connaissant le titre dtermin selon 5.1. du KCN, prparer une solution talon
contenant 30 mg/l d'acide cyanhydrique (30 mg HCN 72,3 mg KCN).
Diluer cette solution au 1/10.
Introduire 1,0- 2,0- 3,0- 4,0 et 5,0 ml de la solution talon dilue dans des
fioles jauges de 100 ml et amener au trait de jauge avec de l'eau distille.
Les solutions prpares titrent respectivement 30-60-90-120 et 150 g/l
d'acide cyanhydrique.

OIV-MA-AS315-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Drives cyanes

5.2.2. Dosage :
Prlever 25 ml des solutions ainsi obtenues et continuer comme il est indiqu
ci-dessus en 4.1 et 4.2.
Les valeurs obtenues pour les absorbances avec ces solutions talons reportes
en fonction des teneurs en acide cyanhydrique correspondantes, s'alignent sur
une droite passant par l'origine.

6. Expression des rsultats


L'acide cyanhydrique est exprim en microgrammes par litre (g/l) sans dcimale.
6.1. Calcul
Lire la teneur en acide cyanhydrique sur la courbe d'talonnage.
Si une dilution a t effectue, multiplier le rsultat par le facteur de dilution.

Rptabilit (r) et reproductibilit (R)


Vin blanc = r 3,1 g/l soit environ 6% xi
= R 12 g/l soit environ 25% xi
Vin rouge = r 6,4 g/l soit environ 8% xi
= R 23 g/l soit environ 29% xi
xi = concentration moyenne de HCN dans le vin.

BIBLIOGRAPIE
1) JUNGE C., Feuillet Vert N 877 (1990)
2) ASMUS E., Garschlagen H., Z. Anal. Chem. 138, 413-422 (1953)
3) WRDIG G., MLLER Th., Die Weinwissenschaft 43, 29-37 (1988)

OIV-MA-AS315-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

Mthode OIV-MA-AS315-07A

Mthode Type IV

Recherche des dulcorants de synthse


1. Principe des mthodes
Recherche de la saccharine (sulfimide benzoque), de la dulcine
(pthoxyphnylure), du cyclamate (cyclohexylsulfamate) et du P-4000
(2N propoxy-2-amino-4-nitrobenzne).
Aprs concentration du vin, la saccharine, la dulcine et le P-4000 sont extraits
en milieu acide par le benzne; le cyclamate est extrait du vin aprs cette
extraction benznique par l'actate d'thyle (il est ncessaire de respecter l'ordre
de ces extractions). Les rsidus d'vaporation des solvants sont soumis la
chromatographie en couche mince.
La saccharine et le cyclamate sont caractriss par chromatographie sur plaque
de cellulose (solvant : actone-actate d'thyle-ammoniaque), la premire dans
l'extrait benznique, le second dans l'extrait par l'actate d'thyle aprs
purification par un lavage l'ther.
Ces dulcorants, dcels par pulvrisation d'une solution de benzidine-anilineactate cuivrique, se sparent avec les Rf suivants : 0,29 pour le cyclamate,
0,46 pour la saccharine.
Le P-4000 et la dulcine sont caractriss par chromatographie sur couche de
polyamide, dans l'extrait benznique (solvant : tolune-mthanol-acide actique
glacial). Ces dulcorants, mis en vidence par pulvrisation d'une solution de
p-dimthylaminobenzaldhyde, se sparent avec les Rf suivants : 0,60 pour la
dulcine, 0,80 pour le P-4000.
2. Mthode
Recherche de la saccharine, du cyclamate, de la dulcine et du P-4000.
2.1 Appareillage
2.1.1 Cuve chromatographie
2.1.2 Seringues Micromtriques ou micropipettes
2.1.3 Tube sparateur de 15 mm de diamtre et 180 mm de longueur, muni
d'un robinet
2.1.4 Bain d'eau 100 C
2.1.5 tuve temprature rglable, pouvant atteindre 125 C
2.2 Ractifs
OIV-MA-AS315-07A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

2.2.1 Solvants d'extraction :


- benzne
- actate d'thyle.
2.2.2 Solvants pour chromatographie :
No.1, mlanger :
60 parties
actone ........................................ ...........................
actate dthyle .................................. ............................ 30 parties
10 parties
ammoniaque concentr (20= 0,92 g/ml) ..............
No 2, mlanger :
tolune ...................................... ............................. 90 parties
mthanol ................................... .............................. 10 parties
acide actique glacial (20= 1,05 g/ml) ............... . 10 parties
2.2.3. Plaques pour la chromatographie (20 x 20 cm) :
avec couche de poudre de cellulose (par ex., Whatman CC 41 ou
Macherey-Nagel MN300),
avec couche de poudre de polyamide (par ex., Merck).
2.2.4 Ractif de rvlation pour la saccharine et le cyclamate
Prparer :
solution alcoolique de benzidine 250 mg dans 100 ml dthanol,
solution sature dactate cuivrique Cu(C2H3O2) 2.H2O,
aniline frachement distille.
Mlanger : 15 ml de solution de benzidine, 1 ml daniline et 0,75 ml de
solution sature dactate cuivrique.
Cette solution doit tre prpare extemporanment. Elle correspond au volume
ncessaire pour la rvlation dune plaque 20 x 20 cm.
2.2.5 Acide chlorhydrique dilu au (v/v),
2.2.6 Acide nitrique en solution 25 p. 100 (v/v),
2.2.7 Ractif de rvlation pour le P-4000 et la dulcine : dissoudre 1 g de
1,4pdimthylaminobenzaldhyde dans 50 ml de mthanol; ajouter 10 ml 25%
dacide nitrique 25 p. 100; porter 100 ml avec du mthanol. Utiliser 15 ml
de ce ractif pour la rvlation dune plaque 20 x 20 cm.
2.2.8 Solution hydroalcoolique de cyclamate 0,10 g p.100
Dissoudre 100 mg de sel de sodium ou de sel de calcium de lacide cyclohxylsulfamique dans 100 ml dun mlange parties gales deau et dthanol.
2.2.9 Solution aqueuse de saccharine 0,05 g p. 100 (m/v)
2.2.10 Solution de dulcine 0,05 g p/ 100 ml de mthanol.
2.2.11 Solution de P-4000 0,05 g dans 100 ml de mthanol.

OIV-MA-AS315-07A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

2.3 Mode opratoire


2.3.1 Extraction
100 ml de vin, placs dans un vase cylindrique, sont vapors rapidement
lbullition jusqu rduction du volume 30 ml, tout en dirigeant un jet dair
froid la surface du rcipient. Laisser refroidir. Aciduler avec 3 ml dacide
chlorhydrique dilu au . Transvaser dans une fiole conique de 500 ml munie
dun bouchon rod, ajouter 40 ml de benzne et agiter avec un agitateur
mcanique pendant 30 min. Transvaser dans une ampoule dcantation pour
sparer la phase organique qui sera centrifuge en cas dmulsion. Placer la
phase organique dans une fiole conique bouchon rod.
Verser le vin dj extrait par le benzne, et qui correspond la couche
infrieure dans lampoule dcantation, dans une fiole conique de 500 ml
bouchon rod, avec 40 ml dactate dthyle. Agiter 30 min. et sparer la phase
organique comme prcdemment en prenant soin de rcuprer uniquement la
fraction organique et de ne pas entraner de vin.
Sur un bain deau 100 C, vaporer chaque solvant dextraction dans des
capsules de 50-60 mm de diamtre, par petites portions et en projetant un
courant dair froid sur la surface des capsules. Continuer lvaporation jusqu
ce que le rsidu ait une consistance sirupeuse, en sarrtant avant lvaporation
complte.
Reprendre le rsidu de la capsule o lon a vapor lextrait benznique avec
0,5 ml de solution dthanol-eau (1:1) (il convient de reprendre le rsidu une
premire fois avec 0,25 ml de solution hydroalcoolique et ensuite de laver la
capsule avec une autre portion de 0,25 ml de la mme solution). Runir lextrait
hydroalcoolique dans un petit tube bouchon rod (extrait B).
Le rsidu de la capsule dans laquelle lactate dthyle (qui contient le
cyclamate) a t vapor, est repris par 0,5 ml deau que lon verse dans un
petit tube sparateur. Laver la capsule avec 10 ml dther thylique et ajouter
lther au contenu du tube sparateur. Agiter nergiquement pendant 2 min. et
sparer la couche infrieure dans un petit tube essai dans lequel aura t
pralablement plac 0,5 ml dthanol. On obtient au total 1 ml de solution
hydroalcoolique qui contient ventuellement le cyclamate (extrait A).
2.3.2 Chromatographie
2.3.2.1 Saccharine et cyclamate
Pour la recherche de la saccharine et du cyclamate, utiliser une plaque de
cellulose, la moiti de la plaque pour la recherche du cyclamate et lautre
moiti pour celle de la saccharine.

OIV-MA-AS315-07A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

Pour cela, dposer 5 10 l de lextrait A et 5l de la solution talon de


cyclamate. Dposer ensuite sur la 2me partie de la plaque 5 10 l de lextrait
B et 5 l de la solution talon de saccharine. Placer la plaque ainsi prpare
dans la cuve chromatographie contenant le solvant n 1 (actone-actate
dthyle-ammoniaque); laisser migrer jusqu une hauteur de 10 12 cm.
Retirer la plaque de la cuve et scher avec de lair chaud. Pulvriser
rgulirement et doucement la plaque avec le ractif la benzidine (17-18 ml
pour chaque plaque). Scher la plaque lair froid. Placer ensuite la plaque
dans une tuve maintenue 120-125 C pendant 3 min. Les spots apparaissent
en gris fonc sur fond marron clair; ils brunissent avec le temps.
2.3.2.2 P-4000 et dulcine
Dposer 5 l de lextrait B et 5 l des solutions talons de dulcine et de P-4000
sur une plaque de polyamide. Placer la plaque ainsi prpare dans la cuve
chromatographie qui contient le solvant n 2 (toulne-mthanol acide actique).
Laisser migrer jusqu une hauteur de 10 12 cm.
Retirer la plaque de la cuve; scher l'air froid. Ensuite, pulvriser avec 15 ml
de ractif la p-dimthylaminobenzaldhyde, puis scher lair froid jusqu
ce quapparaissent les spots de couleur jaune orange qui correspondent la
dulcine et au P-4000.
2.3.2.3 Sensibilit
Le ractif la benzidine permet de mettre en vidence des spots correspondant
2 g de saccharine et
5 g de cyclamate.
Le ractif au pdimthylaminobenzaldhyde dcle 0,3 g de dulcine et 0,5 g de P-4000.
Cette mthode permet de dceler (compte tenu du rendement de certaines
extractions) :
2-3 mg/l
saccharine ............................................................... ...........................
cyclamate ........................................................................................ 40-50 mg/l
1 mg/l
dulcine ........................................................................................
P-4000 ........................................................................................ 1 1,5 mg/l

BIBLIOGRAPHIE
TERCERO C., F.V., O.I.V., 1968, n 277 et F.V., O.I.V., 1970, n 352.
Commission danalyse des vins du Service fdral de la Sant dAllemagne, 1969,
F.V., O.I.V., n 316.
Fdration internationale des producteurs de jus de fruits, 1972, F.V., O.I.V., n 40.
SALO T., ALRO E. et SALMINEN K., Z. Lebensmittel Unters. u. Forschung,
1964, 125, 20.

OIV-MA-AS315-07A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

Mthode OIV-MA-AS315-07B

Mthode Type IV

Recherche des dulcorants de synthse


1. Principe des mthodes
Recherche de la saccharine, de la dulcine et du cyclamate.
Ces dulcorants, extraits du vin par un changeur d'ions liquide, puis rextraits
par l'ammoniaque dilu, sont caractriss par chromatographique sur couche
mince d'un mlange de poudre de cellulose et de poudre de polyamide
(solvant : xylne-propanol; n-acide actique cristallisable-acide formique). Ils
sont mis en vidence grce leur fluorescence bleue sur fond jaune que l'on
observe en lumire ultraviolette aprs pulvrisation d'une solution de
2,7dichlorofluorescine.
Une pulvrisation ultrieure de solution de 1,4-dimehylaminobenzaldhyde
permet de diffrencier la dulcine, qui donne seule un spot orange, d'avec la
vanilline et les esters de l'acide p-hydroxybenzoque qui migrent avec le mme
Rf.
3. Mthode
Recherche de la saccharine, du cyclamate et de la dulcine.
3.1 Appareillage
3.1.1 Dispositif pour ltalement en coche mince,
3.1.2 Plaque de verre 20 x 20 cm
Prparation des plaques : mlanger intimement sec 9 g de poudre de cellulose
et 6 g de poudre de polyamide. Ajouter en agitant 60 ml de mthanol. Etaler sur
plaques sur une paisseur de 0,25 mm. Scher pendant 10 min. 70 C. Les
quantits mises en uvre suffisent pour la prparation de 5 plaques.
3.1.3 Bain-marie temprature rglable ou vaporateur rotatif,
3.1.4 Lampe rayonnement U.V. pour examen des plaques chromatographie.
3.2 Ractifs
3.2.1 ther de ptrole (40-60)
3.2.2 changeur dions liquide par exemple Amberlite LA-2
3.2.3 Acide actique dilu au 1/5 (v/v)
3.2.4 Solution dchangeur dions : 5 ml dchangeur dions sont
vigoureusement agits avec 95 ml dther de ptrole et 20 ml dacide actique
dilu au 1/5 (v/v). On emploie la phase suprieure.

OIV-MA-AS315-07B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

3.2.5 Acide nitrique en solution 1 M


3.2.6 Acide sulfurique 10 p. 100 (v/v)
3.2.7 Ammoniaque dilue au (v/v)
3.2.8 Poudre de polyamide, par exemple : Macherey-Nagel ou Merck
3.2.9 Poudre de cellulose, par exemple : Macherey-Nagel MN 300 AC.
3.2.10 Solvant pour chromatographie :
xylne
................................................................... 45 parties
Propan1ol ................................................................. 6 parties
Acide actique cristallisable (20= 1,05 g/ml) ........... 7 parties
Acide formique 98-100% ............ ............................. 2 parties
3.2.11 Rvlateurs :
solution 0,2 g.p. 100 de 2,7-dichlorofluorescine dans lthanol (m/v),
solution de pdimthylaminobenzaldhyde : dissoudre 1 g de
pdimthylaminobenzaldhyde plac dans une fiole jauge de 100 ml
avec environ 50 ml dthanol. Ajouter 10 ml dacide nitrique dilu 25
p. 100 (v/v), et porter au trait avec de lthanol.
3.2.12 Solution talons :

solution de dulcine, 0,1 g p. 100ml dans le mthanol,


solution de saccharine 0,1 g p. 100 ml dans un mlange de mthanol et
deau parties gales,
solution de cyclamate : solution contenant 1 g du sel de sodium ou du sel de
calcium de lacide cyclohexylsulfamique dans 100 ml dun mlange de
mthanol et deau parties gales,
solution de vanilline 1 g p. 100 ml dans un mlange de mthanol et deau
parties gales,
solution dester de lacide p-hydroxybenzoque 1 g p. 100 ml dans le
mthanol.

3.3 Mode opratoire :


50 ml de vin sont placs dans une ampoule dcanter, acidifis par 10 ml
dacide sulfurique dilu et extraits deux reprises par 25 ml, chaque fois, de
la solution dchangeur dions. Les 50 ml de solution dchangeur dions sont
lavs trois reprises avec, chaque fois, 50 ml deau distille que lon rejette,
puis trois reprises avec, chaque fois, 15 ml dammoniaque dilu. Les
solutions ammoniacales runies sont ensuite vapores prudemment 50 C
jusqu sec sur un bain-marie ou dans un vaporateur rotatif. Le rsidu est
repris par 5 ml dactone et 2 gouttes dacide nitrique en solution M, filtr et de

OIV-MA-AS315-07B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des dulcorants de synthse

nouveau vapor sec 70 C sur un bain-marie. Il faut viter de chauffer trop


longtemps et au-dessus de 70 C. Le rsidu est repris par 1 ml de mthanol.
5 10 l de cette solution et 2 l des solutions talons sont dposs sur la
plaque. On laisse migrer le solvant (xylne-propanol-acide actique-acide
formique) sur une hauteur de 15 cm environ, ce qui demande environ 1 heure.
Aprs schage lair, la solution de dichlorofluorescine est pulvrise, en
insistant, sur la plaque. La saccharine et le cyclamate apparaissent aussitt sous
forme de taches claires sur fond couleur saumon. Par examen en lumire
ultraviolette (254 ou 360 nm), les trois dulcorants apparaissent fluorescents en
bleu sur fond jaune.
Les dulcorants se sparent, de bas en haut de la plaque, dans lordre suivant :
cyclamate, saccharine, dulcine.
La vanilline et les esters de lacide p-hydroxybenzoque migrent avec le mme
rf que la dulcine. Pour identifier la dulcine en prsence de ces substances, la
plaque doit tre ensuite pulvrise avec une solution de
pdimthylaminobenzaldhyde. La dulcine apparat sous forme dune tache
orange, tandis que les autres substances ne ragissent pas.
Sensibilit La quantit limite dcele sur la plaque chromatographie est de
5 g pour les trois substances.
Cette mthode permet de dceler :
saccharine ......................................................... 10 mg/l
cyclamate ....................................................... 50 mg/l
dulcine ................................................................ 10 mg/l

BIBLIOGRAPHIE
TERCERO C., F.V., O.I.V., 1968, n 277 et F.V., O.I.V., 1970, n 352.
Commission danalyse des vins du Service fdral de la Sant dAllemagne, 1969,
F.V., O.I.V., n 316.
Fdration internationale des producteurs de jus de fruits, 1972, F.V., O.I.V., n 40.
SALO T., ALRO E. et SALMINEN K., Z. Lebensmittel Unters. u. Forschung,
1964, 125, 20.

OIV-MA-AS315-07B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des colorants de synthse

Mthode OIV-MA-AS315-08

Mthode Type IV

Recherche des colorants de synthse


1. Principe
1

Le vin concentr au /3 de son volume est alcalinis par de lhydroxyde de sodium


en solution dilue et extrait par lther. La phase thre, lave leau, est extraite
par une solution dilue dacide actique ; cette solution actique, alcalinise par
lammoniaque, est porte lbullition, en prsence dun fragment de laine
mordance par le sulfate daluminium et le tartrate acide de potassium. Le colorant
ventuellement prsent se fixe sur la laine. Il est remis en solution par traitement de
la laine par lacide actique dilu. Aprs lvaporation de la solution actique, le
rsidu repris par une solution hydroalcoolique est analys par chromatographie sur
couche mince pour caractriser le colorant.
La phase aqueuse restant aprs lextraction par lther renferme les colorants
caractre acide ventuellement prsents. On les extrait en mettant profit leur
affinit pour les fibres animales quils teignent dune faon nergique : on passe en
milieu acide minral et on les fixe sur un mouchet de laine.
Pour concentrer la matire colorante, on effectue une double fixation ou mme
plusieurs fixations successives sur des mouchets de laine de plus en plus petits.
Si le mouchet de laine est color, le vin a t additionn dun colorant synthtique
que lon caractrise par chromatographie sur couche mince.
2. Appareillage
2.1 Plaque de verre 20 x 20 recouvertes de poudre de cellulose,
2.2 Cuve chromatographie
3. Ractifs
3.1 Ether sulfurique
3.2 Hydroxyde de sodium en solution 5 p. 100 (m/v)
3.3 Acide actique cristallisable (20 = 1,05 g/ml)
3.4 Acide actique dilu, contenant une partie dacide actique pur cristallisable
pour 18 parties deau,
3.5 Acide chlorhydrique dilu : une partie dacide chlorhydrique pour analyse
(20 = 1,19 g/ml), ajouter 10 parties deau distille,
3.6 Ammoniaque (20 = 0,92 g/ml)
OIV-MA-AS315-08 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des colorants de synthse

3.7 Fils de laine blanche, pralablement lavs, dgraisss lther et schs,


3.8 Fils de laine blanche, pralablement lavs, dgraisss lther, schs et
mordancs.
Mordanage : Dissoudre 1 g de sulfate d'aluminium cristallis Al2(SO4).18H2O
et 1,2 g de tartrate acide de potassium dans 500 ml deau. Placer 10 g de fils de
laine blanche, pralablement lavs, dgraisss lther et schs dans ce bain et
agiter pendant 1 h. Laisser reposer 2 3 h ; goutter, laisser scher
temprature ambiante.
3.9 Solvant No.1 pour la chromatographie des colorants caractre basique :
butan1ol ..................................................... 50 ml
thanol .................................................. 25 ml
acide actique (20 = 1,05 g/ml) ............................ 10 ml
eau distille .................................................... 25 ml
3.10 Solvant No.2 pour chromatographie des colorants caractre acide :
butan1ol ..................................................... 50 ml
thanol .................................................. 25 ml
ammoniaque (20 = 1,05 g/ml) .............. ................ 10 ml
eau distille ................................................ 25 ml
4. Mode opratoire
4.1 Recherche des colorants caractre basique.
4.1.1 Extraction des matires colorantes.
200 ml de vin places dans une fiole conique de 500 ml sont ports lbullition
que lon maintient jusqu rduction au 1/3 du volume.
Aprs refroidissement, neutraliser avec la solution dhydroxyde de sodium 5 p.
100 jusqu virage franc de la couleur naturelle du vin.
Extraire deux reprises avec 30 ml dther. Les phases thres sont runies ;
elles renferment les colorants basiques ventuellement prsents ; le rsidu
dextraction doit tre conserv en vue de la recherche des colorants acides.
Lther dextraction est lav deux fois avec 5 ml deau dans le but dliminer
lhydroxyde de sodium ; il est agit avec 5 ml dacide actique dilu. La phase
aqueuse acide obtenue est colore si lon est en prsence de colorant basique.
La prsence de ce colorant peut tre confirme par sa fixation sur la laine
mordance. La phase aqueuse acide obtenue ci-dessus est alcalinise par
lammoniaque 5 p. 100. Ajouter 0,5 g de laine mordance ; porter
lbullition pendant 5 min. Rincer la laine sous un courant deau. Si la laine est
colore, le vin contient un colorant basique.

OIV-MA-AS315-08 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des colorants de synthse

4.1.2 Caractrisation par chromatographie sur couche mince.


La phase aqueuse actique contenant le colorant basique est concentre jusqu
0,5 ml.
Si le colorant a t fix sur un mouchet de laine, celui-ci est trait lbullition
par 10 ml deau distille et 10 gouttes dacide actique (20 = 1,05 g/ml).
Retirer le fragment de laine aprs lavoir essor. Concentrer la solution jusqu
0,5 ml.
Dposer sur la plaque de cellulose 20 l de cette solution concentre 3 cm du
bord latral et 2 cm du bord infrieur de la plaque.
Mettre la plaque en place dans la cuve contenant le solvant n 1 de faon ce
que son bord infrieur soit immerg dans le solvant sur une hauteur de 1 cm.
Lorsque le front du solvant a migr sur un hauteur de 15 20 cm, retirer la
plaque de la cuve. La laisser scher lair.
Identifier le colorant au moyen de solutions de colorants de synthse
caractre basique dposes simultanment sur le chromatogramme.
4.2 Recherche des colorants caractre acide
4.2.1 Extraction des matires colorantes.
Utiliser le rsidu du vin concentr au 1/3 et neutralis aprs son extraction par
l'ther en vue de la recherche des colorants caractre basique.
Si cette recherche ne s'impose pas, partir de 200 ml de vin, les placer dans une
fiole conique, porter l'bullition jusqu' rduction au 1/3.
Dans l'un ou l'autre cas, ajouter 3 ml d'acide chlorhydrique dilu et 0,5 g de
laine blanche : faire bouillir durant 5 min., dcanter le liquide et laver la laine
l'eau courante.
Dans la fiole conique, qui contient la laine, ajouter 100 ml d'eau et 2 ml d'acide
chlorhydrique dilu; faire bouillir durant 5 min., dcanter le liquide acide et
rpter ce traitement jusqu' ce que le liquide de lavage soit incolore.
Aprs avoir bien lav la laine pour liminer compltement le liquide acide, la
remettre dans la fiole conique avec 50 ml d'eau distille et 10 gouttes
d'ammoniaque (20 = 0,92 g/ml) : porter une douce bullition pendant 10 min.
afin de dissoudre la matire colorante artificielle qui s'est ventuellement fixe
sur la laine.
Retirer la laine de la fiole, porter le volume de liquide 10 ml et faire bouillir
jusqu' vaporation complte de l'ammoniaque. Aciduler avec 2 ml d'acide
chlorhydrique dilu (vrifier que la raction du liquide soit franchement acide
en portant 1 goutte de ce liquide sur du papier indicateur).
Mettre dans la fiole 60 mg (20 cm environ de fil courant) de laine blanche et
faire bouillir durant 5 min.; retirer la laine et la rincer dans de l'eau courante.

OIV-MA-AS315-08 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des colorants de synthse

Si, aprs cette opration, la laine est colore en rouge, lorsqu'il s'agit de vin
rouge, ou en jaune s'il s'agit de vin blanc, la prsence de matire colorante
organique artificielle, de nature acide, est prouve.
Si la coloration est faible ou douteuse, rpter le traitement l'ammoniaque et
faire une seconde fixation sur un fil de laine de 30 mg.
Si au cours de cette seconde fixation, une coloration rose, mme faible mais
nette, est obtenue, conclure la prsence d'un colorant acide.
Si ncessaire pour une plus complte analyse, procder de nouvelles
fixations-lutions (jusqu' 4 ou 5) en oprant toujours de faon identique celle
employe pour la seconde fixation jusqu' ce qu'une coloration rose, mme
ple mais nette, soit obtenue.
4.2.2 Caractrisation par chromatographie sur couche mince.
Le mouchet de laine color est trait l'bullition par 10 ml d'eau distille et
10 gouttes d'ammoniaque (20 = 0,92 g/ml). Retirer le fragment de laine aprs
avoir l'avoir essor. Concentrer la solution ammoniacale jusqu' 0,5 ml.
Dposer sur une plaque de cellulose 20 l de cette solution 3 cm du bord
latral et 2 cm du bord intrieur de la plaque.
Mettre la plaque en place dans la cuve de faon, ce que son bord infrieur soit
immerg dans le solvant sur une hauteur de 1 cm.
Lorsque le front du solvant a migr sur une hauteur de 15 20 cm, retirer le
plaque de la cuve; la laisser scher l'air.
Identifier le colorant au moyen de solutions de colorants de synthse dposes
simultanment sur le chromatogramme.

BIBLIOGRAPHIE
TERCERO C., F.V., O.I.V., 1970, n 356.
ARATA P., SAENZ-LASCANO-RUIZ, Mme I., F.V., O.I.V., 1967, n 229.

OIV-MA-AS315-08 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dithylneglycol

Mthode OIV-MA-AS315-09

Mthode Type IV

Dithylneglycol
(2hydroxy-thoxythanol)
1 Objectif
Dceler le dithylneglycol, HOCH2CH2OCH2CH2OH, dans les vins une teneur
gale ou suprieure 10 mg/l.

2 Principe de la mthode
Sparation du dithylneglycol des autres constituants du vin par chromatographie
en phase gazeuse sur colonne capillaire, aprs extraction par lther.
Remarque : Les conditions opratoires dcrites ci-dessous sont donnes titre
dexemple.

3 Appareillage
3.1 Chromatographe en phase gazeuse quip :
- dun injecteur split-splitless,
- dun dtecteur ionisation de flamme,
- dune colonne de sparation : colonne capillaire revtue dun film de
polythylneglycol (Carbowax 20 M), de longueur 50 m et de diamtre
intrieur 0,32 mm.
Conditions opratoires :
Temprature de linjecteur : 280 C.
Temprature du dtecteur : 270 C.
Gaz vecteur : hydrogne
Dbit du gaz vecteur : 2 ml/min.
Fuite : 30 ml/min.
Injection : splitless.
Volume inject : 2 l.
Injection 35 C fuite ferme pendant 40 s.
Programmation de temprature : 120 C 170 C 3 C/min.
3.2 Centrifugeuse

OIV-MA-AS315-09 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dithylneglycol

4 Ractifs
4.1 Solution de propane1,3diol, 1 g/l, dans lalcool, 20% vol. (talon interne).
4.2 Solution aqueuse de dithylneglycol 20 mg/l.
5. Mode opratoire
Dans un flacon de 50 ml, placer :
10 ml de vin
1 ml de solution de propane1,3diol
25 ml dther.
Agiter et ajouter une quantit suffisante de carbonate neutre de potassium pour
saturer le mlange. Agiter.
Sparer les deux phases par centrifugation.
Procder une deuxime extraction.
Eliminer lther par vaporation et reprendre le rsidu par 5 ml dthanol.
Le rendement de lextraction doit tre au moins de 90 p. 100.
Procder la chromatographie en phase gazeuse selon les conditions donnes en
3.1.
6. Rsultats
Lidentification du dithylneglycol se fait laide de son temps de rtention
comparativement la solution de rfrence, analyse dans les mmes conditions
que le vin.
Le dosage se fait comparativement la solution de rfrence selon le principe de la
mthode par talonnage interne.
Il est recommand, en prsence de teneurs gales ou infrieures 20 mg/l, de
confirmer leur prsence par spectromtrie de masse.

BIBLIOGRAPHIE
BANDION F., VALENTA M. & KOHLMANN H., Mitt. Klosterneuburg, Rebe
und Wein, 1985, 35, 89.
BERTRAND A., Conn. vigne vin, 1985, 19, 191.
Laboratoire de la rpression des fraudes et du contrle de la qualit de Montpellier,
F.V., O.I.V., 1986, n 807.

OIV-MA-AS315-09 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

Mthode OIV-MA-AS315-10

Mthode Type II

Dosage de l'ochratoxine A dans le vin aprs passage sur


colonne d'immunoaffinit et CLHP avec dtection
fluorimtrique
(Rsolution Oeno 16/2001, rvision per Oeno 349-2011)

1. DOMAINE D'APPLICATION
Ce document dcrit une mthode qui s'applique la dtermination de l'ochratoxine
A (OTA) dans les vins rouges, ross et blancs (y compris vins spciaux) des
concentrations allant jusqu' 10 g/l en utilisant une colonne d'immunoaffinit et la
chromatographie liquide haute performance (CLHP) [1].
Cette mthode a t valide lors d'une tude en collaboration internationale qui a
consist doser l'OTA dans les vins blancs et rouges lors de l'analyse de vins
naturellement contamins et de vins additionns de toxine des concentrations
allant de 0,01 g/l 3,00 g/l.
La mthode peut s'appliquer aux vins mousseux et vins ptillants, condition que
les chantillons soient pralablement dgazs (par sonication par exemple).
2. PRINCIPE
Les chantillons de vins sont dilus avec une solution contenant du polythylne
glycol et de l'hydrognocarbonate de sodium puis ils sont filtrs et purifis sur
colonne d'immunoaffinit. L'OTA est lue avec du mthanol et quantifie par
CLHP en phase inverse avec une dtection fluorimtrique.
3. REACTIFS

3.1 Ractifs pour la sparation de lOTA sur colonne dimmunoaffinit


Les ractifs indiqus ci-dessous le sont titre dexemple. En effet, les
fournisseurs des colonnes dimmunoaffinit peuvent proposer des solutions
de dilution et des luants adapts leurs produits. Il est alors souhaitable de
se conformer leurs prescriptions.
3.1.1 Hydrognophosphate de disodium dihydrat (Na2HPO42H2O) CAS
[10028-24-7]
3.1.2 Dihydrognophosphate de sodium monohydrat (NaH2PO4H2O) CAS
[10049-21-5]
OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

3.1.3 Chlorure de sodium (NaCl) CAS [7647-14-5]


3.1.4 Eau purifie pour laboratoire, par exemple de qualit EN ISO 3696
(eau pour utilisation en laboratoire de chimie analytique - spcification et
mthode dessai [ISO 3696 :1987]).
3.1.5 Tampon PB (solution de dilution)
Dissoudre 60 g de Na2HPO42H2O (3.1.1) et 8.8 g de NaH2PO4H2O (3.1.2)
dans 950 ml d'eau et complter 1 litre avec de l'eau.
3.1.6 Tampon PBS (solution de lavage)
Dissoudre 2.85 g de Na2HPO42H2O (3.1.1), 0.55 g de NaH2PO4H2O
(3.1.2) et 8.7 g de NaCl (3.1.3) dans 950 ml d'eau et complter 1 litre avec
de l'eau.
3.1.7 Mthanol (CH3OH) CAS [67-56-1]
3.2 Ractifs pour HPLC
3.2.1 Actonitrile qualit HPLC (CH3CN) CAS [75-05-8]
3.2.2 Acide actique glacial (CH3COOH) CAS [64-19-7]
3.2.3 Phase mobile HPLC : eau : actonitrile : acide actique glacial,
99:99:2, v/v/v
Mlanger 990 ml d'eau avec 990 ml d'actonitrile (3.2.2) et 20 ml d'acide
actique glacial (3.2.3). En cas de prsence de composs non solubiliss,
filtrer sur filtre 0.45 m. Dgazer (par exemple avec hlium) sauf si le
matriel HPLC utilis comporte un tage de dgazage.
3.3 Ractifs pour la prparation de la solution mre dOTA
3.3.1 Tolune (C6H5CH3) CAS [108-88-3]
3.3.2 Mlange de solvants (Tolune: acide actique glacial, 99:1, v/v).
Mlanger 99 parties en volume de tolune (3.3.1) avec une partie en volume
d'acide actique glacial (3.2.2).
3.4 Solution mre d'OTA
Dissoudre 1 mg d'OTA ou le contenu d'une ampoule (si l'OTA a t obtenue sous
forme d'une pellicule aprs vaporation) dans le mlange de solvant (3.12) pour
obtenir une solution contenant approximativement 20 30 g/ml d'OTA.
Pour dterminer la concentration exacte, enregistrer le spectre d'absorption de la
solution entre 300 et 370 nm dans une cuve en quartz de 1 cm de chemin optique
en se servant du mlange du solvant (3.12) comme blanc. Identifier le maximum
d'absorption et calculer la concentration d'OTA (c) en g/ml en utilisant l'quation
suivante:
c = Amax M 100 /
OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

Dans laquelle:
Amax = Absorption dtermine la longueur d'onde maximale ( environ 333 nm)
M = masse molculaire de l'OTA = 403,8 g/mole
= coefficient d'extinction molaire de l'OTA dans le mlange de solvant (3.12)
( = 544/mole)
= chemin optique (cm)
Cette solution est stable -18C pour au moins 4 ans.
3.5 Solution standard d'OTA (2 g/ml dans le tolune:acide actique, 99:1, v/v)
Diluer la solution mre (3.13) avec le mlange de solvants (3.12) pour obtenir une
solution standard la concentration d'OTA de 2 g/ml.
Cette solution peut tre conserve + 4 C au rfrigrateur. La stabilit devrait tre
teste rgulirement..
4. APPAREILLAGE
Equipement usuel de laboratoire et en particulier le matriel suivant :
4.1 Flacons de verre (4 ml)
4.2 Pompe vide pour prparer les colonnes d'immunoaffinit.
4.3 Rservoir et tube d'coulement adapts aux colonnes d'immunoaffinit.
4.4 Filtres en fibre de verre (par exemple Whatman GF/A).
4.5 Colonne d'immunoaffinit spcifique pour l'OTA.
La colonne devrait avoir une capacit de liaison totale au moins gale 100 ng
d'OTA et permettre un rendement de purification au moins gal 85% quand on y
fait passer une solution dilue de vin contenant 100 ng d'OTA.
4.6. Evaporateur rotatif
4.7 Chromatographe liquide, avec pour la phase mobile, une pompe capable
datteindre un dbit constant de 1ml/mn en isocratique.
4.8 Systme d'injection, doit tre quip d'une boucle de 100 l.
4.9 Colonne de CLHP analytique en acier 150 4,6 mm (d.i.) remplie avec une
phase stationnaire C18 (5 m) prcde d'une pr-colonne ou pr-filtre (0,5 m)
contenant une phase convenable. Des colonnes de dimensions diffrentes peuvent
tre utilises pourvu qu'elles assurent une bonne ligne de base et un bruit de fond
permettant de dtecter le pic d'OTA parmi les autres pics.
4.10 Dtecteur de fluorescence reli la colonne et dont la longueur d'onde
d'excitation est fixe 333 nm et la longueur d'onde d'mission 460 nm.
4.11 Systme d'acquisition des donnes
OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

4.12 Spectromtre U.V.


5. MODE OPERATOIRE
5.1 Prparation des chantillons
Verser 10 ml de vin dans un flacon conique de 100 ml. Ajouter 10 ml de la solution
de dilution (3.8). Mlanger vigoureusement. Filtrer sur filtre en fibre de verre (4.4)
(la filtration est ncessaire pour les solutions troubles ou quand il y a un prcipit,
aprs dilution).
5.2 Purification par colonne d'immunoaffinit
Monter la colonne d'immunoaffinit (4.5) la pompe vide (4.2), y fixer le
rservoir (4.3).
Ajouter 10 ml (quivalent de 5 ml de vin) de la solution dilue dans le rservoir et
faire passer dans la colonne d'immunoaffinit avec un dbit d'environ 1 goutte par
seconde. Il faut viter que la colonne d'immunoaffinit soit sec. Laver la colonne
d'immunoaffinit avec 5 ml de la solution de lavage (3.9) puis avec 5 ml d'eau
toujours au dbit de 1 2 gouttes par seconde.
Scher la colonne en y faisant passer de l'air. Eluer l'OTA dans le flacon de verre
(4.1) avec 2 ml de mthanol (3.4) la vitesse de 1 goutte par seconde. Evaporer
l'luat sec 50 C sous azote. Redissoudre immdiatement dans 250 l de la
phase mobile CLHP (3.10) et stocker 4 C jusqu' l'analyse par CLHP.
5.3 Analyse CLHP
Injecter 100 l de l'extrait reconstitu (quivalent 2 ml de vin) dans le
chromatographe par la boucle d'injection.
Conditions opratoires :
Dbit:
1 ml /min.
Phase mobile:
actonitrile:eau:acide actique glacial (99:99:2, v/v/v)
Dtection fluorimtrique:
longueur d'onde d'excitation = 333 nm
longueur d'onde d'mission = 460 nm
Volume d'injection:
100 l
6. QUANTIFICATION DE L'OCHRATOXINE A (OTA)
La quantification de l'OTA devrait tre ralise en mesurant les aires sous courbe
(ou dfaut les hauteurs de pics) au temps de rtention de l'OTA par comparaison
avec la courbe de calibration.
6.1 Courbe de calibration

OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

Prparer une courbe de calibration chaque jour d'analyse et chaque fois que les
conditions chromatographiques changent. Mesurer 0,5 ml de la solution standard
d'OTA (3.14) 2 g/ml dans un flacon en verre et vaporer le solvant sous azote.
Redissoudre dans 10 ml de phase mobile CLHP (3.10) qui a t filtre
pralablement sur filtre 0,45 m. Ceci donne une solution d'OTA 100 ng/ml.
Prparer 5 solutions de calibration CLHP dans 5 flacons de 5 ml jaugs suivant le
tableau 1.
Complter chaque standard 5 ml avec la phase mobile CLHP (3.10).
Injecter 100 l de chaque solution dans le CLHP.

Tableau 1
Std 1

Std 2

Std 3

Std 4

Std 5

l de phase mobile CLHP filtre (3.10)

4970

4900

4700

4000

2000

l de solution d'OTA 100 ng/ml:


Concentration en OTA (ng/ml)
OTA injecte (ng)

30
0,6
0,06

100
2,0
0,20

300
6,0
0,60

1000
20
2,00

3000
60
6,00

NOTE:
1. Si la quantit d'OTA dans les chantillons se situe en dehors de la gamme de
calibration,
une dilution approprie sera ralise ou bien des volumes infrieurs devront tre
injects.
Dans ces cas, le calcul final (7) doit tre reconsidr au cas par cas,
2. Du fait de la grande variabilit des concentrations, il est recommand de faire
passer la
droite de calibration par zro de faon avoir une quantification exacte pour
les faibles
concentrations d'OTA (infrieures 0,1 g/l).
7. CALCULS
Calculer partir des courbes de calibration la quantit d'OTA dans la partie
aliquote de la solution teste injecte dans la colonne de CLHP.
Calculer la concentration d'OTA (COTA) en ng/ml (quivalent g/l) en utilisant la
OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

formule:
COTA = MA F/V1 V3/V2
O:
MA est la masse d'ochratoxine A (en ng) dans la partie aliquote de matrice injecte
sur la colonne et dtermine partir de la courbe de calibration.
F est le facteur de dilution
V1 est le volume d'chantillon analyser (10 ml)
V2 est le volume de la solution teste, injecte dans la colonne (100 l)
V3 est le volume de solution utilise pour redissoudre l'luat sec (250 l)
8. PERFORMANCES DE LA METHODE DANS LE LABORATOIRE
Le tableau 2 regroupe les performances de la mthode applique aux vins blancs,
ross, et rouges dans les laboratoires ayant particip la validation de la mthode.
Tableau 2. Rendement d'extraction partir de vins surchargs en ochratoxine A
diffrentes concentrations
Surcharge
(g/l)
0,04
0,1
0,2
0,5
1,0
2,0
5,0
10,0
Moyenne
des
moyennes

Vin rouge
Rendement RSD#
SD*
(%)
(%)
96,7 2,2
2,3
90,8 2,6
2,9
91,3 0,6
0,7
92,3 0,4
0,5
97,8 2,6
2,6
96,5 1,6
1,7
88,1 1,3
1,5
88,9 0,6
0,7

Vin ros
Rendement RSD#
SD*
(%)
(%)
94,1 6,1
6,5
89,9 1,0
1,1
88,9 2,1
2,4
91,6 0,4
0,4
103,6 2,5
2,5
98,6 1,8
1,8
-

Vin blanc
Rendement
RSD#
SD*
(%)
(%)
91,6 8,9
9,7
88,4 0,2
0,2
95,1 2,4
2,5
93,0 0,2
0,2
100,7 1,0
1,0
98,0 1,5
1,5
-

92,8 3,5

94,5 5,2

94,5 4,1

3,8

5,5

4,3

* SD = Ecart-type (Standard dviation) (n = 3 replicats) ;


#
RSD = Ecart-type relatif (Coefficient de variation).

OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

9. TRAVAIL DE COLLABORATION
La mthode a t valide par une tude collaborative avec la participation de 16
laboratoires rpartis dans 8 pays, suivant les recommandations du protocole
harmonis pour la validation des mthodes d'analyse [2]. Chaque participant a
analys 10 vins blancs, 10 vins rouges, reprsentant 5 vins dupliqus en aveugle
naturellement contamins ou surchargs. Les performances de la mthode qui
rsultent de ce travail sont rapportes dans les annexes I et II.
10. LABORATOIRES PARTICIPANTS
Unione Italiana Vini, Verona
Istituto Sperimentale per lEnologia, Asti
Istituto Tecnico Agraria, S. Michele allAdige (TN)
Universit Cattolica, Piacenza
Institute for Health and Consumer Protection, JRC Ispra
Neotron s.r.l., S. Maria di Mugnano (MO)
Chemical Control s.r.l., Madonna dellOlmo (CN)
Laboratoire Toxicologie Hygine Applique, Universit V.
Segalen, Bordeaux
Laboratoire de la D.G.C.C.R.F. de Bordeaux, Talence
National Food Administration, Uppsala
Systembolagets Laboratorium, Haninge
Chemisches Untersuchungsamt, Trier
State General Laboratory, Nicosia
Finnish Customs Laboratory, Espoo
Central Science Laboratory, York
E.T.S. Laboratories, St. Helena, CA

ITALIE
ITALIE
ITALIE
ITALIE
ITALIE
ITALIE
ITALIE
FRANCE
FRANCE
SUEDE
SUEDE
ALLEMAGNE
CHYPRE
FINLANDE
ROYAUME-UNI
ETATS-UNIS

11. References
[1] A. Visconti, M. Pascale, G. Centonze. Determination of ochratoxin A in
wine by means of immunoaffinity column clean-up and high-performance liquid
chromatography. Journal of Chromatography A, 864 (1999) 89-101.
[2] AOAC International 1995, AOAC Official Methods Program, p. 23-51.

OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

ANNEXE I
Les donnes suivantes sont obtenues dans un test interlaboratoires selon les
recommandations du protocole harmonis pour les tudes collaboratives en vue de
valider une mthode d'analyse.
VIN BLANC
Echantillon
Anne du test interlaboratoires
Nombre de laboratoires
Nombre de laboratoires retenus aprs
limination des valeurs aberrantes
Nombre de laboratoires limins
Nombre de rsultats accepts
Valeur moyenne (g/l)
Ecart-type/Rptabilit sr (g/l)
Ecart-type relatif (Coefficient de
variation) /Rptabilit RSDr (%)
Limite de rptabilit r (g/l)
Ecart-type/Reproductibilit sR (g/l)
Ecart-type relatif (Coefficient de
variation) /Reproductibilit RSDR (%)
Limite de Reproductibilit R (g/l)
Rendement d'extraction %

Blanc
1999
16

Surcharge en OTA (g/l)


0,100
1,100
2,000
1999
1999
1999
16
16
16

n.c.
1999
16

14*

13*

14

14

15

28
<0,01
-

1
26
0,102
0,01

2
28
1,000
0,07

2
28
1,768
0,15

1
30
0,283
0,03

10,0

6,6

8,5

10,6

0,028
0,01

0,196
0,14

0,420
0,23

0,084
0,04

14,0

13,6

13,3

14,9

0,028
101,7

0,392
90,9

0,644
88,4

0,112
-

* 2 laboratoires ont t exclus de l'valuation statistique cause de la limite de


dtection leve (= 0,2 g/l).
n.c. = chantillon naturellement contamin

OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

ANNEXE II
Les donnes suivantes sont obtenues dans un test interlaboratoires selon les
recommandations du protocole harmonis pour les tudes collaboratives en vue de
valider une mthode d'analyse.
VIN ROUGE

Surcharge en OTA (g/l)

Echantillons

Blanc

0,200

0,900

3,000

n.c.

Anne du test interlaboratoires

1999

1999

1999

1999

1999

Nombre de laboratoires

15

15

15

15

15

Nombre de laboratoires retenus aprs


limination des valeurs aberrantes
Nombre de laboratoires limins

14*

12*

14

15

14

Nombre de rsultats accepts

28

24

28

30

28

<0,01

0,187

0,814

2,537

1,693

0,01

0,08

0,23

0,19

5,5

9,9

8,9

10,9

Limite de Rptabilit r (g/l)

0,028

0,224

0,644

0,532

Ecart-type/Reproductibilit sR (g/l)

0,02

0,10

0,34

0,23

9,9

12,5

13,4

13,4

Limite de Reproductibilit R (g/l)

0,056

0,280

0,952

0,644

Rendement d'extraction %

93,4

90,4

84,6

Valeurs moyennes (g/l)


Ecart-type/Rptabilit sr (g/l)
Ecart-type relatif (Coefficient de
variation) /Rptabilit RSDr (%)

Ecart-type relatif (Coefficient de


variation)

/Reproductibilit

RSDR

(%)

* 1 laboratoire a t exclu de l'valuation statistique cause de la limite de


dtection leve (= 0,2 g/l).
n.c. = chantillon naturellement contamin

OIV-MA-AS315-10 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

ANNEXE III

Guide concernant les points critiques de la mthode de dtermination


de l'Ochratoxine A par colonne d'immuno-affinit 16/2001, de type II.
Les points critiques a prendre en considration sont lists ci-aprs titre
indicatif et constituent un guide d'application de la mthode. La
numrotation se rapporte aux paragraphes de la rsolution originale.

1. Domaine d'application
A titre indicatif la mthode peut s'appliquer aux mots de raisins, mots de
raisin partiellement ferments et aux vins nouveaux encore en fermentation.
Les paramtres de validation ne concernent que les vins.

2. Principe
La mthode se dcompose en deux tapes distinctes. La premire est une
tape de purification et de concentration de lOTA prsente dans le vin ou le
mot par fixation sur colonne dimmunoaffinit puis lution. La seconde est
une tape de quantification pratique sur lluat par HPLC avec dtection
fluorimtrique.
3. Ractifs
3.13 Solution mre d'OTA
Lutilisation dOTA sous forme solide est dconseille; utiliser de
prfrence une solution standard dOTA (point 3.14)
3.14 Solution standard d'OTA
Utilisation de solution du commerce dont la concentration (env 50 g/ml)
est raccorde et fait lobjet dun certificat danalyse mentionnant valeur de
rfrence et incertitude sur la concentration
En principe ces solutions ne sont pas certifies en volumtrie, et doivent tre
prleves avec du matriel de pipetage raccord, pour constituer des
solutions mres allant de 0.25 1 mg/L dans lthanol pur ou dans la phase
mobile de la mthode HPLC (3.2.3).
OIV-MA-AS315-10 : R2011

10

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

Cette solution est stable -18C pour au moins 4 ans.]

4. Appareillage
4.13 RECOMMANDATIONS POUR LEVALUATION DE LA
PERFORMANCE DES COLONNES DIMMUNOAFFINITE (optionnel)
Ltape de concentration sur colonne dimmunoaffinit constitue une source
dincertitude importante dans la mthode danalyse. Lexprience a montr
que les diffrentes colonnes proposes sur le march pouvaient avoir des
taux de rcupration variant de 70 100 %.
Il est donc conseill de vrifier la performance dun lot de colonne
avant son utilisation. Cette dmarche est conseille en cas de
changement de fournisseurs ou de rfrences de colonnes.
4.13.1 Caractrisation du lot de colonnes (mesure du taux de rcupration) :
Slectionner environ 10 colonnes reprsentatives des types de colonnes
utilises en routine dans le laboratoire, issues de diffrents numros de lots.
Prparer un mme nombre de vins, reprsentant des matrices diffrentes, et
dont la concentration en OTA est nulle, en effectuant des ajouts doss xi
variables entre 0.5 et 2 gkg -1. Analyser rapidement aprs ajouts doss ces
n chantillons avec le lot de colonnes slectionnes, soit yi les valeurs
trouves.
On calcule les donnes concernant le taux de recouvrement qui est la
quantit mesure par rapport la quantit apporte.

Lcart type du taux de recouvrement ainsi calcul ne reprsente pas


seulement la variabilit des taux de rcupration des colonnes, mais inclut
galement lincertitude type du systme de mesure utilis en aval des
OIV-MA-AS315-10 : R2011

11

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

colonnes (HPLC). Il est cependant possible de raliser une estimation


raisonnable de lcart type du taux de rcupration des colonnes seul, en
retranchant lincertitude type du systme HPLC lerreur de recouvrement
calcule:
- Estimer lincertitude-type Sv (exprime sous la forme dun cart type) du
systme de mesure stricto sensu (sans prendre en compte ltape du passage
sur colonne dimmunoaffinit).
Pour cela il est possible dutiliser une tude de fidlit sur des solutions
dOTA.
Lcart type du taux de rcupration Sp est estim de la faon suivante :

Pour un domaine de concentration assez large, il est prfrable dexprimer


cette grandeur en coefficient de variation de lcart type (RSDR).
CV% = Sp100/ concentration de lajout
5. Mode opratoire
Le mode opratoire donn dans le point 5 est indicatif. La composition des
solutions de dilution et de lavage peut tre diffrente en fonction des
donnes du fabricant des colonnes. De mme, la concentration de
lchantillon de vin dilu peut tre ajuste selon les besoins.

6. Quantification de l'ochratoxine a (ota)


6.1 Courbe de calibration
Prparer, partir de solutions issues de la dilution de la solution mre avec
la phase mobile (3.2.3), une courbe de calibration chaque jour d'analyse ou
chaque fois que les conditions chromatographiques changent. Les valeurs

OIV-MA-AS315-10 : R2011

12

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


OCHRATOXINE

choisies doivent encadrer la gamme de travail en prenant en compte le


facteur de concentration du vin.

OIV-MA-AS315-10 : R2011

13

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Mthode OIV-MA-AS315-11

Mthode Type II

Dtermination par CLHP de neuf anthocyanes principales


dans le vin rouge et ros
(Rsolution Oeno 22/2003 modifie par Oeno 12/2007)
1. CHAMPS DAPPLICATION
La mthode analytique concerne la dtermination de la composition relative des
anthocyanes des vins rouges et ross. La sparation est ralise par CLHP laide
dune colonne en phase inverse et une dtection UV-VIS.
De nombreux auteurs (3, 6-17) ont publi des donnes concernant la composition
en anthocyanes des vins rouges utilisant des mthodes analytiques voisines. Par
exemple, Wulf et al. [18] ont dtect et identifi 21 anthocyanes et Heier et al [13]
prs de 40 par chromatographie en phase liquide couple la spectromtrie de
masse. La composition en anthocyanes peut tre trs complexe or il est ncessaire
de disposer dune procdure simple, en consquence, cette mthode se limite
dterminer les composs principaux de la fraction totale des anthocyanes.
Les Etats-membres sont encourags poursuivre les recherches dans ce domaine
afin dviter toute valuation non scientifique des rsultats.
2. PRINCIPE
Sparation des cinq anthocyanes non acyles les plus importantes (voir Figure
1, pics 1-5) et des quatre anthocyanes acyles principales (voir Figure 1 pics 69).
Analyse du vin rouge et ros par sparation directe en CLHP en utilisant une
colonne de phase inverse et une lution avec un gradient eau/acide
formique/acetonitrile avec une dtection 518 nm [1.2]
3. REACTIFS ET MATERIEL
Acide formique (p.a. 98%) (CAS 64-18-6)
Eau, puret CLHP
Actonitrile, puret CLHP (CAS 75-08-8)
Solvants CLHP
Solvant A : Eau/acide formique/actonitrile 87:10:3 (v/v/v)
Solvant B : Eau/acide formique/acetonitrile 40:10:50 (v/v/v)
OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Filtre membrane pour dgazer les solvants CLHP et pour la prparation des
chantillons analyser
Produits de rfrence pour lidentification des pics.
Le dosage CLHP des anthocyanes du vin est difficilement ralisable en raison
de labsence de produits purs disponibles dans le commerce. De plus, les
anthocyanes sont extrmement instables en solution.
Les pigments anthocyaniques suivants sont disponibles la vente :
Cyanidol-3-glucoside (galement Couromanin chloride);
M=484,84 g/mol
Peonidol-3-glucoside ; M=498,84 g/mol
Malvidol-3-glucoside (galement Oeninchloride); M = 528,84 g/mol
Malvidol-3,5-diglucoside (galement malvinchloride);
M = 691,04 g/mol.
4. APPAREILS
Un systme de CLHP avec :
- une pompe binaire gradient, un systme dinjection pour des volumes
dchantillon de 10 200 l
- Un dtecteur barrettes de diodes ou un dtecteur UV avec une gamme
visible,
- Un intgrateur ou un ordinateur avec logiciel dacquisition de donnes
- Un four permettant le chauffage des colonnes 40 C
- Un systme de dgazage de solvant
- Une colonne analytique, par exemple :
LiChrospher 100 RP 18 (5 m) en LiChroCart 250-4
Une colonne de garde: par exemple RP18 (30-40 mm) en cartouche de 2 mm de
diamtre x 20 mm de long
5. PROCEDURE
5.1 Prparation des chantillons
Les vins limpides sont placs directement sans prparation dans les flacons du
passeur automatique dchantillons. Les chantillons troubles sont filtrs
laide dun filtre membrane de 0,45 m pour la prparation dchantillon
CLHP. La premire partie du filtrat doit tre rejete.
La gamme de linarit de labsorption en fonction de la concentration des
anthocyanes tant tendue, il est possible de moduler les volumes dinjection
entre 10 et 200 l en fonction de lintensit de la couleur du vin.
OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Aucune diffrence significative entre les rsultats obtenus pour des volumes
dinjection diffrents na t observe.
5.2 Analyse
Conditions CLHP
Lanalyse CLHP se droule dans les conditions suivantes:
50 l (vin rouge)
jusqu 200 l (vin ros)
0,8 ml/minute
40C
45 minutes

Volume dinjection :
Dbit:
Temprature :
Temps de passage :
Temps de retour aux
conditions initiales :
Dtection :

5 minutes
518 nm

Gradient dlution:
Temps
(min)
0
15
30
35
41

Solvant A
% (v/v)
94
70
50
40
94

Solvant B
% (v/v)
6
30
50
60
6

Pour vrifier lefficacit de la colonne, le nombre de plateaux thoriques (N)


calcul par rapport la malvidol-3-glucoside ne devrait pas tre infrieur
20000, la rsolution (R) entre la peonidol-3-coumaryl glucoside et la malvidol3-coumaryl glucoside ne devrait pas tre infrieure 1,5. En-dessous de ces
valeurs, il est recommand dutiliser une nouvelle colonne.

La figure 1 montre un chromatogramme typique o les anthocyananes sont


spars :

Groupe 1:
OIV-MA-AS315-11 : R2007

Delphinidol-3-glucoside

Pic-N
1
3

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

anthocyanes-3-glucosides
non acyles:

Cyanidol-3-glucoside
Petunidol-3-glucoside
Peonidol-3-glucoside
Malvidol-3-glucoside

2
3
4
5

Groupe 2:
anthocyanes-3-glucosides
actyles:

Peonidol-3-acetylglucoside
malvidol-3-acetylglucoside

6
7

Groupe 3:
anthocyanes-3-glucosides
coumaryles:

Peonidol-3coumarylglucoside
malvidol-3coumarylglucoside

8
9

6. EXPRESSION DES RESULTATS


Noter que les valeurs sont exprimes en quantits relatives par rapport la
totalit des neuf anthocyanes dfinies dans cette mthode.
7. LIMITE DE DETECTION ET LIMITE DE QUANTIFICATION
La limite de dtection (LD) et la limite de quantification (LQ) sont fixes
conformment aux instructions de la rsolution de l'O.I.V. OENO 7-2000
(Estimation de la limite de dtection et de quantification dune mthode
danalyse). Conformment au schma dcisionnel (No 3) il conviendra
d'appliquer le procd graphique vis au numro 4.2.2.
Pour ce faire, un extrait du chromatogramme sera agrandi et analys sur un
domaine qui correspond 10 fois la largeur mi-hauteur (w) d'un pic
d'anthocyane dans le domaine dintrt. A cet effet, on trace 2 droites parallles
de manire englober les dviations maximales du bruit thermique. La distance
entre les deux droites quivaut hmax, exprime en mAU (milliunits
d'absorption).
La limite de dtection (LD) et la limite de quantification (LQ) dpendent des
conditions individuelles chaque appareil et doivent tre tablies par
l'utilisateur. Un exemple est mentionn en annexe, avec le rsultat suivant :
hmax = 0,208 [mAU];

LD = 3 x 0,208 [mAU] = 0,62 [mAU].


LQ = 10 x 0, 208 [mAu] = 2,08 [mAU].

OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Recommandation :
En ce qui concerne les valeurs calcules, somme des anthocyanes acyls et
rapport entre les anthocyanes actyls et coumaryls, il est recommand de ne
pas calculer ces grandeurs dans le cas o la valeur d'un anthocyane isol est
infrieure au seuil de dtermination.
Il est remarquer que les valeurs infrieures la limite de quantification (LQ)
ne sont pas dpourvues de contenu informatif [1].
Rfrence :
[1] Thompson, M.; Ellison, S.L.R. ; Wood, R., Harmonized Guidelines for
Single-Laboratory Validation of Methods of Analysis, Pure Appl. Chem. (2002)
74: 835- 855
8. PARAMETRES DE LA FIDELITE
Les valeurs de la rptabilit (r) et la reproductivit (R) pour les neuf
anthocyanes sont indiques dans le Tableau 2 et dpendent de la surface relative
du pic. La mesure de lincertitude dune surface dun pic spcifique est
dtermine par la valeur de r et R qui correspond la valeur la plus proche
indique dans le Tableau 2.
Les valeurs des donnes de validations peuvent tre calcules en suivant les
rgles statistiques appropries. Pour calculer lerreur totale (sr) dune somme,
par exemple des anthocyanes actyles, il faut totaliser les variances (Sr2) des
surfaces spcifiques de chaque pic correspondant aux anthocyanes actyles.
Lerreur totale des rapports, par exemple, le rapport des anthocyanes
actyles/coumaryles, est le rsultat de la somme des carrs des erreurs
relatives (sr/ai , ai = surface de pic). En utilisant ces rgles, toutes les valeurs de
fidlit peuvent tre calcules en utilisant les donnes prsentes dans le
Tableau 2.

OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

ANNEXE

OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Annexe A
Bibliographie
[1]

Marx, R., B. Holbach, H. Otteneder; Determination of nine


characteristic Anthocyanins in Wine by HPLC; OIV, F.V.N 1104
2713/100200

[2]

Holbach, B., R. Marx, M. Ackermann; Bestimmung der


Anthocyanzusammensetzung von Rotwein mittels
Hochdruckflssigkeitschromatographie (HPLC).
Lebensmittelchemie (1997) 51: 78 - 80

[3]

Eder, R., S. Wendelin, J. Barna; Auftrennung der monomeren


Rotweinanthocyane mittels Hochdruckflssigkeitschromatographie
(HPLC).Methodenvergleich und Vorstellung einer neuen Methode.
Mitt. Klosterneuburg (1990) 40: 68-75

[4]

ISO-5725-2: 1994 Accuracy (trueness and precision) of measurement


methods and results - Part 2: Basic method for the determination of
repeatability and reproducibility

[5]

Otteneder, H., Marx, R., Olschimke, D.; Method-performance study on


the determination of nine characteristic anthocyanins in wine by HPLC.
O.I.V. F.V.N 1130 (2001)

[6]

Mattivi F.; Scienza, A.; Failla, O.; Vika, P.; Anzani, R.; Redesco, G.;
Gianazza, E.; Righetti; P. Vitis vinifera - a chemotaxonomic approach:
Anthocyanins in the skin. Vitis (special issue) 1990, 119-133

[7]

Roggero, I.P.; Larice, I.L.; Rocheville-Divorne, C.; Archier, P.; Coen,


V. Composition Antocyanique des cepages. Revue Francaise
dOenologie 1998, 112, 41-48

[8]

Eder, R.; Wendelin, S; Barna, J. Classification of red wine cultivars by


means of anthocyanin analysis. Mitt. Klosterneuburg 1994, 44, 201-212

[9]

Arozarena, I.; Casp, A.; Marin, R.; Navarro, M. Differentiation of some


Spanish wines according to variety and region based on their anthocyanin
composition. Eur. Food Res. Technol. 2000, 212, 108-112

[10]

Garcia-Beneytez, E.; Revilla, E.; Cabello, F. Anthocyanin pattern of


several red grape cultivars and wines made from them. Eur. Food Res.

OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Technol. 2002, 215, 32-37


[11]

Arozarena, I.; Ayestarn, B.; Cantalejo, M.J.; Navarro, M.; Vera, M.;
Abril, K.; Casp, A. Eur. Food Res. Technol. 2002, 214, 313-309

[12]

Revilla, E.; Garcia-Beneytez, E.; Cabello, F.; Martin-Ortega, G.; Ryan,


J-M. Value of high-performance liquid chromatographic analysis of
anthocyanins in the differentiation of red grape cultivars and red wines
made from them. J. Chromatogr A 2001, 915, 53-60

[13]

Heier, A.; Blaas, W.; Dro, A.; Wittkowski, R.; Anthocyanin Analysis
by HPLC/ESI-MS, Am.J.Enol.Vitic, 2002, 53, 78-86

[14]

Arozarena, I.; Casp, A.; Marin, R.; Navarro, M. Multivariate


differentiation of Spanish red wines according to region and variety. J.
Sci. Food Agric, 2000, 80, 1909-1917

[15]

Anonymous. Bekanntmachung des Bundesinstituts fr gesundheitlichen


Verbraucherschutz und Veterinrmedizin. Bundesgesundheitsbl.
Gesundheitsforsch. Gesundheitsschutz, 2001, 44, 748

[16]

Burns, I.; Mullen, W.; Landrault, N.; Teissedre, P.-L.; Lean, M.E.I.;
Crozier, A. Variations in the Profile and Content of Anthocyanins in
Wines made from Cabernet Sauvignon and hybrid grapes. J. Agric.
Food Chem. 2002, 50, 4096-4102

[17]

Otteneder, H.; Holbach, B.; Marx, R.; Zimmer, M.


Rebsortenbestimmung in Rotwein mittels Anthocyanspektrum. Mitt.
Klosterneuburg, 2002, 52, 187-194

[18]

L.W. Wulf and C.W. Nagel; High-Pressure liquid chromatographic


separation of Anthocyanins of Vitis vinifera.
Am.J.Enol.Vitic 1978, 29, 42-49

OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Annexe B
Rsultats statistiques

ETUDE ET EVALUATION DE LA PERFORMANCE DE LA METHODE


17 laboratoires et 5 tats europens ont particip ltude de validation de la
mthode sous la coordination du laboratoire dtat officiel allemand pour la chimie
alimentaire de Trier. Les participants figurent dans le Tableau 3. Un exemple de
chromatogramme est prsent la figure 1 et les rsultats dtaills figurent dans le
Tableau 2.
Lvaluation statistique a t effectue selon la Rsolution Oeno 6/99, et la Norme
ISO 5725-1994 (4,5).
Les chromatogrammes renvoys avec les feuilles de rsultats ont satisfait toutes les
exigences par rapport la performance de la colonne analytique. Aucun laboratoire
na d tre compltement limin, par exemple, cause dune fausse identification
de pic.
Les valeurs aberrantes ont t recherches laide des tests de Dixon et de Grubbs
selon la procdure du Protocole harmonis IUPAC 1994 et de la Rsolution
OIV OENO 19/2002. Les valeurs des sr, sR, r et R ont t calcules pour 9
anthocyanes principales et 5 niveaux de teneurs. Pour les rsultats analytiques il
faut utiliser les valeurs des niveaux les plus proches.
Afin davoir une vision globale de la performance de la mthode, toutes les valeurs
RSDr- et RSDR- rassembles sont regroupes par gammes de surface dans le
tableau suivant :

OIV-MA-AS315-11 : R2007

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Tableau 1 : Rsum des rsultats des performances


de la mthode

GAMME DE LA SURFACE DU
PIC RELATIVE*
[%]

Gamme de RSDr

Gamme de RSDR

[%]

[%]

>0,4 1,0

6,8 - 22,4

20,6 - 50,9

>1,1 1,5

4,2 - 18,1

11,8 - 28,1

>1,5 3,5

2,1 - 7,7

10,6 - 15,6

>3,5 5,5

2,7 - 5,7

18,7 7,5

>5,5 7,5

2,4 - 3,9

6,5 - 10,0

>10 14

1,1 - 2,9

3,7 - 9,2

>14 17

1,0 - 3,9

3,2 - 5,4

>50 76

0,3 - 1,0

2,1 - 3,1

* indpendant de lanthocyane

Cela conduit conclure que les rptabilits et les reproductibilits dpendent des
sommes des surfaces relatives des pics. Plus ces sommes sont leves, meilleurs
sont les RSDr et RSDR. Pour les teneurs en anthocyanes proches de la limite de
dtection (ex. Cyanidine-3-glucoside) avec des surfaces relatives petites (infrieure
1%) les valeurs des RSDr et RSDR peuvent augmenter dune faon assez
significative. Pour les anthocyanes dont les surfaces relatives dpassent 1 %, les
valeurs RSDr et RSDR sont raisonnables.

OIV-MA-AS315-11 : R2007

10

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Figure 1
Sparation de 9 anthocyanes dans un vin rouge

ANTHO13 #25 [modified by gyn]

4-98 4039

UV_VIS_1

WVL:518 nm

550
Mv-3-gl

mAU
500
450
400
350
300

Cy-3-gl

100

Po-3-acgl
Mv-3-acgl

Po-3-gl

150

50

Po-3-cugl
Mv-3-cugl

200

Pt-3-gl

De-3-gl

250

0
min
-50
0,0

2,5

5,0

7,5

10,0

12,5

15,0

17,5

OIV-MA-AS315-11 : R2007

20,0

22,5

25,0

27,5

30,0

32,5

35,0

37,5

40,0

42,5

45,0

11

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Tableau 2 : Rsultats de ltude de la performance de la mthode


Anthocyanes
Delphinidol-3-glucoside
N
moyenne
sr
RSDr(%)
r
sR
RSDR(%)
R
Cyanidol-3-glucoside
n
moyenne
sr
RSDr(%)
r
sR
RSDR(%)
R
Petunidol-3-glucoside
n
moyenne
sr
RSDr(%)
r
sR
RSDR(%)
R
Peonidol-3-glucoside
n
moyenne
sr
RSDr(%)
r
sR
RSDR(%)
R
Malvidol-3-glucoside
n
moyenne
sr
RSDr(%)
r
sR
RSDR(%)
R
n
sr
RSDr(%)
r
sR
RSDR(%)
R

chantillon 1 chantillon 2 chantillon 3 chantillon 4 chantillon 5


14
6,75
0,163
2,4
0,46
0,544
8,1
1,52

14
14,14
0,145
1,0
0,41
0,462
3,3
1,29

16
3,45
0,142
4,1
0,40
0,526
15,2
1,47

15
16,68
0,142
0,8
0,40
0,704
4,2
1,97

16
3,54
0,108
3,1
0,30
0,490
13,8
1,37

16
2,18
0,086
4,0
0,24
0,460
21,2
1,29

17
1,23
0,053
4,3
0,15
0,211
17,2
0,59

16
0,61
0,043
7,1
0,12
0,213
34,9
0,60

15
1,46
0,110
7,5
0,31
0,180
12,3
0,50

14
0,34
0,031
9,2
0,09
0,158
46,7
0,44

15
10,24
0,233
2,3
0,65
0,431
4,2
1,21

17
14,29
0,596
4,2
1,67
0,996
7,0
2,79

16
5,75
0,157
2,7
0,44
0,495
8,6
1,39

14
12,21
0,097
0,8
0,27
0,469
3,8
1,31

15
6,19
0,196
3,2
0,55
0,404
6,5
1,13

16
11,88
0,241
2,0
0,68
0,981
8,3
2,75

15
6,23
0,166
2,7
0,47
0,560
9,0
1,57

17
13,75
0,144
1,0
0,40
1,227
8,9
3,44

17
7,44
0,232
3,1
0,65
0,602
8,1
1,69

16
4,12
0,174
4,2
0,49
0,532
12,9
1,49

16
55,90
0,545
1,0
1,53
2,026
3,6
5,67

15
55,04
0,272
0,5
0,76
2,649
4,8
7,42

17
76,11
0,251
0,3
0,70
2,291
3,0
6,41

16
52,60
0,298
0,6
0,83
1,606
3,1
4,50

16
61,04
0,377
0,6
1,06
1,986
3,3
5,56

= Nombre de laboratoires retenu aprs llimination des valeurs aberrantes


= cart-type de rptabilit
= cart-type de rptabilit relatif
= rptabilit
= cart-type de reproductibilit
= cart-type de reproductibilit relatif
= reproductibilit

OIV-MA-AS315-11 : R2007

12

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Tableau 2 : Rsultats de ltude de la performance de la mthode


Anthocyannes

chantillon chantillon chantillon chantillon chantillon


1
2
3
4
5
Peonidol-3-acetylglucoside
n
14
16
14
16
Moyenne
1,16
1,44
0,59
3,74
sr
0,064
0,062
0,059
0,215
RSDr(%)
5,5
4,3
10,1
5,8
0,18
0,17
0,17
0,60
sR
0,511
0,392
0,272
0,374
RSDR(%)
43,9
27,2
46,4
10,0
R
1,43
1,10
0,76
1,05
Malvidol-3-acetylglucoside
n
16
17
17
16
Moyenne
5,51
4,84
3,11
15,07
sr
0,176
0,167
0,088
0,213
RSDr(%)
3,2
3,4
2,8
1,4
r
0,49
0,47
0,25
0,60
sR
0,395
0,366
0,496
0,617
RSDR(%)
7,2
7,6
16,0
4,1
R
1,11
1,02
1,39
1,73
Peonidol-3-coumarylglucoside
n
16
14
17
16
Moyenne
1,26
0,90
0,89
1,32
sr
0,130
0,046
0,060
0,058
RSDr(%)
10,3
5,1
6,8
4,4
r
0,36
0,13
0,17
0,16
sR
0,309
0,109
0,204
0,156
RSDR(%)
24,5
12,2
23,0
11,8
R
0,86
0,31
0,57
0,44
Malvidol-3-coumarylglucoside
n
17
17
17
16
moyenne
4,62
2,66
4,54
4,45
sr
0,159
0,055
0,124
0,048
RSDr(%)
3,4
2,1
2,7
1,1
r
0,45
0,15
0,35
0,13
sR
0,865
0,392
0,574
0,364
RSDR(%)
18,7
14,7
12,6
8,2
R
2,42
1,10
1,61
1,02
n
sr
RSDr(%)
r
sR
RSDR(%)
R

= Nombre de laboratoires retenus aprs llimination des valeurs aberrantes


= cart-type de rptabilit
= cart-type de rptabilit relatif
= rptabilit
= cart-type de reproductibilit
= cart-type de reproductibilit relatif
= reproductibilit

OIV-MA-AS315-11 : R2007

13

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Anthocyanes

Tableau 3:

Liste des participants

ABC Labor Dahmen, Mlheim/Mosel

Chemisches Landes- und Staatliches Veterinruntersuchungsamt


Mnster

Institut fr Lebensmittelchemie Koblenz

Institut fr Lebensmittelchemie Speyer

Institut fr Lebensmittelchemie Trier

Institut fr Lebensmittelchemie und Arzneimittelprfung Mainz

Labor Dr. Haase-Aschoff, Bad Kreuznach

Labor Dr. Klaus Millies, Hofheim-Wildsachsen

Labor Heidger, Kesten

Landesveterinr- und Lebensmitteluntersuchungsamt Halle

Staatliche Lehr- und Forschungsanstalt fr


Weinbau und Gartenbau, Neustadt/Weinstrae

Landwirtschaft,

Staatliches Institut fr Gesundheit und Umwelt, Saarbrcken


Staatliches
Medizinal-,
LebensmittelVeterinruntersuchungsamt Wiesbaden

D
und

Laboratoire Interrgional de la D.G.C.C.R.F de Bordeaux,


Talence/France

Unidad de Nutricion y Bromotologia, Facultad de Farmacia,


Universidad de Salamanca, Salamanca/Espana

University of Glasgow, Div. of Biochem. and Molek. Biology

UK

Hhere Bundeslehranstalt und Bundesamt fr Wein- und Obstbau


Klosterneuburg

17 Laboratoires D (13); A (1); F (1); E (1); UK (1)

OIV-MA-AS315-11 : R2007

14

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

Mthode OIV-MA-AS315-12

Mthode Type IV

Recherche des matires protiques d'origine vgtale


dans les vins et les mots
(Rsolution Oeno 24/2004)
La technique dveloppe ci-aprs permet de dterminer la quantit de
protines dorigine vgtale ventuellement restantes dans les mots et les vins
traits, aprs soutirage.
1 PRINCIPE
Les protines du mot ou du vin sont prcipites par lacide
trichloroactique, puis elles sont spares par lectrophorse en gel de
polyacrylamide en prsence de dodcylsulfate de sodium (SDS). Lajout de bleu de
Coomassie colore les protines. Lintensit de la coloration permet de dterminer la
teneur en protine laide dune courbe talon ralise au pralable avec des
solutions de protine de concentration connue. Le pouvoir antignique des mots et
des vins traits est recherch par un test d'immunoblotting.
2 PROTOCOLE
2.1 Concentration des protines par prcipitation lacide trichloroactique
(TCA)
2.1.1 Ractifs
2.1.1.1 Acide trichloroactique pur
2.1.1.2 TCA 0,1 %: prpar partir de 2.1.1.1 : 0,1 g dans 100
ml deau
2.1.1.3 TCA 100 % prpar partir de 2.1.1.1 : 100 g dans 100
ml deau
2.1.1.4 Hydroxyde de sodium 0,5 M
2.1.1.5 Tampon Tris/HCl 0,25 M pH=6,8
30,27 g de Tris-(hydroxymthyl)aminomthane sont dissous dans 300 ml
deau distille. Le pH est ajust 6,8 avec de lacide chlorhydrique concentr pour
analyses. Le volume est complt 1 l avec de leau distille. Le tampon est
conserv 4C.
2.1.1.6 Glycrol pur
2.1.1.7 Dodcylsulfate de sodium (SDS) pur
2.1.1.8 2-Mercaptothanol pur
2.1.1.9 Solution tampon pour les chantillons
OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

Elle est compose de tampon Tris/HCl 0,25 M, pH=6,8 (2.1.1.5); de 7,5 %


de glycrol pur (2.1.1.6); de 2 % de dodcylsulfate de sodium (SDS) (2.1.1.7) et
de 5 % de 2-mercaptothanol pur (2.1.1.8). Les pourcentage et molarit des
diffrents ractifs correspondent la concentration finale dans la solution tampon.
2.1.2 Mode opratoire
3 ml dacide trichloroactique 100 % (2.1.1.3) et 24 ml de vin ou de mot
(trait ou non trait) sont successivement mis dans des tubes centrifuger de 50 ml.
La concentration finale en TCA ainsi obtenue est de 11 %.
Aprs 30 minutes 4C, les chantillons sont centrifugs 10 000 rpm
pendant 30 minutes 4C. Les culots sont lavs avec une solution aqueuse de TCA
0,1 % (2.1.1.2), recentrifugs et remis en suspension dans 0,24 ml dun mlange
(1:1, v/v) dhydroxyde de sodium 0,5 M (2.1.1.4) et de solution tampon pour les
chantillons (2.1.1.9). Les chantillons sont chauffs 100C au bain deau
pendant 10 minutes.
2.2 Electrophorse en Gel de Polyacrylamide en prsence de SDS
2.2.1 Ractifs
2.2.1.1 Tampon Tris/HCl 1,5 M pH=8,8
181,6 g de Tris-(hydroxymthyl)aminomthane sont dissous dans 300 ml
deau distille. Le pH est ajust 8,8 avec de lacide chlorhydrique concentr pour
analyses. Le volume est complt 1 l avec de leau distille. Le tampon est
conserv 4C.
2.2.1.2 Mlange acrylamide (30 %)bis-acrylamide (0,8 %)
glycrol (75 %)
Ajouter doucement 300 g dacrylamide et 8 g de bis-acrylamide 600 ml
dune solution de glycrol 75 %. Aprs dissolution, ajuster le volume 1 l avec
du glycrol 75 %. Le mlange est conserv lobscurit et temprature
ambiante.
2.2.1.3 SDS 10 %
10 g de SDS sont dissous dans 100 ml deau distille. Conserver la
temprature ambiante.
2.2.1.4 N,N,N,N ttramthylnediamine (TEMED) pour
lectrophorse
2.2.1.5 Persulfate dammonium 10 %
1 g de persulfate dammonium sont dissous dans 10 ml deau distille.
Conserver 4C.

OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

2.2.1.6 Solution de bleu de bromophnol


10 mg de bleu de bromophnol pour lectrophorse sont dissous dans 10
ml deau distille.
2.2.1.7 Solution pour le gel de sparation (15 % dacrylamide)
Elle est prpare juste avant utilisation :
- 1,5 ml de Tris/HCl 1,5 M, pH=8,8 (2.2.1.1),
- 1,5 ml deau distille,
- 3 ml du mlange acrylamide glycrol (2.2.1.2),
- 50 l de SDS 10 % (2.2.1.3),
- 10 l de N,N,N,N-ttramthylnediamine (TEMED) pour lectrophorse
(2.1.1.4),
- 20 l de persulfate dammonium (2.2.1.5),
- 1 goutte de bleu de bromophnol (2.2.1.6).
2.2.1.8 Tampon Tris/HCl 0,5 M pH=6,8
60,4 g de Tris-(hydroxymthyl)aminomthane sont dissous dans 400 ml
deau distille. Le pH est ajust 6,8 avec de lacide chlorhydrique concentr pour
analyses. Le volume est complt 1 l avec de leau distille. Le tampon est
conserv 4C.
2.2.1.9 Mlange acrylamide (30 %)bis-acrylamide (0,8 %)
eau
Ajouter doucement 300 g dacrylamide et 8 g de bis-acrylamide 300 ml
deau. Aprs dissolution, ajuster le volume 1 l avec de leau distille. Le mlange
est conserv lobscurit et temprature ambiante.
2.2.1.10 Gel de concentration 3,5% dacrylamide
Il est prpar juste avant utilisation :
- 0,5 ml de Tris/HCl 0,5 M pH=6,8 (2.2.1.8),
-1,27 ml deau distille,
- 0,23 ml du mlange acrylamide-eau (2.2.1.9),
- 20 l de SDS 10 % (2.2.1.3),
- 5 l de N,N,N,N-ttramthylnediamine (TEMED) pour lectrophorse
(2.2.1.4),
- 25 l de persulfate dammonium (2.2.1.5),
- 1 goutte de bleu de bromophnol (2.2.1.6).
2.2.1.11 Tampon de migration
30,27 g de Tris-(hydroxymthyl)aminomthane, 144 g de glycine et 10 g
de SDS sont dissous dans 600 ml deau distille. Le pH doit tre de 8,8. Si
ncessaire, il est ajust avec de lacide chlorhydrique concentr pour analyses. Le
volume est complt 1 l avec de leau distille. Le tampon est conserv 4C. Au
moment de lutilisation, la solution est dilue au 1/10 dans de leau distille.
2.2.1.12 Solution de coloration
OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

Sont successivement mlangs :


- 16 ml de bleu de Coomassie Brillant G-250 ultrapur 5 % (5 g dans 100 ml deau
distille),
- 784 ml provenant de 1 l dune solution dans laquelle ont t dissous 100 g de
sulfate dammonium et 13,8 ml dacide orthophosphorique 85 % pour analyses,
- 200 ml dthanol absolu pour analyses.
2.2.1.13 Solution de dcoloration
Sont successivement mlangs :
- 100 ml dacide actique glacial 100 % pour analyses,
- 200 ml dthanol absolu pour analyses,
- 700 ml deau distille.
2.2.2 Mode opratoire
La solution pour le gel de sparation (2.2.1.7) est coule entre deux
plaques de verre dune taille de 7 x 10 cm. La surface suprieure du gel est nivele
par lajout de 2 gouttes deau distille.
Aprs polymrisation du gel de sparation et limination de leau, 1 ml de
gel de concentration (2.2.1.10) est dpos sur le gel de sparation laide dune
pipette de 1 ml. Puis on met en place le peigne dont les empreintes creront les
puits de dpts.
Les chantillons ncessaires la gamme talon sont prpars dans un
mlange (1:1, v/v), dhydroxyde de sodium 0,5 M (2.1.1.4) et de solution tampon
(2.1.1.9) de faon ce que la gamme soit comprise entre 5 g/ml et 50 g/ml.
20 30 l dchantillons de vins et dtalons sont dposs dans les puits
Aprs la migration (sous une tension constante de 90 V) la temprature
ambiante pendant 3-4 heures environ, les gels sont dmouls. Ils sont aussitt
plongs dans 50 ml dune solution aqueuse de TCA 20 % pendant 30 minutes puis
dans 50 ml de solution de coloration (2.2.1.12).
Les protines apparaissent sous forme de bandes colores en bleu. Le gel
est ensuite dcolor avec 50 ml de solution de dcoloration (2.2.1.13). Quand le
fond du gel est transparent, il est plac dans de leau distille pour conservation.
3 ANALYSE QUANTITATIVE
Lintensit de chaque tache est value laide dun scanner pour gel
quip dun logiciel danalyseur dimage. La quantit de protine prsente sur le
gel est dtermine par le calcul de la densit moyenne des pixels de la bande et par
intgration de la largeur de la bande. La teneur en protine de chaque chantillon
est obtenue laide dune courbe talon. Les points de cette courbe sont obtenus en
traant les valeurs de concentrations connues de protine vgtale dpose sur le
gel en fonction de la surface dintgration correspondante.

OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

La limite de quantification se situe 0,030 ppm pour le pois et 0,36 ppm


pour le gluten, dans un milieu concentr 100 fois. Le coefficient de variation est
toujours infrieur 5%.
4
RECHERCHE
PAR
IMMUNOBLOTTING
ANTIGENIQUE DES VINS ET DES MOUTS TRAITES

DU

POUVOIR

La capacit antignique des protines dorigine vgtale ventuellement


restantes dans les mots et les vins traits, aprs soutirage, est ensuite value.
4.1 PRINCIPE
Aprs llectrophorse, les gels sont soumis la technique
dimmunoblotting. Les protines sont transfres sur une membrane o elles seront
adsorbes. Un complexe antigneanticorps est form par lajout danticorps antiprotine vgtale (par exemple des anticorps antigliadines si la protine
vgtale est du gluten). Le systme est rvl par lajout danticorps dirigs contre
les anticorps anti-protine vgtale coupls la phosphatase. En prsence du
substrat chromogne de lenzyme, une coloration dont lintensit sera
proportionnelle la quantit dimmunocomplexes va se dvelopper. Cette
immunoractivit sera quantifie laide dune courbe talon ralise avec des
solutions de protine vgtale de concentration connue.
4.2 PROTOCOLE
4.2.1 : Ractifs
4.2.1.1 Tampon de transfert
3,03 g de Tris, 14,4 g de glycine (R) et 200 ml de mthanol (R) sont
mlangs et complts 1 l avec de leau distille.
4.2.1.2 Glatine 1 %
8,77 g de chlorure de sodium (R), 18,6 g dacide
thylnediaminettraactique (EDTA) pour analyses, 6,06 g de Tris et 0,5 ml de
Triton X sont dissous dans 800 ml deau distille. Le pH est ajust 7,5 avec de
lacide chlorhydrique concentr pour analyses. 10 g de glatine sont ajouts et le
volume est complt 1 l.
4.2.1.3 Glatine 0,25 %
8,77 g de chlorure de sodium (R), 18,6 g dacide
thylnediaminettraactique (EDTA) pour analyses, 6,06 g de Tris et 0,5 ml de
Triton X sont dissous dans 800 ml deau distille. Le pH est ajust 7,5 avec de
lacide chlorhydrique concentr pour analyses. 2,5 g de glatine sont ajouts et le
volume est complt 1 l.
OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

4.2.1.4 Solution danticorps polyclonaux (du commerce ou


dcrits en annexe)
10 l danticorps polyclonaux anti-protine vgtale q.s.p. 10 ml avec la
glatine 0,25 % (4.2.1.3).
4.2.1.5 Tampon TBS
29,22 g de chlorure de sodium pour analyse et 2,42 g de Tris sont dissous
dans 1 l deau distille.
4.2.1.6 Tampon phosphatase alcaline
5,84 g de chlorure de sodium (R), 1,02 g de chlorure de magnsium (R) et
12,11 g de Tris sont dissous dans 800 ml deau distille. Le pH est ajust 9,5 avec
de lacide chlorhydrique concentr et le volume est complt 1 l.
4.2.1.7 Rvlateur
15 g de phosphate de bromochloroindol phosphate (BICP), 30 g de bleu de
nitrottrazolium (NBT) sont dissous dans 100 ml de tampon phosphatase alcaline
(4.2.1.6).
4.2.2 Mode opratoire
Aprs llectrophorse, les protines sont transfres du gel vers une
membrane de difluorure de polyvinylidne par lution lectrophortique: 16 heures
4C sous 30 V dans le tampon de transfert (4.2.1.1). Les membranes sont satures
avec de la glatine 1 % (4.2.1.2) et laves 3 fois avec la glatine 0,25 % (4.2.1.3).
La glatine se fixe sur les sites libres et empche ladsorption non spcifique des
ractifs immunologiques. La membrane est ensuite plonge dans 10 ml de la
solution danticorps polyclonaux anti-protine vgtale (4.2.1.4). Dans le cas du
gluten, les anticorps anti-gliadines proviennent du commerce. Les autres types
d'anticorps sont prpars selon la mthode figurant en annexe. Le complexe
antigne-IgG est dtect par lajout de 10 l danticorps anti-IgG de lapin marqus
la phosphatase alcaline. Les membranes sont laves deux fois avec la glatine
0,25 % (4.2.1.3) et une fois avec le tampon TBS (4.2.1.5). Aprs incubation dans le
rvlateur (4.2.1.7), un prcipit de couleur violet fonc se forme lendroit o
lenzyme sest fix.
4.3 ANALYSE QUANTITATIVE
Pour calculer la quantit dimmunoractivit rsiduelle dun vin
commercialis, une courbe talon est trace : concentrations connues de protine
vgtale dpose sur le gel (et transfre sur membrane) en fonction des surfaces
obtenues par intgration de lintensit des spots correspondant la formation des
immun-complexes. Lanalyse se fait avec le mme quipement que celui utilis
pour analyser les gels dlectrophorse.

OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Matires protiques dorigine vgtale

ANNEXE

Production des anticorps polyclonaux anti-pois


Les anticorps polyclonaux anti-pois ncessaires la dtermination de la
capacit antignique des protines de pois dans les vins et les mots traits se
prparent chez lanimal.
1 Principe
Les srums contenant les anticorps polyclonaux sont obtenus chez le lapin
New Zealand aprs injection intradermique de lantigne.
2 Protocole
2.1 Ractifs
2.1.1 Tampon phosphate PBS pH=7.4 : 8 g de NaCl, 200 mg de KCl,
1,73 de Na2HPO4 H2O et 200 mg de KH2PO4 sont dissous dans 300 ml deau
distille. Le pH est ajust 7,4 avec de la soude 1 M. Le volume est complt 1 l
avec de leau distille.
2.1.2 Antignes :
10 mg de protine de pois sont dissous dans 5 ml de tampon
phosphate PBS (2.1.1). La solution est ensuite filtre strilement
sur 0,2 m et conserve 20C jusquau jour de limmunisation.
2.2 Mode opratoire
1 ml de solution 2.1.2 est mlang 1 ml dadjuvant complet de Freund.
1 ml de ce mlange est inject en intradermique chez un lapin New Zealand dun
poids de 3 kg environ. Cette injection est rpte au 15me, 30me et 45me jour.
60 jours aprs la premire injection, 100 l de sang sont prlevs au niveau
de la veine auriculaire et sont tests pour leur capacit ragir avec les antignes.
Cette valuation est ralise par immunoblotting comme dcrit dans le chapitre 4.2
de la mthode danalyse partir dun gel sur lequel la protine de pois a migr.
Aprs vrification de la formation dun complexe antigne-anticorps, 15 ml
de sang sont prlevs au niveau de la veine auriculaire. Le sang est plac 37C
pendant 30 minutes. Le srum contenant les anticorps polyclonaux anti-pois est
prlev aprs centrifugation du sang 3000 rpm pendant 5 minutes.

OIV-MA-AS315-12 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophnols et polychloroanisoles

Mthode OIV-MA-AS315-13

Mthode Type IV

Recherche et dosage des polychlorophenols et des


polychloroanisoles dans les vins, les bouchons, les bois et les
bentonites utilises comme pieges d'atmosphre
(Rsolution Oeno 8/2006)

SUPPRIME
(Remplace par mthode OIV-MA-AS315-17)

OIV-MA-AS315-13 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Lysozyme

Mthode OIV-MA-AS315-14

Mthode Type IV

Dosage du lysozyme dans le vin par HPLC


(Rsolution Oeno 8/2007)
1. Introduction
Il est prfrable dutiliser pour le lysozyme une mthode analytique non base
sur lactivit enzymatique.

2. Champ dapplication
Cette mthode permet la quantification du lysozyme (mg de protine/L)
prsent dans les vins blancs et rouges indpendamment de lactivit
enzymatique (qui pourrait tre compromise par une dnaturation partielle ou
par des phnomnes de complexation et de coprcipitations) de la matrice.

3. Dfinition
La chromatographie liquide haute performance (CLHP) offre une approche
analytique base sur linteraction de type strique, polaire ou dadsorption
entre la phase stationnaire et lanalyte et, par consquent, non lie lactivit
enzymatique relle de la protine.

4. Principe
Lanalyse seffectue par chromatographie liquide haute performance (CLHP)
en associant un dtecteur spectrophotomtrique et un dtecteur
spectrofluorimtrique. Le contenu inconnu de lchantillon de vin est calcul
en fonction de la surface du pic chromatographique en utilisant la
mthodologie de l'talonnage externe.
5. Ractifs
5.1. Solvants et solutions
Actonitrile (CH3CN) pour analyse CLHP
Acide trifluoroactique (TFA) pur
Eau dsionise pour analyse CLHP
Solution standard : acide tartrique 1g/L, Alcool thylique 10% v/v ajust
pH 3,2 avec du tartrate de potassium neutre

OIV-MA-AS315-14 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Lysozyme

5.2.

luants
A : CH3CN 1%, TFA 0,2 %, H2O= 98,8%
B : CH3CN 70%, TFA 0,2 %, H2O= 29,8%
5.3.
Solutions de rfrence
De 1 250 mg/L de lysozyme standard dissous dans la solution modle par
agitation continue durant un minimum de 12 heures.

6. Matriel
6.1.
Appareil HPLC avec systme de pompage prvu pour effectuer un
gradient d'lution
6.2.
Logement pour colonne thermostate (four)
6.3.
Dtecteur
spectrophotomtrique
associ

un
dtecteur
spectrofluorimtrique
6.4.
Boucle d'injection , 20 L
6.5.
Colonne polymre phase inverse avec des groupes fonctionnels
phnyl (diamtre des pores = 1 000 , limite dexclusion = 1 000 000
Da),
Tosoh
Bioscience
TSK-gel
Phnyl
5PW
RP
7,5 cm x 4,6 mm ID, titre dexemple
6.6.
Prcolonne dans le mme matriau que la colonne, Tosoh Bioscience
TSK-gel Phnyl 5PW RP Guardgel 1,5 cm x 3,2mm ID, titre
dexemple

7. Prparation de lchantillon
Les chantillons de vin sont acidifis avec du HCl (10 M) dilu au 1/10me et
filtrs avec un filtre en polyamide dont les pores ont un diamtre de 0,22 m,
5 minutes aprs lajout. Lanalyse chromatographique est effectue
immdiatement aprs la filtration.

8. Conditions opratoires
8.1.
Dbit dluant : 1mL/min
8.2.
Temprature de la colonne : 30C
8.3.
Dtection spectrophotomtrique : 280 nm
8.4.
Dtection spectrofluorimtrique : ex = 276 nm ; em = 345 nm ;
Gain = 10

OIV-MA-AS315-14 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Lysozyme

8.5.

Programme du gradient dlution

Temps
(min)
0

Sol A%

Sol B%

100

100

10

65

35

15

65

35

27

40.5

59.5

29

100

34

100

36

100

40

100

gradient
isocratique
linaire
isocratique
linaire
linaire
isocratique
linaire
isocratique

8.6.

Temps de rtention moyen du lysozyme : 25,50 minutes

9. Calcul
Les solutions de rfrence contenant les concentrations suivantes de lysozyme
sont analyses en triple : 1 ; 5 ; 10 ; 50 ; 100 ; 200 ; 250 mg/L. Sur chaque
chromatogramme, les aires du pic correspondant au lysozyme sont reportes
sur un diagramme en fonction de leurs concentrations respectives afin
dobtenir les droites de rgression linaire exprimes par la formule Y= ax+b.
Le coefficient de dtermination r2 devra tre > 0,999.

OIV-MA-AS315-14 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Lysozyme

10. Caractristiques de la mthode


Dans lobjectif dvaluer laptitude de la mthode pour lobjectif formul, une
tude de validation a t ralise en tenant compte de la linarit, des limites de
dtection et de quantification, et de la prcision de la mthode. Ce dernier
paramtre a t dtermin en dfinissant le niveau de prcision et dexactitude
de la mthode.
Plage
de
linarit
(mg/L)

UV
FLD

5-250
1-250

LD
(mg/L)

LQ
(mg/L)

Rptabilit (n=5) RSD% Reproductibilit


(n=5) RSD%
Std1
V.R.2
V.B.3
Std1

0,9993

1,86

6,20

4,67

5,54

0,62

1,93

0,9990

0,18

0,59

2,61

2,37

0,68

2,30

Pente
de la
droite

Coefficient de
dtermination
(r2)

3 786
52 03
7

Tableau 1 : Donnes relatives aux caractristiques de la mthode :


standard ; 2 vin rouge ; 3 vin blanc

solution

10.1.

Linarit de la mthode
Sur la base des rsultats obtenus grce lanalyse de rgression linaire,
la mthode sest rvle linaire pour les plages indiques dans le tableau
1.

10.2.

Limite de dtection et de quantification


La limite de dtection (LD) et la limite de quantification (LQ) ont t
calcules comme le signal quivalant respectivement 3 fois et 10 fois le
bruit de fond chromatographique en conditions de travail sur matrice
relle (tableau 1).

10.3.

Prcision de la mthode
Les paramtres pris en considration sont la rptabilit et la
reproductibilit. Le tableau 1 indique les valeurs de ces paramtres
(exprimes comme % dcart standard de mesures rptes avec
diffrentes concentrations) releves sur la solution standard, sur vin
blanc et sur vin rouge.

10.4.

Exactitude de la mthode
Le pourcentage de rcupration a t calcul sur les solutions standard
contenant 5 et 50 mg/L de lysozyme, additionnes dune quantit donne
de lysozyme, comme indiqu dans le tableau suivant.

OIV-MA-AS315-14 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Lysozyme

[C] initial
nominal
(mg/L)

Ajout
(mg/L)

[C]
thorique
(mg/L)

[C]
trouve
(mg/L)

cart
standard

Rcupration
%

UV 280
nm

50

13,1

63,1

62,3

3,86

99

FD

50

13,1

63,1

64,5

5,36

102

UV 280
nm

14,4

19,4

17,9

1,49

92,1

FD

14,4

19,4

19,0

1,61

97,7

Fig.1 Chromatogramme de vin rouge contenant du Lysozyme pur (une solution standard
contenant 1 000 mg/L de Lysozyme a t ajout au vin pour obtenir une concentration
finale de 125 mg/L de Lysozyme). A: dtecteur UV 280 nm; B: dtecteur UV 225 nm;
C: dtecteur FLD ( ex 276 nm; em 345 nm).

11. Bibliographie
Claudio Riponi; Nadia Natali; Fabio Chinnici. Quantitation of hens egg white
lysozyme in wines by an improved HPLC-FLD analytical method. Am. J. Enol.
Vit., in press.
OIV-MA-AS315-14 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

Mthode OIV-MA-AS315-15

Mthode Type II

Dtermination du 3-methoxypropane-1,2-diol et des


diglycrols cycliques (drivs de glycrol technique) dans le vin
par CG-SM description de la mthode
et de ltude collaborative
(Rsolution Oeno 11/2007)
1. Introduction
Cest une mthode valide lchelon international pour la dtermination du 3mthoxypropane-1,2-diol (3-MPD) et des diglycrols cycliques (DC) ces deux
produits tant reconnus comme des impurets du glycrol technique dans
diffrents types de vin. Il est avr que le glycrol produit par la transestrification
de triglycrides vgtaux et animaux avec du mthanol contient une quantit
importantee de 3-MPD. La synthse de glycrol partir de produits ptrochimiques
gnre des impurets de DC. Lune des mthodes publies [1, 2, 3i] a t adopte,
modifie et teste dans le cadre dune tude collaborative. Cette mthode
optimise a fait lobjet dune tude collaborative [2] dont la conception et
lvaluation sont inspires de la Rsolution 8/2000 O.I.V. Protocole de
validation de mthodes analytiques .
2. Champ dapplication
La mthode dcrite convient la dtermination de 3-MPD et de 6 diglycrols
cycliques (cis-, trans-2,6-bis(hydroxymthyl)-1,4-dioxane ; cis-, trans-2,5bis(hydroxymthyl)-1,4-dioxane ; cis-, trans-2-hydroxymthyl-6-hydroxy-1,4dioxpane) dans des vins blancs, rouges, doux et secs. Ltude dcrite couvre des
plages de concentration respectives de 0,1 0,8 mg/L pour le 3-MPD et de 0,5
1,5 mg/L pour les DC.
3. Dfinitions
3-MPD
ANVA
C
DC
CG-SM
H2
EI

3-mthoxypropane-1,2-diol
Analyse de variance
Concentration
Diglycrols cycliques
Chromatographie en phase gazeuse Spectromtrie de
masse
Hydrogne
talon interne

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

m/z
NM
S0
S1
S2

Rapport masse/charge
Niveau de calibrage matriciel
Dilution standard 1 000 ng/L
Dilution standard 100 ng/L
Dilution standard 10 ng/L

4. Principe
Les analytes et ltalon interne sont relargus par ajout de K2CO3, puis extraits
laide dther dithylique. Les extraits sont analyss directement par CG-SM sur
une colonne polaire. La dtection est ensuite effectue en mode
fragmentomtrique.
5. Ractifs et appareillages
5.1 Produits chimiques
5.1.1 K2CO3 p.A.
5.1.2 ther dithylique Uvasol pour spectroscopie
5.1.3 Tamis molculaire (diam. : 2 mm, dim. pore : 0,5 nm)
5.1.4 Ethanol (absolu)
5.2 Produits
5.2.1 Mlange diglycrol cyclique (6 composants) - Solvay Alkali GmbH 1 ,
89,3 % cis-, trans-2,6-bis(hydroxymthyl) 1,4-dioxane ; cis-, trans-2,5bis(hydroxymthyl) 1,4-dioxane ; cis-, trans-2,-hydroxymthyl-6-hydroxy-1,4dioxpane
5.2.2 3-mthoxypropane-1,2-diol (3-MPD) 98 % (CAS 623-39-2)
5.2.3 butane-1,4-diol-1,1,2,2,3,3,4,4-(2H)8 98 % (CAS 74829-49-5)
5.3 Prparation des solutions standard
5.3.1 Solutions mres S0
Peser prcisment 10,0 mg 0,05 mg de chaque substance standard (11,2 mg pour
les DC, correspondant une puret de 89,3 %) et transvaser chaque volume dans
une fiole jauge de 10 mL (une pour chaque substance). Ajouter exactement 10 mL
dthanol et mlanger vigoureusement. La concentration de cette solution est de
1 000 ng/L.

1
Solvay Alkali GmbH ne commercialise plus de mlanges standard ; des solutions de ce
mlange peuvent tre obtenues auprs de BfR. Federal Institute for Risk Assessment,
Thielallee 88-92, D-14195 Berlin. www.bfr.bund.de. poststelle@bfr.bund.de

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

5.3.2 Solutions prpares S1


Transvaser volumtriquement 1 000 L de la solution mre S0 (5.3.1) dans une
fiole jauge de 10 mL, diluer avec de lthanol, boucher hermtiquement la fiole et
la renverser pour mlanger. La concentration de cette solution est de 100 ng/L.
5.3.3 Solutions prpares S2
Transvaser volumtriquement 100 L de la solution mre S0 (5.3.1) dans une fiole
jauge de 10 mL, diluer avec de lthanol, boucher hermtiquement la fiole et la
renverser pour mlanger. La concentration de cette solution est de 10 ng/L.
Prsentation des solutions standard requises :
Mlange CD (6 composants)
Solution
S0
S1

Concentration
1 000
100

ng/L
ng/L

3-mthoxypropane-1,2-diol (3-MPD)
Solution
S0
S1
S2

Concentration
1 000
100
10

ng/L
ng/L
ng/L

butane-1,4-diol-(2H)8 (talon interne EI)


Solution
S0
S1

Concentration
1 000
100

ng/L
ng/L

5.4 Prparation de la courbe de calibrage matriciel


Des solutions de calibrage sont prpares, par rapport la matrice, dans un vin non
contamin. Il faut dabord analyser ce vin afin de sassurer quil nest pas
contamin par du 3-MPD ou des DC. Si les concentrations danalytes dans
lchantillon sont hors du champ de la courbe de calibrage, des doses
supplmentaires doivent tre prpares. Un blanc doit en outre tre insr de
manire vrifier que ltalon interne ninterfre pas avec lun ou lautre des
composants du vin.

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

Tableau 1. Plan de pipetage pour le calibrage matriciel

Niveau de
calibrage
matriciel
Blanc

NM0

NM1

NM2

NM3

NM4

NM5

EI
3-MPD
DC
EI
3-MPD
DC
EI
3-MPD
DC
EI
3-MPD
DC
EI
3-MPD
DC
EI
3-MPD
DC
EI
3-MPD
DC

Ajout l
100
100
100
50
100
25
100
100
50
20
100
100
30
100
200
40

Volume
de vin

C vin

C vin

ml
10

g/L
0

mg/L
0

S1

10

1 000

1,00

S1
S2
S1
S1
S1
S1
S1
S1
S0
S1
S1
S0
S1
S1
S0

10

1 000
100
500
1 000
250
1 000
1 000
500
2 000
1 000
1 000
3 000
1 000
2 000
4 000

1,00
0,10
0,50
1,00
0,25
1,00
1,00
0,50
2,00
1,00
1,00
3,00
1,00
2,00
4,00

10

10

10

10

6. Appareillage
6.1
6.2
6.3
6.4

Balance danalyses. Prcision 0,0001 g.


Centrifugeuse de laboratoire (minimum 4 000 tr/mn).
Chromatographe en phase gazeuse. Avec dtecteur spectromtrie de
masse, injecteur split-splitless.
Diverses pipettes de prcision et fioles jauges.

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

6.5
6.6
6.7
6.8
6.9

Pipettes Pasteur.
Flacons de centrifugation 40 mL.
Flacons CG (1,5 2,0 mL).
Thermostat.
Agitateur secoueur.

7. chantillonnage
Prvoir des chantillons de vin de taille suffisante pour lanalyse. Le volume requis
pour un chantillon dessai est de 10 mL. Le vin employ pour la prparation du
calibrage matriciel (5.4) doit tre exempt danalytes.
8. Procdure
8.1 Extraction
Ajouter 100 L de solution standard S1 (5.3.2) 10 mL de vin dans un flacon de
centrifugation adapt ex. : 40 mL (cela correspond une concentration de 1 mg/L
de butane-1,4-diol-(2H)8). Ajouter prcautionneusement 10 g de K2CO3 et
mlanger. Il convient dobserver une grande prudence durant cet ajout, car le
dgagement du CO2 produit de la chaleur. Refroidir la solution dans un bain-marie
environ 20 C, puis ajouter 1 mL dther dithylique. Homogniser le mlange
pendant 5 minutes au moyen dun agitateur secoueur vertical. Centrifuger les
flacons 4 000 tr/mn pendant 5 minutes. Pour une limination optimale de la phase
organique, lextrait peut tre partiellement transvas dans un flacon de diamtre
plus petit. laide dune pipette Pasteur, transvaser la phase organique suprieure,
compose dther dithylique et dthanol, dans un flacon CG. Ajouter environ 120
mg de tamis molculaire dans le flacon. Boucher le flacon, laisser reposer pendant
environ 2 heures et secouer nergiquement de temps en temps. Le surnageant
incolore est transvas dans un second flacon CG pour lanalyse CG-SM.
8.2 Analyse CG-SM
Les paramtres spcifiques de lanalyse CG-SM sont donns ci-dessous. Dautres
systmes peuvent toutefois tre employs dans la mesure o ils sont en mesure de
produire une performance chromatographique analogue et une sensibilit adquate.
Le systme chromatographique doit tre capable de sparer ltalon interne du
phnylthanol, susceptible de provoquer des interfrences.
Conditions CG typiques
Chromatographe en phase gazeuse : HP 5890 ou quivalent.
Colonne DBwax (J&W) 60 m, diamtre interne 0,32 mm, paisseur de film 0,25
m, prcolonne de rtention capillaire 2 m dimensions identiques ou
quivalentes.
OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

Gaz vecteur : H2.


Flux Pression de 60 kPa en tte de colonne
Programme de temprature :
90 C, 2 mn, rampe 10C/mn jusqu 165 C, maintien pendant 6 mn, rampe 4
C/mn jusqu 250C, maintien pendant 5 mn.
Temprature dinjection : 250 C ; volume inject ; 2 l, mode splitless durant
90 s.

Conditions SM spcifiques
Spectromtre de masse : Finnigan SSQ 710 ou quivalent.
Ligne de transfert : 280 C.
Source : 150 C.
Dtection SM :
fentre 1 :
0-25 mn :
14,3 mn
3-MPD :
m/z 75, m/z 61
16,7 mn
EI :
m/z 78, m/z 61
Le temps dacquisition pour chaque masse est de 250 s (temps de maintien).
Vrifier pour m/z 91 la sparation du pic de ltalon interne (EI) de celui du
phnylthanol, qui produit aussi un fragment m/z 78.
fentre 2 :
25-40 mn :
32-34,5 mn
DC :
m/z 57, m/z 117
Le temps dacquisition pour chaque masse est de 250 s (temps de maintien).
Il a t observ que lanalyte pouvait dgrader la colonne chromatographique. En
particulier, linjection du mlange de DC haut point dbullition est suspect de
provoquer des dommages irrversibles. Il convient dviter les injections de
solutions standard de rfrence ; lanalyse doit tre limite aux solutions
relargues, avec de faibles concentrations danalytes. De plus, il est recommand
de prvoir une prcolonne de 1-2 m afin de protger la colonne danalyse. Quoi
quil en soit, la colonne danalyse doit tre considre comme un consommable et,
de ce fait, remplace rgulirement.
9. valuation
9.1. Identification
Noter le temps de rtention relatif de chaque analyte par rapport lEI. Calculer le
temps de rtention relatif moyen des analytes dans les solutions standard de
calibrage. Le temps de rtention relatif de lanalyte doit tre identique celui de
OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

ltalon, avec une marge de 0,5 %. Comme critre de confirmation, un rapport


ionique peut tre calcul pour chaque analyte en mode fragmentomtrique. Ce
rapport est de 117/57 pour les DC, de 75/61 pour 3-MPD et de 78/61 pour lEI. Le
rapport doit se situer 20 % de celui observ pour lchantillon enrichi. Il est
galement possible dobtenir confirmation de lidentit des substances en
effectuant le balayage complet des ions.(scan).
9.2. Quantification
La quantification se fait au moyen de la courbe de calibrage matriciel dment
prpare selon la section approprie. Les surfaces analyte/EI sont corrles par
rgression linaire par rapport la concentration de lanalyte. La quantification des
DC se fait en additionnant les surfaces des 6 pics et en calculant la teneur totale, de
manire autoriser des distributions des six CD caractristiques autres que dans la
solution standard. Les valeurs m/z suivantes sont utilises pour la quantification :
3-MPD :
EI :
DC :

m/z 75
m/z 78
m/z 117

9.3. Expression des rsultats


Les rsultats doivent tre exprims en mg/L pour 3-MPD et DC, avec deux
dcimales (ex. : 0,85 mg/L).
9.4. Limite de dtection et limite de quantification
La limite de dtection (LD) et la limite de quantification (LQ) dpendent des
conditions de mesure individuelles des analyses chimiques qui sont dterminer
par les utilisateurs de la mthode.
La limite de dtection (LD) et la limite de quantification (LQ) ont t values
laide des instruments et des conditions mentionns ci dessus (. 8) en suivant les
instructions mentionnes dans la rsolution OENO 7-2000 (AS1-10-LIMDET)
Estimation de la Limite de Dtection et de la limite de Quantification dune
Mthode dAnalyse. A partir du modle de Schma logique pour la prise de
dcisions numro 3, lapproche graphique doit tre applique en suivant les
conditions stipules au paragraphe 4.2.2. Pour ceci, on choisit une partie du
chromatogramme encadrant le pic et correspondant 10 fois la largeur du pic mihauteur (w). Deux lignes parallles sont traces encadrant lamplitude maximale
de la fentre du signal (bruit de fond). La distance entre ces deux lignes (hmax),
multiplie par 3 pour la LD, et par 10 pour la LQ et finalement convertie en units
de concentration en utilisant le facteur de rponse de la substance donne les valeurs
recherches (LD et LQ).

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

3-MPD:
LD: 0,02 mg/l
LQ: 0,06 mg/l
DC (sum):
LD: 0,08 mg/l
LQ: 0,25 mg/l
(Note: Etant donn que DC correspond un mlange de 6 composs isols avec le
mme facteur rponse - du fait de leur similitude chimique et avec un hmax
constant dans la partie correspondante du chromatogramme, la LD et la LQ pour
chaque compos isol reprsentent un sixime des valeurs cites ci-dessus.)

10. Fidlit (validation interlaboratoire)


Onze laboratoires
ont particip ltude collaborative. Ces laboratoires
participants possdent tous une exprience avre dans lanalyse des drivs. Ils
ont tous pris part lessai prparatoire.
Il est apparu que la rptabilit (r) et la reproductibilit (R), ainsi que les cartstypes respectifs (Sr et SR), taient fortement corrls, sur le plan statistique, avec la
concentration des analytes (ANNEXE : Schmas 1 et 2), r avec une probabilit
suprieure 95 % et R avec une probabilit suprieure 99 % pour chacun des
analytes en utilisant le modle de rgression linaire.
Les paramtres de performance peuvent se calculer ainsi :
3-MPD
Sr = 0,060 x
SR = 0,257 x

x = concentration de 3-MPD [mg/L]

r = 0,169 x
R = 0,720 x
DC
Sr = 0,082 x
SR = 0,092 x + 0,070

x = concentration de DC [mg/L]

r = 0,230 x
R = 0,257 x + 0,197

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

11. ANNEXE (tude interlaboratoire)


11.1. Participants
Onze laboratoires internationaux ont particip ltude collaborative (5). Ces
laboratoires participants possdent tous une exprience avre dans lanalyse des
drivs. Ils ont tous pris part lessai prparatoire :
CSL, York, Royaume-Uni
Unione Italiana Vini, Vrone, Italie
BfR, Berlin, Allemagne
BLGL, Wrzburg, Allemagne
Istituto Sperimentale per l'enologia, Asti, Italie
LUA, Speyer, Allemagne
Labor Dr. Haase-Aschoff, Bad Kreuznach, Allemagne
CLUA, Mnster, Germany
Kantonales Laboratorium, Fllinsdorf, Suisse
LUA, Coblence, Allemagne
ISMAA, S. Michele all Adige, Italie

11.2. chantillons
En novembre 2002, les laboratoires participants se sont vu remettre onze
chantillons de vin, consistant en cinq jeux dchantillons en double aveugle et en
un autre matriau dessai. Des vins blancs secs, des vins rouges secs et un vin
rouge doux faisaient fonction de matriau dessai. Les chantillons ont
pralablement t soumis des essais dhomognit (ii).
11.3. Analyse des donnes
Une analyse statistique a t conduite conformment au Protocole de conception,
de conduite et dinterprtation des tudes de performance-mthode (iii) sur un
modle en double aveugle.
1. La dtermination des valeurs aberrantes a t effectue laide des tests de
Cochran, Grubbs unilatral et Grubbs bilatral.
2. Lanalyse statistique a t conduite afin dobtenir des donnes de rptabilit et
de reproductibilit.
3. Les valeurs de Horrat ont t calcules.

OIV-MA-AS315-15 : R2007

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

Tableau 2. Rsultats pour 3-MPD

Moyenne mg/L
mg/L enrichi
Rcupration %
n
nc
Rsultats
aberrants
n1
r
sr
RSDr %
Hor
R
sR
RSDr %
HoR

CHAN
TILLON
A
Vin blanc

CHAN
TILLON
B
Vin rougea

CHAN
TILLON
C
Vin blanc
0,25
10
1
0

CHAN
TILLON
F
Vin rouge
doux
0,48
10
1
1

0,30
0,30
100
10
1
2

0,145
0,12
121
10a
1a
0

7
0,03
0,01
3,20
0,30
0,13
0,05
15,50
0,80

9a
0,13
0,05
32,67
1,53

CHAN
TILLON
G
Vin blanc
0,73
0,80
91
10
1
1

9
0,05
0,02
7,20
0,60
0,15
0,05
21,20
1,10

8
0,08
0,03
5,80
0,50
0,31
0,11
22,70
1,30

8
0,13
0,05
6,57
0,59
0,59
0,21
28,91
1,72

chantillon dessai simple ; n, nc et n1 sont des rsultats simples.


moyenne
moyenne arithmtique des donnes employes dans lanalyse
statistique
n
nombre total de groupes de donnes soumis
nc
nombre de rsultats (laboratoires) exclus pour non conformit
r. aberrants
nombre de rsultats (laboratoires) exclus aprs avoir t dtermins
aberrants en vertu des essais Cochran ou Grubbs
n1
nombre de rsultats (laboratoires) retenus dans lanalyse statistique
Sr
cart-type de la rptabilit
RSDr cart-type relatif de la rptabilit (Sr x 100/moyenne)
r
rptabilit (2,8 x Sr)
Hor
la valeur Horrat de rptabilit est la valeur RSDr observe, divise par la
valeur RSDr estime par lquation Horwitz sur lhypothse r = 0,66R
R
reproductibilit (entre lcart laboratoire) (2,8 x SR)
cart-type de la reproductibilit
SR
RSDR cart-type relatif de la reproductibilit (SR x 100/moyenne)
HoR
la valeur Horrat de reproductibilit est la valeur RSDR observe, divise
par la valeur RSDR calcule par lquation Horwitz
OIV-MA-AS315-15 : R2007

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

0,7
0,6

R = 0,720 x

r et R [mg/L]

0,5
0,4
R
0,3

0,2
0,1
r = 0,169 x
0
0

0,2

0,4

0,6

0,8

X = Concentration de 3-MPD [m g/L]

Schma 1. Corrlation entre la concentration de 3-MPD et r et R.

OIV-MA-AS315-15 : R2007

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

Tableau 3. Rsultats pour les diglycrols cycliques

Moyenne mg/L
mg/L enrichi
Rcupration %
n
nc
Rsultats aberrants
n1
r
sr
RSDr %
Hor
R
sR
RSDR %
HoR
a

CHANT
ILLON
A
Vin blanc

CHAN
TILLON
B
Vin rougea

CHAN
TILLON
D
Vin rouge

1,55
1,50
103
11
0
2
9
0,37
0,13
8,50
0,90
0,61
0,22
14,00
0,90

0,593
0,53
113
11a
0
0
11a
0,379
0,135
22,827
1,319

0,80

CHAN
TILLON
F
Vin rouge
doux
0,96

11
0
1
10
0,19
0,07
8,60
0,80
0,39
0,13
17,30
1,00

11
0
2
9
0,18
0,07
6,70
0,60
0,41
0,15
15,20
0,90

CHAN
TILLON
G
Vin blanc
0,56
0,50
112
11
0
1
10
0,15
0,05
9,30
0,80
0,34
0,12
21,50
1,20

chantillon dessai simple ; n et nc sont des rsultats simples.

OIV-MA-AS315-15 : R2007

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

0,7
R = 0,257 x + 0,197

0,6

r et R en [mg/L]

0,5
0,4
R
0,3

0,2

r = 0,230 x

0,1
0
0

0,5

1,5

x = Concentration de DC [mg/L]

Schma 2. Corrlation entre la concentration de DC et r et R.

(1) Lampe, U., Kreisel, A., Burkhard, A., Bebiolka, H., Brzezina, T., Dunkel, K.
(1997)
Zum Nachweis eines Glycerinzusatzes zu Wein
Deutsche Lebensmittelrundschau 93(4), 103-110
(2) Otteneder, H., Zimmer, M., Schaab, J. (1999)
Nachweis des Glycerinzusatzes
Deutsche Lebensmittel Rundschau 95, 172-175
(3) Bononi, M., Favale, C., Lubian, E., Tateo F. (2001)
A new method for the identification of cyclic diglycerols in wine
J. Int. Sci. Vigne Vin. 35, 225-229
(4) Fauhl C, Wittkowski R, Lofthouse J, Hird S, Brereton P, Versini G, Lees M,
Guillou C (2004),
Gas Chromatographic/Mass Spectrometric Determination of 3-Methoxy-1,2OIV-MA-AS315-15 : R2007

13

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


3-Methoxypropane-1,2-diols et des glycrols cycliques

Propanediol and Cyclic Diglycerols, By-Products of Technical Glycerol, in Wine:


Interlaboratory Study,
Journal of AOAC International 87: 1179-1188
(5) Thompson, M. and Wood, R. (1993)
International Harmonised Protocol for the Proficiency Testing of (Chemical)
Analytical Laboratories
J AOAC Int 76, 926-940
(6) Horwitz ,W. (1995)
Protocol for the design, conduct and interpretation of method-performance studies
Pure and Applied Chemistry 67, 331-343

OIV-MA-AS315-15 : R2007

14

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


2,4,6-trichloroanisole relargable dans le vin

Mthode OIV-MA-AS315-16

Mthode Type IV

Dosage du 2,4,6-trichloroanisole relargable dans le vin


par les bouchons de lige
(Rsolution OIV-Oeno 296-2009)

1 DOMAINE D'APPLICATION :
Contrle de qualit des bouchons de lige destins fermer les bouteilles de vin.
La mthode pour la dtermination du 2,4,6-trichloroanisole (TCA) relargable par
les bouchons mesure le TCA libr par un chantillon de bouchons macr dans
une solution hydroalcoolique. Lobjectif de cette mthode est dvaluer le risque de
libration par le lot de bouchons analyss et de fournir une mthode visant le
contrle de qualit des bouchons de lige.
2 PRINCIPE
La mthode vise simuler les phnomnes de migration du 2,4,6-trichloroanisole
(TCA) susceptibles de se produire entre le bouchon de lige et le vin en bouteilles.
Les bouchons de lige sont mis macrer dans un vin ou une solution
hydroalcoolique jusqu lobtention dun quilibre. Le TCA de l'espace de tte
d'une partie aliquote du macrt est prlev par la technique de microextraction en
phase solide (SPME), puis analys par chromatographie en phase gazeuse, avec
dtection par spectromtrie de masse (GC/MS) ou par capture dlectrons
(GC/ECD).
3 REACTIFS ET PRODUITS
3.1 Vin blanc de titre alcoomtrique compris entre 10 et 12% vol. Peut tre
remplac par une solution hydroalcoolique de titre alcoomtrique de 12 %
vol. Le vin et/ou la solution hydroalcoolique doivent tre exempts de TCA.
3.2 Chlorure de sodium, puret 99,5%.
3.3 2,4,6-trichloroanisole (TCA)-d5 puret 98% pour GC/MS ; 2,6dibromoanisole ou
2,3,6-trichloroanisole puret 99% pour GC/ECD
3.4 2,4,6-trichloroanisole (TCA) puret 99,0%
3.5 Ethanol absolu
3.6 Eau dsionise pure, exempte de TCA, type II selon la Norme ISO EN 3696.
3.7 Solution hydroalcoolique 12% vol.

OIV-MA-AS315-16 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


2,4,6-trichloroanisole relargable dans le vin

Prpare partir dthanol absolu (3.5) et deau dsionise pure exempte de TCA
(3.6). 3.8 Solution mre dtalon interne (500 mg/L). Ajouter 0.050 g soit de
2,4,6-trichloroanisole d5 soit de 2,6-dibromoanisole ou de 2,3,6
trichloroanisole (3.3) environ 60 mL dthanol absolu (3.5). Aprs
dissolution, ajuster le volume 100 mL avec de lthanol absolu (3.5). Se
conserve en bouteille de verre pourvue dun opercule mtallique ou en verre.
3.9 Solution intermdiaire dtalon interne (5,0 mg/L)
Ajouter 1 mL dune solution soit de 2,4,6-trichloroanisole d5 soit de 2,6dibromoanisole ou 2,3,6 trichloroanisole 500 mg/L (3.8) environ 60 mL
dthanol absolu (3.5). Aprs dissolution, ajuster le volume 100 mL avec
de lthanol absolu (3.5). Se conserve en bouteille de verre pourvue dun
opercule mtallique mtallique ou en verre. 3.10 Solution dtalon interne
(2,0 g/L)
Ajouter 40 l dune solution soit de 2,4,6-trichloroanisole d5 soit de 2,6dibromoanisole ou 2,3,6 trichloroanisole 5.0 mg/L (3.9) environ 60 mL
dthanol absolu (3.5). Aprs dissolution, ajuster le volume 100 mL avec
de lthanol absolu (3.5). Se conserve en bouteille de verre pourvue dun
opercule mtallique mtallique ou en verre. 3.11 Solution mre dtalon
TCA (40 mg/L)
Ajouter 0,020g de 2,4,6-trichloroanisole environ 400 ml dthanol absolu (3.5).
Aprs dissolution, ajuster le volume 500 ml avec dthanol absolu (3.5).
3.12 Solution intermdiaire dtalon TCA (80 g/L)
Ajouter 1 ml dune solution de 2,4,6-trichloroanisole 40 mg/L (3.11) environ
400 ml dthanol absolu (3.5). Aprs dissolution, ajuster le volume 500 ml
avec dthanol absolu (3.5).
3.13 Solution intermdiaire dtalon TCA (160 ng/L)
Ajouter 1 ml dune solution de 2,4,6-trichloroanisole 80 g/L (3.12) environ
400 ml deau dsionise pure (3.6). Aprs dissolution, ajuster le volume
500 ml avec deau dsionise pure (3.6)
3.14 Utiliser la technique des ajouts doss pour construire la gamme talon pour le
TCA. On peut utiliser pour cela les solutions dtalonnage dans une gamme
de 0,5 ng/L 50 ng/L. Ainsi, faire les ajouts doss dune solution de 2,4,6trichloroanisole 160 ng/L (3.13) 6 ml dthanol absolu (3.5). Aprs
dissolution, ajuster le volume 50 ml avec deau dsionise pure (3.6).
Rvaluer priodiquement la courbe de calibration ainsi obtenue ; la
rvaluer galement lors de chaque changement majeur au niveau du
GC/MS ou GC/ECD.
3.15 : Gaz vecteur Hlium, de puret chromatographique ( 99,9990%).
4. MATERIEL
4.1 Verrerie de laboratoire
4.1.1 Fiole jauge de 100 ml
OIV-MA-AS315-16 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


2,4,6-trichloroanisole relargable dans le vin

4.1.2 Microseringue de 100 l


4.1.3 Flacon de verre, large col, avec une capacit adapte la taille de
lchantillon et fermant avec un bouchon en verre, mtallique ou en matriau
qui ne fixe pas le TCA.
4.1.4 Flacon de verre de 20 mL fermant avec une capsule perfore et un opercule
face tflone.
4.2 Systme de microextraction en phase solide (SPME) avec fibre revtue dun
film de polydimthylsiloxane de 100 m dpaisseur
4.3 Systme de chauffage pour flacon (4.1.4)
4.4 Systme dagitation pour flacon (4.1.4)
4.5 Chromatographe en phase gazeuse quip d'un injecteur "split splitless" et d'un
dtecteur spectromtre de masse (SM) ou capture d'lectrons (CE)
4.6 Systme d'acquisition des donnes informatis
4.7 Eventuellement, systme pour prlvement et injection automatique
fonctionnant avec un systme SPME.
4.8
Colonne
capillaire
de
phase
stationnaire
apolaire,
type
phnylmethylpolysiloxane (ex : Poly 5% phenyl methyl polysiloxane, 30 m
x 0,25 mm x 0,25 m de film) ou quivalent.
5. PREPARATION DE L'ECHANTILLON
Les bouchons sont placs entiers dans un flacon en verre ferm. La capacit du
flacon (4.1.3), de mme que la quantit de vin ou solution hydroalcoolique (3.1 ou
3.7), doivent tre choisi en fonction de la taille de lchantillon, en assurant que les
bouchons soient totalement contenus et immergs dans le flacon de macration.
Exemple 1 : 20 bouchons (45x24) mm, dans un flacon de 1 L ;
Exemple 2 : 50 bouchons (45x24) mm, dans un flacon de 2 L .
Lessentiel du TCA libr en macration de groupes de bouchons lest
gnralement par un pourcentage trs faible de ces bouchons. Afin d'obtenir la
meilleure reprsentativit possible d'un lot de bouchon, il convient d'effectuer un
nombre d'analyses appropri selon les rgles d'chantillonnage et du risque encouru
vis--vis de la contamination du vin.
6. MODE OPERATOIRE
6.1 Extraction
Aprs macration durant (24 2) heures dans les conditions de temprature
ambiante du laboratoire, le macrt est homognis par retournement du rcipient.
Une partie aliquote de 10 ml de solution de macration (5) est transfre en flacon
de verre (4.1.4).

OIV-MA-AS315-16 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


2,4,6-trichloroanisole relargable dans le vin

Pour augmenter lefficacit de lextraction et la consquente sensibilit de la


mthode, il peut tre ajout une quantit denviron 1 g de chlorure de sodium (3.2).
50 l de solution dtalon interne 2,0 g/L (3.10) sont immdiatement ajouts,
puis le flacon est ferm laide dune capsule mtallique perce muni dun
opercule silicone/tflonn. La capsule est sertie.
Le contenu du flacon est homognis 10 minutes par agitation laide dun
systme dagitation (4.4) ou par le systme automatique (4.7).
Le flacon contenant lchantillon est plac dans le systme de chauffage (4.3) rgl
35 C 2 C et maintenu sous agitation (4.4). Lextraction de lespace de tte est
ralise par le systme SPME (4.2) pendant au moins 15 minutes.
6.2 Analyse
La fibre est ensuite dsorbe 260C pendant au moins 2 minutes dans linjecteur
dun chromatographe en phase gazeuse, mode splitless (4.5). La sparation
seffectue laide dune colonne capillaire de phase stationnaire apolaire (type
phnylmethylpolysiloxane ou quivalent). Le gaz vecteur est lhlium dbit
constant de 1 mL/min. Gradient de temprature 35C (3 min) 265C (15C/min)
donn titre dexemple.
6.3 Dtection et quantification
La dtection seffectue par spectromtrie de masse avec slection dions
spcifiques pour le 2,4,6-trichloroanisole (ions m/z 195, 210, 212) et quantifi sur
lion m/z 195 et ltalon interne 2,4,6-trichloroanisole d5 (ions m/z 199, 215, 217)
et quantifi sur lion m/z 215. Pour la dtermination par ECD, identifier lanalyte et
ltalon interne (2,6-dibromoanisole ou 2,3,6 trichloroanisole) dans le
chromatogramme, en comparant les temps de rtention des pics correspondants de
lchantillon ceux des pics des solutions dtalon.
7. CALCULS
La surface du pic chromatographique obtenu pour le 2,4,6-trichloroanisole est
corrige par la surface obtenue pour le pic chromatographique de ltalon interne.
La teneur en 2,4,6- trichloroanisole de chaque chantillon est obtenue laide
dune courbe talon. Les points de cette courbe sont obtenus en traant les rponses
relatives de 2,4,6-trichloroanisole/talon interne, obtenues pour des solutions
hydroalcooliques (3.7) contenant des concentrations connues de 2,4,6trichloroanisole, en fonction des concentrations de ces solutions (3.14).
Les rsultats sont donns en ng/L de TCA prsent dans la solution de macration,
arrondis 0,1 ng/L

OIV-MA-AS315-16 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


2,4,6-trichloroanisole relargable dans le vin

8. CARACTERISTIQUE DE LA METHODE
titre indicatif, le seuil de dtection de lanalyse des macrations doit tre
infrieur 0,5 ng/L, et le seuil de quantification proche de 1 ng/L. Le coefficient de
variation est infrieur 5% pour 5 ng/L, lorsque ltalon interne choisi est
lanalogue deutr TCA d5 .
Un essai interlaboratoire a t ralis afin de valider la mthode.
Cet essai interlaboratoire na pas t conduit selon le protocole OIV et les
paramtres de validation sont mentionns dans le FV 1224.

9. BIBLIOGRAPHIE
HERV E., PRICE S., BURNS G., Chemical analysis of TCA as a quality control
tool for natural
corks. ASEV Annual Meeting. 1999.
Norme ISO 20752:2007. Bouchons de lige Dosage du 2,4,6-trichloroanisole
(TCA) relargable.
FV OIV 1224 : Rsultats de lanalyse collaborative Ring test 3-TCA SPME

OIV-MA-AS315-16 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

Mthode OIV-MA-AS315-17

Mthode Type IV

Recherche et dosage des polychlorophenols et des


polychloroanisoles, dans les vins, les bouchons, les bois et les
bentonites utilisees comme piges d'atmosphre
(Rsolution OIV-Oeno 374-2009)

1. DOMAINE DAPPLICATION
Tous les vins, les bouchons en lige, bentonites (piges datmosphre) et bois.
2. PRINCIPE
Dosage du 2,4,6-trichloroanisole, du 2,4,6-trichlorophnol, du 2,3,4,6ttrachloroanisole, du 2,3,4,6-ttrachlorophnol, du pentachloroanisole et du
pentachlorophnol en chromatographie en phase gazeuse par injection dun extrait
lhexane du vin et lther/hexane des chantillons solides analyser et
talonnage interne.
3. REACTIFS
Note pralable : tous les ractifs et solvants doivent tre exempts des composs
doser lists en 2 au seuil de dtection.
3.1 Hexane de puret 99 %
3.2 Ether thylique de puret 99 %
3.3 Mlange ther/hexane (50/50 ; v/v)
3.4 talon interne : 2,5-Dibromophnol, de puret 99 %
3.5 Ethanol absolu
3.6 Eau dsionise pure, exempte de TCA, type II selon la Norme ISO EN 3696.
3.7 Solution hydroalcoolique 50 % vol. placer 100 ml dthanol absolu (3.<5)
dans une fiole jauge de 200 ml (4.9.9) et complter 200 ml avec de leau
dsionise (3.6), homogniser.
3.8 Etalon interne :
3.8.1 Solution mre 200 mg/L. Placer 20 mg de talon interne (3.4) dans une fiole
jauge de 100 ml (4.9.8) complter avec la solution hydroalcoolique 50 % vol.
(3.7) et homogniser.

OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

3.8.2 Solution dtalon interne (2 mg/L). Placer 1 ml de la solution mre dtalon


interne (3.8.1) dans une fiole jauge de 100 ml (4.9.8), complter avec la solution
hydroalcoolique 50 % vol. (3.7) et homogniser.
3.8.3 Solution dtalon interne (20 g/L). Placer 1 ml de la solution mre dtalon
interne (3.8.2) dans une fiole jauge de 100 ml (4.9.8), complter avec la solution
hydroalcoolique 50 % vol. (3.7) et homogniser.
3.9 Produits purs
3.9.1 2,4,6-trichloroanisole : 99 %, cas : 87-40-1
3.9.2 2,4,6-trichlorophnol : 99 %, cas : 88-06-2
3.9.3 2,3,5,6-ttrachloroanisole : 99 %, cas : 6936-40-9 (remarque : le produit
recherch dans les chantillons est le 2,3,4,6-ttrachloroanisole mais il nexiste pas
dans le commerce)
3.9.4 2,3,4,6-ttrachlorophnol : 99 %, cas : 58-90-2
3.9.5 pentachloroanisole : 99 %, cas : 1825-21-1
3.9.6 pentachlorophnol : 99 %, cas : 87-86-5
3.10 Ractifs pour la derivatisation - Pyridine:anhydride actique (1:0,4) vol.
3.10.1 Pyridine: 99 %
3.10.2 Anhydride actique: 98 %
3.11 Solution mre de calibrage 200 mg/l
Dans une fiole jauge de 100 ml (4.9.8), placer 20 mg environ des produits purs
(3.9.1 3.9.6) de poids exactement connu (4.7), complter avec de lthanol absolu
(3.5). Homogniser.
3.12 Solution intermdiaire de calibrage 200 g/l
Dans une fiole jauge de 100 ml (4.9.8) remplie dthanol absolu (3.5), ajouter 100
l de la solution mre de calibrage 200 mg/l (3.11) laide de la micro-seringue
de 100 l (4.9.1) et homogniser.
3.13 Solution fille de calibrage 4 g/l
Dans une fiole jauge de 50 ml (4.9.7) contenant de solution hydroalcoolique 50
% vol. (3.7) ajouter 1 ml de la solution intermdiaire de calibrage 200 g/l (3.12)
laide dune pipette de 1 ml (4.9.6). Complter 50 ml avec la solution
hydroalcoolique 50 % vol. (3.7) et homogniser.
3.14 Solutions de calibrage. Il est possible de prparer diverses solutions de
calibrage diverses concentrations en rajoutant, laide de la micro-seringue de
100 l (4.9.1), par exemple 50 l de la solution fille de calibrage 4 g/l (3.13)
OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

dans 50 ml de solution hydroalcoolique 50 % vol. (3.7) pour obtenir un


enrichissement de celui ci de 4 ng/l en substances doser.
Le mme raisonnement peut permettre de prparer des solutions de calibrage de
diverses concentrations soit dans des solutions hydroalcooliques ou du vin ou
encore denrichir un milieu dextraction avec une quantit parfaitement connue de
produits purs.
3.15 Bentonite du commerce.
4. MATERIEL
4.1 Chromatographe en phase gazeuse avec injecteur split-splitless coupl un
dtecteur capture dlectrons. (Il est galement possible dutiliser un spectromtre
de masse)
4.2
Colonne
capillaire
de
phase
stationnaire
apolaire,
type
phnylmethylpolysiloxane (0,32 mm x 50 m, paisseur de film 0,12 m), ou
quivalent.
4.3 Conditions chromatographiques, titre dexemple:
4.3.1 Injection en mode "split-splitless" (temps de fermeture des vannes 30
secondes)
4.3.2 Dbit gaz vecteur : 30 ml/min dont 1 ml dans la colonne Hydrogne, de
puret chromatographique ( 99,9990%). Il est galement possible d'utiliser de
l'hlium ou de lazote.
4.3.3 Dbit gaz auxiliaire : 60 ml/min Azote, de puret chromatographique (
99,9990%). Il est galement possible d'utiliser argon-mthane.
4.3.4 Gradient de temprature du four, donn titre dexemple:
- de 40 C 160 C raison de 2 C/min
- de 160 C 200 C raison de 5 C/min
- palier 220 C pendant 10 min
4.3.5 Temprature injecteur : 250 C
4.3.6 Temprature dtecteur : 250 C
4.4 Acquisition et intgration : lacquisition se fait sur un ordinateur. Les pics des
diffrents composs identifis par comparaison avec la rfrence, sont ensuite
intgrs.
4.5 Agitateur.
4.6 Vortex avec adaptation pour flacon de 30 ml (4.9.3)
OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

4.7 Balance de prcision 0,1 mg


4.8 Rpe de mnage pour rmoulade manuelle ou lectrique
4.9 Matriel de laboratoire :
4.9.1 Micro Seringue de 100 l
4.9.2 Micro Seringue de 10 l
4.9.3 Flacon de 30 ml fermant avec un bouchon vis et opercule face tflone
4.9.4 Pipette de 10 ml gradue au 1/10 de ml
4.9.5 Pipette de 5 ml gradue au 1/10 de ml
4.9.6 Pipette de prcision de 1 ml
4.9.7 Fiole jauge de 50 ml
4.9.8 Fiole jauge de 100 ml
4.9.9 Fiole jauge de 200 ml
4.9.10 Ampoule dcanter de 100 ml
4.9.11 Pipettes Pasteur et poire propipette adapte
4.9.12 Feuille d'aluminium de mnage en rouleau.
4.9.13 Centrifugeuse
5. PREPARATION DE L'ECHANTILLON
5.1 Le bouchon est rp (4.8) ou coup en morceaux (dimension < 3 mm)
5.2 Le bois est dbit avec une tenaille pour obtenir des morceaux (dimension < 3
mm)
5.3 La bentonite (3.15) (30 g par exemple) est tale sur une feuille d'aluminium
(4.9.12) d'environ 30 cm x 20 cm et expose dans l'atmosphre analyser pendant,
au minimum, 5 jours.
6. MODE OPERATOIRE
6.1 Processus d'extraction pour les chantillons solides :
6.1.1 Bouchon : dans un flacon de 30 ml (4.9.3), placer 1 g environ de bouchon
rp (5.1) de poids exactement connu (4.7)
6.1.2 Bois : dans un flacon de 30 ml (4.9.3), placer 2 g environ de morceaux de
bois (5.2) de poids exactement connu (4.7)

OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

6.1.3 Bentonite contrle : dans un flacon de 30 ml (4.9.3), placer 5 g environ de


bentonite
(3.15) de poids exactement connu (4.7)
6.1.4 Bentonite chantillon : dans un flacon de 30 ml (4.9.3), placer 5 g environ de
bentonite (5.3) de poids exactement connu (4.7)
6.1.5 Ajouter 10 ml (4.9.4) de mlange ther/hexane (3.3)
6.1.7 Ajouter la micro-seringue (4.9.1) 50 l de la solution dtalon interne
(3.8.3)
6.1.8 Agiter au vortex (4.6) pendant 3 min
6.1.9 Rcuprer la phase liquide dther/hexane dans un flacon de 30 ml (4.9.3)
6.1.10 Recommencer lopration dextraction sur lchantillon, avec 2 fois 5 ml de
mlange ther/hexane (3.3)
6.1.11 Extrait final : mlanger les 3 phases dther/hexane.
6.2 Extraction du vin et des solutions de calibrage.
6.2.1 Prlever 50 ml de vin ou de solution de calibrage (3.14) laide de la fiole
jauge (4.9.7)
6.2.2 Les placer dans la fiole jauge de 100 ml (4.9.8)
6.2.3 Ajouter la microseringue (4.9.1) 50 l d'talon interne (3.8.3)
6.2.4 Ajouter 4 ml (4.9.5) dhexane (3.1)
6.2.5 Effectuer l'extraction l'aide de l'agitateur magntique (4.5) durant 5 min.
6.2.6 Dcanter en ampoule (4.9.10)
6.2.7 Rcuprer la phase organique avec l'mulsion dans un flacon de 30 ml (4.9.3)
et la phase aqueuse dans la fiole jauge de 100 ml (4.9.8)
6.2.8 Recommencer l'extraction du vin ou de solution de calibrage par 2 ml
dhexane (3.1)
6.2.9 Effectuer l'extraction l'aide de l'agitateur magntique (4.5) durant 5 min.
6.2.10 Dcanter en ampoule (4.9.10)
6.2.11 Rcuprer la phase organique avec l'mulsion dans le mme flacon de 30 ml
mentionn 6.2.7 (contenant la phase organique obtenue au terme de la premire
extraction).

OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

6.2.12 Casser l'mulsion de la phase organique par centrifugation (4.9.13), en


liminant la phase aqueuse infrieure laide dune pipette Pasteur (4.9.11) munie
dune poire propipette.
6.2.13 Extrait final du vin et des solutions de calibrage : il sagit de lextrait
organique rsiduel.
6.3 Analyse
6.3.1 Ajouter au extrait final (6.1.11 ou 6.2.13) 100 l (4.9.1) de mlange ractif
piridine:anydride actique (3.10) pour la drivatisation.
6.3.2 Agiter l'aide de l'agitateur magntique (4.5) durant 10 min.
6.3.3 Injecter 2 l de l'extrait final drivatis (6.3.2) dans le chromatographe.
7. CALCUL :
Aire du pic du produit
concentration du produit = x Coefficient de rponse
Aire du pic de ltalon interne

Coefficient de rponse = concentration dans la solution de calibrage (3.14) *(Aire


du pic de ltalon interne/ Aire du pic du produit pur dans la solution de calibrage).
Vrification de ltalonnage, en assurant des coefficients de rponse +/- 10 %.
8. RESULTATS
Les rsultats sont exprims en ng/l pour le vin et en ng/g pour les bouchons en
lige, les bentonites et les bois.
9. CARACTERISTIQUES DE LA METHODE
9.1 Taux de recouvrement,
Le taux de recouvrement calcul par rapport des quantits rajoutes dans des
bois, de
polychloroanisoles et de polychlorophnols de 115 ng/g est de :
- 2,4,6-trichloroanisole : 96 %
- 2,4,6-trichlorophnol : 96 %
- 2,3,4,6-ttrachloroanisole : 96 %
- 2,3,4,6-ttrachlorophnol : 97 %
- pentachloroanisole : 96 %
- pentachlorophnol : 97 %
OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

9.2 Rptabilit des mesures,


Calcules pour chaque produit, les valeurs de rptabilit sont les
suivantes :
Dans un bouchon ng/g
2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

Dans un bois 23 ng/g


2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

Moyenne
1,2
26
1,8
2,6
23,3
7,4

Ecart type
0,1
3,3
0,4
0,3
2,9
1,9

Ecart type
1,9
1,9
2,6
3,3
2,7
3,6

rptabilit
0,3
9,2
1,2
0,9
8,1
5,4

rptabilit
5,3
5,3
7,4
9,3
7,5
10,1

Dans un vin 10 ng/l

Ecart type

rptabilit

2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

0,4
2,1
0,6
4
1,2
6,5

1,1
5,9
1,7
11,2
3,4
18,2

Dans une bentonite 15 ng/g

Ecart type

rptabilit

2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

0,9
4
1,2
5,2
4,3
12,1

2,5
11,2
3,4
14,6
12,0
33,9

OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Polychlorophenols et des polychloroanisoles

9.3 Limites de dtection (L.D) et de quantification (L.Q) calcules selon la


mthode OIV :
9.3.1 Bois
2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

L.D en ng/g
0,7
0,6
0,6
1,1
0,4
0,9

L.Q en ng/g
2,4
2,0
2,0
3,7
1,4
3,1

9.3.2 Bentonite
2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

L.D en ng/g
0,5
1
0,5
1
0,5
Non det.

L.Q en ng/g
1
3
1
3
1
Non det.

9.3.3 Bouchon
2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

L.D en ng/g
0,5
1
0,5
1
0,5
1

L.Q en ng/g
1,5
2
1,5
2
1,5
2

L.D en ng/l
0,3
1
0,3
0,3
0,5
1

L.Q en ng/l
1
3
1
1
3
3

9.3.4 Vin
2,4,6-trichloroanisole
2,4,6-trichlorophnol
2,3,4,6-ttrachloroanisole
2,3,4,6-ttrachlorophnol
pentachloroanisole
pentachlorophnol

2 Air liquide

OIV-MA-AS315-17 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Mthode OIV-MA-AS315-18

Mthode Type II

Analyse des amines biognes des mots et des vins par HPLC
(Rsolution OIV-Oeno 346-2009)
1.

DOMAINE DAPPLICATION

Cette mthode est applicable lanalyse des amines biognes dans les mots et les
vins :
Ethanolamine : jusqu 20 mg/L ;
Histamine : jusqu 15 mg/L ;
Mthylamine : jusqu 10 mg/L ;
Srotonine : jusqu 20 mg/L ;
Ethylamine : jusqu 20 mg/L ;
Tyramine : jusqu 20 mg/L ;
Isopropylamine : jusqu 20 mg/L ;
Propylamine : normalement absente ;
Isobutylamine : jusqu 15 mg/L ;
Butylamine : jusqu 10 mg/L ;
Tryptamine : jusqu 20 mg/L ;
Phenylthylamine : jusqu20 mg/L ;
Putrescine ou 1,4-diaminobutane : jusqu 40 mg/L ;
2-Mthylbutylamine : jusqu 20 mg/L ;
3-Mthylbutylamine : jusqu 20 mg/L ;
Cadavrine ou 1,5-diaminopentane : jusqu 20 mg/L ;
Hexylamine : jusqu 10 mg/L.

2.

DFINITION

Les amines biognes doses sont :


Ethanolamine : C2H7NO CAS [141 43 5]
Histamine : C5H9N3 - CAS [51 45 6]
Mthylamine : CH5N CAS [74 89 5]
Srotonine : C10H12N2O CAS [153 98 0]
Ethylamine : C2H7N CAS [557 66 4]
Tyramine : C8H11NO - CAS [60 19 5]
Isopropylamine : C3H9N - CAS [75 31 0]
Propylamine : C3H9N CAS [107 10 8]
Isobutylamine : C4H11N CAS [78 81 9]
Butylamine : C4H11N CAS [109 73 9]
OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Tryptamine : C10H12N2 CAS [61 54 1]


Phenylthylamine : C8H11N CAS [64 04 0]
Putrescine ou 1,4-diaminobutane : C4H12N2 CAS [333 93 7]
2-Mthylbutylamine : C5H13N - CAS [96 15 1]
3-Mthylbutylamine : C5H13N - CAS [107 85 7]
Cadavrine ou 1,5-diaminopentane : C5H14N2 CAS [1476 39 7]
1,6-Diaminohexane : C6H16N2 CAS [124 09 4]
Hexylamine : C6H15N CAS [111 26 2]

3.

PRINCIPE

Les amines biognes sont directement doses par HPLC laide dune colonne C18
aprs drivation l' O-phtaldialdhyde (OPA) et dtects par fluorimtrie.

4.

REACTIFS ET PRODUITS

4.1
4.2
4.3
4.4
;
4.5
4.6
4.7
4.8
4.9
4.10
4.11
4.12
4.13
4.14
4.15
4.16
4.17
4.18
4.19
4.20
4.21
4.22

Eau ultra pure de rsistivit 18Mcm ;


Di-sodium hydrognophosphate dihydrate - puret 99 % ;
Actonitrile - Minimum de transmission 200 nm - puret 99 % ;
O-phtaldialdhyde (OPA) - Application pour fluorescence - puret 99 %
Di-sodium ttraborate dcahydrate - puret 99 % ;
Mthanol - puret 99 % ;
Acide chlorhydrique 32 % ;
Hydroxyde de sodium en pastilles - puret 99 % ;
Ethanolamine - Puret 99 % ;
Histamine dichlorhydrate - Puret 99 % ;
Ethylamine chlorhydrate - Puret 99 % ;
Srotonine - Puret 99 % ;
Mthylamine chlorhydrate Puret 98 % ;
Tyramine chlorhydrate - Puret 99 % ;
Isopropylamine puret 99 % ;
Butylamine - Puret 99 % ;
Tryptamine chlorhydrate - puret 98 % ;
Phnylthylamine - Puret 99 % ;
Putrescine dichlorhydrate - Puret 99 % ;
2-Mthylbutylamine - Puret 98 % ;
3-Mthylbutylamine - Puret 98 % ;
Cadavrine dichlorhydrate - Puret 99 % ;

OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

4.23 1-6-Diaminohexane - Puret 97 % ;


4.24 Hxylamine - Puret 99 % ;
4.25 Azote (impurets maximales : H2O3 mg/L ; O22 mg/L ; CnHm0.5
mg/L ) ;
4.26 Hlium (impurets maximales : H2O3 mg/L ; O22 mg/L ; CnHm0.5
mg/L ).
Prparation des solutions ractives :
4.27

Prparation des luants

Solution A phosphate : sur une balance (5.27), dans un bcher de 50 mL (5.5),


peser 11,12 g 0,01 g de phosphate disodique (4.2). Transvaser dans une fiole
jauge de 2 litres (5.9), ajuster 2 litres avec de l'eau dminralise (4.1).
Homogniser l'aide d'un agitateur magntique (5.30), filtrer sur membrane 0,45
m (5.17). Mettre dans la bouteille de 2 litres (5.12)
Solution B : l'actonitrile (4.3) est directement utilis.
4.28 Solution d'OPA - Prparation journalire
Peser dans une fiole de 50 mL (5.7) sur la balance de prcision (5.27), 20 mg 0,1
mg d'OPA (4.4). Ajuster 50 mL avec du mthanol (4.6). Homogniser.
4.29 Prparation du tampon borate (4.29) - Prparation hebdomadaire
Peser 3,81 g 0,01 g de Na2B4O710H2O (4.5) dans un bcher de 25 mL (5.6), sur
la balance de prcision (5.27). Transvaser dans une fiole jauge de 100 mL (5.8),
ajuster 100 mL avec de l'eau dminralise (4.1). Homogniser l'aide d'un
agitateur magntique (5.30), transvaser dans un bcher de 150 mL (5.4), ajuster
pH 10,5 l'aide du pHmtre (5.28 et 5.29) avec de la soude 10N (4.8).
4.30 Solution dacide chlorhydrique 0,1M : dans une fiole jauge de 2 L (5.9),
mettre un peu deau dminralise (4.1). Ajouter 20 mL dacide chlorhydrique
(4.7) laide dune pipette automatique de 10 mL (5.24 et 5.25)
4.31 Solution de calibration dans lacide chlorhydrique 0.1 N
Concentration indicative de la solution de calibration, peser 0.1 mg

OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Ethanolamine

concentration indicative
finale dans le mlange
talon
en mg/L
5

Histamine

Mthylamine

Srotonine

20

Ethylamine

Tyramine

Isopropylamine

Propylamine

2.5

Isobutylamine

Butylamine

Tryptamine

10

Phnylthylamine

Putrescine
2Mthylbutylamine
3Mthylbutylamine

12

Cadavrine
1.6Diaminohexane

13

Hexylamine

5
6

La concentration relle de la solution de calibration est consigne avec le numro


de lot des produits utiliss.
Certains amines biognes sont sous forme de sel, il faut tenir compte du poids du
sel pour dterminer le poids rel de lamine biogne.
La solution mre est faite dans une fiole jauge de 100 mL (5.8).
La solution fille est faite dans une fiole jauge de 250 mL (5.10).
4.32 Standard interne 1,6 Diaminohexane
OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Peser exactement 119 mg dans un erlenmeyer de 25 mL (5.1) sur une balance


(5.27). Transvaser dans une fiole jauge de 100 mL (5.8). Ajuster au trait de jauge
avec lacide chlorhydrique 0.1 N (4.30) ;
4.33 2-Mercaptothanol - Puret 99 %.
5.

APPAREILLAGE

5.1
Erlenmeyers de 25 mL ;
5.2
Erlenmeyers de 250 mL ;
5.3
Bchers de 100 mL ;
5.4
Bchers de 150 mL ;
5.5
Bcher de 50 mL ;
5.6
Bcher de 25 mL;
5.7
Fioles jauges de 50 mL;
5.8
Fioles jauges de 100 mL;
5.9
Fioles jauges de 2 000 mL;
5.10 Fiole jauge de 250 mL;
5.11 Bouteilles de 1 litre;
5.12 Bouteille de 2 litres;
5.13 Flacons de 2 mL vis adapts au passeur dchantillons;
5.14 Seringue de 50 mL;
5.15 Aiguille;
5.16 Porte filtre;
5.17 Membrane de 0,45 m en cellulose;
5.18 Membrane de 0,8 m en cellulose;
5.19 Membrane de 1,2 m en cellulose;
5.20 Membrane de 5 m en cellulose;
5.21 Prfiltre en cellulose;
5.22 Pipette automatique de 1 mL;
5.23 Pipette automatique de 5 mL;
5.24 Pipette automatique de 10 mL
5.25 Cnes pour pipette automatique de 10 mL, 5 mL et 1 mL;
5.26 Systme de filtration;
5.27 Balances pour des peses de 0 205 g 0,01 mg;
5.28 pHmtre;
5.29 Electrode;
5.30 Agitateur magntique
5.31 Pompe HPLC;
5.32 Passeur-prparateur quip dun four
Note : le four est indispensable, si un passeurprparateur est utilis pour injecter
plusieurs chantillons la suite, cette opration peut aussi se faire manuellement
mais les rsultats risquent dtre moins prcis ;

OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

5.33 Boucle dinjection;


5.34 Colonne C18 de 5 m, 250 mm 4 (qui doit conduire un
chromatogramme proche de celui prsent en annexe B);
5.35 Dtecteur fluorimtrique;
5.36 Intgrateur;
5.37 Tube en verre borosilicat de 15 mL avec bouchon et obturateur recouvert
de PTFE.
6.

PREPARATION DES ECHANTILLONS

Les chantillons sont pralablement dgazs lazote (4.25).


6.1
Filtration
Filtrer environ 120 mL dchantillon sur membrane:
- pour un vin : 0.45m (5.17),
- pour un mot ou un vin non clarifi, empiler les filtres dans l'ordre suivant,
l'chantillon tant pouss par le dessus : 0,45m (5.17) + 0,8 m (5.18) +1,2 m
(5.19) +5 m (5.20) + prfiltre (5.21) +.
6.2
Prparation de lchantillon
Mettre 100 mL d'chantillon (6.1) dans une fiole de 100 mL (5.8) ;
Ajouter 0.5 mL de 1-6-diaminohexane (4.32) 119 mg/100 mL laide dune
pipette automatique de 1 mL (5.21 et 25) ;
Prlever 5 mL dchantillon laide de la pipette (5.23 et 5.25) ; les verser dans un
erlenmeyer de 25 mL (5.1) ;
Y ajouter 5 mL de mthanol (4.6) laide de la pipette (5.23 et 5.25) ;
Homogniser par agitation ;
Transfrer dans des flacons (5.13) ;
Lancer la pompe HPLC (5.31) puis linjection 1 L (5.32 et 5.33).
6.3
Drivatisation
Dans un tube en verre borosilicat (5.37), verser 2 mL de solution d'OPA (4.28), 2
mL de tampon borate (4.29), 0,6 mL de 2-mercaptothanol (4.33). Boucher, agiter
(5.30). Ouvrir et verser 0,4 mL d'chantillon. Boucher, agiter (5.30). Injecter
immdiatement, le deriv n'tant pas stable. Rincer immdiatement la vaisselle
aprs injection, cause de l'odeur.
Note : la drivatisation peut tre ralise par un prparateur/injecteur
automatique. Dans ce cas, il sera programm pour sapprocher des proportions
de la drivatisation manuelle.
6.4
Nettoyage courant
Seringue (5.13) et aiguille (5.14) rinces leau dminralise (4.1) aprs chaque
chantillon ;
OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Porte-filtre (5.16) rinc leau chaude, puis MeOH (4.6). Laisser scher lair.

7.

MODE OPERATOIRE

Phase mobile (5.31)


- A : tampon phosphate (4.2) ;
- B : actonitrile (4.3).
Gradient dlution :
temps
( en min)
0
15
23
42
55
60
70
95

%A

%B

80
70
60
50
35
35
80
80

20
30
40
50
65
65
20
20

Note : le gradient peut tre ajust pour obtenir un chromatogramme proche de


celui prsent en annexe B
Dbit : 1 mL/min ;
Temprature de colonne 35C (5.32) ;
Dtecteur (5.35) : Exc = 356 nm, Em = 445 nm (5.30);
Etalonnage interne
La solution de calibration est injecte chaque srie ;
Calibration par standard interne ;
Calcul des facteurs de rponse :
RF = Ccis surface i / surface is Cci
Cci = concentration du composant dans la solution de calibration et
Ccis = concentration du standard interne dans la solution de calibration (1-6diaminohexane).
Surface i = surface du pic du produit prsent dans lchantillon
Surface is = surface du pic du standard interne dans lchantillon

OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Calcul des concentrations :


Cci = (XF surface i)/ (surface is RF)
Surface i = surface du pic du produit prsent dans lchantillon
Surface is = surface du pic du standard interne dans lchantillon
XF = quantit dtalon interne ajoute aux chantillons analyser
XF = 119 0.5/100 = 5.95.

8.

EXPRESSION DES RESULTATS

Les rsultats sont exprims en mg/L avec un chiffre significatif aprs la virgule.

9.

FIDELITE

Histamine

r (mg/L)
0.07x + 0.23

R (mg/L)
0.50x + 0.36

Mthylamine

0.11x + 0.09

0.40x + 0.25

Ethylamine

0.34x - 0.08

0.33x + 0.18

Tyramine

0.06x + 0.15

0.54x + 0.13

Phnylthylamine

0.06x + 0.09

0.34x + 0.03

Diaminobutane

0.03x + 0.71

0.31x + 0.23

2-mthylbutylamine et 3mthylbutylamine

0.38x + 0.03

0.38x + 0.03

Diaminopentane

0.14x + 0.09

0.36x + 0.12

Les dtails de l'essai interlaboratoires portant sur la fidlit de la mthode sont


rsums dans l'annexe A.

10.

AUTRES CARACTERISTIQUES DE L'ANALYSE

Influence de certains composants du vin : les acides amins sortent au dbut de


lanalyse et ne gnent pas la dtection des amines biognes.

OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Limites de dtection (LOD) et de quantification (LOQ) selon une tude


intralaboratoire :

11.

LOD (en mg/L)

LOQ (en mg/L)

Histamine

0,01

0,03

Mthylamine

0,01

0,02

Ethylamine

0,01

0,03

Tyramine

0,01

0,04

Phnylthylamine

0,02

0,06

Diaminobutane

0,02

0,06

2-mthylbutylamine

0,01

0,03

3-mthylbutylamine

0,03

0,10

Diaminopentane

0,01

0,03

CONTROLE QUALITE

Des contrles qualit peuvent tre raliss avec des matriaux de rfrence
certifis, des vins dont les caractristiques sont issues d'un consensus ou de vins
surchargs insrs rgulirement dans les sries analytiques et en suivant les cartes
de contrle affrentes.

OIV-MA-AS315-18 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Annexe A
Donnes statistiques obtenues partir des rsultats
des essais interlaboratoire
Les paramtres suivants ont t dfinis au cours d'un essai interlaboratoire. Cet
essai a t conduit par l'Institut d'nologie de Bordeaux (France) sous la
supervision de l'Office National Interprofessionnel des Vins (ONIVINS France)
Anne de l'essai interlaboratoire : 1994
Nombre de laboratoires : 7
Nombre dchantillons :9 en double aveugle
(Bulletin de lO.I.V. novembre-dcembre 1994, 765-766, p.916 962) valeurs
recalcules conformment l'ISO 5725-2:1994.
Types d'chantillons : vin blanc (BT), vin blanc (BT) surcharg = B1, vin blanc
(BT) surcharg = B2, vin rouge n1 (RT), vin rouge surcharg = R1, vin rouge
(RT) surcharg = R2, vin rouge n2 (CT), vin rouge (CT) surcharg = C1 et vin
rouge (CT) surcharg = C2. Surcharges en mg/L.

HistN

MtN

EthN

TyrN

PhEtN

DiNbut IsoamN DiNpen

vin B1

vin BT
+ 0,5

vine BT
+ 0,12

vinBT
+ 0,13

vin BT
+ 0,36

vine BT vin BT vine BT


+ 0,15
+ 0,5
+ 0,28

vin B2

vin BT
+2

vin BT
+ 0,40

vin BT
+ 0,50

vin BT
+ 1,44

vin BT
+ 0,60

vin BT vin BT vin BT


+2
+ 0,1,74 + 1,04

vin C1

vin CT
+2

vin CT
+ 0,1

vin CT
+ 0,18

vin CT
+ 0,72

vin CT
+ 0,15

vin CT
+2

vin CT
+ 0,29

vin CT
+ 0,26

vinC2

vin CT
+4

vin CT
+ 0,41

vin CT
+ 0,50

vin CT
+ 2,90

vin CT
+ 0,58

vin CT
+8

vin CT
+ 1,14

vin CT
+ 1,04

vin R1

vin RT
+2

vin RT
+ 0,14

vin RT
+ 0,13

vin RT
+ 1,45

vin RT
+ 0,19

vin RT vin RT vin RT


+3
+ 0,0,57 + 0,51

vin R2

vin RT
+5

vin RT
+ 0,41

vin RT
+ 0,50

vin RT
+ 2,88

vin RT
+ 0,59

vin RT
+ 10

vin RT
+ 2,28

vinBT
+ 0,25

vin RT
+ 2,08

HistN : histamine, MetN : mthylamine, EthN : thylamine, TyrN : tyramine,


PhEtN : phnylthylamine, DiNbut : diaminobutane, IsoamN : isoamylamine et
DiNpen : diaminopentane.
OIV-MA-AS315-18 : R2009

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

Annexe B

Temps de rtention

Modle de chromatogramme obtenu avec cette mthode


OIV-MA-AS315-18 : R2009

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Amines biognes par HPLC

BIBLIOGRAPHIE
TRICARD C., CAZABEIL J.-M., SALAGOTI M.H. (1991) : dosage des
amines biognes dans les vins par HPLC, Analusis, 19, M53-M55.
PEREIRA MONTEIRO M.-J. et BERTRAND A. (1994) : validation d'une
mthode de dosage Application l'analyse des amines biognes du vin.
Bull. O.I.V., (765-766), 916-962.

OIV-MA-AS315-18 : R2009

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

Mthode OIV-MA-AS315-19

Mthode Type IV

Dosage du glutathion dans les mots et les vins


par lectrophorse capillaire
(Rsolution OIV-Oeno 345-2009)

1. Domaine dapplication
Cette mthode permet le dosage du glutathion dans les mots et les vins dans une
gamme de concentration de 0 40 mg/L. Elle utilise llectrophorse capillaire
(EC) couple une dtection fluorimtrique (LIF).

2. Principe
La mthode utilise, qui procde par lectrophorse capillaire, est adapte de celle
mise au point par Noctor et Foyer (1998) pour doser les thiols non volatils dans les
feuilles de peuplier par HPLC couple une dtection fluorimtrique.
La sparation des soluts d'un mlange par lectrophorse capillaire est obtenue par
migration diffrentielle dans un lectrolyte. Le capillaire est rempli avec cet
lectrolyte.
L'chantillon sparer est inject l'une des extrmits du capillaire. Sous l'action
du champ lectrique gnr par les lectrodes plonges dans llectrolyte, les
soluts se sparent par diffrence de vitesse de migration et sont dtects
proximit de l'autre extrmit du capillaire sous forme de pics. Dans des conditions
opratoires donnes, les temps de migration constituent un critre d'identification
des espces chimiques et la surface du pic est proportionnelle la quantit injecte.

3. Produits et ractifs
3.1 Liste des produits
3.1.1 glutathion (GSH, > 98 %),
3.1.2 dithiothritol (DTT, >99 %),
3.1.3 phosphate de sodium monobasique anhydre (NaH2PO4, >99 %)
3.1.4 phosphate de sodium dibasique anhydre (Na2HPO4, >99 %)
3.1.5 acide 2-(N-cyclohexylamino)thanesulfonic (CHES, >98 %),
3.1.6 monobromobimane (MBB, 97 %)
3.1.7 sel de sodium d'acide d'thylnediaminettraactique (EDTA, >99 %)
3.1.8 hydroxyde de sodium
OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

3.1.9 acide chlorhydrique (35 %)


3.1.10 actonitrile (99,5 % )
3.1.11 eau ultrapure de rsistivit >18 M.cm.
3.2 Liste des solutions
Chacune des solutions est homognise avant toute utilisation
3.2.1 Tampon lectrophortique : tampon phosphate, 50 mM, pH 7
Ce tampon est prpar partir de deux solutions A et B
3.2.1.1 Solution A : 3 mg de phosphate monobasique anhydre (3.1.3) repris dans
250 mL d'eau ultra pure (3.1.11)
3.2.1.2 Solution B : 3,55 mg de phosphate dibasique anhydre (3.1.4) repris dans
250 mL d'eau ultra pure (3.1.11)
Le tampon phosphate est obtenu par addition de 40 ml de la solution A (3.2.1.1) et
210 mL de la solution B (3.2.1.2), complt 500 mL par de leau ultra pure
(3.1.11). Le pH du tampon est alors ajust 7 par de l'acide chlorhydrique (3.1.9).
3.2.2 Solution de monobromobimane (MBB), 50 mM
25 mg de monobromobimane (MBB) (3.1.6) sont repris par 1850 L d'actonitrile
(3.1.10).
Conserv - 20 C l'abri de la lumire, le ractif est stable durant trois mois.
3.2.3 Solution dhydroxyde de sodium 0,1 M.
0,4 g dhydroxyde de sodium (3.1.8) sont placs dans une fiole jauge de 100 ml et
repris par
100 mL d'eau ultra pure (3.1.11).
3.2.4 Solution dhydroxyde de sodium 5 M.
20 g dhydroxyde de sodium (3.1.8) sont placs dans une fiole jauge de 100 ml et
repris par
100 mL d'eau ultra pure (3.1.11).
3.2.5 Tampon CHES : 0,5 M, pH 9,3
2,58 g d'acide 2-(N-cyclohexylamino)thanesulfonic (CHES) (3.1.5) sont dissous
dans environ 20 ml d'eau ultra pure (3.1.11). Le pH du tampon est ajust 9,3 par
addition dhydroxyde de sodium 5 M (3.2.4) puis le volume est ajust 25 ml par
de l'eau ultra pure (3.1.11). Ce tampon est rparti dans des tubes de 1,5 mL (type
Eppendorf) raison de 1 ml par tube.
La solution aqueuse de CHES, place - 20C, peut tre conserve durant
plusieurs mois.

OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

3.2.6 Solution de dithiothritol (DTT), 10 mM


15,4 mg de dithiothriol (3.1. 2) sont dissous dans 10 mL d'eau ultra pure (3.1.11)
puis cette solution est rpartie dans des tubes de 1,5 mL (type Eppendorf) raison
de 1 ml par tube.
La solution aqueuse de DTT, place - 20C, peut tre conserve durant plusieurs
mois.

4. Appareillage
4.1 L'lectrophorse capillaire
L'lectrophorse capillaire munie dun injecteur de type hydrostatique est couple
un dtecteur de fluorescence induite par laser ayant une longueur donde
dexcitation proche de la longueur d'onde d'absorption de l'adduit MBB-GSH : ex =
390 nm (par exemple, dtecteur Zetalif).
4.2 Le capillaire
La longueur totale du capillaire en silice non greffe est de 120 cm, la longueur
efficace est de
105 cm, le diamtre interne est de 30 m.

5. Prparation des chantillons


La mthode de dosage utilise met en jeu la drivatisation des fonctions SH par le
monobromobimane (MBB) (Radkowsky et Kosower, 1986). Les chantillons de
mots ou de vins bruts sont clarifis par centrifugation avant d'tre analyss. Les
vins en bouteille sont analyss sans clarification pralable.
Prparation des chantillons :
Dans un tube de 1,5 mL (type Eppendorf) placer successivement :
- 200 l d'chantillon,
- 10 l de la solution de DTT (3.2.4) ; concentration finale 0,25 mM.
- 145 l de CHES (3.2.5) ; concentration finale 179 mM.
- 50 l de MBB (3.2.2) ; concentration finale 6,2 mM.
Aprs agitation du mlange ractionnel, la drivatisation des fonctions thiols par le
MBB ncessite 20 min d'incubation l'abri de la lumire et temprature
ambiante. Dans ces conditions analytiques, les drivs MBB-SR ainsi forms sont
peu stables ; le dosage par EC-LIF doit tre effectu immdiatement aprs la
priode d'incubation.

OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

6. Mode opratoire
6.1 Conditionnement du capillaire
Avant sa premire utilisation et ds que les temps de migration augmentent, le
capillaire (4.2) doit tre conditionn de la faon suivante :
6.1.1. rinage lhydroxyde de sodium 0,1 M (3.2.5) pendant 3 min,
6.1.2. rinage l'eau ultra pure (3.1.12) pendant 3 min,
6.1.3. rinage par le tampon phosphate lectrophortique ( 3.2.1) pendant 3 min.
6.2 Conditions de migration
6.2.1 L'injection de l'chantillon est de type hydrostatique ; 3 s 5 kPa.
Elle est suivie d'une injection de tampon lectrophortique (3.2.1) 50 mb afin
d'amliorer la rsolution des pics (Staking).
6.2.2 Analyse.
La tension de + 30 kV, applique tout au long de la sparation, gnre un courant
de 47 A. Ces conditions sont atteintes en 20 s. La sparation est effectue une
temprature constante de 21C.
6.2.3 Rinage du capillaire
Le capillaire doit tre rinc aprs chaque analyse successivement par :
- lhydroxyde de sodium 0,1 M (3.2.3) pendant 3 min,
- l'eau ultra pure (3.1.12) pendant 3 min,
- le tampon phosphate lectrophortique (3.2.1) pendant 3 min.

7. Rsultats
A la concentration finale utilise dans l'chantillon, la prsence de DTT durant la
drivatisation permet de stabiliser les fonctions thiols instables pH alcalin et trs
facilement oxydables par les quinones, produits de l'auto-oxydation des composs
phnoliques, mais ne rompt pas les ponts disulfures. En effet, dans ces conditions
analytiques, la teneur en glutathion rduit (GSH) retrouve dans un vin additionn
ou non de glutathion oxyd (GSSG) raison de 10 mg/L est strictement
comparable (Figure 1). Cette mthode permet par consquent de doser le glutathion
sous sa seule forme rduite.

OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

Figure 1 : Mise en vidence de la stabilit des ponts disulfures dans les


conditions de drivatisation dcrites. (DTT, 0,25 mM final).

La figure 2 prsente le profil lectrophortique d'un chantillon de mot de raisin


blanc, cpage Sauvignon, dans lequel sont identifis la cystine, le glutathion, la Nactyl-cystine et le dioxyde de soufre. Le premier pic correspond aux ractifs en
excs (DTT, MBB). La sparation des thiols non volatils est effectue en moins de
20 minutes. Parmi tous les pics, seuls certains ont pu tre identifis (figure 2, A)
(Newton et al., 1981). Ces thiols, hormis le dioxyde de soufre, sont gnralement
prsents en quantits variables dans les baies de raisins (Cheynier et al., 1989), les
fruits et les lgumes (Mills et al., 2000).

Figure 2: Exemple de sparation des thiols non volatils connus dans une solution
HCl/EDTA (A) 1 et dans un mot de raisin (B): DTT ; 2 : homocystine ; 3 :
cystine ; 4 : Cys-Gly ; 5 : GSH ; 6 : g Glu-Cys ; ,7 : NAC ; 8 : SO2.
OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

Dans ces conditions analytiques, les temps de rtention des adduits MBB-RS sont
les suivants : MBB-homocystine 10,40 min; MBB-cystine 10,65 min, MBBGSH 14,14 min ; MBB-NAC 15,41min ; MBB-SO2 18,58min.
8. Caractristiques de la mthode
Certains lments de validation internes ont t dtermins mais il ne sagit pas
dune validation formelle selon le protocole pour la planification, la conduite et
linterprtation des tudes de performances des mthodes danalyse (OIV 6/2000)
Le vin est utilis comme matrice pour raliser les courbes dtalonnage et les tests
de rptabilit de chaque compos.
Chaque concentration est calcule partir de la moyenne de trois dterminations
obtenues en utilisant la droite de rgression de la courbe dtalonnage.
Les rsultats sont exprims en mg/L.
Les rgressions linaires et les coefficients de corrlation sont calculs selon la
mthode des moindres carrs. Les solutions mres des diffrents thiols sont
ralises partir dune solution dHCl/EDTA permettant de les conserver sans
perte plusieurs jours + 6C. Des dilutions successives de ces solutions permettent
destimer le seuil limite de dtection dans le vin, pour un rapport signal sur bruit
suprieur ou gal trois.

La gamme de linarit est variable selon les thiols (Tableau 1).


Tableau 1 : gamme de linarit, proprits des rgressions linaires propres
chaque thiol en solutions prpares de faon identique celle du glutathion

Homocystine
Cystine
Glutathion
N-actyl-cystine

Gamme de linarit

Rgression linaire

0 - 15 mg/l
0 - 15 mg/l
0 - 40 mg/l
0 - 10 mg/l

Y= 0.459X 0.231
Y = 0.374X 0.131
Y = 0.583X 0.948
Y = 0.256X 0.085

Coefficient de
corrlation
0,9987
0,9979
0,9966
0,9982

Les conditions danalyses permettent dliminer les interfrences provoques par


les produits dhydrolyse du MBB, contrairement ce qui est signal dans d'autres
travaux (Ivanov et al., 2000).

OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Glutathion

La rptabilit de la mthode est calcule partir de dix analyses dun mme


chantillon de vin. Pour une concentration en thiols de 10 mg/l, le coefficient de
variation est de 6,0 % pour le glutathion ; par ailleurs, il est de 3,2 % pour
lhomocystine, 4,8 % pour la cystine, et 6,4 % pour la N-actyl-cystine.
La limite de dtection du glutathion est de 20 g/l, la limite de quantification est de
60 g/l.

9. BIBLIOGRAPHIE
Noctor, G. and C. Foyer, 1998. Simultaneous measurement of foliar
glutathione, gamma-glutamylcysteine, and amino acids by high-performance
liquid chromatography: comparison with two other assay methods for
glutathione, Analytical Biochemistry, 264, 98-110.
Kosower, N.S., Kosower E. M., Newton G. L.,and Ranney H. M., 1979.
Bimane fluorescent labels: Labeling of normal human red cells under
physiological conditions. Proc. Natl. Acad. Sci., 76 (7), 3382-3386.
Newton, G.L., R. Dorian, and R.C. Fahey, Analysis of biological thiols:
derivatisation with monobromobimane and separation by reverse-phase highperformance liquid chromatography. Anal. Biochem., 1981. 114: p. 383-387.
Cheynier, V., J.M. Souquet, and M. Moutounet, 1989. Glutathione content and
glutathione to
hydroxycinnamique acid ration in Vitis vinifera grapes and musts. Am.
J.Enol.Vitic,. 40 (4), 320-324.
Mills, B.J., Stinson C. T., Liu M. C. and Lang C. A., 1997. Glutathione and
cyst(e)ine profiles of vegetables using high performance liquid chromatography
with dual electrochemical detection. Journal of food composition and analysis,
10, 90-101.
Ivanov, A.R., I.V. Nazimov, and L. Baratova, 2000. Determination of
biologically active low molecular mass thiols in human blood. Journal of
Chromatogr. A,. 895, 167-171.

