From the Director General

Peruvian government honors CIP

Food, livelihood and health
Collaborating in China
The Generation Challenge Program
Late blight - new developments
Breakthrough in bacterial wilt resistance
Innovation alleviating poverty in the Andes
VITAA - lifesaver turns moneyspinner
Farming in the city
Sowing prosperity: New varieties enhance Peru's potato production capacity
In brief
Board of trustees
Donor contributions
Financia l report
Training highlights
Selected publications
Partners
Staff
Global contact points
Future Harvest

4
7
9
10
16

22
30
36
44
50
56
61
67

69
70
71
73

76
80
84
86

:rom the director general

demand our attention, among the poor, hungry and sick in the developing countries.
With such a wide demand, we are looking closely at where we direct our work, as

'<t
0

well as making efforts to carefully measure our impact. CIP, in fact, was the first of

"".......

the CGIAR centers to base its work on the Millennium Goals.

c.
QI
a:

By realigning our program to match the objectives of the Millennium Goals, it is

clear that we are pursuing economic gains to reduce poverty and improve living
standards. The innovative participatory market chain approach that Papa Andina is

....QJ

pioneering as a way of adding value to a product is a good example of this. It is also

QJ

becoming clearer that the operation of our Partnership programs can add value and
increase earnings by including products and processes other than those we have
traditionally dealt with. The relationship of sweetpotato and pigs or the nexus of

....0
...."'
0

CL

"'c0

....ru
c

....
Q)

potato production and mountain resources management illustrate the value of

extending our mandate.

During the year, the reorganized research and program structure generated some
significant advances in knowledge that contribute directly to the crucial aspects of food
security and poverty alleviation. The research program made fundamental advances in
the fight against late blight and considerable progress against bacterial wilt. We also
saw the security of CIP's germplasm collection increased through the work of the
"Potato Park", a local initiative dedicated to in situ conservation of potato biodiversity.
The Partnership programs, which are, in fact, extensions of the research process,
are often applying the results of Divisional work directly in their operations. For
example, the Vitamin A for Africa (VITAA) program is linking breeding activities of
orange-fleshed sweetpotato with active health programs in the community, blurring
the lines between mandated research and operational development.
2004 was a year of consolidation and renewal for CIP. Consolidation in the sense
that we were able to concentrate on our core work, guided by the visioning exercise

that we completed in 2003. Renewal in the sense that the process of management
<I'
0
0
N

.......
0

c..

succession was completed and the leadership of CIP will be assumed early in 2005 by
the chair of CIP's Vision, Dr. Pamela Anderson . Buoyed by a history of solid research
achievement, CIP is also now on a secure financial footing. Our income continues to

Qj

a:.

grow, with the increased restricted and unrestricted funding reflecting the confidence
of our donors in the Center. Through good management practice, our financial
security also increased during the year.
Although this report deals with the highlights of the year 2004, I am writing this
introduction in March 2005. I will be retiring in April, not with reluctance, because I
know the future of the Center is secure, but with great emotion. For the past 14
years my life has been inextricably bound up with CIP and I am proud to have had
the opportunity to direct its course for so long . I would like to take this opportunity
6

to thank all of our donors fo r the commitment they have shown to our work. I would
also like to acknowledge my debt to our many partners, without whom we could not
operate, and CIP's staff, in headquarters and in the regions, who show levels of
dedication and brilliance I could never really demand. My wife Ilse and I will be retiring
to Canada, but we will be taking a piece of Peru, and CIP, with us in our hearts.
With thanks and best wishes for the future .

Hubert Zandstra
Directo r General

Peruvian government
honors CIP
"'"

The Peruvian government

Cross of the Order of Merit

Ambassador Manuel

presented Dr. Hubert G.

is one of the highest honors

Rodriguez Cuadros,

Zandstra, Director General of

that can be bestowed upon

representing the ministry at

0
Cl.

CIP, with the Grand Cross for

a foreigner by the Peruvian

the ceremony, recognized

CIC:

Distinguished Service, on

government. The Peruvian

Dr. Zandstra for his

May 18 2004. The Grand

Minister of Foreign Affairs,

contribution to research on

0
0
N

.......
<II

..,Qi
c

Qi

u
0
..,
ro
0
CL

ro

c
0

the potato, sweetpotato and

Peruvian university students

lost all of their seed during a

lesser known Andean roots

who have benefited from

devastating drought. With

and tubers, as well as for his

the high-level training in

the seed CIP sent, a potato

dedication to promoting the

agricultural research and

variety later called Chacasina,

0
"""
0

.......

integrated management of

natural resources offered by

the farmers ' yields multiplied

ai

natural resources in the

the Center.

by five and the community

"':::sc:

world 's mountain regions,

c.
a:

c:

and particularly in Peru.

The minister also

emphasized that, just as the

ci:

During the ceremony,

""c
u""

cultures of Mexico and

which was held at CIP

Central America are known

headquarters in La Molina,

as maize cultures, the

--"'

Ambassador Rodriguez

highland cultures of Peru

c...

commended Dr. Zandstra 's

should be known as potato

"'c

contributions to Peru and in

cultures, both for the

c
c
c

particular his work in the

connection of the crop to

National Working Group on

Peru's ancient Andean

Mountain Ecosystems

heritage, as well as for the

organized by the Peruvian

global value of the tuber,

Ministry of Foreign Affairs in

the world 's fourth most

2002, the International Year

important food crop.

of Mountains. Mr. Rodriguez

Dr. Zandstra expressed

also acknowledged Dr.

his deep gratitude to Peru

Zandstra 's contributing role

and to the Peruvian people

in Peru's current influence in

for the honor. He recalled

international fora on

that one of his most

biodiversity conservation and

gratifying experiences over

the sustainable development

the past 13 years was the

of mountain regions.
The minister highlighted

reintroduction of true potato

seed, a technology used by

the significance of having

the Incas, in the Callej6n de

CIP headquarters in Peru,

Conchucos in Ancash in

the country known as the

1994. CIP's involvement with

birthplace of the potato. He

this community began at the

commended CIP for the

request of Father Ugo de

quality of its research and

Censi, who first approached

for the opportunity it has

CIP, desperate, after the

given to hundreds of

farmers of the region had

no longer had to constantly

search for good quality seed .

Food, livelihood and health

planning, and potatoes have

are also traded over China's

since producing edible

a significant role in achieving

borders into neighbouring

potatoes from TPS is a two-

that objective.

Vietnam and Burma.

stage, two-season affair. In the

"'00"

True potato seed (TPS) is

first year plants are grown

Potato successes

another valuable contribution

from true seed to produce

contribute to China's anti-

that CIP is making to the

seedling tubers; in the second,

poverty program

eradication of rural poverty in

those tubers are planted out

Since 1978, the percentage

China, especially in regions

to produce a mature crop. But

of people in the rural

that are difficult to reach,

double effort has a double

population considered poor,

where transportation costs

advantage: at the first stage

....<lJ

by Chinese standards, is

make seed tubers

farmers can produce tubers for

estimated to have fallen from

prohibitively expensive. The

sale, as well as for themselves;

....rtl

30 percent to less than three

advantages are obvious: a

at the second they are assured

percent. CIP collaborates in

handful of TPS will produce

of a good crop.

several programs which

enough seedling tubers to

continue contributing to the

plant one hectare of

is that it can help

success of China's anti-

potatoes, an area which

disadvantaged sections of

poverty program. High on the

would require two tonnes of

society in regions where

list of its contributions is a

conventional seed tubers.

mainstream advances in

potato developed from CIP

Yunnan's agricultural

agricultural technology simply

.....

Cl.
Cll

a:

OJ

....0

0
0...
rtl

c
0

''The great thing about TPS

crosses in collaboration with

department began making

aren't applicable," says Chujoy.

the Root and Tuber Crop

CIP's TPS varieties available to

"It will never replace clonal

Research Institute of Yunnan

farmers in the western and

crops totally - the economics

Normal University and the

eastern extremes of the

of time and labor are against

Huize Agricultural Extension

province in 2001, and since

it - but a kilo of TPS in the

Center. Named Cooperation

then plantings have reached

right place can feed a village

88 to reflect the importance

1,000 hectares in total. "That

and give the villagers an

of partnership in its

might not sound like much,"

income. We have to work

development and testing

says geneticist Enrique

with these farmers, and focus

(and its origins as S-88 - a

Chujoy, who coordinates

our efforts specifically on their

CIP cross), this high-yielding

CIP's role in the initiative.

needs."

variety with superior

"But most of the plots

processing characteristics is

making up that total are very

effectiveness of its work in

currently grown on more

small. There are probably

China and the region, CIP has

To increase the

than 100,000 hectares in

several thousand households

been continuing to work with

Yunnan alone, as well as in

involved." And for them TPS

the Chinese government to

adjacent provinces.

is invaluable. Labor-intensive

create the CIP-China Center

Cooperation 88 seed tubers

and time-consuming? Yes,

for Asia and the Pacific. CIP is

11

<I'
0
0
N

.....
0

c.
QI

a:

<lJ
+-'

<lJ

0
+-'

"'0

+-'
CJ_

"'c0
+-'

"'c
<lJ
+-'

12

China is by far the world's

collaborating with the

more meat, horticultural

Chinese Academy of

produce and processed foods.

largest producer of

Agricultural Sciences and the

Starch is the principal

sweetpotato, its annual output

Ministry of Agriculture in

constituent of processed

of almost 100 million tonnes

establishing the Center,

foods such as noodles and

accounting for about 85

which will focus initially on

snacks. Sweetpotato for starch

percent of global production.

work in areas where potato

extraction is therefore much

The volume that goes into

and sweetpotato can

in demand - so much so that

food processing is vast, but

contribute most to reducing

it has ceased to be a staple

medium- and small-scale

hunger and raising incomes.

food and is now grown

production systems are vital

primarily for starch or animal

components of the industry.

Sweetpotato increasingly

feed. But even while its use

At the same time they are

important in generating

as a food has declined,

especially vulnerable to the

income

sweetpotato production has

pressures of China's rapidly

As the purchasing power of

increased. "In this way

growing market economy.

households at all levels of

sweetpotato continues to

society in China has

serve China's farmers well,"

began collaborating with

increased, people have

says economist Keith Fuglie,

Chinese scientists on methods

diversified their food choices,

leader of CIP's Impact

to improve the post-harvest

consuming less rice and

Enhancement Division.

use of sweetpotatoes. Notable

In the late 1980s, CIP

had shown that a CIP-

based pig production systems

the mid-1990s the

developed ensilage method

in the uplands of China's

collaboration's improved

of making pig feed from

Sichuan Province.

starch extraction and noodle-

sweetpotato significantly

making technologies were

increased the productivity of

sweetpotato varieties

being widely adopted.

traditional sweetpotato-pig

developed by the Sichuan

Attention has now turned to

production systems. Instead

Academy of Agricultural

questions of scale and

of chopping up and boiling

Sciences (SAAS) in

efficiency as the key to

sweetpotato for feed,

collaboration with CIP,

making small operators more

villagers were shown how to

scientists from the Sichuan

productive and competitive -

use fermentation to make

Animal Science Academy

especially those working in

the food digestible. Costs

(SASA) working on an

sweetpotato-pig production

were reduced; pigs fattened

International Livestock

systems.

faster and household

Research Institute (I LRI)

incomes rose. This si mple but

initiative, put CIP ensiling

successes were achieved. By

Along with improved

Making silage dramatically

highly effective CIP-

technology high on the list of

improves prospects of a

developed technology has

options they offered the

better life

subsequently been a key

farmers of Tianle and five

Research in Vietnam and

element of projects seeking

other villages situated about

Papua Province, Indonesia,

to improve the sweetpotato-

170 km northeast of

'<I"

Chengdu. The majority of

two hours or more of hard

farmers in Tianle are very

work every day. Moreover, it

poor, with an average per

saved firewood (and the time

capita income of less than

devoted to collecting it) and

US$100 per year. Livestock

reduced pressure on the

contributes up to 80 percent

forests around them. But it

......
Q.
QI

a:.