OIV-MA-AS315-19 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Mthode OIV-MA-AS315-20

Mthode Type IV

Mthode de dtermination des composes -dicarbonyls du


vin par HPLC aprs drivation par le 1,2-diaminobenzene
(OIV-Oeno 386A-2010)
1. Introduction
Les principaux composs -dicarbonyls du vin (Figue 1) sont : glyoxal,
mthylglyoxal, diactyle et pentane-2,3-dione, seules les -dictones sont
assez abondantes dans le vin. Les composs carbonyls existent dans tous
les types de vins et particulirement aprs la fermentation malolactique et
dans les vins rouges. De plus, des vins blancs doux produits partir de
raisins botrytiss peuvent contenir des niveaux de glyoxal et de
mthylglyoxal levs.
Glyoxal : OCHCHO (thanedial)
Mthylglyoxal : CH3COCHO (2-oxopropanal)
Diactyle : CH3COCOCH3 (butane-2,3-dione)
Pentane-2,3-dione : CH3CH2COCOCH3
Hexane-2,3-dione : CH3CH2CH2COCOCH3
Figure 1. Les principaux composs -dicarbonyls du vin, (l'hexane-2,3dione n'est pas naturellement prsente dans le vin mais elle est utilise
comme talon interne).
Les composs dicarbonyls sont importants dans le vin pour des raisons
diffrentes : impact sensoriel, ractivit avec d'autres composants du vin ou
possibles effets microbiologiques.

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

2. Domaine d'application
Cette mthode s'applique tous types de vins (blancs, rouges, sucrs ou
fortifis),.pour des composs dicarbonyls dont la teneur est comprise entre
0,05 mg/L et 20 mg/L
3. Principe
La mthode est base sur la formation de drivs de type quinoxaline
partir des composs -dicarbonyls du vin avec le 1,2-Diaminobenzne
(figure 2).
R
NH2

O C

+
NH2

1,2-Diaminobenzne

O C

Dicarbonyle

Quinoxaline

Figure 2 Formation des drivs.


La raction a lieu directement dans le vin pH 8 et aprs une dure de
raction de 3 h 60 C. L'analyse des drivs est ensuite effectue
directement par chromatographie en phase liquide haute performance
(HPLC) et dtection par absorptiomtrie UV 313 nm.
4. Ractifs et produits
4.1 Composs dicarbonyls
4.1.1 Glyoxal (N CAS 107-22-3) en solution 40 %
4.1.2 Mthylglyoxal (N CAS 78-98-8) en solution 40 %
4.1.3 Diactyle (N CAS 431-03-8) de puret > 99 %
4.1.4 Pentane-2,3-dione (N CAS 600-14-6) de puret > 97 %
4.1.5 Hexane-2,3-dione (N CAS 3848-24-6) de puret > 90 %
4.2 1,2-Diaminobenzne (N CAS 95-54-5) sous forme de poudre,
de puret > 97 %
4.3 Eau pour HPLC (par exemple microfiltre et de rsistivit de 18,2 M)
4.4 Ethanol (N CAS 64-17-5) pur pour HPLC
4.5 Hydroxyde de sodium (N CAS 1310-73-2) en solution M
4.6 Acide actique (N CAS 64-19-7) pur cristallisable
OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

4.7 Solvant A pour l'analyse par HPLC


Dans 1 L d'eau pour HPLC (4.3) rajouter 0,5 ml d'acide actique
(4.6), mlanger, dgazer (par exemple par ultrasons)
4.8 Solvant B pour HPLC
Mthanol (N CAS 67-56-1) pur HPLC
4.9 Solution hydroalcoolique 50 % vol.
Mlanger 50 ml d'thanol pur pour HPLC (4.4) avec 50 ml d'eau
(4.3)
4.10 Solution d'talon interne hexane-2,3-dione 2,0 g/L
Placer 40 mg d'hexane-2,3-dione (4.2) dans un flacon de 30 ml,
diluer dans 20 ml de solution hydroalcoolique 50 % vol (4.9) agiter
jusqu' dissolution complte.
5. Appareillage
5.1 Chromatographie en phase liquide haute performance avec dtection
par absorptiomtrie UV (313 nm).
5.1.1 Colonne analytique remplie de silice greffe par des radicaux
octadcyle de 5 m dont les dimensions sont par exemple 250 mm x
4,6 mm.
5.1.2 Systme d'acquisition des donnes.
5.2 Appareil de mesure du pH
5.3 Agitateur magntique
5.4 Balance de prcision 0,1 mg.
5.5 Systme de dgazage des solvants pour HPLC (par exemple appareil
ultrasons)
5.6 Four pouvant tre rgl 60 C
5.7 Verrerie courante de laboratoire dont pipettes, flacons vis de 30 ml et
microseringues.
6. Prparation de l'chantillon
Aucune prparation spcifique n'est requise
7. Mode opratoire
Placer 10 ml de vin dans un flacon de 30 ml (5.7.)
Amener pH 8 sous agitation, avec de l'hydroxyde de sodium M (4.5)
Ajouter 5 mg de 1,2-diaminobenzne (4.2)
Ajouter 10 l d'hexane-2,3-dione (talon interne) 2,0 g/L (4.10)
Fermer le flacon l'aide d'un bouchon vis muni d'un joint face tflone
Agiter jusqu' disparition complte du ractif (5.3)
Placer dans le four 60 C pendant 3 h (5.6)
OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Refroidir.
7.1 Optimisation et conditions analytiques
Le rendement de la raction des composs dicarbonyls avec le 1,2diaminobenzne est optimal pH 8. Des solutions de composs
dicarbonyls ont t drivs 25, 40 ou 60 C puis analyss par HPLC selon
le protocole dcrit au point 7.2 des moments diffrents (tableau 1). Les
dictones ncessitent beaucoup plus de temps de raction et une temprature
de raction plus leve. La raction est plus lente avec les molcules plus
longue chane (la pentane-2,3-dione et l'hexane-2,3-dione).
Par ailleurs, aucune interfrence du SO2 avec la formation des quinoxalines
n'a t note lors de l'tude de la mthode.
Tableau 1. Effet du temps de raction et de la temprature sur le rendement
de drivs par le 1,2-diaminobenzne du glyoxal, du diactyle et de
l'hexane-2,3-dione
Temps de raction
1h
2h
3h
Temprature (C) Taux de rcupration (%)
Glyoxal

25
40
60

92
95
96

93
97
98

94
98
100

Diactyle

25
40
60

23
64
85

77
89
100

87
94
100

Hexane-2,3-dione

25
40
60

17
55
69

67
79
93

79
88
100

7.2 Analyse par HPLC


- Injection. Aprs refroidissement, le milieu ractionnel contenant les
quinoxalines est directement inject raison de 20 l dans le systme
HPLC.
- Programme d'lution. Pour la sparation, le programme d'lution est
prsent dans le tableau Tableau 2

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Tableau 2. Programme d'lution de l'analyse par HPLC


Temps en minutes
0
8
26
30
32
40
45
50

solvant A
80
50
25
0
0
100
80
80

solvant B
20
50
75
100
100
0
20
20

Le dbit tant de 0,6 ml/min


- Sparation. Le chromatogramme obtenu par HPLC est indiqu dans la
Figure 3.
- Dtection. Le maximum d'absorption a t tudi pour tous les composs
dicarbonyls drivs et fix 313 nm comme tant optimal.
- Identification des drivs. L'identification des drivs a t ralise par
comparaison des temps de rtention avec des solutions de rfrence talons.
Les conditions chromatographiques permettent une bonne sparation des
pics dans tous les vins.
7.2.1Caractristiques de la mthode par HPLC
Certains lments de validation interne ont t dtermins mais il ne sagit
pas dune validation formelle selon le protocole pour la planification, la
conduite et linterprtation des tudes de performances des mthodes
danalyse (OIV 6/2000)
- Rptabilit. La rptabilit de la mthode a t calcule partir de 10
analyses du mme vin (tableau 3).

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Tableau 3. tude de rptabilit et performance de la mthode


Moyenne*

cart type

CV (%)

Vin blanc
Glyoxal
Mthylglyoxal
Diactyle
Pentane-2,3-dione

4,379
2,619
5,014
2,307

0,101
0,089
0,181
0,097

2,31
3,43
3,62
4,21

Vin rouge
Glyoxal
Mthylglyoxal
Diactyle
Pentane-2,3-dione

2,211
1,034
1,854
0,698

0,227
0,102
0,046
0,091

10,30
9,91
2,49
13,09

*Rsultats en mg/l partir de 10 analyses du mme vin.


- Linarit. La linarit de la mthode a t teste en utilisant des solutions
standards (solution hydroalcoolique 12 % vol. comme matrice) (Tableau
4). L'analyse quantitative des ajouts de composs dicarbonyls a montr que
la mthode est linaire pour les quatre composs avec une prcision
satisfaisante.
Tableau 4. tude de la linarit et essais de rcupration avec des solutions
standard (eau-thanol 12 % v/v) valeur du coefficient de corrlation
Glyoxal

Mthylglyoxal

Diactyle

Pentane-2,3dione

R = 0,992

R = 0,997

R = 0,999

R = 0,999

- Le taux de rcupration des ajouts effectus en vins rouges et blancs ont


dmontr la bonne performance de la mthode Compris entre 92 % et 116 %
pour les valeur extrmes
- La limite de quantification des composs dicarbonyls est trs basse, les
meilleurs rsultats tant obtenus avec le diactyle dont la limite de dtection
est 10 fois plus faible que celle des autres composs (tableau 5).

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Tableau 5. Performance de la mthode par HPLC pour la quantification des


composs dicarbonyls
Limites
quantificationa
Glyoxal
Mthylglyoxal
Diactyle
Pentane-2,3-dione

0,015
0,015
0,002
0,003

dtectiona

dterminationa

0,020
0,020
0,002
0,004

0,028
0,027
0,003
0,006

a : rsultats en mg/l, en solution hydroalcoolique (10 % vol).

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Figure 3. Chromatogramme en phase liquide haute performance des


composs dicarbonyls drivs par le 1,2-diaminobenzne d'un vin blanc,
dtects en UV 313 nm Colonne Sperisorb ODS 250 mm x 4,6 mm x 5
m.

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par HPLC

Bibliographie
Bartowski E.J.and Henschke P.A. The buttery attribute of wine diacetyl
desirability spoilage and beyond. Int. j.food microbial. 96 : 235-252 (2004).
Bednarski W, Jedrychowski L, Hammond E and Nikolov L, A method for
determination of -dicarbonyl compounds. J Dairy Sci 72:2474-2477
(1989).
Leppannen O, Ronkainen P, Koivisto T and Denslow J, A semiautomatic
method for the gas chromatographic determination of vicinal diketones in
alcoholic beverages. J Inst Brew 85:278- 281 (1979).
Martineau B, Acree TE and Henick-Kling T, Effect of wine type on the
detection threshold for diacetyl. Food Res Int 28:139-143 (1995).
Moree-Testa P and Saint-Jalm Y, Determination of -dicarbonyl
compounds in cigarette smoke. J Chromatogr 217:197-208 (1981).
de Revel G Pripis-Nicolau L. Barbe J.-C; and Bertrand A, The detection of
-dicarbonyl compounds in wine:by ,formation of quinoxaline derivatives. J
Sci. Food Agric.80:102-108 (2000).
de Revel G and Bertrand A, Dicarbonyl compounds and their reduction
products in wine. Identication of wine aldehydes. Proc 7th Weurman
Flavour Research Symp, Zeist, June, pp 353-361 (1994).
de Revel G and Bertrand A, A method for the detection of carbonyl
compounds in wine: glyoxal and methylglyoxal. J Sci. Food Agric 61:267272 (1993).
Voulgaropoulos A, Soilis T and Andricopoulos N, Fluorimetric
determination of diacetyl in wines after condensation with 3,4diaminoanisole. Am J Enol Vitic 42:73-75 (1991).
Gilles de Revel et Alain Bertrand analyse des composes -dicarbonyles du
vin aprs drivation par le 1,2-diaminobenzene OIV FV 1275

OIV-MA-AS315-20 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

Mthode OIV-MA-AS315-21

Mthode Type IV

Mthode de dtermination des composes -dicarbonyls du


vin par chromatographie en phase gazeuse aprs drivation
par le 1,2-diaminobenzene
(OIV-Oeno 386B-2010)

1. Introduction
Les principaux composs -dicarbonyls du vin (Figue 1) sont : glyoxal,
mthylglyoxal, diactyle et pentane-2,3-dione, seules les -dictones sont
assez abondantes dans le vin. Les composs carbonyls existent dans tous
les types de vins et particulirement aprs la fermentation malolactique et
dans les vins rouges. De plus, des vins blancs doux produits partir de
raisins botrytiss peuvent contenir des niveaux de glyoxal et de
mthylglyoxal levs.
Glyoxal : OCHCHO (thanedial)
Mthylglyoxal : CH3COCHO (2-oxopropanal)
Diactyle : CH3COCOCH3 (butane-2,3-dione)
Pentane-2,3-dione : CH3CH2COCOCH3
Hexane-2,3-dione : CH3CH2CH2COCOCH3
Figure 1. Les principaux composs -dicarbonyls du vin, (l'hexane-2,3dione n'est pas naturellement prsente dans le vin mais elle est utilise
comme talon interne).
Les composs dicarbonyls sont importants dans le vin pour des raisons
diffrentes : impact sensoriel, ractivit avec d'autres composants du vin ou
possibles effets microbiologiques.

OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

2. Domaine d'application
Cette mthode s'applique tous types de vins (blancs, rouges, sucrs ou
fortifis), pour des teneurs en drivs carbonyls comprises entre 0,05 mg/L
et 20 mg/L.
3. Principe
La mthode est base sur la formation de drivs de type quinoxaline
partir des composs -dicarbonyls du vin avec le 1,2-Diaminobenzne
(figure 2).

R
NH2

O C

+
NH2

1,2-Diaminobenzne

O C

Dicarbonyle

Quinoxaline

Figure 2 Formation des drivs.


La raction a lieu directement dans le vin pH 8 et aprs une dure de
raction de 3 h 60 C. L'analyse des drivs est ensuite effectue aprs
extraction des drivs par le dichloromthane et analyse par
chromatographie en phase gazeuse avec une dtection par spectromtrie de
masse (GC-MS) ou l'aide d'un dtecteur spcifique des composs azots.
4. Ractifs et produits
4.1 Composs dicarbonyls
4.1.1 Glyoxal (n cas 107-22-3) en solution 40 %
4.1.2 Mthylglyoxal (n cas78-98-8) en solution 40 %
4.1.3 Diactyle (n cas 431-03-8) de puret > 99 %
4.1.4 Pentane-2,3-dione (n cas 600-14-6) de puret > 97 %
4.1.5 Hexane-2,3-dione (n cas 3848-24-6) de puret > 90 %
4.2 1,2-Diaminobenzne (n cas 95-54-5) sous forme de poudre,
de puret > 97 %
4.3 Eau pour HPLC (par exemple microfiltre et de rsistivit de 18,2 M)
4.4 Ethanol (n cas 64-17-5) pur pour HPLC
OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

4.5 Hydroxyde de sodium (n cas 1310-73-2) en solution M


4.6 Acide sulfurique (n cas 7664-93-9) en solution 2M
4.7 Dichloromthane (n cas 75-09-2)
4.8 Sulfate de sodium anhydre (ncas 7757-82-6)
4.9 Solution hydroalcoolique 50 % vol.
Mlanger 50 ml d'thanol pur pour HPLC (4.4) avec 50 ml d'eau (4.3)
4.10 Solution d'talon interne hexane-2,3-dione 2,0 g/L
Placer 40 mg d'hexane-2,3-dione (4.2) dans un flacon de 30 ml, diluer dans
20 ml de solution hydroalcoolique 50 % vol (4.9) agiter jusqu' dissolution
complte.
4.11 Sulfate de sodium anhydre (ncas 7757-82-6)
5. Appareillage
5.1 Chromatographie en phase gazeuse avec une dtection par spectromtrie
de masse (GC-MS) ou l'aide d'un dtecteur spcifique des composs
azots.
5.1.1 Colonne analytique capillaire polythylne glycol moyennement
polaire (C 20M, BP21 ) avec les caractristiques suivantes ( titre
d'exemple) 50 m x 0,32 mm x 0,25 m.
5.1.2 Systme d'acquisition des donnes.
5.2 Appareil de mesure du pH
5.3 Agitateur magntique
5.4 Balance de prcision 0,1 mg.
5.5 Four pouvant tre rgl 60 C
5.6 Verrerie courante de laboratoire dont pipettes, flacons vis et
microseringues.
6. Prparation de l'chantillon
Aucune prparation spcifique n'est requise
7. Mode opratoire
Placer 50 ml de vin dans un flacon (5.6)
Amener pH 8 sous agitation, avec de l'hydroxyde de sodium M (4.5)
Ajouter 25 mg de 1,2-diaminobenzne (4.2)
Ajouter 50 l d'hexane-2,3-dione (talon interne) 2,0 g/L (4.10)
Fermer le flacon l'aide d'un bouchon vis muni d'un joint face tflone.
Agiter jusqu' disparition complte du ractif (5.3)
Placer dans le four 60 C pendant 3 h (5.5)
Refroidir.
OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

7.1 Optimisation et conditions analytiques (cette tude a t effectue avec


analyse par HPLC, voir cette mthode)
Le rendement de formation des drivs des composs dicarbonyls avec le
1,2-diaminobenzne est optimal pH 8, 60 C, aprs 3 heures de raction.
Par ailleurs, aucune interfrence du SO2 avec la formation des quinoxalines
n'a t note lors de l'tude de la mthode.
7.2 Analyse par GC
7.2.1 Extraction des quinoxalines
- Le milieu ractionnel prpar en 7, est amen pH 2 l'aide de H2SO4 2M
(4.6) ;
- Extraire 2 reprises par 5 ml de dichloromthane (4.7) par agitation
magntique durant 5 minutes ;
- Dcanter la phase infrieure chaque reprise ;
- Mlanger les deux phases de solvant ;
- Scher sur 1 g environ de sulfate de sodium anhydre (4.11) ;
- Dcanter.
7.2.2 Analyse chromatographique (donne titre d'exemple)
- Dtection. Pour l'analyse par GC-MS un chromatographe en phase gazeuse
Hewlett Packard HP 5890 a t coupl avec une chemstation et un
spectromtre de masse HP 5970 (impact lectronique 70 eV, 2,7 kV),
Remarque Il est galement possible dutiliser un dtecteur spcifique des
composs azots.
- Colonne. La colonne est une BP21 (SGE, 50 m x 0,32 mm x 0,25 m).
- Tempratures. Les temprature de l'injecteur et du dtecteur sont
respectivement de 250 C et 280 C ; celle du four est maintenue 60 C
pendant 1min, puis programme raison de 2 C/min jusqu' 220 C et
l'isotherme final dure 20 min.
- Injection. Le volume inject est de 2 l et le temps de fermeture des
vannes de l'injecteur (splitless) est de 30 s.
7.2.3 Analyse des quinoxalines formes
- Sparation. Le chromatogramme des drivs par 1,2-diaminobenzne d'un
vin selon la mthode de slection d'ions (SIM) est montr la Figure 3. De
bonnes sparations ont t obtenues avec tous les types de vins (blancs,
rouges, sucrs ou fortifis) et mme de mots en fermentation.
- Identification des pics. L'utilisation de la GC-MS a permis d'identifier les
composs dicarbonyls drivs du vin en utilisant la mthode du courant
ionique total (scan) qui permet d'obtenir les spectres de masse des drivs
quinoxalines et de les comparer ceux en mmoire dans la bibliothque de
OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

spectres ; par ailleurs les temps de rtention ont t compars avec ceux de
composs purs traits de la mme manire. Le tableau 1 montre les ions
principaux des spectres de masse des composs dicarbonyls drivs
obtenus.
- Dosage. La dtermination quantitative des composs dicarbonyls est
effectue avec le mode SIM, en slectionnant des ions M / Z = 76, 77, 103,
117, 130, 144, 158 et 171. Les ions M/Z = 76 et 77 sont utiliss pour la
quantification et les autres comme qualifieurs, c'est--dire glyoxal : ions
M/Z =103 et 130, mthylglyoxal : ions M/Z =117 et 144, diactyle : ions
M/Z = 117 et 158, pentan-2,3-dione : ions M/Z = 171 et hexane-2,3-dione :
ions M/Z = 158 et 171.
7.2.4 Caractristiques de la mthode.
Certains lments de validation interne ont t dtermins mais il ne sagit
pas dune validation formelle selon le protocole pour la planification, la
conduite et linterprtation des tudes de performances des mthodes
danalyse (OIV 6/2000)
- Rptabilit. La rptabilit de la mthode par GC-MS-SIM. montre des
coefficients de variation compris entre 2 et 5 % pour les quatre composs
dicarbonyls ;
- Taux de rcupration. Les quantits ajoutes un vin ont t retrouves
avec un taux de rcupration variant de 92 117 %
- Linarit. Des corrlations linaires ont t obtenues dans des domaines de
concentration compris entre 0,05 20 mg/l.
- Limite de dtection. La limite de dtection de la plupart des produits
dicarbonyls drivs en utilisant le vin comme matrice est de 0,05 mg/l

OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

Tableau 1. Spectres de masse [ion m/z (intensit de lion molculaire


relative celle du pic de base)] des drivs de composs dicarbonyls par le
1,2-diaminobenzne
Compos
dicarbonyl

Driv

Spectre de masse (principaux


ions et abondance)

Glyoxal

Quinoxaline

130 (100), 103 (56.2), 76(46.8),


50 (20.2),
75 (10.4), 131 (9.4)

Mthylglyoxal

2-Mthylquinoxaline

144 (100), 117 (77.8),


76 (40.5), 77 (23.3),
50 (21.9), 75 (11.3),
145(10.3)

Diactyle

2,3-Dimthylquinoxaline

117 (100), 158 (75.6),


76 (32.3), 77 (23.1),
50 (18.3), 75 (10.4)

Pentane-2,3-dione

2-Ethyl-3-mthylquinoxaline 171 (100), 172 (98), 130


(34.1), 75 (33.3),
77 (21), 50 (19.4), 144
(19), 143 (14.1),
103 (14)

Hexane-2,3-dione

2,3-Dithylquinoxaline

OIV-MA-AS315-21 : 2010

158 (100), 171 (20.1),


76 (13.7), 77 (12.8),
159 (11.4), 157 (10.8),
50 (8.1)

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

Figure 3. Chromatogramme en phase gazeuse de l'extrait des composs


dicarbonyls drivs par le 1,2-diaminobenzne d'un vin blanc, dtects en
spectromtrie de masse en choisissant les ions m/z =76, 77, 103, 117, 130,
131, 144, 158, 160 et 171. Colonne BP21, 50 m , 0,32 mm, 0,25 m
temprature de four 60 C pendant 1min, puis programmation 2 C/min
jusqu' 220 C. temprature de l'injecteur : 250 C.
1. glyoxal ; 2. mthylglyoxal ; 3. diactyle ; 4. pentane-2,3-dione ; 5.
hexane-2,3-dione (talon interne) ; 6. phnylglyoxal (non tudi dans cette
mthode).

OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


-dicarbonyls du vin par GC

Bibliographie
Bartowski E.J.and Henschke P.A. The buttery attribute of wine diacetyl
desirability spoilage and beyond. Int. j.food microbial. 96 : 235-252 (2004).
Bednarski W, Jedrychowski L, Hammond E and Nikolov L, A method for
determination of -dicarbonyl compounds. J Dairy Sci 72:2474-2477
(1989).
Leppannen O, Ronkainen P, Koivisto T and Denslow J, A semiautomatic
method for the gas chromatographic determination of vicinal diketones in
alcoholic beverages. J Inst Brew 85:278- 281 (1979).
Martineau B, Acree TE and Henick-Kling T, Effect of wine type on the
detection threshold for diacetyl. Food Res Int 28:139-143 (1995).
Moree-Testa P and Saint-Jalm Y, Determination of -dicarbonyl
compounds in cigarette smoke. J Chromatogr 217:197-208 (1981).
de Revel G Pripis-Nicolau L. Barbe J.-C; and Bertrand A, The detection of
-dicarbonyl compounds in wine:by ,formation of quinoxaline derivatives. J
Sci. Food Agric.80:102-108 (2000).
de Revel G and Bertrand A, Dicarbonyl compounds and their reduction
products in wine. Identication of wine aldehydes. Proc 7th Weurman
Flavour Research Symp, Zeist, June, pp 353-361 (1994).
de Revel G and Bertrand A, A method for the detection of carbonyl
compounds in wine: glyoxal and methylglyoxal. J Sci. Food Agric 61:267272 (1993).
Voulgaropoulos A, Soilis T and Andricopoulos N, Fluorimetric
determination of diacetyl in wines after condensation with 3,4diaminoanisole. Am J Enol Vitic 42:73-75 (1991).
Gilles de Revel et Alain Bertrand analyse des composs -dicarbonyls du
vinaprs drivation par le 1,2-diaminobenzne OIV FV 1275

OIV-MA-AS315-21 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

Mthode OIV- -MA-AS315-22

Type de mthode : IV

Dosage de la carboxymethylcellulose (gomme de cellulose,


CMC) dans les vins blancs
(OIV-Oeno 404-2010)

1.

Introduction

La carboxymthylcellulose (CMC, gomme de cellulose) est un polymre


driv de la cellulose naturelle, utilis couramment depuis de nombreuses
annes en tant quadditif alimentaire (INS 466) dans des produits tels que
les crmes glaces ou les plats cuisins [1], pour leur donner de lonctuosit.
Lutilisation de CMC dans les vins blancs et les vins mousseux en vue de
participer leur stabilisation tartrique [2] a t rcemment admise par lOIV
dans la rsolution Oeno 2/2008 sous rserve que la dose additionne au vin
soit infrieure 100 mg/l. Une mthode de dosage spcifique de la CMC
dans le vin blanc a donc t dveloppe partir de la mthode de H.D
Graham publie en 1971 [3].
2.

Domaine dapplication

La mthode sapplique aux vins blancs (tranquilles et mousseux).


3.

Principe

Une fois la CMC isole du vin par dialyse, elle est hydrolyse en milieu
acide pour former de lacide glycolique qui est ensuite dgrad pour former
du formaldhyde. Le 2,7-Dihydroxynaphtalne (DHN) est ajout pour
former le 2,2,7,7-tetrahydroxydinaphtylmethane en prsence de
formaldhyde. Le complexe form dveloppe une couleur violace sous
laction de lacide sulfurique concentr, 100C, permettant une mesure
colorimtrique 540nm. (figure 1)
OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

H2SO4 concentr chaud

H2SO4 concentr chaud

H2SO4 concentr

Probable forme quinoidol de E


(couleur pourpre)

Figure1 : Mcanisme de raction de la CMC avec le DHN dans lacide


sulfurique concentr chaud
(Feigl, 1966)

4.

Ractifs

OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

Carboxymthylcellulose sodique [N CAS:9004-32-4] - viscosit


moyenne 400-1000 mPa.s, degr de substitution 0,60-0,95)
2,7-Dihydroxynaphtalne [N CAS 582-17-2] (puret > 98,0% CLHP)
Acide sulfurique concentr 95%
Eau purifie pour laboratoire, (par exemple de qualit EN ISO 3696)
5.

Matriel

6.

Verrerie de laboratoire
Membrane de dialyse (6000 8000 Da)
Bain Thermostat
Spectrophotomtre UV-Visible double faisceau
Mode opratoire

6.1 Prparation du ractif


Mettre 50 mg DHN pes au mg prs dans une fiole jauge de
100mL
Ajouter lacide sulfurique concentr jusquau trait de jauge
Placer la fiole jauge au bain thermostat 28C pendant 4h (sans
agiter)
Transvaser le ractif, aprs chauffage, dans un flacon brun et le
stocker au rfrigrateur 4C
6.2 Prparation des chantillons de vin
Introduire 20mL de vin pralablement dgaz dans la membrane de
dialyse
Placer la membrane de dialyse contenant le vin dans un ballon de 6
litres rempli deau distille
Laisser dialyser 24h en effectuant 2 changements deau de dialyse
6.3 Raction colore
Mettre 1mL de vin dialys dans un tube essais
Ajouter 9mL de ractif
Placer le tube essais au bain thermostat 100C pendant 2h

OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

Analyser la solution colore au spectrophotomtre UV-Visible


540nm et lire la valeur de labsorbance
6.4 Calcul de la teneur en CMC du vin
Reporter la valeur de labsorbance lue en 6.3 sur une droite
dtalonnage obtenue partir dun vin (figure 2).
7.

Caractristiques de la mthode

Certains lments de validation interne ont t dtermins mais il ne sagit


pas dune validation formelle selon le protocole pour la planification, la
conduite et linterprtation des tudes de performances des mthodes
danalyse (OIV 6/2000)
7.1 Linarit de la rponse
Un vin blanc a t additionn de quantits croissantes de CMC comprises
entre 0 et 100 mg/L, puis dialys et trait dans les conditions dfinies dans
le mode opratoire ci-dessus. La rponse est linaire dans le domaine de
concentrations tudi (figure 2).

Figure 2 : Linarit du dosage de la CMC dans un vin blanc

OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

7.2 Rptabilit
La rptabilit du dosage de la CMC dans les vins blancs a t dtermine
partir des rsultats obtenus sur 22 chantillons de vins analyss 2 fois de
suite, de faon tre dans des conditions identiques. Les rsultats sont
donns dans le tableau 1.
valeurs calcules
rptabilit
cart-type
CV en %
limite r
limite r en %

0,075
7,2 %
0,21
20 %

Tableau 1: Rptabilit du dosage de la CMC dans les vins blancs


7.3 Reproductibilit
La reproductibilit du dosage de la CMC dans les vins blancs a t
dtermine en analysant le mme vin blanc trait la CMC 12 fois
diffrentes dates. Les rsultats sont donns dans le tableau 2.
valeurs calcules
rproductibilit
cart-type
CV en %
limite R
limite R en %

0,082
9,6 %
0,23
27 %

Tableau 2 : Reproductibilit du dosage de la CMC dans les vinsblancs

7.4 Spcificit
OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

La spcificit du dosage de la CMC a t vrifie en ajoutant dans


des vins blancs des quantits connues de CMC. Les taux de rcupration
mesurs sont donns dant le tableau 3.

Echantillon Teneur ajoute


Teneur
(mg/l)
retrouve (mg/l)

Taux de
rcupration

Vin 1

50

33

66 %

Vin 1

50

51

102 %

Vin 1

50

24

77 %

Vin 2

75

78

104 %

Vin 2

75

90

121 %

Vin 2

75

69

92 %

Vin 3

100

109

109 %

Vin 3

100

97

97 %

Vin 3

100

103

103 %

Vin 4

150

163

109 %

Vin 4

150

149

100 %

Vin 4

150

159

106 %

Tableau 3 : Spcificit du dosage de la CMC dans les vins blancs

7.4 Limites de dtection et de quantification

OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Carboxymethylcellulose dans les vins blancs

Les limites de dtection (LD) et de quantification (LQ) ont t calcules


partir du vin non trait analys 10 fois. La limite de dtection ainsi
dtermine est de 14 mg/l et la limite de quantification est de 61 mg/l.
La mthode permet donc de dtecter une addition de CMC dans un vin
blanc partir de 20 mg/l et de quantifier cet ajout au-del de 60 mg/l, ce qui
nest pas trs satisfaisant mais reste compatible avec la dose maximale
autorise de 100 mg/l.
7.5 Incertitude
Lincertitude a t calcule 3 niveaux de concentration (25, 75 et 150
mg/l) partir des rsultats danalyse de vins traits par la CMC, en utilisant
lcart-type de reproductibilit. Lincertitude obtenue est de 40 mg/l quelle
que soit la teneur en CMC.
8.

Bibliographie

[1] Rglement (CE) N 1333/2008 du 16 dcembre 2008 sur les additifs


alimentaires.
[2] Stabilisation tartrique des vins par la carboxymthylcellulose - Bulletin
de lOIV 2001, vol 74, n841-842, p151-159.
[3] Determination of carboxymethycellulose in food products - H.D
Graham, Journal of food science 1971, p 1052-1055

OIV-MA-AS315-22 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Mthode OIV- -MA-AS315-23

Type de mthode : critres

Critres pour les mthodes de quantification des rsidus


potentiellement allergniques de protines de collage
dans le vin
(OIV-Oeno 427-2010)
1

Dfinitions des critres des mthodes

Justesse

troitesse de laccord entre la valeur moyenne obtenue


partir dune grande srie de rsultats dessais et la
valeur de rfrence accepte

r=

Limite de rptabilit : valeur en dessous de laquelle on


peut estimer que se situe la diffrence absolue entre
deux rsultats dessais uniques, obtenus dans des
conditions de rptabilit (c.--d. mme chantillon,
mme oprateur, mme appareillage, mme laboratoire,
et court intervalle de temps) avec une probabilit
spcifique (en gnral 95%), d'o r = 2,8 x sr.

Sr =

cart type calcul partir des rsultats produits dans


des conditions de rptabilit.

RSDr=

cart type relatif calcul partir des rsultats produits


dans des conditions de rptabilit [(Sr/ x ) x 100], o x
est la moyenne des rsultats de tous les laboratoires et
chantillons.

R=

Limite de reproductibilit : valeur en dessous de


laquelle on peut estimer que se situe la diffrence
absolue entre des rsultats dessais uniques obtenus
dans des conditions de reproductibilit (c.--d. sur un
matriel identique, par des oprateurs travaillant dans
des laboratoires diffrents et utilisant la mthode d'essai
normalise) avec une certaine probabilit (en gnral
95%) ; R = 2,8 x sR.

OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

SR =

cart type calcul partir des rsultats produits dans


des conditions de reproductibilit.

RSDR =

cart type relatif calcul partir des rsultats produits


dans des conditions de reproductibilit [(SR/ x x 100]

HoR =

Valeur HORRAT : valeur RSDR observe, divise par


la valeur RSDR calcule l'aide de l'quation de
Horwitz [1].

B0 =

Moyenne du Blanc

LOD =

Limite de detection, calcule en tant que LOD = B0 +


3*Sr(B0)

LOQ =

Limite de quantification, calcule en tant que LOD =


B0 + 10*Sr(B0)

2. Aspects gnraux
Exigences
La mthode d'analyse doit tre associe aux pratiques nologiques
spcifiques
Additifs ou auxiliaires technologiques contenant des protines
allergniques
Chaque produit doit tre caractris du point de vue chimique et le contrle
qualit est strictement ncessaire
Classe des mthodes analytiques
D'une manire gnrale, les mthodes immunoenzymatiques sont
considres comme les plus appropries et les plus faciles mettre en uvre
pour le contrle de routine des allergnes.
La dtermination des rsidus de protines de collage allergniques dans
les vins peut utiliser des mthodes ELISA sandwich, Comptitives,
Directes ou Indirectes.

OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Si aucun anticorps enzymatique nest disponible, un mlange


danticorps biotinyls et un conjugu avidine-HRP peut tre utilis
pour la dtection
Anticorps
Caractrisation des anticorps (valuation de la dtection des
allergnes reconnus forte ou faible affinit)
Spcificit leve pour les auxiliaires technologiques du commerce
(caractriss comme indiqu ci-dessus)
Caractrisation de l'activit croise en tenant compte des protines
gnralement utilises dans les pratiques nologiques
Capacit de dtecter des drivs d'allergnes rsultant de traitements
nologiques (protolyse ou molcules modifies)
Mthode
Les anticorps doivent avoir des proprits de liaison optimales dans
des chantillons de vin
Les mthodes doivent avoir des performances optimales dans des
chantillons de vin ayant des caractristiques chimiques diffrentes
(pH et extrait sec, vin rouge et vin blanc, etc.)
Les rsultats avec des vins provenant de zones gographiques
diffrentes (mme en cas d'application de pratiques nologiques
diffrentes) doivent tre comparables
Les proprits de liaison des anticorps doivent tre optimales par
rapport diffrentes conditions de maturation du vin (temps,
tempratures, changements de couleur, etc.)
3. Type de mthodes
Il n'est pas encore prescrit de mthodes spcifiques de dtermination des
protines de collage dans le vin. Plusieurs mthodes ELISA sont dj
disponibles et peuvent tre appliques.
Les laboratoires devront utiliser une mthode valide en fonction des
exigences de l'OIV et rpondant aux critres de performance noncs dans
le tableau 1. Dans la mesure du possible, la validation comprendra un
matriau de rfrence certifi parmi les matriaux de lessai collaboratif.
OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Dans le cas contraire, une valuation alternative de la justesse devra tre


effectue.

PROTOCOLE GENERAL DE LA METHODE ELISA


DIRECTE ET INDIRECTE
La mthode directe, en une tape, utilise uniquement un anticorps
conjugu qui est soumis incubation avec lantigne contenu dans
lchantillon/larfrenceetlilasurface,
La mthode indirecte en deux tapes utilise un anticorps secondaire
conjugu pour la dtection. En premier lieu, lanticorps primaire est
incubaveclantignecontenudanslchantillon/larfrenceetliau
puits. Cette opration est suivie dune incubation avec lanticorps
secondaireconjuguquireconnatlanticorpsprimaire.
Direct
1. Prparer une surface sur laquelle est li lantigne de
lchantillon
2. Bloquer tous les sites de liaison non spcifiques sur la surface.
3. Appliquer les anticorps lis des enzymes qui se lient
spcifiquement lantigne.
4. Rincer la plaque de faon liminer les anticorps en excs (non
lis lantigne).
5. Ajouter une substance chimique qui sera convertie par l'enzyme
en couleur, fluorescence ou en signal lectrochimique
6. Mesurer l'absorbance, la fluorescence ou le signal
lectrochimique (le courant) des puits de la plaque, afin de
dterminer la prsence et la quantit d'antigne
Avant l'analyse, les prparations d'anticorps doivent tre purifies et
conjugues.

OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Indirect
1. Prparer une surface sur laquelle est li lantigne de
lchantillon
2. Bloquer tous les sites de liaison non spcifiques sur la surface.
3. Appliquer les anticorps primaires lis des enzymes qui se lient
spcifiquement lantigne.
4. Rincer la plaque de faon liminer les anticorps primaires en
excs (non lis lantigne).
5. Appliquer les anticorps secondaires lis l'enzyme qui sont
spcifiques des anticorps primaires.
6. Rincer la plaque, de faon liminer les anticorps conjugus
lenzyme en excs (non lis).
7. Ajouter une substance chimique qui sera convertie par l'enzyme
en couleur, fluorescence ou en signal lectrochimique
8. Mesurer l'absorbance, la fluorescence ou le signal
lectrochimique (le courant) des puits de la plaque, afin de
dterminer la prsence et la quantit d'antigne
Avant l'analyse, les deux prparations d'anticorps doivent tre purifies et
l'une d'elle conjugue.

Figure 1: ELISA direct et indirect


Pour la plupart des applications, une plaque microtitre en polystyrne
hautes capacits de liaison convient parfaitement ; consulter cependant les
instructions du fabricant pour dterminer le type de plaque le plus appropri
pour la liaison de lantigne donn.
OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Le principal avantage de la mthode ELISA directe et indirecte est sa grande


sensibilit obtenue par la mise en place par un procd relativement simple
avec des chances rduites de liaisons non-spcifiques. Toutefois, elle ne
sapplique que dans les cas de figures qui contiennent des niveaux peu
levs de protine non-antigne.

PROTOCOLE GENERAL DE LA METHODE ELISA


COMPETITIVE
Letermecomptitifdcritdesessaisolamesureimpliquela
quantificationdunesubstanceselonsacapacitinterfreravecun
systmetabli.Ladtectionpeutsefairedirectement,selonlamthode
enunetape,ouindirectement,selonlamthodeendeuxtapes.
Direct
1. Prparer une surface laquelle est lie une quantit connue de
l'antigne voulu
2. Bloquer tous les sites de liaison non spcifiques sur la surface
3. Appliquer l'chantillon (antigne) ou la rfrence et les anticorps lis
des enzymes qui se lient spcifiquement lantigne sur une
microplaque revtue. Les antignes immobiliss la surface et les
antignes en solution entrent en comptition pour les anticorps.
Ainsi, plus il y aura d'antigne dans l'chantillon, moins l'anticorps
pourra se lier l'antigne immobilis
4. Rincer la plaque de faon liminer les anticorps en excs (non lis)
et les complexes anticorps-antignes non lis
5. Ajouter une substance chimique qui sera convertie par l'enzyme en
couleur, fluorescence ou en signal lectrochimique
6. Mesurer l'absorbance, la fluorescence ou le signal lectrochimique
(le courant) des puits de la plaque, afin de dterminer la prsence et
la quantit d'antigne
Avant l'analyse, les prparations d'anticorps doivent tre purifies et doivent
tre conjugues..
OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Indirect
1. Prparer une surface laquelle est lie une quantit connue
d'antigne
2. Bloquer tous les sites de liaison non spcifiques sur la surface
3. Appliquer l'chantillon (antigne) ou la rfrence et les anticorps
lis des enzymes quiselientspcifiquementlantignesurune
microplaque revtue.Lesantignesimmobilisslasurfaceetles
antignesensolutionentrentencomptitionpourlesanticorps.
Ainsi plus il y aura d'antigne dans l'chantillon, moins l'anticorps
pourra se lier l'antigne immobilis.
4. Rincer la plaque de faon liminer les anticorps en excs (non lis)
et les complexes anticorps-antignes non lis
5. Ajouter un anticorps secondaire, spcifique l'anticorps primaire,
conjugu avec une enzyme
6. Rincer la plaque de faon liminer les anticorps conjugus en
excs (non lis)
7. Ajouter une substance chimique qui sera convertie par l'enzyme en
couleur, fluorescence ou en signal lectrochimique
8. Mesurer l'absorbance, la fluorescence ou le signal lectrochimique
(le courant) des puits de la plaque, afin de dterminer la prsence et
la quantit d'antigne
Avant l'analyse, les deux prparations d'anticorps doivent tre purifies et
l'une d'elle doit tre conjugue..

Figure 2: ELISA Competitive direct et indirect


OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Pour l'ELISA comptitive, plus la concentration initiale d'antigne est


leve, plus le signal ventuel est faible.
Pour la plupart des applications, une microplaque haute capacit de liaison
est ce quil y a de mieux, toutefois, consulter les directives du fabricant pour
dterminer quel type de plaque convient le mieux pour lier l'antigne
considr
ProtocolegnralpourlamthodeELISASandwich
LamthodeELISAsandwichmesurelaquantitdantignesentredeux
couches danticorps (cestdire les anticorps de capture et de
dtection). Lantigne mesurer doit contenir au moins deux sites
antigniques (pitopes) diffrents pour lier deux anticorps diffrents.
Lesanticorpsmonoclonauxetpolyclonauxpeuventtreutiliss.

Direct
1.
2.
3.
4.
5.
6.
7.
8.

Prparer une surface sur laquelle est lie lanticorpsdecapture


Bloquer tous les sites de liaison non spcifiques sur la surface
Appliquerlestandardoulchantilloncontenantlantigne
Laverlaplaqueafind'liminerlesmolculesnonreconnuespar
l'anticorpsdecapture
Ajouter des anticorps lislenzyme(anticorpsdedtection)qui
selientspcifiquementlantigne
Rincer la plaque de faon liminer les anticorps lislenzymeen
excs (non lis)
Ajouter une substance chimique qui sera convertie par l'enzyme en
couleur, fluorescence ou en signal lectrochimique
Mesurer l'absorbance, la fluorescence ou le signal lectrochimique
(le courant) des puits de la plaque, afin de dterminer la prsence et
la quantit d'antigne

Avant l'analyse, les deux prparations d'anticorps doivent tre purifies et


l'une d'elle doit tre conjugue.
OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Indirect
1.
2.
3.
4.

Prparer une surface laquelle est lie lanticorpsdecapture


Bloquer tous les sites de liaison non spcifiques sur la surface
Appliquerlchantilloncontenantlantigne
Laverlaplaqueafind'liminerlesmolculesnonreconnuespar
l'anticorpsdecapture

5. Ajouter les anticorps primaires qui se lient spcifiquement


lantigne
6. Rincer la plaque de faon liminer les anticorps primaires en excs
(non lis)
7. Ajouter des anticorps lislenzyme(anticorpssecondaires)qui
selientspcifiquementlanticorpsprimaire.
8. Rincer la plaque de faon liminer les anticorps lislenzymeen
excs (non lis)
9. Ajouter une substance chimique qui sera convertie par l'enzyme en
couleur, fluorescence ou en signal lectrochimique
10. Mesurer l'absorbance, la fluorescence ou le signal lectrochimique
(le courant) des puits de la plaque, afin de dterminer la prsence et
la quantit d'antigne
Avant l'analyse, les deux prparations d'anticorps doivent tre purifies et
l'une d'elle doit tre conjugue..

Figure 3: ELISASandwichdirectetindirect
OIV-MA-AS315-23 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Pour la mthode ELISA Sandwich indirecte, il est ncessaire que les


anticorpsdecaptureetdedtectionsoientcultivesauseindespces
diffrentes (par exemple souris et lapin) pour que les anticorps
secondaires attachs des enzymes spcifiques la dtection
d'anticorpsneselientpasgalementauxanticorpsdecapture.
Pour la plupart des applications, une microplaque haute capacit de
liaison est ce quil y a de mieux, toutefois, consulter les directives du
fabricantpourdterminerqueltypedeplaqueconvientlemieuxpour
lierl'antigneconsidr
Pour la mthode ELISA Sandwich, la mesure est proportionnelle la
quantitdantignescontenuedansleschantillons.
Lavantage de la mthode ELISA Sandwich est que les chantillons
doriginenontpasbesoindtrepurifisavantlanalyse,etlamthode
peuttretrssensible.

OIV-MA-AS315-23 : 2010

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Tableau 1 : Critres de performance des mthodes d'analyse relatives


aux rsidus potentiellement allergnique de protines de collage du vin
Paramtre

Valeur/Commentaire

Applicabilit

Convient pour dterminer les agents de collage


dans le vin des fins officielles.

Limite de dtection

(exprime en mg/L)
Casine : au moins 0,5
Ovalbumine : au moins 0,5
Ichtyocolle : au moins 0,5
Lysozyme : au moins 0,5

Limite de
quantification

(exprime en mg/L)
Casine : au moins 1 mg/L
Ichtyocolle : au moins 1 mg/L
Lysozyme : au moins 1 mg/L
Ovalbumine : au moins 1 mg/L

Fidlit

Valeurs HORRAT infrieures ou gales 2 dans


l'essai collaboratif de validation

Recouvrement

80% - 105% (comme indiqu dans l'essai


collaboratif)

Spcificit

Pas d'interfrences de la matrice

OIV-MA-AS315-23 : 2010

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Rsidus potentiellement allergniques de protines de collage
dans le vin

Justesse

x m < 1,96 * s

R ( lab )

sr ( lab ) * 1 1 n

o m est la valeur certifie du matriau de


rfrence vin et x est la moyenne de n mesures
de la concentration en protines de ce vin, dans le
mme laboratoire.
Sr(lab) reprsentent les carts-types calculs
partir des rsultats obtenus dans un mme
laboratoire dans des conditions de rptabilit
SR(lab) reprsentent les carts-types calculs
partir des rsultats obtenus dans diffrents
laboratoires dans des conditions de
reproductibilit.

OIV-MA-AS315-23 : 2010

12

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Brome total

Mthode OIV-MA-AS321-01

Mthode Type IV

Brome total

1. Principe de la mthode
Incinration du vin 525 oC en prsence dun excs de chaux sode. Dosage
colorimtrique 590 nm de la ttrabromophnolsulfonephthaline obtenue par
action, sur la phnolsulfonephataline, du brome libr par action de la chloramine
T sur la solution des cendres porte pH 4,65.
2. Appareillage
2.1 Bain deau 100 C.
2.2 Four lectrique rgulation de temprature.
2.4 Spectrophotomtre permettant des mesures entre 300 et 700 nm.
3.
3.1
3.2
3.3

Ractifs
Solution dhydroxyde de sodium 50 p. 100 (m/m)
Suspension dhydroxyde de calcium 2 M contenant 120 g de CaO par litre.
Solution de phnolsulfonephthaline:
0.24 g de phnolsulfonephthaline (rouge phnol) sont dissous dans 24 ml de
solution dhydroxyde de sodium, 0,1 M et port au litre avec de leau distille.
3.4 Solution tampon pH 4,65 :
acide actique, 2 M . 500 ml
hydroxyde de sodium 2 M 250 ml
1l
eau distille q.s.p. ..
3.5 Solution oxydante :
chloramine T
2g
1l
eau distille q.s.p. .
Prparer cette solution 48 heures avant lemploi
Conservation : 2 semaines 4 oC
3.6 Solution rductrice :
thiosulfate de sodium .. 25 g
1l
eau distille q.s.p. .
3.7 Acide sulfurique, (20 = 1,84 g/ml) dilu 1/10 (v/v).
3.8 Acide sulfurique, (20 = 1,84 g/ml) dilu 1/100 (v/v).
3.9 Solution de bromure de potassium correspondant 1 g de brome par litre.
1,489g de bromure de potassium, KBr, est dissous dans de leau distille et
port au litre.
OIV-MA-AS321-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Brome total

4. Mode opratoire
4.1 Obtention des cendres et de la solution des cendres
50 ml de vin, placs dans une capsule de silice de 7 cm de diamtre, sont
additionns de 0,5 ml de solution dhydroxyde de sodium 50 p. 100 et de 1
ml de suspension dhydroxyde de calcium 2 M. Vrifier que le pH est
suprieur ou gal 10. La capsule, recouverte dun verre de montre, est
abandonne au repos pendant 24 h. Le liquide est ensuite vapor au bain
deau 100C jusqu siccit en saidant, pour acclrer lopration,
ventuellement dun courant dair chaud.
Effectuer ensuite lincinration de la faon suivante : la capsule est laisse
pendant 30 min. dans un four rgl 525C; aprs refroidissement le rsidu est
repris par un peu deau distille, leau est limine sur le bain deau 100C;
calciner nouveau 525C. Cette opration est rpte jusqu ce que les
cendres obtenues soient dun blanc gristre.
Reprendre les cendres par 5 ml deau distille bouillante. Ajouter la burette
de lacide sulfurique dilu au 1/10, puis au 1/100 pour amener le pH entre 4 et
5, le pH tant mesur laide de papier indicateur. Soit X ml le volume de ces
solutions sulfuriques vers. Ajouter alors 10,2 - (X + 5) ml deau distille.
Broyer laide dun petit agitateur le sulfate de calcium prcipit. Transvaser le
contenu de la capsule dans un tube centrifugation. Centrifuger 10 min.
Prlever dans un tube essai les 8 9 ml de liquide limpide.
4.2 Essai qualitatif
Cet essai est destin savoir si la teneur en brome du vin tant comprise entre 0
et 1 mg/l, le dosage peut tre effectu sur la solution des cendres sans dilution
pralable.
Dans un petit tube essai placer:
1 ml de solution des cendres,
1 goutte de solution tampon pH 4,65
1 goutte de solution de phnolsulfonephthaline,
1 goutte de solution chloramine.
Aprs 1 min. exactement, arrter la raction par addition de 1 goutte de solution
de thiosulfate de sodium.
Si la coloration obtenue est jaune, jaune brun ou jaune vert, la solution des
cendres peut tre utilise telle quelle.
Si la coloration obtenue est bleu ou violette et a fortiori violette fugace, le vin
contient plus de 1 mg de brome par litre; il faut diluer la solution des cendres
au ou au 1/5 et recommencer lessai qualitatif sur la dilution jusqu ce que
la coloration obtenue rponde aux conditions ci-dessus.
4.3 Dosage proprement dit
OIV-MA-AS321-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Brome total

Dans un tube essai placer :


5 ml de solution des cendres, dilue ou non, ajouter :
0,25 ml de solution tampon pH 4,65
0,25 ml of phnolsulfonephthaline;
0,25 ml de solution de chloramine T;
attendre 1 min. exactement, et ajouter :
0,25 ml de solution de thiosulfate de sodium.
Examiner au spectrophotomtre 590 nm dans une cuve de 1 cm de trajet
optique par rapport un tmoin obtenu en ajoutant 5 ml deau distille les
mmes quantits de ractifs.
Remarque : Lorsque la teneur en brome est faible (coloration jaune peine
verdtre), dterminer labsorbance dans une cuve de 2 cm de trajet optique.

4.4 tablissement de la courbe dtalonnage


Au moment de lemploi prparer une solution contenant 10 mg de brome par
litre en faisant deux dilutions successives au 1/10 de la solution titre de bromure
de potassium correspondant 1 g de brome par litre.
Dans une srie de tubes essai, introduire 0,25, 0,50, 0,75, 1,00, 1,25, 1,50,
2,00 et 2,50 ml de la dilution 10 mg de brome par litre; complter 5 ml avec
de leau distille, (la gamme obtenue correspond des teneurs de 0,10, 0,20,
0,30, 0,40, 0,50, 0,60, 0,80 et 1 mg de brome par litre de vin dans les
conditions opratoires dcrites, sans dilution de la solution des cendres). Traiter
les 5 ml de chacune de ces solutions comme il est indiqu pour la solution des
cendres. Dterminer les absorbances de ces solutions par rapport au tmoin
prpar en traitant de la mme faon 5 ml deau distille. Les absorbances
obtenues en fonction des teneurs en brome correspondantes se situent sur une
droite lgrement incurve vers lorigine.
5. Expression des rsultats
5.1 Calculs
La teneur en brome du vin est obtenue en reportant sur la courbe dtalonnage
labsorbance dtermine sur la solution des cendres et en tenant compte
ventuellement de lpaisseur de la cuve ou de la dilution de la solution des
cendres effectue.
La teneur en brome total est exprime en milligrammes par litre (mg/l) avec
deux dcimales.

OIV-MA-AS321-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Brome total

BIBLIOGRAPHIE
DAMIENS A., Bull. Sci. Pharmacologiques, 1920, 27, 609; Ibid, 1921, 28, 37, 85 et 105.
BALANTRE P., J. Pharm. Chem., 1936, 24, 409.
PERRONET M., ROCQUES Mme S., Ann. Fals. Fraudes, 1952, 45, 347.
CABANIS J.-C., Le brome dans les vins, Thse doct. Pharm., Montpellier, 1962.
JAULMES P., BRUN Mme S., Cabanis J.-C., Chim anal., 1962, 327.
STELLA C., Riv. Viticolt. Enol., Conegliano, 1967, 5.

OIV-MA-AS321-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Chlorures

Mthode OIV-MA-AS321-02

Mthode Type II

Chlorures
1. Principe de la mthode
Les chlorures sont doss directement dans le vin par potentiomtrie en utilisant
l'lectrode Ag/AgCl.
2. Appareillage
2.1. pH mtre millivoltmtre gradu au moins de 2 en 2 mV.
2.2. Agitateur magntique.
2.3. Electrode Ag/AgCl, avec une solution sature de nitrate de potassium comme
lectrolyte.
2.4. Microburette gradue au 1/100
2.5. Chronomtre.

me

de ml.

3. Ractifs
3.1. Solution talon de chlorures; 2,1027 g de chlorure de potassium, KCl (max.
0,005 % Br), desschs avant l'emploi par conservation durant quelques jours dans
un dessiccateur, sont dissous dans de l'eau distille; porter au litre : 1 ml de cette
solution contient 1 mg de Cl-.
3.2. Solution titre de nitrate d'argent : 4,7912 g de nitrate d'argent, AgNO3, pour
analyse, sont dissous et ports au litre dans une solution alcoolique 10 p. 100
(v/v) : 1 ml de cette solution correspond 1 mg de Cl-.
3.3. Acide nitrique pur au moins 65 p. 100 (20 = 1,40 g/ml).
4. Mode opratoire
4.1. 5,0 ml de solution talon de chlorures sont introduits dans un vase cylindrique
de 150 ml plac sur un agitateur magntique, dilus 100 ml environ avec de
l'eau distille et acidifis avec 1,0 ml d'acide nitrique 65 p. 100 au minimum.
Aprs plonge de l'lectrode, titrer en ajoutant la microburette la solution
titre de nitrate d'argent, l'agitation tant modre. Les additions effectues sont
d'abord de 1,00 ml pour les quatre premiers millilitres, lire les valeurs en
millivolts correspondantes. Puis ajouter les 2 ml suivants par fractions de
0,20 ml. Enfin reprendre les additions par fractions de 1 ml jusqu' ce qu'on ait
vers 10 ml au total. Aprs chaque addition attendre environ 30 secondes avant
d'effectuer la lecture des millivolts correspondants. Porter les valeurs obtenues
sur un papier millimtr, en fonction des millilitres de solution titre

OIV-MA-AS321-02 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Chlorures

correspondants et dterminer le potentiel du point quivalent d'aprs le point


singulier de la courbe obtenue.
4.2. 5 ml de la solution talon de chlorures sont introduits dans un vase cylindrique
de 150 ml ainsi que 95 ml d'eau distille et 1 ml d'acide nitrique 65 p. 100 au
minimum. Plonger l'lectrode et titrer en agitant jusqu' obtention du potentiel
du point quivalent. Cette dtermination est rpte jusqu' ce que l'on ait
obtenu une bonne concordance des rsultats. Il faut effectuer ce contrle avant
chaque srie de dosages de chlorures dans les chantillons.
4.3. 50 ml de vin analyser sont introduits dans un vase cylindrique de 150 ml.
Ajouter 50 ml d'eau distille et 1 ml d'acide nitrique au moins 65 p. 100 et
titrer suivant le procd indiqu en 4.2.
5. Expression des rsultats
5.1. Calculs
Si n reprsente le nombre de millilitres de solution titre de nitrate d'argent, la
teneur en chlorure du liquide tudi est :
20 n
exprime en milligrammes de Cl par litre;
0,5633 n exprime en milliquivalents par litre;
32,9 n
exprime en milligrammes de chlorure de sodium par litre.
5.2. Rptabilit (r) :

r = 1,2 mg Cl par litre


r = 0,03 meq/l
r = 2,0 mg NaCl/l

5.3. Reproductibilit (R) :

R = 4,1 mg/l
R = 0,12 meq/l
R = 6,8 mg NaCl/l

6. Remarque : Dosage trs prcis.


On se rfre la courbe de titration complte obtenue au cours du dosage du
liquide tudi par la solution de nitrate d'argent.
a) Placer 50 ml de vin analyser dans un vase cylindrique de 150 ml. Ajouter
50 ml d'eau distille et 1 ml d'acide nitrique au moins 65 p. 100. Titrer au
moyen de la solution de nitrate d'argent, en procdant des additions de 0,5 ml
pour lesquelles on relve le potentiel en millivolts correspondant. Dduire de ce
premier titrage le volume approximatif de solution de nitrate d'argent
ncessaire.
b) Recommencer le dosage dans les mmes conditions. Procder tout d'abord des
additions de 0,5 ml de solution titrante jusqu' ce que le volume vers soit
infrieur de 1,5 2 ml au volume dtermin en a). Procder alors des

OIV-MA-AS321-02 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Chlorures

additions de 0,2 ml; continuer les affusions au-del du point quivalent


approximativement repr, d'une manire symtrique, par addition de 0,2 ml,
puis de 0,5 ml.
Le point final du dosage et le volume de solution de nitrate d'argent exactement
consomm est obtenu :
soit en traant la courbe et en dterminant le point quivalent;
soit par le calcul :

V = V + Vi

avec
V
V
Vi
E1
E2

E1
E1 E 2

= volume de solution titre au point quivalent;


= volume de solution titre avant le plus grand saut de potentiel.
= volume constant des fractions de solution titre ajout, soit 0,2 ml;
= diffrence de potentiel seconde avant la plus grande variation du potentiel;
= diffrence de potentiel seconde aprs la plus grande variation du potentiel.

Exemple :
Volume de solution
titre de AgNO3
0
0,2
0,4
0,6
0,8
1,0
1,2
1,4
1,6
1,8
2,0
2,2
2,4

Potentiel E
en mV
204
208
212
218
224
230
238
250
272
316
350
376
396

Diffrence
E

Diffrence
seconde E

4
4
6
6
6
8
12
22
44
34
26
20

0
2
0
0
2
4
10
22
10
8
6

Dans cet exemple, le point final du titrage se situe entre 1,6 et 1,8 ml : car c'est
dans cet intervalle qu'apparat le plus grand saut de potentiel (E = 44 mV). Le
volume de solution titre de nitrate d'argent consomm pour doser les chlorures
dans la prise d'essai est :
V 1,6 0,2

OIV-MA-AS321-02 : R2009

22 1,74ml
22 10

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Chlorures

BIBLIOGRAPHIE

MIRANDA PATO C. de, F.V., O.I.V., 1959, no12.


HUBACH C.E., J. Ass. Off. Agric. Chem., 1966, 49, 498.
Fdration internationale des Producteurs de jus de fruits, F. O.I.V.,1968, n37.
JUNGE Ch., F.V., O.I.V., 1973, no440.

OIV-MA-AS321-02 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Mthode OIV-MA-AS321-03

Mthode Type II

Dtermination de la teneur des vins en fluorures a laide


dune lectrode slective et ajouts doss
(Rsolution Oeno 22/2004)
1.

PORTEE ET CHAMP DAPPLICATION

Cette mthode est applicable lanalyse des fluorures dans tous les vins. Avec une
dilution adapte, la fourchette de dtection peut aller de 0,1 mg/l 10,0 mg/l.

2.

PRINCIPE

La concentration des fluorures dans lchantillon est mesure aprs addition dun
tampon, en utilisant une lectrode slective des ions fluorure. Le tampon fournit
une force ionique leve; complexe le fer et laluminium (qui autrement
complexeraient avec le fluor) et ajuste le pH un niveau qui minimise la formation
dun complexe HFHF. Les effets de matrice sont ensuite minimiss par
lutilisation d'un ajout dos.

3.

REACTIFS

3.1
Eau distille ou dsionise
3.2
Chlorure de sodium puret 99,0%.
3.3
Citrate trisodique puret 99,0%.
3.4
CDTA (acide 1,2-diaminocyclohexane-N,N,N,N- ttractique hydrate)
puret 98,0%.
3.5
Hydroxyde de sodium puret 98,0%.
3.6
Solution d'hydroxyde de sodium 32% (m/v) fait avec 3.5.
3.7
Acide actique glacial puret 99,0%.
3.8
Fluorure de sodium puret 99,0%.
3.9
Tampon commercial dajustement de force ionique totale (TISAB)
(TISAB III-Orion Research Inc. Cat. # 940911) ou quivalent (Voir 4.2)
3.10 Alternative TISAB :
3.10.1
A environ 700 ml deau distille (3.1) dans un vase cylindrique de 1 l
(4.3), ajouter 58,0 g 0,1 g de chlorure de sodium (3.2) et 29,4 g 0,1 g de citrate
trisodique (3.3).
OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

3.10.2
Dissoudre 10,0 g 0,1 g de CDTA (acide 1,2-diaminocyclohexaneN,N,N,N- ttractique) (3.4) et 6 ml dhydroxyde de sodium 32 % (m/v) (3.6)
dans approximativement 50 ml deau (3.1).
3.10.3
Mlanger les deux solutions, puis ajouter 57 ml d'acide actique glacial
(3.7) et ajuster le pH 5,5 avec lhydroxyde de sodium 32 % (m/v) (3.6).
Refroidir temprature ambiante, transfrer dans une fiole jauge de 1 l (4.10), et
ajuster au volume avec de l'eau (3.1).
3.11 Solutions talons de fluorures
3.11.1
Solution talon de fluorures 100 mg/l : peser 221 mg 1 mg de
fluorure de sodium (3.8) (sch 105 C pendant 4 heures) dans une fiole
volumtrique de 1 l en polythylne (4.10) et ajuster avec de leau (3.1).
3.11.2
Etalons de travail de fluorures 1,0 mg/l, 2,0 mg/l, et 5,0 mg/l :
l'aide de pipettes (4.11), verser respectivement 1ml, 2 ml, et 5 ml de la solution
talon 100 mg/l (3.11.1) dans trois fioles volumtriques de 100 ml en
polythylne (4.10) et ajuster avec de leau (3.1).
3.12

Vin tmoin : vin rput ne contenant pas de fluorures, utilis comme


tmoin.

3.13 Vin talon surcharg 1 mg/l : mettre 10 ml (4.11) de solution talon de


fluorures 100 mg/l (3.11.1) dans une fiole jauge de 1l (4.10) et complter au trait
de jauge avec du vin sans fluorures (3.12).

4.

APPAREILLAGE

4.1
Ionomtre avec une fonction ajouts doss (ex. Analyseur Corning pH/ion
455, Cat. # 475344) ou ionomtre permettant la lecture des tensions (mV).
4.2
Electrode slective pour les ions fluorures et une lectrode de rfrence ou
une lectrode combine (ex. Electrode de fluorure Corning Cat. # 34108-490).
4.3
Vases cylindriques de 150 ml et de 1 l en polythylne.
4.4
Eprouvette gradue pied de 50 ml en polythylne.
4.5
Agitateur magntique
4.6
Barreau magntique, revtu de tflon.
4.7
Flacons en plastique (Nalgne ou quivalent) de 125 ml, avec des
bouchons
4.8
Pipette de prcision, 500 l
4.9
Bain deau ultrasons
OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

4.10
4.11

Fioles jauges, Classe A, 50 ml, 100 ml, et 1 l.


Pipettes, Classe A, 1 ml, 2 ml, 5 ml, 10 ml, 20 ml, et 25 ml.

5.

PREPARATION DES SOLUTIONS D'ETALONNAGE

5.1 Mettre 25 ml (4.11) de solutions talon (3.11.2) de 1,0 mg/l, 2,0 mg/l, et 5,0
mg/l respectivement dans trois vases cylindriques de 150 ml (4.3) et ajouter 20 ml
(4.11) d'eau (3.1) et5 ml de TISAB commercial (3.9) chacun. Mlanger avec un
agitateur magntique (4.5 et 4.6).
5.2 Quand le tampon TISAB alternatif (3.10) est utilis : mettre 25 ml (4.11) de
solutions talon (3.11.2) de 1,0 mg/l, 2,0 mg/l, et 5,0 mg/l respectivement dans trois
vases cylindriques de 150 ml (4.3) et ajouter dans chacun 25 ml (4.11) de tampon
alternatif (3.10). Mlanger avec un agitateur magntique (4.5 et 4.6).

6.

PREPARATION DES ECHANTILLONS

Bien mlanger lchantillon de vin avant le prlvement. Les vins mousseux


devront tre dgazs avant le prlvement en les transfrant dans un vase
cylindrique propre plac dans un bain deau ultrasons (4.9) jusqu limination
du gaz.
6.1
Si le tampon commercial TISAB (3.9) est utilis : mettre 25 ml
d'chantillon (4.11) dans un vase cylindrique de 150 ml (4.3) avec 20 ml d'eau (3.1)
et ajouter 5 ml (4.11) de tampon commercial TISAB (3.9). Mlanger avec un
agitateur magntique (4.5 et 4.6). Facteur de dilution (DF) = 1.
6.2
Si le tampon alternatif TISAB (3.10) est utilis : mettre 25 ml d'chantillon
(4.11) dans un vase cylindrique de 150 ml (4.3) et ajouter 25 ml (4.11) de tampon
alternatif TISAB (3.10). Mlanger avec un agitateur magntique (4.5 et 4.6).
Facteur de dilution (DF) = 1.

OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

MODE OPERATOIRE

Pour effectuer les mesures, les solutions talons et les chantillons de vin doivent
avoir la mme temprature.
7.1

Etalons de rfrence

Mesurer le potentiel de chaque solution talon, en utilisant le ionomtre (4.1),


llectrode slective de fluorure (4.2), et llectrode de rfrence (4.2). La lecture
finale doit tre effectue quand la mesure est stabilise (la stabilit est atteinte
quand le potentiel ne varie pas plus de 0,2 0,3 mV/ 3 minutes). Noter les lectures
pour chaque mlange de rfrence. Le log des concentrations en fonction du
voltage mesur pour chacune des solutions d'talonnage est reporte sur un papier
graphique pour dterminer la pente de l'lectrode.
7.2

Echantillons de vin

Mesurer et noter le potentiel exprim en mV (E1) de l'chantillon (6.1 ou 6.2)


quand la mesure est stabilise. Ajouter 500 l (4.8) de solution talon 100 mg/l
de fluorure (3.11.1) au prlvement (6.1 ou 6.2). Quand la mesure est stabilise,
lire et noter le potentiel exprim en mV (E2) de la solution de vin.
Pour une meilleure prcision, il est recommand que la concentration finale en ions
fluorure aprs addition soit au moins du double de celle de l'chantillon. Pour s'en
assurer, il est suggr, si la concentration dans l'chantillon est suprieure 2 mg/l
lors de la premire dtermination, d'effectuer une seconde dtermination aprs
dilution de l'chantillon. Dans ce cas , la dilution doit tre faite comme suit (7.2.1
ou 7.2.2).
7.2.1 Lorsquon utilise le tampon commercial TISAB (3.9) : l'aide d'une pipette
(4.11) mettre 25 ml d'chantillon de vin dans une fiole jauge de 50 ml (4.10) et
ajuster avec de leau (3.1). Verser 25 ml (4.11) de ce vin dilu dans un vase
cylindrique de 150 ml (4.3) et ajouter 20 ml d'eau (3.1) et 5 ml de tampon
commercial TISAB (3.9). Mlanger avec un agitateur magntique (4.5 et 4.6), puis
procder la mesure comme en 7.2. Facteur de dilution (DF) = 2.
7.2.2 Lorsquon utilise le tampon alternatif TISAB (3.10) : l'aide d'une pipette
(4.11) mettre 25 ml d'chantillon de vin dans une fiole jauge de 50 ml (4.10) et
ajuster avec de leau (3.1). Verser 25 ml (4.11) de ce vin dilu dans un vase
cylindrique de 150 ml (4.3) et ajouter 25 ml de tampon alternatif TISAB (3.10).
OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Mlanger avec un agitateur magntique (4.5 et 4.6), puis procder la mesure


comme en 7.2. Facteur de dilution (DF) = 2.

8.

CALCUL

La teneur en fluorure de lchantillon, exprime en mg/l, est obtenue avec la


formule suivante :

Cf

Va Ca
1

Vo
((anti log E / S ) 1)

si le volume de solution talon ajout Vstd est < 1% du volume de la solution aprs
ajout,
alors Va = Vo et

Cf DF Ca

1
((anti log E / S ) 1)

Cf = concentration en fluorure de l'chantillon (mg/l)


DF = facteur de dilution. S'il est ncessaire de diluer l'chantillon comme en (7.2.1)
ou en (7.2.2), utiliser une valeur identique la dilution de l'chantillon, c'est dire
DF = 2 pour un chantillon dilu (7.2.1) et (7.2.2) ou DF = 1 s'il ne l'est pas,
comme en (6.1) ou (6.2).
Vo = volume initial dchantillon avant ajout (ml)
Va = volume de la solution aprs ajout (ml)

E = diffrence entre potentiels E1 et E2 obtenus en (7.2) en mV.


S = pente de la droite de calibration de llectrode.

Ca =

Vstd C std
Vsamp

o
Ca = concentration (en mg/l) de fluorure ajoute la solution de l'chantillon (Vo)
obtenu en multipliant le volume de l'talon ajout (3.11.1) (Vstd) par la
concentration (Cstd) de l'talon (3.11.1) et divis par le volume d'chantillon (25 ml)
utilis en (6.1) ou (6.2).
Vstd = volume ajout d'talon (3.11.1) (0,5 ml)
Vsamp = volume d'chantillon utilis en (6.1) ou (6.2), Vsamp = 25 ml.
OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Cstd = concentration de l'talon (3.11.1).


Exemple de calcul :
(1) pour un chantillon prpar comme en (6.2) et dtermin comme en (7.2)
DF = 1

Ca =

Vstd C std
0.5 ml 100 mg / l
=
= 2 mg /l
Vsamp
25 ml

E = 19,6 mV
S = -58,342

1
((anti log E / S ) 1)
1
C f 1 2 mg / l
((anti log 19,6 / 58,342) 1)
C f 1 2 mg / l 0,856 = 1,71 mg / l de fluorures

Cf DF Ca

(2) pour un chantillon prpar comme en (7.2.2), et dtermin comme en (7.2)


DF = 2

Ca =

Vstd C std
0,5 ml 100 mg / l
=
= 2 mg /l
Vsamp
25 ml

E = 20,4 mV
S = -55,937

1
((anti log E / S ) 1)
1
C f 2 2 mg / L
((anti log 20,.4 / 55,.937) 1)
1
C f 2 2 mg / L
((anti log 20,.4 / 55,.937) 1)

Cf DF Ca

Cf = 2 x 2 mg / l x 0,760 = 3,04 mg / l de fluorures

9.

FIDELITE

OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Les dtails de l'tude interlaboratoires sont donns en annexe B. Les valeurs de


HORRAT (HoR) variant de 0,30 0,97 indiquent une bonne reproductibilit parmi
les participants.
Les rsultats des calculs statistiques sont donns dans l'annexe B tableau 2. L'cart
type de rptabilit (RDSr) varie de 1,94% 4,88% ; l'cart type de reproductibilt
(RDSR) varie de 4,15% 18,40%. La moyenne des taux de recouvrement varie
entre 99,% et 100,3% de la valeur cible.

10.

ASSURANCE ET MAITRISE DE LA QUALITE

10.1 Analyser une solution talon 1,0 mg/l (3.11.2) au dbut et la fin de
chaque srie de mesure. Les rsultats doivent tre de 1,0 0,1 mg/l.
10.2 Avant chaque srie de mesures, analyser un blanc (3.12) et, pour le
contrle de qualit interne (CQI), un vin surcharg (3.13). Le blanc ne doit pas
excder 0,0 mg/l 0,1 mg/l et le CQI ne doit pas dpasser 1,0 mg/l 0,2 mg/l.

OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Annexe A
Bibliographie

[1] AOAC International, AOAC Official Methods Program, Associate Referees


Manual On Development, Study, Review, and Approval Process,1997
[2] Postel, W.; Prasch, E., Wein-Wissenschaft, (1975) 30 (6), 320-326
[3] Office International de la Vigne et du Vin, Compendium of International
Methods of Wine Analysis, 5/10/94, 255257
[4] Gil Armentia, J. M.; Arranz, J. F.; Barrio, R. J.; Arranz, A., Anales de
Bromatologia, (1988) 40 (1) 71-77
[5] Gran, G; Analyst (1952) 77, 661
[6] Corning fluoride ion selective electrode Instruction Manual, 1994
[7] Corning Instruction Manual pH/ion analyzer 455, 109121-1 Rev. A, 11/96
[8] Horwitz,W.; Albert, R.; Journal of the Association of Official Analytical
Chemists, (1991) 74 (5) 718

OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Annexe B
Etude interlaboratoires

B.1

INTRODUCTION

La mthode de dtermination des fluorures dans les vins a t valide par une tude
collaborative. Douze participants au total ont particip cette tude, six europens
et six amricains. Ltude collaborative a t mene en utilisant, le protocole de
Youden de l'AOAC.
B.2

Participants

Les douze laboratoires participant la validation se situaient en Allemagne,


Autriche, Espagne, Etats-Unis et France : BATF Alcohol and Tobacco
LaboratoryAlcohol Section, SF, Walnut Creek, CA., Etats-Unis; BATF, National
Laboratory Ctr., Rockville, MD, Etats-Unis; Bundesinstitut fr Gesundheitlichen
Verbraucherschutz, Berlin, Allemagne ; Canandaigua Winery, Madera, CA, EtatsUnis; CIVC, Epernay, France ; E. & J. Gallo Winery-Analytical Services
Laboratory, Modesto, CA, Etats-Unis; E. & J. Gallo Winery-Technical Analytical
Services Laboratory, Modesto, CA, Etats-Unis; ETS Labs, St. Helena, CA, EtatsUnis; Hhere Bundeslehranstalt & Bundesamt fr Wein und Obstbau,
Klosterneuburg, Autriche ; Institut Catala de la Vinya i el Vi, Vilafranca del
Penedes (Barcelone), Espagne ; Laboratorio Arbitral Agroalimentario, Madrid,
Espagne ; and Sutter Home Winery, St. Helena, CA., Etats-Unis.
B.3
Les chantillons utiliss pour l'tude
Les chantillons utiliss pour l'tude sont donns dans lAnnexe I. Ils ont t
distribus en double aveugle (six paires dchantillons, trois vins rouges et trois
vins blancs).
Echantillon
1
2
3
4
5
6

Description de lchantillon

Vin blanc sans surcharge (total de 0,6 mg/l F-)


Vin blanc surcharg avec 0,3 mg /l (total de 0,9 mg/l F-)
Vin blanc surcharg avec 0,9 mg /l (total de 1,5 mg/l F-)
Vin blanc surcharg avec 1,2 mg /l (total de 1,8 mg/l F-)
Vin blanc surcharg avec 1,4 mg /l (total de 2,0 mg/l F-)
Vin blanc surcharg avec 1,7 mg /l (total de 2,3 mg/l F-)

OIV-MA-AS321-03 : R2004

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

7
8
9
10
11
12

Vin rouge sans surcharge (total de 0,2 mg/l F-)


Vin rouge surcharg avec 0,3 mg /l (total de 0,5 mg/l F-)
Vin rouge surcharg avec 0,8 mg /l (total de 1,0 mg/l F-)
Vin rouge surcharg avec 1,1 mg /l (total de 1,3 mg/l F-)
Vin rouge surcharg avec 2,5 mg /l (total de 2,7 mg/l F-)
Vin rouge surcharg avec 2,8 mg /l (total de 3,0 mg/l F-)

B.4
Rsultats
Un rsum des rsultats obtenus par les douze participants se trouve dans le
Tableau I. Aucun des laboratoires na signal de difficult particulire. Le test de
Cochran a mis en vidence une paire aberrante. Ces rsultats sont nots (c) dans le
Tableau I, et nont pas t utiliss dans lanalyse statistique.

OIV-MA-AS321-03 : R2004

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Tableau 1
Donnes concernant l'analyse collaborative pour la dtermination des fluorures
dans les vins par lectrode slective aprs ajouts doss
Les rsultats sont exprims en mg fluorures/l

Paire 1
1
2
0,55
0,80
0,52
0,81
0,52
0,81
0,62
0,98
0,48
0,78
0,53
0,84
0,53
0,76
0,57
0,88
0,51
0,81
0,54
0,84
0,60
0,93
0,65
0,94
12
12

Vin blanc
b
Paire 2
3
4
1,33
1,56
1,39
1,64
1,40
1,70
1,48
1,64
1,34
1,64
1,45
1,74
1,27
1,64
1,51
1,85
1,40
1,71
1,43
1,71
1,48
1,75
1,54
1,79
12
12

Paire 3
5
6
1,86
2,24
1,86
2,31
1,92
2,25
1,85
2,14
1,84
2,11
1,97
2,30
1,89
2,06
2,11
2,33
1,90
2,20
1,93
2,22
1,98
2,32
2,05
2,32
12
12

Paire 4
7
8
0,19
0,45
0,19
0,46
0,14
0,42
0,28
0,56
0,12
0,39
0,13
0,43
0,14
0,40
c
c
0,48
0,48
0,13
0,42
0,18
0,44
0,25
0,57
0,21
0,52
11
11

Vin rouge
b
Paire 5
9
10
0,89
1,17
0,92
1,20
0,96
1,22
1,00
1,32
0,88
1,16
0,92
1,21
0,88
1,12
1,01
1,32
0,90
1,19
0,96
1,23
1,06
1,31
1,03
1,24
12
12

Paire 6
11
12
2,54
2,77
2,58
2,77
2,64
2,95
2,64
2,72
2,56
2,82
2,66
2,93
2,44
2,83
2,64
3,08
2,60
2,86
2,66
2,87
2,68
2,82
2,81
3,07
12
12

0,48
0,65
0,17
0,55
0,54
0,050

1,27
1,54
0,27
1,42
1,42
0,079

1,84
2,11
0,27
1,93
1,91
0,084

0,12
0,28
0,16
0,18
0,18
0,052

0,88
1,06
0,18
0,95
0,94
0,061

2,44
2,81
0,37
2,62
2,64
0,090

Labo
b

Numro
1
2
3
4
5
6
7
8
9
10
11
12

No de cas
Minimum
Maximum
Ecart
Moyenne
Mdiane

0,76
0,98
0,22
0,85
0,83
0,069

1,56
1,85
0,29
1,70
1,71
0,079

2,06
2,33
0,27
2,23
2,25
0,091

0,39
0,57
0,18
0,46
0,44
0,063

1,12
1,32
0,20
1,22
1,22
0,065

2,72
3,08
0,36
2,87
2,85
0,114

Ecart-type

b
c

Paires de Youden
Valeur supprime aprs test de Cochran et qui n'est pas reprise dans lanalyse statistique

OIV-MA-AS321-03 : R2004

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Fluorures

Tableau 2
Rsultats de l'analyse collaborative pour la dtermination des fluorures dans les
vins par lectrode slective aprs ajouts doss

Vin Blanc
STATISTIQUE

Paire 1

Paire 2

Paire 3

Paire 4

Nombre de
Laboratoires

12

12

12

11

Paire 5

Paire 6

12

12

Nombre de
rptitions par
laboratoire

0,55
0,85

1,42
1,70

1,93
2,23

0,18
0,46

0,95
1,22

2,62
2,87

Variance de
rptabilit

0,0006

0,0015

0,0026

0,0002

0,0005

0,0049

Ecart type de
rptabilit

0,0235

0,0382

0,5106

0,0156

0,0211

0,0703

Ecart-type relatif
RSDr de
rptabilit

3,35 %

2,45 %

2,45 %

4,88 %

1,94 %

2,55 %

Variance de
reproductibilit

0,0039

0,0070

0,0089

0,0034

0,0042

0,0130

Ecart-type de
reproductibilit

0,0625

0,0835

0,0945

0,0587

0,0647

0,1141

Ecart-type RSDR,
de reproductibilit

8,92 %

5,36 %

4,54 %

18,39 %

5,95 %

4,15 %

Reproductibilit
thorique selon
Horwitz (RSDR)

16,88

14,97

14,33

19,00

15,80

13,74

Valeur de
HORRAT HoR
(RSDR
(mesur)/RSDR
(Horwitz))

0,53

0,36

0,32

0,97

0,38

0,30

taux moyen de
rcupration
(en%)

93,1

94,6

96,7

91,0

94,4

96,4

Moyenne (deux
niveaux)

Vin rouge

Une paire dun labo a t supprime des donnes fixes par le Test de Cochran

OIV-MA-AS321-03 : R2004

12

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Phosphore total

Mthode OIV-MA-AS321-04

Mthode Type IV

Phosphore total
1. Principe de la mthode
Aprs oxydation nitrique et incinration, lacide phosphorique est dos
colorimtriquement sur la solution chlorhydrique des cendres grce la coloration
jaune quil donne avec le ractif vanadomolybdique.
2. Appareillage
2.1 Bain deau 100C
2.2 Plaque chauffante
2.3 Four lectrique rgulation de temprature
2.4 Spectrophotomtre permettant des mesures entre 300 et 700 nm.
3. Ractifs
3.1 Acide nitrique, (20 = 1,39 g/ml).
3.2 Acide chlorhydrique environ 3 M; obtenu en ajoutant 1 volume dacide
chlorhydrique (20 = 1,15 1,18 g/ml), 3 volumes deau.
3.3 Ractif vanadomolybdique:
Solution A : dissoudre 40 g molybdate dammonium, (NH4)6Mo7O24.4H2O,
dans 400 ml deau.
Solution B : dissoudre 1 g de vanadate dammonium, NH4 VO3, dans 300 ml
deau et 200 ml dacide nitrique (20 = 1,39g/l). Laisser refroidir.
Ractif vanadomolybdique : dans une fiole jauge de 1 l, verser dabord la
solution B puis la solution A; complter 1 litre avec de leau. Ractif utiliser
8 jours aprs sa prparation.
3.4 Solution de P2O5 0,1 g/l.
Prparer une solution 1 g/l de P2O5 en dissolvant 2,454 de
dihydrognophosphate de potassium, K2HPO4, dans 1 litre d'eau; la diluer au
1
/10 (v/v).
4. Mode opratoire
4.1 Obtention des cendres
5 ml* de vin ou de mot prlevs dans une capsule de platine ou de silice, sont mis
vaporer sur un bain deau 100C.
* Une prise dessai de 5 ml permet le dosage de teneurs en P2O5 comprises entre 100 et
500 mg/l. En dehors de ces limites augmenter ou diminuer la prise dessai.
1
OIV-MA-AS321-04 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Phosphore total

Quand le rsidu est presque sec, ajouter 1 ml dacide nitrique (20 = 1,39g/l) et
placer la capsule pendant 1 h sur une plaque chauffante puis dans un four port
600-650C jusqu obtention des cendres blanches.
4.2 Dosage
Reprendre les cendres par 5 ml dacide chlorhydrique environ 3 M et verser la
solution obtenue dans une fiole jauge de 100 ml. Rincer la capsule avec
environ 50 ml deau distille et verser ces eaux de lavage dans la fiole. Ajouter
25 ml exactement mesurs de ractif vanadomolybdique. Agiter, laisser la
coloration se dvelopper pendant 15 20 min. Porter 100 ml le contenu de la
fiole avec de leau distille. Examiner au spectrophotomtre 400 nm.
Simultanment, prparer la gamme dtalonnage. Placer dans des fioles jauges
de 100 ml, 5, 10, 15, 20 et 25 ml de la solution titrant 0,1 g de P2O5/l amener
le volume 50 ml environ avec de leau distille, ajouter 25 ml de ractif
vanadomolybdique. Laisser la coloration se dvelopper en mme temps dans la
gamme talon et dans les chantillons doser, car la coloration volue
lgrement avec le temps. Dterminer les absorbances 400 nm aprs avoir
port 100 ml avec de leau distille le contenue des fioles jauges.
Pour rester toujours dans la zone dabsorbance la mieux adapte, ne pas utiliser
de mise au zro avec de leau distille, mais rgler la dviation du
galvanomtre du spectrophotomtre sur une valeur donne dabsorbance pour
une concentration dtermine.
5. Expression des rsultats
5.1 Calculs
La teneur en phosphore total, exprime en milligrammes par litre danhydride
phosphorique, P2O5, est obtenue en reportant sur la courbe dtalonnage
labsorbance dtermine sur lchantillon de vin.
La teneur en phosphore total est exprime en milligrammes par litre de P2O5 sans
dcimale.

BIBLIOGRAPHIE
A.F.N.O.R., Norme U, 42-246, Tour Europe, Paris.
SUDRAUD P., Bull. O.I.V., 1969, nos462-463, 933.

OIV-MA-AS321-04 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sulfates

Mthode OIV-MA-AS321-05A

Mthode Type II

Sulfates
1. Principe des mthodes
Prcipitation du sulfate de baryum et pese. Le phosphate de baryum prcipit
dans les mmes conditions est limin par un lavage du prcipit l'acide
chlorhydrique.
Dans le cas des mots ou des vins riches en dioxyde de soufre, un dsulfitage
pralable par bullition l'abri de l'air est prescrit.

2. Mthode
2.1. Ractifs
2.1.1. Acide chlorhydrique en solution 2 M.
2.1.2. Chlorure de baryum en solution 200 g/l de BaCl2.2H2O.
2.2. Mode opratoire
2.2.1. Cas gnral
Introduire dans un tube centrifugation de 50 ml, 40 ml d'chantillon
analyser; ajouter 2 ml d'acide chlorhydrique 2 M et 2 ml de solution de chlorure
de baryum 200 g/l; agiter avec une baguette de verre; rincer la baguette avec
un peu d'eau distille et abandonner au repos pendant 5 min. Centrifuger
pendant 5 min., puis dcanter avec prcaution le liquide surnageant.
Laver ensuite le prcipit de sulfate de baryum en procdant de la faon
suivante : ajouter 10 ml d'acide chlorhydrique 2 M, mettre le prcipit en
suspension et centrifuger pendant 5 minutes. Sparer avec prcaution le liquide
surnageant. Rpter deux fois le lavage du prcipit dans les mmes conditions
avec 15 ml d'eau distille chaque fois.
Transvaser quantitativement en rinant, avec de l'eau distille, le prcipit dans
une capsule de platine tare et la placer sur un bain d'eau 100 C jusqu'
vaporation sec. Le prcipit dessch est calcin plusieurs fois brivement
sur flamme jusqu' obtention d'un rsidu blanc. Laisser refroidir dans un
dessiccateur et peser.
Soit m la masse en milligrammes de sulfate de baryum obtenue.
2.2.2. Cas particulier : mots sulfits et vin teneur leve en dioxyde de soufre.
Procder au pralable l'limination du dioxyde de soufre.
Dans une fiole conique de 500 ml, munie d'une ampoule robinet et d'un tube
de dgagement, introduire 25 ml d'eau et 1 ml d'acide chlorhydrique pur
OIV-MA-AS321-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sulfates

(20 = 1,15 1,18 g/ml). Faire bouillir cette solution pour chasser l'air et
introduire 100 ml de vin par l'ampoule robinet, tout en maintenant l'bullition.
Poursuivre l'bullition jusqu' ce que le volume de liquide contenu dans la fiole
conique soit rduit environ 75 ml et le transvaser quantitativement, aprs
refroidissement dans une fiole jauge de 100 ml. Complter au trait de jauge
avec de l'eau. Procder au dosage des sulfates sur une prise d'essai de 40 ml,
comme il est indiqu en 2.2.1.
2.3. Expression des rsultats
2.3.1. Calculs
La teneur en sulfates, exprime en milligrammes par litre de sulfate de
potassium, K2SO4, est :
18,67 m
La teneur du mot ou du vin en sulfates est exprime en milligrammes par litre
de sulfate de potassium, sans dcimale.
2.3.2. Rptabilit :
jusqu' 1000 mg/l :
environ 1500 mg/l :

r = 27 mg/l
r = 41 mg/

2.3.3. Reproductibilit :
jusqu' 1000 mg/l :
environ 1500 mg/l :

R = 51 mg/l
R = 81 mg/l

BIBLIOGRAPHIE
DEIBNER L, BNARD P., Ind. alim. agric., 1954, 71, no1, 23; no5, 427; 1955,
72, no9-10, 565 et no11, 673.
DEIBNER L., Rv. ferm. ind. alim., 1959, 14 no5, 179 et no6, 227.
BLAREZ Ch., Vins et spiritueux, 1908, 149, Maloine d., Paris.
DER HEIDE X. von, SCHITTHENNER F., Der Wein, 1922, 320, Vieweg & Sohn
Verlag, Braunschweig.
JAULMES P., Analyse des vins, 1924, 73, Dubois et Poulain, d., Montpellier; 2e
dition, 1951, 112.
SIMONEAU G., tude sur les mots concentrs de raisins, 1946, Thse pharm.,
Montpellier, 49.
RIBREAU-GAYON J., PEYNAUD E., Analyse et contrle des vins, 1947, 244,
Ch. Branger d., Paris-Lige.

OIV-MA-AS321-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sulfates

FROLOV-BAGREEV A., AGABALIANTZ G., Chimie du vin, 1951, 369,


Moscou, Laboratoire de chimie de l'tat de Wrzburg (R.F. Allemagne), F.V.,
O.I.V., 1969, no321.

OIV-MA-AS321-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sulfates

Mthode OIV-MA-AS321-05B

Mthode Type IV

Sulfates

1. Principe des mthodes


Classement des vins en plusieurs catgories par une mthode dite des limites,
base sur la prcipitation du sulfate de baryum l'aide d'une solution titre
d'ions baryum.

SUPPRIME
(Rsolution OIV-Oeno-377-2009)

OIV-MA-AS321-05B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Ammonium

Mthode OIV-MA-AS322-01

Mthode Type IV

Ammonium
1. Principe de la mthode
Fixation du cation ammonium sur une rsine cationique faible, lution par une
solution acide, distillation de lluat et dosage de lammoniaque dans le distillat par
une solution titre dacide chlorhydrique.
2. Appareillage
2.1. Colonne de rsine changeuse de cations
Employer une burette robinet de 50 ml dans laquelle est plac un petit tampon
de laine de verre et 25 g de rsine faiblement cationique (Amberlite IR50,
80100 mesh, par exemple).
Commencer par deux lavages, alterns, avec une solution M dhydroxyde de
sodium et une solution M dacide chlorhydrique, laver ensuite la rsine avec de
leau distille jusqu raction ngative de lion chlorure avec le nitrate
dargent, faire passer lentement travers la colonne 50 ml de la solution
tampon neutre et rincer avec de l'eau distille jusqu' limination des
phosphates (dcels l'aide d'une solution sature d'actate de plomb).
2.2. Appareil de distillation
Utiliser lappareil dcrit au chapitre Titre alcoomtrique en 3.1.
Le liquide condens est amen dans la fiole conique rceptrice par un tube
effil touchant le fond de ce rcipient.
On peut galement employer lappareil entranement par la vapeur deau
dcrit au chapitre Acidit volatile en 4.1., ou tout autre appareil rpondant aux
essais dcrits ci-aprs (qui vrifient galement la puret des ractifs) :
a) placer dans le ballon distillation 40-50 ml de solution dhydroxyde de
sodium 30 p. 100, 50 ml dune solution M dacide chlorhydrique. Distiller
la moiti du volume en recueillant le distillat dans 30 ml de solution d'acide
borique 40 g/l additionne de 5 gouttes de solution de rouge de mthyle.
Le virage de l'indicateur doit tre obtenu par 0,1 ml de solution 0,1 M d'acide
chlorhydrique.
b) Un essai semblable est fait avec, en plus des ractifs numrs en a), 10 ml
de solution 0,05 M de sulfate dammonium, contenant 3,55 g/l de
(NH4)2SO4. Dans ce cas, on doit utiliser entre 10 et 10,1 ml de solution
0,1 M dacide chlorhydrique pour obtenir le virage de lindicateur.

OIV-MA-AS322-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Ammonium

3. Ractifs
3.1. Solution M dacide chlorhydrique
3.2. Solution M dhydroxyde de sodium
3.3. Solution neutre pour le lavage de la rsine :
hydrognophosphate de sodium, Na2HPO4.12H2O .. . . . . . . . .. . . 15 g
dihydrognophosphate de potassium, KH2PO4 .. . . . . . . . . . . 3,35 g
eau q.s.p. .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . .... . . . . 1000 ml
Vrifier que le pH est 7 0,2.
3.4. Solution dhydroxyde de sodium 30 p. 100 (m/m), = 1,33 g/ml.
3.5. Solution 0,1 M dacide chlorhydrique.
3.6. Solution de phnolphtaline 1 p. 100 (m/v) dans lalcool neutre, 96% vol.
3.7. Solution de vert de bromocrsol 1 p. 100 (m/v) :
vert de bromocrsol .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . .
1g
dissoudre dans une solution 0,1 M dhydroxyde de sodium .. . 14 ml
eau q.s.p. .. . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . . . . . .. . . . . . . . . . . . 100 ml
3.8. Solution hydroalcoolique de rouge de mthyle 0,2 p. 100 (m/v) :
rouge de mthyle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . .. 0,2 g
alcool 95% vol. . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . .. . . ... 60 ml
eau q.s.p. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100 ml
3.9. Solution dacide borique :
40 g
Acide borique . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . .
eau q.s.p. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . 1000 ml
Cette solution, additionne de 5 gouttes de solution de rouge de mthyle, doit
devenir rose par addition de 0,1 ml au plus de solution 0,1 M dacide
chlorhydrique. Lorsque lacide borique dont on dispose contient une petite
quantit de bases comme impurets, il est possible de corriger ce dfaut en
ajoutant la solution 5 gouttes dun de ces deux indicateurs et den amener le
virage par quelques gouttes dacide chlorhydrique 0,1 M.
4. Mode opratoire
Placer 50 ml de lchantillon analyser dans un vase cylindrique de 250 ml.
Ajouter un volume de solution M dhydroxyde de sodium gal (n 0,5) ml,
n tant le volume de solution 0,1 M dhydroxyde de sodium utilis dans le titrage
de lacidit totale sur 10 ml de vin. Les faire passer sur la colonne de rsine
changeuse de cations prpare ci-dessus, raison de une goutte toutes les deux
secondes. Le pH de leffluent doit tre compris entre 4 et 5. Rincer la colonne avec
50 ml deau distille qui doit passer avec la mme vitesse.
OIV-MA-AS322-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Ammonium

Le cation ammonium ainsi que les autres cations sont quantitativement fixs. Les
amides, les oligopeptides et la presque totalit des acides amins sont entrans par
les eaux de lavage.
luer ensuite les cations fixs par la rsine avec 50 ml dune solution M dacide
chlorhydrique et rincer avec 50 ml deau distille.* Lluat et les eaux de lavage
sont recueillis dans un ballon distillation fond rond de un litre.
Ajouter 1 goutte de solution de phnolphtaline 1 p. 100 et une quantit
suffisante de solution dhydroxyde de sodium 30 p. 100 pour obtenir une raction
franchement alcaline, en ayant soin de refroidir constamment le ballon pendant
cette addition. Distiller ensuite la moiti environ du volume du liquide qui se
trouve dans le ballon distillation en recueillant le distillat dans 30 ml de solution
dacide borique 40 g/l.
Titrer lammoniaque distille en prsence de vert de bromocrsol ou de rouge de
mthyle, laide dune solution 0,1 M dacide chlorhydrique, soit n ml le volume
vers.
5. Expression des rsultats
La teneur en ammonium, NH4, est exprime en milligrammes par litre sans
dcimale.
5.1. Calcul
La teneur en ammonium, exprime en milligrammes par litre est :
36 x n
Lorsquon a affaire des vins pauvres en ammonium, effectuer le dosage sur
100 ml de vin. La quantit dammonium est, dans ce cas :
18 x n

BIBLIOGRAPHIE
JAULMES P., Analyse des vins, 1951, 220, Montpellier.
KOURAKOU Mme S., Ann. Fals. Exp. Chim., 1960, 53, 337

* Faire passer 50 ml de la solution tampon neutre et rincer avec de leau avant demployer
la colonne pour un nouveau dosage.
OIV-MA-AS322-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Potassium

Mthode OIV-MA-AS322-02A

Mthode Type II

Potassium
1. Principe des mthodes
Le potassium est dos directement dans le vin dilu par spectrophotomtrie
d'absorption atomique aprs addition d'un tampon spectral de chlorure de
csium pour viter l'ionisation du potassium.

2. Mthode
2.1. Appareillage
Spectrophotomtre d'absorption atomique quip d'un brleur aliment par de
l'air et de l'actylne.
Lampe cathode creuse au potassium.
2.2. Ractifs
2.2.1. Solution de potassium 1 g par litre
Utiliser une solution standard de potassium du commerce 1 g/l. Cette solution
peut tre prpare en dissolvant 4,813 g d'hydrognotartrate de potassium dans
de l'eau distille et en ajustant le volume 1 litre.
2.2.2. Solution modle
3,5 g
Acide citrique (C6H8O7.H2O) ...
Saccharose
1,5 g
5,0 g
Glycrol ..
Chlorure de calcium anhydre (CaCl2) 50 mg
Chlorure de magnsium anhydre (Mg Cl2) 50 mg
Alcool absolu ....... 50 ml
Eau q.s.p. 500 ml
2.2.3. Solution de chlorure de csium 5 p. 100 en csium
Dissoudre 6,330 g de chlorure de csium (CsCl) dans 100 ml d'eau distille.
2.3. Mode opratoire
2.3.1. Prparation de l'chantillon
1
Prlever 2,5 ml de vin (pralablement dilu /10), les placer dans une fiole
jauge de 50 ml, ajouter 1 ml de la solution de chlorure de csium (2.1.3) et
amener au trait de jauge avec de l'eau distille.
2.3.2. talonnage

OIV-MA-AS322-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Potassium

Dans une srie de fioles jauges de 100 ml, introduire 5 ml de solution modle,
placer 0 - 2,0 - 4,0 - 6,0 - 8,0 ml de la solution de potassium 1 g par litre
1
(pralablement dilue au /10), ajouter dans toutes les fioles 2 ml de la solution
de chlorure de csium (2.1.3), ajuster le volume 100 ml avec de l'eau distille.
Les solutions-talons prpares titrent respectivement 0-2-4-6-8 mg de
potassium par litre et contiennent 1 g de csium par litre. Ces solutions seront
conserves dans des flacons en polythylne.
2.3.3. Dosage
Slectionner la longueur d'onde 769,9 nm. Rgler le zro de l'chelle des
absorbances avec la solution modle contenant 1 g de csium par litre. Aspirer
directement le vin dilu dans le brleur du spectrophotomtre puis
successivement les solutions talons; relever les absorbances. Effecteur les
dterminations en double.
2.4. Expression des rsultats
2.4.1. Mode de calcul
Tracer la courbe de variation de l'absorbance en fonction de la concentration en
potassium des solutions-talons.
Reporter la valeur moyenne des absorbances obtenues pour l'chantillon de vin
dilu sur cette courbe et dterminer la concentration C en potassium en
milligrammes par litre.
La concentration en potassium exprime en milligrammes par litre de vin, sans
dcimale, sera:
FxC
F = facteur de dilution (ici 200).
2.4.2. Rptabilit (r)

r = 35 mg/l.

2.4.3. Reproductibilit (R) R = 66 mg/l.

2.4.4. Autres expressions des rsultats

en milliquivalents par litre : 0,0256 x F x C


en tartrate acide de potassium en milligrammes par litre 4,813 x F x C.

OIV-MA-AS322-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Potassium

Mthode OIV-MA-AS322-02B

Mthode Type III

Potassium
1. Principe des mthodes
Le potassium est dos directement dans le vin dilu par photomtrie de flamme.

2. Mthode
3.1. Appareillage
3.1.1. Photomtre flamme aliment par un mlange air-butane.
3.2. Ractifs
3.2.1. Solution de rfrence 100 mg de potassium par litre
Alcool absolu .... 10 ml
Acide citrique C6H8O7, H2O .... 700 mg
Saccharose . 300 mg
Glycrol .. 1000 mg
Chlorure de sodium dessch, NaCl .. 50,8 mg
Chlorure de calcium anhydre, Ca Cl2 . 10 mg
Chlorure de magnsium anhydre (Mg Cl2) . 10 mg
Hydrognotartrate de potassium dessch ...481,3 mg
Eau q.s.p. ... 1000 ml
3.2.2. Solution de dilution
Alcool absolu .. 10 ml
Acide citrique C6H8O7, H2O ... 700 mg
Saccharose . 300 mg
Glycrol .. 1000 mg
Chlorure de sodium dessch, NaCl 50,8 mg
Chlorure de calcium anhydre, Ca Cl2 10 mg
Chlorure de magnsium anhydre (Mg Cl2) .. 10 mg
Hydrognotartrate de potassium dessch . 383 mg
Eau q.s.p. 1000 ml
Pour prparer les solutions 3.2.1. et 3.2.2., dissoudre l'hydrognotartrate de
potassium dans environ 500 ml deau distille trs chaude, mlanger la solution
aux autres constituants pralablement dissous dans 400 ml deau distille et
ajuster 1 litre.
OIV-MA-AS322-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Potassium

Ces solutions, additionnes de 2 gouttes d'isothiocyanate d'allyle seront


conserves dans des flacons en polythylne.
3.3. Mode opratoire
3.3.1. talonnage
Dans quatre fioles jauges de 100 ml, placer 25-50-75-100 ml de la solution de
rfrence et complter 100 ml avec la solution de dilution. On obtient ainsi
des solutions contenant respectivement 25-50-75-100 mg par litre de
potassium.
3.3.2. Dosage
Effectuer les mesures 766 nm. Rgler le 100 % de transmission avec de l'eau
distille. Aspirer directement dans le brleur du photomtre, successivement les
me
avec de l'eau distille et relever
solutions-talons, puis le vin dilu au 1/10
les pourcentages de transmission. Si cela est ncessaire, diluer nouveau le vin
me
dj dilu au 1/10 , avec la solution de dilution.
3.4. Expression des rsultats
3.4.1. Mode de calcul
Tracer la courbe de variation des pourcentages de transmission en fonction de
la concentration en potassium des solutions-talons. Reporter la transmission
obtenue pour l'chantillon de vin dilu sur cette courbe et dterminer la
concentration C en potassium.
La concentration en milligrammes de potassium par litre sans dcimale sera:
CxF
F = facteur de dilution.
3.4.2.Rptabilit (r)

r = 17 mg/l.

3.4.3. Reproductibilit (R) R = 66 mg/l.


3.4.4. Autres expressions des rsultats:
- en milliquivalents par litre: 0,0256 x Fx C
- en hydrognotartrate acide de potassium par litre: 4,813 xF x C.

OIV-MA-AS322-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Potassium

Mthode OIV-MA-AS322-02C

Mthode Type IV

Potassium

Dosage du potassium par pese du ttraphnylborure prcipit

SUPPRIME
(Rsolution OIV-Oeno-377-2009)

OIV-MA-AS322-02C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sodium

Mthode OIV-MA-AS322-03A

Mthode Type II

Sodium
1. Principe des mthodes
Spectrophotomtrie d'absorption atomique
Le sodium est dos directement dans le vin par spectrophotomtrie d'absorption
atomique aprs addition d'un tampon spectral de chlorure de csium pour viter
l'ionisation du sodium.

2. Mthode
2.1. Appareillage
- Spectrophotomtre d'absorption atomique quip d'un brleur aliment par de
l'air et de l'actylne.
- Lampe cathode creuse au sodium.
2.2. Ractifs
2.2.1. Solution de sodium 1 g par litre
Utiliser une solution standard de sodium du commerce 1 g/l. Cette solution
peut tre prpare en dissolvant 2,542 g de chlorure de sodium NaCl, dessch,
dans de l'eau distille et en ajustant le volume 1 litre.
Conserver cette solution dans un flacon en polythylne.
2.2.2. Solution modle
Acide citrique, (C6H8O7.H2O) .................... 3,5 g
Saccharose ................................................. 1,5 g
Glycrol ........................................................... 5,0 g
Chlorure de calcium anhydre (CaCl2) ....................... 50 mg
Chlorure de magnsium anhydre, (MgCl2) ................ 50 mg
Alcool absolu ............................................... 50 ml
Eau q.s.p. ............................ 500 ml
2.1.3. Solution de chlorure de csium 5 p. 100 en csium
Dissoudre 6,330 g de chlorure de csium (CsCl) dans 100 ml d'eau distille.
2.3. Mode opratoire
2.3.1. Prparation de l'chantillon
Prlever 2,5 ml de vin, les placer dans une fiole jauge de 50 ml, ajouter 1 ml
de la solution de chlorure de csium et amener au trait repre avec de l'eau
distille.
2.3.2. talonnage
OIV-MA-AS322-03A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sodium

Dans une srie de fioles jauges de 100 ml introduire 5,0 ml de solution


modle, placer 0-2,5-5-7,5-10 ml de la solution de sodium 1 g/l pralablement
dilue 1/100, ajouter dans toutes les fioles 2 ml de la solution de chlorure de
csium et ajuster le volume 100 ml avec de l'eau distille.
Les solutions talons prpares titrent respectivement 0-0,25-0,50-0,75-1,00
mg de sodium par litre et contiennent 1 g de csium par litre. Ces solutions
seront conserves dans des flacons en polythylne.
2.3.3. Dosage
Slectionner la longueur d'onde 589 nm. Rgler le zro de l'chelle des
absorbances avec la solution modle contenant 1 g de csium par litre. Aspirer
directement le vin dilu dans le brleur du spectrophotomtre puis
successivement les solutions talons. Relever les absorbances. Effectuer les
dterminations en double.
2.4. Expression des rsultats
2.4.1. Mode de calcul
Tracer la courbe de variation de l'absorbance en fonction de la concentration en
sodium des solutions talons.
Reporter la valeur moyenne des absorbances obtenues pour l'chantillon sur
cette courbe et dterminer la concentration C en sodium en milligrammes par
litre.
La concentration en sodium exprime en milligrammes par litre de vin sans
dcimale sera :
20. C

2.4.2. Rptabilit (r) r = 1 + 0,024 xi


xi = concentration en sodium de l'chantillon en mg/l.
2.4.3. Reproductibilit (R) R = 2,5 + 0,05 xi
xi = concentration en sodium de l'chantillon en mg/l.

OIV-MA-AS322-03A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sodium

Mthode OIV-MA-AS322-03B

Mthode Type III

Sodium
1. Principe des mthodes
Photomtrie de flamme
1
Le sodium est dos directement dans le vin dilu au moins /10 par photomtrie
de flamme
2. Mthode
2.1. Appareillage
2.1.1. Photomtre de flamme aliment par un mlange air-butane.
2.2. Ractifs
2.2.1. Solution talon de sodium 20 mg par litre
10 ml
Alcool absolu .........................................
Acide citrique, (C6H8O7.H2O) ................ 700 mg
Saccharose ......................................................... 300 mg
Glycrol .......................................................... 1000 mg
Hydrognotartrate de potassium .. 481,3 mg
10 mg
Chlorure de calcium anhydre (CaCl2) ...............
10 mg
Chlorure de magnsium anhydre, (MgCl2) ............
Chlorure de sodium dessch . 50,84 mg
1l
Eau q.s.p. ............................................
2.2.2. Solution de dilution
Alcool absolu................................................
10 ml
Acide citrique, (C6H8O7 H2O) .................... 700 mg
Saccharose ......................................................... 300 mg
Glycrol .......................................................... 1000 mg
Tartrate de potassium .. 481,3 mg
10 mg
Chlorure de calcium anhydre (CaCl2) ...................
10 mg
Chlorure de magnsium anhydre, (MgCl2) ................
1l
Eau q.s.p. ............................................
Pour prparer les solutions 2.2.1 et 2.2.2, dissoudre l'hydrognotartrate de
potassium dans 500 ml environ d'eau distille trs chaude, mlanger la solution aux
autres constituants pralablement dissous dans 400 ml d'eau distille et ajuster
1 litre.
Ces solutions additionnes de 2gouttes d'isothiocyanate d'allyle seront conserves
dans des flacons en polythylne.
2.3. Mode opratoire
OIV-MA-AS322-03B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Sodium

2.3.1. talonnage
Dans une srie de fioles jauges de 100 ml, placer 5-10-15-20-25 ml de la
solution de sodium 20 mg/l et complter 100 ml avec la solution de dilution.
On obtient ainsi des solutions contenant respectivement 1-2-3-4-5 mg de
sodium par litre.
2.3.2. Dosage
Effectuer les mesures 589 nm. Rgler le 100 % de transmission avec de l'eau
distille. Aspirer directement dans le brleur du photomtre, successivement les
solutions-talons, puis le vin dilu au 1/10 avec de l'eau distille et relever les
pourcentages de transmission. Si cela est ncessaire, diluer le vin dj dilu au
1
/10 , avec la solution de dilution.
2.4. Expression des rsultats
2.4.1. Mode de calcul
Tracer la courbe des variations du pourcentage de transmission en fonction de
la concentration en sodium des solutions talons. Reporter la transmission
obtenue pour l'chantillon de vin dilu sur cette courbe et relever la
concentration C en sodium.
La concentration en milligrammes de sodium par litre sans dcimale sera :
CF
F = Facteur de dilution.
2.4.2. Rptabilit (r)
Sauf vins de liqueur,
Vins de liqueur

r = 1,4 mg/l
r = 2,0 mg/l.

2.4.3. Reproductibilit (R)


R = 4,7 + 0,08 xi.
xi = concentration en sodium de l'chantillon en mg/l.

OIV-MA-AS322-03B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Calcium

Mthode OIV-MA-AS322-04

Mthode Type II

Calcium
1. Principe
Le calcium est dos directement dans le vin convenablement dilu par
spectrophotomtrie d'absorption atomique, aprs addition d'un tampon spectral.
2. Appareillage
2.1. Spectrophotomtre d'absorption atomique quip d'un brleur aliment par de
l'air et de l'actylne.
2.2. Lampe cathode creuse au calcium.
3. Ractifs
3.1. Solution talon de calcium titrant 1 g par litre. Utiliser une solution standard de
calcium du commerce, 1 g par litre.
Cette solution peut tre prpare en dissolvant 2,5 g de carbonate de calcium,
(CaCO3), dans la quantit suffisante dacide chlorhydrique dilu au 1/10 (v/v)
pour obtenir sa dissolution et en ajustant le volume 1 litre avec de l'eau
distille.
3.2. Solution talon dilue de calcium titrant 50 mg par litre.
Remarque : Conserver les solutions-talons de calcium dans des flacons en
polythylne.
3.3. Solution de chlorure de lanthane 50 g/l en lanthane.
Dissoudre 13,369 g de chlorure de lanthane La Cl3.7H2O, dans de l'eau
distille; ajouter 1 ml dacide chlorhydrique dilu 1/10 (v/v) et ajuster le
volume 100 ml.
4. Mode opratoire
4.1. Prparation de l'chantillon
Dans une fiole jauge de 20 ml, placer 1 ml de vin, 2 ml de solution 3.3 et
amener au trait de jauge avec de l'eau distille. Le vin dilu au 1/20, titre 5 g de
lanthane par litre.
Remarque : Pour les vins doux, la concentration de 5 g de lanthane par litre est
suffisante condition que la dilution amne la teneur en sucres moins de 2,5
g par litre. Pour des concentrations suprieures en sucres, il est ncessaire de
porter 10 g par litre la teneur en lanthane.
4.2. talonnage
OIV-MA-AS322-04 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Calcium

Dans une srie de fioles jauges de 100 ml placer 0-5-10-15 et 20 ml de la


solution 3.2, ajouter dans toutes les fioles 10 ml de la solution 3.3 et ajuster le
volume 100 ml avec de l'eau distille. Les solutions-talons prpares titrent
respectivement 0-2,5-5-7,5 et 10 mg de calcium par litre et contiennent 5 g de
lanthane par litre. Ces solutions seront conserves dans des flacons en
polythylne.
4.3. Dosage
Slectionner la longueur d'onde 422,7 nm. Rgler le zro de l'chelle des
absorbances avec la solution contenant 5 g de lanthane par litre. Aspirer
directement le vin dilu dans le brleur du spectrophotomtre, puis
successivement les solutions-talons prpares en 4.2. Relever les absorbances.
Effectuer les dterminations en double.
5. Expression des rsultats
5.1. Mode de calcul
Tracer la courbe de variation de l'absorbance en fonction de la concentration en
calcium des solutions-talons.
Reporter la valeur moyenne des absorbances obtenues pour l'chantillon de vin
dilu sur cette courbe et dterminer sa concentration C en calcium. La
concentration en calcium exprim en milligrammes par litre de vin sans
dcimale sera:
20 x C
5.2. Rptabilit (r) :
teneur < 60 mg/l:
teneur > 60 mg/l:

r = 2,7 mg/l
r = 4,0 mg/l.

5.3.Reproductibilit (R) :
R mg/l = 0,114 i - 0,5
i = concentration en mg/l de l'chantillon.

OIV-MA-AS322-04 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Fer

Mthode OIV-MA-AS322-05A

Mthode Type IV

Fer
1. Principe des mthodes
Aprs dilution convenable du vin et limination de l'alcool, le fer est dos
directement par spectrophotomtrie d'absorption atomique.

2. Mthode
2.1. Appareillage
2.1.1. vaporateur rotatif avec bain d'eau thermostat.
2.1.2. Spectrophotomtre d'absorption atomique quip d'un brleur aliment
par de l'air et de l'actylne.
2.1.3. Lampe cathode creuse en fer.2.3. Mode opratoire
2.2. Ractifs
2.2.1. Solution talon concentre de fer III titrant 1 g par litre.
Utiliser une solution standard du commerce 1 g/l. Cette solution peut tre
prpare en dissolvant 8,6341 g de sulfate de fer III et d'ammonium
(FeNH4(SO4)2.12H2O) dans de l'eau distille lgrement acidifie par de l'acide
chlorhydrique M et en ajustant le volume 1 litre.
2.2.2. Solution talon dilue de fer titrant 100 milligrammes par litre.
2.3. Mode opratoire
2.3.1. Prparation de l'chantillon
liminer l'alcool du vin par concentration du volume de l'chantillon au demi
l'aide d'un vaporateur rotatif (50-60 C). Ramener au volume initial avec de
l'eau distille. Effectuer si ncessaire une dilution pralablement au dosage
2.3.2. talonnage
Dans une srie de fioles jauges de 100 ml, placer 1-2-3-4-5 ml de la solution
de fer 100 milligrammes par litre et complter 100 ml avec de l'eau distille.
Les solutions prpares titrent respectivement 1-2-3-4-5 mg de fer par litre.
Ces solutions seront conserves dans des flacons en polythylne.
2.3.3. Dosage
Slectionner la longueur d'onde 248,3 nm. Rgler le zro de l'chelle des
absorbances avec de l'eau distille. Aspirer directement l'chantillon dilu dans
le brleur du spectrophotomtre puis successivement les solutions-talons
prpares en 2.3.2. Relever les absorbances. Effectuer les dterminations en
double.
OIV-MA-AS322-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Fer

2.4. Expression des rsultats


2.4.1. Mode de calcul
Tracer la courbe de variation de l'absorbance en fonction de la concentration en
fer des solutions-talons. Reporter la valeur moyenne de l'absorbance obtenue
pour l'chantillon de vin dilu sur cette courbe et dterminer la concentration C
en fer.
La concentration en fer exprime en milligrammes par litre de vin avec
1 dcimale sera :
CxF
F = facteur de dilution.

OIV-MA-AS322-05A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Fer

Mthode OIV-MA-AS322-05B

Mthode Type IV

Fer
1. Principe des mthodes
Aprs minralisation du vin par le peroxyde d'hydrogne, le fer qui se trouve
l'tat de fer II est dos grce la coloration rouge qu'il donne avec
l'orthophnanthroline.
2. Mthode
2.1. Appareillage
2.1.1. Fiole ovode de Kjeldahl de 100 ml.
2.1.2. Spectrophotomtre permettant d'effectuer des mesures la longueur
d'onde de 508 nm.
2.2. Ractifs
2.2.1. Solution de peroxyde d'hydrogne (H2O2) 30 p. 100 (m/g) exempt de
fer.
2.2.2. Solution M d'acide chlorhydrique, exempt de fer.
2.2.3. Hydroxyde d'ammonium, (20 = 0,92 g/ml).
2.2.4. Pierre ponce traite par l'acide chlorhydrique au 1/2 bouillant et lave
avec de l'eau distille.
2.2.5. Solution d'hydroquinone 2,5 p. 100, acidifie par 1 ml d'acide
sulfurique pur pour 100 ml de solution. Cette solution est conserve dans un
flacon jaune au rfrigrateur et remplace ds apparition du moindre
brunissement.
2.2.6. Solution de sulfite de sodium 20 p. 100 prpare partir du sulfite
neutre et anhydre.
2.2.7. Solution d'orthophnanthroline 0,5 p. 100 dans l'alcool 96 % vol.
2.2.8. Solution d'actate d'ammonium 20 p. 100.
2.2.9. Solution de fer III 1 g de fer par litre. Utiliser une solution standard du
commerce. Cette solution peut tre prpare en dissolvant 8,6341 g de sulfate
de fer et d'ammonium (FeNH4 (SO4)2.12H2O) dans 100 ml de solution M
d'acide chlorhydrique et en ajustant le volume 1 litre avec la solution M
d'acide chlorhydrique.
2.2.10 Solution talon dilue de fer 100 milligrammes par litre.
OIV-MA-AS322-05B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Fer

2.3. Mode opratoire


2.3.1.Minralisation
2.3.1.1. Vin dont la teneur en sucres est infrieure 50 g/l :
Dans la fiole de Kjeldahl introduire 25 ml de vin, 10 ml de solution de
peroxyde d'hydrogne et quelques grains de pierre ponce. Concentrer le liquide
jusqu' un volume de 2 3 ml. Aprs refroidissement, ajouter au rsidu obtenu,
sans mouiller les parois du ballon, de l'hydroxyde d'ammonium en quantit
ncessaire pour alcaliniser le milieu et prcipiter les hydroxydes.
Aprs refroidissement, additionner le liquide alcalin de solution M d'acide
chlorhydrique en quantit ncessaire pour dissoudre le prcipit des
hydroxydes et transvaser la solution obtenue dans une fiole jauge de 100 ml.
Aprs rinage de la fiole de Kjeldahl avec la solution M d'acide chlorhydrique,
ajuster le volume 100 ml l'aide de la mme solution.
2.3.1.2. Mots et vins dont la teneur en sucres est suprieure 50 g/l :

Teneur en sucres comprise entre 50 et 200 g/l : la prise d'essai de 25 ml de


mot ou de vin est traite par 20 ml de solution de peroxyde d'hydrogne

Teneur en sucres suprieure 200 g/l : les chantillons de mot ou de vin


doivent tre pralablement dilus au ou mme au ; la prise dessai de
25 ml dchantillon dilu est traite par 20 ml de solution de peroxyde
dhydrogne.

2.3.2. Essai blanc


Effectuer un essai blanc avec de l'eau distille en employant le mme volume
de solution de peroxyde d'hydrogne que celui utilis pour la minralisation et
en suivant le protocole exprimental dcrit en 2.3.1.1.
2.3.3. Dosage
Prlever 20 ml de la solution chlorhydrique du produit de minralisation de
l'chantillon et 20 ml de la solution chlorhydrique essai blanc et les
introduire dans deux fioles jauges de 50 ml. Ajouter dans chaque fiole 2 ml de
la solution d'hydroquinone, 2 ml de la solution de sulfite et 1 ml de la solution
d'orthophnanthroline. Laisser au repos pendant 15 min. pour favoriser la
rduction du Fe III en Fe II. Ajouter 10 ml de la solution d'actate
d'ammonium, ajuster le volume 50 ml avec de l'eau distille et agiter les deux
fioles jauges. Mesurer l'absorbance 508 nm de la solution doser en rglant
le zro de l'chelle des absorbances avec la solution provenant de l'essai
blanc.
2.3.4. talonnage

OIV-MA-AS322-05B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Fer

Dans une srie de fioles jauges de 50 ml, placer 0,5-1-1,5-2 ml de la solution


100 mg de fer par litre, 20 ml d'eau distille; continuer selon le mode opratoire
dcrit en 2.3.3 et mesurer labsorbance de chacune des solutions talons
prpares, correspondent respectivement 50-100-150-200 microgrammes de
fer dans la prise d'essai.
2.4. Expression des rsultats
2.4.1. Mode de calcul
Tracer la courbe des variations de l'absorbance en fonction de la concentration
en fer des solutions talons. Reporter l'absorbance obtenue pour la solution
examiner et dterminer la concentration en fer C contenue dans la prise d'essai
de 20 ml de solution chlorhydrique de minralisation, c'est--dire dans 5 ml
d'chantillon analyser.
La concentration en fer exprime en milligrammes par litre de vin avec 1
dcimale sera :
200 x C.
Si le vin (ou le mot) a t dilu, la concentration en fer exprime en
milligrammes par litre de vin avec 1 dcimale sera :
200 x C x F.
F = facteur de dilution.

OIV-MA-AS322-05B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Cuivre

Mthode OIV-MA-AS322-06

Mthode Type IV

Cuivre
(Rsolution Oeno 377/2009)
1. Principe de la mthode
Emploi de la spectrophotomtrie d'absorption atomique.
2. Appareillage
2.1. Capsule de platine.
2.2. Spectrophotomtre d'absorption atomique.
2.3. Lampe cathode creuse au cuivre.
2.4. Gaz d'alimentation: actylne/air ou actylne/protoxyde d'azote.
3. Ractifs
3.1. Cuivre mtal.
3.2. Acide nitrique concentr 65 % (20 = 1,38 g/ml).
3.3. Acide nitrique dilu 1/2 (v/v).
3.4. Solution de cuivre 1 g/l
Utiliser une solution standard de cuivre du commerce. Cette solution peut tre
prpare en pesant 1,000 g de cuivre mtal, qui est transfr quantitativement
dans une fiole jauge de 1000 ml. Ajouter de l'acide nitrique dilu 1/2 en
quantit strictement suffisante pour dissoudre le mtal, ajouter 10 ml d'acide
nitrique concentr, porter au trait repre avec de l'eau bidistille.
3.5. Solution de cuivre 100 mg/l.
Prlever 10 ml de la solution 3.4 et les placer dans une fiole jauge de 100 ml
en compltant le volume avec de l'eau bidistille.
3.6. Eau bidistille
4. Mode opratoire
4.1. Prparation de l'chantillon et dosage du cuivre
Prlever 20 ml de lchantillon, les placer dans une fiole jauge de 100 ml et
amener au trait repre avec de leau bidistille. Modifier la dilution si
ncessaire.
Lire au spectrophotomtre dabsorption atomique labsorbance de lchantillon
dilu, la longueur donde de 324,8 nm, aprs avoir rgl le zro de lchelle
des absorbances avec de leau distille.
OIV-MA-AS322-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Cuivre

4.2. tablissement de la courbe dtalonnage


Prlever 0,5-1-2 ml de solution 100 mg de cuivre par litre, les placer dans des
fioles jauges de 100 ml en compltant le volume avec de l'eau bidistille; les
solutions obtenues contiennent respectivement 0,5-1-2 mg/l de cuivre. Avec les
valeurs des absorbances de ces solutions, mesures comme il est dcrit au point
4.1., construire la courbe dtalonnage.
5. Expression des rsultats
Reporter labsorbance lue pour le dosage sur la courbe dtalonnage et relever la
concentration C en mg/l.
Si F est le facteur de dilution, la teneur du vin en cuivre en milligrammes par litre
est:
F x C.
Elle est donne avec 2 dcimales.
Remarques:
a) Les solutions pour l'tablissement de la courbe d'talonnage et les dilutions de
l'chantillon doivent toutefois tre choisies en fonction de la sensibilit de
l'appareil utilis et de la concentration en cuivre prsente dans l'chantillon.
b) Pour une srie de dterminations, il est opportun de contrler au moins un point
de la courbe dtalonnage.
c) Pour des concentrations trs faibles en cuivre dans l'chantillon, le mode
opratoire est le suivant: placer 100 ml d'chantillon dans une capsule de
platine, vaporer au bain d'eau 100 C jusqu' consistance sirupeuse, ajouter
goutte goutte 2,5 ml d'acide nitrique concentr en cherchant recouvrir tout le
fond de la capsule. Procder avec prcaution l'incinration du rsidu sur une
plaque chauffante lectrique ou bien sur une petite flamme; introduire ensuite la
capsule dans un four moufle rgl 500 C 25 C, la laisser pendant environ
une heure. Aprs refroidissement, humecter les cendres avec 1 ml d'acide
nitrique concentr en les crasant avec une petite baguette de verre, vaporer et
incinrer nouveau comme prcdemment. Porter nouveau la capsule dans le
four pendant 15 min.; rpter au moins trois fois ce traitement avec l'acide
nitrique concentr. Solubiliser les cendres en ajoutant dans la capsule 1 ml
d'acide nitrique concentr et 2 ml d'eau bidistille; transvaser dans une fiole
jauge de 10 ml. Laver la capsule trois fois avec 2 ml chaque fois d'eau
bidistille, complter au trait repre avec de l'eau bidistille. Procder au dosage
comme il est indiqu en 4.1. en utilisant les 10 ml de solution; tenir compte du
facteur de concentration pour lexpression des rsultats.

OIV-MA-AS322-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Magnsium

Mthode OIV-MA-AS322-07

Mthode Type II

Magnsium
1. Principe
Le magnsium est dos directement dans le vin convenablement dilu par
spectrophotomtrie d'absorption atomique.
2. Appareillage
2.1. Spectrophotomtre d'absorption atomique quip d'un brleur aliment par de
l'air et de l'actylne.
2.2. Lampe cathode creuse au magnsium.
3. Ractifs
2.1. Solution talon concentre de magnsium titrant 1 g par litre.
Utiliser une solution standard de magnsium du commerce, 1 g/l.
Cette solution peut tre prpare en dissolvant 8,3646 g de chlorure de
magnsium (MgCl2.6H2O) dans de l'eau distille et en ajustant le volume
1 litre.
2.2. Solution talon dilue de magnsium titrant 5 mg par litre.
Remarque : Conserver les solutions-talons de magnsium dans des flacons en
polythylne.

4. Mode opratoire
4.1. Prparation de l'chantillon
Diluer le vin au 1/100 avec de l'eau distille.
4.2. talonnage
Dans une srie de fioles jauges de 100 ml, placer 5-10-15 et 20 ml de la
solution 3.2 et complter 100 ml avec de l'eau distille. Les solutions
prpares titrent respectivement 0,25-0,50-0,75-1 mg de magnsium par litre.
Ces solutions seront conserves dans des flacons en polythylne.
4.3. Dosage
Slectionner la longueur d'onde 285 nm. Rgler le zro de l'chelle des
absorbances avec de l'eau distille. Aspirer directement le vin dilu dans le
brleur du spectrophotomtre, puis successivement, les solutions-talons
prpares en 4.2.
Relever les absorbances; effectuer les dterminations en double.

OIV-MA-AS322-07 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Magnsium

5. Expression des rsultats


5.1. Mode de calcul
Tracer la courbe de variation de l'absorbance en fonction de la concentration en
magnsium des solutions-talons.
Reporter la valeur moyenne des absorbances obtenues pour l'chantillon de vin
dilu sur cette courbe et dterminer la concentration en C en magnsium.
La concentration en magnsium exprime en milligrammes par litre de vin sans
dcimale sera :
100 x C.
5.2. Rptabilit (r) :

r = 3 mg/l.

5.3. Reproductibilit (R) :

R = 8 mg/l.

OIV-MA-AS322-07 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Zinc

Mthode OIV-MA-AS322-08

Mthode Type IV

Zinc
1. Principe
Le zinc est dos directement dans le vin dsalcoolis par spectrophotomtrie
d'absorption atomique.
2. Appareillage
2.1. vaporateur rotatif avec bain d'eau thermostat.
2.2. Spectrophotomtre d'absorption atomique quip d'un brleur aliment par de
l'air et de l'actylne.
2.3. Lampe cathode creuse en zinc.
3. Ractifs
L'eau utilise doit tre de l'eau bidistille dans un appareil en verre borosilicat ou
de l'eau de puret quivalente.
3.1. Solution talon de zinc 1 g par litre.
Utiliser une solution standard de zinc du commerce. Cette solution peut tre
prpare en dissolvant 4,3975 g de sulfate de zinc (ZnSO4.7H2O) dans de l'eau
et en ajustant le volume un litre.
3.2. Solution talon dilue de zinc titrant 100 milligrammes par litre.
4. Mode opratoire
4.1. Prparation de l'chantillon
liminer l'alcool du vin par concentration au 1/2 de 100 ml de vin placs dans
un vaporateur rotatif (temprature: 50-60 C). Ramener au volume initial de
100 ml avec de l'eau bidistille.
4.2. talonnage
Dans une srie de fioles jauges de 100 ml, placer 0,5-1-1,5-2 ml de la solution
de zinc 100 mg/l et ajuster au trait de jauge avec de l'eau bidistille. Les
solutions talons correspondent respectivement 0,5-1-1,5 et 2 mg de zinc par
litre.
4.3. Dosage
Slectionner la longueur d'onde 213,9 nm. Rgler le zro de l'chelle des
absorbances avec de l'eau bidistille. Aspirer directement le vin dans le brleur
OIV-MA-AS322-08 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Zinc

du spectrophotomtre, puis successivement les solutions talons. Relever les


absorbances. Effectuer les dterminations en double.
5. Expression des rsultats
5.1. Mode de calcul
Tracer la courbe de variation de l'absorbance en fonction de la concentration en
zinc des solutions talons. Reporter la valeur moyenne des absorbances obtenues
pour le vin et dterminer la concentration en zinc en milligrammes par litre de vin,
avec une dcimale.

OIV-MA-AS322-08 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Argent

Mthode OIV-MA-AS322-09

Mthode Type IV

Argent
1. Principe de la mthode
Emploi de la spectrophotomtrie d'absorption atomique prcde de la
minralisation de l'chantillon.
2. Appareillage
2.1. Capsule de platine.
2.2. Bain d'eau thermostat 100 C.
2.3. Four rgul 500525 C.
2.4. Spectrophotomtre d'absorption atomique.
2.5. Lampe cathode creuse l'argent.
2.6. Gaz d'alimentation : air, actylne
3. Ractifs
3.1. Nitrate d'argent (AgNO3).
3.2. Acide nitrique concentr 65 % (HNO3 20 = 1,38 g/ml).
1
3.3. Acide nitrique dilu /10 (v/v).
3.4. Solution d'argent 1 g/l
Utiliser une solution standard d'argent du commerce. Cette solution peut tre
prpare en dissolvant 1,5750 g de nitrate d'agent dans l'acide nitrique dilu et
en ajustant le volume 1000 ml avec l'acide nitrique dilu.
3.5. Solution d'argent 10 mg/l
10 ml de solution 3.4 sont dilus 100 ml avec l'acide nitrique dilu.
4. Mode opratoire
4.1. Prparation de l'chantillon et dosage de largent
Placer 20 ml d'chantillon dans une capsule de platine, vaporer sec sur bain
d'eau 100 C. Incinrer au four jusqu' cendres blanches 500525 C.
Reprendre les cendres avec 1 ml d'acide nitrique concentr, vaporer au bain
d'eau 100 C, rpter l'addition de 1 ml d'acide nitrique et l'vaporation.
Ajouter 5 ml d'acide nitrique dilu et chauffer lgrement jusqu' dissolution.
Effectuer la mesure de labsorbance au spectrophotomtre dabsorption
atomique la longueur donde de 328,1 nm dans une flamme air-actylne.

OIV-MA-AS3232-09 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Argent

4.2. tablissement de la courbe dtalonnage


Dans une srie de fioles jauges de 100 ml, placer 2-4-6-8-10 et 20 ml de
solution 3.5 10 mg d'argent par litre et porter au trait repre avec l'acide
nitrique dilu. Ces solutions contiennent 0,20-0,40-0,60-0,80-1,0 et 2,0 mg/l
d'argent.
Effectuer les mesures au spectrophotomtre dabsorption atomique et tracer la
courbe dtalonnage avec les valeurs dabsorbance trouves.
5. Expression des rsultats
Reporter l'absorbance lue pour le dosage sur la courbe d'talonnage et relever la
concentration C en mg/l.
La teneur du vin en argent, exprime en milligrammes par litre est : 0,25 C.
Elle est donne avec 2 dcimales.
Remarque : Les solutions de rfrence pour l'tablissement de la courbe d'talonnage,
la quantit d'chantillon prleve et le volume final de liquide peuvent tre modifis en
fonction de la sensibilit de l'appareil utilis.

OIV-MA-AS3232-09 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Cadmium

Mthode OIV-MA-AS322-10

Mthode Type IV

Cadmium

1. Principe de la mthode
Le cadmium est dos directement dans le vin par spectrophotomtrie d'absorption
atomique sans flamme.
2. Appareillage
Toute la verrerie doit tre lave au pralable avec de l'acide nitrique concentr
chaud (70-80 C) et rince l'eau bidistille.
2.1. Spectrophotomtre d'absorption atomique quip d'un four graphite, d'un
correcteur de bruit de fond et d'un enregistreur multipotentiomtrique.
2.2. Lampe cathode creuse au cadmium.
2.3. Micropipettes de 5 l munies d'embouts spciaux pour mesures d'absorption
atomique.
3. Ractifs
L'eau utilise doit tre de l'eau bidistille dans un appareil en verre borosilicat ou
de l'eau de puret quivalente. Tous les ractifs doivent tre de puret analytique
reconnue, et en particulier tre exempts de cadmium.
3.1. Acide phosphorique 85 p. 100 (20 = 1,71 g/ml).
3.2. Solution d'acide phosphorique obtenue par dilution de 8 ml d'acide
phosphorique 100 ml avec de l'eau.
3.3. Solution 0,02 M de sel disodique de l'acide thylnediaminettractique
(EDTA).
3.4. Solution tampon pH 9 obtenue par dissolution dans une fiole jauge de 100 ml
de 5,4 g de chlorure d'ammonium dans quelques millilitres d'eau, addition de
35 ml de solution d'hydroxyde d'ammonium (20 = 0,92 g/ml) dilue 25 %
(v/v) et ajustage au trait repre avec de l'eau.
3.5. Noir riochrome T : dilution solide 1 % (m/m) dans du chlorure de sodium.
3.6. Sulfate de cadmium (3CdSO4.8H2O)
Le titre du sulfate de cadmium doit tre vrifi selon le mode opratoire
suivant :

OIV-MA-AS322-10 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Cadmium

Peser exactement 102,6 mg de l'chantillon de sulfate de cadmium, entraner


quantitativement dans un vase cylindrique avec de l'eau, agiter jusqu'
dissolution; ajouter 5 ml de solution tampon pH9, 20 mg environ de noir
riochrome T. Titrer l'aide de la solution d'EDTA jusqu' virage de
l'indicateur au bleu.
Le volume d'EDTA vers doit tre gal 20 ml. Si le volume est peu diffrent,
corriger en consquence la prise d'essai de sulfate de cadmium pese utilise
pour la prparation de la solution de rfrence.
3.7. Solution de rfrence de cadmium 1 g par litre
Utiliser une solution standard du commerce. Cette solution peut tre obtenue
par dissolution de 2,2820 g de sulfate de cadmium dans de l'eau et ajustage du
volume 1 litre. Conserver la solution dans un flacon de verre borosilicat
bouchon rod.
4. Mode opratoire
4.1. Prparation de l'chantillon
Diluer le vin au (v/v) avec la solution d'acide phosphorique.
4.2. Prparation des solutions de la gamme d'talonnage
partir de la solution de rfrence de cadmium, prparer par dilutions
successives des solutions titrant respectivement 2,5-5-10-15 microgrammes de
cadmium par litre.
4.3. Dtermination
4.3.1. Programme du four (propos titre indicatif) :
Schage 100 C pendant 30 s
Minralisation 900 C pendant 20 s
Atomisation 2 250 C pendant 2 3 s
Dbit d'azote (gaz de balayage) : 6 litres par min.
Remarque : En fin d'opration, monte de temprature jusqu' 2700 C pour purger le four.
4.3.2. Mesures d'absorption atomique
Slectionner la longueur donde 228,8 nm. Rgler le zro de lchelle des
absorbances avec de l'eau bidistille. Injecter dans le four, l'aide d'une
micropipette, trois fois 5 l de chacune des solutions de la gamme d'talonnage
et de la solution de l'chantillon analyser. Enregistrer les absorbances
mesures. Calculer la valeur moyenne de l'absorbance partir des rsultats
relatifs aux trois injections.

OIV-MA-AS322-10 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Cadmium

5. Expression des rsultats


5.1. Mode de calcul
Tracer la courbe des variations de l'absorbance en fonction des concentrations
en cadmium des solutions de la gamme d'talonnage. La variation est linaire.
Reporter la valeur moyenne de l'absorbance de la solution de l'chantillon sur la
droite d'talonnage, en dduire la concentration C en cadmium.
La concentration en cadmium exprime en microgrammes par litre de vin est
gale : 2 C.

BIBLIOGRAPHIE
MEDINA B., Application de la spectromtrie d absorption atomique sans flamme au
dosage de quelques mtaux dans les vins, Thse Doct. en (nologie, Bordeaux II, 1978.
MEDINA B. et SUDRAUD P., FV O.I.V 1979, n 695.

OIV-MA-AS322-10 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Plomb

Mthode OIV-MA-AS322-11

Mthodes Type II

Plomb
(Rsolution oeno 3/94)
Principe de la mthode
Le plomb est dos directement dans le vin par spectrophotomtrie d'absorption
atomique sans flamme.

SUPPRIME
(Remplace par la mthode OIV-MA-AS322-12)

OIV-MA-AS322-11 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Mthode OIV-MA-AS322-12

Mthodes Type II

Critres pour les mthodes de dtermination de la teneur


en plomb du vin
(Rsolution Oeno 7/2006)

1.1

Dfinitions des critres de la mthode

justesse

troitesse de laccord entre la valeur moyenne obtenue


partir dune grande srie de rsultats dessais et la valeur de
rfrence accepte.

r=

limite de rptabilit, valeur au-dessous de laquelle la valeur


absolue de la diffrence entre deux rsultats dun mme
essai obtenus sous des conditions de rptabilit (cest dire
mme chantillon, mme oprateur, mme appareillage,
mme laboratoire, et court intervalle de temps), peut tre
attendue dans une limite de probabilit spcifique (en
principe 95 %), do r = 2,8 x sr.

Sr =

cart-type, calcul partir des rsultats obtenus dans des


conditions de rptabilit.

RSDr=

cart-type relatif, calcul partir des rsultats obtenus dans


des conditions de rptabilit [(Sr/ x ) x 100], o x
reprsente la moyenne des rsultats pour tous les laboratoires
et chantillons.

R=

limite de reproductibilit, valeur au-dessous de laquelle la


valeur absolue de la diffrence entre deux rsultats dun
mme essai obtenus dans des conditions de reproductibilit
(cest dire pour un produit identique, obtenu par les
oprateurs dans des laboratoires diffrents en utilisant la
mme mthode dessais), peut tre attendue avec une
certaine probabilit (en principe 95 %) ; R = 2,8 x sR.

SR =

cart-type, calcul partir de rsultats obtenus dans des


conditions de reproductibilit.

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

RSDR =

cart-type relatif calcul partir de rsultats obtenus dans


des conditions de reproductibilit [(SR/ x x 100]

HoR =

valeur du HORRAT: la valeur observe du RSDR, divise


par la valeur RSDR calcule partir de lquation de Horwitz
[1].

2
Mthode danalyse utiliser par le laboratoire et exigences de contrle
pour le laboratoire
2.1

Exigences

Il nexiste pas de mthodes spcifiques de dtermination de la teneur en plomb du


vin. Les laboratoires sont tenus dutiliser une mthode (Type II) valide selon les
exigences de lOIV [2] et qui rpond aux critres de performance figurant dans le
Tableau 1. Les mthodes GFAA (spectromtrie dabsorption atomique au four
graphite) ou ICP-MS (spectromtre de masse) sont applicables condition quelles
respectent les critres de performance indiqus ci-dessous. Chaque fois que
possible, la validation doit inclure un matriau de rfrence certifi dans les
matriaux soumis lessai collaboratif. Dans le cas contraire, une estimation de la
justesse devra tre effectue. Des exemples de mthodes valides pour la
dtermination de la teneur en plomb du vin sont prsents dans les Annexes 1 et 2.

2.2

Considrations gnrales

Tout appareillage entrant en contact avec lchantillon doit tre dun matriau
inerte (par ex. polypropylne, polyttrafluorothylne [PTFE], etc.). Lutilisation
de la cramique nest pas recommande en raison de la prsence possible de plomb.
Si les matriaux disponibles ne sont pas exempts avec certitude des analytes
prcits, leur utilisation doit tre value au moyen dtudes ad hoc, qui doivent
tre considres comme faisant partie intgrante de la validation de la mthode
danalyse. Tout le matriel en plastique, y compris les rcipients pour chantillons,
doivent tre nettoys lacide. Lquipement utilis pour prparer les chantillons
doit si possible tre rserv aux analyses du plomb uniquement.

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Tableau 1 : Critres de performance pour les mthodes danalyse de la teneur


en plomb du vin

Paramtres

Valeur/Commentaire

Applicabilit

Convient pour dterminer le plomb dans le vin dans


des buts officiels.

Limite de dtection

Pas plus dun dixime de la valeur correspondant la


limite de lOIV (exprime en g/l)

Limite de quantification

Pas plus dun cinquime de la valeur correspondant


la limite de lOIV, (exprime en g/l) sauf si la valeur
prcise pour le plomb est infrieure 100 g/l. Dans
ce dernier, pas plus de deux cinquimes de la valeur
prcise.

Fidlit

Valeurs du HORRAT infrieures ou gales 2 dans


lessai collaboratif de validation.

Recouvrement

80 % - 105 % (comme indiqu dans lessai


collaboratif)

Spcificit

Pas dinterfrences spectrales ou de matrice

Justesse

xm

< 1,96 *

sR ( lab ) sr ( lab ) * 1 1 n

o m est la valeur certifie du matriau de rfrence


vin et x est la moyenne de n mesures de la
concentration en plomb de ce vin, dans le mme
laboratoire.
SR(lab) et Sr(lab) reprsentent les carts-types calculs
partir des rsultats obtenus dans un mme laboratoire
dans des conditions de reproductibilit et de
rptabilit.

2.3

Estimation de la justesse analytique et calculs de recouvrement

Chaque fois que possible, la justesse des analyses doit tre estime [3] en incluant
dans la partie analytique les matriaux de rfrence certifis requis. Lanalyste doit
galement bien prendre note des Directives harmonises concernant lutilisation
des taux de recouvrement dans les mesures analytiques [4], mises au point sous les
OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

auspices de lUIPAC, lISO et lAOAC. La rcupration devrait avoisiner 100 %,


auquel cas les calculs de recouvrement sont alors de moindre importance.

Bibliographie

[1]

W Horwitz, Evaluation of Analytical Methods for Regulation of Foods


and Drugs, Anal. Chem., 1982, 54, 67A - 76A

[2]

Protocol for the design, conduct and interpretation of method-performance


studies, FV 1061, OIV, 1998

[3]

ISO 5725-6:1994, 4.2.3. International Organisation for Standardisation,


case Postal 56, CH-1211, Genve 20, Switzerland.

[4]

ISO/AOAC/IUPAC Harmonised Guidelines for the Use of Recovery


Information in Analytical Measurement. Edited Michael Thompson,
Steven L R Ellison, Ales Fajgelj, Paul Willetts and Roger Wood, Pure
Appl. Chem., 1999, 71, 337 348

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

EXEMPLE 1

Dtermination de la teneur en plomb dans les vins par


spectrophotomtrie dabsorption atomique
1

DOMAINE DAPPLICATION

La mthode peut tre utilise pour les vins rouges, blancs, tranquilles, mousseux et
fortifis.

DEFINITION

Concentration en plomb du vin : Concentration en plomb dtermine par cette


procdure exprime en mg/l.
3

PRINCIPE

Le vin est dilu par une matrice synthtique simulant la composition du vin et la
concentration en plomb mesure directement par spectrophotomtrie dabsorption
atomique utilisant un four graphite (SAAFG). Une matrice synthtique simulant la
composition du vin est ajoute aussi bien au vin analyser quaux solutions
modles dtalonnage de plomb. Ce mlange contient les modificateurs de
matrice et les composants simulant le vin. Leur but est de modifier les matrices
de sorte que la mme allure dabsorption par rapport au temps soit obtenue la fois
sur les solutions talons et les solutions chantillons pendant ltape datomisation
dans le four graphite.
Un mcanisme datomisation retard, tel une plate-forme de Lvov, est ncessaire.
Il se peut que la composition exacte du diluant ait besoin dtre ajuste pour
convenir des modles particuliers dinstruments du four graphite. Avant
dappliquer la mthode, des expriences doivent tre menes pour vrifier le
rapport absorbance temps produit par les talons et chantillons, et le diluant doit
faire lobjet des ajustements qui simposent. Linstrument utilis doit tre capable
de contrler le rapport de labsorption au temps pendant latomisation. Le profil
doit tre tel que les talons et chantillons parviennent aux mmes rsultats et que
le pic datomisation du plomb prcde la majeure partie de labsorption de fond
non spcifique, permettant le mcanisme de correction de fond employ de
OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

fonctionner efficacement. Des exemples de profils correspondants sont donns


dans lAnnexe 2.
4

REACTIFS

Les produits chimiques doivent tre aussi exempts de plomb que possible. Il
convient dutiliser de leau distille desionise, ou de leau dune puret
quivalente. Sauf contre-indication, toutes les solutions sont prpares chaque jour
danalyse.
4.1

Solution du diluant

NOTE 1 : la composition exacte du diluant utilis peut ncessiter un ajustement


pour correspondre au modle spcifique dinstrument et de four graphite utiliss.
Si des problmes surviennent avec la composition du modificateur suggre,
ajuster les concentrations en phosphate et nitrate afin dobtenir :
i) un signal stable de llment la temprature dincinration optimale et
ii) latomisation avec un pic unique danalyte reproductible dcal dans le temps
par rapport au signal de labsorption non spcifique.
Lquipement avec des amnagements VDU permet aux analystes de confirmer le
dcalage dans le temps entre les pics dchantillon et labsorption non spcifique
(voir lAnnexe). Lexemple suivant est une technique pour dterminer lallure de la
courbe dabsorbance en fonction du temps :
Mesurer la largeur totale mi-hauteur (LTMH) dun pic dchantillon et le
comparer la LTMH dun talon de calibration dabsorbance maximale similaire.
Si les allures des pics sont lvidence diffrentes, il convient alors dajuster la
composition du modificateur de matrice.
Ci-dessous des exemples de diluants utiliss pour :
(a) un appareillage Perkin-Elmer 3030 quip dun correcteur dabsorption non
spcifique arc au deutrium, quip dun four HGA 500 ; et (b) un ThermoElectron Video 12E quip dun correcteur dabsorption non spcifique SmithHieftje,dun four CTF 188 et dun systme de dpt dchantillon FASTAC.
4.1.1

Diluant Perkin-Elmer 3030 :

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Dans une bouteille en plastique de 250 ml (5.1) 187 g deau, ajouter 11 g


dthanol (4.1.3), 1,1 g de glucose (4.1.4), 1,1 g de fructose (4.1.5) et 0,28 g de
chlorure de sodium (4.1.6). Agiter pour dissoudre les solides. Puis ajouter 22 ml
dacide nitrique (4.1.7) et 4,4 g de dihydrogno-phosphate dammonium (4.1.8).
Agiter jusqu ce que tout le phosphate soit dissous. Ajouter enfin 0,88 g de nitrate
de magnsium (4.1.9) et agiter de nouveau jusqu ce que tout le solide soit
dissous.
4.1.2

Diluant Thermo-Electron Video 12E :

Comme prcdemment, mais en utilisant seulement 0,66 g de dihydrognophosphate dammonium (4.1.8) et 0,44 g de nitrate de magnsium (4.1.9).
4.1.3

Ethanol (absolu)

4.1.4. D-glucose
4.1.5. D(-)fructose
4.1.6. Chlorure de sodium
4.1.7. Acide nitrique (concentr)
4.1.8. Dihydrogno-phosphate dammonium
4.1.9. Nitrate de magnsium hexahydrat
4.2

Ethanol 10 %(v/v)

Dans une bouteille en plastique de 250 ml (5.1), ajouter 180 ml deau 20 ml


dthanol (4.1.3.) en utilisant une pipette et agiter pour mlanger.
4.3.

Solutions-talons de plomb

4.3.1. Solution-talon de plomb (1000 mg/l)


4.3.2

Solution-talon de plomb (10,00 mg/l)

Dans un ballon jaug de 100 ml (5.2), pipeter (5.7) 1,00 ml de solution-talon de


plomb (4.3.1). Diluer au volume avec de leau et mlanger soigneusement.
NOTE 2 : vrifier la calibration de la pipette juste avant lutilisation.

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

4.3.3

Solution de travail talonne en plomb (1,00 mg/l)

Dans un ballon jaug de 100 ml (5.2), peser 10,00 g de la solution mre de plomb
(4.3.2) en utilisant une pipette Pasteur (5.3). Laver leau lintrieur du col du
ballon jaug, ajouter 1 ml dacide nitrique (4.1.7) et amener jusquau trait de jauge
avec de leau. Mlanger soigneusement.
4.3.4. Solutions dtalonnage en plomb.
Les huit solutions talon de calibration sont prpares dans des rcipients
universels (5.4). Les talons varient de 0 50 g/l. Ils correspondent 0,0 ; 2,5 ;
5,0 ; 10,0 ; 20,0 ; 30,0 ; 40,0 et 50,0 g/l. Un neuvime conteneur est utilis pour
prparer un blanc ractif.
Rincer trois fois lintrieur de chaque rcipient avec de leau, et scher en agitant ;
rincer les couvercles trois fois et scher en agitant. Laisser debout les rcipients
ferms pendant 5-10 minutes puis vider le liquide rsiduel en agitant. Pipeter (5.8)
dans les 9 rcipients, dans lordre : 5,00 ; 5,00 ; 4,95 ; 4,90 ; 4,80 ; 4,60 ; 4,40 ;
4,20 et 4,00 ml deau. Pipeter (5.8) dans chacun des rcipients 5,00 ml dthanol
10 % (4.2) suivi de deux fois 5,00 ml de diluant (4.1).
Dans les 9 rcipients, pipeter (5.6) (5.7) dans lordre : 0 (blanc ractif), 0, 50, 100,
200, 400, 600, 800 et 1000 l de solution de travail talonne (4.3.3). Fermer les
rcipients et agiter pour mlanger les contenus. Refaire ces prparations pour
chaque lot dchantillons.
4.4

Acide nitrique 1 % (v/v).

5.

APPAREILLAGE

Toute la verrerie et les articles en plastique doivent tre lavs lacide (tremper
dans de lacide nitrique 20 % pendant au moins 24 heures), rincer soigneusement
avec de leau distille avant utilisation et les maintenir ferms (avec film tirable si
ncessaire) pour empcher toute contamination par lair.
5.1

250 bouteilles en plastique, avec bouchon (par exemple : Nalgene ou


quivalent).

5.2

Fioles jauges, 100 ml (classe A).

5.3

Pipettes Pasteur, avec poires

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

5.4

Rcipients universels de 30 ml (Nunc, Sterilin ou quivalent).

5.5

Rcipients coniques en verre de 600 ml.

5.6

Pipette*, 40 200 l (Finnpipette de Labsystem ou quivalent).

5.7

Pipette*, 200 1000 l (Finnpipette de Labsystem ou quivalent).

5.8

Pipette*, 0.5 - 5.0 ml (Finnpipette de Labsystem ou quivalent).

5.9

Pipette*, 2.0 - 10.0 ml (Finnpipette de Labsystem ou quivalent).

*NOTE 3: les pipettes doivent tre calibres chaque jour (d utilisation).


5.10

Balance analytique, (+ ou 1 mg, Mettler PC440 ou quivalent).

5.11

Agitateur de type Vortex ou quivalent.

5.12

Tubes essai, capacit de 20 ml.

5.13

Portoirs de tubes essai, compatibles pour utilisation avec 5.12.

5.14

Portoirs de conteneurs, compatibles pour utilisation avec 5.4.

5.15

Agitateur magntique.

5.16

Barreau magntique, recouvert de PTFE.

5.17

Embouts de pipette, compatibles pour utilisation avec 5.6, 5.7, 5.8 et 5.9

5.18

Spectrophotomtre dabsorption atomique,

Spectrophotomtre dabsorption atomique quip dun four graphite, dune cuvette


de retard latomisation, dun injecteur automatique, dun correcteur dabsorption
non spcifique, et dun quipement de contrle de labsorbance en fonction du
temps quivalent ce qui suit. Les conditions instrumentales doivent tre ajustes
de faon approprie au modle utilis.

OIV-MA-AS322-12 : R2006

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Exemples donns ci-dessous :


(a) Spectrophotomtre dabsorption atomique, Perkin-Elmer 3030 quip dun
correcteur dabsorption non spcifique arc au deutrium pur. Lampe
cathode creuse au plomb que lon fait fonctionner 12 mA. Slectionner la
raie 283,3 nm; largeur de fente 0,7 nm. Four graphite, HGA 500 quip
dun tube de graphite revtement pyrolytique avec lintrieur une plateforme Lvov de graphite pyrolytique solide. Utiliser de largon comme gaz
de purge. Les conditions du four pour le HGA 500 sont les suivantes :
Etape
Temprature (C)
Rampe (s)
Plateau (s)
Gaz
Dbit de gaz (ml/min)
Lecture (intgration
2,5 s)

1
200
5
60
Ar
50

2
1100
20
20
Ar
50

3
1100
1
2
Ar
0

4
1800
0
3
Ar
0
X

5
2400
1
6
Ar
300

6
20
1
25
Ar
300

Echantillonneur/injecteur automatique, AS 40. Volume dinjection de 20 l, 3


injections par position de plateau.
(b) Spectrophotomtre dabsorption atomique Thermo-electron Video 12E
utilis avec un four graphite CTF 188 et un systme de dpt dchantillon
FASTAC rpondant aux conditions suivantes :
Etape
Temprature (C)
Rampe (s)
Plateau (s)
Gaz
Dbit du gaz (ml/min)
Lecture (intgration
2,5 s)

1
150
0
2
Ar
50

2
350
30
0
Ar
50

3
650
15
5
Ar
0

4
1000
1
4
Ar
0
X

5
2400
10
Ar
300

Dpt dchantillon 5 s, retard FASTAC 10 s, avec 3 injections par position de


plateau. Slectionner la raie 283,3 nm.

OIV-MA-AS322-12 : R2006

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

6.

MODE OPERATOIRE

6.1.

Prparation du vin

Agiter le rcipient de vin pour bien mlanger les contenus avant le souschantillonage. Les vins mousseux doivent tre transfrs dans un bcher propre et
placs dans un bain ultrasonique jusqu ce quil ny ait plus dmission de gaz
avant utilisation.
6.2

Solutions de mesure

6.2.1

Echantillons de vin

Dans un tube essai de 20 ml (5.12), pipeter (5.8) 2,00 ml deau, 4,00 ml de


diluant (4.1) et 2,00 ml de lchantillon de vin. Mlanger soigneusement en
utilisant lagitateur vortex (5.11).
6.2.2

Estimation du recouvrement

Afin destimer le recouvrement, dans un tube essai de 20 ml (5.12), pipeter (5.8)


1,80 ml deau, 4,00 ml de diluant (4.1), 2,00 ml de lchantillon de vin et ajouter
0,200 ml de solution de travail talonne en plomb (4.3.3) en utilisant une pipette
(5.7). Mlanger soigneusement en utilisant lagitateur vortex (5.11).
NOTE 4 : tout chantillon dpassant ltalon de calibration le plus lev devra tre
analys nouveau en utilisant une quantit dchantillon plus petite. Ajouter de
lthanol supplmentaire 10 % (4.2) au volume de lchantillon.
6.3.

Mesure

Les dterminations sont effectues par lots. Chaque lot doit contenir au moins
quatre rpliques du blanc ractif et trois rpliques des chantillons supplments
pour estimation du recouvrement. Les solutions dtalonnage du plomb sont
distribues de faon rgulire parmi les inconnues sur le plateau de
lchantillonneur automatique. Transfrer les chantillons et talons dans les
rcipients pour chantillons de lchantillonneur automatique en utilisant une
pipette Pasteur (5.3). Se dbarrasser du premier remplissage du rcipient et mesurer
le deuxime remplissage (sil ny a pas assez dchantillon, prendre garde ce que
les rcipients des chantillons soient parfaitement propres). Laver la pipette Pasteur
quatre ou cinq fois lacide nitrique 1 % (4.4.) entre chaque transfert dtalon et
dchantillon.

OIV-MA-AS322-12 : R2006

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

6.4.

Quantification du plomb

La moyenne des absorbances de 3 injections est utilise dans tous les cas. Tracer
une courbe dtalonnage partir des rponses moyennes fournies par les lots
dtalons. Noter les absorbances enregistres par linstrument pour chaque
chantillon. La concentration en plomb des chantillons est dtermine par
comparaison avec la courbe dtalonnage.
NOTE 5 : il est recommand de remplacer le tube du four et la plate-forme tous les
deux lots voire plus frquemment si une baisse de labsorbance des talons est
note.
7

EXPRESSION DES RESULTATS

Corriger les rsultats pour la rcupration moyenne par lots .


7.1

Calcul

Obtenir partir du graphique dtalonnage la concentration en plomb de toutes les


solutions de mesure. Calculer la concentration en plomb des chantillons de vin et
des chantillons de vins supplments en utilisant le calcul suivant :
Concentration en plomb (mg/l) =

(Cm - Cb) x Vt
--------------------------Vm

o :
Cm est la concentration moyenne en plomb de la solution de mesure
(mg/l).
Cb est la concentration moyenne en plomb mesure, des solutions de blanc ractif
(mg/l).
Vt est le volume total final de la solution de mesure (ml).
.
Vm est le volume de lchantillon de vin prlev (ml).

OIV-MA-AS322-12 : R2006

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

7.2

Calcul des estimations de recouvrement

Rcupration (%) =

(Cs - Ca) x Vs x 100


----------------------S

o :
Cs est la concentration calcule moyenne en plomb de lchantillon de vin
supplment (mg/l).
Ca est la concentration calcule moyenne de plomb dans le vin non supplment
(mg/l).
Vs est le volume de vin auquel le supplment est ajout (ml).
S est la quantit de supplment ajoute (g).

7.3

Calcul des rsultats corrigs du recouvrement

Concentration en plomb corrige (mg/l) =

Cw x 100
---------Ra

o:
Cw est la concentration en plomb calcule de lchantillon de vin (mg/l).
Ra est la moyenne de recouvrement par lots (%).

OIV-MA-AS322-12 : R2006

13

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

ANNEXE : ETUDE DE VALIDATION


Ltude suivante a men des procdures acceptes lchelle internationale
(1)(2).

TABLEAU 1 ECHANTILLONS

Code de lchantillon

Description de lchantillon

5&9

Bordeaux (vin doux)

3 & 11

Chardonnay italien (blanc)

7&8

Vin rouge espagnol supplment avec 260 g/l

6 & 10

Pinot Noir roumain

2 & 12

Pinot Noir roumain supplment avec 150 g/l

Echantillon 3/11 supplment avec 124 g/l

Echantillon 3/11 supplment avec 134 g/l

OIV-MA-AS322-12 : R2006

14

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

TABLEAU II RESUME DES PARAMETRES STATISTIQUES POUR


LETUDE COLLABORATIVE SUR LA CONCENTRATION EN PLOMB
DU VIN (Les rsultats dun laboratoire nont pas t retenus dans lanalyse
statistique)
Echantillon

F1

Code

5, 9

3, 11

7, 8

6, 10

2, 12

16

15*

16

16

16

16

n (-val. aberr.)

16

15

14

16

15

16

Valeur cible
Moy.
r
Sr
RSDr
Hor
R

56

24

279

67

192

143

153

50,8

27,2

298

70,6

189

143

149

23

15

32

51

38

8,7

11,8

18.2

13,6

17

10

8,1
16
1,0
42

SR
RSDR

15,1

HoR

1,2

30

5,3
19
1,1
25
8,8
28
1 ,2

24

0,2

1,1

0,7

0,7

83

57

29,8

20,3

55,2

28,2

10

29

29

19

0,5

1,2

154

1,4

79

0,9

CONCERNANT LES TABLEAUX I-II


n

Nombre initial de laboratoires

n (-val. aberr.)Nombre de laboratoires aprs limination des valeurs aberrantes


(*)

Laboratoire 17 a indiqu <20 g/l pour le matriel de test 11. Ses


rsultats nont pas t inclus dans lanalyse statistique pour cet
chantillon (B).

Moy.

Moyenne observe, la moyenne obtenue des donnes de lessai


collaboratif aprs limination des valeurs aberrantes.

Valeur cible La valeur moyenne observe linterne en utilisant lICP-MS

OIV-MA-AS322-12 : R2006

15

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Limite de rptabilit, la valeur en dessous de laquelle on peut estimer


que se situe la diffrence absolue entre deux rsultats danalyse unique
obtenus dans des conditions de rptabilit (cest dire mme
chantillon, mme oprateur, mme appareillage, mme laboratoire, et
court intervalle de temps) dans une limite donne de probabilit (en
principe 95 %) do r = 2,8 x sr.

Sr

Lcart-type de rptabilit.

RSDr

Lcart-type relatif de rptabilit (S x 100/MOYENNE).


r
Le RSD observ divis par la valeur RSD estime partir de lquation
r
r
de Horwitz en supposant que r=0.66R.

Hor
R

SR
RSDR
HoR

Limite de reproductibilit, la valeur en dessous de laquelle on peut


estimer que se situe la diffrence absolue entre deux rsultats danalyse
unique obtenus dans des conditions de reproductibilit (cest dire avec
du matriel identique obtenu par des oprateurs dans diffrents
laboratoires, en utilisant la mthode dessai standardise), dans une limite
donne de probabilit (en principe 95 %) ; R = 2.8 x sR.
Lcart-type de la reproductibilit (entre la variation des laboratoires).
Lcart-type relatif de la reproductibilit (S x 100/MOYENNE).
R
La valeur RSD observe divise par la valeur RSD calcule partir de
R
R
lquation de Horwitz.
RSDR = 2(1-0.5log10C)

(o C = concentration exprime en dcimale)

Les valeurs du HORRAT(4) sont :


- Pour la rptabilit, la RSDr observe divise par la valeur RSDr estime partir
de lquation de Horwitz en supposant que r = 0.66R.
- Pour la reproductibilit, la RSDR observe divise par la valeur RSDR estime
partir de lquation de Horwitz.

8. BIBLIOGRAPHIE
8.1 Paul A. Brereton, Paul Robb, Christine M Sargent, Helen M. Crews and Roger
Wood. Determination of Lead in Wine by Graphite Furnace Atomic
Absorption Spectrometry: Interlaboratory Study. JAOAC Int., 1997, 80, No 6,

OIV-MA-AS322-12 : R2006

16

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

1287-1297.
8.2 "Protocol for the Design, Conduct and Interpretation of Collaborative Studies."
Editor W Horwitz, Pure & Appl. Chem., Vol. 67, No., 2, pp.331-343, 1995
8.3 Horwitz W, Evaluation of Methods Used for Regulation of Foods and Drugs,
Analytical Chemistry, 1982, 57, 67A-76A.
8.4 Peeler J T, Horwitz W and Albert R, Precision Parameters of Standard
Methods
of Analysis for Dairy Products, JAOAC, 1989, 72, No 5, 784-806.

OIV-MA-AS322-12 : R2006

17

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Annexe
Allure des courbes absorbance - temps pour la mesure de la concentration
en plomb du vinavec utilisation dun spectrophotomtre dabsorption
atomique Perkin-Elmer 3030 quip dune correction dabsorption non
spcifique
arc au deuterium.

(i)

talon de vin 30 ng/l

OIV-MA-AS322-12 : R2006

18

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

(ii)

chantillon de vin

Cl :

absorbance corrige, absorbance non spcifique

OIV-MA-AS322-12 : R2006

19

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

EXEMPLE 2

Dtermination de la teneur en plomb dans les vins par


spectrophotomtrie dabsorption atomique
1.

DOMAINE D'APPLICATION

La mthode danalyse est applicable tout type de vins, eut gard la limite
maximum fixe par lO.I.V.
2. BIBLIOGRAPHIE
2.1. Journal Officiel des Communauts Europennes (3 octobre 1990). Mthode de
dosage du plomb dans le vin (p. 152 et 153).
2.2. Teissdre P.L., Brun S., Mdina B. (1992). Dosage du plomb dans les vins /
Proposition de modifications la mthode du Recueil. Feuillet Vert de lO.I.V.,
n928, 1997/151292.
2.3. Moreira Balio da Silva M., Gaye J., Mdina B. (1996). Comparaison de six
mthodes de dosage du plomb dans les vins par absorption atomique en four
graphite. Feuillet Vert de lO.I.V. n 1013, 2310/190196.
2.4. Brereton P., Robb P., Sargent C., Crews H., Wood R. (1996). Validation of a
graphite furnace atomic absorption spectrometry method for the detection of lead
in wine. Feuillet Vert de lO.I.V. n 1016, 2913/230196.
2.5. Bourguignon J.B., Douet Ch., Gaye J., Mdina B. (1997). Dosage du plomb
dans le vin / Interprtation des rsultats de lessai interlaboratoire. Feuillet Vert
1055 de lO.I.V. n 2456/190397.
3. PRINCIPE
Le vin ne subit aucune prparation, except une dilution dans le cas des vins blancs
doux.
Lajout de dihydrogno-phosphate dammonium permet au plomb contenu dans le
vin dtre stable haute temprature - ce qui conduit liminer les interfrences et de se comporter de faon identique une solution talon.
Latomiseur est un tube en graphite pyrolytique chauff par effet Joule quip
dune plate-forme.
La longueur donde de la raie utilise est de 283,3 nanomtres.
La correction de labsorption non spcifique peut se faire par effet Zeeman ou avec
une lampe au deutrium.
OIV-MA-AS322-12 : R2006

20

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Le type de dtermination du plomb dans le vin est une mthode directe de dosage
avec un talonnage externe.
4. REACTIFS
4.1. Eau dminralise : ultra pure ; ayant une rsistivit suprieure 18 M/cm.
4.2. Acide nitrique : 65 % ; acide de qualit pour analyses.
4.3. Dihydrogno-phosphate dammonium NH4H2PO4 pour analyses.
4.4. Solution talon de plomb : 1000 g/mL (ou 1 g/l) dans de lacide nitrique 2
% (solution du commerce, prte lemploi).

5. APPAREILLAGE
5.1

Balance analytique (e = 1 mg).

5.2

Verrerie :

5.2.1

Fioles jauges de 50, 100 ml (classe A),

5.2.2

Pipettes jauges de 1, 10 ml (classe A),

5.2.3 Dcontamination de la verrerie utilise : rinage l'eau dminralise;


trempage au moins 24 heures dans un bac d'acide nitrique 10 % ; rinage deux
fois l'eau dminralise.
5.3
Spectrophotomtre d'absorption atomique quip d'un atomiseur tube de
graphite, avec correction de l'absorption non spcifique et passeur automatique
d'chantillons (rincer auparavant les godets du passeur dans de l'acide nitrique 10
%).
5.3.1. Four en graphite pyrolytique contenant une plate-forme de L'Vov
ventuellement tantalise (rfrence 9.1 - voir ci-dessous:
5.3.1.1 solution de tantale : placer 3 g de poudre de tantale (tantale mtal dont la
puret est suprieure 99,7 %) dans un bcher en tflon de 100 mL ; ajouter 10 mL
dacide fluorhydrique dilu (1 + 1), 3 g dacide oxalique dshydrat et 0,5 mL
deau oxygne 30 % ; chauffer lensemble avec prcaution pour dissoudre le
mtal ; ajouter de leau oxygne lorsque la raction se ralentit ; quand la
dissolution est complte, ajouter 4 g dacide oxalique dshydrat et
OIV-MA-AS322-12 : R2006

21

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

approximativement 30 mL deau dminralise ; dissoudre lacide ; porter la


solution 50 mL ; cette solution est stocke dans un flacon en matire plastique.
5.3.1.2 tantalisation d'une plate-forme : la plate-forme est dpose l'intrieur d'un
tube en graphite. L'ensemble est fix sur l'unit d'atomisation du
spectrophotomtre. Un volume de 10 L de la solution de tantale est inject sur la
plate-forme l'aide du distributeur automatique d'chantillons. Le cycle des
tempratures est fix selon le programme suivant : schage 150C pendant 40 s ;
minralisation 900C pendant 60 s ; atomisation 2600C pendant 2,5 s. L'argon
est utilis comme gaz inerte.

6. MODE OPERATOIRE
6.1
Prise dessai : Le goulot dune bouteille de vin possdant une capsule de
surbouchage en plomb-tain doit tre trs soigneusement nettoy avant
dbouchage.
6.2
Prparation de lchantillon : gnralement, aucune prparation du vin
nest ncessaire ; les chantillons sont placs directement dans les godets du
passeur automatique. Il faut filtrer les vins troubles. Pour prolonger la dure
dutilisation des plates-formes, les vins blancs doux sont dilus : pour des teneurs
en sucre de 10 50 g/l, diluer au 1/2 ; pour des teneurs suprieures 50 g/l, diluer
au 1/4.
6.3

Prparation des solutions :

6.3.1 Blanc de dilution :


la solution servant de complment au volume l'injection est constitue par de
leau dminralise contenant 1 % dacide nitrique (4.2.).
6.3.2. Modificateur de matrice :
introduire 3 g de dihydrogno-phosphate dammonium (4.3.) dans un ballon jaug
de 50 mL (5.2.1.) ; dissoudre et complter avec de leau dminralise (4.1.).
6.3.3. Solution de plomb 10 mg/l :
placer 1 mL de la solution 1 g/l (4.4.) dans un ballon jaug de 100 mL (5.2.1.) ;
ajouter 1 % dacide nitrique (4.2.) ; complter au volume avec de leau
dminralise (4.1.). Cette solution se conserve un mois la temprature de + 4C.
6.3.4

Solution de plomb 100 g/l :

OIV-MA-AS322-12 : R2006

22

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

placer 1 mL de la solution de plomb 10 mg/l (6.3.3.) dans un ballon jaug de 100


ml (5.2.1.); complter au volume avec de leau dminralise (4.1.). Cette solution
doit tre prpare chaque jour danalyse.
6.3.5
Gamme dtalonnage ( titre indicatif) : 0 ; 16,7 ; 33,3 et 50 g/l (voir
tableau II).
6.4

Etalonnage et dosage :

6.4.1

Mesurages spectromtriques :

6.4.1.1
6.4.1.2
6.4.1.3
6.4.1.4
6.4.1.5

longueur donde : 283,3 nm;


largeur de la fente : 0,5 nm;
intensit de la lampe cathode creuse : 5 mA ;
correction du fond continu : par effet Zeeman ou deutrium ;
introduction chaud des talons et des chantillons dans le four graphite,
avec un passeur automatique dchantillons. Le liquide de rinage est
constitu de 500 ml deau dminralise contenant une goutte de Triton X
100.
Note: pour obtenir une injection 90C sur la plate-forme, il faut rgler la

temprature du four 150C environ.


6.4.1.6 mesure du signal: en hauteur de pic ;
6.4.1.7 dure de la mesure: 3 secondes ;
6.4.1.8 nombre de mesures par talon ou chantillon: 2
Note: la moyenne de ces deux mesures constitue le rsultat dessai. Si le
coefficient de variation de deux mesures est suprieur 15 %, on doit refaire deux
autres mesures.
6.4.1.9. paramtres du four ( titre indicatif) : voir tableau I.

OIV-MA-AS322-12 : R2006

23

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

Tableau I Paramtres du four


pour le dosage du plomb dans les vins
temprature
(en C)
150
750
750
750
2400
2400
2400
40

dure
(en s)
60
10
30
2
1
2
2
20

type de gaz dbit du gaz


(en l/mn)
argon
3,0
argon
3,0
argon
3,0
argon
0
argon
0
argon
0
argon
3,0
argon
3,0

lecture du
signal

oui
oui

6.4.1.10. Paramtres de lchantillonneur automatique ( titre indicatif): voir tableau


II.
Tableau II - Paramtres de l'chantillonneur
pour le dosage du plomb dans les vins
Analyse :
blanc de calibration
talon n1
talon n2
talon n3
chantillon

volumes injects en l
chantillon solution de Pb "blanc" de
100 g/l
dilution
0
0
5
0
1
4
0
2
3
0
3
2
2
0
3

modificateur
de matrice
1
1
1
1
1

6.4.2 Trac de la courbe dtalonnage : le cycle du distributeur automatique


permet de raliser la prparation des talons partir de la solution de plomb 100
g/l (tableau II). On tablit le graphe dtalonnage : absorbance en fonction de la
quantit de plomb en microgrammes par litre.

OIV-MA-AS322-12 : R2006

24

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

7. EXPRESSION DES RESULTATS


7.1
Concentration en plomb de la solution injecte : On l'obtient partir de la
courbe dtalonnage (6.4.2.).
7.2
Concentration en plomb du vin : On la dduit en multipliant par 3 le
rsultat donn en 7.1. (2 l de solution injecte pour un volume final de 6 l sur la
plate-forme). Tenir compte dune ventuelle dilution du vin (cas des vins blancs
doux).
7.3
Rsultat : On l'exprime en milligrammes de plomb par litre de vin (mg/l),
avec deux chiffres significatifs.

8. ESSAI INTERLABORATOIRE
L'essai a t conduit "en double aveugle" avec 8 vins diffrents, obtenus partir de
mlanges de vins de Bordeaux : deux vins rouges (R1 et R2), deux vins ross (Ro1
et Ro2), deux vins blancs secs (Bs1 et Bs2) et deux vins blancs doux (D1 et D2).
Onze laboratoires espagnols, portugais, marocains et franais ont particip l'tude
en dosant le plomb dans les 16 chantillons reus.
Prsentation des 8 chantillons de vins :

8.1

Tableau III : Caractristiques des vins utiliss pour


l'essai interlaboratoire
Vins

Type

T.A.V.
(% Vol.)