Ill

:I

cc
a;

of total farm income. The

was as an improved feed that

project has dramatically

the farmers most valued the

improved their prospects of a

technology. With the addition

better life. "The use of the

of a protein-rich supplement

improved sweetpotato variety

developed by SASA scientists,

resulted in at least 25

the sweetpotato silage feed

percent increment in root

reduced the time taken for

yield," a report on the project

pigs to reach market weight

a;

u
0
~

"'0

CL

"'c0

14

The project
had
enabled
them to
send their
children
to an
agricultural
college

reveals, and all farmers who

by six to eight weeks. This

planted improved varieties

meant that more pigs could

increased the area planted to

be raised per year - in some

that variety in the second

instances 50 percent more.

Mrs. Ye Yongju and Mrs.

year and established

"Last year Tianle village sold

Jufang, said the project had

multiplication plots to ensure

300 pigs," village leader Mr.

enabled them to send their

they had enough planting

Liang Bo told the scientists in

children to an agricultural

material to cover it. One of

early 2004. "But th is year we

college. Others said that

the farmers, Mr. Liang Dong

have already sold 380 in the

some of the additional

Shen said, "Last year I

first quarter alone. I estimate

income was being reinvested

produced enough roots of the

that we will sell at least 1200

in the farm, and the rest put

new variety not only to

fattened pigs in 2004, when

into savings. But perhaps the

ensile, and reserve seeds for

the average for previous

most visible indication of the

this year's planting, but also

years was less than 800."

changes brought to Tianle by

The additional income

the project is the motorcycles

to give 100 kg as presents to

my friends, and even sold

derived from these

some farmers have bought.

500 kg."

enterprises is already

'Twenty-five farme rs in Tianle

changing lives in the village.

village have bought

silage was also enthusiastically

Overall, fa rmers felt confident

motorcycles this year,'' Mr.

received. All the farmers

of being able to commit

Liang Bo announced proudly.

appreciated not having to

themselves to investment

"All thanks to extra income

cook the sweetpotato roots

expenses that would build

obtained from the pig

and vines for their pigs, not

upon what has been

enterprise."

least because it spared them

achieved so far. Two farmers,

The practice of making

may scan the horizon from

can they locate everything

Program (see Box 2). This is

the summit of their own

that might be relevant to

an initiative that brings

mound and get a very

their own investigations?

together three sets of

general view of what is

Thirty years ago the

partners - CGIAR, advanced

going on elsewhere, but they

Green Revolution dramatically

research institutes (ARls) and

will rarely have an

increased farm production

national agricultural research

opportunity of delving into

through the spread of new

systems (NARS) in developing

the detail of other mounds.

plant types, irrigation and

countries - with the aim of

""'

0
0
N

.......
0
0..
QI

a:

Ill
::I

c
c

cl:

Yet as time and knowledge

fertilizer. Today, the

delivering the fruits of the

progress we are evermore

emerging Genomics

Genomics Revolution to

certain that information

Revolution (see Box 1) can

resource-poor farmers.

useful to us is hidden

bring new science to bear on

there ... "

problems encountered by the

the world's poorest people

resource-poor farmers who

live in rural areas and rely on

Information bottleneck

derived little or no benefit

agriculture for food and

Dr. Bonierbale is the head of

from the earlier wave of

income, and a great many of

CIP's Germplasm

innovation. But first, there has

them live on marginal land,

Enhancement and Crop

to be a way of collating,

where modern domesticated

Improvement Division and

exploring and comparing the

varieties do not always fare

she is speaking of a major

accumulating information,

well," points out Robert

problem facing today's crop

effectively and on a

Zeigler, former Director of

improvement fraternity.

reasonable timescale.

the Generation Challenge

QJ
+-'

QJ

u
0

"Seventy-five percent of

Prog ram . "Crop varieties that

Investigations into the

genetic characteristics of food

Generation Challenge

can withstand harsh

plants are advancing so

Program

conditions and survive on

rapidly that traditional

During 2004, CIP's

few inputs could greatly help

methods of disseminating

Information Technology Unit

these people in their

new findings are not enough

has made a significant

interminable struggle with

to make sure that

contribution to alleviating this

food insecurity and poverty."

information is available to

problem, not simply for the

everyone who could use it.

benefit of CIP's own in-house

countries do not have the

"Most developing

Not every result merits

scientists, but also for the

scientific infrastructure or

publication in a refereed

benefit of a much wider

trained staff necessary to

journal, yet the unpublished

network of research

apply advanced genomics,"

research of a laboratory on

institutions. CIP's information

explained Zeigler.

one side of the globe might

technology expertise is a

"Unfortunately, this means

apply directly to the work of

valuable component of the

that the scientific institutions

scientists on the other. How

Generation Challenge

in closest proximity to

+-'

"'
0

+-'

CL

"'c0
+-'

"'c
QJ
+-'

17

struggling farmers and poor

rural areas are the least
equipped to take advantage
of the technological

Revo ution

those people. To make a

The Genomics Revolution is producing plants specifically

continues, "the Generation

designed and bred to overcome the difficult conditions

found in smallholders' fields and marginal environments and

Challenge Program must

revolution that may help

lasting impact," he

so improve the quality and quantity of these farmers' yields.

create a global environment

It has been fueled by technological advances that have

allowed scientists to unravel the genetic code of an organism

that promotes scientific

and draw up maps of the entire genome, with landmarks

countries ."

innovation by NARS in those

locating genes associated with particular characteristics, such

as adaptability, disease resistance or environmental tolerance.
And as the genetic maps are filled with ever-finer detail,

High Performance

breeders are cross-referencing the maps of different species

Computing system

(see illustrations on opposite page and following). In this

Challenge Program member

way, the genetics of whole families of plants can be

compared. Thus the existence of genetic information on a
particular trait can be predicted in one species, from the
detailed genetic studies of another. This is a major advance,
making it possible to explore the relationship of gene
sequence to function across species, further expanding the
opportunities for significant breakthroughs and delivering
the promise of the Genomics Revolution .
Up to now, plant breeding has been as much an art as
a science. A highly successful art with an honorable pedigree,
true, but always a subjective exercise, based on the
experience and skill of the plant breeder to choose parents
for crosses and to select out, either visually or by means of
empirical tests, improved individuals from among the
progeny of those crosses. There are notable exceptions, in
which a few identified genes have had a dramatic effect
when bred into other varieties (for example, the directed
introduction of dwarfing genes in wheat and rice was
responsible for the increased productivity of the Green
Revolution), but comparative genomics has the capacity to
make these exceptions the rule and, ultimately, to change
the plant breeders' art into an objectively based science.

scientists often quip that the

fourth of the Program's five
subprograms, Bioinformatics
(SP4 see Box 2), "is the
lynchpin of the whole global
undertaking." If SP4 is the
lynchpin of the system, then
CIP is responsible for
ensuring that it functions
smoothly and effectively.
Managed by its Head,
Anthony Collins, CIP's
Information Technology Unit
has set up a Paracel cluster
computer system made up
of four nodes (based at CIP
and three other research
establishments within the
CGIAR network) with dual
64-bit processing units and a
terabyte of database storage

(with substantial capability

which genes are involved in

for future expansion), which

drought-tolerance

will facilitate the analysis of

mechanisms, but an

very large germplasm,

enormous amount of data

molecular and functional

has to be processed to arrive

genomics data sets. And this

at the result.

High Performance

The plant used for

Computing (HPC) system is

comparison is Arabidopsis -

already enabling scientists to

thale cress - a small weed

make progress on important

whose entire genome has

challenges. "For instance, the

been sequenced. In recent

HPC facility has greatly

years, scientists have shown

enhanced the application of

that Arabidopsis has about

comparative genomics to the

2,300 genes that are

search for drought-tolerant

involved with its response to

genes in potatoes," says CIP

stresses such as drought,

biotechnologist Roland

cold or high salinity. With

Schafleitner.

this knowledge at hand,

In a world confronting

scientists tested potatoes for

the prospects of climate

the presence of orthologous

change, drought is one of

genes (meaning genes that

the most serious challenges

have the same stress-

faced by resource-poor

responsive function as in

farmers. Comparative

Arabidopsis), and could

genomics could provide the

begin evaluating the

vital clues needed to

potential of those genes as

enhance drought-tolerance

candidates for drought

in potatoes and other staple

tolerance research.

crops of developing

The first step in this

countries. In this work, the

procedure was to discover

drought-stress responses at

whether high-sequence

the genetic level in a known

similarity to stress-induced

or model plant are

Arabidopsis genes also

compared with those of

occurred in the potato.

potato genotypes exhibiting

"Comparing the 2,300

different levels of tolerance.

Arabidopsis stress-responsive

These comparisons provide

gene sequences that had

invaluable information on

been identified with the

Potato
Tomato
Tobacco
Pepper
Petunia
Oak

AGG AA GCTTTTAGCCTTTTCGACAA GG ATGG CGATGG CTGTATTACTACC AA GG AGTTGGG AA CAGTGATG

AGG AA GCTTTTAGCCTTTTCGACAA GG ATGG CGATGG CTGTATTACTACC AA GG AGTTGGG AA CAGTGATG
AGG AGG CCTTTAGCCTTTTCGACAA GG ACGG CGATGG CTGTATTACTACC AA GG AATTGGG AA CAGTGATG
AGG AGG CTTTTAGCCTTTTTGACAA GG ACGG CGATGG CTGTATTACTACC AA GG AGTTGGG AA CAGTGATG
AGG AA GCTTTTAGCCTTTTTGACAA GG ACGG TGACGG CTGTATTACTACCAA GG AGTTGGG AA CAGTGATG
AGG AA GCCTTCAGCCTCTTTGACAAGG ACGG CGATGG CTGCATCACTACCAAA GAGTTGGG AA CAGTCATG

~--------1

Potato
Tomato

~--------Tobacco
~---Pepper

1--------

Petunia

approximately 40,000 potato

genes whose role was

further research into drought

gene sequences available

consistently significant. Then

tolerance in potatoes."

today, would have meant

we had to search for

performing 2,300 searches

orthologs to those genes in

SP4 an innovator in the

on the potato material,"

the potato material. With

field

Roland Schafleitner explains.

conventional equipment that

"It is important to remember

"So we began by clustering

would have taken days and

that CIP's HPC is part of a

the 2,300 stress-responsive

driven us crazy," he adds.

process, not just a facility,"

Arabidopsis genes according

"But we had the HPC

says Reinhard Simon, Head

to their spatial and temporal

system. The results were

of CIP's Research lnfomatics

expression patterns, and

available almost immediately

Unit, who coordinated the

then selected some 450

as a sound foundation for

establishment of an

storing everything in a
mutually comprehensible and

tion Challenge
Program

interactive form . It's a

challenge," he concludes,

0
0
N

with characteristic

..

understatement.

Q.
GI

excites an enthusiastic
~

van Hintum, a bioinformatics

...,

specialist at Wageningen

University in the Netherlands,

...,0
...,ro

who heads SP4. He is

a_

optimistic about the potential

Q)

Q)

of the SP4 platform . "There

ro

...,
ro

is a clear commitment
among our partners to make
the SP4 infrastructure easily
accessible and to make our
increasingly complex analyses
easier," he says. "SP4 gets

Andean root and tuber crops, barley, cassava,

chickpea, coconut, cowpea, finger millet, forages,
groundnut, lentil, maize, Musa, pearl millet,
Phaseoulus, pigeon pea, potato, rice, sorghum,
soybean, sweet potato, wheat and yam

a:

But it is a challenge that

response, not least in Theo

CGIAR's Generation Challenge Program has five
subprograms, within which scientists
1. explore the genetic diversity and potential
of its 22 mandate crops*
2. focus on developing genomic technologies
and approaches to advance understanding
of genetic principles across significant crop
species in developing countries
3. seek ways to increase the efficiency, speed
and scope of plant breeding
4. build a viable bioinformatics platform
5. work to improve the research capabilities
of developing countries.

really interesting when we

start talking about processing
all the information that is
available through the
network. There is a whole

infrastructure for building

of this increasingly

range of applications that

capacity, storing and

integrated world of plant

researchers have only dreamt

exchanging data across the

genetics," he explains. "Every

about that this platform will

network in a standard form.

aspect of the system we are

enable us to do. These new

"With genomics breaking

building in SP4 has to be

applications and analyses will

down the knowledge

agreed upon by every

make SP4 an innovator in

boundaries between plant

information technology

this field, and the Generation

genomes, the informatics

manager in the network. It

Challenge Program a leader

systems must work

has to overcome the

in making high science work

seamlessly across institutes

problems of using existing

for the people who need it

and crops to meet the

data, capturing all

most."

storage and analysis needs

experimental data and then

Q)
...,

21

But Dr. Sergi Bang, research

commercial potato-growing

leader of Papua New

industry (already worth $11

refugees from elsewhere in

Guinea's National Agricultural

million per year) and

Indonesia were planting

Research Institute (NARI)

destroying crops that were

infected seed potatoes. He

knew. He had travelled to

to have fed the family of So

told the villagers to bury the

the remote village with a

Wan Kusit and many

uprooted plants and advised

deep sense of foreboding,

thousands like her.

them not to cultivate

Jaya, where thousands of

potatoes again for a couple

and a brief inspection was

Arrival from lrian Jaya

of years "to allow the late

fears: late blight. Hitherto,

Dr. Bang could guess what

blight fungus to die."