Acidit
Totale
(g/l H2SO4)

Acidit
Volatile
(g/l H2SO4)

Sucres
Rducteurs
(g/l)

R1

Rouge

11,86

4,43

1,57

1,2

R2

Rouge

12,54

3,77

0,34

1,5

Ro1

Ros

12,23

5,30

0,44

1,2

Ro2

Ros

11,43

4,88

0,45

1,1

Bs1

Blanc sec

11,65

4,62

0,37

2,2

Bs2

Blanc sec

12,32

4,57

0,31

0,9

D1

Blanc doux

12,94

3,72

0,67

76,4

D2

Blanc doux

12,66

4,70

0,45

62,8

OIV-MA-AS322-12 : R2006

25

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

8.2

Exploitation statistique des rsultats :


Tableau IV : Analyse statistique des rsultats de l'essai interlaboratoire
Echantillon de vin

Rptitions en double
aveugle

R1

R2

Ro1

Ro2

BS1

BS2

D1

D2

C&K F&I D&G J&L B&H P&N A&E M&0

Nombre initial de
laboratoires

11

11

11

11

11

11

11

11

Nombre de laboratoires
aprs limination des
plus grandes dispersions

11

10

11

11

10

10

11

10

Moyenne (g/l)

44

162

28

145

52

138

60

145

Limite de rptabilit r

18

12

17

13

28

Ecart-type de
rptabilit Sr

6,4

4,3

2,5

6,1

2,1

4,6

10

2,5

2,8

9,2

4,2

4,2

3,4

16,5

1,8

0,1

0,3

0,2

0,2

0,2

0,7

0,1

34

105

23

86

30

101

86

144

12,3

37,5

8,2

30,8

10,7

35,9

30,6

51,6

28

23,1

29,3

21,2

20,6

26

51

35,6

1,1

1,1

1,1

0,8

1,2

2,1

1,7

Coefficient de variation
de rptabilit RSDr (en 14,5
%)
Valeur du Horrat
0,6
(Hor):RSDr observ /
RSDr Horwitz
Limite de
reproductibilit R
Ecart-type de
reproductibilit SR
Coefficient de variation
de reproductibilit
RSDR (en %)
Valeur du Horrat
(HoR):RSDR observ /
RSDR Horwitz

Parmi les 11 laboratoires ayant particip l'essai, 7 ont dclar avoir suivi la
mthode d'analyse propose, 4 ont modifi quelques paramtres.

OIV-MA-AS322-12 : R2006

26

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

9. PERFORMANCES DE LA METHODE ET CONTROLE QUALITE


9.1 Limite de dtection : Elle est dtermine partir d'une srie de 20 rptitions du
blanc analytique et elle est gale 3 carts types. Dans le cas de la mthode
propose, une srie de 20 mesures du blanc analytique a donn comme rsultat :
moyenne = 1,29 g/l; cart type = 0,44 g/l; limite de dtection = 1,3 g/l.
9.2 Limite de quantification : Elle est gale 3 fois la limite de dtection. Dans le
cas de la mthode propose, la limite de quantification est de 4 g/l (3 * 1,32 =
3,96).
9.3 Justesse : L'intervalle de confiance de la moyenne d'une srie de rsultats est
compar avec celui donn pour un matriau de rfrence.
Trois matriaux de rfrence ont t utiliss: un vin rouge, un vin blanc sec et un
vin blanc doux dont les concentrations en plomb ont t certifies par le B.C.R.
(Bureau Communautaire de Rfrence) en 1992.

Tableau V : Justesse de la mthode

Concentration
en plomb (g/l)

Valeur
certifie
(B.C.R. 1992)
Valeur
moyenne
(srie : 10
rsultats)

OIV-MA-AS322-12 : R2006

Vin rouge
BCR E

Vin blanc sec


BCR C

Vin blanc
doux
BCR D

36,1 4,9

65,1 9,1

132,4 32

41,0 3,8

66,0 4,4

128,3 14,1

27

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

9.4 Carte de contrle


Une carte de contrle peut tre tablie pour chaque matriau de rfrence utilis.
Les limites de contrle sont gales : +/- 2 SRintra (SR intra : cart-type de
reproductibilit).

Carte de contrle
Plomb du BCR E
80
plomb en g/l

70

limites : + 2SR = 63,9 g/l


- 2SR = 28,7 g/l

60
50
40
30

20
15/12/95 26/06/96 29/04/97 08/12/97 09/10/98
date
moyenne : 46,3 g/l

OIV-MA-AS322-12 : R2006

28

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Critres pour les mthodes de dtermination du plomb

10.

BIBLIOGRAPHIE

10.1. Zatka V. (1978). Treated graphite atomizer tubes for atomic absorption
spectrometry. Analytical Chemistry, vol. 50, n3.
10.2. US Bureau of Alcohol, Tobacco and Firearms (1991). Analysis of lead in
wines and related products by graphite furnace atomic absorption spectrometry.
Note dinformation de lO.I.V. du 21 aot 1991 : Plomb dans les vins aux
U.S.A. .
10.3. Mindak W.R. (1994). Determination of lead in table wines by graphite
furnace atomic absorption spectrometry. Journal of A.O.A.C. International, vol.
77, n4, p. 1023-1030.
10.4. Mdina B. (1994). Apport de nouvelles techniques au dosage des mtaux
dans les vins. Congrs des nologues de France Bordeaux.
10.5. Norme franaise NF ISO 5725-2 (1994). Application de la statistique :
Exactitude (justesse et fidlit) des rsultats et mthodes de mesure.
10.6. Jorhem L., Sundstrm B. (1995). Direct determination of lead in wine using
graphite furnace AAS. Atomic Spectroscopy, September/October 1995.

OIV-MA-AS322-12 : R2006

29

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic- Absorption atomique

Mthode OIV-MA-AS323-01A

Mthodes Type IV

Dosage de l'arsenic dans le vin


par spectrometrie d'absorption atomique
(Rsolution Oeno 14/2002)

1. PRINCIPE
Aprs avoir vapor l'alcool thylique et aprs rduction de l'arsenic V
en arsenic III, l'arsenic du vin est dos par gnration d'hydrure et
spectromtrie d'absorption atomique.
2. APPAREILLAGE
2.1. Verrerie :
2.1.1. Fioles jauges de 50, 100 ml (classe A)
2.1.2. Pipettes jauges de 1, 5, 10, 25 ml (classe A)
2.2. Bain d'eau 100C
2.3. Filtres sans cendres
2.4. Spectrophotomtre :
2.4.1. Spectrophotomtre d'absorption atomique
2.4.2. Paramtres instrumentaux :
2.4.2.1. flamme air-actylne oxydante
2.4.2.2. lampe cathode creuse (arsenic)
2.4.2.3. longueur d'onde : 193,7 nm
2.4.2.4. largeur de la fente : 1,0 nm
2.4.2.5. intensit de la lampe cathode creuse : 7 mA
2.4.2.6. correction de l'absorption non spcifique avec une lampe au
deutrium
2.5. Accessoires :
2.5.1. Cellule d'absorption d'hydrure, place sur le brleur air-actylne.
2.5.2. Gnrateur de vapeur (sparateur gaz-liquide)
2.5.3. Gaz neutre (argon)

OIV-MA-AS323-01A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic- Absorption atomique

Figure 1. Gnrateur d'hydrure.

3. REACTIFS
3.1 Eau dminralise ultra-pure
3.2 Acide nitrique ultra-pur 65 %
3.3 Iodure de potassium KI
3.4 Iodure de potassium 10 % (m/v)
3.5 Acide chlorhydrique concentr (R)
3.6 Acide chlorhydrique 10 % (R)
3.7 Borohydrure de sodium NaBH4
3.8 Hydroxyde de sodium NaOH
3.9 Borohydrure de sodium 0,6 % (contenant de lhydroxyde de sodium :
0,5 % (m/v)
3.10 Chlorure de calcium CaCl2 (utilis comme desschant)
3.11 Solution-mre d'arsenic 1 g/l
Dissoudre 1,5339 g de As2O5 dans de leau dminralise, ajuster 1 l.
3.12 Solution d'arsenic 10 mg/l :
Placer 1 ml de la solution-mre (3.11.) dans une fiole de 100 ml (2.1.1.) ;
ajouter 1 % d'acide nitrique (3.2.) ; complter au volume avec de l'eau
dminralise (3.1.).

OIV-MA-AS323-01A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic- Absorption atomique

3.13 Solution d'arsenic 100 g/l :


Placer 1 ml de la solution d'arsenic 10 mg/l (3.12.) dans une fiole de
100 ml (2.1.1.) ; complter au volume avec de l'eau dminralise (3.1.).
3.14 Gamme d'talonnage : 0, 5, 10, 25 g/l
Placer successivement 0, 5, 10, 25 ml de la solution d'arsenic 100 g/l
(3.13.) dans 4 fioles de 100 ml (2.1.1.) ; ajouter dans chaque fiole 10 ml
d'iodure de potassium 10% (3.4.) et 10 ml d'acide chlorhydrique
concentr (3.5.) ; laisser au repos pendant une heure, ajuster 100 ml
avec de leau dminralise.
4. PREPARATION DES ECHANTILLONS
25 ml de vin sont vapors sur bain deau 100 C et ramens 50 ml
en prsence de 5 ml d'iodure de potassium 10 % et 5 ml d'acide
chlorhydrique concentr ; laisser au repos une heure ; filtrer sur un filtre
sans cendres.
Faire un blanc analytique.
5. DETERMINATION
La pompe pristaltique aspire la solution de borohydrure, la solution
d'acide chlorhydrique 10 % et l'talon ou l'chantillon.
Prsenter successivement les solutions d'talonnage (3.14.) ; faire une
lecture de l'absorbance pendant 10 secondes ; raliser deux mesures ; le
logiciel de l'appareil tablit la courbe d'talonnage (absorbance en
fonction de la concentration en arsenic en g/l).
Prsenter ensuite les chantillons (4) ; le logiciel donne la concentration
en arsenic des chantillons en g/l ; dduire la concentration en arsenic
du vin en g/l en tenant compte de la dilution 1/2 .
6. CONTROLE QUALITE
Le contrle qualit est effectu en plaant un chantillon de contrle
qualit interne (*) de faon rgulire tous les 5 chantillons, ou bien un
aprs la gamme-talon, un au milieu de la srie et un la fin des dosages.
Une tolrance de deux carts-types par rapport la valeur connue est
accepte.
(*) Echantillons du Bureau Communautaire de Rfrence (B.C.R.) : un
vin rouge, un vin blanc sec et un vin blanc doux.

OIV-MA-AS323-01A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic- Absorption atomique

7. BIBLIOGRAPHIE
Varian Techtron, 1972. Analytical methods for flame spectroscopy.
Hobbins B., 1982. Arsenic Determination by Hydride Generation. Varian
Instruments at Work.
Le Houillier R., 1986. Use of Drierite Trap to Extend the Lifetime of Vapor
Generation Absorption Cell. Varian Instruments at Work.
Varian, 1994. Vapor Generation Accessory VGA-77.

OIV-MA-AS323-01A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic

Mthode OIV-MA-AS323-01B

Mthodes Type IV

Arsenic
1. Principes des mthodes
Aprs minralisation sulfo-nitrique, rduction de larsenic V en arsenic III par
liodure de potassium en milieu chlorhydrique, larsenic est transform en
hydrure arsnieux H3As par action du borohydrure de sodium NaBH4.
Lhydrure arsnieux form est entran par un courant dazote, dissoci haute
temprature et dos par spectrophotomtrie dabsorption atomique.
2. Mthode
2.1. Appareillage
2.1.1. Fiole de type Kjeldahl en verre borosilicat.
2.1.2. Spectrophotomtre dabsorption atomique quip dune lampe cathode
creuse larsenic, dun gnrateur dhydrures, dun correcteur de bruit de fond
et dun enregistreur multipotentiomtrique.
Le gnrateur dhydrures comporte un flacon racteur (qui peut
ventuellement tre plac sur un dispositif dagitation magntique) reli par
une premire tubulure un gnrateur dazote (gaz de balayage,
dbit = 11 l/min.) et, par une deuxime tubulure, une cellule en quartz qui
peut tre porte la temprature de 900 C. Le flacon racteur porte, en outre,
une ouverture pour lintroduction du ractif (borohydrure).
2.2. Ractifs
Tous les ractifs doivent tre de puret analytique reconnue et, en particulier,
exempts darsenic. Leau utilise doit tre de leau bidistille dans un appareil
en verre borosilicat ou de leau de puret quivalente.
2.2.1. Acide sulfurique (20 = 1,84 g/ml) exempt darsenic.
2.2.2. Acide nitrique (20 = 1,38 g/ml) exempt darsenic.
2.2.3. Acide chlorhydrique (20 = 1,19 g/ml) exempt darsenic.
2.2.4. Solution diodure de potassium 10 g pour 100 ml.
2.2.5. Solution de borohydrure de sodium 2,5 g pour 100 ml obtenue par
dissolution de 2,5 g de borohydrure de sodium, NaBH4, dans 100 ml de
solution dhydroxyde de sodium 4 g pour 100 ml. Cette solution doit tre
prpare au moment de lemploi.
2.2.6. Solution de rfrence darsenic 1 g par litre. Utiliser une solution
standard darsenic du commerce. Cette solution peut tre prpare en
OIV-MA-AS323-01B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic

dissolvant dans une fiole jauge de 1000 ml, 1,320 g de trioxyde darsenic III,
As2O3, dans un volume minimum de solution dhydroxyde de sodium 20 g
pour 100 ml, acidifier par de lacide chlorhydrique dilu 1/2 (v/v) et ajuster au
trait de jauge avec de leau.
2.3. Mode opratoire
2.3.1. Minralisation
Placer 20 ml de vin dans une fiole Kjeldahl, porter lbullition et concentrer
le volume au demi, environ, de manire liminer lalcool. Laisser refroidir.
Ajouter 5 ml dacide sulfurique et, lentement, 5 ml dacide nitrique ; porter
lbullition ; ds que le liquide tend brunir, rajouter, goutte goutte, de
lacide nitrique, en quantit juste suffisante pour claircir le milieu en
maintenant une bullition douce. Poursuivre le chauffage jusqu dcoloration
du milieu et concentration de fumes blanches de trioxyde de soufre au-dessus
du liquide de minralisation.
Laisser refroidir, reprendre une deuxime fois la mme opration. Laisser
refroidir, diluer le rsidu sulfurique par quelques millilitres deau distille,
transvaser quantitativement la solution dans une fiole jauge de 40 ml, ajouter
les eaux de rinage et ajuster au trait de jauge aprs refroidissement avec de
leau distille.
2.3.2. Dosage
2.3.2.1. Prparation de la solution analyser.
Placer 10 ml de la solution de minralisation obtenue en 2.3.1. dans le flacon
racteur du gnrateur dhydrures, ajouter 10 ml dacide chlorhydrique, 1,5 ml
de solution diodure de potassium, brancher lagitateur magntique et le
courant dazote (dbit : 11 l/min.) ; aprs 10 s de contact, ajouter 5 ml de
solution de borohydrure de sodium. La vapeur dhydrure produite aussitt est
entrane par le courant dazote dans la cellule porte la temprature de
900 C o se produit la dissociation du compos et latomisation de larsenic.
2.3.2.2. Prparation des solutions de la gamme dtalonnage.
A partir de la solution de rfrence darsenic, prparer, par dilutions
successives, des solutions titrant respectivement 1-2-3-4-5 microgrammes
darsenic par litre.
Placer dans le flacon racteur du gnrateur dhydrures successivement 10 ml
de chacune des solutions prpares et traiter selon le mode opratoire dcrit en
2.3.2.1.
2.3.2.3. Mesures
Slectionner la longueur donde 193,7 nm. Rgler le zro de lchelle des
absorbances du spectrophotomtre avec de leau bidistille. Effectuer les
dterminations en double. Enregistrer les absorbances mesures pour la

OIV-MA-AS323-01B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic

solution de lchantillon et les solutions de la gamme dtalonnage. Calculer la


valeur moyenne de labsorbance pour chacune des solutions.
2.4. Expression des rsultats
2.4.1. Mode de calcul
Tracer la courbe des variations de labsorbance en fonction des concentrations
en arsenic des solutions de la gamme dtalonnage. La variation est linaire.
Reporter sur la droite dtalonnage la valeur moyenne de labsorbance de la
solution analyse. En dduire la concentration C en arsenic.
La concentration du vin en arsenic, exprime en microgrammes par litre est
gale 2 C.

BIBLIOGRAPHIE
JAULMES P. et HAMELLE G., Trav. Soc. Pharm. Montpellier, 1967, 27, no 3,
213-225.
JAULMES P., F.V., O.I.V., 1967, no 238
MEDINA B et SUDRAUD P., F.V., O.I.V., 1983, no 770.

OIV-MA-AS323-01B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Arsenic

Mthode OIV-MA-AS323-01C

Mthodes Type IV

Arsenic
1. Principes des mthodes
Aprs minralisation sulfo-nitrique, rduction de larsenic V en arsenic III par
le chlorure dtain II, larsenic est transform en hydrure arsnieux H3As par
action de lhydrogne naissant. Lhydrure arsnieux est dtect par raction
avec le bromure de mercure II (essai limite).
Le dosage de larsenic est ralis par spectrophotomtrie 520 nm dun
complexe color en rouge, form par action de lhydrure arsnieux sur le
dithyldithiocarbamate dargent.

SUPPRIME
(Rsolution OIV-Oeno-377-2009)

OIV-MA-AS323-01C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total

Mthode OIV-MA-AS323-02A

Mthodes Type IV

Azote total
1. Principe
Minralisation par lacide sulfurique en prsence de catalyseur, alcalinisation des
produits de la raction, distillation de lammoniac libr qui est titr par
alcalimtrie.
2. Appareillage
2.1 Appareil de minralisation :
Matras ovode long col de 300 ml pos sur un disque de mtal de 15 cm de
diamtre, perc dune ouverture circulaire de 3 cm de diamtre.
Support permettant de maintenir ce matras le col inclin 45 .
2.2 Appareil de distillation:
Lappareil est constitu par un ballon fond rond de 1 litre, surmont dune
petite colonne rectificatrice de 30 cm de long sur 2,5 cm de diamtre, ou tout
autre dispositif antiprimage et rectificateur efficace. La vapeur, la sortie de ce
dispositif, pntre dans la partie suprieure dun rfrigrant cylindrique, tenu
verticalement, de 30 cm de longueur utile et 1 cm de diamtre interne. Le
liquide condens est amen dans la fiole conique rceptrice par un tube effil
touchant le fond de ce rcipient. On peut galement employer lappareil
entranement par la vapeur deau, tel que celui qui est dcrit au chapitre Acidit
volatile, ou tout autre appareil rpondant aux essais dcrits au paragraphe
Essais blanc et essais tmoins.
3. Ractifs
3.1 Acide sulfurique exempt dammoniaque (20 = 1,83 1,84g/ml)
3.2 Acide benzoque
3.3 Catalyseur:
Sulfate de cuivre, CuSO4.5H2O .......................... ................. 10 g
Sulfate de potassium, K2SO4 .................................. ............... 100 g
3.4 Lessive dhydroxyde de sodium 30 P.100 (m/m) (20 =1,33 g/ml);
3.5 Solution 0,1 M dacide chlorhydrique
3.6 Indicateur:
Rouge de mthyle ............................................ ......... 100 mg
Bleu de mthylne ............................................................. 50 mg
Alcool 50% vol. ............................................... ....... .. 100 ml

OIV-MA-AS323-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total

3.7 Solution dacide borique :


40 g
Acide borique H3BO3 ...................................................
Eau q.s.p. ............................................... .......... 1000 ml
Cette solution, additionne de 5 gouttes de solution de rouge de mthyle, doit
devenir rose par addition de 0,1 ml au plus de solution 0,1 M dacide
chlorhydrique.
3.8 Solution de sulfate dammonium:
Sulfate d'ammonium (NH4)2SO4 .............................................. 6,608 g
Eau q.s.p ........................................................................... 1000 ml
3.9 Tryptophane, C11H12O2N2, (ce corps contient en thorie 13,72 g dazote pour 100 g)
4. Mode opratoire
Dans le matras long col de 300 ml, placer 25 ml de vin, 2 g dacide benzoque et
10 ml dacide sulfurique. Ajouter 2 3 g de catalyseur. Chauffer ce matras, le col
inclin 45, pos sur un disque de mtal perc dun trou de 3 cm de diamtre,
jusqu dcoloration complte, et prolonger ce chauffage pendant 30 min. de plus.
Aprs refroidissement, verser le contenu du matras dans un ballon de 1 litre o lon
a plac 30 ml deau, et rincer le matras plusieurs reprises avec de leau. Aprs
refroidissement du ballon, ajouter 1 goutte de solution de phnolphtaline 1 p. 100
et une quantit suffisante de lessive dhydroxyde de sodium 30 p. 100 pour
obtenir une raction franchement alcaline (40 ml environ), en ayant soin de
refroidir constamment le ballon pendant cette addition. Distiller ensuite 200-250 ml
en recueillant le distillat dans 30 ml de solution dacide borique 40 g/l.
Titrer lammoniaque distill en prsence de 5 gouttes dindicateur laide dune
solution 0,1 M dacide chlorhydrique.
NOTA. On peut utiliser lappareil entranement par la vapeur dcrit au chapitre
Acidit volatile pour obtenir la distillation rapide de lammoniac. Dans ce cas placer
successivement dans le barboteur 40 45 ml de lessive dhydroxyde de sodium 30 p.
100, 50 ml deau, et le contenu du matras pralablement dilue 50-60 ml 10 min.
avant dtre introduite dans le barboteur.
5. Calculs
Soit n le volume dacide chlorhydrique 0,1 M utilis. La quantit dazote total
contenu dans le vin est de 0,56 x n g/l.
6. Essais blanc et essais tmoins
Tout appareil de distillation permettant de doser avec exactitude lammoniac doit
satisfaire aux essais suivants :

OIV-MA-AS323-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total

a) Placer dans le barboteur 40 - 45 ml dhydroxyde de sodium, 50 ml deau,


2 g dacide benzoque et 5 g de sulfate de potassium, 10 ml dacide
sulfurique dilu 50 ml. Distiller 200 ml en recueillant le distillat dans 30
ml dacide borique 40 g/l additionn de 5 gouttes dindicateur. Le virage
de lindicateur doit tre obtenu par 0,1 ml de solution 0,1 M dacide
chlorhydrique.
b) Un essai semblable est fait avec 10 ml de solution 0,1 M de sulfate
dammonium. Dans ce cas, on doit utiliser entre 10,0 et 10,1 ml de solution
0,1 M dacide chlorhydrique pour obtenir le virage de lindicateur.
c) c)

Lessai de la mthode complte (minralisation et


distillation) doit tre ralis en utilisant 200 mg de tryptophane; on
doit utiliser 19,5 19,7 ml dacide chlorhydrique 0,1 M.

OIV-MA-AS323-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total (Mthode Dumas)

Mthode OIV-MA-AS323-02B

Mthodes Type II

Quantification de l'azote total selon la mthode de Dumas


(mots et vins)
(Rsolution Oeno 13/2002)

1. DOMAINE D'APPLICATION
La prsente mthode s'applique l'analyse de l'azote total des mots et des vins
dans la gamme de 0 1000 mg/l.

2. DESCRIPTION DE LA TECHNIQUE
2.1 Principe de la mthode de Dumas
Lanalyse de lazote total se trouvant dans une matrice organique peut-tre ralise
par la mthode de Dumas (1831). Celle-ci consiste en une combustion totale de la
matrice sous oxygne. Les gaz produits sont rduits par du cuivre puis desschs ;
le CO2 est pig. Lazote est ensuite quantifi l'aide d'un dtecteur universel.
2.2 Principe de lanalyse (figure n 1)
- Injection de lchantillon et de loxygne dans le tube de combustion
940C (1) ;
- Combustion flash (2) ;
- La combustion de la nacelle (3) porte temporairement la temprature
1800C ;
- Oxydation complmentaire et pigeage des halognes sur de loxyde
cobalto cobaltique argent et sesquioxyde de chrome granulaire (4) ;
- Rduction des oxydes dazote en N2 et pigeage des composs soufrs et de
lexcs doxygne par du cuivre 700C (5) ;
- Les gaz prsents dans lhlium sont les suivants : N2, CO2 et H2O (6) ;
- Pigeage des lments non doss : H2O par de lanhydrone (perchlorate de
magnsium anhydre granulaire) (7) et du CO2 par de lascarite (hydroxyde
de sodium sur silice) (8) ;
- Sparation chromatographique de lazote et du mthane ventuellement
prsent la suite dune prise dessai trop importante (9) ;
- Dtection sur catharomtre (10) ;
- Collection du signal et traitement des donnes (11).

OIV-MA-AS323-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total (Mthode Dumas)

11
1
66
He

H
11

10
1

22
77

33
55

88

99

44

Figure 1 : Schma du principe de l'analyse

3. REACTIFS ET PREPARATION DES SOLUTIONS REACTIVES


3.1 Azote (qualit technique) ;
3.2 Hlium (puret 99,99994%) ;
3.3 Oxyde de chrome (sesquioxyde de chrome en granules) ;
3.4 Oxyde de cobalt (oxyde cobalto-cobaltique argent granul) ;
3.5 Laine de quartz ;
3.6 Cuivre (cuivre rduit en fils) ;

OIV-MA-AS323-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total (Mthode Dumas)

3.7 Ascarite (hydroxyde de sodium sur silice) ;


3.8 Anhydrone (perchlorate de magnsium anhydre granulaire) ;
3.9 Oxygne (puret 99,995%) ;
3.10 Atropine ;
3.11 Chlorhydrate d'acide glutamique ;
3.12 Eau dminralise ;
3.13 Nacelles en tain.

4. APPAREILLAGE
4.1 Centrifugeuse quipe de pots de 25 ml ;
4.2 Analyseur d'azote ;
4.3 Creuset mtallique ;
4.4 Tube de raction en quartz (2) ;
4.5 Balance de prcision entre 0,5 mg et 30 g 0,3 mg ;
4.6 Porte-nacelles ;
4.7 Etuve ;
4.8 Appareil pour plier les nacelles ;
4.9 Passeur d'chantillons ;
4.10 Ordinateur et imprimante.

5. ECHANTILLONNAGE
Dgazage par barbotage l'azote (3.1) pendant 5 10 mn, des vins
effervescents. Les mots sont centrifugs (4.1) pendant 10 mn 10C, 4200 g.

6. MODE OPERATOIRE
- Ouvrir le programme de l'appareil (4.2 et 4.10) ;
- Mettre en chauffe l'appareil (4.2).

OIV-MA-AS323-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total (Mthode Dumas)

6.1 Principaux paramtres analytiques


Analyseur d'azote (4.2) dans les conditions suivantes :
- gaz vecteur : hlium (3.2) ;
- creuset mtallique (4.3) vider toutes les 80 analyses ;tube (4.4) d'oxydation,
chauff 940 C, contenant de l'oxyde de chrome (3.3) et de l'oxyde de cobalt (3.4)
maintenus par de la laine de quartz (3.5). L'ensemble, tube et ractifs doivent tre
changs toutes les 4000 analyses ;
- tube (4.4) de rduction, chauff 700 C, contenant le cuivre (3.6) maintenu par
de la laine de quartz (3.5). Le cuivre est chang toutes les 450 analyses ;
- tube d'absorption, contenant 2/3 d'ascarite (3.7) et 1/3 d'anhydrone (3.8). Toutes
les 200 analyses, l'ascarite qui a pris en bloc est limine et remplace. Les
absorbeurs sont compltement changs une fois par an.
- Plus il y a de matire organique brler, plus il faut d'oxygne : le temps
d'ouverture de la boucle d'oxygne (3.9) est de 15 secondes pour le mot et de 5
secondes pour le vin.

NOTE : les mtaux sont rcuprs pour envoi en centre de destruction ou de


recyclage spcialis.
6.2 - Prparation de la gamme talon
Prparer deux chantillons d'atropine (3.10) entre 4 et 6 mg. Les peser (4.5)
directement dans les nacelles. La courbe talon passe donc par trois points (origine
= nacelle vide).
6.3 Prparation des autocontrles
Les autocontrles sont passs rgulirement en dbut et au milieu d'une srie
d'analyses.
Les autocontrles sont raliss l'aide d'acide glutamique sous forme de
chlorhydrate utilis sous forme d'une solution 600 mg/l dazote dans de l'eau
dminralise (3.12).
Masse molaire de l'acide glutamique = 183,59
Masse molaire de l'azote = 14,007

183,59 0,6
= 7,864 g/l
14,007

OIV-MA-AS323-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Azote total (Mthode Dumas)

Peser (4.5) 7,864 g d'acide glutamique (3.11) et le diluer dans l'eau


dminralise (3.12) q.s.p. 1 litre, pour obtenir une solution 600 mg/l dazote.
Cette solution est dilue au demi, pour obtenir une solution 300 mg N/l et cette
dernire solution est elle-mme dilue au demi pour obtenir une solution 150
mg/l.
6.4 - Prparation des chantillons :
6.4.1 - Dans une nacelle (3.13), peser ( 0,01 mg prs) 20 l de mot ou 200 l
de vin avec la balance de prcision (4.5). Rpter trois fois l'opration par
chantillon ;
6.4.2 - Noter chaque poids ;
6.4.3 Placer au fur et mesure les nacelles dans le porte-nacelles (4.6) ;
6.4.4 - Mettre les nacelles dans l'tuve (4.7) rgle ~ 60 C, jusqu' schage
complet du liquide (cela demande au moins une heure) ;
6.4.5 - Plier et craser les nacelles avec l'appareil prvu cet effet (4.8), les
mettre sur le passeur (4.9) dans l'ordre des numros.

7. EXPRESSION DES RESULTATS


Ils sont exprims en g/l avec 4 chiffres significatifs aprs la virgule

8. CONTROLE DES RESULTATS


Raccordement indirect par masse, temprature et volume.

9. CARACTERISTIQUES DE PERFORMANCE DE LA METHODE

nombre de
laboratoires

teneur moyenne

rptabilit

reproductibilit

11

591 mg/l

43 mg/l

43 mg/l

10. BIBLIOGRAPHIE

Dumas A. (1826) : Annales de chimie, 33,342.


Buckee G.K. (1994) : Determination of total nitrogen in Barley, Malt and Beer by
Kjeldahl procedures and the Dumas combustion method. Collaborative trial. J. Inst.
Brew., 100, 57-64.

OIV-MA-AS323-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Bore

Mthode OIV-MA-AS323-03

Mthodes Type IV

Bore
Mthode colorimtrique rapide
1. Principe
Aprs concentration au demi pour chasser lalcool, le vin est pass sur une colonne
de plyvinylpolypyrollidone qui retient les matires colorantes. Sur une fraction de
lluat quantitativement recueilli, le bore est dos 420 nm grce au complexe
color en jaune quil donne avec lazomthine H pH 5,2.
2. Appareillage
2.1. Evaporateur rotatif.
2.2. Spectrophotomtre permettant des mesures entre 300 et 700 nm.
2.3. Cuves de 1 cm de trajet optique.
2.4. Colonne de verre dun diamtre intrieur de 1 cm et de 15 cm de haut
contenant sur une hauteur de 8 cm environ de la polyvinylpolypyrrolidone.
3. Ractifs
3.1. Azomthine H (acide-4-hydroxy-5-(2-hydroxybenzylideneamino)-napthalne2,7-disulfonique);
3.2. Solution dazomthine H
Peser 1 g dazomthine H et 2 g dacide of ascorbique et les diluer avec 50 ml
deau bidistille. Tidir pour faire dissoudre puis complter 100 ml dans un
ballon jaug. Le ractif est stable 2 jours si on le conserve au froid.
3.3. Solution tampon, pH 5,2.
Dissoudre 3 g dE.D.T.A. (sel disodique de lacide thylnediaminetetraactique) dans 150 ml deau distille. Ajouter 125 ml dacide actique
(20 = 1,05 g/ml) et dissoudre 250 g dactate dammonium, (NH4CH3COO).
Vrifier le pH au pH-mtre et lajuster, si ncessaire pH 5,2.
3.4. Solution talon de bore 100 mg/l
Utiliser une solution standard du commerce. Cette solution peut tre prpare
en dissolvant 0,571 g dacide borique H3BO3, pralablement dessch 50 C
jusqu poids constant, dans 500 ml deau bidistille. Complter au litre.
3.5. Solution talon de bore 1 mg/l
me

Diluer au 1/100

la solution talon 100 mg/l avec de leau bidistille.

3.6. Polyvinylpolypyrrolidone ou PVPP (Voir Codex nologique international).

OIV-MA-AS323-03 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Bore

4. Mode opratoire
liminer lalcool de 50 ml de vin par concentration au demi dans un vaporateur
rotatif 40 C. Ramener 50 ml avec de leau bidistille.
Prlever 5 ml de cette solution et les faire passer sur la colonne de PVPP.
La matire colorante est totalement fixe. Recueillir lluat et les eaux de rinage
1
de la colonne dans un ballon jaug de 50 ml. Lluat obtenu est du vin dilu au /10.
Le dosage colorimtrique seffectue sur un volume de 5 ml dluat, plac dans un
ballon jaug de 25 ml; diluer 15 ml environ avec de leau bidistille et ajouter en
agitant aprs chaque addition :
5 ml de solution dazomthine H;
4 ml de solution tampon pH 5,2.
Complter 25 ml avec de leau bidistille.
Attendre 30 min. et dterminer labsorbance As, 420 nm, le zro de lchelle des
absorbances tant rgl sur leau distille.
Faire un blanc en portant 25 ml les mmes volumes de ractifs. Attendre 30 min.
et lire labsorbance Ab dans les mmes conditions. Elle doit tre comprise entre
0,20 et 0,24; une absorbance suprieure signifie un apport de bore par leau ou les
ractifs.
tablissement de la droite dtalonnage :
Dans une srie de ballons jaugs de 25 ml, placer de 1 10 g de bore soit 1 10
ml de solution de bore 1 mg/l et continuer comme il est indiqu ci-dessus. La
courbe reprsentative de la variation de (As-Ab) en fonction de la concentration est
une droite passant par lorigine.
As = absorbance de l'chantillon
Ab = absorbance du blanc
5. Calculs
Soit E g de bore contenus dans 5 ml dluat, correspondant 0,5 ml de vin,
obtenu en reportant la diffrence (As - Ab) dtermine pour lchantillon sur la
courbe dtalonnage. La teneur en milligrammes de bore par litre est :
B mg/L = E
0 ,5

BIBLIOGRAPHIE

WOLF B., Soil Science and Plant Analysis, 1971, 2(5), 363-374 et 1974, 5(1), 39-44.
CHARLOT C. et BRUN S., F.V., O.I.V., 1983, no771.

OIV-MA-AS323-03 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Mthode OIV-MA-AS323-04A

Mthodes Type II

Dioxyde de soufre
1 Dfinitions
On appelle dioxyde de soufre libre, le dioxyde de soufre prsent dans le mot ou le vin
sous les formes suivantes : H2SO3, HSO3, dont l'quilibre est fonction du pH et de la
temprature :
H+ + HSO3
H2SO3
H2SO3 reprsente le dioxyde de soufre molculaire.
On appelle dioxyde de soufre total l'ensemble des diffrentes formes de dioxyde de
soufre prsentes dans le vin l'tat libre ou combin ses constituants.
2. Dioxyde de soufre libre et total
2.1. Principe des mthodes
Le dioxyde de soufre est entran par un courant d'air ou d'azote; il est fix et oxyd
par barbotage dans une solution dilue et neutre de peroxyde d'hydrogne. L'acide
sulfurique form est dos par une solution titre d'hydroxyde de sodium.
Le dioxyde de soufre libre est extrait du vin par entranement froid (10 C environ).
2.2. Mthode
2.2.1. Appareillage
L'appareil utilis doit tre conforme au schma ci-dessous, principalement en ce qui
concerne le rfrigrant.
Le tube d'amene des gaz dans le barboteur B est termin par une petite sphre de
1 cm de diamtre comportant sur son grand cercle horizontal 20 trous de 0,2 mm de
diamtre. On peut galement le terminer par une plaque de verre fritt assurant la
formation d'un grand nombre de trs petites bulles ralisant un bon contact des
phases gazeuse et liquide.
Le dbit gazeux qui doit parcourir l'appareil doit tre de 40 l/h environ. Le flacon
plac la droite de l'appareil est destin limiter de 20 30 cm d'eau la dpression
produite par la trompe eau. Pour pouvoir rgler cette dpression de manire que le
dbit soit correct, il y a avantage placer un dbitmtre tube semi-capillaire entre le
barboteur et le flacon.

OIV-MA-AS323-04A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

75
130

250 ml

150

150

60

20

150
200

35

120

Pompe

100 ml

Figure 1 - Les dimensions sont indiques en millimtres. Les diamtres internes des
4 tubes concentriques qui constituent le rfrigrant sont: 45, 34, 27 et 10 mm

2.2.2. Ractifs
2.2.2.1. Acide phosphorique 85% (20 = 1,71 g/ml) dilu 25 pour 100 (m/v).
2.2.2.2. Solution de peroxyde d'hydrogne 9,1 g d'H2O2/l (3 volumes).
2.2.2.3. Ractif indicateur :
Rouge de mthyle ..100 mg
Bleu de mthylne .... 50 mg
Alcool 50 % vol. 100 ml
2.2.2.4. Solution 0,01 M d'hydroxyde de sodium.
2.2.3. Dosage du dioxyde de soufre libre
Le vin doit tre maintenu 20 C en flacon plein et bouch pendant 2 jours avant le
dosage.
2.2.3.1. Mode opratoire
Dans le ballon A de 250 ml de l'appareil entranement, introduire 50 ml
d'chantillon et 15 ml d'acide phosphorique (2.2.2.1). Mettre en place le ballon.
OIV-MA-AS323-04A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Dans le barboteur B, placer 2 3 ml de solution de peroxyde d'hydrogne (2.2.2.2)


2 gouttes de ractif indicateur et neutraliser la solution de peroxyde d'hydrogne par
la solution 0,01 M d'hydroxyde de sodium (2.2.2.4). Adapter ce barboteur
l'appareil.
Faire ensuite barboter l'air (ou l'azote) pendant 15 minutes. Le dioxyde de soufre libre
entran est oxyd en acide sulfurique. Retirer le barboteur de l'appareil et titrer l'acide
form par la solution d'hydroxyde de sodium 0,01 M.
Soit n le nombre de millilitres verss.
2.2.3.2. Expression des rsultats
Le dioxyde de soufre libre est exprim en milligrammes par litre (mg/l) sans dcimale.
2.2.3.2.1. Calcul
Dioxyde de soufre libre en milligrammes par litre : 6,4 n.
2.2.4. Dosage du dioxyde de soufre total
2.2.4.1. Mode opratoire
Teneur prsume de l'chantillon 50 mg/l SO2 total.
Dans le ballon A de 250 ml de l'appareil entranement, introduire 50 ml d'chantillon
et 15 ml d'acide phosphorique (2.2.2.1). Mettre en place le ballon.
Remarque : Dans le cas des jus de raisin, on continuera utiliser le mode opratoire
dcrit dans l'dition 1978 du Recueil (voir page 367).
Teneur prsume de l'chantillon 50 mg/l SO2 total.
Dans le ballon A de 250 ml de l'appareil entranement, introduire 20 ml de cette
solution et 5 ml d'acide phosphorique 85%. Mettre en place le ballon.
Placer dans le barboteur B 2 3 ml de solution de peroxyde d'hydrogne (2.2.2.2), la
neutraliser comme prcdemment, porter le vin contenu dans le ballon A l'bullition
au moyen d'une petite flamme de 4 5 cm de haut qui doit lcher directement le fond
du ballon. Ne pas placer sous le ballon une toile mtallique, mais le poser sur un
disque perc d'un trou de 30 mm de diamtre. On vite ainsi la pyrognation des
matires extractives du vin sur les parois du ballon.
Maintenir l'bullition pendant le passage du courant d'air (ou d'azote). En 15 minutes,
le dioxyde de soufre total a t entran et oxyd. Doser l'acide sulfurique form par la
solution 0,01 M d'hydroxyde de sodium (2.2.2.4).
Soit n le nombre de millilitres verss.
2.2.4.2. Expression des rsultats
2.2.4.2.1. Calcul
Dioxyde de soufre total en milligrammes par litre.
chantillons pauvres en dioxyde de soufre (prise d'essai 50 ml) : 6,4 n
Autres chantillons (prise d'essai 20 ml) : 16 n
2.2.4.2.2. Rptabilit (r)
Teneur < 50 mg/l (prise d'essai de 50 ml), r = 1 mg/l
Teneur > 50 mg/l (prise d'essai de 20 ml), r = 6 mg/l
OIV-MA-AS323-04A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

2.2.4.2.3. Reproductibilit (R)


Teneur < 50 mg/l (prise d'essai de 50 ml), R = 9 mg/l
Teneur > 50 mg/l (prise d'essai de 20 ml), R = 15 mg/l

BIBLIOGRAPHIE
PAUL F., Mitt. Klosterneuburg, Rebe u. Wein, 1958, ser. A, 821.

OIV-MA-AS323-04A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Mthode OIV-MA-AS323-04B

Mthodes Type IV

Dioxyde de soufre
1 Dfinitions
On appelle dioxyde de soufre libre, le dioxyde de soufre prsent dans le mot ou le vin
sous les formes suivantes : H2SO3, HSO3, dont l'quilibre est fonction du pH et de la
temprature :
H+ + HSO3
H2SO3
H2SO3 reprsente le dioxyde de soufre molculaire.
On appelle dioxyde de soufre total l'ensemble des diffrentes formes de dioxyde de
soufre prsentes dans le vin l'tat libre ou combin ses constituants.
2. Dioxyde de soufre libre et total
2.1. Principe des mthodes
Mthode rapide d'essai
Le dioxyde de soufre libre est dos par titrage iodomtrique direct.
Le dioxyde de soufre combin est dos, la suite, par titrage iodomtrique aprs
hydrolyse alcaline. Ajout au dioxyde de soufre libre, il permet d'obtenir le dioxyde
de soufre total.
2.2. Mthode rapide d'essai
2.2.1. Ractifs
2.2.1.1. EDTA : sel disodique de l'acide thylnediaminettractique.
2.2.1.2. Solution 4 M d'hydroxyde de sodium (160 g/l).
2.2.1.3. Acide sulfurique (20 = 1,84 g/ml), solution au 1/10 (v/v).
2.2.1.4. Empois d'amidon solution 5 g/l.
Dlayer 5 g d'amidon dans 500 ml d'eau environ. Porter bullition en agitant et
maintenir l'bullition pendant 10 minutes; ajouter 200 g de chlorure de sodium. Porter
au litre aprs refroidissement.
2.2.1.5. Solution 0,025 M d'iode.
2.2.2. Dioxyde de soufre libre
Dans une fiole conique de 500 ml, placer :
- 50 ml de vin
- 5 ml d'empois d'amidon (2.2.1.4)
- 30 mg de EDTA (2.2.1.1)
- 3 ml de H2SO4 au 1/10 (v/v) (2.2.1.3)
Titrer immdiatement par l'iode 0,025 M (2.2.1.5) jusqu' ce que la coloration bleue
persiste nettement durant 10 15 secondes. Soit n ml le volume d'iode utilis.
OIV-MA-AS323-04B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

2.2.3. Dioxyde de soufre combin


Ajouter 8 ml de solution 4 M d'hydroxyde de sodium (2.2.1.2), agiter une seule fois et
laisser 5 minutes en contact. Verser d'un seul coup et en agitant nergiquement le
contenu d'un petit vase cylindrique dans lequel 10 ml d'acide sulfurique au 1/10e
(2.2.1.3) avaient t placs. Titrer immdiatement par l'iode 0,025 M, (2.2.1.5). Soit n'
le volume d'iode employ.
Ajouter 20 ml de solution 4 M d'hydroxyde de sodium (2.2.1.2), laisser en contact 5
minutes aprs avoir agit une seule fois. Diluer avec 200 ml d'eau aussi froide que
possible.
En agitant nergiquement, verser d'un seul coup 30 ml d'acide sulfurique au 1/10
pralablement placs dans une prouvette. Titrer par l'iode 0,025 M (2.2.1.5) le
dioxyde de soufre libr. Soit n" le volume d'iode employ.
2.2.4. Expression des rsultats
2.2.4.1. Calcul
Dioxyde de soufre libre en milligrammes par litre : 32 n
Dioxyde de soufre total en milligrammes par litre : 32 (n + n' + n").
Remarques :
1. Pour les vins rouges pauvres en SO2 il y a intrt employer de l'iode plus dilu que
0,025 M, par exemple : 0,01M. Remplacer le coefficient 32 par 12,8 dans les
formules ci-dessus.
2. Pour les vins rouges, il y a avantage clairer le vin par-dessous avec un faisceau de
lumire jaune obtenue l'aide d'une ampoule lectrique ordinaire et d'une solution
de chromate de potassium ou l'aide d'une lampe vapeur de sodium. Il faut se
placer dans une chambre noire et observer la transparence du vin, qui devient
opaque ds que le virage de l'empois est atteint.
3. Lorsque la quantit de dioxyde de soufre trouve avoisine ou dpasse la limite
lgale, il convient de doser le dioxyde de soufre total par la mthode de rfrence.
4. Lorsqu'on attache un intrt particulier au dosage du dioxyde de soufre, il sera
conventionnellement dtermin sur un chantillon maintenu pendant 2 jours l'abri
de l'air la temprature de 20 C avant l'analyse : celle-ci sera galement excute
cette temprature.
5. tant donn que certaines substances sont oxydes par l'iode en milieu acide, il est
ncessaire - pour des dosages plus prcis - d'valuer la quantit d'iode ainsi utilise.
Pour cela, il faut combiner le dioxyde de soufre libre par un excs d'thanal ou de
propanal, avant d'effectuer le titrage par l'iode. 50 ml de vin placs dans une fiole
conique de 300 ml, ajouter 5 ml de solution d'thanal (C2H4O 7 g/l) ou 5 ml d'une
solution de propanal (C3H6O) 10 g/l.
Boucher et laisser au repos 30 minutes au moins. Ajouter 3 ml d'acide sulfurique au
/10 (2.2.1.3) et de l'iode 0,025 M (2.2.1.5) en quantit suffisante pour faire virer

OIV-MA-AS323-04B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

l'empois d'amidon. Soit n''' le volume d'iode employ. Il doit tre retranch de n
(dioxyde de soufre libre) et de n + n' + n" (dioxyde de soufre total).
n''' est gnralement faible : 0,2 0,3 ml d'iode 0,025 M. Si le vin a t additionn
d'acide ascorbique, n''' est beaucoup plus lev et on peut, au moins
approximativement, mesurer la quantit de ce produit par la valeur de n''' sachant que 1
ml d'iode 0,025 M oxyde 4,4 mg d'acide ascorbique. Par la mesure de n''', on peut ainsi
dceler sans difficults les vins qui ont t additionns d'acide ascorbique en quantit
suprieure 20 mg/l et qui ne s'est pas transform en produits d'oxydation.

BIBLIOGRAPHIE
Mthode rapide d'essai :
RIPPER M., J. Prakt. Chem., 1892, 46, 428.
JAULMES, P., DIEUZEIDE J.-C., Ann. Fals. Fraudes, 1954, 46, 9; Bull. O.I.V.,
1953, 26, n 274, 52.
KIELHOFER E., AUMANN H., Mitt. Klosterneuburg, Rebe und Wein, 1957, 7, 289.
JAULMES P., HAMELLE Mme G., Ann. Fals. Exp. Chim., 1961, 54, 338

OIV-MA-AS323-04B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Mthode OIV-MA-AS323-04C

Mthode Type IV

Dioxyde de soufre
1 Dfinitions
On appelle dioxyde de soufre libre, le dioxyde de soufre prsent dans le mot ou le vin
sous les formes suivantes : H2SO3, HSO3, dont l'quilibre est fonction du pH et de la
temprature :
H+ + HSO3
H2SO3
H2SO3 reprsente le dioxyde de soufre molculaire.
On appelle dioxyde de soufre total l'ensemble des diffrentes formes de dioxyde de
soufre prsentes dans le vin l'tat libre ou combin ses constituants.
2. Dioxyde de soufre molculaire
2.1. Principe de la mthode
Le pourcentage de dioxyde de soufre molculaire, H2SO3, dans le dioxyde de soufre
libre, est valu en fonction du pH, du titre alcoomtrique et de la temprature.
Pour une temprature et un titre alcoomtrique donns :
H+ + HSO3
L
[H2SO3] =
(pH pk M )
10
1
H2SO3

avec

(1)

L = [H2SO3] + [HSO3]
pkM = pkT

A I
I B I

I
= force ionique
A et B = coefficients qui varient avec la temprature et le titre alcoomtrique
= constante thermodynamique de dissociation; la valeur de pkT est donne
kT
dans le tableau 1 en fonction du titre alcoomtrique et de la temprature
= constante mixte de dissociation
kM
En prenant pour la force ionique i la valeur moyenne 0,038 le tableau 2 donne les
valeurs de pkM en fonction de la temprature et du titre alcoomtrique.
La teneur en dioxyde de soufre molculaire calcule partir de la relation (1) est
donne dans le tableau 3 en fonction du pH, de la temprature et du titre
alcoomtrique.

OIV-MA-AS323-04C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

2.2. Calcul
Connaissant le pH du vin, son titre alcoomtrique, le pourcentage de dioxyde de soufre
molculaire est donn par le tableau 3 pour la temprature t C; soit X %.
Teneur en dioxyde de soufre molculaire en mg/l : X C
C = teneur en dioxyde de soufre libre en mg/l.

Tableau 1
Valeurs de la constante thermodynamique pkT
Temprature C
30
2,219
2,299
2,394
2,503
2,628

Alcool
% en volume
0
5
10
15
20

20
1,798
1,897
1,997
2,099
2,203

35
2,334
2,397
2,488
2,607
2,754

40
2,493
2,527
2,606
2,728
2,895

Alcool
% en volume
0
5
10
15
20

Valeurs de la constante mixte pkM (I = 0,038)


Temprature C
20
25
30
35
1,723
1,925
2,143
2,257
1,819
2,020
2,220
2,317
1,916
2,116
2,311
2,405
2,014
2,216
2,417
2,520
2,114
2,317
2,538
2,663

40
2,416
2,446
2,522
2,640
2,803

25
2,000
2,098
2,198
2,301
2,406

Tableau 2

OIV-MA-AS323-04C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Tableau 3
Dioxyde de soufre molculaire en pourcentage du dioxyde de soufre libre (I = 0,038)
T = 20 oC
PH
2,8
2,9
3,0
3,1
3,2
3,3
3,4
3,5
3,6
3,7
3,8

7,73
6,24
5,02
4,03
3,22
2,58
2,06
1,64
1,31
1,04
0,83

Alcool % en volume
10

15

20

9,46
7,66
6,18
4,98
3,99
3,20
2,56
2,04
1,63
1,30
1,03

11,55
9,40
7,61
6,14
4,94
3,98
3,18
2,54
2,03
1,62
1,29

14,07
11,51
9,36
7,58
6,12
4,92
3,95
3,16
2,53
2,02
1,61

17,09
14,07
11,51
9,36
7,58
6,12
4,92
3,95
3,16
2,53
2,02

20,67
17,15
14,12
11,55
9,40
7,61
6,14
4,94
3,97
3,18
2,54

24,75
22,71
17,18
14,15
11,58
9,42
7,63
6,16
4,55
3,98
3,18

29,28
24,75
20,71
17,18
14,15
11,58
9,42
7,63
6,16
4,95
3,98

35,36
30,29
25,66
21,52
17,88
14,75
12,08
9,84
7,98
6,44
5,19

T = 25 oC
2,8
2,9
3,0
3,1
3,2
3,3
3,4
3,5
3,6
3,7
3,8

11,47
9,58
7,76
6,27
5,04
4,05
3,24
2,60
2,07
1,65
1,32

14,23
11,65
9,48
7,68
6,20
4,99
4,00
3,20
2,56
2,05
1,63

17,15
14,12
11,55
9,40
7,61
6,14
4,94
3,97
3,18
2,54
2,03

T = 30 oC
2,8
2,9
3,0
3,1
3,2
3,3
3,4
3,5
3,6
3,7
3,8

18,05
14,89
12,20
9,94
8,06
6,51
5,24
4,21
3,37
2,69
2,16

20,83
17,28
14,23
11,65
9,48
7,68
6,20
4,99
4,00
3,21
2,56

OIV-MA-AS323-04C : R2009

24,49
20,48
16,98
13,98
11,44
9,30
7,53
6,08
4,89
3,92
3,14

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Tableau 3 (suite)
Dioxyde de soufre molculaire en pourcentage du dioxyde de soufre libre (I = 0,038)
T=35 oC
pH
Alcool % en volume
0
5
10
15
20
2,8
2,9
3,0
3,1
3,2
3,3
3,4
3,5
3,6
3,7
3,8

22,27
18,53
15,31
12,55
10,24
8,31
6,71
5,44
4,34
3,48
2,78

24,75
20,71
17,18
14,15
11,58
9,42
7,63
6,16
4,95
3,98
3,18

28,71
24,24
20,26
16,79
13, 82
11,30
9,19
7,44
6,00
4,88
3,87

34,42
29,42
24,88
20,83
17,28
14,23
11,65
9,48
7,68
6,20
4,99

42,18
36,69
31,52
26,77
22,51
18,74
15,49
12,71
10,36
8,41
6,80

34,52
29,52
24,96
20,90
17,35
14,29
11,70
9,52
7,71
6,22
5,01

40,89
35,47
30,39
25,75
21,60
17,96
14,81
12,13
9,88
8,01
6,47

50,14
44,74
38,85
33,54
28,62
24,15
20,19
16,73
13,77
11,25
9,15

T = 40 oC
2,8
2,9
3,0
3,1
3,2
3,3
3,4
3,5
3,6
3,7
3,8

29,23
24,70
20,67
17,15
14,12
11,55
9,40
7,61
6,14
4,94
3,97

30,68
26,01
21,83
18,16
14,98
12,28
10,00
8,11
6,56
5,28
4,24

BIBLIOGRAPHIE
Dioxyde de soufre molculaire :
BEECH F.W. & TOMAS Mme S., Bull. O.I.V., 1985, 58, 564-581.
USSEGLIO-TOMASSET L. & BOSIA P.D., F.V., O.I.V., 1984, n 784.

OIV-MA-AS323-04C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Dioxyde de soufre

Mthode OIV-MA-AS323-05

Mthode Type IV

Dioxyde de soufre
Mthode de rfrence
Mode opratoire dans le seul cas des jus de raisin

1. Appareillage :
Voir en 2.2.1., de la fiche OIV-MA-AS323-04A
2. Ractifs :
Acide phosphorique (20 =1,71 g/ml) dilu 25 p.100 (m/v).
Pour les autres ractifs, voir en 2.2.2., de la fiche OIV-MA-AS323-04A
3. Mode opratoire :
Dans le ballon A de 250 ml de lappareil entranement, introduire 50 ml de
jus de raisin et 5 ml dacide phosphorique dilu 25 p.100 (m/v). Mettre en
place le ballon.
Continuer comme il est indiqu en 2.2.4.1., de la fiche OIV-MA-AS323-04A
4. Calculs :
Si n est le nombre de millilitres de solution 0,01 M dhydroxyde de sodium
utiliss, la teneur en dioxyde de soufre total du jus de raisin en milligrammes
par litre est : 6,4 x n

OIV-MA-AS323-05 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

Mthode OIV-MA-AS323-06

Mthode Type IV

Dosage du mercure dans le vin par gnration de vapeur et


spectromtrie de fluorescence atomique
(Rsolution Oeno 14/2002)

1. DOMAINE DAPPLICATION
La prsente mthode sapplique lanalyse du mercure des vins dans la gamme
de concentration de 0 10 g/l.
2. DESCRIPTION DE LA TECHNIQUE
2.1. Principe de la mthode
2.1.1. Minralisation du vin : Elle est effectue en milieu acide, en
chauffant sous reflux.
La minralisation est acheve par du permanganate de potassium.
2.1.2. Rduction du permanganate non consomm par du chlorhydrate
dhydroxylamine.
2.1.3. Rduction du mercure II en mercure mtal par du chlorure dtain
II.
2.1.4. Entranement du mercure par un courant dargon, temprature
ambiante.
2.1.5. Dosage du mercure ltat de vapeur monoatomique par
spectromtrie de fluorescence atomique, la longueur donde de
254 nm : les atomes de mercure sont excits par une lampe
vapeur de mercure ; les atomes ainsi excits rmettent une
radiation dite de fluorescence qui permet de quantifier le mercure
prsent laide dun dtecteur photonique plac 90 par rapport
au faisceau dexcitation ; la dtection par fluorescence atomique
permet dobtenir une bonne linarit et limine les effets de
mmoire.
2.2. Principe de lanalyse (figure n1)
La pompe pristaltique aspire la solution de chlorure dtain II, le blanc
(eau dminralise contenant 1 % dacide nitrique) et ltalon ou
lchantillon de vin minralis.
Le mercure mtal est entran, dans le sparateur gaz-liquide, par un
courant dargon.
OIV-MA-AS323-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

Aprs passage dans la gaine dun desschant, le mercure est dtect par
fluorescence.
Puis, le courant gazeux passe dans une solution de permanganate de
potassium afin de piger le mercure.

3. REACTIFS ET PREPARATION DES SOLUTIONS REACTIVES


3.1. Eau dminralise ultra-pure
3.2. Acide nitrique ultra-pur 65 %
3.3. Blanc
eau dminralise (3.1.) contenant 1 % dacide nitrique (3.2.)
3.4. Solution dacide nitrique 5,6 M :
Introduire 400 ml dacide nitrique (3.2.) dans une fiole de 1000 ml ;
complter au volume avec de leau dminralise (3.1.).
3.5. Acide sulfurique (d = 1,84)
3.6. Solution dacide sulfurique 9 M :

OIV-MA-AS323-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

Introduire 200 ml deau dminralise (3.1.) dans une fiole de 1000 ml,
puis 500 ml dacide sulfurique (3.5.) ; aprs refroidissement, complter au
volume avec de leau dminralise (3.1.).
3.7. Permanganate de potassium KMnO4
3.8. Solution de permanganate de potassium 5 % (m/v):
Dissoudre, avec de leau dminralise (3.1.), 50 g de permanganate de
potassium (3.7.) dans une fiole de 1000 ml ; complter au volume avec de
leau dminralise (3.1.).
3.9. Chlorhydrate dhydroxylamine NH2OH, HCl
3.10. Solution rductrice :
Peser 12 g de chlorhydrate dhydroxylamine (3.9.) et les dissoudre dans
100 ml deau dminralise (3.1.).
3.11. Chlorure dtain II (SnCl2, 2 H2O)
3.12. Acide chlorhydrique concentr
3.13. Solution de chlorure dtain II :
Peser 40 g de chlorure dtain II (3.11.) et les dissoudre dans 50 ml
dacide chlorhydrique (3.12.) ; complter 200 ml avec de leau
dminralise (3.1.).
3.14. Solution-mre de mercure 1 g/l,
Prpare par dissolution de 1,708 g de Hg(NO3)2.H2O dans une solution
aqueuse dacide nitrique 12 %.
3.15. Solution-talon de mercure 10 mg/l,
Placer 1 ml de la solution mre de mercure (3.14) dans une fiole jauge
de 100 ml, ajouter 5 ml dacide nitrique (3.2), complter au volume avec
de leau dminralise (3.1)

OIV-MA-AS323-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

3.16. Solution de mercure 50 g/l :


Placer 1 ml de la solution 10 mg/l (3.15.) dans une fiole de 200 ml ;
ajouter 2 ml dacide nitrique (3.2.) ; complter au volume avec de leau
dminralise (3.1.).

4. APPAREILLAGE
4.1 Verrerie :
4.1.1 fioles jauges de 100, 200 et 1000 ml (classe A)
4.1.2 pipettes jauges de 0,5 ; 1,0 ; 2,0 ; 5 ; 10 et 20 ml (classe A)
4.1.3 prcautions : Avant toute utilisation, la verrerie doit tre lave avec
de lacide nitrique 10 %, laisse en contact pendant 24 heures,
puis rince avec de leau dminralise.
4.2 Appareil de minralisation (figure n2)
4.3 Chauffe-ballon thermostat
4.4 Pompe pristaltique
4.5 Gnrateur de vapeur froide
4.5.1 sparateur gaz-liquide
4.6 Desschant
(membrane hygroscopique) parcouru par un courant dair (fourni par un
compresseur) et plac avant le dtecteur
4.7 Spectrofluorimtre :
4.7.1 lampe vapeur de mercure, rgle la longueur donde de 254 nm
4.7.2 dtecteur spcifique de fluorescence atomique
4.8 Micro-ordinateur :
4.8.1 logiciel rglant les paramtres du gnrateur de vapeur et du
dtecteur de fluorescence atomique et permettant ltalonnage et
lexploitation des rsultats.

OIV-MA-AS323-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

4.8.2 imprimante archivant les rsultats


4.9 Bouteille de gaz neutre (argon)

5. PREPARATION
ECHANTILLONS

DE

LA

COURBE

DETALONNAGE

ET

DES

5.1 Courbe dtalonnage : 0 ; 0,25 ; 0,5 et 1,0 g/l


Introduire 0 ; 0,5 ; 1,0 ; 2,0 ml de la solution de mercure 50 g/l (3.16.)
dans 4 fioles de 100 ml ; ajouter 1 % dacide nitrique (3.2.) ;
complter au volume avec de leau dminralise (3.1.).
5.2 Prparation des chantillons (figure n2)
Le vin est minralis dans un appareil en verre-pyrex compos de trois
lments runis entre eux par des rodages sphriques : un ballon de 250 ml,
une chambre de rcupration des vapeurs, un rfrigrant.
Placer laide dune pipette 20 ml de vin dans le ballon raction de 250
ml ; assembler lappareil de minralisation.
Ajouter trs lentement 5 ml dacide sulfurique (3.6.) et 10 ml dacide
nitrique (3.4.) ; laisser agir une nuit.
Chauffer lentement sous reflux jusqu disparition des vapeurs nitreuses ;
laisser refroidir.
Rcuprer les vapeurs condenses dans le ballon raction.
Rincer le dispositif avec de leau dminralise.
Transvaser le contenu du ballon raction dans une fiole jauge de 100 ml.
Ajouter la solution de permanganate de potassium (3.8.) jusqu
persistance de la coloration.
Solubiliser le prcipit (MnO2) avec la solution rductrice (3.10.).
Complter au volume avec de leau dminralise (3.1.).
Faire un essai blanc sur de leau dminralise.

OIV-MA-AS323-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

6 MODE OPERATOIRE
6.1 Dtermination analytique
Allumer le fluorimtre ; lappareil est stabilis au bout de 15 minutes. La
pompe pristaltique aspire le blanc (3.3.), la solution de chlorure dtain II
(3.13.) et les talons ou les chantillons (5.1.) ou (5.2.).
Vrifier quil se produit un bullage dans le sparateur gaz-liquide.
Prsenter successivement les solutions dtalonnage (5.1.) ; dclencher la
programmation du gnrateur de vapeur. Le logiciel de lordinateur tablit
la courbe dtalonnage (pourcentage de fluorescence en fonction de la
concentration en mercure en g/l).
Prsenter ensuite les chantillons (5.2.).
6.2.Autocontrles
Toutes les cinq dterminations, un blanc analytique et un talon sont
analyss afin de corriger une ventuelle drive du spectrofluorimtre.

OIV-MA-AS323-06 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Mercure

7. EXPRESSION DES RESULTATS


Les rsultats sont donns par le logiciel de lordinateur et exprims en g/l.
Dduire la concentration en mercure du vin en g/l en tenant compte de la
dilution 1/5.

8. CONTROLE DES RESULTATS


Le contrle qualit est effectu en plaant, aprs la gamme dtalonnage et tous
les cinq chantillons, un matriau de rfrence dont on connat avec certitude la
teneur en mercure. Suivant les sries analytiques, le matriau de rfrence est un
vin rouge, ou un vin blanc sec ou un vin blanc doux.
Une carte de contrle est tablie pour chaque matriau de rfrence utilis. Les
limites de contrle ont t fixes : +/- 2SR intra (SR intra : cart-type de
reproductibilit).
Le calcul de lincertitude, ralis partir des cartes de contrle, a donn pour le
vin rouge de rfrence : 3,4 +/- 0,8 g/l et pour le vin blanc sec de rfrence :
2,8 +/- 0,9 g/l.

9. BIBLIOGRAPHIE
CAYROL M., BRUN S., 1975. Dosage du mercure dans les vins. Feuillet Vert
de lO.I.V. n371.
REVUELTA D., GOMEZ R., BARDON A., 1976. Dosage du mercure dans le
vin par la mthode des vapeurs froides et spectromtrie dabsorption atomique.
Feuillet Vert de lO.I.V. n494.
CACHO J., CASTELLS J.E., 1989. Determination of mercury in wine by
flameless atomic absorption spectrophotometry. Atomic Spectroscopy, vol. 10,
n3.
STOCKWELL P.B., CORNS W.T., 1993. The role of atomic fluorescence
spectrometry in the automatic environmental monitoring of trace element
analysis. Journal of Automatic Chemistry, vol. 15, n3, p 79-84.
SANJUAN J., COSSA D., 1993. Dosage automatique du mercure total dans les
organismes marins par fluorescence atomique. IFREMER, Rapport dactivit.
AFNOR, 1997. Dosage du mercure total dans les eaux par spectromtrie de
fluorescence atomique. XPT 90-113-2.
GAYE J., MEDINA B., 1998. Dosage du mercure dans le vin par analyse en
flux continu et spectrofluorimtrie. Feuillet Vert de lO.I.V. n1070.

OIV-MA-AS323-06 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS
Mthode OIV OIV-MA-AS323-07

Type de mthode II

Analyse multi-lmentaire par ICP-MS


(OIV-Oeno 344-2010)
1.

DOMAINE DAPPLICATION

La prsente mthode peut tre applique lanalyse des lments de la liste


suivante qui sont prsents dans les vins dans la fourchette indique :
Aluminium entre 0,25 et 5,0 mg/l
Bore entre 10 et 40 mg/l
Brome entre 0,20 et 2,5 mg/l
Cadmium entre 0,001 et 0,040 mg/l
Cobalt entre 0,002 et 0,050 mg/l
Cuivre entre 0,10 et 2,0 mg/l
Strontium entre 0,30 et 1,0 mg/l
Fer entre 0,80et 5,0 mg/l
Lithium entre 0,010 et 0,050 mg/l
Magnsium entre 50 et 300 mg/l
Manganse entre 0,50 et 1,5 mg/l
Nickel entre 0,010 et 0,20 mg/l
Plomb entre 0,010 et 0,20 mg/l
Rubidium entre 0,50 et 1,2 mg/l
Sodium entre 5 et 30 mg/l
Vanadium entre 0,003 et 0,20 mg/l
Zinc entre 0,30 et 1,0 mg/l

OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Cette technique permet galement danalyser dautres lments.


Il savre parfois ncessaire de minraliser lchantillon. Cest le cas, par
exemple, des vins avec plus de 100 g/L de sucre o il peut tre ncessaire de
raliser avant, une minralisation de lchantillon. Dans ce cas, il est
recommand de raliser une digestion avec lacide nitrique dans un
microonde.
La technique peut tre applique galement aux mots, aprs la
minralisation.

2.

PRINCIPE

Dtermination quantitative multi-lmentaire par spectromtrie de masse


plasma coupl inductivement ou ICP-MS (Inductively Coupled Plasma
Mass Spectrometry).
Injection et nbulisation de lchantillon dans un plasma form par un
courant haute frquence. Le plasma provoque la dsolvatation,
latomisation et lionisation des lments prsents dans l'chantillon.
Extraction des ions travers un systme de vide dot de lentilles ioniques.
Sparation des ions en fonction du rapport masse/charge dans un
spectromtre de masse, par exemple un quadriple. Dtection et
quantification des ions travers un systme multiplicateur dlectrons.

3.

RACTIFS ET SOLUTIONS

3.1 Eau dminralise, ultra pure avec une rsistivit ( 18 M),


conformment la norme ISO 3696.
3.2

Solution(s) certifie(s) (par exemple 100 mg/l) contenant les mtaux


qui vont tre analyss. Des solutions multi-lmentaires ou monolmentaires peuvent tre utilises.

3.3 Solution dindium et/ou


(normalement 1 g/l).

de

rhodium

comme

talon

interne

3.4 Acide nitrique 60 % (impurets mtalliques 0,1 g/l).


OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

3.5 Argon avec une puret minimale de 99,999 %


3.6 Azote (teneur maximale en impurets : H2O 3 mg/l, O2 2 mg/l et
CnHm 0,5 mg/l).
La concentration des solutions, ainsi que les talons internes, sont donns
titre dexemple.

Prparation des solutions talons :


La concentration dacide dans les talons et dans la dilution finale des
chantillons de vin doit tre identique et ne pas dpasser
5
%.
Celle indique ci-aprs est donne titre dexemple.
3.7 Solution mre (5 mg/L).
Dans un tube de 10 ml (4.5), mettre 0,5 ml de la solution (3.2) et ajouter
0,1 ml dacide nitrique (3.4). Complter 10 ml avec de leau
dminralise (3.1), et homogniser.
Dure de conservation : 1 mois
3.8 Solution talon interne (1 mg/L).
laide des micropipettes (4.4), mettre 50 l de la solution dindium
et/ou de rhodium (3.3) et 0,5 ml dacide nitrique (3.4) dans un tube de
50 ml (4.6). Complter 50 ml avec de leau dminralise (3.1), et
homogniser.
Dure de conservation : 1 mois
3.9 Solutions talon de la courbe dtalonnage.
Adapter la fourchette de la srie d'talons en fonction de la dilution
effectue sur
lchantillon ou lquipement utilis.
Utiliser les pipettes de 1 000 l et 100 l (4.4).
Dure de conservation des solutions talons : 1 jour
Ces solutions talon peuvent galement tre prpares de manire
gravimtrique.
OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Ajouter un talon interne avec la mme concentration


que pour les chantillons.
3.10

Vin avec contrle interne des concentrations connues (matriau de


rfrence certifi, matriau de rfrence externe, matriau de rfrence
interne, etc.).

4.

MATRIEL ET QUIPEMENTS

4.1 Spectromtre de masse plasma coupl inductivement avec ou sans


cellule de raction/collision.
4.2 Ordinateur avec logiciel de traitement de donnes et imprimante.
4.3 chantillonneur automatique (en option)
4.4 Micropipettes de 1 000 l et 100 l.
4.5 Tubes essai avec bouchon de 10 ml, en plastique, gradus ou fioles
jauges en
verre.
4.6 Tubes essai avec bouchon de 50 ml, en plastique, gradus ou fioles
jauges en
verre.
Tout le matriel volumtrique (micropipettes et tubes essai) doit tre
dment talonn.
Note : le matriel qui va tre en contact avec l'chantillon comme, par
exemple, les tubes et les pointes, doit rester, au moins pendant 24 heures,
dans une solution d'acide nitrique (3.4) une concentration de 10 %, et doit
ensuite tre rinc plusieurs fois avec de leau (3.1).

5.

PRPARATION DES CHANTILLONS

Les chantillons de vin mousseux doivent faire lobjet dun dgazage. Ce


dernier peut tre ralis par barbotage d'azote (3.6) pendant 10 minutes ou
en utilisant un bain d'ultrasons.

OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

viter que le vin soit contamin en retirant le bouchon avec prcaution. Le


goulot de la bouteille doit tre lav avec une solution acide (HNO3 2 %).
Les chantillons de vin doivent tre prlevs directement de la bouteille.
Dans un tube de 10 ml (3.5), introduire avec une micropipette (4.4), 0,5 ml
de vin, de 0,1 0,5 ml dacide nitrique (3.4) et 100 l de la solution talon
interne (3.8). Complter avec de leau (3.1) et homogniser.
Pour certains lments, il peut tre ncessaire deffectuer une dilution plus
importante en raison de la teneur naturelle leve desdits lments dans
l'chantillon.
Llment Br prsente un potentiel dionisation lev et, compte tenu de la
prsence de concentrations importantes dautres lments dans les vins avec
un faible potentiel dionisation, son ionisation dans le plasma peut tre
incomplte, donnant lieu une quantification errone de llment, cest
pourquoi il est recommand deffectuer une dilution 1/50 pour viter cet
effet (dans le cas o une autre dilution serait utilise, examiner les rsultats,
en vrifiant la rcupration obtenue aprs avoir effectu un ajout).
Dans le cas o les talons seraient prpars de manire gravimtrique, la
dilution finale de lchantillon doit galement tre obtenue de manire
gravimtrique.

6.

PROCDURE

Mettre lappareil en marche (pompe en fonctionnement et plasma allum).


Nettoyer le systme pendant 20 minutes avec de lacide nitrique (3.4) 2 %.
Sassurer que lappareil fonctionne correctement.
Analyser un blanc et la srie de solutions talon dans lordre croissant des
concentrations, la suite dune solution talon (ex. n 2 de la srie 3.9) pour
vrifier que ltalonnage est correct et enfin le blanc pour sassurer de
labsence deffet-mmoire. Lire les chantillons en double. Utiliser comme
contrle interne un vin dont les concentrations sont connues (3.10) pour
sassurer que les rsultats sont cohrents.
OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

lment

m/z (rapport masse/charge) *

Aluminium

27

Bore

11

Brome

79

Cadmium

114

Cobalt

59

Cuivre

63

Strontium

88

Fer

56/57

Lithium

Magnsium

24

Manganse

55

Nickel

60

Plomb

moyenne de 206, 207 et 208

Rubidium

85

Sodium

23

Vanadium

51

Zinc

64

Le tableau ci-dessus est donn titre dexemple. En fonction de


lquipement, il peut tre ncessaire
dutiliser dautres isotopes.

Dans le cas dquipements sans cellule de raction/collision, il est


ncessaire davoir recours des quations de correction dans certains
lments.

7.

RSULTATS

Le logiciel peut calculer directement les rsultats.


Les concentrations des lments sont exprimes en mg/l avec deux chiffres
significatifs.
OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Obtenir en interpolant dans la courbe dtalonnage la concentration des


lments dans les chantillons dilus. Calculer la concentration des lments
dans lchantillon en utilisant lquation suivante :

Cm Vt
Vm

o :
C
Cm
Vt
Vm

=
=
=
=

concentration de llment dans l'chantillon


concentration des lments dans l'chantillon dilu
volume final de la solution de mesure, en ml.
volume de laliquote de vin, en ml.

8.

CONTRLE QUALIT

Assurer la traabilit grce lutilisation dtalons certifis.


Dans chaque srie analytique, utiliser comme contrle interne un MRC
(matriau de rfrence certifi) de vin ou un vin utilis comme matriau de
rfrence provenant dun programme dintercomparaison entre laboratoires.
Il est recommand dlaborer des graphiques de contrle partir des
rsultats obtenus lors de lanalyse des contrles qualit.
Participation des programmes dintercomparaison entre laboratoires.

9.

FIDLIT

Les rsultats des paramtres statistiques de lessai collaboratif sont prsents


dans lannexe A.
9.1 Rptabilit (r)
Diffrence entre deux rsultats indpendants, obtenus avec la mme
mthode, pour le mme chantillon, dans le mme laboratoire, avec le mme
OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

analyste, en utilisant le mme quipement dans un court intervalle de temps.


Les rsultats de r sont prsents dans les tableaux 1 17 de lannexe A.
9.2

Reproductibilit (R)

Diffrence entre deux rsultats, obtenus avec la mme mthode, pour


le mme chantillon, dans des laboratoires diffrents, avec un analyste
diffrent et avec des quipements diffrents. Les rsultats de R sont
prsents dans les tableaux 1 17 de lannexe A.
Le tableau 1 reprsente les pourcentages dcart type de rptabilit relatif
et de reprodicibilit relatif (RSDr% et RSDR%) de la mthode
Tableau 1 : Ecart type relatifs en conditions de rptabilit et de
reproductibilit
(*) C = Concentration
Element

Concentration

RSDr %

RSDR %

Aluminium

0,25 5,0 mg/l

10

Bore

10 - 40 mg/l

3,8

6,3

0,20 1,0 mg/l


1,0 2,5 mg/l
0,001 0,020 mg/l
0,020 0,040 mg/l

4,1
2.1
0,06 C*+0,18
1,5

16,3
8,0
10
10

Cobalt

0,002 0,050 mg/l

3,2

13,2

Cuivre

0,10 0,50 mg/l


0,50 2,0 mg/l

3,8
2,0

11,4
11,4

Strontium

0,30 1,0 mg/l

2,5

7,5

Fer

0,80 1,0 mg/l


1,0-5,0 mg/l

4,2
4,2

15,7
7,8

Lithium

0,010 0,050 mg/l

12

Magnesium

50 - 300 mg/l

Manganse

0,50-1,5 mg/l

Nickel

0,010 0,20 mg/l

Plomb

0,010 0,050 mg/l

Brome
Cadmium

OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Rubidium
Sodium
Vanadium
Zinc

10.

0,050 0,20 mg/l

0,50 1,2 mg/l

5 - 10 mg/l
10 - 30 mg/l
0,003 0,010 mg/l
0,010 0,20 mg/l

2
0,3 C*-2,5
8
3

10
10
10
10

0,30 1,0 mg/l

12

BIBLIOGRAPHIE

ISO 5725:1994, Precision of test methods-Determination of repeatability


and reproducibility for a Standard test method by interlaboratory test.
Norme ISO 17294:2004.
ALMEIDA M. R, VASCONCELOS T, BARBASTE M. y MEDINA B.
(2002), Anal. Bioanal Chem., 374, 314-322.
CASTIEIRA et al. (2001), Frenesius J. Anal. Chem., 370, 553-558.
DEL MAR CASTIEIRA GOMEZ et al. (2004), J. Agric Food Chem., 52,
2962-2974.
MARISA C., ALMEIDA M. et VASCONCELOS T. (2003), J. Agric. Food
Chem., 51, 3012-3023.
MARISA et al., (2003), J. Agric Food Chem., 51, 4788-4798.
PREZ-JORDAN M. Y., SOLDEVILLA J., SALVADOR A., PASTOR A
y de la GURDIA M. (1998), J. Anat. At. Spectrom., 13, 33-39.
PEREZ-TRUJILLO J.-P., BARBASTE M. y MEDINA B. (2003), Anal.
Lett., 36(3), 679-697.
TAYLOR et al. (2003), J. Agric Food Chem., 51, 856-860.
THIEL et al. (2004), Anal. Bioanal. Chem, 378, 1630-1636.

ANNEXE A
RSULTATS DES ESSAIS COLLABORATIFS
OIV-MA-AS323-07 : R2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

La mthode a t vrifie au moyen de deux essais collaboratifs, en valuant


la fidlit conformment lISO 5725. Lexactitude de la mthode a t
obtenue par le biais dtudes de rcuprations.
1er essai collaboratif
Huit chantillons ont t utiliss (A, B, C, D, E, F, MH1 et MH2), dont
lorigine tait :
Trois chantillons de vin rouge, avec et sans ajout.
Trois chantillons de vin blanc, avec et sans ajout.
Deux chantillons de mlange hydroalcoolique synthtiques, prpars

avec de lthanol et de leau.


L'chantillon hydroalcoolique MH1 a prsent des problmes dinstabilit
pendant l'essai et ses rsultats n'ont pas t pris en compte.
MH2

Mlange
hydroalcoolique

VT2

VT3

VB2

VB3

0,5

Cadmium

0,001

0,005

0,02

0,05

0,01

Strontium

0,300

Lithium

0,020

0,01

0,02

0,04

0,01

Magnsium

50

100

200

50

25

Manganse

0,500

0,5

0,5

Nickel

0,070

0,025

0,2

0,1

0,1

Plomb

0,010

0,05

0,1

0,15

0,05

Rubidium

1,0

Sans
ajout

Sans
ajout

Sans
ajout

Sans
ajout

Sodium

20

10

10

20

Vanadium

0,010

0,05

0,2

0,1

0,1

Zinc

0,500

0,1

0,5

0,5

Mtal
(mg/L)
Aluminium

Sans
ajout

Sans
ajout

Sans
ajout

Sans
ajout

E
Vin
rouge
naturel
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout

F
Vin
blanc
naturel
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout
Sans
ajout

2 essai collaboratif
OIV-MA-AS323-07 : R2010

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

16 chantillons ont t utiliss (A, B, C, D, E, F, G, H, I, J, K, L, M, N, O,


P), dont lorigine tait :
Quatre chantillons de vin rouge, avec et sans ajout.
Quatre chantillons de porto, avec et sans ajout.
Six chantillons de vin blanc, avec et sans ajout.
Deux chantillons de champagne.

Quantits ajoutes aux chantillons


chantillons
Vin blanc
Vin de liqueur
Vin rouge
Vin mousseux

Code

Ajout

F-N
C-I
A-O
B-K
E-L
D-M
H-J
G-P

Sans ajout
Ajout 1
Ajout 2
Sans ajout
Ajout 3
Sans ajout
Ajout 4
Sans ajout

OIV-MA-AS323-07 : R2010

B
mg/l
0,0
5,0
10,0
0,0
15,0
0,0
20,0
0,0

Co
g/l
0,0
5,0
1,0
0,0
20,0
0,0
50,0
0,0

Cu
mg/l
0,0
5,0
1,0
0,0
1,5
0,0
2,0
0,0

Fe
Mg/l
0,0
1,0
2,0
0,0
3,0
0,0
5,0
0,0

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

PARAMTRES DE FIDLIT (Tableaux du n1 au n 17) :


Les valeurs de Horratr et de HorratR ont t obtenues en utilisant lquation de Horwitz en tenant compte de la
modification de Thompson pour les concentrations infrieures 120 g/L
Tableau 1 : Aluminium (mg/l)
CHANTILLON LABO. Accepts
A
B
C
D
E
F
MH2

11
11
11
11
11
11
11

10
9
9
10
10
10
8

Vrf

Sr

0,68
2,1
2,1
1,2
0,34
0,27
5,2

0,020
0,043
0,032
0,041
0,014
0,006
0,26

0,06
0,12
0,09
0,12
0,04
0,02
0,73

OIV-MA-AS323-07 : R2010

RSD r Horwitz RSDr


(%)
(%)
2,9
2,0
1,5
3,4
4,1
2,2
5,0

11
9,4
9,5
10
12
13
8,2

Horratr

SR

RSDR
(%)

HorwitzR
RSDR (%)

HorratR

0,26
0,22
0,16
0,34
0,34
0,17
0,60

0,077
0,21
0,21
0,10
0,029
0,028
0,56

0,22
0,61
0,59
0,29
0,08
0,08
1,6

11
10
10
8,3
8,5
10
11

17
14
14
16
19
20
13

0,66
0,71
0,69
0,56
0,46
0,52
0,86

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 2 : Bore (mg/l)


CHANTILLON LABO. Accepts
A-O
B-K
C-I
D-M
E-L
F-N
G-P
H-J

8
8
8
8
8
8
7
8

6
4
4
7
5
5
4
5

Vrf
18
4,5
13
11
21
8,3
3,1
31

OIV-MA-AS323-07 : R2010

Sr
0,77
0,27
0,31
0,26
0,47
0,43
0,094
1,0

r
2,2
0,76
0,89
0,74
1,3
1,2
0,27
3,0

RSD r (%)
4,3
6,0
2,4
2,4
2,2
5,2
3,0
3,2

Horwitz
RSDr (%)
6,8
8,4
7,2
7.4
6.7
7.7
8.9
6.3

Horratr
0,62
0,72
0,33
0,31
0,33
0,68
0,34
0,54

SR

0,94
0,40
0,33
1,1
0,85
0,47
0,18
1,6

2,69
1,14
0,94
3,11
2,43
1,34
0,51
4,43

RSDR (%)
5,2
8,9
2,5
10
4,0
5,7
5,8
5,2

HorwitzR RSDR
(%)
10
13
11
11
10
12
14
9,6

HorratR
0,50
0,70
0,24
0,90
0,40
0,48
0,43
0,52

13

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 3 : Brome (mg/l)


CHANTILLON LABO. Accepts
A-O
B-K
C-I
D-M
E-L
F-N
H-J

6
5
6
6
6
6
6

Vrf

Sr

RSD r
(%)

1,21
0,19
0,81
0,38
1,72
0,22
2,30

0,028
0,006
0,017
0,017
0,030
0,014
0,061

0,08
0,02
0,05
0,05
0,09
0,04
0,17

2,3
2,9
2,1
4,5
1,7
6,4
2,7

2
2
3
4
3
3
2

Horwitz
RSDr (%) Horratr
10,3
13,6
10,9
12,2
9,7
13,3
9,3

0,22
0,21
0,19
0,37
0,17
0,48
0,28

SR

RSDR
(%)

0,041
0,0043
0,062
0,066
0,22
0,046
0,092

0,12
0,012
0,18
0,19
0,62
0,13
0,26

3,4
2,3
7,7
17,4
12,8
20,9
4

HorwitzR
RSDR (%) HorratR
15,6
20,5
16,5
18,5
14,8
20,1
14,1

0,22
0,11
0,47
0,94
0,86
1
0,28

Tableau 4 : Cadmium (g/l)


CHANTILLON N LABO.
A
B
C
D
E
F
MH2

12
12
12
12
8
8
9

Accepts

Vrf

Sr

11
11
9
10
7
6
5

6
16
40
10
0,3
0,3
0,9

0,2
0,4
0,4
0,3
0,20
0,04
0,08

0,6
1
1
0,8
0,6
0,1
0,2

OIV-MA-AS323-07 : R2010

RSD r
(%)
3,3
2,5
1,0
3,0
67
13
8,9

Horwitz
Horratr
RSDr (%)
15
0,22
15
0,17
15
0,07
15
0,20
15
4,47
15
0,87
15
0,59

SR

1
2
3
0,9
0,20
0,20
0,10

3
6
8
3
0,67
0,45
0,29

RSDR (%)
17
13
7,5
9,0
67
67
11

HorwitzR
RSDR (%)
22
22
22
22
22
22
22

HorratR
0,77
0,59
0,34
0,41
3,05
3,05
0,50

14

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 5 : Cobalt (g/l)


CHANTILLON N LABO.
A-O
B-K
C-I
D-M
E-L
F-N
G-P
H-J

10
10
10
10
10
10
9
10

Accepts

Vrf

Sr

RSD r
(%)

Horwitz
RSDr (%)

Horratr

SR

RSDR (%)

HorwitzR
RSDR (%)

HorratR

6
6
8
3
8
7
5
6

22
8
19
3
27
12
2
49

0,5
0,3
0,4
0,07
1
0,5
0,2
0,5

1
0,9
1
0,2
3
2
0,5
1

2,3
3,8
2,1
2,3
3,7
4,2
10
2,3

15
15
15
15
15
15
15
15

0,15
0,25
0,14
0,15
0,25
0,28
0,67
0,15

2
1
3
0,1
3
1
0,3
6

6
4
7
0,3
9
4
0,8
18

9,1
13
16
3,3
11
8,3
15
12

22
22
22
22
22
22
22
22

0,41
0,59
0,73
0,15
0,50
0,38
0,68
0,55

OIV-MA-AS323-07 : R2010

15

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 6 : Cuivre (mg/l)


CHANTILLON N LABO.
A-O
B-K
C-I
D-M
E-L
F-N
G-P
H-J

10
10
10
10
10
10
9
10

Accepts

Vrf

8
8
7
8
9
7
4
7

1,1
0,21
0,74
0,14
1,7
0,16
0,042
2,1

OIV-MA-AS323-07 : R2010

Sr
0,013
0,006
0,009
0,007
0,061
0,006
0,004
0,018

r
0,040
0,020
0,030
0,020
0,17
0,020
0,010
0,050

Horwitz
RSD r (%) RSDr (%)
1,2
2,9
1,2
5,0
3,6
3,8
9,5
0,86

10
13
10
14
7,8
14
15
9,5

Horratr

SR

RSDR
(%)

HorwitzR
RSDR (%)

HorratR

0,12
0,22
0,12
0,36
0,5
0,27
0,63
0,09

0,11
0,021
0,046
0,015
0,16
0,029
0,006
0,24

0,32
0,060
0,13
0,043
0,46
0,083
0,017
0,69

10
10
6,2
11
9,0
18
14
11

16
20
17
22
15
21
22
14

0,63
0,50
0,36
0,50
0,60
0,86
0,64
0,79

16

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 7 : Strontium (g/l)


CHANTILLON LABO. Accepts

Vrf

SR

RSDR (%)

HorwitzR
RSDR (%)

HorratR

0,30

78

222

7,2

16

0,45

195

19

54

6,1
5,8

16

13

0,58
0,14

69

19

0,38
0,31

Horwitz
RSDr (%) Horratr

RSD r
(%)
3,0

10
10

12

11

33

93

12

1139

66

188

12

328

18

5,8
1,8

12

10

313

20

2,2

13

0,17

22

61

7,0

19

0,37

12

10

1176

28

80

2,4

10

0,24

86

243

7,3

16

0,46

F
MH2

12

10

293

1,0

13

0,08

22

62

7,5

19

0,39

12

352

19

2,0

12

0,17

24

69

6,8

19

0,36

OIV-MA-AS323-07 : R2010

1091

Sr

17

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 8 : Fer (mg/l)


CHANTILLON
A-O
B-K
C-I
D-M
E-L
F-N
G-P
H-J

N
LABO.
10
10
10
10
10
10
9
10

Horwitz

HorwitzR

Accepts

Vrf

Sr

RSD r
(%)

RSDr (%)

Horratr

SR

RSDR
(%)

RSDR (%)

HorratR

6
6
5
5
5
6
6
7

3,2
1,5
2,1
3,1
4,3
1,1
0,83
7,8

0,017
0,085
0,036
0,033
0,120
0,051
0,024
0,180

0,05
0,24
0,10
0,094
0,34
0,15
0,07
0,52

0,53
5,7
1,7
1,1
2,8
4,6
2,9
2,3

8,9
9,9
9,4
8,9
8,5
10
11
7,8

0,06
0,58
0,18
0,12
0,33
0,46
0,26
0,29

0,23
0,11
0,18
0,29
0,29
0,16
0,14
1,2

0,66
0,31
0,51
0,83
0,83
0,46
0,40
3,52

7,2
7,3
8,6
9,4
6,7
15
17
15

13
15
14
14
13
16
16
12

0,55
0,49
0,61
0,67
0,52
0,94
1,06
1,25

OIV-MA-AS323-07 : R2010

18

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 9 : Lithium (g/l)


N
LABO.