Papua New Guinea had

had happened. Late blight,

been free of the disease.

caused by the fungus-like

than California, but with less

Now, in a matter of weeks it

Phytophthora infestans, had

than 500 miles of paved

was sweeping across the

probably drifted into Papua

roads and only 1.9 percent

country, closing down a

New Guinea on winds from

of its land surface suitable

young but flourishing

across the border with lrian

for growing crops, the

enough to confirm his worst

In a country slightly larger

potato had been a prized

by CIP, visited the island and

crop. Especially among the

formulated an extended

85 percent of a 5.4 million

research and development

population that depends

project to help Papua New

entirely on subsistence

Guinea deal with the

farming for food and

problem. "Initially, late

livelihood. The potato was

blight-resistant cultivars from

particularly well-suited to the

CIP will be introduced and

country's highlands, where

evaluated to select a variety

altitude tempered the heat

that will replace the

of an equatorial sun and

susceptible variety currently

year-round rainfall watered

grown in Papua New

fertile soils. In such cool and

Guinea," says Forbes. "To this

humid conditions farmers

end, 10 resistant CIP clones

could grow potatoes

are being multiplied under

throughout the year. But

quarantine conditions for

once late blight arrived it

shipment in June 2005," he

spread very quickly. By May

adds. "After further

2003 the devastation was

multiplication in Papua New

complete. Wh ile subsistence

Guinea, they will be assessed

farmers struggled to survive

in the field for adaptation

on alternative crops, and

and late blight resistance."

urban consumers bought

imported potatoes at three or

25

Potato late blight is a

devastating disease.

four times the price for local

Resource-poor farmers in the

produce, the government

developing world alone

appealed for help.

spend more than US$750

million per year on

Global Initiative on Late

fungicides to control late

Blight

blight while still losing an

As part of an Australian

additional US$2.5 billion in

response to the catastrophe,

yield; to which must be

Australian and CIP scientists,

added the millions spent on

including Greg Forbes, plant

controlling the disease in the

pathologist and coordinator

developed world. The

of the Global Initiative on

pathogen's taxonomy and

Late Blight (GILB) convened

biology are very well

understood, but a fully

understanding of how the

the man who bred Canchan,

effective response remains

pathogen populations evolve,

one of Peru's most popular

..,.

elusive. Breeders have

so that they can begin to

and widely grown varieties,

0
0
N

succeeded in producing

build models predicting

which was renowned for its

.....

varieties that will tolerate

future directions and thus

resistance to late blight. But

GI

various degrees of infection

stay one step ahead of the

not any more. In recent

IV
:I

but none is completely

disease.

years Canchan's ability to

immune. The problem is that

0
Q.

cc:
c

<

26

Meanwhile CIP's plant

withstand the disease has

P. infestans is highly

breeders have been working

broken down. Landeo

adaptable. "Over the past

towards developing varieties

shrugs. "Only one padlock,"

few years we've been

with a resistance to late

he says. "A strong one, but

finding new forms of

blight that lasts. So far,

not durable, or else there

P. infestans that have never

durability has been elusive.

we re low levels of resistance

been seen before, " says

The point is that although a

due to minor genes built in."

Forbes. 'The pathogen is

degree of resistance occurs

evolving faster than the

naturally in some varieties,

Recurrent selection for

control measures used to

and breeders have been

new varieties

combat it. New approaches

able to intensify that

With this in mind Landeo

are urgently needed."

resistance, it has eventually

began a breeding program

broken down. 'That's

in the early 1990s that was

because the resistance was

designed to develop

Fuller understanding of
pathogen populations

due to either a major gene

varieties which would be

Among the new approaches

on the one hand, or to

protected by many small

being developed, CIP

minor genes on the other,"

padlocks (minor genes), and

scientists are collaborating

Juan Landeo, of CIP's

be free of major genes

with colleagues from

breeding program explains.

national programs worldwide

"In the case of major gene

to track movements and

resistance, it's as though

changes in pathogen

there was one big padlock

populations in key locations.

with one big key keeping

DNA fingerprinting

the pathogen out. It worked

techniques and other state-

very well for a while, but

of-the-art methods are used

eventually the pathogen

to detect variation among

found a way through. And

pathogen strains. These

that's it: no more resistance!"

investigations are giving

scientists a fuller

Landeo speaks from

personal experience. He is

Canchan's
ability to
withstand
the disease
has broken
down

0
0

understood, but a fully

understanding of how the

the man who bred Canchan,

effective response remains

pathogen populations evolve,

one of Peru 's most popular

elusive. Breeders have

so that they can begin to

and widely grown varieties,

.....

succeeded in producing

build models predicting

which was renowned for its

varieties that will tolerate

future directions and thus

c.
~
a:

resistance to late blight. But

various degrees of infection

stay one step ahead of the

not any more. In recent

"'

but none is completely

disease.

years Canchan's ability to

immune. The problem is that

::J

Meanwhile CIP's plant

withstand the disease has

C(

26

P. infestans is highly

breeders have been working

broken down. Landeo

adaptable. "Over the past

towards developing varieties

shrugs. "Only one padlock,"

few years we've been

with a resistance to late

he says. "A strong one, but

finding new forms of

blight that lasts. So far,

not durable, or else there

P. infestans that have never

durability has been elusive.

were low levels of resistance

been seen before," says

The point is that although a

due to minor genes built in."

Forbes. "The pathogen is

degree of resistance occurs

evolving faster than the

naturally in some varieties,

Recurrent selection for

control measures used to

and breeders have been

new varieties

combat it. New approaches

able to intensify that

With this in mind Landeo

are urgently needed."

resistance, it has eventually

began a breeding program

broken down. "That's

in the early 1990s that was

Fuller understanding of

because the resistance was

designed to develop

pathogen populations

due to either a major gene

varieties which would be

Among the new approaches

on the one hand, or to

protected by many small

being developed, CIP

minor genes on the other,"

padlocks (minor genes), and

scientists are collaborating

Juan Landeo, of CIP's

be free of major genes

with colleagues from

breeding program explain s.

national programs worldwide

"In the case of major gene

to track movements and

resistance, it's as though

changes in pathogen

there was one big padlock

populations in key locations.

with one big key keeping

DNA fingerprinting

the pathogen out. It worked

techniques and other state-

very well for a while, but

of-the-art methods are used

eventually the pathogen

to detect variation among

found a way through . And

pathogen strains. These

that's it: no more resistance!"

investigations are giving

scientists a fuller

Landeo speaks from

personal experience. He is

Canchan's
ability to
withstand
the disease
ha<) broken
down

(single big ones) . The

technique, known as
recurrent selection, was
applied to two main genetic
sources of resistance
(breeding populations), with
the aim of upgrading gene
frequencies for partial
resistance to late blight (due
to minor genes) and raising
higher levels that would
eventually lead to the
selection of new varieties.
"In effect, each partially
resistant variety has
numerous small padlocks,"
Landeo explains. "And I
wanted to incorporate as
many as possible into
breeding populations, from
which varieties would
emerge with a string of
padlocks to keep the
pathogen out. The plant
wouldn't be totally immune
to infection, but if there
were enough padlocks it
would survive long enough
to produce tubers."
Working with thousands
of "pureblooded" native
Andean potato plants,
Landeo found that although
they all died when exposed
to normal levels of late
blight infection, specimens
from 60 clones survived at

lower levels. Crossing these

creep up the mountainside,

than the traditional highland

clones and repeating the

taking hold in areas where it

varieties, and seven of them

selection and crossing

was not previously a threat.

scored high marks in the

procedures through five

"When we got news of their

villagers' overall estimation.

cycles over a period of 13

plight I selected 20 clones

They had not succumbed to

years, he found 150 clones

from among the late bl ight-

that survived to maturity

resistant breeding

produced good harvests,

when exposed to severe

populations we were

their tubers were well-

levels of late blight. "What"s

working with," says Landeo,

formed, the right color, they

more, they preserve the

"and sent 100 tubers of

cooked well, had the right

color, taste, texture and

each up to Chacllabamba."

textu re and tasted very

late blight or frost, they

0
0

.....

a.
Iii
a:

"'c.
j

ct

culinary qualities of the

good. "The program has

original varieties," says

New clones perform well

been a success," says

Landeo.

In May 2004, when

Landeo. "We have bred

Landeo had an

Chacllabamba's potato fields

highland-type potatoes that

opportunity to test his

we re due for harvesting, a

resist late blight while

clones when the Quechua-

team including scientists

retaining the qualities that

speaking farmers of

from CIP returned to see

make them acceptable to

Chacl labamba, a remote

how the new clones had

consumers." It is his hope

village in the high Andes,

fared and hear what the

that these new potatoes

appealed to CIP (via their

villagers thought of them, in

(and some more tuberosum-

local government agricultural

terms of both their

like clones also developed in

advisory service) for help.

agronomic and culinary

the program) will eventually

Th eir crops of native

characteristics. Appearance,

be available to people in

potatoes had been almost

taste and cooking qualities

Africa and Asia, and there

totally destroyed by an

are very important to the

can be little doubt that

enemy previously unknown

people for whom native

villagers in the highlands of

to them: late blight.

potatoes are the staple food.

Papua New Guinea would

In Chacllabamba, at more

"They grow potatoes and eat

have a use for them too.

than 4,000 meters above sea

potatoes at every meal -

level, harsh climate

often potatoes are the meal

conditions had kept

- so of course they have

Phytophthora infestans at

strong opinions about what

bay. But the increased rain

constitutes a good potato,"

and temperatures associated

says Landeo.

with global climate change

had allowed late blight to

The new clones had

produced better harvests

29

resistance comes from a

113 wild species and

so/anacearum, the bacterium

wild relative of the

subspecies of potato were

that causes bacterial wilt

domesticated potato its

tested for resistance. In first-

(see Box 3), has been

transfer to commercial

of-their-kind tests conducted

outwitting farmers and

varieties should not be too

during 2004, genotypes that

scientists for a very long

""

..

....
0

c..

difficult - whether by

showed resistance were re-

conventional breeding

exposed to the pathogen in

keeping the disease at bay is

procedures or by direct

less severe conditions, to

essential and, fortunately,

gene transfer.

assess the presence of latent

affordable. The same cannot

infection in tubers. Seven

be said of developing

.....<11

Major constraint

wild potato genotypes came

nations, and it is here that

Bacterial wilt is the number

through very successfully,

the work of Sylvie Priou and

.....
"'

two constraint (after late

exhibiting high levels of

her team at CIP is especially

c..

blight) on potato production

resistance to both wilt in the

relevant.

"'c

in more than 40 developing

stems of mature plants and

countries. More than four

latent infection in the tubers.

Supersensitive

million hectares are infected,

Studies to identify the

methodology

causing damage estimated

mechanisms and genetic

An important milestone in

to exceed US$0.5 billion

basis of the resistance will

the battle against bacterial

annually. Tens of millions of

proceed during 2005, before

wilt was passed in the late

farm families are affected,

the trait is transferred to

1990s, with the

time. For developed nations,

commercial potatoes - and

development at CIP of a

from there to the fields of

procedure that vastly

loss. To have found a source

farmers in developing

enhanced available methods

of resistance to this scourge

countries. "I'm 90 percent

of detecting Ralstonia

is a major breakthrough that

certain that our final tests

solanacearum in its latent

ultimately could increase

will confirm the resistance

form . Priou and the CIP

productivity by an average

we have already seen," says

team refined the procedure,

of 10 percent across the

Priou. "Just a few more

which multiplies the bacteria

developing world and by

months ... "

in samples to be tested with

the NCM-ELISA technique

most severely afflicted

make a definitive

(enzyme-linked

regions.

announcement at this stage

immunosorbent assay on

reflects both scientific

nitro-cellulose membrane). It

CIP have spent four years on

caution and her respect for a

is one million times more

a large-scale screening

tough and resourceful

sensitive than methods

effort: 4461 genotypes from

adversary. Ralstonia

previously used to detect

Priou and her team at

0
.....
0

.....

suffering yield reductions

Priou's reluctance to

<11

that can amount to total

substantially more in the

<II

a:

"'c
~

<11
.....

31

"""

0
0
N

...
0

Q.
QI

a:

ClJ
'"-'

<lJ

0
'"-'

"'0

'"-'

"-

"'c0

32

Solan um
acaule in its
native habitat
A. SALAS

latent infection in potato

taken from infected fields

tubers. The procedure is as

often carries latent infection,

countries, doing good work.

But while certification,

sensitive as the sophisticated

even if it comes from

containment and good

techniques used in

healthy-looking plants." CIP

farming practices ease

developed countries - but

distributes detection kits at a

some of the damage

simpler, and far cheaper.

cost of US$120 each that

caused by bacterial wilt, no

allow users to evaluate up to

one doubts that the

to prevent bacterial wilt is to

250 tonnes of tubers, enough

availability of resistant

detect the pathogen on seed

seed to plant 150 to 200

varieties would achieve

before it reaches the farmers '

hectares. They are already in

more. With no susceptible

fields, " says Priou. "Seed

use in more than a dozen

potatoes to feed on ,

"The most effective way

Ralstonia solanacearum

genotypes from 199 wild

"Alberto Salas' observations

would fade out on even the

species and subspecies of

gave us the first indication

most heavily infested soils.

potato that could ultimately

that resistance to bacterial

be tested, but CIP's plant

wilt might exist in nature,"

taxonomist Alberto Salas was

says Priou.

Although CIP's plant

breeders had been working
on the development of a

able to give the team a clue

resistant variety for about 15

as to which might be

intensive sceening, CIP's

years, the prize had eluded

resistant. "I was on an

team has found 49

After four years of

<t
0
0
N

........
0

c.
a:
<11

RI

:;,

c
c

<C

them. The vastly more

expedition collecting wild

genotypes of 11 species

sensitive NCM-ELISA

species high up in the

resistant to at least five

procedures re-invigorated the

Porcon area of Cajamarca,"

strains of the pathogen. The

QJ
~

QJ

search. Since it is so

he recalls. "It was in the

most virulent forms of the

sensitive, scientists can be

1970s. We were not looking

pathogen found in different

confident that if no traces

for resistance in particular,

parts of South America were

are found, then the samples

just any wild potato species,

used to infect the wild

are free of the pathogen. But

but close to where I had

potatoes to test the staility

first, were any wild species

found a few healthy

of their resistance. After

resistant to bacterial wilt in

specimens of wild Solanum

having challenged 28 of the

even its visible form?

acau/e, I noticed a field of

49 selected genotypes in

cultivated potatoes that was

less severe conditions that

badly infected with bacterial

allowed the plants to

Resistance exists in nature

CIP is the custodian of the

wilt." Within this general

produce tubers, six

world's largest collection of

gene pool were also 30

genotypes of the wild

potato germplasm, so there

newly acquired wild species

species Alberto Salas saw

were several thousand

that had never been tested.

that day - plus one

genotype of another wild
species, Solanum chacoense

"Alberto Salas'
observations gave us the
first indication that
resistance to bacterial
wilt might exist in nature"

- showed high levels of

resistance to both wilt and
tuber infection. But there are
still 21 selected genotypes
of five other species to be
tested for tuber infection,
which could greatly broaden
the genetic basis of
resistance.

u
0
..,

..,"'
0

Q..

"'c0

As the likelihood of
confirming wilt resistance in
wild species became a
reality, Priou and her team
broadened their
investigations: was there
bacterial wilt resistance
among genotypes known to
have some resistance to
another disease: late blight?
Results so far are promising .
"During the current project
period, we have tested 177
of the genotypes that CIP's
late blight team previously
found to have some level of
resistance," Priou explains.
"And among these the
selection rate of wiltresistant genotypes reached
18.6 percent, compared with
only 3.3 percent for other
material tested."
Late blight and bacterial
wilt together cause
widespread hardship and
cost farmers worldwide over
US$ l .5 billion in control
costs and lost harvests. "If
combined resistance to both
diseases can be confirmed, it
would represent an
important advance," Priou
notes, with commendable
understatement.

.....__A.n

expeosi~e-.~-.~~

disease

<:t

0
0

.......
0

c.
QI

IX
IQ

::s
c:
c:
<C

Ra/stonia solanacearum, the bacterium that causes bacterial wilt, can

survive in small numbers in even the worst circumstances, and then
proliferate rapidly when conditions allow. Low concentrations are
enough to sustain a viable population in the soil, and a potato
planted in such ground will very quickly become infected. As the plant
grows, its vascular system becomes clogged with the rapidly
multiplying bacteria. The plant wilts and dies; the bacteria retreat to

"'c
0

the soil and the tubers, there either to concentrate as a pus-like mess
in the vascular ring that causes the tuber to rot, or to adopt its latent
state.
The latent state of Ra/stonia solanacearum is the most difficult. The
bacteria are invisible to all but specialized testing. The tubers appear
healthy, but will spread the disease wherever they are planted. They
can be eaten, since mammals are immune to the organism and its
latent form does not affect the taste or nutritional value of the tubers.
This may seem a blessing, but the bacteria can survive a journey
through the digestive system. Even sewage treatment plants do them
no harm, and when they reach water, aquatic plants serve as staging
posts for further proliferation as they disperse via irrigation systems
and back onto the land.

Ra/stonia solanacearum is thought to have evolved on native

Solanum species in the Andean region of South America . Europe was
invaded by virulent strains of Ralstonia in the 1990s. Now all of
Western Europe maintains a rigorous system of quarantine, testing and
certification. More recently, the arrival of potato-like strains in the
United States on Geranium was an immediate and potentially serious
threat to the huge US potato industry.
Containing the outbreaks of bacterial wilt in Europe and the United
States cost millions and maintaining a quarantine on the disease is a
massive recurrent expense, but there is a lot at stake. A huge industry,
supplies of a staple food and many livelihoods depend upon the
continuing viability of potato production. And in developing countries
it is often a matter of life and death.

35

innovation as its main driving

del Peru), run by Celfia

poverty, largely because of

force (see Box 4). The

Obregon Ramirez. Obregon

the inequity and inefficiency

innovation Devaux is talking

is particularly familiar with

in the traditional potato

about includes many areas

the plight of the smallholder

supply chain .

of intervention, from seed

farmers who produce yellow

technology and integrated

potatoes in the very high

was considering new

crop management to

Andes, above 3,500 meters.

avenues for ADERS, yellow

processing and marketing.

Yellow potatoes, valued by

potatoes seemed to be a

"CIP doesn't have expertise

Peruvian consumers over

sure bet. Not only were they

in all of these areas. We

white potatoes for their

grown by the poorest of the

have to develop strategic

floury texture and rich flavor,

poor, their potential for

alliances with key partners to

are among the very few

development was obvious.

cover that much ground ."

native potatoes always

''The product is excellent,

available in Peru 's rural and

demand is good, and the

One such partner is the

rural development group

In 2002, when Obregon

urban markets. Even so,

prices of yellow potatoes

known as ADERS (Asociacion

most of the farmers who

don't drop like they do with

para el Desarollo Sostenible

grow them live in extreme

white ones," she explain s. "It

Papa Andina's overriding mission is to improve the livelihoods of subsistence and small-scale producers by
helping them to respond to the changing political and social contexts in which they operate. Papa Andina was
conceived within the new multiple actor paradigm of technology innovation. It is a "learning" project developing
national capacities through collaborative learning with partners, progressively incorporating new ideas, adapting
them to local circumstances and finding new ways to achieve goals. Papa Andina brings together a
heterogeneous group of partners, including agricultural and development institutions, private sector
stakeholders, farmers and numerous other players in the potato market chain.
Papa Andina generates synergy in research and promotes technology spillover among national partners in
Bolivia, Ecuador and Peru. It is governed by a coordinating committee that includes representatives from the
Swiss Agency for Development Cooperation, the project's major funder, CIP and the ministry of agriculture of
each country. They are joined by a member of the lead institution in each of the participating countries: the
PROINPA Foundation (Fundacion para la Promoci6n e lnvestigaci6n de Productos Andinos) in Bolivia, the
Ecuadorian National Program for Roots and Tubers, and INCOPA (Proyecto de lnnovaci6n Tecnol6gica y
Competitividad de la Papa en el Peru) in Peru. Two CIP staff complete the committee: Andre Devaux, who is
based in Lima, and Graham Thiele, a social scientist who operates out of CIP's Ecuador office. Both of them
coordinate the actions of the project with national partners.

"'
......
0
0
N

c.
a:
GI

.,
::J

<

QJ

QJ

-0

ro

Q._

ro

c
0

38

was clear to me that we

CIP put together won a

de Cayna, in Peru 's Province

could make a real difference

competition convened by

of Ambo, who have come

by simply marketing our

INCAGRO (lnnovacion y

together to exchange their

product better."

Competitividad del Agro

experiences. "Your

Peruano), a competitive fund

enthusiasm and

potato production in Peru,

of Peru's Ministry of

determination have allowed

Obregon chose Huanuco as

Agriculture. Co-funding was

you to make headway."

With her knowledge of

the place to start. "Huanuco

provided by Papa Andina 's

has the best yellow potato

strategic partner INCOPA

growers still use ancient

on the market: Amarilla

(Proyecto lnnovacion

methods of cultivation,

Tumbay, the queen," she

Tecnologica y Competitividad

rotating their crops to allow

explains. At the same time,

de la Papa en el Peru).

their fields to rest and using

Obregon's familiarity with

These yellow-potato

animal manure as fertilizer.

CIP made it clear who she

Success in San Pedro de

Thanks to the INCAGRO-

should work with . "I knew

Cayna

INCOPA project, the farmers

that with CIP's expertise and

"It's rewarding to see the

have seen productivity in

backing, we had a winner.

signs of progress among

their fields grow by 45

So I went to see Andre."

you," says Obregon two

percent, on average. The

Obregon's conviction was

right. The proposal she and

years later, to a group of

benefits are evident

producers from San Pedro

throughout the small

community. "A few years

provider of the community.

planning." De la Cruz goes on

ago there weren't even

De la Cruz is presenting the

to explain that the first

telephones in Cayna,"

results of the INCAGRO-

priority of the communal

continues Obregon. "Now

INCOPA project at the

group, made up of 45

the roads have improved

workshop. The audience

families, was to produce

and you even have your

includes potato farmers from

quality seed. They developed

own radio station," said

nearby areas who have

a seed system using disease-

Obregon at the meeting.

come to learn from their

free material supplied by

One of the workshop

neighbors' achievements.

CIP's highland station in

participants, Pedro de la

"I'm impressed by what you

Huancayo. From there, they

Cruz Ramirez, is also

have accomplished for

went on to build a

president of the Empresa

yourselves and your

distribution and storage

Comunal de Servicios

community," says Leonidas

facility, from which they are

Agropecuarios San Pedro de

Acosta Valdiviezo of Chaglla.

now able to sell their product

Cayna. This producer

"I'd like to do the same for

directly in Lima without

association evolved out of a

my community. What is the

depending on intermediaries.

participatory research group

key to your success?"