Accepts

11

10

34

11

11

42

11

11

47

11

11

18

11

11

25

F
MH2

11

11

CHANTILLON

OIV-MA-AS323-07 : R2010

Horwitz

HorwitzR

RSDr

Horratr

SR

RSDR (%)

HorratR

5,9

(%)
15

RSDR
(%)

0,39

11

11

22

0,50

7,1

15

0,47

12

10

22

0,45

2,1

15

0,14

13

9,8

22

0,45

5,6

15

0,37

14

22

0,64

4,0

15

0,27

12

22

0,55

0,3

3,8

15

0,25

0,6

7,2

22

0,33

22

4,6

15

0,31

5,3

22

0,24

Vrf

Sr

RSD r
(%)

19

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 10 : Magnsium (mg/l)


N
LABO.

Accepts

10

182

2,9

8,1

10

280

3,9

11

10

104

2,4

6,9

10

85

1,4

10

94

F
MH2

10

10

CHANTILLON

OIV-MA-AS323-07 : R2010

Horwitz

HorwitzR

RSDr

Horratr

SR

RSDR (%)

HorratR

1,6

(%)
4,3

RSDR
(%)

0,37

9,3

26

5,1

7,3

0,70

1,4

4,5

0,31

6,0

17

2,1

6,9

0,30

2,3

5,3

0,43

6,8

19,25

6,5

8,0

0,81

4,0

1,7

5,4

0,31

2,2

6,1

2,6

8,2

0,32

2,2

6,2

2,3

5,3

0,43

5,5

16

5,9

8,1

0,73

65

0,95

2,7

1,5

5,6

0,27

3,8

11

5,9

8,5

0,69

51

0,90

2,5

1,8

5,8

0,31

2,4

6,9

4,7

8,9

0,53

Vrf

Sr

RSD r
(%)

20

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 11 : Manganse (mg/l)


N
LABO.

Accepts

11

10

1,3

0,014

0,040

11

1,8

0,14

11

1,5

0,028

11

1,0

11

0,84

F
MH2

11

11

CHANTILLON

Horwitz

HorwitzR

RSDr

Horratr

SR

RSDR (%)

HorratR

1,1

(%)
10

RSDR
(%)

0,11

0,13

0,37

10

15

0,67

0,40

7,8

9,7

0,80

0,20

0,56

11

15

0,73

0,080

1,9

9,9

0,19

0,084

0,24

5,6

15

0,37

0,035

0,10

3,5

11

0,32

0,049

0,14

4,9

16

0,31

0,019

0,050

2,3

11

0,21

0,057

0,16

6,8

16

0,43

0,59

0,015

0,040

2,5

11

0,23

0,031

0,090

5,3

17

0,31

0,52

0,029

0,080

5,6

12

0,47

0,037

0,10

7,1

18

0,39

Vrf

OIV-MA-AS323-07 : R2010

Sr

RSD r
(%)

21

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 12 : Nickel (g/l)

N
LAB
O.
11

10

40

5,0

15

0,33

13,90

13

22

0,59

12

10

194

20

3,6

14

0,26

17

48,96

8,8

21

0,42

12

148

10

2,7

14

0,19

15,12

3,4

21

0,16

12

157

12

2,6

14

0,19

23,10

5,1

21

0,24

11

15

0,6

4,0

15

0,27

3,33

6,7

22

0,30

F
MH2

12

66

1,5

15

0,10

10,58

6,1

22

0,28

11

71

14

7,0

15

0,47

11,41

5,6

22

0,25

CHANTILLON

Accepts

OIV-MA-AS323-07 : R2010

Vrf

Sr

Horwitz

RSD r
(%)

RSDr (%)

Horratr

SR

HorwitzR

RSDR
(%)

RSDR (%)

HorratR

22

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 13 : Plomb (g/l)


N
LABO.

Accepts

12

59

12

10

109

12

136

12

12

F
MH2

12
12

CHANTILLON

Horwitz

HorwitzR

RSDr

Horratr

SR

RSDR (%)

HorratR

1,7

(%)
15

RSDR
(%)

0,11

5,1

22

0,23

1,8

15

0,12

23

7,3

22

0,33

2,2

14

0,16

13

37

9,6

22

0,44

119

1,7

15

0,11

13

4,2

22

0,19

10

13

7,7

15

0,51

7,7

22

0,35

92

1,1

15

0,07

11

4,4

22

0,20

10

13

7,7

15

0,51

7,7

22

0,35

OIV-MA-AS323-07 : R2010

Vrf

Sr

RSD r
(%)

23

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 14 : Rubidium (g/l)


Horwitz

HorwitzR

N
LABO.

Accepts

Vrf

Sr

RSD r
(%)

RSDr (%)

Horratr

SR

RSDR
(%)

RSDR (%)

HorratR

11

717

14

41

2,0

11

0,18

13

36

1,8

17

0,11

11

799

25

70

3,1

11

0,28

30

86

3,8

17

0,22

11

677

10

27

1,5

11

0,14

34

96

5,0

17

0,29

11

612

18

51

2,9

11

0,26

18

50

2,9

17

0,17

11

741

19

53

2,6

11

0,24

66

187

8,9

17

0,52

F
MH2

11

617

10

28

1,6

11

0,15

43

123

7,0

17

0,41

11

1128

10

28

0,89

10

0,09

64

181

5,7

16

0,36

CHANTILLON

OIV-MA-AS323-07 : R2010

24

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 15 : Sodium (mg/l)


CHANTILLON N LABO.

Accepts

Vrf

Sr

RSD r
(%)

Horwitz

RSDr (%)

Horratr

SR

RSDR
(%)

HorwitzR

RSDR (%)

HorratR

10

19

0,59

1,7

3,1

6,8

0,46

2,2

5,7

12

10

1,20

10

20

1,3

3,6

6,5

6,7

0,97

2,2

6,3

11

10

1,10

10

28

0,33

0,93

1,2

6,4

0,19

1,9

5,4

6,8

9,7

0,70

10

11

0,24

0,68

2,2

7,4

0,30

1,1

3,0

10

11

0,91

10

9,8

0,19

0,53

1,9

7,5

0,25

0,89

2,5

9,1

11

0,83

F
MH2

10

6,1

0,093

0,26

1,5

8,1

0,19

0,74

2,1

12

12

1,00

10

24

1,8

5,0

7,5

6,6

1,14

2,6

7,2

11

9,9

1,11

OIV-MA-AS323-07 : R2010

25

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 16 : Vanadium (g/l)


CHANTILLON

N
LABO.

Accepts

Vrf

Sr

RSD r
(%)

Horwitz

RSDr (%)

Horratr

SR

RSDR
(%)

HorwitzR

RSDR (%)

HorratR

12

11

46

2,2

15

0,15

13

11

22

0,50

12

11

167

15

3,0

14

0,21

19

54

11

21

0,52

12

11

93

3,2

15

0,21

12

33

13

22

0,59

12

96

3,1

15

0,21

22

8,3

22

0,38

10

0,2

0,7

6,7

15

0,45

0,3

0,9

10

22

0,45

F
MH2

10

0,2

0,6

6,7

15

0,45

0,2

0,7

6,7

22

0,30

12

11

0,3

2,7

15

0,18

0,9

8,2

22

0,37

OIV-MA-AS323-07 : R2010

26

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse multi-lmentaire par ICP-MS

Tableau 17 : Zinc (g/l)


CHANTILLON

N
LABO.

Accepts

Vrf

Sr

RSD r
(%)

Horwitz

RSDr (%)

Horratr

SR

RSDR
(%)

HorwitzR

RSDR (%)

HorratR

11

405

22

61

5,4

12

0,45

45

128

11

18

11

1327

49

138

3,7

10

0,37

152

429

11

15

0,73

11

990

14

41

1,4

11

0,13

86

243

8,7

16

0,54

11

1002

28

79

2,8

11

0,25

110

310

11

16

0,69

11

328

13

37

4,0

13

0,31

79

224

24

19

1,26

F
MH2

11

539

15

42

2,8

12

0,23

61

172

11

18

0,61

11

604

72

204

12

11

1,09

89

251

15

17

0,88

OIV-MA-AS323-07 : R2010

0,61

27

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

METHOD OIV-MA-AS4-01

Mthode Type IV

Analyse microbiologique des vins et des mots :


detection, differenciation et denombrement des microorganismes
(OIV-Oeno 206-2010)
L'analyse microbiologique a pour but de suivre les fermentations alcoolique
et/ou malolactique et de dceler les risques d'altrations microbiennes, ce
qui permet de dtecter toute anomalie, non seulement dans le produit fini,
mais aussi pendant les diffrentes phases de sa fabrication.
Remarque :
Toutes les manipulations doivent tre faites selon les conditions aseptiques
usuelles dans les travaux de microbiologie, en utilisant du matriel strilis,
proximit de la flamme d'un bec Bunsen ou dans une chambre flux
laminaire et en passant la flamme les orifices des pipettes, tubes, flacons,
etc. Avant d'effectuer l'analyse microbiologique, il est ncessaire d'effectuer
correctement le prlvement de l'chantillon analyser.
Champ d'application :
L'analyse microbiologique peut tre applique aux vins, mots, mistelles et
tous produits similaires, mme lorsque ceux-ci sont altrs par une activit
microbienne. Ces mthodes sont aussi adaptes l'analyse des prparations
industrielles de microorganismes slectionns, levures LSA et bactries
lactiques.
Techniques d'analyse microbiologique :
1.
2.
3.
4.

Ractifs et produits
Installations et quipement
chantillonnage
Essais de tenue

4.1 objectif
4.2 principe
4.3 mode opratoire
4.3.1 essai de tenue l'air
4.3.2 essai de tenue l'tuve
OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

5.
Techniques de microscopie pour la dtection, diffrenciation des
micro-organismes et dnombrement direct des levures
5.1. Examen microscopique des liquides ou des dpts
5.2. Coloration de Gram pour la diffrentiation des bactries isoles partir
de colonies (voir paragraphe 6)
5.3. Recherche de la catalase pour la diffrentiation des bactries isoles
partir de colonies(voir paragraphe 6)
5.4. Dnombrement des cellules de levure hmocytomtrie
5.5. Dnombrement des cellules de levure Coloration au bleu de
mthylne
6. Dnombrement des micro-organismes par culture
6.1 Dtection, diffrenciation et dnombrement des micro-organismes
(numration sur plaque)
6.2. Culture en milieu liquide - "nombre le plus probable" (NPP).

1. RACTIFS ET PRODUITS
quipement et appareillage courants de laboratoire, comme indiqu dans
ISO 7218:2007 - Microbiologie des denres alimentaires et aliments pour
animaux - Rgles gnrales relatives aux analyses microbiologiques.
Le matriel suivant est recommand :
- Matriel et verrerie de laboratoire courants, striles (striliss ou striles
prts l'emploi).
- Tubes (16x160 mm ou similaires) contenant 9 ml d'eau peptone strile
(tryptone : 1 g/l) ou d'autres diluants utiliser pour les dilutions
d'chantillons en srie.
- thanol pour passer la flamme les taleurs et les brucelles.
- Solution de peroxyde d'hydrogne 3 %.
- Micropipette bouts striles : 1 ml et 0,2 ml.
- Tiges de verre coudes en L ou de forme triangulaire (crosses de hockey)
ou taleurs en plastique.
OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

- Brucelles en acier inoxydable, bords plats.


- Membrane de porosit 0,2 et 0,45 m en ester de cellulose strile (ou
quivalent), d'un diamtre de 47 ou 50 mm, si possible avec une grille
imprime sur la surface, en conditionnement individuel.
- prouvettes striles.
- Pipettes striles de 10 ml.
2. INSTALLATIONS ET QUIPEMENT
quipement et appareillage courants de laboratoire, comme indiqu dans
ISO 7218:2007 - Microbiologie des denres alimentaires et aliments pour
animaux - Rgles gnrales relatives aux analyses microbiologiques.
Le matriel suivant est recommand :
- Hotte microbiologique ou hotte flux laminaire. En l'absence de ce
dispositif, travailler proximit (moins de 50 centimtres) d'un brleur
gaz.
- Balance, d'une prcision de 0,01 g.
- Autoclave.
- Incubateur, rglable de 25C 37C.
- pH-mtre, prsentant une prcision de 0,1 unit pH et un seuil de
mesure minimum de 0,01 unit pH.
- Rfrigrateur(s), rgl(s) 5 3 C, et conglateur(s) dont la temprature
devra
tre
infrieure

-18C et de prfrence gale -24 2 C.


- Bain thermostatique, rgl 45 1 C
- Four micro-ondes.
- Microscope optique.
- Brleur gaz.
- Dispositif de comptage de colonies.
- quipement de culture en atmosphre modifie (fiole scelle dans
laquelle l'anarobiose peut avoir lieu).
- Appareillage de filtrage avec des filtres de diamtre 47 mm ou 50 mm
(en cas de filtration sur membrane).
- Agitateur vortex ou quivalent ;
- Etuve pour la sterilisation sec ;
- Centrifugeuse ;
- Pompe vcue.

OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

3. CHANTILLONNAGE
L'chantillon doit reproduire la microbiologie de la masse totale de mot ou
de vin analyser.Dans la mesure du possible, la masse doit tre
homognise avant chantillonnage, afin de remettre en suspension les
micro-organismes qui tendent se dposer au fond du rcipient. Lorsqu'une
homognisation n'est pas souhaite, les chantillons doivent tre prlevs
l o les micro-organismes sont susceptibles (ou suspects) d'tre prsents
(c.--d. en cas de recherche de levures au fond des rservoirs ou fts), mais
dans ce cas les rsultats ne sont pas quantitatifs. Avant de prlever un
chantillon provenant d'un robinet, ce dernier doit tre pass la flamme, et
2 3 litres de liquide doivent tre vacus. L'chantillon doit tre plac dans
un rcipient strile
L'chantillon doit tre maintenu au frais et analys le plus rapidement
possible.
Les quantits suivantes d'chantillons sont ncessaires pour l'examen
microbiologique :
Mot, ou mot en fermentation ou vin stock : pas moins de 250 ml ;
Vin mis en bouteille ou emball :
pas moins d'une unit,
quelle que soit la capacit ;
4. ESSAIS DE TENUE
4.1 Objectif
Ces essais ont pour but de dceler l'avance les risques d'altrations
microbiennes.
4.2 Principe
Cette technique est base sur les modifications organoleptiques et d'aspect
(troubles, voiles, dpts, couleurs inhabituelles) prsentes par le vin quand
il est soumis certaines conditions d'aration et de temprature pouvant
induire une activit microbiologique. La nature de l'altration devra tre
confirme par examen microscopique.
4.3 Mode opratoire
4.3.1 Essais de tenue l'air
Un chantillon de 50 ml de vin aprs filtration sur papier filtre grossier
strile est plac dans un Erlenmeyer strile de 150 ml bouch avec du coton
OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

et laiss temprature ambiante pendant au moins 3 jours. La limpidit, la


couleur, la prsence ventuelle d'un trouble, d'un dpt, d'un voile sont
examines au cours de cette priode. Un examen microscopique est ralis
en cas de trouble, dpt, voile ou changement de couleur.
4.3.2 Essais de tenue l'tuve
Un chantillon de vin de 100 ml aprs filtration sur papier filtre grossier
strile est plac dans un Erlenmeyer strile de 300 ml, bouch avec du
coton, mis dans une tuve 30 C et examin aprs au moins 72 h. Des
altrations organoleptiques ou visuelles peuvent tre l'indice d'un
dveloppement microbien. Un examen microscopique doit alors tre
effectu.

5. TECHNIQUES MICROSCOPIQUES POUR LA DETECTION, LA


DIFFERENCIATION DES MICRO-ORGANISMES ET LE
DENOMBREMENT DIRECT DES LEVURES
5.1 Examen microscopique des liquides ou des dpts
Objectif :
L'examen microscopique l'tat frais a pour but de dceler et de
diffrencier, par leur taille et leur forme, les levures des bactries
ventuellement prsentes. L'observation microscopique ne permet pas de
distinguer les micro-organismes vivants de ceux qui sont morts.
Remarque :
Une estimation des levures vivantes peut tre effectue l'aide d'une
coloration approprie (voir plus loin).

Principe :
Cette technique repose sur le grossissement au microscope permettant
d'observer des micro-organismes dont la taille est de l'ordre du micron.
Mode opratoire :
L'examen au microscope peut tre effectu directement sur le liquide ou sur
le dpt.
L'observation directe sur le liquide n'est intressante que quand la
population est suffisamment leve (plus de 5 x 10 5 cellules/ml).

OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Quand le vin prsente une population infrieure de micro-organismes, il est


ncessaire de concentrer l'chantillon. Environ 10 ml de vin homognis
sont donc centrifugs 3000-5000 tr/mn pendant 5 15 minutes. Aprs
dcantation du liquide surnageant, le dpt est remis en suspension dans le
liquide restant au fond du tube de centrifugation.
Pour raliser l'observation au microscope, une goutte de l'chantillon de
liquide ou du dpt homognis est dpose sur une lame de verre propre
l'aide d'une pipette Pasteur ou d'une anse strilise. Recouvrir avec une
lamelle et placer la lame sur la platine du microscope. L'observation
s'effectue en champ clair ou, de prfrence contraste de phase, ce qui
permet de mieux observer les dtails des micro-organismes. Un
grossissement optique de 400 x 1000 x est gnralement utilis.
5.2. Coloration de Gram pour la diffrentiation des bactries isoles
partir de colonies (voir paragraphe 6)
Objectif :
La coloration de Gram a pour but de diffrencier les bactries lactiques
(Gram positif) des bactries actiques (Gram ngatif) et d'observer
galement leur morphologie.
Remarque :
Il convient de garder l'esprit que la coloration de Gram ne suffit pas
conclure car d'autres bactries peuvent tre prsentes en plus des bactries
lactiques et actiques.
Principe :
Cette coloration est base sur la diffrence de structure et de composition
chimique des parois cellulaires. des bactries Gram positif et Gram
ngatif Dans les bactries Gram ngatif, la paroi riche en lipides a une
quantit trs rduite de peptidoglycane. Ceci permet la pntration de
l'alcool et llimination du complexe violet de gentiane-iode en laissant la
cellule incolore, laquelle sera ensuite recolore en rouge par la safranine. Au
contraire, la paroi cellulaire des bactries Gram positif contient une grande
quantit de peptidoglycane et une faible concentration de lipides. Ainsi,
l'paisse paroi de peptidoglycane et la dshydratation produite par l'alcool
ne permettent pas llimination de la coloration violette ou bleue fonce du
complexe violet de gentiane-iode.

OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

La coloration de Gram perd sa signification si elle est ralise sur une


culture trop ge. Ainsi, la bactrie doit tre dans une phase de croissance
exponentielle de 24 48 heures. La coloration de Gram est ralise aprs
isolement de colonies et mise en culture liquide.
Solutions :
L'eau utilise doit tre distille.
1. Solution de violet de gentiane
Prparation : peser 2 g de violet de gentiane (ou cristal violet), introduire
dans un Erlenmeyer de 100 ml et dissoudre dans 20 ml d'alcool 95 % vol.
Dissoudre 0,8 g d'oxalate d'ammonium dans 80 ml d'eau distille. Mlanger
les deux solutions et utiliser seulement aprs 24 heures. Filtrer sur papier au
moment de l'emploi. Maintenir l'abri de la lumire dans un flacon fonc.
2. Solution de Lugol
Prparation : dissoudre 2 g d'iodure de potassium dans une quantit
minimale d'eau (4 5 ml) et, dans cette solution sature, dissoudre 1 g
d'iode. Complter le volume 300 ml avec de l'eau distille. Maintenir
l'abri de la lumire dans un flacon fonc.
3. Solution de safranine :
Prparation : peser 0,5 g de safranine dans un Erlenmeyer de 100 ml,
dissoudre avec 10 ml d'alcool 95 % vol. et ajouter 90 ml d'eau. Agiter.
Maintenir l'abri de la lumire dans un flacon fonc.
Mode opratoire :
Prparation du frottis
Faire un repiquage des bactries en milieu liquide ou solide. Recueillir les
bactries des cultures jeunes dans le dpt (aprs centrifugation de la culture
liquide) ou directement dans le milieu solide avec une anse ou un fil et
mlanger dans une goutte d'eau strilise.
Faire un frottis sur une lame en talant une goutte de la suspension
microbienne. Laisser scher le frottis. Procder ensuite la fixation en
passant rapidement la lame 3 fois sur la flamme d'un bec Bunsen ou par une
technique quivalente.
Aprs refroidissement, effectuer la coloration.
Coloration
Verser sur le frottis fix quelques gouttes de solution de violet de gentiane.
Laisser agir pendant 2 minutes et laver avec de l'eau.
Verser 1 2 gouttes de la solution de lugol. Laisser agir pendant 30
secondes. Laver avec de l'eau et scher sur papier filtre.
OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Verser l'alcool 95 % vol., laisser agir pendant 15 secondes. Rincer avec de


l'eau et scher sur papier filtre.
Verser quelques gouttes de solution de safranine, laisser agir pendant 10
secondes. Laver avec de l'eau et scher sur papier filtre.
Dposer sur le frottis color une goutte d'huile d'immersion.
Observer au microscope avec l'objectif immersion en champ clair.
Rsultats :
Les bactries lactiques restent colores en violet ou bleu fonc (Grampositif). Les bactries actiques sont colores en rouge (Gram-ngatif).
5.3 Recherche de la catalase pour la diffrentiation des bactries isoles
partir de colonies (voir paragraphe 6)
Objectif :
Cette recherche a pour but de faire la distinction entre les bactries actiques
et les bactries lactiques. Les levures et les bactries actiques ont une
raction positive. Les bactries lactiques donnent une rponse ngative.
Remarque :
Il convient de garder l'esprit que la recherche de la catalase ne suffit pas
car d'autres bactries peuvent tre prsentes en plus des bactries lactiques
et actiques.
Principe :
La recherche de la catalase est base sur la proprit qu'ont les microorganismes arobies de dcomposer le peroxyde d'hydrogne avec libration
d'oxygne :
2H2O2

catalase

2H2O + O2

Ractif :
Solution de peroxyde d'hydrogne 12 volumes (3%)
Prparation : mesurer 10 ml de peroxyde d'hydrogne 30 volumes dans
une fiole jauge de 100 ml et complter avec de l'eau distille rcemment
bouillie. Agiter et conserver au rfrigrateur dans un flacon fonc. La
solution doit tre frachement prpare.
Mode opratoire :
Dposer une goutte de peroxyde d'hydrogne 3 volumes sur une lame et
ajouter un petit chantillon d'une colonie jeune. S'il y a libration de gaz, on
peut en dduire que la culture possde lactivit catalase. Il est parfois
OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

difficile d'observer directement le dgagement gazeux, notamment avec les


colonies de bactries ; il est donc conseill de faire l'observation au
microscope (objectif 10 x).
5.4. Dnombrement des cellules de levure hmocytomtrie
5.4.1 Champ d'application
Dtermination de la concentration en cellules de levure dans les mots ou
vins en fermentation, et les LSA (levure sche active). Une concentration
cellulaire leve est ncessaire : au moins 5106 cellules/ml. Les mots et
vins en fermentation peuvent faire l'objet d'une numration directe, la levure
sche active (LSA) doit tre dilue 1000 ou 10000 fois. Les mots ou vins
contenant peu de cellules doivent tre centrifugs (3000 g, 5 minutes) et le
sdiment remis en suspension dans un volume connu.,
5.4.2 Principe
Une goutte de suspension de cellules de levure est dpose la surface d'une
lame comportant une cellule de comptage. La cellule de comptage a un
volume dfini et est subdivise en carrs la surface de la lame. La
numration est ralise sous microscope en champ clair. Le contraste de
phase n'est pas indiqu si des cellules sont colores.
5.4.3 Ractifs et produits
Hmocytomtre, double cellule, de prfrence pinces : Brker,
Thoma, Malassez, Neubauer.
Lamelle couvre-objets pour hmocytomtre : les lamelles couvreobjets ordinaires (largeur 0,17 mm) ne conviennent pas pour cette
utilisation, car elles sont souples et ne garantissent pas une largeur de cellule
constante.
Pipettes bouts fins, d'un volume de 1 et 10 ml.
Fiole jauge, 100 ml.
Bcher, 250 ml.
5.4.4 Installations et quipement
Microscope avec clairage fond clair : grossissement 250-500 x.
Contraste de phase contre-indiqu.
Barre magntique et agitateur.

OIV-MA-AS4-01 : 2010

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Des hmocytomtres sont disponibles avec diffrentes cellules de comptage


: Thoma, Malassez, Brker, Neubauer. Confirmer le type et le volume de la
cellule de comptage utiliser. Les cellules de Brker, Thoma et Neubauer
ont une profondeur de 0,1 mm , la cellule de Malassez 0,2 mm.
La cellule de Thoma possde un grand carr central (1 mm2), ce qui fait que
son volume est de 0,1 mm3 (10 -4 ml). Ce grand carr est subdivis en 16
carrs, eux mmes subdiviss en 16 petits carrs. Les petits carrs ont 0,05
mm de ct et une profondeur de 0,1 mm, de sorte que le volume de chaque
petit carr est de 0,00025 mm3 (25 x 10-8 ml). Il est galement possible de
compter dans les carrs moyens. Chaque carr moyen a 16 petits carreaux
de 0,2 mm de ct, et d'un volume de 0,004 mm3 soit 4 x 10-6 ml.
La cellule de Brker contient 9 grands carrs de 1 mm de ct, diviss en
16 carrs moyens de 0,2 mm de ct par des doubles lignes espaces de
0,05mm. La surface de chacun de ces carrs moyens est de 0,04 mm et le
volume de 0,004mm3. Les petits carrs forms par les double lignes ont une
surface de 0,025mm..
Les grands, moyens et petits carrs des cellules de Neubauer, de Thoma et
de Brker sont de mme taille. Les carrs moyens des cellules de Brker ne
contiennent pas d'autres lignes l'intrieur ; ce sont donc probablement les
plus faciles compter.
5.4.5 Mthodes d'examen
La cellule de comptage et la lamelle couvre-objets doivent tre propres et
sches avant utilisation. Il peut tre ncessaire de frotter la surface
quadrille, car des cellules sales ont une incidence sur le volume de
l'chantillon. Nettoyer l'eau dminralise, ou l'thanol, et scher avec un
papier doux.
En cas de numration de levure floculante, le milieu de suspension doit tre
de l'acide sulfurique 0,5 %, afin d'viter la floculation, mais ceci interdit la
possibilit de coloration au bleu de mthylne et le comptage des cellules
viables et des cellules mortes. La remise en suspension peut tre effectue
par sonication.
Dposer l'chantillon sur la lame l'aide d'une pipette bout fin, en suivant
l'un des deux modes opratoires noncs ci-dessous.
Mode opratoire 1
Bien mlanger la suspension de levure. Si des dilutions sont ncessaires,
procder par dilutions dcimales, comme d'habitude. En cas de coloration au

OIV-MA-AS4-01 : 2010

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

bleu de mthylne, effectuer la coloration sur l'chantillon le plus dilu en


mlangeant 1 ml d'chantillon avec 1 ml de solution de bleu de mthylne.
Agiter en permanence la suspension de levure. Prlever un chantillon avec
une pipette bout fin, vacuer 4-5 gouttes de suspension et dposer une
petite goutte de suspension de levure (dilue au besoin) sur chacune des
deux zones quadrilles de la lame. Recouvrir avec la lamelle couvre-objets
dans les 20 secondes qui suivent et presser fermement avec les pinces. La
zone de numration doit tre compltement remplie, mais aucun liquide ne
doit s'couler dans la rigole.
Mode opratoire 2
Disposer la lamelle couvre-objets rigide de sorte que les deux cellules de
comptage soient galement couvertes. Utiliser les pinces pour presser la
lamelle couvre-objets sur le support jusqu' ce qu'une irisation apparaisse
(anneaux de Newton). En l'absence de pinces, ne pas dplacer la lamelle
couvre-objets en remplissant la cellule.
Agiter en permanence la suspension de levure. Prlever un chantillon avec
une pipette bout fin, vacuer 4-5 gouttes de suspension et laisser une petite
goutte d'chantillon couler entre l'hmocytomtre et la lamelle couvreobjets. Procder de mme dans l'autre partie de la lamelle. La zone de
numration doit tre compltement remplie, mais aucun liquide ne doit
s'couler dans la rigole.
Laisser la lame prpare reposer pendant trois minutes, de faon ce que les
cellules de levure se dposent, et la placer sous le microscope.
Compter 10 carrs moyens dans chaque zone quadrille. Des procdures
normalises doivent tre dfinies, afin d'viter de compter deux fois le
mme carr. Les cellules en contact avec ou reposant sur les lignes de
dlimitation suprieure ou droite ne sont pas prises en compte, celles en
contact avec ou reposant sur les lignes de dlimitation infrieure ou gauche
sont comptes. Les cellules de levure en bourgeonnement sont comptes
comme une seule cellule si la taille du bourgeon est infrieure la moiti de
celle de la cellule mre, dans le cas contraire les deux cellules sont
comptes.
Pour obtenir une numration prcise des cellules, il est recommand de
compter en moyenne au minimum un total de 200 500 cellules de levure.
L'cart de numration entre les deux cts de la lame doit tre infrieur

OIV-MA-AS4-01 : 2010

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

10 %. Si une dilution est utilise, le facteur de dilution doit tre intgr dans
le calcul.
5.4.6 Expression des rsultats
C tant le nombre moyen de cellules comptes dans un carr moyen de
0,2mm de ct, la population T totale dans l'chantillon est :
Exprime en cellules/ml
T = C X 0,25 x 106 x facteur de dilution
C tant le nombre moyen de cellules comptes dans un petit carr de
0,05mm de ct, la population T totale dans l'chantillon est :
Exprime en cellules/ml
T = C X 4 x106 x facteur de dilution
5.4.7 Rfrences
European Brewery Convention. Analytica Microbiologica EBC.
Fachverlag Hans Carl, 2001
5.5 Dnombrement des cellules de levure Coloration de cellules de
levure au bleu de mthylne
5.5.1 Champ d'application
Cette mthode permet une estimation rapide du pourcentage de cellules
viables (non colores), car les cellules mortes sont colores en bleu. La
mthode est applicable tous les chantillons contenant des levures, except
aux mots contenant plus de 100 g de sucre par litre.
Les bactries sont trop petites et leur coloration n'est pas visible avec cette
mthode.
Remarque : il faut bien focalis les cellules en differents profodeurs, pour
bien visualiser leur coloration avec le bleu de mthylne.
5.5.2 Principe
Le bleu de mthylne est transform en son driv incolore par lactivit
rductrice des cellules de levure viables. Les cellules de levure mortes
seront colores en bleu.
La viabilit est calcule partir du rapport entre le nombre de cellules
viables et le nombre de cellules total. La mthode surestime la viabilit
"relle" lorsque les cellules viables reprsentent moins de 80 % du nombre
de cellules total, car elle ne distingue pas les cellules "vivantes" des cellules
aptes se reproduire (Cellules viables mais non cultivables).
Si la concentration en sucre est suprieure 100 g/l, la plupart des cellules
sont bleu clair, cette mthode est donc dconseille.
OIV-MA-AS4-01 : 2010

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Dans le cas d'un vin faible pH et fortement tamponn, le colorant ne peut


pas oprer correctement. Dans ce cas, la numration doit tre applique au
moins la premire dilution dcimale.
5.5.3 Ractifs et produits
Solution A : Bleu de mthylne, en solution dans de l'eau distille, 0,1 g/500
ml.
Solution B : KH2PO4, en solution dans de l'eau distille, 13,6 g/500 ml.
Solution C : Na2HPO4 x 12 H2O, en solution dans de l'eau distille, 2,4
g/100 ml
Solution D : 498,75 ml de solution B + 1,25 ml de solution C.
Solution E : Mlanger les 500 ml de solution D aux 500 ml de solution A
pour obtenir la solution tamponne finale de bleu de mthylne d'un pH
approximatif de 4,6.
5.5.4 Installations et quipement
Microscope, avec grossissements de 250-500 x. Le contraste de phase est
contre-indiqu.
Lames de microscope et lamelles couvre-objets, ou hmocytomtre (cellule
de Thoma, de Brker ou de Neubauer).
Tube essai et agitateur.
Pipettes bout fin.
5.5.5 Mthodes d'examen
Dtermination de la viabilit
Diluer la suspension de levure avec la solution de bleu de mthylne dans
un tube essais jusqu' ce que la suspension comporte approximativement
100 cellules de levure dans un champ microscopique. Dposer une petite
goutte de suspension bien mlange sur une lame de microscope et la
recouvrir d'une lamelle couvre-objets. Examiner au microscope sous un
grossissement de 400 x, dans les 10 minutes suivant la mise en contact avec
le colorant.
Compter un total de 400 cellules, en notant le nombre de cellules mortes,
casses, ratatines et plasmolyses. Les cellules de levure en
bourgeonnement sont comptes comme une seule cellule si la taille du
bourgeon est infrieure la moiti de celle de la cellule mre. Si la taille du
bourgeon est gale ou suprieure la moiti de celle de la cellule mre, les

OIV-MA-AS4-01 : 2010

13

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

deux cellules sont comptes. Les cellules de couleur bleu clair doivent tre
considres vivantes.
5.5.6 Expression des rsultats
Si T est le nombre total de cellules et C le nombre de cellules colores en
T C
bleu, alors le pourcentage des cellules viables est
x100
T
5.5.7 Rfrences
European Brewery Convention. Analytica Microbiologica EBC.
Fachverlag Hans Carl, 2001

6. DENOMBREMENT DES MICRO-ORGANISMES PAR CULTURE


Objectif :
Le dnombrement des micro-organismes par culture a pour but d'valuer le
niveau de contamination de l'chantillon, c'est--dire d'estimer la quantit de
micro-organismes cultivables. Selon les milieux de culture utiliss et les
conditions de culture, quatre types de micro-organismes peuvent tre
dnombrs : levures, bactries lactiques et bactries actiques et
moisissures.
Principe :
Le dnombrement par culture est bas sur le fait que les micro-organismes
vivants sont capables de se multiplier en milieu nutritif et conditions
dincubation appropris pour former des colonies sur le milieu solidifi par
de la glose, ou un trouble dans le milieu liquide. Sur milieu glos une
cellule produit par multiplication un amas de cellules visible lil nu
appel colonie.
6.1 Dtection, diffrenciation et dnombrement des micro-organismes
(numration sur plaque).
6.1.1 Champ d'application
Cette norme formule des recommandations gnrales pour le dnombrement
des levures, moisissures et bactries lactiques et bactries actiques viables
OIV-MA-AS4-01 : 2010

14

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

dans les mots, les mots concentrs, les mots partiellement ferments, les
vins (vins mousseux y compris) pendant leur laboration et aprs la mise en
bouteilles, par comptage des colonies cultives sur un milieu solide aprs une
incubation approprie. Le but de l'analyse microbiologique est de contrler le
processus de vinification et d'viter l'altration microbienne des mots ou des
vins.
6.1. 2 Termes et dfinitions
Les termes "plaque" et "bote de Petri" sont employs comme synonymes.
UFC = Units formant colonies.
6.1. 3 Mthode
Le nombre de micro-organismes viables prsents dans des mots ou des
vins est dtermin en talant un petit volume connu d'chantillon la
surface d'un milieu de culture ou en lajoutant selon la mthode de
incorporation (voir 6.1.7.4), et en laissant incuber les plaques le temps
ncessaire, dans les conditions les plus favorables la croissance. Chaque
cellule, ou groupe de cellules, se divise et se rassemble en un groupe qui
devient visible en tant que colonie. Le nombre de colonies prsentes la
surface d'une plaque est une indication du nombre de cellules prsentes dans
l'chantillon original. Les rsultats sont par consquent exprims en UFC. Si
le nombre de cellules dans un chantillon est cens tre lev, des dilutions
dcimales en srie sont ralises afin d'obtenir un nombre de colonie
compris entre 10 et 300 par plaque. Si le nombre d'UFC dans un chantillon
est cens tre bas, elles sont collectes sur un filtre strile de 0,45 0,88 m
pour les levures et 0, 22 0,45 m pour les bactries, qui est ensuite plac
dans la bote de Petri sur la surface du milieu de culture.
La plage de mesure de cette mthode va de < 1 UFC/ (volume analys) 109
UFC/ml ou 1010 UFC/g dans l'chantillon original.
6.1.4 Ractifs et produits
Ceux indiqus au paragraphe 1 de la rsolution, plus :
Tubes (16x160 mm ou quivalents), contenant 9 ml d'eau peptone
strile (Tryptone : 1 g/l) ou d'autres diluants utiliser pour la dilution des
chantillons ( Annexe 4). Le nombre indicatif de tubes ncessaires pour les
chantillons suivants est prcis ci-dessous :

OIV-MA-AS4-01 : 2010

15

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Mots non ferments :


4 / chantillon.
Mots de fermentation :
7 / chantillon.
Vins stocks :
2 / chantillon.
Micropipette bouts striles : 1 ml et 0,2 ml.
Tiges de verre coudes en L ou de forme triangulaire (tiges de
Digralsky)) ou taleurs en plastique.
Botes de Petri de 90 mm de diamtre (avec 15-20 ml de milieu de culture) (56
cm2) pour la technique sur plaques, et de 90 mm ou 60 mm (avec 6-8 ml de
milieu de culture) pour la technique de filtration sur membrane, remplies 1824 h l'avance avec 15-20 ml de milieu de culture (simple ou en dupliqu
botes sont ncessaires pour chaque chantillon test) :
Pour le comptage des levures et moisissures, utiliser : YM, YEPD, glose
nutritive WL, glose levure ou glose TGY (trypticase-glucose-extrait de
levure) ou quivalant si valid. Plaques de glose de lysine et de glose
diffrentielle WL (annexe 1) ou quivalant si valid en cas de recherche de
levures non Saccharomyces. (Annexe 5 milieux de culture)
Pour le comptage des bactries actiques, utiliser : Glose GYC, milieu
G2 ou Kneifel (Annexe 5 milieux de culture) ou quivalant si valid
Pour le comptage des bactries lactiques, utiliser : MRS additionn de
20 % de jus de tomate (ou de pomme ou de raisin), ou glose ATB (bouillon
de tomate acide) modifie (milieu pour Oenococcus oeni), ou bouillon de jus
de tomate (TJB) plus glose, ou milieu Lafon-Lafourcade, milieu 104 ou
glose MTB (Annexe 5 milieux de culture) ou quivalant si valid
Pour le comptage des champignons filamenteux, utiliser de la glose
Czapek-Dox modifie, de la glose DRBC (dichloran-rose Bengalechloramphnicol) ou de la MEA additionne de ttracycline (100 mg/l) et de
streptomycine (100 mg/ l) (Annexe 5 milieux de culture) ou quivalant si
valid
Il convient d'ajouter des antibiotiques pour effectuer un comptage
slectif, tant donn que tous les micro-organismes sont prsents ensemble
dans le vin. (Voir Annexe I milieux de culture)
6.1.5 Installations et quipement
Comme indiqu au paragraphe 2 de la rsolution.
6.1. 6 chantillonnage
Comme indiqu au paragraphe 3 de la rsolution
OIV-MA-AS4-01 : 2010

16

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Les quantits suivantes d'chantillons sont exiges pour la numration sur


plaques :
Mot ou mot en fermentation ou vin stock :
pas moins de 250 ml ;
Vin en bouteille ou conditionn :
pas moins d'une unit, quelle que soit
la capacit ;
6.1. 7 Mthodes d'examen
6.1.7.1 Conditions pralables requises
Tous les produits et quipements utiliss au cours des essais doivent tre
striles, et des conditions aseptiques doivent tre maintenues tout au long des
oprations.
La hotte flux laminaire doit tre mise en marche 5 minutes avant de
commencer le travail, afin d'avoir un flux d'air strile et stable.
6.1.7.2 Strilisation
Les milieux de culture doivent tre striliss en autoclave 121C pendant
au moins 15 minutes (20 minutes pour de grands volumes). Le matriel et la
verrerie striles usage unique doivent tre ouverts et utiliss sous la hotte
flux laminaire. Les brucelles et les taleurs doivent tre plongs dans
l'thanol et flambs avant utilisation. Les entonnoirs en acier inoxydable
doivent tre flambs avec de l'thanol aprs chaque utilisation. Les
entonnoirs en verre et en polycarbonate doivent en revanche tre passs
l'autoclave avant utilisation, leur nombre doit par consquent tre gal
celui des chantillons tester.
6.1.7.3 Dilution des chantillons (Annexe 1)
Un ml d'chantillon est introduit la pipette dans un tube contenant 9 ml d'eau
peptone strile. Le tube est mis en agitation pendant 20 secondes au moyen
d'un agitateur vortex. C'est la premire dilution (dcimale), dont 1 ml est
transfr dans le tube suivant de 9 ml d'eau peptone strile, ce qui constitue la
deuxime dilution. Aprs 20 secondes d'agitation, l'opration est rpte autant
de fois que ncessaire.
Le nombre indicatif de dilutions en srie ncessaires pour les chantillons
suivants est indiqu ci-dessous :
Mots non ferments :
4
dilutions dcimales.
Mots de fermentation :
7
dilutions dcimales.
OIV-MA-AS4-01 : 2010

17

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Vins non-filtrs pendant le vieillissement (comptage des levures)


2
dilutions dcimales.
Vins non filtrs pendant le vieillissement (comptage des bactries lactiques) 6
dilutions dcimales.
Vins
filtrs
ou
vins
conditionns
(mis
en
bouteille)
Auc
une dilution.
Mots concentrs
Diluer 10 ml dans 100 ml d'eau peptone
(ou 100 ml dans 1000 ml).
Les vins en bouteille ou filtrs, et les mots concentrs aprs dilution dans de
l'eau peptone strile, sont analyss selon la technique de filtration sur
membrane.
6.1.7.4 Prparation des plaques
Les dilutions en srie ncessaires sont prpares en fonction du nombre
d'chantillons taler sur des plaques. De multiples dilutions en srie peuvent
tre prpares, si un grand nombre d'chantillons doivent tre tals sur des
plaques, mais toute dilution devra tre utilise dans un dlai de 20 minutes.
Inoculer chaque plaque avec 0,1 ou 0,2 ml des trois dilutions les plus faibles
ayant t prpares, en procdant comme indiqu ci-dessous :
Mots non ferments
dilutions -2 ; -3 ; -4.
Mots de fermentation
dilutions -5 ; -6 ; -7.
Vins non filtrs pendant le vieillissement
dilutions 0 ; -1 ; -2.
Dans le doute, inoculer un nombre plus lev de dilutions, jamais un nombre
infrieur.
Dans des conditions aseptiques (de prfrence sous une hotte flux laminaire),
avec une tige de verre coude strile (tige de Digralsky) ou usage unique,
taler l'chantillon la surface des milieux de culture avant absorption du
liquide (gnralement en 1-2 minutes). Utiliser une nouvelle " tige de
Digralsky " pour chaque plaque ou procder en allant de l'chantillon le plus
dilu jusqu'au moins dilu. Laisser les plaques quelques minutes sous le flux
d'air strile, jusqu' ce que le liquide soit absorb.

OIV-MA-AS4-01 : 2010

18

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Note 1 : Le fait d'utiliser 0,2 ml au lieu de 0,1 ml, comme frquemment


indiqu, facilite l'talement et prolonge le dlai d'utilisation. Ces lments
doivent tre pris en compte dans les calculs.
Note 2 : Pour le dnombrement des levures, le dveloppement bactrien est
inhib en ajoutant 50 mg/l de chloramphnicol (ou quivalant si valid) au
milieu de croissance, aprs passage dans l'autoclave, et le dveloppement
des moisissures en ajoutant 150mg/l de diphnyle (ou quivalant si valid).
Note 3 : Pour le dnombrement des bactries lactiques, le dveloppement
des levures est inhib en ajoutant de la natamycine (pimaricine) (0,1 g/l)
(ou quivalant si valid) et le dveloppement des bactries actiques par
incubation anarobie.
Note 4 : Pour le dnombrement des bactries actiques, le dveloppement
des levures est inhib en ajoutant de la natamycine (pimaricine) (0,1 g/l)
(ou quivalant si valid) et celui des bactries lactiques par ajout de
pnicilline
(12,5
mg/l)
(ou
quivalant
si
valid).
L'ajout d'antibiotiques est effectu aprs la strilisation en autoclave.
Pour une recherche spcifique de levures non Saccharomyces, inoculer,
comme indiqu prcdemment, trois plaques de glose de lysine et trois
plaques de glose diffrentielle WL avec les dilutions appropries
- Mthode de incorporation (mthode alternative).
Prparer et striliser 15 ml de milieu dans des tubes, et maintenir les tubes
dans un bain d'eau (ou quivalant si valid) 471 C.
Verser 1 ml d'chantillon ou de dilution dans une bote de Petri vide.
Ajouter 15 ml de milieu de culture et remuer doucement la bote de Petri, afin
d'obtenir une rpartition homogne des micro-organismes dans la masse du
milieu.
Laisser refroidir et se solidifier en plaant les botes de Petri sur une surface
horizontale frache (le temps de solidification de la glose ne devra pas
excder 10 minutes).

OIV-MA-AS4-01 : 2010

19

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

6.1.7.5 Dnombrement avec concentration par filtration sur membrane


La porosit de la membrane doit tre de 0,45 ou 0,8 m pour le dnombrement
des levures ; 0,2 ou 0,45 m pour celui des bactries. La surface de la
membrane doit de prfrence tre quadrille, afin de faciliter le dnombrement
des colonies.
Les plaques, sur lesquelles sont places les membranes, peuvent contenir un
milieu nutritif glos ou un tampon, dans lequel le milieu sec est dispers et
qui doit tre imbib d'eau strile juste avant utilisation. Certains fournisseurs
proposent des plaques striles contenant un tampon strile, sur lequel sont
verss juste avant utilisation 2 ml de milieu liquide strile usage unique.
Assembler le matriel de filtration de manire aseptique, et relier au systme
qui permettra de faire le vide.
Plonger les brucelles dans l'thanol et les flamber : une fois la flamme teinte,
attendre quelques secondes et mettre la membrane, avec les brucelles, sur son
support dans l'unit de filtration.
Avant d'ouvrir la bouteille, bien lagiter, renverser le goulot et le plonger dans
l'thanol (1-2 cm), puis flamber pour le striliser.
Prlever trois volumes de chaque chantillon : 10 ml avec une pipette strile
de 10 ml, 100 ml avec une prouvette cylindrique strile de 100 ml, et le reste
directement de la bouteille si applicable. Pour filtrer, verser le vin dans
l'entonnoir, puis activer le vide.
Lorsque la quantit de vin dsire a t filtre, casser le vide, flamber les
brucelles, ouvrir l'entonnoir, maintenir la membrane avec les brucelles, placer
sa face oppose sur le milieu solide d'une plaque et la faire adhrer la surface
du milieu en vitant que des bulles ne se forment en-dessous.
6.1.7.6 Incubation des chantillons
Incuber les plaques l'envers, en conditions arobies, pour les levures ou
pour les bactries actiques, pendant 4 jours 25 2C. Si la temprature
est infrieure 23C, prolonger l'incubation d'un jour, si elle est infrieure
20C prolonger de trois jours supplmentaires. La temprature maximale ne
doit pas excder 28C.
En cas de comptage portant sur des levures Brettanomyces (ou Dekkera),
doubler le temps d'incubation.
En cas de comptage de BL (bactries lactiques), mettre les plaques dans une
fiole ou un sac anarobies, et incuber les plaques l'envers pendant 10 jours
30 2C. Si la temprature est infrieure 28C prolonger l'incubation

OIV-MA-AS4-01 : 2010

20

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

d'un jour ; si elle est infrieure 25C, prolonger de trois jours


supplmentaires. La temprature maximale ne doit pas excder 33C.
6.1. 8 Expression des rsultats
6.1.8.1 Dnombrement des colonies de levure et bactries :
Compter les colonies dveloppes en 4 jours pour les levures et les bactries
actiques (8 jours pour les levures Brettanomyces/Dekkera), et 10 jours pour
les bactries lactiques au besoin l'aide d'un compteur de colonies, en ignorant
la morphologie diffrente des colonies en cas de comptage total des levures, ou
en la prenant en compte s'il y a lieu.
Les milieux et les conditions dincubation sont suffisamment spcifiques pour
que les colonies visibles lil nu permettent le comptage des diffrents types
de micro-organismes.
6.1.8.2 Calcul des rsultats.
Les rsultats les plus fiables proviennent du comptage de plaques contenant de
10 300 colonies (ISO 7218:2007 - Microbiologie des denres alimentaires et
aliments pour animaux - Rgles gnrales relatives aux analyses
microbiologiques).
Calculer le nombre N de micro-organismes prsents dans l'chantillon d'essai
sous forme de moyenne pondre de deux dilutions dcimales successives, en
utilisant l'quation suivante :
N

V 1,1 d

o :

est la somme des colonies comptes sur les deux botes conserves

aprs deux dilutions dcimales successives, dont une au moins contient au


minimum 10 colonies.
V est le volume d'inoculum plac dans chaque bote, en millilitres.
d est la dilution correspondant la premire dilution retenue [d = 1 quand le
produit liquide non dilu (chantillon d'essai) est retenu].
En d'autres termes, si les plaques de deux dilutions dcimales conscutives
contiennent 10-300 colonies, calculer le nombre d'UFC/ml pour chaque
OIV-MA-AS4-01 : 2010

21

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

dilution, et ensuite la moyenne des deux valeurs : c'est la valeur d'UFC/ml de


l'chantillon. Si une valeur est suprieure au double de l'autre, garder la valeur
infrieure comme UFC/ml.
Arrondir les rsultats au deuxime chiffre significatif seulement au moment de
la conversion en UFC/ml, et rapporter les rsultats sous la forme d'un nombre
compris entre 1,0 et 9,9 multiplis par la puissance 10 approprie (ISO
7218:2007 - Microbiologie des denres alimentaires et aliments pour animaux
- Rgles gnrales relatives aux analyses microbiologiques).
Si les chantillons ont t inoculs en double, et si une ou deux plaques
inocules avec la mme dilution contiennent des colonies, calculer le nombre
moyen de colonies et multiplier par l'inverse du facteur de dilution, pour
obtenir le nombre d'UFC/ml.
Si aucune plaque ne contient 10-300 colonies, et que toutes les plaques
contiennent plus de 300 colonies, compter celles comportant le moins de
colonies. Si elles contiennent moins de 10 colonies/cm, compter 12 carrs de
1 cm2 et multiplier la moyenne par 56 (la surface d'une plaque de 90 mm de
diamtre) ; si les colonies sont plus denses, compter 4 carrs de 1 cm2 et
multiplier la moyenne par 56. Exprimer les rsultats en tant que "Valeur
UFC/ml estime". Dans la mesure du possible, ne pas rapporter les rsultats
sous la forme TNTC [too numerous to count (trop nombreux pour tre
compts)].
Si les seules plaques prsentant des colonies contiennent moins de 10 colonies,
mais au moins 4, calculer le rsultat comme indiqu dans le cas gnral, et le
rapporter en tant que "Valeur UFC/ml estime".
Si le total est compris entre 3 et 1, la prcision du rsultat est trop faible, et le
rsultat sera rapport sous la forme "(les micro-organismes recherchs) sont
prsents mais en quantit infrieure 4 d UFC/ml".
Si les plaques de toutes les dilutions d'un chantillon ne prsentent aucune
colonie, rapporter le rsultat sous la forme "moins de 1/d UFC/ml", mais tenir
compte de la prsence ventuelle d'inhibiteurs dans l'chantillon.
En cas d'application de la technique de filtration sur membrane, exprimer les
rsultats par rapport la quantit de liquide filtre, par exemple UFC/bouteille,
UFC/100 ml ou UFC/10 ml.

OIV-MA-AS4-01 : 2010

22

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

6.1.9 Incertitude de la mesure


6.1.9.1 Critres de contrle des rsultats.
Pour chaque lot de milieu, une plaque est utilise comme tmoin de strilit
aprs strilisation. Une plaque, par milieu de culture utilis lors des tests, est
laisse ouverte sous la hotte flux laminaire tout au long des oprations afin
de contrler la strilit de l'environnement de travail. Cette plaque sera
incube comme les plaques inocules.
Priodiquement, un chantillon est inocul en double, et le Kp exprimental
est calcul au moyen de l'quation suivante :

Kp

| C1 C 2 |
C1 C 2

dans laquelle C1 et C2 sont les rsultats des deux comptages.


Si Kp < 1,96 2,0 les rsultats sont acceptables : la moyenne des deux
comptages peut tre utilise comme rsultat.
Si 2,0<Kp 2,576 2,6 la diffrence des deux comptages est critique et
doit tre soigneusement value avant d'accepter les rsultats comme
moyenne des deux comptages.
Si Kp > 2,6 la diffrence des deux comptages est anormale. Le rsultat est
rejet et le test doit tre rpt. Dans ces circonstances, le responsable du
laboratoire doit examiner tous les rsultats obtenus aprs les derniers
rsultats acceptables.
6.1.9.2 Incertitude de la mesure
Si le nombre de colonies comptes sur la plaque pouvant l'tre est infrieur
10, le rsultat est acceptable, mais la population des colonies est considre
conforme la loi de Poisson. Le niveau de confiance de 95 %, et par
consquent l'incertitude de la mesure du comptage estimatif ralis sur une
seule bote de Petri, est rapport dans le tableau suivant.

OIV-MA-AS4-01 : 2010

23

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Nombre
colonies

de Limite de confiance au niveau Pourcentage d'erreur de la limite


95 %
*
Infrieure
Suprieure
Infrieure
Suprieure
1
<1
6
-97
457
2
<1
7
-88
261
3
<1
9
-79
192
4
1
10
-73
156
5
2
12
-68
133
6
2
13
-63
118
7
3
14
-60
106
8
3
16
-57
97
9
4
17
-54
90
10
5
18
-52
84
11
6
20
-50
79
12
6
21
-48
75
13
7
22
-47
71
14
8
24
-45
68
15
8
25
-44
65
re
* Par rapport au dnombrement des micro-organismes (1 colonne)
Si le nombre de colonies est > 10, la limite de confiance un seuil de
probabilit p est calcule au moyen de l'quation suivante :
C = Ci Kp Ci,
dans laquelle Ci est le nombre de colonies de la plaque, et Kp est le facteur
de couverture. Gnralement, le facteur de couverture est 2 ou 1,96. La
valeur de C est calcule partir de chaque plaque et multiplie par le
nombre de dilutions ainsi que par le rsultat du comptage.

6.2. Culture en milieu liquide - "nombre le plus probable" (NPP)


6.2.1 Objectif
Cette technique a pour but d'valuer le nombre de micro-organismes viables
dans les vins ayant des teneurs leves en particules solides en suspension
et/ou des indices levs de colmatage.

OIV-MA-AS4-01 : 2010

24

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

6.2.2 Principe
Cette technique est base sur l'estimation du nombre de micro-organismes
viables en milieu liquide, en partant du principe d'une rpartition normale
dans l'chantillon.
6.2.3 Diluants et milieux de culture liquides (Annexes 4 et 5)
6.2.4 Mode opratoire
Plusieurs solutions quantitatives et successives sont prpares et, aprs
incubation, une certaine proportion d'essais ne donneront lieu aucun
dveloppement (essais ngatifs), tandis que d'autres commenceront se
dvelopper (essais positifs). Si l'chantillon et les dilutions sont homognes
et si le nombre de dilutions est suffisamment lev, il est possible de faire
un traitement statistique des rsultats en utilisant des tables appropries
(tables reposant sur les calculs de probabilit de
McCrady) et d'extrapoler ce rsultat l'chantillon initial.
6.2.5 Prparation des dilutions
En partant d'un chantillon de vin homognis, prparer une srie de
dilutions dcimales (1/10) dans le diluant.
Prlever 1 ml de vin et ajouter 9 ml de diluant dans le premier tube.
Homogniser. Prlever 1 ml de cette dilution pour l'ajouter 9 ml de
diluant dans le deuxime tube. Continuer ce protocole de dilution jusqu' la
dernire dilution requise, selon la population microbienne prsume, en
utilisant des pipettes
striles pour chaque dilution. Les dilutions doivent tre ralises jusqu'
extinction, c'est--dire l'absence de dveloppement dans les dilutions les
plus faibles (annexe 2).
6.2.6 Prparation des inoculations
Inoculer 1 ml de vin et 1 ml de chacune des dilutions homognises lors de
leur prparation, dans trois tubes avec le milieu de culture appropri (annexe
5). Bien mlanger.
Incuber les tubes inoculs dans l'tuve 25 C, pour les levures (pendant 3
10 jours), en arobiose et, pour les bactries lactiques, en anarobiose ou
microarophilie (pendant 8 10 jours), en faisant des observations
priodiques jusqu'au dernier jour d'incubation.

OIV-MA-AS4-01 : 2010

25

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

6.2.7 Rsultats
Sont considrs positifs tous les tubes qui prsentent un dveloppement
microbien se traduisant par la formation d'un sdiment blanchtre, plus ou
moins vident et/ou par un trouble plus ou moins accentu. Les rsultats
doivent tre confirms par observation au microscope. Prciser la dure
d'incubation.
La lecture des tubes se fait en notant le nombre de tubes positifs ou ngatifs
de chaque combinaison de trois tubes (de chaque dilution). Par exemple, "31-0" signifie : trois tubes positifs dans la dilution 100 (vin), un dans la
dilution 10-1 et zro dans la dilution 10-2.
Pour un nombre de dilutions suprieur trois, seuls trois de ces rsultats
sont significatifs. Pour slectionner les rsultats adopter dans la
dtermination du "NPP", il est ncessaire de dterminer le "nombre
caractristique" conformment aux exemples figurant dans le tableau
suivant :
Tableau
Nombre de tubes positifs pour chaque
Nombre caractristique
dilution
10
10
10
10
3-1-0
Exemp 10
le
a
3
3
3
1
0
3-2-0
a
3
3
2
0
0
3-2-1
a
3
2
1
0
0
3-0-1
a
3
0
1
0
0
3-2-3
b
3
2
2
1
0
3-2-3
b
3
2
1
1
0
3-2-2
c
2
2
2
2
0
2-2-2
d
0
1
0
0
0
0-1-0
Exemple a : prendre la plus grande dilution pour laquelle tous les tubes sont
positifs et les deux suivantes.
Exemple b : si un rsultat positif est not pour une dilution plus grande que la
dernire ainsi choisie, il faut lajouter celle-ci.
Exemple c : si aucune dilution ne fournit trois tubes positifs, prendre les
dilutions correspondantes aux trois derniers tubes positifs.
Exemple d : cas ou le nombre de tubes positifs est trs rduit, choisir le
nombre caractristique de faon ce que la dilution positive
occupe le rang des dizaines
Adapt de Bourgeois, C.M. et Malcoste, R. in : Bourgeois, C.M. et Leveau, J.Y. (1991).
OIV-MA-AS4-01 : 2010

26

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Calcul du nombre le plus probable (NPP)


Le NPP est dtermin l'aide du Tableau A (Annexe 3) reposant sur les
calculs de probabilits de McCrady, en tenant compte du nombre
caractristique obtenu et de la dilution effectue. Si la srie de dilutions est
100, 10-1, 10-2, la lecture est directe. Si la srie de dilutions est 101, 100, 10-1,
la lecture correspond 0,1 fois cette valeur. Si la srie de dilutions est 10-1,
10-2, 10-3, la lecture correspond dix fois cette valeur.
Remarque :
S'il est ncessaire d'augmenter le niveau de dtection, une concentration de
vin de 101 peut tre utilise. Pour obtenir cette concentration de microorganismes dans 1 ml, centrifuger 10 ml de vin et prlever 1 ml de dpt
(aprs avoir enlev 9 ml du liquide surnageant) inoculer selon la procdure
dcrite prcdemment.
6.2.8 Expression des rsultats
La teneur en micro-organismes du vin doit tre prsente en germes par
millilitre, en notation scientifique une dcimale. Si la teneur est infrieure
1,0 cellule par millilitre, le rsultat doit tre prsent sous la forme "< 1,0
cellule par ml".
(voir les annexes en pages suivantes)
7. Bibliographie
ISO 4833:2003. Microbiology of food and animal feeding stuffs
Horizontal medium for the enumeration of microorganisms Colony count
technique at 30C.
ISO 7218:2007 - Microbiology of food and animal feeding stuff General rules for microbiological examinations.
ISO 7667:1983. Microbiology - Standard layout for methods of
microbiological examination.
Pallman, C., J. B. Brown, T. L. Olineka, L. Cocolin, D. A. Mills and
L. F. Bisson. 2001. Use of WL medium to profile native flora fermentations.
American Journal of Enology and Viticulture 52:198-203 ;
A. Cavazza, M. S. Grando, C. Zini, 1992. Rilevazione della flora
microbica di mosti e vini. Vignevini, 9-1992 17-20.ANDREWS, W.
et MESSER, J. (1990). Microbiological Methods. in : AOAC Official

OIV-MA-AS4-01 : 2010

27

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Methods of Analysis, 15th edition, 1, 425-497, Association of Analytical


Chemist, Washington.
BIDAN, P. (1992). Analyses Microbiologiques du Vin. F.V. O.I.V.
n 910, Paris.
BOURGEOIS, C.M. et LEVEAU, J.Y. (1991). Techniques d'analyse
et de contrle dans les industries agro alimentaires, 2me dition, 3. Le
Contrle Microbiologique Lavoisier, Tec. & Doc., APRIA Ed. Paris.
CARR, J. G. (1959). Acetic acid bacteria in ciders. Ann. Rep. Long
Ashton Res. Sta., 160.
DE MAN, J. C. (1975). The probability of most probable number.
European Journal of Applied Microbiology, 1, 67-78.
LAFON-LAFOURCADE, S. et al. (1980). Quelques observations
sur la formation d'acide actique par les bactries lactiques. Conn. Vigne
Vin, 14, 3, 183-194.
MAUGENET, J. (1962). Les Actobacter du cidre. Identification de
quelques souches. An. Technol. Agric., 11, 1, 45-53.
PLARIDIS et LAFON-LAFOURCADE, S. (1983). Contrle
microbiologique des vins. Bull. O.I.V., 618, 433-437, Paris.
RIBREAU-GAYON, J. et PEYNAUD, E. (2004). Trait
d'nologie, Tome 2, Librairie Polytechnique CH. Branger, Paris et Lige.
Standard Methods for the Examination of Water and Waste Water
(1976). 14th edition, American Public Health Association, Incorporated,
New York.
Standard Methods for the Examination of Water and Waste Water
(1985). 16th edition, American Public Health Association, DC 20005,
Washington.
VAZ OLIVEIRA, M., BARROS, P. et LOUREIRO, V. (1995).
Analyse microbiologique du vin. Technique des tubes multiples pour
l'numration de micro-organismes dans les vins - "Nombre le plus
probable" (NPP), F.V. O.I.V. n 987, Paris.
VAZ OLIVEIRA, M. et LOUREIRO, V. (1993). L'numration de
micro-organismes dans les vins ayant un indice de colmatage lev, Compte
rendu des travaux du groupe d'experts "Microbiologie du Vin" de l'O.I.V.,
12me session, annexe 2, Paris.
VAZ OLIVEIRA, M. et LOUREIRO, V. (1993). L'numration de
micro-organismes dans les vins ayant un indice de colmatage lev, 2me
partie, Doc. Travail du groupe d'experts "Microbiologie du Vin" de l'O.I.V.,
13me session, Paris.

OIV-MA-AS4-01 : 2010

28

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Annexe 1
Prparation des dilutions et inoculations

OIV-MA-AS4-01 : 2010

29

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Annexe 2
Prparation des dilutions et inoculations
Dilution

chantillon

Dilution obtenue
Inoculation des botes
chantillon

Quantit d'chantillon

OIV-MA-AS4-01 : 2010

30

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Annexe 3
TABLEAU A
"Nombre le plus probable" (NPP) pour 1 ml d'chantillon en utilisant 3
tubes
contenant 1 ml, 0,1 ml et 0,01 ml
Tubes positifs
Tubes positifs
Tubes positifs
1
0,1 0,01 NPP 1
0,1 0,01 NPP 1
0.1 0,01 NPP
ml ml ml 1 ml ml ml ml 1 ml ml
ml ml 1 ml
0
0
0
0,0
2
0
2
2,0
1
1
1
7,5
0
0
1
0,3
2
1
0
1,5
3
1
2
11,5
0
1
0
0,3
2
1
1
2,0
3
1
3
16,0
0
1
1
0,6
2
1
2
3,0
3
2
0
9,5
0
2
0
0,6
2
2
0
2,0
3
2
1
15,0
1
0
0
0,4
2
2
1
3,0
3
2
2
20,0
1
0
1
0,7
2
2
2
3,5
3
2
3
30,0
1
0
2
1,1
2
2
3
4,0
3
3
0
25,0
1
1
0
0,7
2
3
0
3,0
3
3
1
45,0
1
1
1
1,1
2
3
1
3,5
3
3
2 110,0
1
2
0
1,1
2
3
2
4,0
3
3
3 >140,
0
1
2
1
1,5
3
0
0
2,5
1
3
0
1,6
3
0
1
4,0
2
0
0
0,9
3
0
2
6,5
2
0
1
1,4
3
1
0
4,5
Adapt de Standard Methods for the Examination of Water and Waste
Water (1976)

OIV-MA-AS4-01 : 2010

31

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Annexe 4
Diluants :
Les diluants sont indiqus titre d'exemple. L'eau utiliser doit tre
distille, bidistille ou dsionise, sans traces de mtaux, d'inhibiteurs ou
d'autres substances antimicrobiennes.
1. Eau physiologique
Prparation : peser 8,5 g de chlorure de sodium dans une fiole jauge
de 1000 ml. Aprs dissolution dans l'eau, ajuster au volume de
rfrence. Bien mlanger. Filtrer. Rpartir 9 ml dans les tubes essais.
Boucher avec du coton card et placer en autoclave pendant 20 mn
121 C.
2. Solution de Ringer 1/4
Prparation : dans une fiole jauge de 1000 ml, peser 2,250 g de chlorure de
sodium, 0,105 g de chlorure de potassium, 0,120 g de chlorure de calcium
(CaCl2.6H2O), 0,050 g d'hydrognocarbonate de sodium. Aprs dissolution
dans de l'eau, ajuster au volume de rfrence. Bien mlanger. Rpartir 9 ml
dans les tubes essais. Boucher avec du coton card et placer en autoclave
pendant 15 mn 121 C. (cette solution est disponible dans le commerce)
3. Eau peptone
Prparation : dans une fiole jauge de 1000 ml, peser 1g de peptone. Aprs
dissolution dans l'eau, ajuster au volume de rfrence. Bien mlanger.
Rpartir 9 ml dans les tubes d'essai. Boucher avec du coton card et placer
en autoclave pendant 20 mn 121 C.

OIV-MA-AS4-01 : 2010

32

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Annexe 5

Milieux de culture
Les milieux de culture et les antimicrobiens sont indiqus titre d'exemple.
L'eau utiliser doit tre distille, bidistille ou dsionise, sans traces de
mtaux, d'inhibiteurs ou d'autres substances antimicrobiennes.

1. Milieux de culture solides


En l'absence d'indication contraire, le pH de tous les milieux doit tre ajust
entre pH 5,5 et pH 6,0
1 MILIEUX POUR LE DNOMBREMENT DES LEVURES
1.1 YM
Glucose
50 g
Peptone
5g
Extrait de levure
3g
Extrait de malt
3g
Agar-agar
20 g
Eau : jusqu'
1000 ml
Ajouter au besoin 100 mg de chloramphnicol pour inhiber le
dveloppement bactrien et 150 mg de diphnyle pour inhiber le
dveloppement des moisissures.
1.2 YEPD
Glucose
20 g
Peptone
20 g
Extrait de levure
10 g
Agar-agar
20 g
Eau : jusqu'
1000 ml
Ajouter au besoin 100 mg de chloramphnicol pour inhiber le
dveloppement bactrien et 150 mg de diphnyle pour inhiber le
dveloppement des moisissures.

OIV-MA-AS4-01 : 2010

33

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

1.3 Glose nutritive WL


Glucose
Peptone
Extrait de levure
Phosphate de potassium monobasique (KH2PO4)
Chlorure de potassium (KCl)
Chlorure de calcium (CACL2)
Sulfate de magnsium (MgSO4)
Chlorure ferrique (FeCl3)
Sulfite de manganse (MnSO4)
Vert de bromocrsol
Glose bactriologique
Eau : jusqu'
pH

50 g
5g
4g
0,55 g
0,425 g
0,125 g
0,125 g
0,0025 g
0,0025 g
0,022 g
12 g
1000 ml
5,5

La glose diffrentielle est produite en ajoutant 4 mg/l de cycloheximide la


glose nutritive WL.
Ajouter au besoin 100 mg de chloramphnicol pour inhiber le
dveloppement bactrien.
1.4 Glose de lysine ASBC
Solution A :
Base carbone de levure
2,35 g
Eau : jusqu'
100 ml
Striliser par filtration sur membrane.
Solution B :
Lysine-HCl
0,5 g
Agar-agar
4g
Eau : jusqu'
100 ml
Striliser pendant 20 mn 121 C.
Ajouter au besoin 100 mg de chloramphnicol pour inhiber le
dveloppement bactrien.

OIV-MA-AS4-01 : 2010

34

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

2 MILIEUX
LACTIQUES

POUR

LE

DNOMBREMENT

DES

BACTRIES

2.1 M.R.S. + jus de tomate (ou pomme).


Glucose
20 g
Peptone
10 g
Extrait de buf
8g
Extrait de levure
4g
Phosphate de potassium, dibasique (KH2PO4)
2g
Actate de sodium 3H2O
5g
Citrate d'ammonium
2g
Sulfate de magnsium 6H2O
0,2 g
Sulfate de manganse 4H2O
0,05 g
"Tween 80"
1 ml
Agar-agar
12 g
Jus de tomate (ou jus de pomme ou de raisin)
200 ml
Eau jusqu'
1000 ml
Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le
dveloppement des levures, aprs passage l'autoclave, juste avant
utilisation.
2.2 Glose au jus de tomate
Jus de tomate (extrait sec de 400 ml)
20 g
Peptone
10 g
Lait peptonis
10 g
Agar-agar
14 g
Eau : jusqu'
1000 ml
pH
6,1
Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le
dveloppement des levures, aprs passage l'autoclave, juste avant
utilisation.

OIV-MA-AS4-01 : 2010

35

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

2.3 Milieu ATB modifi, ou milieu Oenococcus oeni (anciennement milieu


Leuconostoc oenos).
Solution A :
Glucose
Extrait de levure
Peptone
Sulfate de magnsium
Sulfate de manganse
Jus de tomate (ou jus de pomme ou de raisin)
Agar-agar
Eau
Striliser l'autoclave pendant 20 mn 121 C.
Solution B :
Cystine HCl
Eau : jusqu'
pH
Striliser par filtration sur membrane.
Ajouter 100 mg/L de natamycine (pimaricine)
dveloppement des levures, juste avant utilisation.

10 g
5g
10 g
0,2 g
0,050 g
250 ml
12 g
750 ml

1g
100 ml
4,8
pour

inhiber

le

Ajouter 1 ml de la solution B dans 20 ml de solution A au moment de


l'utilisation
2.4 Milieu Lafon-Lafourcade
Glucose
Extrait de levure
Extrait de buf
Peptone
Actate de sodium
Citrate de tri-ammonium
Sulfate de magnsium 6H2O
Sulfate de manganse 4H2O
"Tween 80"
Agar-agar
Eau : jusqu'
pH
OIV-MA-AS4-01 : 2010

20 g
5g
10 g
10 g
5g
2g
0,2 g
0,05 g
1 ml
20 g
1000 ml
5,4
36

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le


dveloppement des levures, aprs passage l'autoclave, juste avant
utilisation.
2.5 Milieu Dubois (milieu 104)
Jus de tomate
250 ml
Extrait de levure
5g
Peptone
5g
Acide malique
3g
Sulfate de magnsium 6H2O
0.05 g
Sulfate de manganse 4H2O
0.05 g
Agar-agar
20 g
Eau : jusqu'
1000 ml
pH
4,8
Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le
dveloppement des levures, aprs passage l'autoclave, juste avant
utilisation.
2.6 MTb.
Glucose
15 g
Poudre Lab-Lemco (Oxoid)
8g
Casine hydrolyse
1g
Extrait de levure
5g
Jus de tomate
20 ml
Actate de sodium
3g
Citrate d'ammonium
2g
Acide malique
6g
Sulfate de magnsium
0,2 g
Sulfate de manganse
0,035 g
"Tween 80"
1 mg
TC Vitamins Minimal Eagle, 100x (BD-Difco)
10 ml *
pH (avec KOH)
5,0
Eau jusqu'
1000 ml
* ajouter aprs strilisation.
Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le
dveloppement des levures, aprs passage l'autoclave, juste avant
utilisation.

OIV-MA-AS4-01 : 2010

37

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

3 MILIEUX POUR LE DNOMBREMENT DES BACTRIES ACTIQUES


3.1 GYC
Glucose
Extrait de levure
Carbonate de calcium (CaCO3)

50 g
10 g
3g

Glose
25 g
Eau : jusqu'
1000 ml
Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le
dveloppement des levures, et 12,5 mg/L de pnicilline pour liminer la
croissance des bactries lactiques, aprs passage l'autoclave, juste avant
utilisation.
3.2 Milieu G2
Extrait de levure
1,2 g
Phosphate d'ammonium
2g
Jus de pomme
500 ml
Glose
20 g
Eau : jusqu'
1000 ml
pH
5,0
Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le
dveloppement des levures, et 12,5 mg/L de pnicilline pour liminer la
croissance des bactries lactiques, aprs passage l'autoclave, juste avant
utilisation.
3.3 Milieu Kneifel
Extrait de levure
thanol
Glose
Vert de bromocrsol 2,2 %
Eau : jusqu'

30 g
20 ml *
20 g
1mL
1000 ml

* ajouter aprs strilisation.

Ajouter 100 mg/L de natamycine (pimaricine) pour inhiber le


dveloppement des levures, et 12,5 mg/L de pnicilline pour liminer la
croissance des bactries lactiques, aprs passage l'autoclave, juste avant
utilisation.
OIV-MA-AS4-01 : 2010

38

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Colonies bleues : Acetobacter, Gluconacetobacter


Colonies vertes : Gluconobacter
4 MILIEUX POUR LE DNOMBREMENT DES MOISISSURES
4.1 Czapek-Dox, Modifi
Sucrose
30 g
NaNO3
3g
K2HPO4
1g
MgSO4
0,5 g
KCl
0,5 g
0,01g
FeSO4
Glose
15 g
pH final ( 25 C)
7,3 0,2
Ajouter 10 mg/l de cycloheximide pour inhiber le dveloppement des
levures (le dveloppement des levures rsistantes au cycloheximide est
gnralement plus lent que celui des moisissures).
Remarque : Ce milieu permet la croissance uniquement des moisissures se
dveloppant en prsence de nitrates.
Ajouter de la ttracycline (100 mg/l) et de la streptomycine (100 mg/l) pour
inhiber la croissance des bactries.
4.2 Glose dichloran-rose Bengale-chloramphnicol (glose DRBC)
Glucose
10 g
Peptone
5g
KH2PO4
1g
MgSO4
0,5 g
Rose Bengale
0,025 g
Dichloran (2,6 dichloro-4-nitroaniline)
0,002g
Solution de chloramphnicol (0,1 g/10ml) *
10 ml
Glose
15 g
pH final ( 25 C)
5,6 0,2
* ajouter aprs strilisation.

OIV-MA-AS4-01 : 2010

39

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

4.3 Glose l'extrait de malt (MEA)


Glucose
20 g
Extrait de malt
20 g
Peptone
5g
Glose
15 g
pH final ( 25 C)
5,5 0,2
Ajouter de la ttracycline (100 mg/l) et de la streptomycine (100 mg/l) pour
inhiber la croissance des bactries.

2. Milieux de culture liquides


2.1. Pour les levures
Milieu YEPD (extrait de levure, peptone, dextrose) + chloramphnicol
Prparation : Peser 10,0 g d'extrait de levure (Difco ou quivalent), 20 g de
peptone, 20 g de glucose et 100 mg de chloramphnicol. Dissoudre,
complter le volume avec de l'eau jusqu' 1000 ml et mlanger.
Verser des portions de 5 ml de ce milieu dans les tubes et placer en
autoclave pendant 15 mn 121 C.
2.2. Pour les bactries lactiques
Milieu MTJ (50 % de milieu MRS "bouillon pour lactobacilles selon Man,
Rogosa et Sharpe"+ 50 % de milieu TJB "bouillon de jus de tomate") +
actidione
Prparation : Peser 27,5 g de MRS "bouillon pour lactobacilles selon Man,
Rogosa et Sharpe" (Difco ou quivalent). Ajouter 500 ml d'eau, porter
bullition pour permettre la dissolution totale et ajouter 20,5 g de TJB
"bouillon de jus de tomate" (Difco ou quivalent). Ajouter 50g d'actidione.
Dissoudre avec de l'eau de faon obtenir 1000 ml de solution aprs avoir
corrig le pH 5,5 avec une solution d'acide chlorhydrique 1N et mlanger.
Verser des parties de 10 ml de ce milieu3) dans les tubes et placer en
autoclave pendant 15 minutes 121C.

3) On utilise un volume de 10 ml au lieu de 5 ml comme dans le cas des levures, en raison de la plus
grande sensibilit des bactries lactiques l'oxygne.

OIV-MA-AS4-01 : 2010

40

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

ANNEXE 6 : IDENTIFICATION DE MICRO-ORGANISMES


SPCIFIQUES
6.1 Identification de colonies de levure sur glose nutritive WL.
L'utilisation de ce milieu ne prtend pas constituer une mthode
d'identification des espces, mais peut offrir aux laboratoires non spcialiss
un moyen rapide et bon march de prvoir le genre des levures viables et
cultivables. Aprs incubation de 4 jours, valuer la morphologie des
colonies comme suit (Pallman, C., J. B. Brown, T. L. Olineka, L. Cocolin,
D. A. Mills et L. F. Bisson. 2001. Use of WL medium to profile native flora
fermentations. American Journal of Enology and Viticulture 52:198-203 ;
A. Cavazza, M. S. Grando, C. Zini, 1992. Rilevazione della flora microbica
di mosti e de vini. Vignevini, 9-1992 17-20) :
Saccharomyces spp. : Se dveloppe bien en 4 jours sur glose
nutritive WL, en formant des colonies circulaires de couleur crme
lgrement verdtre. Les diffrentes nuances de couleur n'indiquent pas
ncessairement la prsence de diffrentes souches, mais la prsence de
lgres mutations ; les colonies prsentent une protubrance, ont une surface
lisse et mate, et leur consistance est butyreuse. Ne se dveloppe pas sur la
glose de lysine.
Torulaspora spp. : Les colonies sont semblables celles de
Saccharomyces spp. Se dveloppe sur la glose de lysine.
Hanseniaspora spp. (Kloeckera spp.) : Se dveloppe sur la glose
nutritive WL en 4 jours, donnant des colonies plates, lisses et butyreuses de
couleur vert fonc. Se dveloppe sur la glose de lysine et sur la glose
diffrentielle WL.
Candida stellata : Se dveloppe sur la glose nutritive WL en 4
jours, donnant des colonies vert pois, lisses et butyreuses qui, avec le temps,
deviennent plus fonces au centre. Se dveloppe sur la glose de lysine.
Saccharomycodes spp. : Se dveloppe sur la glose nutritive WL en
4 jours, donnant des colonies convexes, lisses et butyreuses de couleur vert
clair. Se dveloppe sur la glose de lysine, pas sur la glose diffrentielle
WL.
Remarque : Ses cellules, observes au microscope, sont trs grandes
(jusqu' 25 m).

OIV-MA-AS4-01 : 2010

41

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Schizosaccharomyces pombe : Se dveloppe sur la glose nutritive


WL en 4 jours, donnant des colonies lisses, de la taille d'une pointe
d'aiguille et de couleur vert fonc. Se dveloppe sur la glose de lysine.
Remarque : Ses cellules, observes au microscope sont facilement
identifiables en raison de leur division caractristique par scission.
Rhodotorula spp. : Se dveloppe sur la glose nutritive WL en 4
jours, donnant des colonies butyreuses, la surface lisse et muqueuse, et de
couleur rose fonc. Se dveloppe sur la glose de lysine.
Metschnikowia spp. : Se dveloppe sur la glose nutritive WL en 4
jours, donnant de petites colonies claires, lisses et butyreuses. Un pigment
rougetre se rpand dans le milieu au-dessous des colonies. Se dveloppe
sur la glose de lysine.
Pichia membranifaciens : Se dveloppe sur la glose nutritive WL
en 4 jours, donnant des colonies convexes, la surface grossire et
pulvrulente, et de couleur gristre ou bleutre. Se dveloppe sur la glose
de lysine.
Pichia anomala (anciennement Hansenula anomala) : Se dveloppe
sur la glose nutritive WL en 4 jours, donnant des colonies de couleur crme
ou bleutre, nettement bleutre aprs 8 jours. Les colonies circulaires, la
surface lisse ont une consistance butyreuse mais parfois clairement
muqueuse. Se dveloppe sur la glose de lysine.
Dekkera spp. ou Brettanomyces spp. : Se dveloppe sur la glose
nutritive WL en 8 jours, donnant de petites colonies lisses et butyreuses, en
forme de dme et de couleur crme. Produit une grande quantit d'acide
actique, nettement perceptible l'odeur, qui fait virer le milieu au jaune. Se
dveloppe sur la glose de lysine et sur la glose diffrentielle WL. La
croissance sur ce dernier milieu permet de la distinguer de
Zygosaccharomyces bailii.
Remarque : Une confirmation est possible par examen microscopique :
Dekkera possde des cellules de petite taille, dont certaines ont une forme
ogivale caractristique.
Zygosaccharomyces bailii : Se dveloppe sur la glose nutritive WL
en 4 jours, donnant de petites colonies lisses et butyreuses, de forme
circulaire et de couleur crme. Se dveloppe sur la glose de lysine mais pas
sur la glose diffrentielle WL. Un halo jauntre est souvent prsent autour
des jeunes colonies.
Remarque : en cas de dveloppement dans du vin mis en bouteille, produit
des groupes bruns de 0,5 - 1 mm. Ses cellules ne sont pas de forme ogivale.
OIV-MA-AS4-01 : 2010

42

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Analyse microbiologique des vins et des mots

Bactries actiques : Se dveloppent sur la glose nutritive WL, en


donnant des colonies brillantes et intensment vertes, d'une taille allant de
petite celle d'une pointe d'aiguille, et qui sont fortement positives au test
la catalase. (Remarque ce milieu n'est pas appropri leur comptage).
Bactries lactiques : Se dveloppent sur la glose nutritive WL en
10 jours, en donnant des colonies catalase-ngatives claires de la taille d'une
pointe d'aiguille. (Remarque ce milieu n'est pas appropri leur
comptage).

6.2 Identification des colonies de bactries lactiques.


Les colonies de BL sont translucides et d'une taille allant de celle d'une
pointe d'aiguille quelques mm. Elles sont Gram-positif et catalasengatives. Oenococcus oeni se dveloppe sous forme de courtes chanes, les
pdiocoques forment des ttrades et diplocoques, les lactobacilles forment
des bacilles longs ou courts.
6.3 Identification des colonies de bactries actiques.
Les colonies de BA sont catalase-positives et Gram ngatif, et sont
fortement acidognes : ceci se traduit par une zone claire autour de leurs
colonies dans les milieux contenant du carbonate de calcium ou par une
couleur diffrente si le milieu contient un indicateur de pH. Leurs cellules
sont des coques ou des bacilles, en gnral lgrement plus grandes que
celles des BL.

OIV-MA-AS4-01 : 2010

43

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Mthode OIV-MA-AS4-02A

Mthode Type IV

Recherche des antiseptiques et des inhibiteurs de


fermentation
(Mthode A 35 modifie par la rsolution Oeno 6/2006)
1. Test de fermentescibilit
1.1. Objectif
Mettre en vidence la prsence ventuelle d'une ou plusieurs substances
action antifermentaire dans les vins, mais sans en prciser la nature.
1.2. Principe
Le vin, dont le dioxyde de soufre libre a t combin par addition d'une
solution aqueuse d'thanal, est ramen 10% vol. d'alcool, additionn de
glucose pour que sa teneur en sucres soit comprise entre 20 et 50 g/l et de
solutions nutritives.
Aprs un ensemencement par une souche de levure rsistant l'alcool, la
fermentation est suivie par pese de la quantit de dioxyde de carbone dgage.
La vitesse de fermentation est compare, d'une part celle d'un vin naturel
authentique, de composition aussi voisine que possible de celle du vin analys,
d'autre part celle du vin analys dont le pH a t amen 6 (la plupart des
antiseptiques minraux et organiques sont sans action sur la fermentation ce
pH). Ces deux vins tmoins sont ensemencs dans les mmes conditions que le
vin analys.
1.3. Appareillage
Flacon de 90 ml obtur par un bouchon de caoutchouc perfor d'un trou, dans
lequel est engag un tube trs effil son extrmit suprieure.
1.4. Ractifs et milieux de culture
1.4.1.- Solution aqueuse d'thanal :
Solution prpare partir d'thanal obtenu par distillation de mtaldhyde ou
de paraldhyde, en prsence d'acide sulfurique et titre par la mthode au
sulfite de sodium. On ajuste le titre de la solution 6,9 g/1.
1 ml de cette solution fixe 10 mg de dioxyde de soufre.
1.4.2. Solutions nutritives :
- Sulfate d'ammonium, (NH4)2SO4 .......................................... 25 g/l
- Asparagine .......................................................................................... 20 g/l
Ces solutions sont conserver au rfrigrateur.
1.4.3. Milieux de culture :
- Milieu solide : malt glos.
Malt en poudre ................................................................................... 3 g
OIV-MA-AS4-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Glucose .................................................................................................. 10 g
Peptone pancratique ..................................................................... 5 g
Extrait de levure en poudre ......................................................... 3 g
Glose ..................................................................................................... 20 g
Eau q.s.p. ............................................................................................... 11
6
pH ..............................................................................................................
Striliser 20 min. 118 C.
Ce mlange existe sous forme de prparations commerciales.
- Milieu liquide (au choix) :
Rpartir du jus de raisin contenant 170 200 g/1 de sucres, en tubes
bouchs avec du coton, raison de 10 ml par tube; striliser au bain
d'eau 100 C pendant 15 min.
Malt liquide : mme milieu que le milieu solide, mais sans glose.
1.4.4. Culture et entretien de la souche de Saccharomyces bayanus et
prparation du levain. .
a) Culture et entretien de la souche sur milieu solide :
partir d'une souche de collection, ensemencer en stries les tubes de milieux
solides. Ces tubes sont mis incuber l'tuve 25 C jusqu' ce que la
culture soit bien apparente (3 jours environ); ces tubes peuvent tre
conservs au rfrigrateur. Il suffit de les repiquer tous les 6 mois.
b) Prparation du levain :
Un des tubes du milieu liquide est ensemenc selon les techniques microbiologiques partir de la souche cultive sur milieu solide; aprs croissance
(24 48 h), repiquer 2 fois conscutivement sur le mme milieu enrichi
10% vol. d'alcool, de faon accoutumer la souche.
La deuxime culture en pleine activit renferme environ 50 millions de
levures par millilitre. Cette culture servira ensemencer le vin tudi.
5
Effectuer une numration et ensemencer raison de 10 levures/ml.
1.5. Mode opratoire
- Prparation du vin :
100 ml de vin sont traits par la quantit ncessaire d'thanal calcule d'aprs la
teneur en dioxyde de soufre libre (44 mg d'aldhyde bloquent 64 mg de
dioxyde de soufre). Attendre 24 h et vrifier que le vin contient moins de
20 mg de dioxyde de soufre libre par litre.
Si le titre alcoomtrique est suprieur 10 % vol., le vin sera dilu avec des
solutions de glucose et de l'eau en quantit calcule de manire raliser une
teneur en sucres comprise entre 20 et 50 g/l et ramener le titre 10 % vol.
environ. Pour les vins titrant moins de 10 % vol., ajouter du glucose solide pour
ramener sans dilution la teneur en sucres entre ces valeurs, pour lesquelles la
vitesse de fermentation n'est pas modifie par la teneur en sucres.
- Test de fermentescibilit :

OIV-MA-AS4-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Dans le flacon de 90 ml, placer 60 ml de vin prpar comme ci-dessus, 2,4 ml


de solution de sulfate d'ammonium et 2,4 ml de solution d'asparagine. Ensemencer par 3 gouttes d'une culture de 3 jours de Saccharomyces bayanus, de
5
manire raliser une population initiale voisine de 10 levures/ml. Mettre en
place le bouchon avec son tube effil, peser 10 mg prs l'ensemble et le placer
dans une tuve 25 C.
Une pese est effectue quotidiennement pendant au moins 8 jours.
Oprer chaque fois paralllement, d'une part avec un vin de composition et
d'origine analogues dont on est sr qu'il n'a pas reu d'antiseptique, d'autre part
avec le vin essayer dont on a ajust le pH 6.
Un flacon de vin non ensemenc indique la perte par vaporation.
1.6. Interprtation
Dans la plupart des cas, la fermentation se dclare en 48 h et le dgagement
quotidien est maximum entre le 3me et le 5me jour.
On ne pourra affirmer la prsence d'un inhibiteur de fermentation que :
a) Si la fermentation ne se dclare pas ou est retarde d'au moins 2 jours par
rapport l'un des 2 tmoins. Il est difficile de se prononcer lorsque le retard
est lger, car il peut y voir des rsultats "faux positifs", certains vins naturels
se conduisant parfois comme s'ils contenaient des traces d'inhibiteurs (en
particulier les vins liquoreux issus de raisins atteints de pourriture noble).
b) Si le dgagement maximum quotidien n'a pas eu lieu entre le 3me et le 5me,
mais aprs le 7me jour, ce dgagement doit tre suprieur ou gal 50 mg
pour 60 ml de vin.
c) Le trac de la courbe de fermentation et celui de la courbe de dgagement
quotidien de C02 en fonction du temps peuvent faciliter l'interprtation dans
les cas difficiles.

OIV-MA-AS4-02A : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Mthode OIV-MA-AS4-02B

Mthode Type IV

Recherche des antiseptiques et des inhibiteurs de


fermentation
(Mthode A 35 modifie par la rsolution Oeno 6/2006)
1. Recherche des acides sorbique, benzoque, p-chlorobenzoque, salicylique,
p-hydroxybenzoque et ses esters
1. 1. Chromatographie sur couche mince
1.1.1. Principe
Ces antiseptiques sont extrait par l'ther du vin acidifi au pralable. Aprs
sparation par chromatographie sur couche mince de poudre de polyamide, ils
sont localiss et caractriss par un examen du chromatogramme sous
rayonnement ultraviolet.
1.1.2. Appareillage
- Dispositif pour l'talement en couche mince.
- Plaques de verre 20 X 20 cm.
Prparation des plaques - Mlanger intimement sec 12 g de poudre de
polyamide avec 0,3 g d'indicateur fluorescent; ajouter en agitant 60 ml de
mthanol; taler sur plaques sur une paisseur de 0,3 mm. Scher la
temprature ordinaire.
Remarque : Des plaques prtes l'emploi commercialises peuvent tre utilises.
1.1.3. Ractifs
- ther dithylique.
- Mthanol.
- Alcool 96% vol.
- Acide sulfurique dilu 20 p. 100 (v/v).
- Sulfate de sodium anhydre.
- Poudre de polyamide pour chromatographie (par exemple, Macherey-Nagel
ou Merck).
- Indicateur fluorescent (F254 Merck ou quivalent).
- Solvants :
Pentane ...................................................................................................... 10 vol.
Hexane ................................................................................................... 10 vol.
Acide actique glacial ....................................................................... 3 vol.
- Solutions talons :
Prparer des solutions 0,1 g pour 100 ml d'alcool 96% vol. avec les
acides sorbique, p-chlorobenzoque, salicylique, p-hydroxybenzoque et
ses esters.
OIV-MA-AS4-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Prparer une solution 0,2 g pour 100 ml d'alcool 96% vol. avec l'acide
benzoque.

1.1.4. Mode opratoire


Placer 50 ml de vin dans une ampoule dcanter; acidifier par l'acide
sulfurique dilu 20 p.100 et extraire 3 reprises par 20 ml d'ther dithylique
chaque fois. Runir les solutions thres dans une ampoule dcanter et les
laver avec quelques millilitres d'eau distille. Scher ensuite cet ther avec du
sulfate de sodium anhydre. Evaporer l'ther sec, soit sur un bain d'eau
100 C, soit dans un vaporateur rotatif. Si l'vaporation est effectue sur un
bain d'eau, il est avantageux d'activer l'vaporation par un courant d'air modr
jusqu'aux 2 ou 3 derniers millilitres et de terminer l'vaporation froid.
Dissoudre le rsidu dans 1 ml d'thanol, dposer 3 5 1 de cette solution sur
la plaque de polyamide, ainsi que 3 5 l des solutions alcooliques talons des
divers conservateurs. Introduire la plaque dans une cuve chromatographie,
sature des vapeurs du solvant. Laisser migrer le solvant sur une hauteur de
15 cm environ, ce qui demande 1 h 30 2 h 30.
Retirer la plaque de la cuve et la laisser scher la temprature ordinaire.
Examiner ensuite en lumire ultraviolette, la longueur d'onde 254 nm. Les
conservateurs apparaissent de bas en haut de la plaque dans l'ordre suivant :
acide p-hydroxybenzoque, esters de l'acide p-hydroxybenzoque, acide
salicylique, acide p-chlorobenzoque, acide benzoque, acide sorbique.
l'exception de l'acide salicylique qui prsente une fluorescence bleu clair, les
autres conservateurs donnent des spots foncs sur fond jaune-vert fluorescent.
Sensibilit - Cette technique permet de dceler les quantits suivantes des
divers conservateurs exprimes en milligrammes par litre :
Acide salicylique ........................................................................................
3
Acide sorbique .............................................................................................
5
5
Esters de l'acide p-hydroxybenzoque ............................................
Acide p-hydroxybenzoque .................................................................. 5-10
Acide p-chlorobenzoque ....................................................................... 5-10
Acide benzoque .......................................................................................... 20
1.2. Chromatographie liquide haute performance
1.2.1. Mode opratoire
Le dosage s'effectue directement sur le vin, sans prparation d'chantillon.
Il faut cependant diluer les vins rouges avant de les injecter afin de mnager la
colonne.
D'aprs cette mthode, le seuil de dtection de chaque antiseptique dans la
solution soumise au dosage est d'environ 1 mg/l.
1.2.2. Conditions opratoires

OIV-MA-AS4-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Les conditions qui se sont rvles tre les plus avantageuses sont les
suivantes :
A. Pour le dosage des acides sorbique et benzoque
Procder selon la mthode de dosage des acides sorbique, benzoque,
salicylique dans les vins par chromatographie liquide haute performance
(AS313-20-SOBESA) figurant au Recueil
B. Pour le dosage de l'acide p-chlorobenzoque, de l'acide p-hydroxybenzoque
et ses esters
Colonne : voir A
Phase mobile :
Solution 0,01 M d'actate d'ammonium-mthanol (40:60)
pH : 4,5-4,6
Dbit : voir A
Volume inject : voir A
Dtecteur : UV, 254 nm
Temprature : voir A

BIBLIOGRAPHIE
JUNGE Ch., Zeits. Unters. Lebensmit., 1967, 133, 319

OIV-MA-AS4-02B : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Mthode OIV-MA-AS4-02C

Mthode Type IV

Recherche des antiseptiques et des inhibiteurs de


fermentation
(Mthode A 35 modifie par la rsolution Oeno 6/2006)

1. Recherche des drivs monohalogns de l'acide actique


1.1. Principe
Les drivs monohalogns de l'acide actique sont extraits par l'ther du vin
acidifi. On soumet ensuite cet ther une extraction au moyen d'une solution
0,5 M d'hydroxyde de sodium. La solution d'extraction dont l'alcalinit doit tre
maintenue entre 0,4 et 0,6 M, est additionne d'acide thiosalicylique, la
synthse du thioindigo se ralise en passant par les tapes suivantes :
a) Condensation du driv monohalogn avec l'acide thiosalicylique et
formation de l'acide phnylthioglycolique orthocarboxyl;
b) cyclisation de l'acide form en milieu alcalin chaud, avec formation de
thioindoxyle;
c) Oxydation du thioindoxyle par l'hexacyanoferrate III de potassium en milieu
alcalin avec formation de thioindigo, soluble dans le chloroforme qu'il
colore en rouge.
1.2. Appareillage
Bain d'eau 100 C.
Agitateur mcanique.
tuve permettant d'obtenir une temprature de 200 2 C.
1.3. Ractifs
ther dithylique.
1
Solution d'acide chlorhydrique dilu au /3 (v/v). Mlanger une partie d'acide
chlorhydrique pur, 20 = 1,19 g/ml, avec 2 parties d'eau distille.
Sulfate de sodium anhydre.
Solution d'acide thiosalicylique :
Acide thiosalicylique ...................................................................................
3g
Solution d'hydroxyde de sodium 1,5 M q.s.p. ............................... 100 ml
Solution d'hydroxyde de sodium : 0,5 M.
Solution d'hexacyanoferrate III de potassium contenant 2 g de K3Fe(CN)6
pour 100 ml d'eau.
Chloroforme.

OIV-MA-AS4-02C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

1.4. Mode opratoire


Placer dans une fiole d'extraction bouche l'meri 100 ml de vin analyser;
ajouter 2 ml d'acide chlorhydrique dilu au 1/3 et 100 ml d'ther. Agiter
nergiquement le contenu pendant quelques secondes la main, puis pendant
1 h avec un agitateur mcanique. Transvaser dans une ampoule dcanter et
recueillir la couche thre aprs avoir laiss dcanter et avoir limin la
couche infrieure.
Agiter l'extrait thr avec 8 10 g de sulfate de sodium anhydre pendant
quelques secondes.
Transvaser cet extrait dans une ampoule dcanter, ajouter 10 ml de la solution
0,5 M d'hydroxyde de sodium; agiter pendant 1 min. Laisser reposer.
Prlever 0,5 ml de l'extrait alcalin et vrifier, par titration au moyen d'acide
sulfurique 0,05 M, que son titre est bien compris entre 0,4 et 0,6 M. Recevoir
l'extrait alcalin contenu dans l'ampoule dcanter dans un tube essai, dans
lequel on a plac 1 ml de solution d'acide thiosalicylique Ajuster, si ncessaire,
le titre de l'extrait alcalin pour qu'il soit compris dans les limites indiques, au
moyen d'une solution d'hydroxyde de sodium de titre plus lev et connu
exactement. Agiter le contenu du tube essai pendant 30 s et le transvaser dans
une capsule de porcelaine.
Placer la capsule sur un bain d'eau 100 C en projetant sa surface un courant
d'air froid. Maintenir la capsule sur le bain d'eau 100 C pendant 1 h, dure
qui devra tre respecte, mme si l'on arrivait en un temps plus court un
rsidu pratiquement sec. S'il se formait au cours de l'vaporation une crote la
surface du rsidu, il convient de la rompre en la triturant avec une fine baguette
de verre pour faciliter l'vaporation.
Placer ensuite la capsule dans une tuve maintenue 200 2 C pendant
30 min. exactement. Aprs refroidissement, reprendre le contenu de la capsule
par 4 ml d'eau; transvaser dans un tube sparateur robinet placer dans la
capsule 3 ml de la solution d'hexacyanoferrate III de potassium pour finir de
dissoudre le rsidu qui pourrait y adhrer et le placer ensuite dans le tube
sparateur. Agiter pendant 30 s pour favoriser l'oxydation. Ajouter 5 ml de
chloroforme, agiter par 3 4 retournements Laisser dcanter.
Une coloration rose ou rouge (selon la quantit de thioindigo form) indique la
prsence de driv monohalogn de l'acide actique.
Sensibilit - La mthode permet de dceler 1,5 2 mg d'acide monochloractique par litre de vin et les quantits correspondantes des autres driv
monohalogns. Mais le rendement des diverses extractions n'tant pas
quantitatif, cette mthode ne peut tre utilise pour le dosage de ces drivs
monohalogns dans les vins.

OIV-MA-AS4-02C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

BIBLIOGRAPHIE
FRIEDLANDER, Ber. Deutsch. Chem. Gesell., 1906, 39, 1062.
RAMSEY L.L., PATTERSON W.I., J. Ass. Off. Agr. Chem., 1951, 34, 827.
PERONNET M., ROCQUES S., Ann. Fais. Fraudes, 1953, 21-23.
Trait de chimie organique, publi sous la direction de V. GRIGNARD, 1942, 19,
565566.
Official Methods of Analysis of the Association of Official Analytical Chemists
11e dition, publie par l'Association of Official Analytical Chemists, Washington
1970, 340-341.
TERCERO C., F. V. O.I.V., 1967, n 224.

OIV-MA-AS4-02C : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Mthode OIV-MA-AS4-02D

Mthode Type IV

Recherche des antiseptiques et des inhibiteurs de


fermentation
(Mthode A 35 modifie par la rsolution Oeno 6/2006)

1. Recherche et dosage du pyrocarbonate d'thyle


1.1. Principe
Le carbonate dithylique form par la dgradation du pyrocarbonate d'thyle
(ester dithylique de l'acide pyrocarbonique) en prsence d'thanol est extrait
du vin par le sulfure de carbone et dos par chromatographie en phase gazeuse.
L'un ou l'autre des modes opratoires dcrits ci-dessous peut tre utilis.
1.2. Appareillage
1.2.1. Chromatographe en phase gazeuse avec dtecteur ionisation de
flamme.
1.2.2. Colonnes :
Colonne capillaire garnie de Carbowax 1540
Longueur de la colonne : 50 pieds (15,24 m)
Diamtre intrieur : 0,02 pouce (0,51 mm)
Polypropylneglycol sur Celite 545 (15:100), 60-100 mesh
Longueur de la colonne : 2 m
Diamtre intrieur : 3 mm
1.3. Ractifs
Sulfate de sodium anhydre
Sulfure de carbone
Le sulfure de carbone ne devra pas prsenter d'impurets dans la zone de rtention critique (de 5 7 min.) pour une sensibilit maximale dans les conditions
de chromatographie en phase gazeuse indiques dans le paragraphe 1.4.2.
1.4. Mode opratoire
1.4.1. Utilisation de la colonne capillaire.
Introduire 100 ml de vin dans une ampoule dcanter de 250 ml de capacit
avec 1 ml de sulfure de carbone. Agiter vigoureusement pendant 1 min.
La phase sulfure de carbone spare est centrifuge fortement, puis sche au
moyen de sulfate de sodium anhydre.
OIV-MA-AS4-02D : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Injecter 10 l du liquide limpide surnageant dans le chromatographe.


Conditions de la chromatographie :
Gaz d'alimentation du dtecteur :
hydrogne : 37 ml/min.
air : 250 ml/min.
Gaz vecteur : azote :
40 ml/min.
Un systme de division dans un rapport voisin de 1/10 envoie dans le dtecteur
le mlange gazeux avec un dbit de 3 5 ml/min.
Temprature :
injecteur : 150 C, four : 80 C, dtecteur : 150 C,
Limite de dtection :
0,05 mg/1 de vin.
1.4.2. Utilisation de la colonne au polypropylneglycol.
Introduire 20 ml de vin et 1 ml de sulfure de carbone dans un tube centrifuger
fond conique et pouvant tre bouch. Agiter vigoureusement pendant 5 min.,
puis centrifuger pendant 5 min. en appliquant une force centrifuge de 1000
1200 g. Le liquide surnageant est prudemment aspir au moyen d'une pipette
pointe effile; la phase sulfure de carbone est sche par une faible quantit de
sulfate de sodium anhydre, ajoute en agitant avec une baguette de verre.
Injecter 1 l du liquide limpide dans le chromatographe en phase gazeuse.
Conditions de la chromatographie.
Gaz d'alimentation du dtecteur :
hydrogne : 35 ml/min.
air : 275 ml/min.
Gaz vecteur : azote :
25 ml/min.
Temprature :
injecteur : 240 C
four : 100 C
dtecteur : 240 C
Domaine de sensibilit :
12 x 10-11 A 3 X 10-11 A
Vitesse de droulement du papier enregistreur :
1 cm/min.
Limite de dtection :
0,10-0,05 mg/1 de vin
En observant exactement ces conditions, le carbonate dithylique prsente un
temps de rtention voisin de 6 min.

OIV-MA-AS4-02D : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

L'talonnage de l'appareil est effectu au moyen de solutions 0,01 et 0,05 p.


100 (m/v) de carbonate dithylique dans le sulfure de carbone.
1.5. Calculs
La dtermination quantitative du carbonate dithylique est effectue de
prfrence par la mthode de l'talon interne, en se rfrant aux pics de l'alcool
isobutylique ou de l'alcool isoamylique qui sont voisins de celui du carbonate
dithylique.
Pour ce faire, prparer deux chantillons du vin analyser : l'un tant le vin
additionn de 10 ml d'alcool 10 % vol., l'autre le mme vin additionn de
1 mg de carbonate dithylique par litre au moyen de 10 -ml d'une solution de
carbonate dithylique 100 mg/l dans l'alcool 10 % vol.
Traiter ces deux chantillons selon l'une ou l'autre des techniques ci-dessus en
fonction de la colonne utilise.
Soit :
S = la surface du pic du carbonate dithylique correspondant au vin sur
charg de 1 mg de carbonate dithylique par litre.
Sx = la surface du pic correspondant au vin,
I = la surface du pic de l'talon interne dans le vin,
1 = la surface du pic de l'talon interne dans le vin surcharg.
La concentration du carbonate dithylique en mg/1 de vin est :

S
S x i S
I
Dans le cas o l'on effectue l'talonnage au moyen d'une solution talon pure de
carbonate dithylique, il est ncessaire de dterminer au pralable le rendement
de l'extraction par le sulfure de carbone dans les conditions opratoires
utilises. Ce rendement est exprim par le facteur d'extraction F, sous forme
d'un nombre dcimal infrieur ou gal 1 (rendement 100%).
Soit :
Sx = la surface du pic de carbonate dithylique donn par le vin,
Se = la surface du pic donn par l'injection d'un mme volume de
solution talon de carbonate dithylique de concentration C en mg/1,
Vx = le volume de vin soumis l'extraction par le sulfure de carbone,
Vs = le volume de sulfure de carbone utilis pour l'extraction,
Ex = la sensibilit pour l'enregistrement de Sx,
Ee = la sensibilit pour l'enregistrement de Se.

OIV-MA-AS4-02D : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

La concentration du carbonate dithylique en mg/1 de vin est :


C x S x E x Vs
Se x Ee x F x V
Si les concentrations des deux solutions injectes dans le chromatographe sont
voisines, la sensibilit est la mme pour l'enregistrement de Sx et de Se, la
formule se simplifie et devient :
C x S x Vs
Se x F x V

BIBLIOGRAPHIE
KIELHOFER E., WURDIG G., Dtsch. Lebensmit. Rdsch. . 1963, 59, 197-200 et 224-228.
PRILLINGER F., Weinberg u. Keller, 1967, 14, 5-15.
REINHARD C., Dtsch. Lebensmit. Rdsch., 1967, 5, 151-153.
BANDION F., Mitt. Klosterneuburg, Rebe und. Wein, 1969, 19, 37-39.

OIV-MA-AS4-02D : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Mthode OIV-MA-AS4-02E

Mthode Type IV

Recherche des antiseptiques et des inhibiteurs de


fermentation
(Mthode A 35 modifie par la rsolution Oeno 6/2006)

1. Recherche de l'acide dhydroactique


1.1. Principe
Le vin acidifi par l'acide sulfurique est trait par un mlange parties gales
d'ther dithylique et d'ther de ptrole. Aprs vaporation du solvant, l'extrait,
repris par une petite quantit d'thanol 96% vol., est dpos sur une couche
mince de polyamide et de gel de silice avec indicateur de fluorescence et
soumis l'action du solvant mobile benzne-actone-acide actique. L'acide
dhydroactique est localis et caractris par un examen en ultraviolet du
chromatogramme.
1.2. Appareillage
Dispositif pour chromatographie en couche mince.
tuve.
vaporateur rotatif.
Lampe U.V. 254 nm.

1.3. Ractifs
ther dithylique.
ther de ptrole (point d'bullition 40 C). - Mthanol.
Acide sulfurique 20 p. 100 (v/v). - Sulfate de sodium anhydre.
thanol 96% vol.
Couche de sparation chromatographique : 10 g de poudre de polyamide avec
indicateur de fluorescence (par exemple polyamide DC II UV254 de
Macherey-Nagel) sont agits fortement avec 60 ml de mthanol. Ajouter, en
continuant l'agitation, 10 ml d'eau et 10 g de gel de silice G avec indicateur
fluorescent (par exemple Kiesselgel GF254 de Merck).
taler ce mlange sur 5 plaques (200 x 200 mm) sur une paisseur de 0,25 mm.
Scher les plaques temprature ambiante pendant 30 min. puis l'tuve
70 C pendant 10 min.
Solvant de migration :
Benzne cristallisable ............................................................................................. 60 vol.
Actone ........................................................................................................................... 3 vol.
Acide actique cristallisable ............................................................................... 3 vol.
OIV-MA-AS4-02E : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Solutions tmoins
Solutions alcooliques d'acide dhydroactique et d'acide benzoque 0,2 p.
100.
Solutions alcooliques d'acide sorbique, d'acide p-chlorobenzoque, d'acide
salicylique, d'acide p-hydroxybenzoque et de ses esters propylique, mthylique
et thylique 0, 1 p. 100 (m/v).
1.4. Mode opratoire
Acidifier 100 ml de vin par 10 ml d'acide sulfurique dilu 20 p. 100, puis
procder 3 fois l'extraction avec chaque fois 50 ml d'un mlange ther
diethylique-ther de ptrole (1:1, v/v). Les mulsions peuvent tre habituellement limines en laissant s'couler la partie limpide de la phase aqueuse.
Agiter nouveau le liquide restant dans l'ampoule dcantation compos d'une
mulsion et de la phase thre. -La phase aqueuse rsiduelle se spare dans la
plupart des cas d'une faon nette de la phase ther. S'il demeurait encore un peu
d'mulsion, celle-ci serait limine par addition de quelques gouttes d'thanol.
Les phases ther dithylique-ther de ptrole runies sont laves au moyen de
50 ml d'eau, dessches par le sulfate de sodium, puis vapores dans un
vaporateur rotatif 30-35 C. Le rsidu est repris par 1 ml d'thanol.
Dposer 20 l de cette solution sur la ligne de dpart sous forme d'un trait de
2 cm de largeur, ou 10 l sous forme d'une tache circulaire. A titre de comparaison, dposer 5 l de chacune des solutions tmoins indiques ci-dessus.
Aprs la chromatographie (ascendante, hauteur de migration 15 cm, dure
1 h 15 min. 1 h 45 min., saturation normale de la chambre), la plaque est
sche temprature ambiante. L'acide dhydroactique et les autres conservateurs ventuellement prsents sont localiss sous la lampe U.V. 254 nm.
Lorsque l'examen du chromatogramme a rvl la prsence d'acide
pchlorobenzoque, des esters propylique ou mthylique de l'acide
phydroxybenzoque qui ne sont spars qu'en partie par cette mthode leur
identification peut s'oprer, en partant de l'extrait ci-dessus, suivant la mthode
dcrite dans ce chapitre, en 2 Recherche des acides sorbique, benzoque,
parachlorobenzoque . . . , 2. 1. Chromatographe sur couche mince.

BIBLIOGRAPHIE
HALLER H.E., JUNGE Ch., F.V. O.LV., 1972, n* 397, Mitt. BI. der Gd CH, Fachgruppe, Lebensmitt. u. gerichtl. Chem., 1971, 25, n 5, 164-166.

OIV-MA-AS4-02E : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Mthode OIV-MA-AS4-02F

Mthode Type IV

Recherche des antiseptiques et des inhibiteurs de


fermentation
(Mthode A 35 modifie par la rsolution Oeno 6/2006)

1. Azothydrate de sodium
1. 1. Mthode par chromatographie liquide haute performance
1.1.1. Principe
L'acide azothydrique isol du vin grce une double distillation est dcel
aprs une drivation avec le chlorure de 3,5-dinitrobenzoyle, par chromatographie en phase liquide haute performance. La dtection est effectue au
spectrophotomtre d'absorption dans l'ultraviolet 240 nm.
1.1.2. Appareillage
1.1.2.1. Appareil distiller (appareil de distillation pour la dtermination du
titre alcoomtrique volumique); l'extrmit du rfrigrant se termine par un
tube effil.
1.1.2.2. Ballons col rod de 500 ml.
1.1.2.3. Flacon de 10 ml bouchant l'meri.
1.1.2.4. Appareil pour HPLC.
Conditions opratoires :
Colonne : C18, 25 cm de long.
Phase mobile : actonitrile-eau (50 :50)
Dbit : 1 ml/min.
Volume inject : 20 l
Dtecteur : spectrophotomtre d'absorption dans l'ultraviolet 240 nm
Temprature : ambiante
1.1.3. Ractifs
1.1.3.1. Hydroxyde de sodium en solution 5 p. 100 (m/v).
1.1.3.2. Acide sulfurique en solution 10 p. 100 (m/v).
1.1.3.3. Ractif indicateur : rouge de mthyle 100 mg, bleu de mthylne 50 mg,
alcool 50% vol. 100 ml.
1.1.3.4. Actonitrile pour la chromatographie.
1.1.3.5. Ractif pour la drivation : solution de chlorure de 3,5-dinitrobenzoyle
10 p.100 (m/v) dans l'actonitrile.

OIV-MA-AS4-02F : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

1.1.3.6. Solution-tampon d'actate de sodium, pH 4,7 : mlanger un volume de


solution d'actate de sodium (NaC2H3O2.3H2O) 1 M avec un volume de
solution d'acide actique 1 M,.
1.1.3.7. Azothydrate de sodium, NaN3.
1.1.4. Mode opratoire
1.1.4.1. Prparation de l'chantillon.
Dans un ballon col rod, placer 100 ml de vin, distiller en plongeant
l'extrmit du rfrigrant dans 10 ml d'une solution d'hydroxyde de sodium 5
p. 100 additionne de quelques gouttes du ractif indicateur. Distiller jusqu'
recueillir 40-50 ml de distillat.
Transvaser le distillat dans un autre ballon col rod en rinant la fiole avec
deux fois 20 ml d'eau et ajouter de l'eau pour atteindre, le volume de dpart
(100 ml). Pour chasser l'thanol, fixer le ballon l'appareil distiller et
liminer environ 50 ml de distillat (rduction du volume au demi).
Refroidir compltement le ballon. Acidifier par de l'acide sulfurique 10 p.
100. Distiller, recueillir le distillat dans un flacon de 10 ml bouchant l'meri,
contenant 1 ml d'eau et immerg dans un bain glac. Arrter la distillation
lorsque le volume total est de 10 ml.
1.1.4.2. Drivation
Mlanger 1 ml du distillat + 0,5 ml d'actonitrile + 0,2 ml de la solution tampon
+ 30 l de ractif pour la drivation et agiter vigoureusement; attendre cinq
minutes.
1.1.4.3. Chromatographie
Injecter 20 l dans les conditions adoptes, le driv de l'acide azothydrique a
un temps de rtention voisin de 11 minutes.
Limite de dtection : 0,01 mg/l
Remarque : Parfois, une autre substance non drive peut simuler l'acide
azothydrique. C'est pourquoi il faut vrifier un rsultat positif comme suit : on
injecte 20 l de distillat directement; une disparition du pic indique la prsence
d'acide azothydrique.
1.1.5. Calcul
Pour connatre la concentration de l'azothydrate de sodium, se rfrer la
rponse donne par une solution talon aprs drivation. Tenir compte de la
concentration d'un facteur 10 de l'chantillon de vin lors de l'analyse.

OIV-MA-AS4-02F : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

1.2. Mthode colorimtrique


1.2.1. Principe
L'acide azothydrique, trs volatil, est spar par double distillation, condition
permettant l'limination de l'thanol, de l'acide actique et du dioxyde de
soufre, puis dos colorimtriquement aprs formation d'un complexe color
avec le chlorure de fer III (absorbance maximum 465 nm).
1.2.2. Appareillage
1.2.2.1. Appareil distiller simple, compos d'un ballon de 500 ml col rod et
d'un rfrigrant termin par un tube effil.
1.2.2.2. Spectrophotomtre et cuves de verre de 1 cm de trajet optique.
1.2.3. Ractifs
1.2.3.1. Hydroxyde de sodium en solution M.
1.2.3.2. Acide sulfurique M.
1.2.3.3. Peroxyde d'hydrogne 3 p.100 en vol.; son titre doit tre contrl
extemporanment par une solution 0,02 M de permanganate de potassium; soit
p ml le volume qui oxyde 1 ml de la solution de peroxyde d'hydrogne 3
p.100.
1.2.3.4. Solution de fer III 20 g par litre en Fe III : (peser 96,6 g de
FeC13.6H2O, ou davantage car ce sel est trs hygroscopique, contrler la teneur
en Fe III de la solution et l'ajuster si ncessaire 20 g par litre 0,5 g).
1.2.3.5. Solution mre d'azothydrate de sodium (NaN3) 1 g par litre dans l'eau
distille.
1.2.3.6. Solution d'azothydrate de sodium 200 mg par litre prpare
extemporanment par dilution de la solution 1 g par litre.
1.2.4. Mode opratoire
a) Dans un ballon de 500 ml col rod, placer 200 ml de vin, distiller, recueillir
le distillat dans une fiole jauge de 50 ml contenant 5 ml d'eau et immerge
dans un bain glac. Arrter la distillation lorsque le volume total est de 50 ml
environ.
b) Transvaser quantitativement le distillat dans un autre ballon rod de 500 ml
en rinant la fiole de 50 ml avec 2 fois 20 ml d'eau.
Neutraliser au moyen de la solution d'hydroxyde de sodium M (utiliser un
papier indicateur de pH).
OIV-MA-AS4-02F : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Recherche des antiseptiques et des inhibiteurs de fermentation

Acidifier par 10 ml d'acide sulfurique M, agiter, puis oxyder le dioxyde de


soufre par addition de solution de peroxyde d'hydrogne 3 p. 100.
Si le vin contient S mg par litre de dioxyde de soufre, et si p ml est le volume
de solution de permanganate de potassium 0,02 M ncessaire pour oxyder 1
ml de solution de peroxyde d'hydrogne 3 p. 100, il faut utiliser pour 200
ml de vin :

S
S ml de solution H2O2
5 x 3,2p 16p
Complter le volume 200 ml environ par addition d'eau distille.
Distiller, recueillir le distillat dans une fiole jauge de 50 ml contenant 5 ml
d'eau distille et immerge dans un bain glac; arrter la distillation juste
avant le trait de jauge, ramener la temprature ambiante et ajuster le
volume 50 ml.
c) Ajouter 0,5 ml (exactement mesur) de solution de chlorure ferrique,
homogniser et mesurer aussitt (dlai maximum 5 min.) l'absorbance
465 nm dans une cuve de 1 cm de trajet optique, le zro de l'appareil tant
rgl sur un essai blanc constitu par 50 ml d'eau additionne de 0,5 ml de
solution de chlorure ferrique.
d) tablissement de la courbe talon.
Dans des fioles jauges de 50 ml introduire 1, 2, 3, 4, 5 ml de solution
d'azothydrate de sodium 200 mg par litre, complter le volume 50 mi par
de l'eau distille, ajouter 0,5 ml de solution de chlorure de fer III et mesurer
les absorbances 465 nm.
Ces solutions contiennent 4, 8, 12, 16, 20 mg d'azothydrate de sodium par
litre. Les teneurs correspondantes par litre de vin sont : 1, 2, 3, 4, 5 mg.
La courbe reprsentative de la variation des absorbances en fonction des
concentrations est une droite passant par l'origine.
1.2.5. Calcul
Reporter l'absorbance lue pour l'chantillon analyser sur la droite d'talonnage et relever la teneur en azothydrate de sodium en mg/1 de vin.

BIBLIOGRAPHIE
Mthode par HPLC :
SWARIN S.J. et WALDO R.A., J. Liquid. Chrom., 1982, 5 (4), 597-604.
BATTAGLIA R. et MITISKA J., Z. Lebensm. Unters. Forsch., 1986, 182, 501-502.
Mthode colorimtrique :
CLERMONT S. et CHRTIEN D., F. V. 0. L V., 1977, n 627.

OIV-MA-AS4-02F : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

Mthode OIV-MA-AS4-03

Mthode Type IV

Numration des Levures de lespce Brettanomyces


bruxellenis par Qpcr
Rsolution OIV-Oeno 414-2011

Avertissement aux utilisateurs :


Phnol : Toutes les tapes de manipulation o le phnol est prsent doivent tre
ralises sous la hotte avec des gants. Les rsidus contamins au phnol sont
rcuprs dans les containers appropris.
SYBR Green : il prsente une mutagenicit non nulle mais cependant trs
infrieure au Bromure dthydium. Les prcautions d'usage doivent tre nanmoins
conserves.

1. Domaine dapplication
Ce protocole dcrit une mthode de dnombrement des levures de lespce
Brettanomyces bruxellensis dans les vins en cuve ou embouteills, par PCR
(Polymrase chain reaction) quantitative en temps rel (qPCR). Lanalyse des vins
en cours de FA (Fermentation alcoolique) et des mots nest pas valide ce jour.
2. Dfinition
Les microorganismes dnombrs par cette mthode sont les levures Brettanomyces
bruxellensis qui disposent dune copie du gne cible.
3. Principe
Le principe consiste amplifier, par une raction enzymatique rpte, une rgion
dADN (Acide dsoxyribonuclique) cible balise par deux amorces. Le procd
ncessite la succession de nombreux cycles avec trois tapes :
- La dnaturation de lADN par chauffage
- Lhybridation des amorces
- La polymrisation ralise par la Taq (Thermophilus aquaticus)
polymrase
Cependant, contrairement la PCR classique, la qPCR permet de quantifier lADN
amplifi au cours de lamplification grce lutilisation dun fluorophore.

OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

Jusquici deux rgions se rvlant spcifiques de lespce ont t utilises


comme cibles. Il sagit du gne codant pour lARN (Acide ribonuclique)
ribosomal 26S et du gne RAD4 [2, 3]. Comme pour la mthode FISH, il sagit
donc dune technique spcifique de Brettanomyces bruxellensis mais qui prsente
lavantage dtre moins coteuse.
La particularit de la qPCR rside dans la lecture, chaque cycle
damplification, de la fluorescence qui augmente de faon exponentielle au fur et
mesure que lADN est amplifi. De nombreuses technologies de fluorescence ont
t dveloppes pour cette application. Dans le cas prsent, il sagira dutiliser le
fluorophore SYBR Green.
Fluorophore SYBR Green
Cet agent fluoresce fortement en sintercalant de faon non spcifique entre les
nuclotides au niveau de lADN double brin. En revanche ltat libre il ne
prsente quune faible fluorescence. Grce cette technologie, une courbe de
fusion peut tre gnre la fin de lamplification afin de sassurer de la spcificit
de la raction .
Contrle interne
Afin de valider les tapes dextraction et damplification de lADN, un contrle
interne a t intgr la mthode ((Lip4) Yarrowia lipolytica).
4. Ractifs et produits
Tous les consommables plastiques doivent tre autoclavs au pralable afin de
dtruire les DNAses (dsoxyribonuclases), ainsi que les solutions de tampon TrisHCl, TE (Tris EDTA, acide thylne diamine ttra actique), lactate
dammonium et leau ultrapure (18 M). Toutes les solutions aqueuses sont
prpares dans leau ultrapure (18 M). Certaines solutions sont strilises
lautoclave (indiqu par "autoclav"). Pour les solutions qui ne sont pas
autoclaves, on utilise si possible de leau ultrapure (18 M) strile pour leur
prparation. Il nest pas ncessaire ensuite de travailler en conditions de strilit.

PVPP (par exemple : ISP Polyclar Super R ou Sigma P6755-100G),


solutions temprature ambiante : tampon Tris-HCl 10mM pH8,
solution I (Tris-HCl 10 mM pH8, EDTA 1 mM, NaCl 100mM, SDS 1%
(Sodium dodcyl sulfate), Triton X-100 2%), TE (Tris-HCl 10 mM pH8,
EDTA 1 mM) autoclav, actate dammonium 4M, thanol absolu,
prvoir un flacon deau ultrapure (18 M) strilise (20mL) autoclav
chaque plaque qPCR,

OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

solutions 4C : phnol satur pH8:chloroforme :IAA (alcool


isoamylique : 24 :25 :1) et RNase (Ribonuclase) 1g/L
suspension 20C : contrle interne, SYBR Green (par exemple mix iQ
SYBR Green supermix, Bio-Rad 170-8884), amorces 4M Brett rad3,
Brett rad4, YAL-F et YAL-R chacune.
bain-sec 37C.

Toutes les tapes de manipulation o le phnol est prsent doivent tre


ralises sous la hotte avec des gants. Les rsidus contamins au phnol
sont rcuprs dans les containers appropris.

Produits Chimiques PCR


Spcifications
4.1. actate dammonium
98%

Numro CAS
631-61-8

4.2.
phnol:chloroforme:IAA
24:25:1

136112-00-0
Ultra

4.3. protinase K

1215U/mg protines 39450-01-6


(16,6 ng/mL)

4.4. SDS

99% Ultra

151-21-3

4.5. Tris base

99,8% Ultra

77-86-1

4.6. BSA

Molecular
grade

biology 9048-46-8

4.7. phnol satur pH 8

108-95-2

4.8. PVPP 360kDa

9003-39-8

4.9. RNase A

70U/mg en solution

9001-99-4
Tris : 77-86-1

4.10. TE pH8
4.11. amorces 25nmol

OIV-MA-AS4-03 : R2011

Ultra

EDTA : 60-00-4
-

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

5. Appareillage

Consommables plastiques : microtubes vis 2mL, microtubes 1,5 et


1,7mL, embouts de pipettes blancs (10 L), jaunes (200 L) et bleus (1000
L) pour micropipettes P20, P200, P1000, P5000, microplaques PCR 96
puits et film optique, gants non poudrs
Billes de verre ( 500m),
Flacon (20mL) autoclav (pour eau ultrapure [18 M] strilise chaque
plaque qPCR),
Tubes centrifuger 15 et 50 mL.
Matriel :
pipettes automatiques (P20, P200, P1000, P5000)
centrifugeuse microtubes
agitateur automatique pour casser les cellules (par exemple
GnieDisruptor)
Thermocycleur coupl un spectrofluorimtre (systme optique de
dtection de la fluorescence gnre lors des ractions de PCR en temps
rel)
Agitateur magntique
Chronomtre
bain-sec 37C
autoclave
Fioles jauges 100 mL
Fioles jauges 50 mL
Fioles jauges 10 mL
Bchers 100 mL
Bchers 50 mL
Bchers 10 mL
Barreaux aimants

6. Echantillonnage (Prparation de lchantillon)


6.1 Dnombrement chantillons :
Les chantillons sont prlevs soit directement dans les bouteilles analyser, soit
dans des flacons de prlvements au pralable striliss
Aucune interfrence de la mthode na t observe avec les levures testes (dont
K1 et L2056) lorsque les populations de levures sont infrieures ou gales
OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

5.106UFC/mL (Units formant colonies). Pas de donnes au del, donc viter les
mesures sur vins en cours de FA.
NB : Lorsque le dnombrement des levures est ralis par des mthodes danalyse
relevant de la microbiologie classique (croissance sur milieu glos nutritif, densit
optique), les rsultats sont exprims en UFC/mL (unit formant colonie). A
contrario, le dnombrement rsultant de lanalyse par qPCR est exprim en
UG/mL (unit gntique)
6.2 Prparation du contrle interne :
Culture Yarrowia en YPD (Yeast peptone dextrose) liquide 28 C jusqu une
DO600 (Densit optique 600 nm) de 1 (environ 48h).
Aprs estimation de la DO600nm faire une dilution 1,0.106 UFC/mL dans de leau
physiologique (1DO = 1,0.107 UFC/mL).
Prlever 110L de la culture 1,0.106 UFC/mL dans un microtube de 1,7mL et
ajouter 110L de glycrol 40% pour obtenir une population 5,0.105UFC/mL.
Mlanger et conserver -80C. Un tube permet de traiter 5 chantillons de vin.
Raliser une numration en parallle afin de vrifier le titre de la suspension.

6.3 Prparation des solutions :


100mL de Tris-HCl pH8 10mM : peser 0,121 g de tris base (par exemple :
Trizma base et dissoudre dans 80mL deau ultrapure (18 M). Ajuster le pH avec
de lHCl. Ajuster le volume 100mL. Autoclaver.
100mL TE : peser 0,121 g de tris base et dissoudre dans 80mL deau. Ajuster le
pH avec de lHCl. Ajouter 37,2 mg dEDTA. Ajuster le pH 8 (favorise la
dissolution de lEDTA) puis le volume 100mL. Autoclaver.
100mL solution I : prparer 50mL de TE 2x et ajouter 10mL de NACl 1M, 10mL
de SDS 10% ( dissoudre en chauffant lgrement) et 2g de Triton X100, puis
ajuster le volume.
Actate dammonium 4M : dissoudre 15,4 g dactate dammonium qsp (quantit
suffisante pour) 50mL eau ultrapure (18 M).
100mL phnol :chloroforme :IAA (25 :24 :1) : partir de 50mL de phnol satur
avec du tampon TE pH8, ajouter 48mL de chloroforme et 2mL dalcool
isoamylique.Conserver 4C.

OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

RNAse A 1g/L : diluer la RNase A 70U/mg en solution (par exemple :Sigma,


R4642-50MG, stocke 20C) avec de leau ultrapure (18 M). La concentration
de la RNase stock est indique sur le tube et la feuille de spcifications du lot. La
solution dilue est conserver 4C maximum 3 semaines.
Amorces Brett 4M : partir des solutions stocks damorces (tubes fournisseurs)

100M,
faire
un
mlange
4M
Brett
rad3
(GTTCACACAATCCCCTCGATCAAC)
et
4M
Brett
rad4
(TGCCAACTGCCGAATGTTCTC) qsp 1mL avec de leau ultrapure [18 M].
Conservation 1 an 20C.
Amorces YAL 4M : partir des solutions stocks damorces (tubes fournisseurs)
100M, faire un mlange 4M YAL-F (ACGCATCTGATCCCTACCAAGG) et
4M YAL-R (CATCCTGTCGCTCTTCCAGGTT) qsp 1mL avec de l eau
ultrapure [18 M]). Conservation 1 an 20C.
7. Mode opratoire
chantillon analyser : agiter le flacon ou la bouteille de faon homogniser son
contenu.
Cas dune bouteille bouche : dsinfecter le col de la bouteille l'alcool 70% et
dboucher la flamme, au moyen dun tire-bouchon dsinfect lalcool 70%.
Transvaser un chantillon de vin de 15-20mL dans un flacon strile en matire
plastique usage unique de 30 mL.
Les tapes auxquelles le protocole peut tre interrompu sont signales par *
.

(dure dinterruption max, T)

7.1. Sparation des cellules


Cette tape doit tre ralise en double, et les manipulations doivent tre
ralises sous une hotte ddie et confine prvue cet effet.
-

prlever 1mL de vin dans un microtube vis 2mL


ajouter 20L du contrle interne 5,0.105 UFC/mL
centrifuger 30s (secondes) 9300 g
liminer le surnageant par retournement dlicat
reprendre le culot dans 1mL de Tris-HCl 10mM pH8
centrifuger 30s 9300 g et liminer le surnageant.
Agiter au vortex brivement afin de suspendre le culot dans le liquide
rsiduel * (3 mois, -20C).

OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

Un tube est utilis pour lextraction de lADN et lautre conserv 20C


jusqu obtention de rsultats valids.
7.2. Extraction de lADN
A partir dun culot frais ou congel. Au maximum traiter 24 chantillons en
parallle.
-

ajouter PVPP (1% final m/v)


ajouter 0,3g de billes de verre 200-500m
ajouter 200L de solution I
ajouter 200L de phnol :chloroforme :IAA (24 :25 :1)
casser les cellules lagitateur automatique (par exemple GnieDisruptor)
4x80s avec passage au froid (bloc rfrigr -20C) 80s environ entre
chaque casse
additionner 200L de TE
centrifuger 5min (minutes) 15700 g.
rcuprer dlicatement 400L de la phase aqueuse suprieure dans un
microtube 1,7mL. En cas de mlange des deux phases, ritrer ltape
de centrifugation.
ajouter 1mL thanol absolu et mlanger le tube par inversion 4-5 fois * (qqs
heures, T ambiante)

centrifuger 5min 15700 g et liminer le surnageant par retournement


reprendre le culot dans 400L TE et 30L de Rnase 1g/L
incuber la solution 37C pendant 5min (modifier ensuite le rglage
48C)
ajouter 10L actate dammonium 4M + 1mL thanol absolu ; mlanger
par inversion
centrifuger 5min 15700 g
Eliminer le surnageant par retournement, les dernires gouttes sont
absorbes sur du papier filtre
scher le culot (tube ouvert dans le bain-sec 48C, 1 heure environ)
ajouter au culot 25L TE, agiter au vortex et mettre 4C entre 1 et 18h
(favorise la solubilisation de lADN). Homogniser lagitateur
automatique * (qqs semaines, -20C)
7.3. qPCR

Pour chaque chantillon de vin, prvoir 2 puits avec les amorces Brett rad3/4
et 2 puits de contrle interne avec les amorces YAL. Pour chaque plaque,
prvoir un contrle ngatif avec du TE pour chaque couple damorces
raliser en dernier. Faire aussi un contrle positif avec lADN de
OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

Brettanomyces bruxellensis disponible -20C. Pour prparer le contrle


positif, ajouter 5 L de solution mre (4,5 UG/mL) dans un volume de
raction final de 25 L.
Programme damplification PCR :
Nombre de cycle
1
40

Temps (sec)
Temprature (C)
180
95
30
95
10
64,6
La courbe de fusion est dtermine partir de 90C en diminuant de
0,5C toutes les 10 secondes
nb puits Brett = nb puits YAL = 2 x nb chantillons + 2
La table ci-dessous indique selon le nombre dchantillons, le nombre de
puits et la quantit de chaque composant du mlange.
nombre d
chantillons
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22

nombre de eau 18
puits
M (L)
4
26,3
6
36,8
8
47,3
10
57,8
12
68,3
14
78,8
16
89,3
18
99,8
20
110,3
22
120,8
24
131,3
26
141,8
28
152,3
30
162,8
32
173,3
34
183,8
36
194,3
38
204,8
40
215,3
42
225,8
44
236,3
46
246,8

OIV-MA-AS4-03 : R2011

iQ SYBR Green
supermix (L)
65,6
91,9
118,1
144,4
170,6
196,9
223,1
249,4
275,6
301,9
328,1
354,4
380,6
406,9
433,1
459,4
485,6
511,9
538,1
564,4
590,6
616,9

mlange
amorces 4M
13,1
18,4
23,6
28,9
34,1
39,4
44,6
49,9
55,1
60,4
65,6
70,9
76,1
81,4
86,6
91,9
97,1
102,4
107,6
112,9
118,1
123,4
8

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

23

48

257,3

643,1

128,6

sortir les amorces Brett 4M et les amorces YAL 4M du conglateur


sortir le SYBR Green (4C si tube en cours, sinon 20C)
prparer un mlange Brett et un mlange YAL avec la table ci-dessous selon
le nombre dchantillons.
dposer au fond de chaque puits 20L de mlange
ajouter 5L de solution dADN homognise lagitateur automatique ou 5
Ldeau pour les contrles ngatifs
ajuster le film optique et charger la plaque
7.4. Lecture des rsultats

sortir la plaque et la mettre directement dans le sac pour destruction (ne


pas louvrir)
fixer la ligne de base 100.
analyser dans lordre :
o les tmoins ngatifs qui ne doivent pas donner de signal. Si un Ct
est observ avec une valeur infrieure 37, recommencer la
manipulation en changeant toutes les solutions
o le contrle positif Brett: son Ct doit tre voisin de 25 avec une
temprature de fusion de 82,5C ( 0,5C),
o les contrles internes YAL : si un Ct est obtenu, vrifier la
temprature de fusion du produit (84C 0,5C). Dans les cas non
conformes, labsence de signal Brett ne peut tre interprte.,
o les chantillons : vrifier le Tm du produit Brettanomyces
bruxellensis (82C 0,5C). Si et seulement si le Tm est
acceptable, vrifier lallure exponentielle de lamplification.
Relever alors les valeurs de Ct pour les reporter sur la droite
dtalonnage.

NB : le Ct reprsente le temps ncessaire pour que la fluorescence de la squence


cible atteigne une valeur seuil. Il sagit par consquent le nombre de cycle PCR
minimum pour que le signal fluorescent sorte du bruit de fond.

OIV-MA-AS4-03 : R2011

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR


8. Calculs (Rsultats)

Cinq souches Brettanomyces bruxellensis ont t inocules diffrentes


concentrations allant de 3,1.105 3 UFC/mL sur 14 vins (3 vins blancs, 2 vins
ross, 9 vins rouges dont les teneurs en composs phnoliques stendent sur une
large gamme). LADN a ensuite t extrait en prsence de PVPP 1%.
Une droite talon a t tablie partir des rsultats obtenus sur les diffrentes
combinaisons de vins et de souches.
Les rsultats sont obtenus en UG/mL (unit gntique/mL) partir de la droite
dtalonnage
logUG = log(2,03)Ct + 12,34

8,00
7,00

log (UG) = -log (2,03)*Ct + 12,3

logUG

6,00
5,00
4,00
3,00
2,00
I > 1,2log

1,00

I = 1,2log

(Imax =1,6log)

I > 1,2log

0,00
20

22

24

26

28

30

32

34

36

38

Ct

9. Caractristiques de la mthode : paramtres de validation


intralaboratoires
9.1. Linarit, rptabilit et reproductibilit [4]
La courbe dtalonnage en six points a t ralise sur lintervalle 0 2x105
UFC/mL de la souche L0211 dans un vin, avec quatre rplicats. Cet intervalle de
populations a t choisi daprs les niveaux habituels de Brettanomyces
OIV-MA-AS4-03 : R2011
10

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

bruxellensis dans le vin. Le rapport log UG mesur / log UG thorique a t tabli


laide dune analyse de rgression simple. Les paramtres de rgression, la pente
et lordonne lorigine ont t dtermins comme indiqu dans le Tableau cidessous. Le modle de rgression a t accept avec un risque = 1 % et le
domaine de linarit choisi a t valid, aucune erreur de modle nayant t
constate.
La fidlit de la mthode a t compare celle de la mthode de culture classique.
Trois oprateurs ont prpar de lADN extrait dun vin inocul par la souche
L0211 deux niveaux de population : 1,9x104 (lev) ou 1,9x102 (faible) UFC/mL.
Quatre mesures par PCR ont t ralises pour chaque ADN extrait. Les
cartstypes pour la rptabilit et la reproductibilit, respectivement Sr et SR, ont
t calculs daprs les valeurs de log UG pour les deux niveaux (tableau cidessous). Pour la mthode qPCR, Sr et SR taient similaires pour le niveau bas,
mais SR tait suprieur Sr pour les niveaux de population levs. Les deux
cartstypes ont t deux fois suprieurs ceux obtenus avec la mthode
microbiologique classique. Cet effet a t attribu laugmentation du nombre
dtapes pour la mthode qPCR.
Tableau : Paramtres de validation de la mthode qPCR pour la numration des
Brettanomyces dans les vins

Paramtre
Equation de rgression
Intervalle (UFC/mL)
Pente (T)
Ordonne lorigine (T)
Modle de rgression
Erreur de modle

Valeurs
0-2x105
0,957 (0,044)
-0,049 (0,142)
Fobs>F(1,18) : modle linaire accept
Fobs<F(4,18) : aucune erreur de modle

Fidlit
Sr qPCR (bas/lev)
Sr microbio (bas/lev)
SR qPCR (bas/lev)
SR microbio (bas/lev)

0,26/0,25
0,17/0,04
0,29/0,41
0,17/0,04

Justesse
Moyenne 43 chantillons (D)
SR D
Test dgalit W=D/SR D

2,39 (qPCR)/2,25 (microbio)


1,18
0,11<3 justesse acceptable

OIV-MA-AS4-03 : R2011
11

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

9.2. Limite de dtection (LD) et limite de quantification (LQ) [4]


LD et LQ indiquent la sensibilit de la mthode. LD est la plus basse population
dtecte par la mthode ; LQ est la population minimale qui peut tre quantifie
avec prcision. Dans lanalyse des produits alimentaires, ces paramtres sont
calculs daprs les rsultats antrieurs. Or, pour la qPCR, il nexiste pas de tels
rsultats. Nous avons donc utilis les autres mthodes pour valuer LD et LQ. La
premire mthode utilise la pente, lordonne lorigine et lerreur type sur
lordonne lorigine obtenues lors des essais de validation de la linarit. Avec
cette mthode, des valeurs de LD et LQ de 3 et 31 UG/mL respectivement ont t
obtenues. Avec la deuxime mthode, la LD a t obtenue daprs le niveau de
population donnant un rsultat ngatif pour 10 mesures indpendantes. Lanalyse
de nos donnes obtenues sur 14 vins inoculs par cinq souches a montr que 96 %
des chantillons (48/50) contenant 101 250 UFC/mL conduisaient des signaux
positifs, tandis que 83 % (49/59) taient positifs sils contenaient 26 100 UFC/mL
et 65 % (44/68) pour un niveau de population de 5 25 UFC/mL. Par consquent,
la limite de dtection value avec cette mthode serait comprise dans lintervalle
26100 UFC/mL. Par rptition systmatique du test PCR, une LD de 5 UFC/mL
a t certifie laide de calculs de probabilits (1p) 2. En effet, pour 5 UFC/mL,
88 % des chantillons ont t positifs. Ce pourcentage a atteint 97 % pour 25
UFC/mL.

10. Bibliographie
1. Phister T.G., Mills D.A., 2003. Real-time PCR assay for detection and
enumeration of Dekkera bruxellensis in wine. Applied and Environmental
Microbiology, 69: 7430-7434.
2. Cocolin L., Rantsiou K., Iacumin L., Zironi R., Comi G., 2003. Molecular
detection and identification of Brettanomyces/Dekkera bruxellensis
Brettanomyces/Dekkera anomalus in spoiled wines. Applied and
Environmental Microbiology, 70: 1347-1355.
3. Ibeas J.I., Lozano I., Perdigones F., Jimenez J., 1996. Detection of DekkeraBrettanomyces strains in sherry by a nested PCR method. Applied and
Environmental Microbiology, 62: 998-1003.
4.

Tessonnire H., Vidal S., Barnavon L., Alexandre H., Remize F., 2009.
Design and performance testing of a real-time PCR assay for sensitive and

OIV-MA-AS4-03 : R2011
12

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Numration des Levures de lespce Brettanomyces bruxellenis par qPCR

reliable direct quantification of Brettanomyces in wine. International Journal of


Food Microbiology, 129: 237-243.

OIV-MA-AS4-03 : R2011
13

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Diffrentiation des mistelles des vins de liqueur doux

Mthode OIV-MA-AS5-01

Mthode Type IV

Diffrentiation des mistelles des vins


de liqueur doux
1. Principe des mthodes
1.1. Mthode de triage
La dfinition donne par lO.I.V. (Code international des pratiques
nologiques) pour les produits, imposant pour les vins de liqueur 4% vol. au
moins dalcool acquis naturel de fermentation et tolrant pour les mistelles 1%
vol. au plus dalcool acquis, leur diffrentiation peut tre faite par la mise en
vidence par la chromatographie en phase gazeuse des substances se formant
au cours de la fermentation alcoolique.
Cette mthode nest applicable que si lalcool utilis pour llaboration des
mistelles est neutre comme le prvoit leur dfinition.
1.2. Recherche de lacide citramalique par chromatographie sur couche mince.
La prsence dacide citramalique caractrise les vins de liqueur doux. Sa
recherche seffectue par chromatographie sur couche mince aprs sparation
des sucres laide dune colonne changeuse dions.
2. Mthode de triage
2.1. Appareillage
Chromatographe en phase gazeuse avec :
- dtecteur ionisation de flamme,
- colonne inox 3 m, 2 mm de diamtre intrieur,
- phase stationnaire : Carbowax 20 M 20%,
- support: Chromosorb W 60/80 mesh.
Conditions de la chromatographie :
- tempratures:
injecteur: 210C
dtecteur: 250C
four isotherme 70C pendant 6 min.; puis programmation de 6C/min.;
temprature limite suprieure: 170C
D'autres types de colonnes peuvent tre utiliss.
Le mode opratoire dcrit ci-dessous est donn titre d'exemple.
2.2. Mode opratoire
2.2.1. Prparation de l'chantillon

OIV-MA-AS5-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Diffrentiation des mistelles des vins de liqueur doux

Procder une dmixion dans les conditions suivantes : 25 ml d'chantillon


(mistelle ou vin de liqueur) sont additionns de 7 ml d'thanol et de 15 g de
sulfate d'ammonium, (NH4)2SO4, agiter. Laisser reposer pour obtenir la
sparation des phases.
2.2.2 Chromatographie
Injecter 2 l de la phase organique et procder la chromatographie dans les
conditions indiques ci-dessus.
Le chromatogramme d'un vin de liqueur se diffrencie par la prsence des pics
dus aux produits secondaires de la fermentation alcoolique.
3. Recherche de l'acide citramalique par chromatographie en couche mince
3.1 Appareillage
3.1.1 Colonne de verre de 300 mm environ de longueur et de 10-11 mm de
diamtre intrieur munie d'un rgulateur de dbit (robinet) :
3.1.2 vaporateur rotatif sous vide,
3.1.3 tuve 100 C,
3.1.4 Cuve chromatographie
3.1.5 Seringue micromtrique ou micro-pipette.
3.2 Ractifs
3.2.1 Solution d'acide formique 4 M, contenant 150,9 ml d'acide formique
(20 = 1,227 g/ml) pour un litre.
3.2.2 Plaques pour la chromatographie prtes l'emploi avec couche de poudre
de cellulose (par exemple MN 300) (20 x 20 cm).
3.2.3 Solvant:
alcool isopropylique contenant 1 g/l de bleu bromophnol .. 5 vol.
eucalyptol ....................................................... 5 vol.
acide formique (20= 1,227 g/ml) ...................................................... 2 vol.
Saturer le solvant avec de l'eau et laisser au repos pendant 24 h avant emploi.
3.2.4. Solutions talons.
Prparer des solutions aqueuses :
acide citramalique .....................................................
acide lactique .......................................................
acide citrique .......................................................
acide tartrique .....................................................
acide malique ......................................................

0,25 g/l
0,5 g/l
0,5 g/l
1,0 g/l
1,0 g/l

3.3. Mode opratoire

OIV-MA-AS5-01 : R2009

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Diffrentiation des mistelles des vins de liqueur doux

3.3.1 Prparation de la colonne d'changeur d'ions.


Voir chapitre Acide tartrique, Mthode usuelle en 3.3.1.
3.3.2 Isolement des acides organiques dont l'acide citramalique
Oprer comme il est indiqu au chapitre Acide tartrique, mthode usuelle en
3.3.2. pour la fixation des acides organiques sur l'changeur d'ions.
luer ensuite les acides fixs en utilisant la solution 4 M d'acide formique
(100 ml), et en recueillant l'luat dans un ballon jaug de 100 ml.
Concentrer cet luat sec dans un vaporateur rotatif 40C et reprendre le
rsidu par A ml d'eau distille.
3.3.3 Chromatographie
La plaque de cellulose doit tre active par passage l'tuve 100C pendant 2
heures.
Dposer sur la ligne de dpart sous forme de d'un trait de 2 cm de largeur, 10 l
de cette solution sur la plaque de cellulose ainsi que 10 l des solutions talons
d'acide citramalique et des autres acides organiques.
Placer la plaque dans la cuve chromatographie, au-dessus du solvant, pendant
45 minutes.
Procder au dveloppement et laisser migrer le solvant sur une hauteur de 15 cm.
3.3.4 Rvlation du chromatogramme
Maintenir la plaque la temprature ordinaire sous un courant d'air, jusqu'
limination de l'acide formique du solvant. Des taches jaunes apparaissent sur
un fond bleu, indiquant la prsence des acides.
Dtecter la prsence ou l'absence d'acide citramalique dans le produit analys
en comparant les spots de son chromatogramme aux spots des solutions talons
d'acide citramalique et des autres acides organiques.
BIBLIOGRAPHIE
Mthode de triage :
HARVALIA A., F.V., O.I.V., 1980, n 728 bis.
Chromatographie de l'acide citramalique:
DIMOTAKI-KOURAKOU V., Ann. Fals. Exp. Chim., 1960, 53, 149.
DIMOTAKI-KOURAKOU V., C. R. Ac. Sci., Paris 1962, 254, 4030.
CARLES J., LAMAZOU-BETBEDER M. & PECH M., C. R. Ac. Sci., Paris 1958,
246, 2160.
CASTINO M., Riv. Vit. Enol., 1967, 6, 247.
KOURAKOU V., F.V., O.I.V., 1977, n 642.
JUNGE Ch F.V., O.I.V., 1978, n 679.
ROUEN J., F.V., O.I.V., 1979, n 691.
OIV-MA-AS5-01 : R2009

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV

Annexe B
Modles de certificats danalyse

OIV-MA-ANNEXE-B

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Rgles d'application des mthodes d'analyse

Rgles d'application des mthodes d'analyse

Le contrle de la qualit des vins doit toujours comporter, d'une part, un examen
sensoriel et, d'autre part, la dtermination des lments essentiels et les plus
caractristiques de leur composition.
L'analyse sensorielle n'a pas t tudie dans le prsent Recueil, elle est laisse
l'apprciation des Etats, mais elle s'impose dans tous les cas.
En ce qui concerne les lments de la composition des vins, trois sortes de
dterminations peuvent ou doivent tre effectues :
1/ Les dterminations qui servent identifier les vins et peuvent servir de base des
transactions commerciales (Certificat n 1);
2/ Les dterminations qui permettent de s'assurer de faon satisfaisante des qualits
et caractres d'un vin et qui, de ce fait, correspondent aux usages du commerce
(Certificat n 2).
Des dterminations autres que celles prvues dans les certificats nos 1 et 2
peuvent tre exiges dans le cadre contractuel.
3/ Un troisime Certificat (n 3) pourra tre prvu qui contiendrait des
dterminations particulires qui ne sont pratiques que de faon exceptionnelle
ou spciale.
Le recours aux dterminations vises au Certificat n 2 est de nature exonrer la
responsabilit des oprateurs.
Le recours aux dterminations du Certificat n 3 pourrait tre de nature exonrer
la responsabilit des importateurs.
Lorsque la sant publique est en cause, d'autres dterminations peuvent tre
demandes, soit par l'O.I.V., soit par les pouvoirs publics, soit par toute partie
intresse lorsque des doutes srieux sont apparus dans les milieux professionnels
ou parmi les consommateurs.
L'exception de sant publique pourra tre soumise, par toute partie intresse, au
groupe spcialis d'experts scientifiques de l'Office selon une procdure d'urgence.
Les dterminations analytiques sont effectues, lorsqu'elles existent, selon les
mthodes dcrites au prsent Recueil.

OIV-MA-B1-01

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Modles de certificats d'analyse


Modles de certificats d'analyse
Certificat n 1

Couleur
Limpidit
Masse volumique 20 C
Titre alcoomtrique 20 C
Extrait sec total g/l
Sucres g/l
Dioxyde de soufre total mg/l
pH
Acidit totale meq/l
Acidit volatile meq/l
Recherche du diglucoside du malvidol
Surpression du dioxyde de carbone dans le cas des vins effervescents
Diffrentiation des vins de liqueur et des mistelles dans le cas des vins
doux

Certificat n 2
Le certificat n 1 est complt par les dterminations suivantes :
Cendres g/l et leur alcalinit
Potassium g/l
Fer mg/l
Cuivre mg/l
Dioxyde de soufre libre mg/l
Acide sorbique mg/l
Contrle de la fermentation malolactique
Acide citrique mg/l
Acide tartrique g/l
Indice de Folin-Ciocalteu
Indices chromatiques
Les dterminations ci-aprs tant facultatives :

Sodium excdentaire mg/l


Calcium, magnsium mg/l
Sulfates mg/l
Test de fermentescibilit
Recherche de colorants artificiels

OIV-MA-B1-02

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV

Annexe C
Limites maximales acceptables
de divers lments

OIV-MA-ANNEXE-C

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Limites maximales acceptables de divers lments dans le vin

Limites maximales acceptables de divers lments dans le vin


(dition 2012)

Acide citrique :

1 g/l

Acidit volatile :

20 milliquivalents/l
L'acidit volatile de certains vins vieux d'laboration
particulire (vins soumis une lgislation
particulire et contrls par le gouvernement) peut
dpasser cette limite.

Argent (145/2009)

0,1 mg/l

Arsenic :

0,2 mg/l

Bore :

80 mg/l (exprim en acide borique).

Brome :

1 mg/l (limite dpasse exceptionnellement dans des


vins provenant de certains vignobles sous-sol
saumtre).

Cadmium :

0,01 mg/l

Cuivre :

1 mg/l
2mg/l pour les vins de liqueur labors partir de
mot de raisin non ferment ou peu ferment

Dithylne glycol :

10 mg/l, la limite de quantification

Diglucoside de malvidol :

15 mg/l (dtermin par la mthode quantitative


dcrite dans le Recueil).

OIV-MA-C1-01

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Limites maximales acceptables de divers lments dans le vin

Dioxyde de soufre total au moment de la vente au consommateur: (oeno 9/98)


- 0,150 g/l pour les vins rouges contenant au plus
4 g/l de matires rductrices,
- 0,200 g/l pour les vins blancs et ross contenant au
plus 4 g/l de matires rductrices,
- 0,300 g/l pour les vins rouges, blancs et ross
contenant plus de 4 g/l de matires rductrices,
- 0,400 g/l pour certains vins blancs doux spciaux.

Etanediol/Ethylne glycol

10 mg/l

Fluor (oeno 8/91)

1 mg/l sauf pour les vins issus de vignobles traits


la cryolithe, conformment la loi nationale ; dans
ce cas, la teneur en fluor ne doit pas tre suprieure
3 mg/l

Mthanol (Oeno 19/2004): 400 mg/l pour les vins rouges


250 mg/l pour les vins blancs et ross
Ochratoxine A
(CST 1/2002):

2 g/l

Plomb (oeno 13/06):

0,15 mg/l

Propane-1,2- diol /
Propylne glycol
(oeno 20/2003)

Vins tranquilles: = 150 mg/l.


Vins mousseux: = 300 mg/l.

Sodium excdentaire
(Oeno 12/2007)

OIV-MA-C1-01

(pour les vins obtenus compter de la rcolte 2005)

pour les vins produits partir de la


campagne 2007,

: 80 mg/l

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Limites maximales acceptables de divers lments dans le vin

Sulfates :
(exprims en sulfate de
potassium)

Zinc :

OIV-MA-C1-01

1 g/l
Toutefois cette limite est porte :
- pour les vins ayant fait l'objet d'une
priode de vieillissement en fts de
2 ans au moins
- pour les vins dulcors
- pour les vins obtenus par adjonction
des mots ou des vins d'alcool
ou d'eau de vie

1,5 g/l

- pour les vins additionns de mots


concentrs
- pour les vins naturellement doux

2 g/l

- pour les vins obtenus sous voile

} 2,5 g/l

5 mg/l

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV

Annexe D
Avis

OIV-MA-ANNEXE-D

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Acide gluconique

Acide gluconique
(Rsolution oeno 4/91)
AVIS

L'acide gluconique est toujours prsent dans les mots et dans les vins.
Dans les vins, issus d'une vendange saine arrive maturit, sa teneur ne dpasse
pas 200-300 mg/l.
L'acide gluconique augmente par surmaturation par passerillage et surtout par
l'intervention de Botrytis cinerea.
Sa prsence en quantit leve dans les vins - mis part les vins issus de pourriture
noble dont elle constitue une caractristique - ne peut pas tre considre comme
un signe de mauvaise qualit lie la mise en oeuvre d'une vendange atteinte de
pourriture grise, ce qui doit tre dmontr par ailleurs.
En effet, par des techniques appropries de vinification, il est possible d'obtenir
dans ce cas des vins de qualit satisfaisante.
Quant la fraude par addition d'acide gluconique, elle est sans motif.

OIV-MA-D1-01

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Caractrisation des vins issus du surpressurage

Caractrisation des vins issus du surpressurage


(Rsolution oeno 5/91)
AVIS

Au vu des rsultats et des discussions concernant les essais de


CARACTERISATION DES VINS ISSUS DU SURPRESSURAGE, les experts
ont constat que, pour l'ensemble des tests effectus, le comportement des vins est
trs diffrent en fonction du cpage, ce qui rend impossible toute interprtation
concernant les vins issus de plusieurs cpages.
De plus, doivent tre pris en compte les effets des diffrents modes de pressurage et
de techniques de vinification, telle la macration prfermentaire.
Des tudes doivent tre poursuivies pour mettre en vidence les vins issus d'un
pressurage excessif et pour rechercher une dfinition du surpressurage.

OIV-MA-D1-02

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Teneur en ions chlorure et en ions sodium des vins

Teneur en ions chlorure et en ions sodium des vins


(Rsolution oeno 6/91)

AVIS

+
La teneur en ions Cl- et en ions Na des vins dpend essentiellement des conditions
gographiques, gologiques et climatiques de culture de la vigne.

En rgle gnrale, ces teneurs sont faibles.


Les teneurs en ces lments s'lvent dans les vins provenant de vignobles tablis
au bord de la mer, sous-sols saumtre, sur des terres arides avec irrigation avec
des eaux salines et le rapport molaire Cl /Na+ varie alors de manire importante et
peut mme prendre une valeur proche de 1 faisant penser l'adjonction de sel (Na
Cl) au vin.
Lorsque le vin contient du sodium excdentaire (sodium excdentaire gal la
teneur en ions sodium moins la teneur en ions chlorures exprimes en sodium), il
est en rgle gnrale infrieur 60 mg/l, limite qui peut tre exceptionnellement
dpasse.
Les laboratoires et les services officiels de contrle, devant des teneurs leves en
+
Cl et/ou Na , doivent prendre en compte les conclusions ci-dessus et
ventuellement s'informer auprs des services officiels du pays d'origine avant
d'liminer ces vins.

OIV-MA-D1-03

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV

Annexe E
Assurance qualit
dans les laboratoires

OIV-MA-ANNEXE-E

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Principe de validation - Mthodes usuelles Mthodes de rfrence

Principe de validation des mthodes usuelles


par rapport aux mthodes de rfrence
Rsolution oeno 7/98

LOIV reconnat lexistence, ct des mthodes danalyse des vins dcrites dans
le Recueil des mthodes internationales danalyse des vins et des mots, de
mthodes usuelles le plus souvent automatises. Ces mthodes sont
conomiquement et commercialement importantes car elles permettent dassurer
un encadrement analytique complet et efficace autour de la production et de la
mise en march des vins. Par ailleurs, ces mthodes permettent la mise en oeuvre
des moyens modernes danalyse et le dveloppement et ladaptation des techniques
danalyse.
Afin de permettre aux laboratoires dutiliser ces mthodes et dassurer leur
raccordement aux mthodes dcrites dans le Recueil, lOIV dcide la mise en
place dun protocole dvaluation et de validation par un laboratoire dune
mthode usuelle alternative, automatise ou non par rapport une mthode
rfrentielle dcrite dans le Recueil des mthodes internationales danalyse des
vins et des mots.
Ce principe, qui sera adapt au cas particulier de lanalyse des vins et des mots
sinspirera des normes internationales en vigueur et permettra au laboratoire
dvaluer et de valider sa mthode alternative.

OIV-MA-AS1-05 : R1998

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

tude collaborative
Ltude collaborative a pour but de donner une indication quantitative sur
lexactitude dune mthode danalyse, exprime par la rptabilit r et la
reproductibilit R.
La rptabilit reprsente la valeur au-dessous de laquelle est situe, avec une
probabilit spcifie, la valeur absolue de la diffrence de deux rsultats
individuels obtenus partir de mesures effectues dans les mmes conditions
(mme oprateur, mme appareil, mme laboratoire, et un court intervalle de
temps).
La reproductibilit reprsente la valeur au-dessous de laquelle est situe, avec une
probabilit spcifie, la valeur absolue de la diffrence de deux rsultats
individuels obtenus dans des conditions diffrentes (oprateurs diffrents,
appareillages diffrents, et/ou laboratoires diffrents, et/ou poques diffrentes).
Le terme rsultat individuel est la valeur obtenue lorsquon applique, une fois et
compltement, la mthode dessai normalise sur un seul chantillon. En labsence
dindication, la probabilit est de 95%.
Principes gnraux
La mthode soumise lessai doit tre normalise, cest--dire choisie parmi les
mthodes existantes comme convenant le mieux pour tre applique
ultrieurement de faon gnrale.
Le protocole doit tre clair et prcis.
Le nombre des laboratoires participant doit tre de 10 au moins.
Les essais doivent tre effectus sur des lots prlevs dans un lot homogne du
matriau.
Les teneurs en substance analyser doivent couvrir les concentrations
gnralement rencontres.
Les participants doivent avoir une bonne exprience de la technique employe.
Toutes les expriences doivent tre effectues lintrieur dun mme
laboratoire par le mme analyste.
La mthode doit tre suivie de faon aussi rigoureuse que possible. Toute
dviation de la mthode dcrite doit tre indique.
Les valeurs exprimentales doivent tre dtermines dans des conditions
strictement identiques : sur le mme type dappareil, etc.
Elles doivent tre dtermines indpendamment les unes des autres, lune
immdiatement aprs lautre.
Les rsultats doivent tre exprims par tous les laboratoires avec la mme unit,
le mme nombre de chiffre aprs la virgule, savoir un chiffre de plus qu
lordinaire.

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative
Il faut dterminer cinq valeurs exprimentales exemptes de valeurs aberrantes.

Sil y a une valeur exprimentale aberrante selon le test de Grubbs, il faut refaire
trois mesures supplmentaires.
Modle statistique
Les mthodes statistiques exposes dans ce document sont donnes pour un niveau
(concentration, chantillon). Sil y a diffrents niveaux, lvaluation statistique
doit se faire sparment pour chaque niveau.
Si lon trouve une relation linaire (y = bx or y = a + bx) entre la rptabilit (r) ou
la reproductibilit (R) et la concentration ( x ), une rgression de r (ou R) en
fonction de x peut tre effectue.
Les mthodes statistiques donnes ci-dessous prsupposent des valeurs alatoires
normalement distribues.
Les tapes suivre sont les suivantes :
A/ limination des valeurs aberrantes au sein dun mme laboratoire par le test de
Grubbs. Les valeurs aberrantes sont celles qui scartent si fortement des
autres valeurs exprimentales que ces carts ne peuvent tre considrs comme
fortuits et que les causes de ces carts ne peuvent tre dtermines.
B/ Examiner si tous les laboratoires travaillent avec la mme prcision en
effectuant une comparaison des variances par le test de Bartlett et le test de
Cochran. liminer les laboratoires pour lesquels on obtient des valeurs
statistiquement aberrantes.
C/ Dpister les erreurs systmatiques des laboratoires restants par une analyse de variance
et prciser par le test de Dixon les valeurs extrmes aberrantes. liminer les
laboratoires pour lesquels on obtient des valeurs statistiquement aberrantes.

D/ A partir des rsultats restants, calculer lcart-type de rptabilit sr et la


rptabilit r, lcart-type de reproductibilit SR et la reproductibilit R.
Notation :
Les dsignations suivantes ont t choisies.
M
Nombre de laboratoires
i(i = 1, 2... m)
Indice (n. du laboratoire)
ni
Nombre des valeurs individuelles du i-me laboratoire
m

N = n i

Nombre total des valeurs individuelles

x(i = 1, 2... ni)

Valeur individuelle du ime laboratoire

i =l

xi =
x=

ni

1
ni

x
i =1

Valeur moyenne du ime laboratoire

ni
1
xi
N i =1 i =1

Valeur moyenne totale

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

si =

1 ni
x ix i
n i-1 i =1

Ecart-type du ime laboratoire

A/ Vrification des valeurs aberrantes au sein dun laboratoire


Aprs avoir dtermin 5 valeurs individuelles x , on excute au laboratoire le test
i
de Grubbs pour dpister les valeurs aberrantes.
On teste lhypothse nulle selon laquelle la valeur exprimentale ayant le plus
grand cart absolu par rapport la moyenne nest pas une observation aberrante.
On calcule PG =

x*i xi
si .

x*i = valeur suspecte.


On compare PG avec la valeur correspondante indique au tableau 1 pour P =
95%.
Si PG < valeur lue, la valeur x* nest pas une valeur aberrante et on peut calculer s .
i
i
*
Si PG > valeur lue, la valeur x est probablement une valeur aberrante et on refait

trois dterminations supplmentaires.


On calcule nouveau pour x* le test de Grubbs avec les huit dterminations.

Si PG > valeur correspondante pour P = 99%, on considre x* comme une valeur


aberrante et on calcule s sans x* .
i
i

B/ Comparaison des variances entre les diffrents laboratoires


- Test de Bartlett
Le test de Bartlett permet dexaminer aussi bien les grandes variances que les
petites. Il sert tester lhypothse nulle de lgalit des variances dans tous les
laboratoires par opposition avec lhypothse alternative selon laquelle les
variances sont ingales pour quelques laboratoires au moins.
Il a pour condition quil y ait au moins 5 valeurs individuelles par laboratoire.
On calcule la statistique du test :

PB = 1 (N m ) ln s 2I f i ln si2
C
i =1

C=

i =1

1 1
N m
fi
+1
3 (m1)

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative
m

f sI

*
sI =

=1

N m
fi = ni - 1 degrs de libert de si.
On compare PB avec la valeur indique au tableau 2 la distribution de x2 avec m
- 1 degrs de libert.
Si PB > la valeur du tableau, il y a des diffrences entre les variances.
A laide du test de Cochran, on peut vrifier que la variance dun laboratoire est
plus grande que celle dautres laboratoires.
On calcule la statistique du test :
2
max
PC = sim

2
i

i =1

On compare PC avec la valeur indique au tableau 3 pour m et n P = 99%.


i
Si PC > la valeur du tableau, la variance est significativement plus grande que les
autres.
Sil y a un rsultat significatif du test de Bartlett ou du test de Cochran, on peut
liminer la variance aberrante et calculer le test statistique nouveau.
A dfaut dune mthode statistique approprie au test simultan de plusieurs
valeurs aberrantes, lapplication rpte des tests est propose comme un moyen
utile. Cependant, les tests nont pas t prvus dans cet objectif et il faut prendre
beaucoup de prcautions lors des conclusions.
Si les laboratoires prsentent des variances divergeant fortement les unes des
autres, il faut effectuer une analyse pour en dtecter les causes et dcider si les
valeurs exprimentales trouves par ces laboratoires doivent tre limines ou non.
Dans cette ventualit, il faut tudier la question de la reprsentativit des
laboratoires restants.
Si le rsultat indique quil y a des variances diffrentes, ceci montre que les
laboratoires ont excut mthodes avec une prcision diffrente. De grandes
dispersions peuvent tre dues par exemple linsuffisance de pratique ou aussi au
manque de clart ou linsuffisance de la description de la mthode danalyse.
C/ Erreurs systmatiques
On examine si les laboratoires ont fait des erreurs systmatiques par la mthode
danalyse de variance selon R.A. Fischer ou par le test de Dixon.
Analyse de variance selon R. A. Fischer
Ce test sapplique aux valeurs exprimentales restantes des laboratoires ayant une
variance identique.
OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

On teste si la dispersion des valeurs moyennes des laboratoires est fortement plus
grande que celle des valeurs individuelles exprimes par la variance entre les
laboratoires ( s2Z ) et la variance au sein des laboratoires ( s2I ).
On calcule la statistique du test :
2
PF = s Z2

sI

2
s Z = m1-1

n (x x)
m

i=1

2
s I = N 1m

(x x )
m

ni

i=1 i=1

On compare PF avec la valeur correspondante indique dans le tableau


(distribution de F) avec fi = fZ = m - 1 et f2 = f1 = N - m degrs de libert.
Si PF > la valeur du tableau, on peut conclure la prsence de diffrences entre
les moyennes, cest--dire la prsence derreurs systmatiques.
Test de Dixon
Ce test permet de vrifier que la moyenne dun laboratoire est plus grande ou plus
petite que celle des autres laboratoires.
Soit une srie de donnes Z(h), h = 1,2,3...H, ranges par ordre croissant.
On calcule la statistique du test :

37

Q10=

Z (2 )Z (1)
Z (H )Z (1)

ou

Z (H )Z (H 1)
Z (H )Z (1)

8 12

Q11=

Z (2 )Z (1)
Z (H 1)Z (1)

ou

Z (H )Z (H 1)
Z (H )Z (2 )

13 ou plus

Q 22=

Z (3) Z (1)
Z (H 2 ) Z (1)

ou

Z (H )Z (H 2 )
Z (H )Z (3)

On compare la valeur plus grande de la fonction Q avec les valeurs critiques


indiques dans le tableau 5.

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Si la statistique est > la valeur du tableau P = 95%, la moyenne xi examine


peut tre considre comme valeur aberrante.
Sil y a un rsultat significatif dans lanalyse de variance selon R.A. Fischer ou au
test de Dixon, on limine lune des valeurs extrmes et on calcule la statistique du
test de nouveau par les valeurs restantes. En ce qui concerne lapplication rpte
des tests : voir les explications du paragraphe B.
Si les laboratoires font des erreurs systmatiques, les valeurs exprimentales
correspondantes en cause ne doivent en aucun cas tre prises en considration dans
les calculs ultrieurs. Il faut analyser les causes de lerreur systmatique.
D/ Calcul de la rptabilit (r) et de la reproductibilit (R).
A partir des rsultats restants aprs limination des valeurs aberrantes, on calcule
lcart-type de rptabilit sr et la rptabilit r, ainsi que lcart-type de
reproductibilit sR et la reproductibilit R, qui sont indiqus comme valeurs
caractristiques de la mthode danalyse.
sr =

1
N m

fs
i =1

r =s r2 2

2
i i

2
2
s R = a1 s Z + (a 1)s I

R =s R2 2

m
2

ni
a = 1 N
m1
n
i =1

Sil ny a pas de diffrence entre les moyennes des laboratoires, il ny a pas non
plus de diffrence entre sr et sR et entre r et R. Cependant, si lon a constat des
carts entre les moyennes des laboratoires, qui peuvent toutefois tre tolrs pour
des considrations dordre pratique, il faut indiquer sr et sR, r et R.

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

BIBLIOGRAPHIE
AFNOR, norme NFX06041, Fidlit des mthodes d'essai. Dtermination de la
rptabilit et de la reproductibilit par essais interlaboratoires.
DAVIES O. L., GOLDSMITH P.l., Statistical Methods in Research and
Production, Oliver and Boyd, Edinburgh, 1972.
GOETSCH F. H., KRNERT W., OLSCHIMKE D., OTTO U., VIERKTTER
S., Meth. An., 1978, No 667.
GOTTSCHALK G., KAISER K. E., Einfhrung in die Varianzanalyse und
Ringversuche, B-1 Hochschultaschenbcher, Band 775, 1976.
GRAF, HENNING, WILRICH, Statistische Methoden bei
Untersuchungen, Springer Verlag, Berlin, Heidelberg, New York, 1974.

textilen

GRUBBS F. E., Sample Criteria for Testing Outlying Observations, The Annals of
Mathematical Statistics, 1950, vol. 21, p 27-58.
GRUBBS F. E., Procedures for Detecting Outlying Observations in Samples,
Technometrics, 1969, vol. 11, No 1, p 1-21.
GRUBBS F. E. and BECK G., Extension of Sample Sizes and Percentage Points
for Significance Tests of Outlying Observations, Technometrics, 1972, vol. 14,
No 4, p 847-854.
ISO, norme 5725.
KAISER R., GOTTSCHALK G., Elementare Tests zur Beurteilung von
Messdaten, B-I Hochschultaschenbcher, Band 774, 1972.
LIENERT G. A., Verteilungsfreie Verfahren in der Biostatistik, Band I, Verlag
Anton Haine, Meisenheim am Glan, 1973.
NALIMOV V. V., The Application of Mathematical Statistics to Chemical
Analysis, Pergamon Press, Oxford, London, Paris, Frankfurt, 1963.
SACHS L., Statistische Auswertungsmethoden, Springer Verlag, Berlin,
Heidelberg, New York, 1968.