This means more profits for

in postharvest practices to

De la Cruz responds

the producers as well as

become the trading

without hesitation, "In the

much better market prices for

company and service

first place, organization and

consumers.

The Cayna producers aim

group and one of the new

is coordinated by Papa

to refine their knowledge

generation of potato

Andina for CIP, has helped

and capabilities to produce

technicians that have

develop stakeholder

starter seed and services for

emerged from training

platform s made up of

others in the region. "Since

programs run by CIP and its

different groups in the

the project began we have

partners. As well as seed-

potato market and supply

learned a lot. We've had the

multiplication techniques,

chain, from researchers to

opportunity to participate in

Espinoza has taught

producers to chefs. Despite

tra ining events here and

fundamental concepts such

thei r diversity, all have one

elsewhere," explains de la

as integrated pest control

thing in common : their

Cruz. "With CIP's help, we

and crop planning to the

desire to help small-scale

hope to learn even more. If

farmers .

we can begin to supply

As well as technological

growers improve the

competitiveness of Peruvian

high-quality seed to our

expertise, however,

potatoes by taking advantage

neighbors, we can cover

encounters with other

of new and emerging

much more ground."

groups in the potato market

market opportunities. They

chain have been crucial. "We

expect to do so using the

Ramirez has been supervising

have INCOPA to thank," says

participatory market chain

the Cayna producers. He is

Obregon, " INCOPA and CIP."

approach (see Box 5) .

the manager of the producer

The INCOPA p roject, which

Leonardo Espinoza

damaging the product from

community believes in us.

handling. "This was possible

They have seen that our

thanks to the mutual

success also benefits them."

'<!'

The producers of San

0
0
N

confidence built up through

the INCOPA interchanges,"

Pedro de Cayna are

says Obregon. 'The people

enthusiastic about the future.

who are buying our product

They are looking at new

are sure that they are getting

products, such as processed

what they are paying for."

potatoes for puree, and are

......
0

c..
QI

a:

'

:::l

c
c

<(

thinking about training

Clear impact

QJ
~

c
QJ

programs that will help them

The Cayna growers are

enthusiastic about their
success. They have

share their knowledge with

other farmers.
"You know it all by

significantly increased their

heart," says Obregon,

average yearly family income

summing up the technical

ro
~

0
CL

ro

c
0

ro

::
QJ

INCOPA brought the

Cayna producers to Lima,
where they met buyers in
the wholesale market and
the big supermarkets. The
farmers understood the
quality criteria behind market
demand and adapted their

from sales of Tumbay. Above

expertise they have gained.

and beyond the boost to

"With your effort, experience

their livelihoods, they have

and enthusiasm, we can take

made gains that are far less

off from here, adding value

tangible, but equally

to our potatoes and giving

important. "We've had

them the value they

success and failures," says de

deserve." A brighter future

la Cruz. "But we've gained

for the farmers of Cayna is

confidence and the

just beginning to unfold.

practices to meet them.

The Cayna growers now
know that it is crucial to
plan their plantings to
ensure that they will not be
flooding the market when
demand is low. They have
also begun to select their
potatoes, delivering them in
graded, preweighed bags to
eliminate steps in the chain
that were raising costs and

Canchan's
ability to
withstand
the disease
has broken
down

41

<t
0
0
N

......
0

Q.
QI

a:

~articipatory

market
ct1a1n approach

<I.I
....,

Papa Andina's innovative participatory market chain approach (PMCA), developed in conj nction

<I.I

with CIP'S Impact Enhancement Division, is a demand-driven research and development

...
..."'

that aims to identify, analyze and implement joint market opportun ities through a parti ipatory

0
0

CL

"'c0

odel

research process during its three phases of implementation .

PMCA seeks to generate group innovations in a shared decision-making process that defines
and implements joint activities. Commercial innovations that bring added value to nativ
potatoes drive technological and institutional innovations that are achieved through its
implementation.
The first phase begins with diagnostic research, accomplished through extensive inte views.
These interviews allow researchers to get to know and understand the key people and , roups

42

in the market chain and to understand their interests, problems and ideas. Based on thi
research, small working groups are then formed of members with shared areas of intere t .
The working groups exchange ideas and experiences in meetings, collectively identif ing
and evaluating challenges and opportunities with a strong demand-oriented focus. "This is

Objectives

Participants

Leading tnsti ution

Phase 1
To get to know the different market
chain actors, their activities, interests,
ideas, problems, etc.
Interest

Phase 2
To analyze potential market opportunities using participatory methods
Phase 3
To implement joint innovations:
new market products
new technologies
new in stitutions

Leaders hi

Trust

Facilitacio n

Collaboration

Backstoppi g

when everyone talks about their problems,"

says CIP's Andre Devaux. Specialists may be
called in to support the process, but the idea is
that the members of each group select the
problems they feel are most pressing, the best
opportunities and together agree on actions to
take. In the process, confidence and trust is
built among the many people involved. "It can
be summed up in two words," Devaux
concludes, "Collective learning". In the final
stage of this second phase, identified market
opportunities are presented by each working
group and discussed with a wider audience,
which allows the integration of new people
into the research and development process.
The third and final phase concentrates on
implementing the activities needed to take
advantage of the market opportunities the
groups have envisioned. Guided by the lead
institution, with support from CIP, this process
may take from three to six months. The
commercial innovations obtained may come as new or improved products or services, such as two new brands
of yellow and native potato chips, "Papy Bum" from Peru and "Lucana" from Bolivia.
At the end of the process, the participants present the positive outcomes of their activities. More than just a
ceremony, the event is actually intended to capitalize on the project's outcomes to help the actors move forward
with their initiatives. By inviting media representatives, politicians and donors, the organizers generate interest in
the larger community and fuel continuing support. "The idea is that we pass full responsibility over to the
actors," says Devaux, "helping to ensure that they have what they need to sustain the innovations, of which
they are now the proud owners".

rich orange-fleshed sweet-

A sharply focused project

differ from white varieties in

potato, but are also earning

aimed at children

taste (they are sweeter) and

a living from the sale of

"We have made VITAA a

texture (more moist) - but

.,.
0
0
N

roots and processed products.

sharply focused program,"

they are not as different as

I myself make juices,

explains Regina Kapinga,

carrots, for instance, and will

doughnuts, cakes and chips

VITAA' s Africa-based

grow wherever the white

that I sell from my kiosk.

coordinator. "There are 50

varieties will.

People like them too much."

Vitamin A is essential for
normal development,

million children in Sub-Saharan

"Even so, persuading

a:
IQ

:I

<

people to eat something

vitamin A deficiency. For all of

they're not accustomed to was

::.

"';

them, eating just 100 g - that's

never going to be easy," says

pregnant and nursing

about half a cup - of orange-

David Yanggen, agricultural

mothers (see Box 6). CIP

fleshed sweetpotato each day

economist leading a CIP

pioneered the Vitamin A for

would solve the problem. And

initiative that is assessing the

Africa (VITAA) partnership,

if children grow up with the

impact of orange-fleshed

which is thought to be the

habit of eating it as part of

sweetpotato on health. "But

world's first large-scale food-

their staple diet they'll feed it

the need is immense." In

based initiative to eradicate

to their children too. A vitamin

Uganda alone, a survey in

vitamin A deficiency (see

A-rich diet will become part of

2000-2001 found that in most

Box 7). The principal thrust

the culture."

parts of the country, more

And the signs so far are

than 50 percent of pregnant

Africans to grow and eat

good. "My children love it,"

and lactating women were

orange-fleshed

says Florence Kiwendo, a

deficient in vitamin A. Among

sweetpotatoes (which are

farmer and mother of six in

Ugandan children, nearly one-

rich in vitamin A) in addition

crowded central Uganda. "At

third were deficient. The good

to the white varieties (which

first I wasn't keen myself,

news is that a first-of-its-kind

have no vitamin A) that are

because it's not what I was

study conducted by South

widely grown in Africa. Since

brought up on. But now I'm

African scientists under the

its launch in 2001, VITAA has

getting to like it too. The

umbrella of VITAA confirmed

made real progress, largely

nutritional advisor at our clinic

that eating orange-fleshed

because its concerns are

says it will add a sparkle to my

sweetpotatoes really does

aimed at the section of

eyes!"

make a difference. School

society people care for most:

Q.
Cl

Africa who are at risk from

especially in children and in

has been to encourage

.....

A major advantage of VITAA

children aged between 5 and

young children, and

is that it does not ask people

10 years who ate a daily

harnesses the energy of a

to start growing and eating a

portion of orange-fleshed

large and dedicated

food they are not used to.

sweetpotatoes (100-200 g)

workforce: their mothers.

Orange-fleshed sweetpotatoes

had significantly increased

--'"'
"C

"'c0

45

.,.
0
0

...

0
Q.
Qj

a:

..,

:I

c
c

<

c::
a..

-.;:
:::

levels of vitamin A after just

money you have a win-win

11 weeks.

situation."

'VITAA has the capacity to

help massive numbers of

the many women throughout

people," says Yanggen. ''The

Uganda who are the living

introduction of orange-fleshed

proof of this contention.

sweetpotatoes has already had

Jowelia's active involvement in

a significant impact in target

sweetpot ato growing began in

areas of Uganda. What we're

1975, the year she was

looking for now is that

married. In customary fashion,

orange-fleshed sweetpotatoes

she established a small garden

will advance to become

(1 /4 acre) and raised a

integrated into African food

growing family on its white-

production and consumption

fleshed sweetpotatoes,

systems."

bananas, maize, beans and

;;-

::..

46

Jowelia Sekiyanja is one of

cassava. The garden supplied

The sweetpotatoes offer

food, while Jowelia's husband

women the chance of

(a civil servant) provided

earning money

money for household

Although health is the primary

essentials. Jowelia had no

incentive for the introduction

income of her own. Things

of orange-fleshed

began to change, however,

sweetpotato, family economics

when Makerere University's

are also helping to carry its

Child Health and Nutrition

potential over the threshold

Program told her and other

and onto the dinner tables of

mothers of the dangers of

Uganda. The sweetpotatoes

micronutrient deficiency in

offer women the chance of

children - especially vitamin A

earning money, as well as

deficiency. Through the VITAA

saving their children from

program she learned of the

vitamin A deficiency.

new orange-fleshed varieties

"Sweetpotatoes are tradition-

that could supply the missing

ally a woman's crop," explains

vitamin A and began growing

Regina Kapinga. "And when

them. As the promotion of

you offer a woman something

orange-fleshed sweetpotato as

that is both good for her chil-

a means of combating vitamin

dren and brings in some extra

A deficiency spread through

Vitamin A is essential for a child's normal mental and physical development and for keeping the
body healthy and strong Vitamin A deficiency is one of the leading causes of early childhood
blindness and death in Africa. The lack of it can be a death sentence, in some cases directly but
more often via a weakened immune system, which exposes victims to diseases such as measles,
pneumonia and malaria. Vitamin A deficiency also reduces the ability to see clearly in poor light and
can lead to blindness.
The actual amounts of vitamin A and other micronutrients required by the body are very small
but, overall, micronutrient deficiency is a notorious "hidden hunger" of the developing world . And
along with the health issue there is an inevitable economic consequence. By affecting the learning
ability of children and sapping the energy of working -age people, micronutrient deficiency causes
billions of dollars of lost productivity in countries that can least afford it.
It is only since the 1980s that nutritionists have assembled compelling evidence that the diets of
many children (especially young children) and adults in developing countries do not provide healthsustaining amounts of essential vitamins and minerals. Vitamin A deficiency is one of the most
prevalent problems, particularly in Sub-Saharan Africa and South Asia, where "severe vitamin A
deficiency has very high fatality rates (60 percent)," according to World Bank nutritionist Judith
McGuire, and "even sub-clinical deficiency is associated with a 23 percent increase in pre-schooler
mortality in areas with endemic vitamin A deficiency."
A massive international effort to combat vitamin A deficiency has been underway since the early
1990s. Emphasis in many countries was initially placed on supplementation programs, believing that
the distribution of vitamin capsules could solve the problem quickly. However, experience has shown
that although supplementation can be cost-effective, it must be repeated every six months and thus
can be difficult to implement in countries with poorly developed health and road infrastructure. A
second approach, that of fortifying common foods with a micronutrient, has been used successfully
in some instances (iodized salt successfully treats iodine deficiencies, for example). But in countries
where markets for food are not well developed, it has been difficult to identify appropriate foods to
fortify and ensure they would reach the consumers who are most at risk.
A third approach is to improve dietary quality and quantity through diversification. Here the aim
is to achieve and maintain an adequate intake of vitamin A (and the other essential micronutrients)
as part of an adequate total diet. A food-based approach such as this requires an inter-sectoral
perspective, which means providing agricultural and educational inputs, together with a keen
awareness of cultural, socio-economic, market and health conditions - a challenging proposition but
likely, economists believe, to be the most sustainable of the three available options. The advantage is
that once achieved, food-based approaches are self-sustaining and by far the lowest cost approach.

partners
The VITAA partnership, winner of the 2003
CGIAR Partnership Award, is a novel initiative
that is achieving a major impact in SubSaharan Africa (SSA). On May 9, 2001 , an
international group of 70 agriculturists, health
expe rts and nutritionists launched what is
believed to be the first crop-based initiative
to attack the tragic consequences of vitamin
A deficiency in the region .
Pioneered and led by CIP, more than 50
partner agencies from the health, nutrition
and agricultural sectors are now working
together to extend the impact of orangefleshed sweetpotato in more than ten partner
countries in the SSA region. The original
VITAA countries included Ethiopia, Kenya,
South Africa, Tanzania, Uganda, Mozambique
and Ghana. CIP and partner scientists are
working in this region , and for the larger
global community.

the community, people were

an income of her own, and as

wait like that anymore," she

keen to buy roots from

it grew, her status in the

says. Jowelia bought a site in

Jowelia, and the vine cuttings

family and the community

the nearby trading center, built

with which they could begin

was transformed. She could

a house for the family and

growing the orange-fleshed

pay the childrens' school fees

bought clothes, a radio and a

varieties themselves. Before

instead of having to depend

refrigerator. Her sweetpotato

long, 90 of the 95 households

on her husband. "Before, the

holding expanded to five

in her own community were

children would have to wait at

hectares, and she is putting up

growing and eating orange-

home, missing school, until

a building on the commercial

fleshed sweetpotato regularly.

their father could bring the

site she bought - all initially

Jowelia Sekiyanja now had

money. They don't have to

from the sale of fresh

sweetpotato and vines.

Lately, though, there has
been an added value
element. Each day, Jowelia

q0
0

processes and sells juice,

.....

doughnuts, pancakes and

a:

0
0..
QI

cakes made from

sweetpotato. "I've opened a
savings account, and every

.'1J

day I put more money in it,"

she says.

<11
J

"As a wife who was

entirely depending on her
husband I feel really proud

""c

for having made this," says

-"'

Jowelia. And she is not the

a,

only one to have benefited

in this way. In her
community and across the
country, "the arrival of
orange-fleshed sweetpotato
has been a moneyspinner for
many women,'' she says.
"Orange-fleshed
sweetpotato is definitely a
life-saver first, and a moneyspinner second," reflects
Regina. "It is nice to see
mothers making some
money from providing
vitamin A supplements,
instead of the pharmaceutical
industry,'' she adds,
whimsically.

49

urban agriculture in the

responsib le for enforcing

employed by the

municipality, and responsible

health regulations, the

municipality with a brief to

for ensuring its farmers are

public water supply is a

utilize the services and

aware of city health

service of the state.

expertise of Urban Harvest,

regulations. "You must clean

Saracoto has yet to be

which CIP coordinates,

up this place," she told Luis

scheduled for connection .

wherever possible. Already

again.

Meanwhile, its residents

this has allowed her to liase

Luis was not inclined to

must buy their water from

effectively between farmers

argue. Indeed, there could

private suppliers, and it is

and local authorities on

be no argument, and it was

not cheap .

issues of land ownership

not just the pigsty that

"We have to help

pigraising as an urban

of Saracoto was in

wherever we can"

occupation . Saracoto 's water

desperate need of attention.

The municipality is not

supply now features

Luis shrugged, and led the

insensitive to the difficulties

prominently on her agenda .

group away from the pigs,

facing Luis Cespedes and

towards the shack in which

his colleagues in the

like a contradiction in term s,

he lived with his young

Saracoto Association of Pig

but growing food has

wife. Their first child was

Marketers. "We know they

become a lifeline for

due very soon . They had

must have somewhere to

millions of people in cities,

Farming in cities sounds

made a respectable home

live", says Rocio Oyola,

bringing a measure of self-

out of discarded corrugated

"They have to make a

sufficiency to the poorest of

iron and timber. It was

living. We are very

families. Most of those

clean . A cage with two song

concerned about the health

crowding into the cities of

birds hung in the shade of

risks, but we have to

the developing world are

an awning ; purple-flowered

understand their situation

from rural communities. Any

bougainvillaea climbed a

too. Our job is not just to

open piece of ground is an

corner post. Luis stood

enforce regulations, we

opportunity to feed

proudly now. The shack and

have to help as well,

them selves and earn some

his body language said it all :

wherever we can ."

money as well. After all,

It is at this interface,

cities are concentrations of

Saracoto should be as clean

where urban agriculture

wealth as well as poverty,

as this. Give us a water

confronts the edicts of an

with a constant demand for

supply and we'll hose it

urban municipality that

fresh vegetables, meat, cut

down tomorrow".

CGIAR's Urban Harvest

flowers, ornamental plants

initiative (see Box 8)

and other agricultural

operates. Rocio Oyola is

products.

And there's the problem.

While the municipality is

0
N

........
0
0..
GI

a::
tt;I

:::l

s::

s::

er:

and the legitimacy of

needed cleaning up: most

"Yes, we know, all of

"'c

..
0

ro

QJ
+-'

51

Urban Harvest provides strategic information and practical technology to practitioners and policy makers inv ' lved in
urban agriculture. Its research is designed to enhance food security, augment nutrition and help urban famil es
improve their earning capacity. In the process, Urban Harvest aims to reduce environmental pollution and m igate
the health risks stemming from poorly managed urban production. Fundamentally, its mission is to promote the
view that urban and peri-urban agriculture, when practiced sustainably, is not only productive but can also
valuable contribution to the development and wellbeing of the world's urban centers.

ake a

"Urban Harvest is a response to a pressing need," says anthropologist Gordon Prain, who coordinates th
initiative from CIP's headquarters in Lima . "The past 30 years have seen an explosion in urban populations a d
urban poverty. Urban agriculture provides an important opportunity for new migrants to supplement house old
food supplies and earn cash incomes. It can make a valuable contribution to the nutritional status and inco e of
vulnerable households. But it is vitally important to ensure that it is supported and recognized by local gov rnment
policies and regulations, and contributes to a healthy environment."
Focusing its activities on large, rapidly growing cities with significant concentrations of poor people and a high
proportion of food and nutritional insecurity, Urban Harvest has established platforms for stakeholder dialo ue and
policy analysis in a number of locations. "Stakeholder dialogue is crucial," says Prain. "All parties must discus the
issues with one another. Often there is misunderstanding, sometimes hostility, but urban agriculture offers p sitive
opportunities on many levels, and once that is understood and accepted, people begin working together to ards a
resolution ."

Millions of urban families

superfluous laws, set the

the surrounding agricultural

depend on technically

stage for real reforms that

land. The projected plan for

illegal activity

will reduce health ri sks to

Lima in 2010 makes no

..,.
0

Urban farming is not an

farmers and consumers, and

provision whatsoever for

activity that municipal

improve the quality of life

agriculture in Lurigancho-

authorities facilitate or even

in the city," says Diana Lee-

Chosica. It is this

approve of. In many

Smith, Urban Harvest's

unquestioned assumption of

in stances, city ordinances

Regional Coordinator for

inexorable urban expansion

condemn it. Yet an

Sub-Saharan Africa .

that Blanca Arce's work is

estimated 800 million

"Kampa la is the model

....

c..
<II
a:

"'

:I

<

tackling - both in the

....c~
(lJ

people already earn their

for what we would like to

meeting rooms of the city

living in this way, a number

achieve here in Lima," says

administration and in the

that will continue to ri se

Dr. Blanca Arce, a specialist

fields, gardens and livestock

....ro0
....0

rapidly through the first half

in animal production

pens of Lurigancho-Chosica.

of the twenty-first century.

systems who coordinates

"There are 20,000 families

This means millions of urban

Urban Harvest initiatives in

who are involved in

familie s around the world

Latin America. Stakeholder

agriculture in some way or

depend on an activity that

dialogues involving farmers

other," she points out.

is t echnically illegal, yet in

and city officials are already

"seventy percent of their

total they make a significant

ongoing, and Dr. Arce is

plots are less than one

contribution to urban food

directing the research and

hectare, some are very

supply networks and

development activities of

small, a few range up to ten

economies. This is a

the urban agriculture project

hectares, but in all ca ses,

paradox that Urban Harvest

in Lurigancho-Chosica, on

farming is a crucial part of

aims to resolve.

the north-eastern fringes of

the household economy. "

Urban Harvest initiatives

Lima. The appointment of

Two hundred fifty families

in Hanoi, Manila and

Urban Harvest liaison

are directly involved with

Kampala are already

officers to municipal

the program . Th ey have

producing positive results

administrations in two of

good fertile land: with

(see CIP Annual Reports

Lurigancho-Chosica 's five

irrigation it can be cropped

2001, 2002 and 2003). Most

sectors is an encouraging

continuously, producing

recently, stakeholder

measure of progress. One of

three or four harvests of

dialogues in Kampala led to

them is Rocio Oyola.

various crops a year. "We

new regulations being

As Lima has grown from

don 't preach," Dr. Arce

drawn up by the City

a city of 973,000 in 1950 to

insists. "We respond to the

Council. "These will simplify

approaching nine million in

farmers' enquiries - with

or nullify dozens of

2005 it has swallowed up

workshops on how to

a._

ro

c
0

53

washed has previously run

<t
0
0
N

.......
0

c.

QI

a:

Lima has grown ...

it has swa Ilowed
up the surrounding
agricultural land

through the village on the

hill above - where it could
have been contaminated
w ith household effluents .
"This is something we are
working on," he says .

Lima is hungry for pork

QJ
+-'

And then there is Luis

QJ

improve productivity and

president of the local

Cespedes and hi s colleagues

marketing, for instance, and

Farmer Field School and the

in the Saracoto Association

by helping farme rs to set

neighbors are working with

of Pig Marketers. Out on

up Farmer Field Schools that

him on experimental plots

the dirt road that run s

can give advice on specific

that should tell them which

through Saracoto's

issues, such as fertilizers

fertilizer is best suited to

ramshackle buildings and

and pest control."

which crop - chicken

pigsties he explains that,

manure, stable manu re or

although the Association

commercial fertilizer.

bought the land ten years

0
+-'

ro

+-'

0
CL

ro

c
0

+-'

ro

QJ
+-'

54
"The neighbours laughed
at me - but it worked"

Over at Carapongo,

ago, they obtained legal

On the meticulously

Esteban Malpartida looks on

furrowed hectare of land in

approvingly as a local

2004 - after Urban Harvest

the Nana district of Lima

farmer harvests a hectare of

advisors had helped to

that has supported Leoncio

radishes. Mr. Malpartida is

clarify crucial owne rship

Rivera Hijar and his family

president of the elected 8-

issues. Just recently, the

for 25 years, insect pests

person committee

Lima city authority officially

had become a problem .

responsible for ensuring that

recognized pig raising as a

t itle to it only in November

Pesticides were prohibitively

the complex irrigation

leg itimate livelihood. Urban

expensive, so Mr. Rivera

network of the former

Harvest advisors were

Hijar turned to Urban

hacienda is kept in good

involved with that

Harvest for advice. "They

order, and its waters

development too, and now

told me to put up fly-traps

equitably distributed . "That's

Mr. Cespedes is hopi ng they

made of yellow plastic and

a good crop," he says of

can help the Saracoto

smeared with grease. The

the radishes, but does not

Association improve their

neighbours laughed at me.

need reminding that the

husbandry and living

It was embarrassing. But it

stream of water in which

conditions . "At present w e

worked. " Now he is

the bunches are being

market an average of

around 10 pigs a day," he

says . "It could be more. We
could sell 100 a day. Lima
is hungry for pork."
Like most cities, Lima
does not yet fully
appreciate the value of
what urban farmers have to
offer. The Saracoto
Association is already
making a positive
contribution to the food
budget of the city - and
doing the municipality a
favour in the process.
"eighty percent of what we
feed our pigs is kitchen
waste we collect from
restaurants and factory
canteens, " Mr. Cespedes
explains. "If we didn't
collect it, the municipality
would have to pay someone
else to do it."

in Peru from CIP-derived

Valdizan in Huanuco, and

I told him to come to

materials in recent years.

now, since 2002, as a

Huanuco." The department

member of the Proyecto de

of Huanuco, one of Peru 's

'<I'

achieved this," he says,

Reducci6n y Alivio a la

poorest, comprises enormous

0
0
N

"without the Peruvian

Pobreza (Proyecto PRA).

ecological diversity.