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Tableau 1 - Valeurs critiques pour le test de Grubbs


ni

P = 95%

3
4
5
6
7
8
9
10
11
12

1,155
1,481
1,715
1,887
2,020
2,126
2,215
2,290
2,355
2,412

P 99%
1,155
1,496
1,764
1,973
2,139
2,274
2,387
2,482
2,564
2,636

Tableau 2 Valeurs critiques pour le test de Bartlett (P = 95%)


f(m - 1)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20

OIV-MA-AS1-07 : R2000

X2

f(m - 1)

X2

3,84
5,99
7,81
9,49
11,07
12,59
14,07
15,51
16,92
18,31
19,68
21,03
22,36
23,69
25,00
26,30
27,59
28,87
30,14
31,41

21
22
23
24
25
26
27
28
29
30
35
40
50
60
70
80
90
100

32,7
33,9
35,2
36,4
37,7
38,9
40,1
41,3
42,6
43,8
49,8
55,8
67,5
79,1
90,5
101,9
113,1
124,3

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Tableau 3 Valeurs critiques pour le test de Cochran


m

ni = 2
99%
95%

n i= 3
99%
95%

ni = 4
99%
95%

ni = 5
99%
95%

ni = 6
99%
95%

2
3
4

0,993
0,968

0,967
0,906

0,995
0,942
0,864

0,975
0,871
0,768

0,979
0,883
0,781

0,939
0,798
0,684

0,959
0,834
0,721

0,906
0,746
0,629

0,937
0,793
0,676

0,877
0,707
0,590

5
6
7
8
9

0,928
0,883
0,838
0,794
0,754

0,841
0,781
0,727
0,680
0,638

0,788
0,722
0,664
0,615
0,573

0,684
0,616
0,561
0,516
0,478

0,696
0,626
0,568
0,521
0,481

0,598
0,532
0,480
0,438
0,403

0,633
0,564
0,508
0,463
0,425

0,544
0,480
0,431
0,391
0,358

0,588
0,520
0,466
0,423
0,387

0,506
0,445
0,397
0,360
0,329

10
11
12
13
14

0,718
0,684
0,653
0,624
0,599

0,602
0,570
0,541
0,515
0,492

0,536
0,504
0,475
0,450
0,427

0,445
0,417
0,392
0,371
0,352

0,447
0,418
0,392
0,369
0,349

0,373
0,348
0,326
0,307
0,291

0,393
0,366
0,343
0,322
0,304

0,331
0,308
0,288
0,271
0,255

0,357
0,332
0,310
0,291
0,274

0,303
0,281
0,262
0,246
0,232

15
16
17
18
19

0,575
0,553
0,532
0,514
0,496

0,471
0,452
0,434
0,418
0,403

0,407
0,388
0,372
0,356
0,343

0,335
0,319
0,305
0,293
0,281

0,332
0,316
0,301
0,288
0,276

0,276
0,262
0,250
0,240
0,230

0,288
0,274
0,261
0,249
0,238

0,242
0,230
0,219
0,209
0,200

0,259
0,246
0,234
0,223
0,214

0,220
0,208
0,198
0,189
0,181

20
21
22
23
24

0,480
0,465
0,450
0,437
0,425

0,389
0,377
0,365
0,354
0,343

0,330
0,318
0,307
0,297
0,287

0,270
0,261
0,252
0,243
0,235

0,265
0,255
0,246
0,238
0,230

0,220
0,212
0,204
0,197
0,191

0,229
0,220
0,212
0,204
0,197

0,192
0,185
0,178
0,172
0,166

0,205
0,197
0,189
0,182
0,176

0,174
0,167
0,160
0,155
0,149

25
26
27
28
29

0,413
0,402
0,391
0,382
0,372

0,334
0,325
0,316
0,308
0,300

0,278
0,270
0,262
0,255
0,248

0,228
0,221
0,215
0,209
0,203

0,222
0,215
0,209
0,202
0,196

0,185
0,179
0,173
0,168
0,164

0,190
0,184
0,179
0,173
0,168

0,160
0,155
0,150
0,146
0,142

0,170
0,164
0,159
0,154
0,150

0,144
0,140
0,135
0,131
0,127

30
31
32
33
34

0,363
0,355
0,347
0,339
0,332

0,293
0,286
0,280
0,273
0,267

0,241
0,235
0,229
0,224
0,218

0,198
0,193
0,188
0,184
0,179

0,191
0,186
0,181
0,177
0,172

0,159
0,155
0,151
0,147
0,144

0,164
0,159
0,155
0,151
0,147

0,138
0,134
0,131
0,127
0,124

0,145
0,141
0,138
0,134
0,131

0,124
0,120
0,117
0,114
0,111

35
36
37
38
39

0,325
0,318
0,312
0,306
0,300

0,262
0,256
0,251
0,246
0,242

0,213
0,208
0,204
0,200
0,196

0,175
0,172
0,168
0,164
0,161

0,168
0,165
0,161
0,157
0,154

0,140
0,137
0,134
0,131
0,129

0,144
0,140
0,137
0,134
0,131

0,121
0,119
0,116
0,113
0,111

0,127
0,124
0,121
0,119
0,116

0,108
0,106
0,103
0,101
0,099

40

0,294

0,237

0,192

0,158

0,151

0,126

0,128

0,108

0,114

0,097

OIV-MA-AS1-07 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Tableau 4 Valeurs critiques pour le F-Test (P=99%)


f1

10

11

12

13

14

15

1
2
3
4
5

4052
98,5
34,1
21,2
16,3

4999
99,0
30,8
18,0
13,3

5403
99,2
29,4
16,7
12,1

5625
99,3
28,7
16,0
11,4

5764
99,3
28,2
15,5
11,0

5859
99,3
27,9
15,2
10,7

5928
99,4
27,7
15,0
10,5

5981
99,4
27,5
14,8
10,3

6023
99,4
27,3
14,7
10,2

6056
99,4
27,2
14,5
10,1

6083
99,4
27,1
14,5
9,96

6106
99,4
27,1
14,4
9,89

6126
99,4
27,0
14,3
9,82

6143
99,4
26,9
14,2
9,77

6157
99,4
26,9
14,2
9,72

6
7
8
9
10

13,7
12,2
11,3
10,6
10,0

10,9
9,55
8,65
8,02
7,56

9,78
8,45
7,59
6,99
6,55

9,15
7,85
7,01
6,42
5,99

8,75
7,46
6,63
6,06
5,64

8,47
7,19
6,37
5,80
5,39

8,26
6,99
6,18
5,61
5,20

8,10
6,84
6,03
5,47
5,06

7,98
6,72
5,91
5,35
4,94

7,87
6,62
5,81
5,26
4,85

7,79
6,54
5,73
5,18
4,77

7,72
6,47
5,67
5,11
4,71

7,66
6,41
5,61
5,05
4,65

7,60
6,36
5,56
5,01
4,60

7,56
6,31
5,52
4,96
4,56

11
12
13
14
15

9,64
9,33
9,07
8,86
8,68

7,20
6,93
6,70
6,51
6,36

6,21
5,95
5,74
5,56
5,42

5,67
5,41
5,21
5,04
4,89

5,31
5,06
4,86
4,69
4,56

5,07
4,82
4,62
4,46
4,32

4,88
4,64
4,44
4,28
4,14

4,74
4,50
4,30
4,14
4,00

4,63
4,39
4,19
4,03
3,89

4,54
4,30
4,10
3,94
3,80

4,46
4,22
4,02
3,86
3,73

4,39
4,16
3,96
3,80
3,67

4,34
4,10
3,90
3,75
3,61

4,29
4,05
3,86
3,70
3,56

4,25
4,01
3,82
3,66
3,52

16
17
18
19
20

8,53
8,40
8,29
8,18
8,10

6,23
6,11
6,01
5,93
5,85

5,29
5,18
5,09
5,01
4,94

4,77
4,67
4,58
4,50
4,43

4,44
4,34
4,25
4,17
4,10

4,20
4,10
4,01
3,94
3,87

4,03
3,93
3,84
3,77
3,70

3,89
3,79
3,71
3,63
3,56

3,78
3,68
3,60
3,52
3,46

3,69
3,59
3,51
3,43
3,37

3,62
3,52
3,43
3,36
3,29

3,55
3,46
3,37
3,30
3,23

3,50
3,40
3,32
3,24
3,18

3,45
3,35
3,27
3,19
3,13

3,41
3,31
3,23
3,15
3,09

21
22
23
24
25

8,02
7,95
7,88
7,82
7,77

5,78
5,72
5,66
5,61
5,57

4,87
4,82
4,76
4,72
4,68

4,37
4,31
4,26
4,22
4,18

4,04
3,99
3,94
3,90
3,85

3,81
3,76
3,71
3,67
3,63

3,64
3,59
3,54
3,50
3,46

3,51
3,45
3,41
3,36
3,32

3,40
3,35
3,30
3,26
3,22

3,31
3,26
3,21
3,17
3,13

3,24
3,18
3,14
3,09
3,06

3,17
3,12
3,07
3,03
2,99

3,12
3,07
3,02
2,98
2,94

3,07
3,02
2,97
2,93
2,89

3,03
2,98
2,93
2,89
2,85

26
27
28
29
30

7,72
7,68
7,64
7,60
7,56

5,53
5,49
5,45
5,42
5,39

4,64
4,60
4,57
4,54
4,51

4,14
4,11
4,07
4,04
4,02

3,82
3,78
3,75
3,73
3,70

3,59
3,56
3,53
3,50
3,47

3,42
3,39
3,36
3,33
3,30

3,29
3,26
3,23
3,20
3,17

3,18
3,15
3,12
3,09
3,07

3,09
3,06
3,03
3,00
2,98

3,02
2,99
2,96
2,93
2,91

2,96
2,93
2,90
2,87
2,84

2,90
2,87
2,84
2,81
2,79

2,86
2,82
2,79
2,77
2,74

2,81
2,78
2,75
2,73
2,70

40
50
60
70
80

7,31
7,17
7,07
7,01
6,96

5,18
5,06
4,98
4,92
4,88

4,31
4,20
4,13
4,07
4,04

3,83
3,72
3,65
3,60
3,56

3,51
3,41
3,34
3,29
3,25

3,29
3,19
3,12
3,07
3,04

3,12
3,02
2,95
2,91
2,87

2,99
2,89
2,82
2,78
2,74

2,89
2,78
2,72
2,67
2,64

2,80
2,70
2,63
2,59
2,55

2,73
2,62
2,56
2,51
2,48

2,66
2,56
2,50
2,45
2,42

2,61
2,51
2,44
2,40
2,36

2,56
2,46
2,39
2,35
2,31

2,52
2,42
2,35
2,31
2,27

90
100
200
500

6,92
6,89
6,75
6,69
6,63

4,85
4,82
4,71
4,65
4,61

4,01
3,98
3,88
3,82
3,78

3,53
3,51
3,41
3,36
3,32

3,23
3,21
3,11
3,05
3,02

3,01
2,99
2,89
2,84
2,80

2,84
2,82
2,73
2,68
2,64

2,72
2,69
2,60
2,55
2,51

2,61
2,59
2,50
2,44
2,41

2,52
2,50
2,41
2,36
2,32

2,45
2,43
2,34
2,29
2,25

2,39
2,37
2,27
2,22
2,18

2,33
2,31
2,22
2,17
2,13

2,29
2,27
2,17
2,12
2,08

2,24
2,22
2,13
2,07
2,04

f2

OIV-MA-AS1-07 : R2000

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Tableau 4 Valeurs critiques pour le F-Test (P=99%) (Suite)


f1

17

18

19

20

30

40

50

60

70

80

1
2
3
4
5

6169
99,4
26,8
14,2
9,68

6182
99,4
26,8
14,1
9,64

6192
99,4
26,8
14,1
9,61

6201
99,4
26,7
14,0
9,58

6209
99,5
26,7
14,0
9,55

6261
99,5
26,5
13,8
9,38

6287
99,5
26,4
13,7
9,29

6303
99,5
26,4
13,7
9,24

6313
99,5
26,3
13,7
9,20

6320
99,5
26,3
13,6
9,18

6326
99,5
26,3
13,6
9,16

6335
99,5
26,2
13,6
9,13

6350
99,3
26,2
13,5
9,08

6361
99,5
26,1
13,5
9,04

6366
99,5
26,1
13,5
9,02

6
7
8
9
10

7,52
6,28
5,48
4,92
4,52

7,48
6,24
5,44
4,89
4,49

7,45
6,21
5,41
4,86
4,46

7,42
6,18
5,38
4,83
4,43

7,40
6,16
5,36
4,81
4,41

7,23
5,99
5,20
4,65
4,25

7,14
5,91
5,12
4,57
4,17

7,09
5,86
5,07
4,52
4,12

7,06
5,82
5,03
4,48
4,08

7,03
5,80
5,01
4,46
4,06

7,01
5,78
4,99
4,44
4,04

6,99
5,75
4,96
4,41
4,01

6,93
5,70
4,91
4,36
3,96

6,90
5,67
4,88
4,33
3,93

6,88
5,65
4,86
4,31
3,91

11
12
13
14
15

4,21
3,97
3,78
3,62
3,49

4,18
3,94
3,74
3,59
3,45

4,15
3,91
3,72
3,56
3,42

4,12
3,88
3,69
3,53
3,40

4,10
3,86
3,66
3,51
3,37

3,94
3,70
3,51
3,35
3,21

3,86
3,62
3,42
3,27
3,13

3,81
3,57
3,37
3,22
3,08

3,77
3,54
3,34
3,18
3,05

3,75
3,51
3,32
3,16
3,02

3,73
3,49
3,30
3,14
3,00

3,70
3,47
3,27
3,11
2,98

3,65
3,41
3,22
3,06
2,92

3,62
3,38
3,19
3,03
2,89

3,60
3,36
3,17
3,00
2,87

16
17
18
19
20

3,37
3,27
3,19
3,12
3,05

3,34
3,24
3,16
3,08
3,02

3,31
3,21
3,13
3,05
2,99

3,28
3,19
3,10
3,03
2,96

3,26
3,16
3,08
3,00
2,94

3,10
3,00
2,92
2,84
2,78

3,02
2,92
2,84
2,76
2,69

2,97
2,87
2,78
2,71
2,64

2,93
2,83
2,75
2,67
2,61

2,91
2,81
2,72
2,65
2,58

2,89
2,79
2,70
2,63
2,56

2,86
2,76
2,68
2,60
2,54

2,81
2,71
2,62
2,55
2,48

2,78
2,68
2,59
2,51
2,44

2,75
2,65
2,57
2,49
2,42

21
22
23
24
25

2,99
2,94
2,89
2,85
2,81

2,96
2,91
2,86
2,82
2,78

2,93
2,88
2,83
2,79
2,75

2,90
2,85
2,80
2,76
2,72

2,88
2,83
2,78
2,74
2,70

2,72
2,67
2,62
2,58
2,54

2,64
2,58
2,54
2,49
2,45

2,58
2,53
2,48
2,44
2,40

2,55
2,50
2,45
2,40
2,36

2,52
2,47
2,42
2,38
2,34

2,50
2,45
2,40
2,36
2,32

2,48
2,42
2,37
2,33
2,29

2,42
2,36
2,32
2,27
2,23

2,38
2,33
2,28
2,24
2,19

2,36
2,31
2,26
2,21
2,17

26
27
28
29
30

2,78
2,75
2,72
2,69
2,66

2,75
2,71
2,68
2,66
2,63

2,72
2,68
2,65
2,63
2,60

2,69
2,66
2,63
2,60
2,57

2,66
2,63
2,60
2,57
2,55

2,50
2,47
2,44
2,41
2,39

2,42
2,38
2,35
2,33
2,30

2,36
2,33
2,30
2,27
2,25

2,33
2,29
2,26
2,23
2,21

2,30
2,27
2,24
2,21
2,18

2,28
2,25
2,22
2,19
2,16

2,25
2,22
2,19
2,16
2,13

2,19
2,16
2,13
2,10
2,07

2,16
2,12
2,09
2,06
2,03

2,13
2,10
2,06
2,03
2,01

40
50
60
70
80

2,48
2,38
2,31
2,27
2,23

2,45
2,35
2,28
2,23
2,20

2,42
2,32
2,25
2,20
2,17

2,39
2,29
2,22
2,18
2,14

2,37
2,27
2,20
2,15
2,12

2,20
2,10
2,03
1,98
1,94

2,11
2,01
1,94
1,89
1,85

2,06
1,95
1,88
1,83
1,79

2,02
1,91
1,84
1,78
1,75

1,99
1,88
1,81
1,75
1,71

1,97
1,86
1,78
1,73
1,69

1,94
1,82
1,75
1,70
1,65

1,87
1,76
1,68
1,62
1,58

1,85
1,71
1,63
1,57
1,53

1,80
1,68
1,60
1,54
1,49

90
100
200
500

2,21
2,19
2,09
2,04
2,00

2,17
2,15
2,06
2,00
1,97

2,14
2,12
2,03
1,97
1,93

2,11
2,09
2,00
1,94
1,90

2,09
2,07
1,97
1,92
1,88

1,92
1,89
1,79
1,74
1,70

1,82
1,80
1,69
1,63
1,59

1,76
1,74
1,63
1,56
1,52

1,72
1,69
1,58
1,52
1,47

1,68
1,66
1,55
1,48
1,43

1,66
1,63
1,52
1,45
1,40

1,62
1,60
1,48
1,41
1,36

1,55
1,52
1,39
1,31
1,25

1,50
1,47
1,33
1,23
1,15

1,46
1,43
1,28
1,16
1,00

OIV-MA-AS1-07 : R2000

100 200 500

16

f2

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Tableau 5 Valeurs critiques pour le test de Dixon


Critres du test

Valeurs critiques
m

95%

99%

Q10 =

Z(2) Z(1) ou Z(H) Z (H 1)


Z(H) Z(1)
Z(H) Z(1)
La plus grande de ces deux valeurs

3
4
5
6
7

0,970
0,829
0,710
0,628
0,569

0,994
0,926
0,821
0,740
0,680

Q11 =

Z(2) Z(1) ou Z(H) Z (H 1)


Z(H 1) Z(1)
Z(H) Z(2)
La plus grande de ces deux valeurs

8
9
10
11
12

0,608
0,564
0,530
0,502
0,479

0,717
0,672
0,635
0,605
0,579

Q22 =

Z(3) Z(1) ou Z(H) Z (H 2)


Z(H 2) Z(1)
Z(H) Z(3)
La plus grande de ces deux valeurs

13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40

0,611
0,586
0,565
0,546
0,529
0,514
0,501
0,489
0,478
0,468
0,459
0,451
0,443
0,436
0,429
0,423
0,417
0,412
0,407
0,402
0,397
0,393
0,388
0,384
0,381
0,377
0,374
0,371

0,697
0,670
0,647
0,627
0,610
0,594
0,580
0,567
0,555
0,544
0,535
0,526
0,517
0,510
0,502
0,495
0,489
0,483
0,477
0,472
0,467
0,462
0,458
0,454
0,450
0,446
0,442
0,438

OIV-MA-AS1-07 : R2000

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Etude collaborative

Tableau 6 Feuille de rsultats dtude collaborative

Analyse
Lab
n

Echantillon

Valeurs individuelles x1
1

n1

x1

s1

s21

548 556 558 553 542

551 6,47 41,8

300 299 304 308 300

302 3,83 14,7 x1, < x

567 558 563 532* 560 560 563 567

563 3,51 12,3

557 550 555 560 551

555 4,16 17,3

569 575 565 560 572

568 5,89 34,7

550 546 549 557 588 570 576 568

563

557 560 560 552 547

555 5,63 31,7

548 543 560 551 548

550 6,28 39,5

558 563 551 555 560

556 5,63 31,7

10

554 559 551 545 557

553

14,9 222,
s1 > s1
2
6

5,5 30,2

Donnes statistiques :

Test de Bartlett :

Au sein de laboratoires : s1= 5.37 1 = 34

PB = 3.16 < 15.51 (95%; = 8)

Entre les laboratoires : sz = 13.97 z = 7

Lanalyse de variance :

sr = 5.37

PF = 6.76 > 3.21 (99%; 1 = 7; 2 = 34)

r = 15 sR = 7.78

OIV-MA-AS1-07 : R2000

R = 22

13

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques

Fidlit des mthodes analytiques


(Rsolution oeno 5/99)
Les donnes concernant la fidlit des mthodes analytiques dtermines par des
tudes collaboratives sont applicables dans les cas suivants :
1) Vrification de l'acceptabilit des rsultats obtenus par un Laboratoire avec une
mthode de rfrence.
2) valuation des rsultats analytiques dmontrant qu'une limite lgale a t dpasse.
3) Comparaison des rsultats obtenus par deux ou plusieurs laboratoires, et
comparaison des ces rsultats avec une valeur de rfrence.
4) Evaluation des rsultats obtenus avec des mthodes non valides.
1) Vrification de l'acceptabilit des rsultats obtenus avec une mthode de
rfrence.
La validit des rsultats d'une analyse dpend des points suivants :
- Le laboratoire devra accomplir les analyses dans les conditions d'un systme
d'assurance qualit appropri, couvrant la structure, lorganisation, les
responsabilits, les procdures, etc.
- Faisant partie du systme d'assurance qualit, le laboratoire devra oprer avec une
procdure de Contrle de Qualit interne.
- Les rsultats devront avoir t obtenus sous les critres d'acceptabilit dcrits dans la
procdure de Contrle de Qualit interne.
Le Contrle de Qualit interne sera tabli suivant les normes internationalement
reconnues comme par exemple, celles figurant dans le document IUPAC "Harmonized
Guidelines for International Quality Control in Analytical Laboratories".
Le Contrle de Qualit implique lanalyse de matriels de rfrence.
Les matriels de rfrence sont constitus de la mme matrice que les chantillons
analyser, et ils contiennent une concentration approprie et connue de lanalyte,
semblable celle trouve dans l'chantillon.
Les matriels de rfrence seront autant que possible des matriels certifis par une
organisation internationalement reconnue.
Cependant, pour beaucoup d'analyses, les matriels de rfrence certifis appropris
n'existent pas. Dans ce cas, on peut utiliser, par exemple, un matriel analys par
plusieurs laboratoires dans un essai de comptence, en considrant la moyenne des
rsultats comme la valeur assigne pour l'analyte.
On peut aussi prparer un matriel de rfrence par formulation (solution modle
de composition connue), ou en ajoutant une quantit connue de l'analyte un
matriel qui ne le contient pas, ou encore, en faisant un essai de rcupration (ajout
dos) sur un des chantillons analyser.

OIV-MA-AS1-08 : R1999

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques

Le Contrle de Qualit est mis en oeuvre en insrant dans chaque srie


dchantillons, des matriels de rfrence, et en analysant des doubles, soit des
matriels de rfrence, soit des chantillons essai. C'est une vrification de
lexcution correcte de la mthode, elle doit tre indpendante de la calibration et
du protocole analytique, puisque son but est de les vrifier.
On entend par srie un nombre d'chantillons analyss sous conditions de
rptabilit. Le contrle interne sert vrifier que le niveau d'incertitude appropri
n'est pas dpass.
Si lon considre les rsultats analytiques pour le matriel de contrle comme faisant
partie d'une population normale de moyenne m et d'cart type s, seulement autour de
0,3% des rsultats seront hors des limites m 3s. Lorsque l'on obtient des rsultats
aberrants ( hors des limites), le systme est considr hors de contrle statistique
(donnes non fiables)
Le contrle est effectu graphiquement avec les Cartes de Contrle de Shewhart. Pour
obtenir ces graphiques, les valeurs mesures pour le matriel de rfrence sont portes
sur l'axe vertical, et le numro de srie sur l'axe horizontal. La carte comporte
galement des lignes horizontales, reprsentant la moyenne, m, m 2s (limites
d'attention, s = cart type) et m 3s (limites d'action).(Figure 1).
Pour estimer l'cart type, un matriel de contrle doit tre analys en double, au moins
12 reprises. Chaque double analyse doit tre faite sous conditions de rptabilit,
insre de manire alatoire dans une srie d'chantillons. Des analyses seront
dupliques des jours diffrents pour reflter les changements raisonnables d'une srie
l'autre. Les variations peuvent avoir plusieurs causes : la modification de la
composition des ractifs, les recalibrations des instruments, et ventuellement le travail
doprateurs diffrents. Aprs avoir limin les donnes aberrantes au moyen du Test
de Grubbs, on peut calculer l'cart type pour construire les graphiques de Shewhart.
Cet cart type est compar avec celui de la mthode de rfrence. Si l'on n'arrive pas
la prcision publie pour la mthode de rfrence, les causes devront tre recherches.
Les limites de prcision du laboratoire doivent tre rvises priodiquement, en
rptant la procdure indique.
Une fois que la Carte de Contrle est construite, on porte sur le graphique les donnes
obtenues dans chaque srie pour le matriel de contrle.
Une srie est considre hors de contrle statistique lorsque :
I) Une valeur dpasse la limite d'action.
II) La valeur actuelle et la prcdente sont hors de la limite d'attention, tout en tant
situes lintrieur de la limite d'action.
III) Neuf valeurs successives se trouvent du mme cot de la moyenne.
Le laboratoire doit rpondre une condition de hors de contrle, en rejetant les
rsultats de la srie, en faisant des essais pour identifier les causes et en prenant des
actions pour les remdier.

OIV-MA-AS1-08 : R1999

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques

Une Carte de Contrle de Shewhart peut tre faite galement pour les diffrences
entre doubles analyses d'un mme chantillon, spcialement quand des matriels de
rfrence n'existent pas. Dans ce cas, la diffrence absolue entre deux analyses d'un
mme chantillon, est porte sur le graphique. La ligne infrieure de la carte est 0,
la limite d'attention est 1,128 Sw, et la limite d'action est 3,686 Sw, pour Sw = cart
type dans une srie.
Ce type de graphique ne rend compte que de la rptabilit. Elle ne doit pas tre
suprieure la rptabilit publie pour la mthode.
En absence de matriels de contrle, il faut, de temps en temps, vrifier que la limite de
reproductibilit de la mthode de rfrence n'est pas dpasse par comparaison des
rsultats analytiques avec les rsultats obtenus sur le mme chantillon par un
laboratoire expriment :
On fait une double dtermination dans chaque laboratoire, et on applique la formule :

C r D95 ( y1 - y 2 ) =
CrD95
y1
y2
R
r

=
=
=
=
=

r2
R 2
2

Diffrence critique (P=0,95)


Moyenne de deux rsultats obtenus par le laboratoire 1
Moyenne de deux rsultats obtenus par le laboratoire 2
Reproductibilit de la mthode de rfrence.
Rptabilit de la mthode de rfrence.

Si la diffrence critique est dpasse on doit en trouver la cause, et l'exprience sera


rpte dans un dlai d'un mois.
2) Evaluation des rsultats analytiques dmontrant qu'une limite lgale a t
dpasse.
Quand un rsultat analytique montre qu'une limite a t dpasse, on applique la
procdure suivante :
1) Lorsque il s'agit d'un rsultat individuel, faire une seconde analyse dans des
conditions de rptabilit. S'il n'est pas possible de faire une seconde analyse sous
conditions de rptabilit, mettre en oeuvre une double analyse sous conditions de
rptabilit et utiliser ces dernires donnes pour valuer la diffrence critique.
2) Dterminer la valeur absolue de la diffrence entre la moyenne des rsultats
obtenus sous conditions de rptabilit et la limite lgale. Une valeur absolue de la
diffrence plus grande que la diffrence critique montre que l'chantillon ne s'ajuste
pas aux spcifications.

C r D95 ( y - m0 ) = 2 1
2

OIV-MA-AS1-08 : R1999

2 2 n-1
R -r n

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques

La diffrence critique est calcule par la formule :


y
=
Moyenne des rsultats obtenus
=
Limite
m0
n
=
Nombre d'analyses
R
=
Reproductibilit
r
=
Rptabilit
Autrement dit, si c'est une limite maximale, la moyenne des rsultats ne doit pas tre
suprieure
- m0)
m0 + CrD95 (y
Si la limite est un minimum, la moyenne des rsultats ne doit pas tre infrieure
m0 - CrD95 (y
- m0)
3) Comparaison des rsultats obtenus par deux ou plusieurs laboratoires et
comparaison de ces rsultats avec une valeur de rfrence.
Pour dcider si les donnes provenant de deux laboratoires sont en accord, on calcule
la diffrence absolue entre les deux rsultats et on compare avec la diffrence critique

C r D95 ( y1 - y 2 ) = 2 R2 - r 2 (1y1
y2
n1
n2
R
r

=
=
=
=
=
=

1
1
)
2 n1 2 n2

Moyenne des rsultats au laboratoire n 1


Moyenne des rsultats au laboratoire n 2
Nombre d'analyses/chantillon au laboratoire n 1
Nombre d'analyses/chantillon au laboratoire n 2
Reproductibilit
Rptabilit

Si les rsultats sont la moyenne de deux dterminations, la formule se simplifie :

r2
C r D95 ( y1 - y 2 ) = R 2
2

Si les donnes sont des rsultats individuels, la diffrence critique est R.


Si la diffrence critique n'est pas dpass, on conclut que les rsultats des deux
laboratoires sont en concordance.
- Comparaison des rsultats obtenus par plusieurs laboratoires avec une valeur de
rfrence.
Supposons p laboratoires, ayant fait n1 dterminations, de moyenne yi pour chaque
laboratoire, et avec une moyenne totale

y=

OIV-MA-AS1-08 : R1999

1
yi
p

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques

La moyenne de tous les laboratoires est compare avec la valeur de rfrence. Si la


diffrence absolue dpasse la diffrence critique, calcul selon la formule suivante, on
conclut que les rsultats ne sont pas en accord avec la valeur de rfrence.

C r D95 ( y - m0 ) =

1
2p

R2 - r 2 (1 -

1 1
)
p n1

CrD95 = Diffrence critique, calcule comme indiqu au point 2, pour la mthode de


rfrence.
La valeur de rfrence peut tre, par exemple, la valeur assigne un matriel de
rfrence, ou la valeur obtenue par un autre ou le mme Laboratoire avec une mthode
diffrente.
4) Evaluation des rsultats analytiques obtenus avec des mthodes non valides.
Une valeur provisoire de la reproductibilit pour une mthode non valide peut tre
tablie par comparaison avec un second laboratoire :

R prov =
y1
y2
r

=
=
=

r2
( y1 - y 2 ) +
2
2

Moyenne des rsultats obtenus par le laboratoire n 1


Moyenne des rsultats obtenus par le laboratoire n 2
Rptabilit provisoire dtermine dans le laboratoire

La reproductibilit provisoire peut tre utilise pour calculer la diffrence critique.


Si la reproductibilit provisoire est infrieure a deux fois la rptabilit, elle devra tre
fixe 2r.
Une reproductibilit suprieure trois fois la rptabilit ou deux fois la valeur
calcule par l'quation de Horwitz, n'est pas acceptable.
quation de Horwitz :

RSD R % = 21-0,5log10 C
RSDR % = Ecart type relatif de la reproductibilit
(exprim comme pourcentage de la moyenne).
C
= Concentration exprime comme fraction
10g/100g=0,1

dcimale :

exemple

Cette quation fut obtenue empiriquement partir de plus de 3000 tudes


collaboratives comprenant une grande diversit d'analytes, matrices et techniques de
mesure. En absence dautre information, des valeurs de la RSDR infrieures ou gales
la RSDR calcule par l'quation de Horwitz peuvent tre considres comme
acceptables.
OIV-MA-AS1-08 : R1999

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques

Valeurs de RSDR % calcules par l'quation de Horwitz


Concentration
-9

10
10-8
10-7
10-6
10-5
10-4
10-3
10-2
10-1
1

RSDR %
45
32
23
16
11
8
5,6
4
2,8
2

Si un rsultat analytique obtenu avec une mthode non valide est proche d'une limite
spcifie par la lgislation, la limite de dcision considre sera, pour le cas d'une
limite suprieure :
S = m0 + {(Rrout/Rref)-1} CrD95
et pour une limite infrieure :
S = m0 - {(Rrout/Rref)-1} CrD95
S
m0
Rrout
Rref
CrD95

=
=
=
=
=

limite de dcision
limite lgale
Reproductibilit provisoire estime pour la mthode non valide.
Reproductibilit de la mthode de rfrence.
Diffrence critique, calcule comme indiqu au point 2, pour la mthode
de rfrence.
Un rsultat dpassant la limite de dcision doit tre remplac par un rsultat final
obtenu avec la mthode de rfrence.
Diffrences critiques pour les niveaux de probabilit autres que 95%
Ces diffrences peuvent tre obtenues en multipliant les diffrences critiques au niveau
95% par les coefficients donns dans la table 1.
Table 1 - Coefficients multiplicateurs permettant de calculer les diffrences critiques
pour des niveaux de probabilit autres que 95%
Niveau de probabilit P
90
95
98
99
99,5
OIV-MA-AS1-08 : R1999

Coefficient multiplicateur
0,82
1,00
1,16
1,29
1,40
6

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV

Fidlit des mthodes analytiques


CARTE DE CONTROLE DE SHEWHART

BIBLIOGRAPHIE
- "Harmonized Guidelines for Internal Quality Control in Analytical Chemistry
Laboratories". IUPAC. Pure and App. Chem. Vol 67, n 4, 649-666, 1995
- "Shewhart Control Charts" ISO 8258. 1991.
- "Precision of test methods - Determination of repeatability and reproducibility for a
standard test method by inter-laboratory tests". ISO 5725, 1994.
- "Draft Commission Regulation of establishing rules for the application of reference and
routine methods for the analysis and quality evaluation of milk and milk products".
Commission of the European Communities, 1995.
- "Harmonized protocols for the adoption of standardized analytical methods and for the
presentation of their performance characteristics". IUPAC. Pure an App. Chem., Vol. 62,
n 1, 149-162. 1990.

OIV-MA-AS1-08 : R1999

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

Protocole pour la planification, la conduite et linterprtation


des tudes de performance des mthodes danalyse
(Rsolution oeno 6/2000)
INTRODUCTION
Aprs un certain nombre de rencontres et d'ateliers, un groupe de reprsentants de
27 organisations a adopt par consensus un "Protocole pour la planification, la
conduite et l'interprtation des tudes collaboratives", publi dans Pure & Appl.
Chem. 60, 855-864, (1998). Un certain nombre d'organisations ont accept et
utilis ce protocole. En se basant sur leur exprience et les recommandations du
"Codex Committee on Methods of Analysis and Sampling" (programme commun
FAO/WHO pour Food Standards. Rapport de la Dix huitime Session, 9-13
Novembre 1992; FAO, Rome, Italie, ALINORM 92/93, sections 34-39), il a t
recommand d'inclure 3 rvisions mineures au protocole original. Ce sont : (1)
Enlever le plan avec double division des niveaux de teneurs (en anglais : double
split level) parce que le terme d'interaction qu'il gnre dpend du choix des
niveaux et si l'interaction a une signification statistique, elle ne peut pas tre
interprte d'un point de vue physique (2). Dvelopper la dfinition de "matriau"
(3). Faire passer de 1 2,5 % le critre utilis pour liminer un rsultat aberrant.
Le protocole rvis qui inclut ces changements est reproduit ci-dessous. Quelques
rvisions dans la rdaction ont aussi t faites pour amliorer la lecture. Le
vocabulaire et les dfinitions du document "Nomenclature des Etudes Interlaboratoires (Recommandations 1994)" [publi dans Pure Applied Chem., 66,
1903-1911 (1994)] ont t inclus dans cette rvision, ainsi que, autant que possible,
les termes appropris de l'International Organization for Standardization (ISO)
modifis pour les appliquer la chimie analytique.
PROTOCOLE
1. Travail prliminaire
Les tudes (collaboratives) de performance des mthodes exigent un effort
considrable et devraient tre entreprises seulement pour des mthodes qui ont
reu ou subi un test prliminaire adquat. Ce test interne au laboratoire, devrait
inclure si possible (quand cela est applicable), l'information sur les points
suivants :
1.1. Estimation prliminaire de la fidlit
Estimation de l'cart-type total des rsultats analytiques intralaboratoire sur
l'intervalle de concentration intressant, tudi au moins la limite suprieure
et la limite infrieure de l'intervalle de concentration, avec une insistance
particulire sur la valeur standard ou la valeur de la spcification.
OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

NOTE 1 : L'cart-type total intralaboratoire est une mesure du manque de


fidlit plus globale que celle de l'cart-type de rptabilit de l'ISO, 3.3 cidessous. Cet cart-type reprsente la variation intralaboratoire la plus grande
qui peut tre attendue des performances de la mthode; elle inclut au moins la
variabilit entre jours diffrents et aussi de prfrence entre droites
d'talonnage diffrentes. Elle inclut les variations entre-sries (entre-lots) et
intra-srie, (intra-lot). En ce sens elle peut tre considre comme une mesure
de la reproductibilit l'intrieur du laboratoire. Si cette valeur est vraiment
dans les limites acceptables, il ne faut pas s'attendre ce que l'cart type entre
laboratoires (cart-type de reproductibilit) soit meilleur. Cette fidlit n'est
pas estime partir de l'tude minimum dcrite dans ce protocole.
NOTE 2 : L'cart-type total intralaboratoire peut aussi tre estim partir
d'essais de robustesse qui indiquent avec quelle rigueur les facteurs
exprimentaux doivent tre contrls et quelles sont les limites de variations
autorises. Ces limites dtermines exprimentalement devraient tre incluses
dans la description de la mthode.
1.2. Erreurs systmatique (biais)
Estimations de l'erreur systmatique des rsultats analytiques sur l'intervalle de
concentration et pour les substances analyser, tudies au minimum aux
limites suprieure et infrieure de l'intervalle de concentration, avec une
insistance particulire sur la valeur standard ou de la valeur de la spcification.
Les rsultats obtenus en appliquant la mthode aux matriaux de rfrence
adquats doivent tre nots.
1.3. Recouvrement
Recouvrement d ajouts effectus sur des matriaux vrais, sur des extraits,
sur les solutions de digestion, ou d'autres solutions issues de leur traitement.
1.4. Domaine d'application
Possibilit qu'a la mthode d'identifier et de mesurer les formes physiques et
chimiques de l'analyte susceptibles d'tre prsentes dans les matriaux, en
tenant compte des effets de matrice.
1.5. Interfrence
Effet des autres constituants qui sont susceptibles d'tre prsents des
concentrations apprciables dans les matrices considres et qui peuvent
interfrer sur le dosage.
1.6. Comparaison de mthode
Rsultats de comparaison de la mthode des mthodes existantes testes et
destines des usages similaires.
1.7. Procdures d'talonnage
Les procdures spcifies pour l'talonnage et la correction de blanc ne doivent
pas introduire de biais important dans les rsultats.
OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

1.8. Description de mthode


La mthode doit tre crite de faon claire et sans ambigut.
1.9. Chiffres significatifs
Le laboratoire qui initie l'tude devrait indiquer le nombre de chiffres
significatifs qui doit tre report en se basant sur les donnes sortant de
l'instrument de mesure.
NOTE : En faisant des calculs statistiques partir des donnes, il faut utiliser
pleinement la puissance du calculateur ou de l'ordinateur et ne pas arrondir ou
tronquer les rsultats avant de donner la moyenne finale ou les carts-type.
Arriv ce stade, les carts-type sont arrondis deux chiffres significatifs et
les moyennes et dviations correspondantes sont arrondies pour fournir les
chiffres significatifs de l'cart-type. Par exemple, si sR = 0,012, x est report
comme 0,147 et non pas comme 0,1473 ou 0,15 et le coefficient de variation
donn est 8,2 % (les symboles sont dfinis dans l'Appendice 1). Si les calculs
d'carts-type doivent tre tablis manuellement par tapes avec transfert des
rsultats intermdiaires, le nombre de chiffres significatifs retenir pour les
nombres au carr devrait tre au moins 2 fois le nombre de chiffres fournis par
les donnes plus 1.
2. Plan d'tude de performance de la mthode
2.1. Nombre de matriaux
Pour un type unique de substance, il faut utiliser au moins 5 matriaux
(matriaux d'essai); ce nombre minimum peut tre rduit 3, seulement si un
niveau unique est spcifi pour une matrice unique. Pour ce paramtre du plan
d'expriences, les deux parties provenant d'un niveau de teneurs (en anglais :
split level) divis et les deux parties individuelles de rpliques effectues en
aveugle (en anglais : blind duplicate) par laboratoire, sont considres comme
un matriau unique.
NOTE 1 : Un matriau est une combinaison "analyte/matrice/concentration"
laquelle s'appliquent les paramtres de performance de la mthode. Ce
paramtre dtermine l'applicabilit d'une mthode. Pour appliquer la mthode
un certain nombre de substances diffrentes, un nombre suffisant de matrices
et de niveaux devrait tre choisi pour tenir compte des interfrences
potentielles et de la concentration la plus utilise.
NOTE 2 : Les matriaux d'essai rpliqus en "aveugle" ou en "non aveugle" en
nombre gal ou suprieur 2 constituent d'un point de vue statistique un seul
matriau (ils ne sont pas indpendants).
NOTE 3 : Un niveau divis une fois (paire de Youden) analys en statistique
comme une paire constitue un seul matriau; si l'analyse statistique est
effectue et reporte en considrant que les chantillons sont indpendants, ils
OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

constituent 2 matriaux. De plus, la paire peut tre utilise pour calculer


l'cart-type intralaboratoire sr :
sr =

(di 2 ) / 2n

(pour essais dupliqus, en aveugle ou non)

sr =

(di 2 ) / 2(n1)

(pour paire de Youden)

o di est la diffrence entre 2 valeurs individuelles partir du niveau divis


pour chaque laboratoire et n le nombre de laboratoires. Dans ce cas particulier
l'cart-type entre laboratoires sR est seulement la moyenne des deux valeurs de
sR calcules partir des composantes individuelles du niveau divis et est
utilis seulement pour vrifier les calculs.
NOTE 4 : Le blanc ou contrle ngatif peut tre un matriau ou non selon la
finalit de l'analyse. Par exemple, dans l'analyse de traces o il y a des niveaux
trs faibles (proches de la limite et quantification), les blancs sont considrs
comme des matriaux et sont ncessaires pour dterminer les "limites de
mesure". Cependant si le blanc est seulement un contrle de procdure en
macro analyse (par ex., la matire grasse dans le fromage) il ne serait pas
considr comme un matriau.
2.2. Nombre de laboratoires
Au moins 8 laboratoires doivent reporter les rsultats pour chaque matriau;
dans le cas o il n'est pas possible d'obtenir ce nombre (par ex., appareillage
trs cher ou laboratoires spcialiss requis) l'tude peut tre conduite avec un
nombre moins important de laboratoires, mais avec un minimum de
5 laboratoires. Si l'tude est ralise pour une utilisation internationale de la
mthode, les laboratoires de diffrents pays doivent y participer. Dans le cas
de mthodes exigeant l'utilisation d'appareils spcialiss, l'tude pourrait
inclure l'ensemble des laboratoires disponibles. Dans de tels cas, "n" est utilis
au dnominateur pour calculer l'cart-type au lieu de "n-1". Les laboratoires
qui participent par la suite l'tude doivent dmontrer qu'ils peuvent raliser
les analyses aussi bien que les laboratoires participants d'origine.
2.3. Nombre de rpliques
Les paramtres de rptabilit doivent tre estims en utilisant l'une des
combinaisons suivantes (listes dans l'ordre approximatif de prfrence) :
2.3.1. Niveau divis
Pour chaque niveau qui est divis et constitue seulement un matriau unique
d'un point de vue plan et analyse statistique, utiliser 2 matriaux d'essai
presque identiques diffrant seulement lgrement dans leur concentration en
analyte (par exemple de moins de 1 5 %). Chaque laboratoire doit analyser
chaque matriau d'essai une fois et seulement une fois.

OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

NOTE : Le critre statistique qui doit tre satisfait pour qu'une paire
d'chantillons analyser constitue un niveau divis est que l'cart-type de
reproductibilit des 2 parties du niveau divis une fois doit tre gal.
2.3.2. Combinaison de rpliques en aveugle et de niveau divis
Utiliser des niveaux diviss pour quelques matriaux et des rpliques en
aveugle pour d'autres matriaux dans la mme tude (valeurs uniques pour
chaque matriau d'essai soumis).
2.3.3. Rpliques en aveugle
Pour chaque matriau, utiliser des rpliques en aveugle identiques; quand les
donnes ne peuvent tre censures (par ex., entre, calcul et impression
automatique), il est possible d'utiliser des rpliques identiques non ralises en
aveugle.
2.3.4. Rpliques connues
Pour chaque matriau, utiliser des rpliques connues (au moins 2 analyses de
prises d'essai issues d'un mme matriau d'essai), mais seulement lorsque
l'utilisation de l'un des plans prcdents n'est pas pratique.
2.3.5. Analyses indpendantes
Utiliser seulement une prise d'essai unique de chaque matriau (c'est--dire, ne
pas raliser des analyses multiples) dans l'tude, mais compenser
l'impossibilit de calculer les paramtres de rptabilit par l'tude des
paramtres de contrle de qualit ou les autres donnes intralaboratoires
obtenues indpendamment de l'tude de performance de la mthode.
3. Analyse statistique (voir diagramme, A.4.1.)
Pour l'analyse statistique des donnes, les procdures statistiques requises
listes ci-dessous doivent tre ralises et les rsultats reports. Les procdures
supplmentaires, additionnelles, ne sont pas cartes.
3.1. Donnes valides
Seuls les rsultats valides devraient tre reports et soumis au traitement
statistique. Les donnes valides sont les donnes rsultant de performance
normale des analyses de laboratoire; elles ne sont pas entaches par des
dviations de mthode, de mauvais fonctionnement des instruments,
d'vnements inattendus pendant la ralisation de la mthode ou par des
erreurs d'criture, de typographie et d'arithmtique.
3.2. Analyse de variance un facteur
L'analyse de variance un facteur et le traitement des valeurs aberrantes
doivent tre appliqus sparment chaque matriau (matriau d'essai) pour
estimer les composantes de la variance et les paramtres de rptabilit et
reproductibilit.

OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

3.3. Estimation initiale


Calculer la moyenne x (= la moyenne des moyennes des laboratoires), le
coefficient de variation de rptabilit, RSDr, et le coefficient de variation de
reproductibilit, RSDR sans enlever les valeurs aberrantes, mais en utilisant
seulement les donnes valides.
3.4. Traitement des valeurs aberrantes
Les paramtres estims de fidlit qui doivent tre aussi reports sont bass sur
les donnes initiales dbarrasses de toutes les valeurs aberrantes signales par
la procdure harmonise de 1994 d'limination des valeurs aberrantes. Cette
procdure consiste essentiellement appliquer les tests de Cochran et de
Grubbs (au seuil de probabilit P de 2,5 %, unilatral pour le Cochran et
bilatral pour le Grubbs) jusqu' ce qu'il n'y ait plus de valeurs aberrantes
indiques, ou jusqu' ce que le nombre initial des laboratoires fournissant des
rsultats valides chute de 22,2 % (= 2/9).
NOTE : Une consultation rapide du laboratoire qui reporte des valeurs
suspectes peut permettre de corriger des fautes ou de dcouvrir les conditions
qui ont conduit aux donnes invalides, 3.1. Il est prfrable de reconnatre des
fautes et des rsultats invalides per se que de se baser sur des tests statistiques
pour enlever des valeurs qui s'cartent.
3.4.1. Test de Cochran
D'abord appliquer le test de Cochran des rsultats aberrants (test unilatral
P = 2,5 %) et enlever tout laboratoire dont la valeur critique excde la valeur
tabule pour le nombre de laboratoires et de rpliques considres, Appendice
A.3.1,3.4.2.
3.4.2. Tests de Grubbs
Appliquer le test de Grubbs bilatral aux valeurs uniques et enlever tout
laboratoire aberrant. Si aucun laboratoire n'est signal aberrant, appliquer alors
les tests de Grubbs pour les valeurs par paire (bilatral), P = 2,5 % au total.
Enlever tout(s) laboratoire(s) signal(s) par ces tests dont la valeur critique
excde la valeur tabulaire donne dans la colonne approprie de la table,
Appendice A.3.3. Arrter quand l'application suivante du test signale plus de
22,2 % (2 sur 9) des laboratoires comme aberrants.
NOTE : Les tests de Grubbs doivent tre appliqus sur un matriau la fois,
aux sries des moyennes rpliques de tous les laboratoires, et non aux valeurs
individuelles obtenues partir de plans rpliqus, parce que la distribution de
toutes les valeurs prises ensemble est multimodale, non Gaussienne, c'est-dire que leurs diffrences partir de la moyenne gnrale pour ce matriau ne
sont pas indpendantes.

OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

3.4.3. Estimation finale


Recalculer les paramtres comme dans le 3.3. aprs avoir enlev les
laboratoires signals par le calcul prcdent. Si aucune des donnes aberrantes
n'a t enleve par la squence Cochran-Grubbs terminer le test. Sinon,
appliquer nouveau la squence Cochran-Grubbs aux donnes dbarrasses
des rsultats aberrants signals, jusqu' ce qu'il n'y en ait plus de signals ou
jusqu' ce que plus de 22,2 % (2 laboratoires sur 9) soient enlevs dans le
cycle suivant. Voir le diagramme A.3.4.
4.

Rapport final
Le rapport final doit tre publi et inclure tous les rsultats valides. Les autres
informations et les paramtres doivent tre reports dans un format similaire
(pour chaque sujet report) celui indiqu ici, quand cela est possible.
Tests de performance de mthode [x] raliss au niveau international en
[anne(s)] par [organisation] dans laquelle [y et z] laboratoires ont particip,
chacun ralisant [k] rpliques, ont donn les rsultats statistiques suivants :

TABLEAU DES PARAMETRES DE PERFORMANCE DES METHODES


Analyte; Rsultats exprims en [units]
Matriau [Description et liste en colonnes dans un tableau par ordre croissant
de grandeur des moyennes]
Nombre de laboratoires retenus aprs limination des rsultats aberrants.
Nombre de laboratoires aberrants
Code (ou dsignation) des laboratoires aberrants
Nombre de rsultats accepts
Moyenne
Valeur vraie ou accepte comme vraie, si connue
Ecart-type de rptabilit (sr)
Coefficient de variation de rptabilit (RSDr)
Limite de rptabilit, r (2,8 x sr)
Ecart-type de reproductibilit (sR)
Ecart-type de reproductibilit (RSDR)
Ecart-type de reproductibilit, R (2,8 x sR)
4.1. Symboles
Une srie de symboles utiliser dans les rapports et publications est jointe
dans l'Appendice 1 (A.1.).
4.2. Dfinitions
Une srie de dfinitions utiliser dans les rapports d'tude et les publications
est donne dans l'Appendice 2 (A.2.).
4.3. Divers
OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

4.3.1. Recouvrement
Le recouvrement d'un analyte ajout pour contrler la mthode ou le biais d'un
laboratoire doit tre calcul comme indiqu ici :
Recouvrement [Marginal], % =
(Analyte total trouv - analyte prsent originellement) x 100/(analyte ajout)
Bien que l'analyte puisse tre exprim en concentration ou en quantit, les
units doivent tre partout identiques. Quand la quantit d'analyte est
dtermine par analyse, elle doit tre dtermine partout de la mme manire.
Les rsultats analytiques pour le recouvrement doivent tre reports sans
correction. Reporter les recouvrements sparment.
4.3.2. Quand sL est ngatif
Par dfinition sR est plus grand ou gal sr dans les tudes de performance de
la mthode; il peut arriver parfois que l'estimation de sr soit suprieure
l'estimation de sR (la variance des rpliques est suprieure la variance entre
2
laboratoires et la valeur calcule sL est alors ngative). Quand cela arrive,
mettre sL = 0 et sR = sr.
5.

Rfrences
Horwitz, W. (1988) Protocol for the design, conduct, and interpretation of
method-performance studies. Pure & Appl. Chem. 60, 855-864.
Pocklington, W.D. (1990) Harmonized protocol for the adoption of
standardized analytical methods and for the presentation of their performance
characteritics. Pure and Appl. Chem. 62, 149-162.
International Organization for Standardization. International Standard 57251986. Under revision in 6 parts; individual parts may be available from
National Standards member bodies.

OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

A. Apendices
APPENDICE 1. - SYMBOLES

Utiliser les sries de symboles et termes suivants pour dsigner les paramtres
dvelopps par une tude de performance de mthode.

Moyenne (des moyennes de laboratoires)


Ecarts-type
Rptabilit
"Pur" interlaboratoire
Reproductibilit

x
s (estimation)
sr
sL
sR

Variances :
2
2
2
sR = sL + sr

s (avec les indices r, L et R)

Coefficient de variation
RSD (avec les indices r, L et R)
Diffrences maximales
(comme dfinies par l'ISO 5725-1986) ;
Voir A.2.4. et A.2.5.)
Limite de rptabilit
r = 2,8 x Sr)
Limite de reproductibilit
R = (2,8 x SR)
Nombre de rpliques par laboratoire
Nombre moyen de rpliques par laboratoire i

k (gnral)
ki (pour un plan quilibr )

Nombre de laboratoires
Nombre de matriaux (matriaux d'essai)
Nombre total de rsultats d'essai
Nombre total de valeurs pour une tude donne

L
m
n (= kL pour un plan quilibr)
N (=kLm pour un plan totalement
quilibr).

_____________________
Si d'autres symboles sont utiliss, il faut expliquer totalement leur relation
avec les symboles recommands.

OIV-MA-AS1-09 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

APPENDICE 2. - DEFINITIONS
Utiliser les dfinitions suivantes. Les trois premires dfinitions utilisent le
document de l'IUPAC "Nomenclature of Interlaboratory Studies" (approuv pour
publication en 1994). Les deux dfinitions suivantes sont issues des donnes de
l'ISO 3534-1 : 1993. Tous les rsultats des essais sont supposs tre indpendants
c'est--dire, "obtenus sans avoir subi l'influence d'un rsultat quelconque prcdent
sur le mme matriau ou sur un matriau d'essai similaire. Les mesures
quantitatives de fidlit dpendent de faon critique des conditions stipules. Les
conditions de rptabilit et de reproductibilit constituent des ensembles
particuliers de conditions extrmes stipules".
A.2.1. Etude de performance de mthode
Une tude interlaboratoire dans laquelle tous les laboratoires suivent le
mme protocole crit et utilisent le mme mthode tester pour mesurer une
quantit dans les sries d'articles identiques tester [chantillons, matriaux
d'essai. Les rsultats reports sont utiliss pour estimer les caractristiques
de performance de la mthode. Habituellement ces caractristiques sont la
fidlit intralaboratoire et interlaboratoire, et si ncessaire et possible,
d'autres caractristiques pertinentes comme l'erreur systmatique, le
recouvrement, les paramtres du contrle interne de qualit, la sensibilit, la
limite de quantification, et le domaine d'application.
A.2.2. Etude de performance du laboratoire
Une tude interlaboratoire qui consiste en un nombre d'analyses ou de
mesures suprieur un, ralis en utilisant la mthode choisie ou utilise par
chaque laboratoire. Les rsultats reports sont compars ceux d'autres
laboratoires ou une valeur connue ou assigne comme rfrence, avec en
gnral l'objectif d'valuer ou d'amliorer la performance d'un laboratoire.
A.2.3. Etude de la certification d'un matriau
Une tude interlaboratoire qui assigne une valeur de rfrence ("valeur
vraie") une quantit (concentration ou proprit) dans un article tester,
en indiquant habituellement une incertitude dclare.
A.2.4. Limite de rptabilit (r)
Quand la moyenne des valeurs obtenues partir de deux dterminations
indpendantes avec la mme mthode sur des articles identiques dans le
mme laboratoire par le mme oprateur utilisant le mme appareil dans un
court intervalle de temps se situe dans l'intervalle des valeurs moyennes
cites dans le Rapport Final, 4.0., la diffrence absolue entre deux rsultats
d'essais devrait tre infrieure ou gale la limite de rptabilit (r) = [2, 8 x
sr] qui peut tre gnralement dduite par interpolation linaire de sr partir
du Rapport.
OIV-MA-AS1-09 : R2000

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

NOTE : Cette dfinition, et la dfinition correspondante de limite de


reproductibilit, ont t obtenues partir de cinq termes dcoulant les uns
de autres; ces dfinitions ont t tendues pour permettre de les appliquer
par interpolation un article tester dont la moyenne n'est pas la mme que
celle utilise pour tablir les paramtres d'origine, ce qui est le cas habituel
quand on applique ces dfinitions. Le terme "limite de rptabilit
[et reproductibilit]" est appliqu spcifiquement une probabilit de 95 %
et est pris comme 2,8 x sr [ ou sR]. Le terme gnral pour ce concept
statistique appliqu toute mesure de tendance (par exemple, la mdiane) et
avec d'autres probabilits (par exemple, 99%) est "diffrence critique de
rptabilit [et reproductibilit]".
A.2.5. Limite de reproductibilit (R)
Quand la moyenne des valeurs obtenues partir de deux dosages uniques
avec la mme mthode sur des articles tester identiques dans diffrents
laboratoires avec diffrents oprateurs utilisant un quipement diffrent, se
situe dans l'intervalle des valeurs moyennes cites dans le Rapport Final,
4.0., la diffrence absolue entre deux rsultats d'essai doit tre infrieure ou
gale la limite de reproductibilit (R) [=2,8 x sR] qui peut tre
gnralement dduite par l'interpolation linaire sR partir du Rapport.
NOTE 1 : Quand les rsultats du test interlaboratoire le permettent, les
valeurs r et R peuvent tre indiques comme des valeurs relatives (par
exemple, pourcentage de la valeur moyenne dtermine) au lieu de valeurs
absolues.
NOTE 2 : Quand le rsultat final report dans l'tude est une moyenne
obtenue partir de plus d'une valeur, c'est--dire k plus grand que 1, la
valeur de R doit tre ajuste selon la formule suivante avant d'utiliser R pour
comparer les rsultats d'analyse de routine ralises en simple exemplaire
entre deux laboratoires :
R' = R2 + r2 (1 - [1/k])1/2
Il faut raliser des ajustements similaires dans le cas de rsultats rpts
constituants les valeurs finales pour sR et RSDR s'ils doivent tre des
paramtres reports pour le contrle de qualit.
NOTE 3 : La limite de rptabilit, r, peut tre interprte comme le degr
d'accord l'intrieur duquel deux rsultats d'essai individuels d'un
laboratoire doivent se trouver dans 95 % des cas. La limite de
reproductibilit, R, peut tre interprte comme le degr d'accord
l'intrieur duquel deux rsultats d'essai individuels raliss dans diffrents
laboratoires doivent se trouver dans 95 % des cas.

OIV-MA-AS1-09 : R2000

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

NOTE 4 : Les estimations de sR peuvent tre obtenues seulement partir


d'une tude de performance de mthode planifie et organise; les
estimations de sr peuvent tre obtenues partir du travail de routine dans un
laboratoire en utilisant des cartes de contrle. Pour des analyses
occasionnelles, en l'absence de carte de contrle, la fidlit intralaboratoire
peut tre value approximativement comme la moiti de sR (Pure and Appl.
Chem., 62, 149-162 (1990), Sec. I.3. Note.).
A.2.6. Analyse de variance un facteur
L'analyse de variance un facteur est le procd statistique pour obtenir des
estimations de la variabilit intralaboratoire et interlaboratoire, matriau par
matriau. Des exemples de calculs pour les plans niveau unique et
niveau unique divis une fois peuvent tre trouvs dans la norme ISO 57251986.

OIV-MA-AS1-09 : R2000

12

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

APPENDICE 3. - VALEURS CRITIQUES


A.3.1. Valeurs critiques pour le rapport maximum des variances de Cochran au
niveau de rejet 2,5 % (test unilatral), exprim en pourcentage de la
variance la plus haute par rapport la variance totale ; r = nombre de
rptitions.
Nombre de lab.
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
35
40
50

r=2
94.3
88.6
83.2
78.2
73.6
69.3
65.5
62.2
59.2
56.4
53.8
51.5
49.5
47.8
46.0
44.3
42.8
41.5
40.3
39.1
37.9
36.7
35.5
34.5
33.7
33.1
32.5
29.3
26.0
21.6

r=3
81.0
72.6
65.8
60.2
55.6
51.8
48.6
45.8
43.1
40.5
38.3
36.4
34.7
33.2
31.8
30.5
29.3
28.2
27.2
26.3
25.5
24.8
24.1
23.4
22.7
22.1
21.6
19.5
17.0
14.3

r=4
72.5
64.6
58.3
52.2
47.4
43.3
39.9
37.2
35.0
33.2
31.5
29.9
28.4
27.1
25.9
24.8
23.8
22.9
22.0
21.2
20.5
19.9
19.3
18.7
18.1
17.5
16.9
15.3
13.5
11.4

r=5
65.4
58.1
52.2
47.3
43.0
39.3
36.2
33.6
31.3
29.2
27.3
25.7
24.4
23.3
22.4
21.5
20.7
19.9
19.2
18.5
17.8
17.2
16.6
16.1
15.7
15.3
14.9
12.9
11.6
9.7

r=6
62.5
53.9
47.3
42.3
38.5
35.3
32.6
30.3
28.3
26.5
25.0
23.7
22.0
21.2
20.4
19.5
18.7
18.0
17.3
16.6
16.0
15.5
15.0
14.5
14.1
13.7
13.3
11.6
10.2
8.6

Les tableaux A.3.1. et A.3.3. ont t calculs par R. Albert (Octobre 1993) par
simulation l'ordinateur avec plusieurs passages d'environ 7000 cycles chacun
pour chaque valeur, et ont t ensuite lisss. Bien que le tableau A.3.1. ne soit
strictement applicable qu' un plan quilibr (mme nombre de rptitions pour
tous les laboratoires) il peut tre appliqu un plan non quilibr sans trop
d'erreurs, s'il y a seulement quelques dviations.
OIV-MA-AS1-09 : R2000

13

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

A.3.2. Calcul du rapport de variance maximum de Cochran pour rejeter les rsultats
aberrants
Entrer dans l'ordinateur la variance intralaboratoire pour chaque laboratoire
et diviser la plus grande de ces variances par la somme de toutes les
variances et multipliez par 100. Le quotient rsultant est la statistique de
Cochran qui indique la prsence d'un rsultat aberrant retirer si ce quotient
excde la valeur critique indique dans la table de Cochran donne ci-dessus
pour le nombre de rptitions et laboratoires spcifis.
A.3.3. Valeurs critiques pour les tests des rsultats aberrants de Grubbs au niveau
de rejet 2,5 % (test bilatral), 1,25 % (test unilatral), exprim par le
pourcentage de diminution des cart-type rsultant de l'enlvement de la
(des) valeurs(s) suspectes.
Nombre de
Laboratoires
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
40
50

Une valeur, la plus


haute ou la plus
basses
86.1
73.5
64.0
57.0
51.4
46.8
42.8
39.3
36.3
33.8
31.7.
29.9
28.3
26.9
25.7
24.6
23.6
22.7
21.9
21.2
20.5
19.8
19.1
18.4
17.8
17.4
17.1
13.3
11.1

OIV-MA-AS1-09 : R2000

Deux valeurs, les


plus hautes ou les
plus basses
98.9
90.9
81.3
73.1
66.5
61.0
56.4
52.5
49.1
46.1
43.5
41.2
39.2
37.4
35.9
34.5
33.2
31.9
30.7
29.7
28.8
28.0
27.1
26.2
25.4
24.7
24.1
19.1
16.2

Une valeur la plus


haute et une la plus
basse
99.1
92.7
84.0
76.2
69.6
64.1
59.5
55.5
52.1
49.1
46.5
44.1
42.0
40.1
38.4
36.9
35.4
34.0
32.8
31.8
30.8
29.8
28.9
28.1
27.3
26.6
26.0
20.5
17.3

14

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

A.3.4. Calcul des valeurs du test de Grubbs


Pour calculer la statistique du test de Grubbs pour les valeurs uniques, entrer
dans l'ordinateur la moyenne de chaque laboratoire et calculer l'cart-type
(SD) de ces L moyennes (dsign par s l'origine). Calculer l'cart-type de
l'ensemble des moyennes en enlevant la moyenne la plus haute (sH) ; calculer
l'cart-type de l'ensemble des moyennes en enlevant la moyenne la plus
basse (SL). Le calcul de la diminution de l'cart-type en pourcentage, pour
les deux est :
100 x [1 - (sL/s] et 100 x [1 - sH/s]
La diminution la plus forte obtenue pour ces deux calculs est la statistique de
Grubbs pour les valeurs uniques, qui signale la prsence d'un rsultat
aberrant qu'il faut enlever pour un niveau P = 2,5 %, en test bilatral, si sa
valeur excde la valeur critique tabule dans la colonne 2 de la table A.3.3.,
pour le nombre de moyennes de laboratoire utilis pour calculer la valeur
d'origine s.
Pour calculer la statistique dans le test de Grubbs pour les paires, calculer le
pourcentage de diminution de l'cart-type en enlevant les deux moyennes les
plus hautes, et aussi les plus basses, comme ci-dessus. Comparer le
pourcentage de changement de l'cart-type le plus lev avec les valeurs
tabules de la colonne 3 et procdez selon (1) ou (2) :
(1) Si la valeur tabule est dpasse, enlevez la paire responsable.
Recommencer le cycle en partant au dbut avec le test de Cochran de
variance extrme, le test de Grubbs de la valeur extrme, et le test de Grubbs
de la valeur extrme pour les paires.
(2) Quand les valeurs suivantes ne sont plus enleves, calculer le
pourcentage de changement de l'cart-type obtenu en rejetant la fois et
ensemble la valeur extrme la plus haute et la valeur extrme la plus basse et
comparer avec les valeurs tabules de la dernire colonne de A.3.3. Si la
valeur tabule est dpasse, enlevez la paire haute-basse des moyennes, et
recommencer le cycle avec le test de Cochran jusqu' ce que des valeurs
suivantes ne soient plus enleves. Dans tous les cas, arrter le test des
rsultats aberrants lorsque plus de 22,2 % (2/9) des moyennes sont enleves.

OIV-MA-AS1-09 : R2000

15

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Protocole dtudes collaboratives de performance

APPENDICE 4
A.4.1. Diagramme pour enlever les valeurs aberrantes
IUPAC 1994 PROCEDURE STATISTIQUE HARMONISE

OIV-MA-AS1-09 : R2000

16

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Estimation de la limite de dtection et de quantification

Estimation de la limite de dtection et de quantification


d'une mthode d'analyse
(Rsolution oeno 7/2000)
1 - Objet : tablir la limite de dtection et la limite de quantification dune
mthode.
Remarque : Le calcul propos tablit des valeurs limites de dtection et de
quantification relatives la rponse instrumentale. Pour une mthode
donne, le calcul final de ces valeurs doit prendre en compte les facteurs
provenant de la prparation de lchantillon
2 - Dfinitions :
- la limite de dtection est la plus petite concentration ou teneur de lanalyte
pouvant tre dtecte, avec une incertitude acceptable, mais non quantifie dans les
conditions exprimentales dcrites de la mthode ;
- la limite de quantification est la plus petite concentration ou teneur de lanalyte
pouvant tre quantifie, avec une incertitude acceptable, dans les conditions
exprimentales dcrites de la mthode.
3 - Logigramme de dcision

OIV-MA-AS1-10 : R2000

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Estimation de la limite de dtection et de quantification

4 - Mthodologie
4 1. Approche "rsultats"
Quand la mthode d'analyse ne fournit pas un enregistrement graphique, mais
seulement des valeurs chiffres (ex colorimtrie); la limite de dtection (LD) et la
limite de quantification (LQ), sont estimes laide dune des deux mthodes cidessous.
4.1.1. Mthode 1 :
Lecture directe de n mesures (rponse ou grandeur de l'analyte) de blancs d'analyse
indpendants sur des chantillons contenant l'ensemble des constituants,
l'exception de la substance rechercher.
LD = mblanc + 3 Sblanc, et
LQ = mblanc + 10 Sblanc, avec
o mblanc et Sblanc la moyenne et l'cart-type sur les n mesures de blancs.
Note : Le facteur multiplicatif 3 correspond un risque de 0,13 % de conclure la
prsence de la substance recherche alors qu'elle est absente ; celui de 10,
0,5/oo.
4.1.2 - Mthode 2 :
Utilisation de la droite d'talonnage : Y = a + b X
La limite de dtection est la plus petite concentration que l'on peut distinguer du
blanc avec un risque de 0,13 % de garder des chantillons ne contenant rien. C'est-dire la valeur partir de laquelle un test statistique de comparaison de la rponse
la valeur 0 devient significatif avec un risque d'erreur de 0,13 %. D'o :
YLD = a + 3 Sa
XLD = (a + 3 Sa) / b
avec Sa l'cart-type sur l'ordonne l'origine de la droite de rgression. Le
raisonnement est le mme pour LQ o le facteur de mutiplication est 10 (risque a de
0,5/oo).
4.2 - approche "graphique"
Pour la mthode d'analyse qui fournit un enregistrement graphique (ex :
chromatographie) ; la limite de dtection est estim partir du bruit de fond de
l'enregistrement de blanc d'analyse sur un chantillon.
LD = 3 h R (le rique associ reste infrieur 0,13 %), et
LQ = 10 h R (le rique associ reste infrieur 0,5/oo), avec

h l'amplitude moyenne ou maximum du signal sur une fentre correspondant


10 largeurs du pic mi-hauteur de part et d'autre du temps de rtention selon la
stabilit.

OIV-MA-AS1-10 : R2000

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Estimation de la limite de dtection et de quantification

R le facteur de rponse quantit/signal, exprime en quantit matire/hauteur.

A chaque fois, trois sries de trois injections sont ralises sur des blancs
plusieurs jours d'intervalle.
4.2.1 - mthode du hmax

agrandir au maximum le bruit de fond (figure 1 ci-dessus) ;


centrer sur le temps de rtention du produit (RT) ;
dessiner une fentre de 10 largeurs du pic mi-hauteur (W ) de part et d'autre
du RT;
tracer deux parallles passant l'une par le sommet du pic le plus lev, lautre par
la base de la valle la plus profonde;
valuer la hauteur hmax ;
calculer le facteur de rponse (facteur R) ;

LDmax = 3 hmax R.

LQmax = 10 hmax R

4.2.2 - mthode du hmoyen

OIV-MA-AS1-10 : R2000

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Estimation de la limite de dtection et de quantification

agrandir au maximum le bruit de fond (figure 2 ci-dessus) ;


centrer sur le temps de rtention du produit (RT);
prendre une fentre de 10 largeurs de pic mi-hauteur de part et d'autre du RT;
dcouper en 20 tranches gales (x) ;
tracer deux parallles, dans chaque bloc, l'une passant par le sommet du pic le
plus lev, l'autre par la base de la valle la plus profonde ;
mesurer les hauteurs y ;

calculer la moyenne ( y = hmoyen) ;

calculer le facteur de rponse (Facteur R) ;

LDmoy = 3 hmoy R.

LQmoy = 10 hmoy R.

Ces estimations peuvent elles-mmes tre valides en injectant des quantits de


solut proches des limites calcules (Figures n3 et 4).

OIV-MA-AS1-10 : R2000

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Estimation de la limite de dtection et de quantification

Figure n3 : validation des calcul de limitesconcentration du compos proche du H moy

NOTE : La ligne pointille correspond la valeur relle injecte.

OIV-MA-AS1-10 : R2000

RECUEIL INTERNATIONAL DES METHODES DANALYSES OIV


Estimation de la limite de dtection et de quantification

Figure n4 : validation des calcul de limites concentration du compos comprise


entre le H moy et le Hmax
NOTE : La ligne pointille correspond la valeur relle injecte.

OIV-MA-AS1-10 : R2000

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

Recommandations harmonisees pour le contrle interne


de qualit dans les laboratoires d'analyse
(Rsolution Oeno 19/2002)

CONTENU

1. INTRODUCTION
1.1 Concepts de base
1.2. Domaine d'application de ce document
1.3. CIQ et incertitude
2. DEFINITIONS
2.1. Dfinitions internationales
2.2. Dfinitions de termes spcifiques ce document
3. PRATIQUES DE L'ASSURANCE DE QUALITE ET DU CONTROLE
INTERNE DE QUALITE
3.1. Assurance de qualit
3.2. Choix de la mthode analytique
3.3. Contrle de qualit et tests d'aptitude
4. PROCEDURES DE CONTROLE INTERNE DE QUALITE
4.1. Introduction
4.2. Approche gnrale. Contrle statistique
4.3. CIQ et adquation au but recherch
4.4. Nature des erreurs
5. CIQ ET FIDELITE INTRA-SERIE
5.1. Fidlit et duplication
5.2. Interprtation de donnes dupliques
6. MATERIAUX DE CONTROLE DANS LE CIQ
6.1. Introduction
6.2. Rle des matriaux de rfrence certifis
6.3. Prparation des matriaux de contrle
6.4. Dtermination des blancs
6.5. Traabilit des surcharges et vrification des recouvrements

OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

7. RECOMMANDATIONS

8. CONCLUSIONS

9. REFERENCES

APPENDICE 1. CARTES DE CONTROLE DE SHEWHART

OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

1. INTRODUCTION
1.1 Concepts de base.
Ce document donne des recommandations permettant de mettre en oeuvre
le contrle interne de qualit (CIQ) dans les laboratoires d'analyse. Le CIQ
est l'une des mesures parmi un ensemble de mesures que les analystes
peuvent prendre pour s'assurer que les rsultats produits dans le laboratoire
conviennent l'usage auquel ils sont destins. En pratique, cette adquation
l'usage est dtermine en comparant l'exactitude obtenue dans un
laboratoire un temps donn au niveau requis d'exactitude. Le contrle
interne de qualit comprend donc les procdures pratiques de routine qui
permettent l'analyste d'accepter un rsultat ou un groupe de rsultats
comme adapt l'usage, ou de rejeter les rsultats et rpter l'analyse.
Ainsi, le CIQ est un facteur important de la qualit des rsultats d'analyse
et reconnu en tant que tel par les organismes d'accrditation.
Le CIQ est ralis en incluant des matriaux de rfrence particuliers, ici
appels "matriaux de contrle" dans la squence analytique et en
dupliquant les analyses. Les matriaux de contrle devraient, si possible,
tre reprsentatifs des matriaux analyser d'un point de vue composition
de la matrice, tat de prparation physique et tre situs dans la gamme de
concentration de l'analyte. Comme les matriaux de contrle sont traits
exactement de la mme manire que les matriaux analyser, ils sont
considrs comme des substituts qui peuvent tre utiliss pour caractriser
la performance du systme analytique, la fois un temps donn et sur des
priodes de temps plus longues.
Le CIQ est une vrification finale de l'excution correcte de toutes les
procdures (y compris l'talonnage) qui sont prescrites dans le protocole
d'analyse et de toutes les autres mesures d'assurance de qualit qui sous
entendent une bonne pratique d'analyse. Le CIQ est donc ncessairement
rtrospectif. Il est aussi exig qu'il soit autant que possible indpendant du
protocole analytique et en particulier de l'talonnage qu'il a pour but de
tester.
De faon idale, les matriaux de contrle et ceux utiliss pour l'talonnage
devraient tre tous deux raccords des matriaux de rfrence certifis
appropris ou une mthode de rfrence base sur l'exprience. Quand
cela n'est pas possible, les matriaux de contrle devraient tre raccords
au moins un matriau de puret garantie ou tout autre matriau bien
caractris. Mais, les deux voies de raccordement ne doivent pas se
rejoindre une tape trop lointaine dans le processus analytique. Par
OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

exemple, si les matriaux de contrle et les talons taient prpars partir


d'une seule solution mre d'analyte, le CIQ ne dtecterait pas une
inexactitude provenant d'une prparation incorrecte de la solution mre.
Il est commun d'analyser plusieurs ou peut-tre de nombreux matriaux
d'essais similaires ensemble et d'inclure des matriaux de contrle dans la
srie. Souvent les dosages seront dupliqus en analysant des prises d'essai
du mme matriau. Dans ce document, un tel groupe de matriaux sera
appel "srie" analytique. (Les mots "squence", "ensemble" ou "lot" ont
t aussi utiliss comme synonymes de "srie"). Ces sries sont considres
comme si elles taient analyses dans des conditions effectivement
constantes. Les lots de ractifs, rglages de l'appareillage, l'analyste et
l'environnement du laboratoire resteront dans des conditions idales,
inchanges au cours de l'analyse d'une srie. Les erreurs systmatiques
devraient donc rester constantes ainsi que les valeurs des paramtres qui
dcrivent les erreurs alatoires, pendant l'analyse d'une srie. Tant qu'il
s'agit de suivre ces erreurs, la "srie" est l'unit oprationnelle de base du
CIQ.
On considre qu'une srie est effectue dans des conditions de rptabilit,
c'est--dire que les erreurs alatoires de mesure sont de l'ordre de grandeur
de celles qui seraient rencontres dans une courte priode de temps. En
pratique, l'analyse d'une srie peut prendre suffisamment de temps pour que
de petites erreurs systmatiques se produisent. Par exemple, les ractifs
peuvent se dgrader, les appareils peuvent driver, des ajustages mineurs
des valeurs instrumentales peuvent tre ncessaires, ou la temprature du
laboratoire peut s'lever. Cependant, ces effets systmatiques sont dans le
cadre du CIQ englobs dans les variations de rptabilit. En plaant les
matriaux constituant une srie dans un ordre alatoire les effets de la
drive sont transforms en erreur alatoire.

1.2 Domaine d'application de ce document.


Ce document est une harmonisation des procdures de CIQ qui se sont
dveloppes dans divers domaines de l'analyse, notamment en biochimie
clinique, gochimie et dans les tudes environnementales, l'hygine
professionnelle et l'analyse alimentaire(3-9). Il y a beaucoup de points de
base communs dans les procdures utilises dans ces divers domaines. La
chimie analytique recouvre d'ailleurs un domaine d'activits encore plus
large et les principes de base du CIQ devraient tre capables de les
englober toutes. Ce document fournit les recommandations qui seront
applicables dans la plupart des cas. Cette politique exclut ncessairement
OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

un certain nombre de pratiques rserves des secteurs particuliers de la


communaut analytique. De plus, dans quelques secteurs il est commun de
combiner le CIQ tel qu'il est dfini ici avec d'autres aspects de la pratique
de l'assurance de qualit. Il n'y a pas de danger dans une telle combinaison,
mais les aspects essentiels du CIQ doivent rester clairs.
Pour raliser une harmonisation et fournir un guide de base sur le CIQ,
quelques types d'activit analytique ont t exclus de ce document. Les
points spcifiquement exclus sont :
(i) Le contrle de qualit de l'chantillonnage. Tandis qu'il est reconnu que
la qualit du rsultat analytique peut tre infrieure celle de l'chantillon,
le contrle de qualit de l'chantillonnage constitue un sujet spar et dans
beaucoup de domaines n'est pas pleinement dvelopp. De plus, dans de
nombreux cas, les laboratoires d'analyse n'ont pas de contrle sur la
pratique et la qualit de l'chantillonnage.
(ii) L'analyse en ligne et suivi continu. Dans ce type d'analyse il n'est pas
possible de rpter la mesure, et le concept de CIQ tel qu'il est utilis dans
ce document n'est pas applicable.
(iii) Le CIQ multivari. Les mthodes multivaries en CIQ sont encore un
sujet de recherche et ne peuvent tre considres comme suffisamment
tablies pour tre incluses ici. Le document actuel considre les donnes
"multianalyses" comme exigeant une srie de tests de CIQ univaris. Il
faudra faire attention l'interprtation de ce type de donnes pour viter un
rejet frquent inappropri des donnes.
(iv) Exigences statutaires et contractuelles.
(v) Les mesures d'assurance de qualit telles que les vrifications de la
stabilit des instruments avant et pendant l'analyse, l'talonnage en
longueur d'onde, l'talonnage de la balance, les tests de rsolution des
colonnes chromatographiques et le diagnostic
des problmes ne sont pas inclus. Dans le cadre envisag, ils sont
considrs comme faisant partie du protocole d'analyse, et le CIQ teste leur
efficacit en mme temps que les autres aspects de la mthodologie.

OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

1.3 CIQ et incertitude.


Un pr-requis de la chimie analytique est de reconnatre l'adquation au but
recherch, le niveau d'exactitude requis pour une utilisation efficace des
donnes analytiques. Ce niveau est atteint en considrant les usages prvus
des donnes, bien qu'il soit rarement possible de prvoir la totalit des
applications potentielles futures des rsultats analytiques. Pour cette raison
et pour viter une interprtation inapproprie, il est important que les
rsultats analytiques soient accompagns de leur incertitude ou qu'elle soit
facilement disponible pour ceux qui veulent utiliser les donnes.
A strictement parler, un rsultat d'analyse ne peut pas tre interprt sauf
s'il est accompagn de son incertitude associe un niveau de confiance
donn. Un simple exemple dmontre ce principe. Supposons qu'il y ait une
exigence statutaire disant qu'un aliment ne doit pas contenir plus que 10
g.g-1 d'un constituant particulier. Un fabricant analyse un lot et obtient
un rsultat de 9 g.g-1 de ce constituant. Si l'incertitude du rsultat
exprime en demi-intervalle (en prsumant qu'il n'y a pas d'erreur
d'chantillonnage) est de 0,1 g.g-1 (c'est--dire que le rsultat se situe
avec une probabilit leve dans l'intervalle 8,9 - 9,1), on peut alors
supposer que la limite lgale n'est pas dpasse. Si au contraire l'incertitude
est de 2 g.g-1 il n'y a pas une telle assurance. L'interprtation et l'usage
qui peuvent tre faits de la mesure dpendent de l'incertitude qui lui est
associe.
Les rsultats analytiques devront donc tre accompagns d'une incertitude
si on doit leur attacher un sens dfini ou si on doit faire une interprtation
documente. Si cette exigence ne peut pas tre satisfaite, l'utilisation des
rsultats est limite. Il faudra aussi tester que l'incertitude de mesure
requise est atteinte en routine, la qualit des donnes pouvant varier la
fois dans un mme laboratoire au cours du temps et entre diffrents
laboratoires. Le CIQ inclut le processus de vrification que l'incertitude
exige est accomplie dans une srie.

OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

2. DEFINITIONS
2.1. Dfinitions internationales.
Assurance de qualit : toutes les actions planifies et systmatiques
ncessaires pour fournir la confiance adquate qu'un produit ou service
satisfera aux exigences donnes de qualit(10).
Justesse : troitesse de l'accord entre la valeur moyenne obtenue partir
d'une grande srie de rsultats exprimentaux d'un test et une valeur
accepte comme valeur de rfrence(11).
Fidlit : troitesse de l'accord entre les rsultats d'essais indpendants
obtenus dans des conditions prescrites(12).
Biais : diffrence entre l'esprance de rsultats d'essai et une valeur
accepte comme rfrence.
Exactitude : troitesse d'accord entre le rsultat d'un mesurage et une
valeur vraie du mesurande(13).
Note 1. L'exactitude est un concept qualitatif.
Note 2. Le terme "prcision" ne doit pas tre utilis pour "exactitude".
Erreur : rsultat d'un mesurage moins une valeur vraie du mesurande(13).
Conditions de rptabilit : conditions o des rsultats d'essai sont
obtenus avec la mme mthode sur des chantillons d'essai identiques dans
le mme laboratoire par le mme oprateur utilisant le mme appareillage,
dans un court intervalle de temps(11).
Incertitude de mesure : paramtre, associ avec le rsultat d'une mesure,
qui caractrise la dispersion des valeurs qui pourraient tre
raisonnablement attribues au mesurande(14).
Note 1. Le paramtre peut tre, par exemple un cart-type (ou un multiple
de celui-ci) ou la demi-largeur d'un intervalle un niveau de confiance
dtermin.
Note 2. L'incertitude de mesure comprend en gnral plusieurs
composantes. Certaines peuvent tre values partir de la distribution
OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

statistique des rsultats d'une srie de mesurages et peuvent tre


caractrises par des carts-types exprimentaux. Les autres composantes
qui peuvent aussi tre caractrises par des carts-types, sont values
partir de distributions prsumes de probabilit bases sur l'exprience
acquise ou sur d'autres informations.
Note 3. Il est entendu que le rsultat d'un mesurage est la meilleure
estimation de la valeur d'un mesurande et que toutes les composantes de
l'incertitude, y compris celles qui proviennent d'effets systmatiques, telles
que les composantes associes aux corrections et aux talons de rfrence,
contribuent la dispersion.
Traabilit : proprit du rsultat d'un mesurage ou d'un talon tel qu'il
puisse tre reli des rfrences dtermines, gnralement des talons
nationaux ou internationaux par l'intermdiaire d'une chane ininterrompue
de comparaisons ayant toutes des incertitudes dtermines.
Matriau de rfrence : matriau ou substance dont une ou plusieurs
valeurs de la (des) proprit(s) est (sont) suffisamment homogne(s) et
bien dfinie(s) pour permettre de l'utiliser pour l'talonnage d'un appareil,
l'valuation d'une mthode de mesurage, ou l'attribution de valeurs aux
matriaux.
Matriau de rfrence certifi : matriau de rfrence, accompagn d'un
certificat, dont une (ou plusieurs) valeur(s) de la (des) proprit(s) a une
ralisation exacte de l'unit dans laquelle les valeurs de proprit sont
exprimes et pour laquelle chaque valeur certifie est accompagne d'une
incertitude un niveau de confiance indiqu.

2.2 Dfinitions de termes spcifiques ce document.


Contrle interne de qualit : ensemble de procdures entreprises par le
personnel du laboratoire pour suivre en continu les oprations et les
rsultats de mesurages afin de dcider si les rsultats sont suffisamment
fiables pour tre dlivrs.
Matriau de contrle : matriau utilis pour le contrle de qualit interne
et soumis tout ou partie de la mme procdure de mesurage que celle
utilise pour les matriaux analyser.

OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

Srie (srie analytique) : ensemble de mesurages raliss dans des


conditions de rptabilit.
Adquation l'usage : degr auquel les donnes produites par un
processus de mesurage permet l'utilisateur de prendre des dcisions
correctes d'un point de vue technique et administratif pour un usage
indiqu.
Systme analytique : ensemble de circonstances qui contribuent la
qualit des donnes analytiques, y compris l'appareillage, les ractifs,
procdures, matriaux d'analyse, personnel, environnement et mesure de
l'assurance qualit.

3. PRATIQUES DE L'ASSURANCE DE QUALITE ET DU CONTROLE


INTERNE DE QUALITE
3.1 Assurance de qualit
L'assurance de qualit est l'infrastructure d'organisation essentielle qui
assure que toutes les mesures analytiques sont fiables. Elle a pour rle de
raliser des niveaux de qualit appropris dans des domaines comme la
formation et la gestion du personnel, l'adquation de l'environnement du
laboratoire, la scurit, le stockage, l'intgrit et l'identit des chantillons,
la conservation des enregistrements, la maintenance et l'talonnage des
instruments, et l'utilisation de mthodes techniquement valides et
convenablement documentes. Une dfaillance dans l'un de ces secteurs
pourrait anantir des efforts importants faits par ailleurs pour atteindre la
qualit dsire des donnes. Ces pratiques ont t rcemment codifies et
reconnues formellement comme essentielles. En effet la prdominance de
ces circonstances favorables ne permet en aucun cas d'assurer que la qualit
des donnes a t atteinte, moins que le CIQ ne soit effectu.

OIV-MA-AS1-11 : R2002

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

3.2 Choix de la mthode analytique.


Il est important que les laboratoires limitent leur choix aux mthodes qui
ont t caractrises comme adaptes la matrice et l'analyte considr. Le
laboratoire doit possder la documentation dcrivant les caractristiques de
performance de la mthode, estimes dans des conditions appropries.
L'emploi d'une mthode ne garantit pas en lui-mme que les
caractristiques de performances tablies soient acheves. Une mthode
donne a seulement un potentiel pour atteindre un certain degr de fiabilit
quand la mthode est applique dans un ensemble particulier de
circonstances. C'est l'ensemble de ces circonstances, appel "systme
analytique" qui est responsable de l'exactitude des donnes analytiques. Il
est donc important de suivre le "systme analytique" pour qu'il ait un
fonctionnement adapt l'usage. C'est le but des mesures du CIQ
entreprises dans un laboratoire.

3.3 Contrle de qualit et test d'aptitude.


Le test d'aptitude est une vrification priodique de la performance de
laboratoires individuels ou de groupes de laboratoires. Il est ralis par un
organisme spcialis indpendant qui distribue des matriaux types des
participants pour qu'ils les analysent sans supervision(2). La participation
des tests d'aptitude, bien qu'elle soit importante ne saurait se substituer
des mesures de CIQ ou vice versa.
Les tests daptitude peuvent tre regards comme normaux mais les
contrles sur les erreurs analytiques sont relativement rares. Sans le
support dun bon systme de CIQ, la valeur de la participation un test
daptitude est insignifiante. Il est probable que leffet bnfique principal
des tests daptitude est quil encourage les participants installer des
systmes de contrle de qualit. Il a t prouv que les laboratoires avec
des systmes de CIQ avaient de meilleurs rsultats dans les tests daptitude.

OIV-MA-AS1-11 : R2002

10

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

4. PROCEDURES DE CONTROLE INTERNE DE QUALITE


4.1. Introduction.
Le contrle interne de qualit implique les tapes pratiques entreprises pour
s'assurer que les erreurs dans les donnes analytiques sont d'un ordre de
grandeur appropri leur utilisation. La pratique du CIQ dpend de
l'utilisation de 2 stratgies : l'analyse de matriaux de rfrence pour suivre
la justesse et le contrle statistique, et la duplication pour suivre la fidlit.
L'approche de base vers le CIQ implique l'analyse de matriaux de contrle
paralllement aux matriaux d'essais analyser. Le rsultat des analyses de
contrle forme la base de la dcision d'accepter les donnes de l'essai.
Deux points cls doivent tre nots dans ce contexte.
(i) L'interprtation des donnes du contrle doit tre base sur des critres
documents, objectifs, et sur des principes statistiques quand cela est
possible.
(ii) Les rsultats des analyses de contrle doivent tre considrs en
premier lieu comme des indicateurs de la performance du systme
analytique, et seulement ensuite comme un guide vers les erreurs associes
aux rsultats d'essais individuels. Des changements substantiels dans
l'exactitude des dosages du contrle peuvent quelquefois tre pris comme
indicateurs de changements similaires dans les donnes des matriaux
d'essai analyss en parallle mais ne peuvent tre accepts pour corriger
des donnes analytiques.

4.2. Approche gnrale. Contrle statistique.


L'interprtation des rsultats des analyses du CIQ dpend beaucoup du
concept de contrle statistique, qui correspond la stabilit de l'ensemble
de l'opration. Le contrle statistique implique qu'un rsultat x de CIQ peut
tre considr de manire indpendante et alatoire comme provenant d'une
population normale de moyenne et de variance 2.
Avec ces contraintes, seulement 0,27 % des rsultats (x) se situeraient en
dehors des limites 3. Quand on rencontre ces rsultats extrmes, on
considre qu'ils sont "hors contrle" et que le systme analytique
commence se comporter diffremment. La perte du contrle implique que
l'exactitude des donnes produites par le systme n'est pas connue et que
l'on ne peut se baser sur ces donnes. Le systme analytique doit tre
examin et doit tre soumis une action correctrice avant de raliser
OIV-MA-AS1-11 : R2002

11

RECUEIL DES METHODES INTERNATIONALES D'ANALYSES OIV


Contrle interne de qualit

d'autres analyses. La maitrise du contrle statistique peut tre suivie


graphiquement avec les cartes de contrle de Shewhart (voir appendice 1).
Il est aussi possible d'utiliser une approche numrique quivalente, qui
consiste comparer les valeurs de z = (x-)/ aux valeurs appropries de
l'cart-type normal.

4.3 CIQ et adquation au but recherch.


Le processus du CIQ est en grande partie bas sur une description en terme
de paramtres statistiques d'un systme d'analyse fonctionnant dans des
conditions