"We couldn't have

farmers and scientists who

Mendoza calculates that he

have worked side-by-side

has participated in the

Mendoza, signaling the

with us to develop and test

evaluation of some 20,000

surrounding landscape.

the varieties. They deserve

CIP-derived potatoes.

"We're at 3,500 meters

much of the credit, for their

"We have Juan Landeo to

"Right now," continues

above sea level. But just

......
0

Q.
QI

a:

~
...,
c

QJ

thank for placing his bet on

over those mountains is the

Huanuco," he says. "And it

jungle. In an hour we can

...,0
...,"'

Juan Landeo can testify to

has certainly paid off."

be in Tingo Maria, where

Cl..

this. He has spent a good

Mendoza is referring to the

there's 80-90 percent

conviction and dedication."

CIP potato plant breeder

part of his career

success of Canchan, a high-

humidity all year long. That's

contributing to the pool of

yielding, late blight-resistant

late blight paradise."

potatoes available to farmers

potato variety tested and

in Peru. Working closely with

released by the Huanuco

The proof is in the potato

his Peruvian partners, Landeo

experiment station from

"We had to face a lot of

has been able to develop

materials developed by

resistance," explains

and test the new varieties

Landeo and his team.

Mendoza . "Believe it or not,

on the ground.

Although official figures are

nobody wanted a new

lacking, CIP scientists

potato variety. The markets

Mendoza," he says . "He's

estimate that Canchan easily

had been selling Yungay for

helped to produce most of

covers at least 50 percent of

twenty years and they

the varieties that have been

the area planted to

preferred to keep the status

released in Peru from CIP

commercial potato

quo. We ended up having to

materials."

production in Peru.

"Talk to Alejandro

"It all began in 1983,"

"'c0

...,

"'c
~

...,
QJ

disguise it as another, more

familiar variety to sell the

Partnerships that pay

recalls Mendoza. "Nobody

product of our first cycle of

Alejandro Mendoza has

wanted to invest in Huanuco

seed production in the

worked for 20 years in close

- coca production and

markets."

cooperation with CIP as

terrorism made the risks too

head of the Peruvian

high. But when Juan told

The variety's outstanding

characteristics had not gone

national experimental station

me that CIP wa s looking for

unnoticed, however, by the

in Huanuco, professor of the

the ideal spot to evaluate its

farmers who had been

National University Hermilio

late blight-resistant materials,

testing it in their fields.

57

<:!'
0
0
N

.......
0

0..
Q)

a:

Q)
~

c
Q)

u
0
~

ro
~

0
Q_

"'c0

58

"Canchan is a classic
example," says Landeo, "of

determined to use it.

"It didn't take long for

continues. "He had heard

about Canchan and wanted

how the will and effort of

the word to spread among

to try it. He ended up

the small farmers can

them," says Mendoza.

producing 40 tonnes per

prevail." Impressed not only

Summing up years of

hectare in his first season."

by how well it stood up to

experience in one phrase,

Although this is a normal

late blight, enabling them to

he adds: "If a potato is good,

yield for European or US

cut their pesticide

it will find its own way."

potato fields, average potato

applications to a minimum,

"I soon got a call from a

but also by its cooking

farmer from Mala, a coastal

quality, the farmers were

valley near Lima," Mendoza

yields in Peru reach only 12

to 13 tonnes per hectare.

The variety that could, the

According to Mendoza,

quality, unprecedented

farmers that would

they probably missed the

resistance to late blight, and

In terms of quality, the

mark by over a hundred

fantastic yields. One of the

..,,.

coastal farmer's results were

thousand hectares. "My

secrets to the new variety's

0
0
N

even better than he had

calculation is that Canchan

success is its ancestry, which

expected: at sea level,

covers anywhere from 140 to

includes native potatoes. This

Canchan produced a potato

150,000 hectares in Peru

gives it its deep purple skin

that was extremely low in

today," he says. "I am

color and floury texture.

......
0

Q.
QI

cc:

"'::sc:
c:

ct

sugar content. This made it

permanently in contact with

ideal for processing, an

growers and researchers all

Mendoza hopes to name the

emerging source of demand .

over the country, and they

new variety, promises to do

Huanuquefiita, as

~
c

(JJ

u
0

"After this," recalls

give me their information.

everything Canchan has

(1J
~

Mendoza, "we began to sell

Twenty hectares here, fifty

done, and more. To draw

a..

Canchan seed from Huanuco

there - it adds up." Updated

farmers' attention, he

like popcorn." The variety still

analyses by CIP put Canchan's

planted a field of the new

hadn't been officially

economic benefits in Peru at

potatoes next to another,

released . But the farmers

some US$90 million per year.

smaller plot sown to

(1J

Canchan. After a few

pushed the envelope.

Cultivating change

months, the message was

continued to this day, making

Landeo and Mendoza both

clear even to the untrained

it the predominant

recognize, nonetheless, that

eye; while Canchan's foliage

commercial variety on the

it is time for a change. In

was withered and brown,

Peruvian market. In 1996 CIP

2000, Canchan's resistance to

economists published an

late blight began to break

impact study, calculating

down. Farmers who once

benefits per hectare at

thought the variety was

US$280 to $600, mainly from

invincible began to see their

Canchan~

success has

reduction in use of

fields "melt" in the face of

pesticides, with a stream of

the disease.

net benefits of US$8 million.

"They are controlling it

Their estimates for future

with fungicides, but really that

success, while quite

isn't necessary," Landeo says

encouraging, were

enthusiastically. "There's more

characteristically conservative:

where Canchan came from."

they foresaw some 25,000

Landeo is referring to a

hectares planted to Canchan

new potato that has great

in Peru by the year 2020.

consumer and processing

"After this
we began
to sell
Canchan
seed from
Huanuco
like
popcorn"

59

<:t
0
0
N

.......
0

c..
QI

a:

...c~

displaying clear sign s of late

gene is resistant to all of

fields in Africa, Asia and

blight, Huanuqu efiita 's stood

them." When breeders test

Latin America . Huanuquefiita

tall and green, topped by

potatoes with major genes,

is just one of them.

beautiful purple flowers .

he continues, "these often

CIP Director General

'mask' or 'mimic' resistance

Hubert Zandstra is

to certain strains, which

encouraged by the prospect

makes it impossible to detect

of change. "Breeders are

their vulnerability. As soon as

continuing to stretch the

your potatoes come up

life-span of the new

against that strain in the field,

varieties,'' he says. "But they

their resistance breaks down ."

Q)

...
..."'
0

will never make one eternal.

This is why, in the 1990s,

CL

We need to make change a

Landeo devised a way to

"'c0

habit."

eliminate major genes,

...
"'c

...c
Q)

60

Peruvian farmers have

allowing breeders to

given the world one of the

overcome the masking and

greatest gastronomic

mimicking effects. "Our job,''

treasures: the potato. CIP's

he emphasizes, "is to assure

work with Peruvian scientists

farmers that what they have

to develop new and better

will not brea k down, or at

varieties is a way of giving

least, that its resistance will

back to the farmers some of

be long-lasting and effective."

that richness.

CIP has contributed to the

development of some 60

Building better resistance

potato varieties with

Canchan 's defenses against

horizontal resistance to late

late blight included what

blight in 22 countries. In

breeders refer to as "major"

addition, since 1996 a new

or "R" genes. Although these

batch of about 100 potatoes

genes convey very high

with higher re sistance levels

levels of resistance, they also

as well as improved

have their down side.

adaptation and market

"The problem,'' says

qualities has been lined up

Landeo, "is that there are so

for distribution and testing.

many different strains of the

Many of these potatoes have

late blight pathogen. No one

already made it to farmers '

In Brief

The clean seed produced

yearly in Uganda, it still

by researchers William Wagoire

provides an important

and Rogers Kakuhenzire, who

mechanism for making new

are working for Uganda's

varieties available to other

National Agricultural Research

farmers. "The Uganda seed

Organization (NARO), is only a

system is one of the best I've

small part of the planting

seen in the region," says CIP

material used each year in

scientist Greg Forbes, who

Uganda. Yet this seed plays an

oversees CIP's pathology work

important role in introducing

on the destructive potato

new potato germplasm into

disease late blight. "It could

the country's production

be that the success of this

system.
Lacking laboratory facilities
and any sort of equipment for

program comes from its

simplicity."
In addition to their seed

disease testing, Wagoire and

production activities, Wagoire

Kakuhenzire choose mother

and Kakuhenzire collaborate

plants that look to be free of

on all CIP-supported activities

Without a laboratory facility

virus and bacterial wilt

with NARO and conduct

or scientific equipment, two

symptoms, and then multiply

experiments on late blight

researchers working closely

cuttings from these plants to

management. NARO

with national and CIP seed

produce up to 100 tonnes of

researchers see successful

programs in Uganda are

basic seed. This is enough for

disease management as the

leading the production of

the farmers that they have

poor farmers' key to

improved basic seed potatoes

trained in local workshops to

increasing productivity,

in this African nation. The

produce about 1,000 tonnes of

reducing production costs,

availability of disease-free

clean seed, which can then be

and reducing negative

seed has been one of the

sold to other farmers, enough

impacts on their health and

biggest constraints on

to plant about 500 hectares.

environment.

Uganda's potato production.

Many of the farmers trained to

Although people depend

multiply the basic seed belong

more on beans,

to nongovernmental

sweetpotatoes and field peas

organizations, farmers'

for food security, potatoes

associations and local

bring in scarce cash and, in

government councils.

some cases, are farmers'

primary cash crop.

Although 500 hectares

represent only about one
percent of the area planted

prize in a contest against 80

other entries during the
second National Fair of
Science and Technology held
in Peru in November 2004.
Late blight causes damage
to potato crops worldwide
worth more than US$2.5
billion a year. The discovery
of this new defensin from
maca could lead to the
development of new control
strategies for P. infestans. In
his experiments, Solis, who
carried out his research in
CIP's Laboratory of Applied
A prize-winning discovery of

Biotechnology, showed that

an anti-pathogen protein in a

the defensin strongly

lesser-known Andean root is

inhibited the growth of a

Higher levels of iron and

an important step forward in

particularly virulent strain of

vitamin C in potatoes and

the work to control late

P. infestans. Such a defensin

sweetpotatoes came a step

blight, one of the deadliest

will be effective against any

closer to reality in 2004. CIP

potato diseases worldwide.

strain of P. infestans. "This is

scientists conducting a

Julio Solis, an MSc student of

the first time that a defensin

preliminary characterization of

the Peruvian San Marcos

gene or peptide sequence of

genebank accessions and

breeders' lines during the

University, won the prize for

maca, an Andean root that

his work in isolating the

grows in Peru above 4,000

past year confirmed their

gene in maca that codes for

meters, has been reported

suspicions that Andean

a defensin, a protein that

worldwide," said Marc

potatoes may be a prime

proved to have activity

Ghislain, head of CIP's

source of nutritional traits for

against Phytophthora

Biotechnology Laboratory,

higher-than-expected levels of

infestans, the microorganism

who directed this research .

iron and vitamin C.

that causes late blight.

CIP was the main supporter

Enhancing the nutritional

The National Council of

of this investigation,

value of root and tuber crops

Science and Technology of

providing the necessary

while not sacrificing quality,

Peru awarded Solis their 2004

infrastructure, equipment,

value and consumer

Prize for Scientific

materials and intellectual

preference, continues to be

Investigation. Solis won the

counseling.

one of the most complex

challenges for CIP breeders

content seems to have been

varieties will have a

and geneticists today.

sacrificed during improvement

significant impact on the

for other important

nutritional levels of people in

characteristics.

many developing countries.

Screening potato and

sweetpotato germplasm for
higher levels of iron and
vitamin C in Andean

In sweetpotato, advanced
orange-flesh selections have

potatoes, and 13-carotene in

reached 8.5 mg of 13-carotene

sweetpotato, together with

per 100 g of fresh weight,

the selection of new breeding

which is well above the

material, will allow scientists

previously recorded levels.

to estimate the extent to

Although the dry matter

which these CIP mandate

contents range from 22

crops could help alleviate

percent to 39 percent in

undernourishment and

advanced breeding material,

hunger in poor potato- and

there is still a gap for those

sweetpotato-producing

varieties with both elevated

regions around the world,

dry matter and

where iron and vitamin A

13-carotene content. So far, CIP

deficiencies continue to be

breeders and geneticists have

the leading cause of

developed high dry/medium

malnutrition.

13-carotene varieties as well as

medium dry/high

Development organizations

confirmed that a yellow-

During 2004, CIP breeders

13-carotene varieties with

are crucial in creating

fleshed Peruvian potato

profitable yields. CIP is

mechanisms to merge

landrace contains 35 mg of

currently testing this material

scientific information and

vitamin C per 100 g of fresh

in elite demonstration trials,

farmer knowledge. These

weight - or almost twice the

together with national

efforts are particularly

amount indicated in previous

agricultural research systems

important in poor economies

reports. Losses in cooking are

and CIP regional offices in

with restricted governmental

variety-dependent, which,

the target regions of the

research and extension

combined with the good

world. Prospects are high for

initiatives. "This is when non-

heritability previously shown

sweetpotato breeding to fill

governmental organizations

for vitamin C, is favorable for

this gap without losses in

become important providers

crop improvement. The

yield and yield stability by

of information and

highest iron content found

simultaneous improvement of

technologies to rural families,

so far is more than twice that

both nutritional quality and

and thus key partners for the

previously known for peeled

yield traits. Success here will

dissemination of research

potatoes, although iron

eventually mean that the

results," says Oscar Ortiz,

leader of CIP's Integrated

Agricultural Research

Crop Management Division.

Organization and Self-Help

help teach research and

CARE, the humanitarian

Efforts like this not only

Development International),

development organizations

organization fighting global

Uganda (National Agricultural

how to work together for the

poverty, and CIP, in a

Research Organization and

benefit of resource-poor

collaboration that started 12

AFRICARE), China (Chonqing

farmers, but also lead to a

years ago, have been

Plant Protection Institute and

more efficient contribution to

developing, testing and

Extension Service), Bangladesh

CIP's underlying development

disseminating integrated pest

(Tuber Crop Research Center

goal of poverty and hunger

management (IPM) of potato

and CARE-Bangladesh) and

alleviation.

in small farming communities

Bolivia (Programa de

in the Peruvian Andes. In

lnvestigaci6n de la Papa and

addition to the economic

the local nongovernmental

benefits for farmers, the

organization Asociaci6n de

experience has promoted IPM

Servicios Artesanales y Rurales).

and participatory research

and training in Peru.
The farmer field school

CIP researchers plan to

further disseminate the
approach to other countries,

approach to participatory

such as Georgia, where CARE

research has turned out to be

also operates, and Kenya and

a good way to work with

Ecuador, where a number of

small farmers on potato-

NGOs plan to participate

related problems, particularly

during the next couple of

late blight. In the highland

years.

region of Cajamarca, for

example, the new knowledge

Meanwhile, CIP continues

to enhance its partnership

and technologies gained

with CARE. In 2004, it signed

through participation in

a three-year agreement to

farmer field schools have

continue conducting

A new CIP-led potato project

brought higher potato yields,

participatory research to find

launched in Korea and

and thus better food security

innovative ways to promote

Bhutan last year is set to

and higher incomes for

technological innovation on

help rehabilitate and develop

farmers.

the potato crop in the Andes.

potato production in these

Learning to face new

two countries, where the

The lessons learned by

the CIP-CARE collaboration

challenges, such as improving

potato is an important cash

have already benefited other

farmer competitiveness in

crop and a primary source of

institutions, for example, in

emerging markets, is another

nutrition among rural

Ethiopia (Ethiopian

key goal of the agreement.

households.

The project, aims to

establish sustainable seed
production and distribution

project coordinator based in

DP Korea.
In Bhutan, major

The Rehabilitation and

Development of Potato

systems, develop measures

emphasis is being given to

Production for North

to reduce storage losses in

seed-related issues, with the

Korea and Bhutan

ware and seed potatoes, and

objective of helping potato

coordinates research and

improve pest and disease

producers capitalize on the

development activities

control techniques.

opportunities for seed

among the different

According to Fernando Ezeta,

export to West Bengal. In

agencies and in stitution s

CIP's regional leader for East

Bhutan, as in Korea, efforts

involved in the project. In

and South East Asia, the

are being developed to

Bhutan, these include the

objective of the project is to

rehabilitate seed-producing

Department of

help improve potato yields

facilities, introduce improved

Agriculture and the

and increase areas planted

methods for production of

Council of Renewable

to potato in the Democratic

quality seeds and identify

Natural Resources

People's Republic of Korea

post-harvest storage and

Research for Bhutan, and

(DP Korea) and Bhutan, and

handling technologies

in DP Korea the Swiss

therefore ultimately improve

suitable to the local climate

Agency for Development

the income and nutrition of

and economic conditions.

resource-poor farmers.
In DP Korea, where the

Introducing germplasm,

and Cooperation ,
Cooperazione e Sviluppo

meanwhile, is one of the

Onlus, German Agro

demand for potato is rising

key activities of the CIP-led

Action, as well as some

sharply, the total area

project in Korea. This

institutes in northeast

planted to potato has

includes new varieties that

China. This project forms

already increased from

could be grown directly in

an integral component of

42,000 hectares in the mid-

DP Korea and valuable

the Bhutan Potato

1990s to 187,000 hectares in

clones that could be used in

Development Program,

2002, which equals 9.4

breeding programs.

established by the

percent of the country's

Developing and

Department of Agriculture

total arable land. "Particularly

implementing quick, low-

in June 2004 to coordinate

in the country's

cost and sensitive

all aspects of potato

mountainous areas, potato,

identification methods is

research, development,

with its strong tolerance to

also a project priority in DP

marketing and processing .

stress and relatively high

Korea, where virus diseases

The UN's Food and

yields, is a substitute for

are serious problems for

Agriculture Organization

major crops such as maize

potato and particularly seed

has been assigned a

and rice, " adds Fengyi Wang,

production .

supervisory role.

Board of trustees

Notes from the chair

The international community
has emphasized its intention
to support the Millennium
Development Goals (MDG)
and we in the Consultative
Group on International
Agricultural Research (CGIAR)
can contribute to many of
the targets set within those
goals. Currently the Science
Council of the CGIAR is
setting priorities for the
CGIAR System to address
them in a systematic
manner, with the intention
that the donor community
will support them and give a
strong foundation for long
term research to prosper and
produce Global Public Goods.
The International Potato
Center (CIP) has agreed on a
new vision which addresses
these MDGs, but vision in
itself is not enough, we are
now actively embedding this
within the institution both in
programs and with our staff.
The Board of Trustees has
been active in ensuring we
have the highest standards
of governance. In 2004 the
Board of the Alliance of the
Future Harvest Centers of
the CGIAR initiated board
orientation and training
courses to improve standards
of governance at all centers,
CIP has been an active
participant in this. It is
through good governance
that the Board exercises its
responsibilities to provide
leadership, direction and
oversight that are rightly
required by our stakeholders.
Indeed in 2004 this leadership

was demonstrated when the

Board selected a new Director
General, Dr. Pamela K. Anderson
to succeed Dr. Hubert Zandstra
when he retires in 2005. A
planned and controlled change of
Director General creates a stable
environment in which our work
can flourish. The Center has again
achieved its financial targets
whilst at the same time ensuring
our research output is both

Dr. Eija Pehu

World Bank
USA

relevant and productive.

lnstituto Nacional de lnvestigaci6n

Agraria
Peru

I express my thanks to my Board

and all the staff at CIP for making
this another successful year for the
International Potato Center.
This Annual Report will give you an
insight into the high quality of
work that takes place at CIP and
demonstrates we have real
outputs and outcomes that
improve the lives of many of the
poorest people in the world.

Dr. Carlos Antonio Salas

(January)

lnstituto Nacional de lnvestigaci6n

Agraria
Peru

Ing. Alfonso Pablo Huerta

(February - September 15)

Dr. Victor Palma

(September 15 to date)

INCAGRO
Peru

Dr. Theresa Sengooba

(January-March)

Kawanda Agricultural Research

Institute
Uganda

Jim Godfrey
Chairman

Dr. Pauline Kuzwayo

Mr. James Godfrey (Chair)

United Kingdom

Medical University of Southern

Africa
South Africa

(March to date)

Dr. G. Edward Schu

Dr. Alexander Boronin

Institute of Biochemistry and
Physiology of Microorganisms,
Russian Academy of Sciences
Russia

Hubert Humphrey Institute of

Public Affairs
U.S.A.

Dr. Ruth Egger

lntercooperation
Switzerland

Dr. Madhura Swaminathan

Indian Statistical Institute
India

Dr. Keiji Ohga

College of Bioresource Sciences,
Nihon University
Japan

Dr. Song Jian

Chinese Academy of Engineering
China

Dr. Kim, Kang-kwun

College of Natural Science, Konkuk
University
Republic of Korea
Dr. Orlando Olcese
Universidad Nacional
Agraria La Molina
Peru

(March to date)

Dr. Hubert Zandstra

International Potato Center
Peru

Donor contributions
The International Potato
Center is grateful for the
generous support of all its
donors. The funding received
helps CIP to develop high
quality research and training
that helps reduce poverty
and achieve food security on
a sustained basis in some of
the poorest areas of the
world.

Donors (ranked by level of contnbut1on) (US$000)

Unrestricted

Swiss Agency for Development and Cooperation (SDC)

Government of Spain
Department for International Development (DFID), UK
International Bank for Reconstruction and Development
(World Bank Group)
Canadian International Development Agency (CIDA)
European Commission (EC)
Government of Netherlands
United States Agency for International Development
(USAID)
Government of Germany (BMZ/GTZ)
Swedish International Development Cooperation
Agency (SIDA)
Government of Austria
International Deve lopment Research Centre (IDRC)
Government of Luxembourg
Danish International Development Agency (DAN IDA)
Global Environmental Facility (GEF)
Association for Strengthening Agricultural Research
in Eastern & Central Africa (ASARECA)
Australian Centre for International Agricultural
Research (ACIAR)
New Zealand Agency for International
Development (NZAID)
Government of Japan
Government of Norway
Common Fund for Commodities (CFC)
Government of Italy
Bill & Melinda Gates Foundation
International Fund for Agricultural Development (IFAD)
Government of Peru - STC CGIAR
Food and Agriculture Organization of the
United Nations (FAO)
The McKnight Foundation
CGIAR - IWMI - International Water Management Institute
Government of China
Government of the Republic of Korea
Swiss Centre for International Agriculture (ZIL)
Government of Belgium
The Rockefeller Foundation
Organization of Petroleum Exporting Countries
(OPEC) I Fund for Internationa l Development
International Livestock Research Institute (ILRI)
Government of Israel
Government of India
United States Agency for Interna tional Development International Center for Agricultural Research in Dry
Areas (USAID) - (ICARDA)
United States Department of Agriculture (USDA)
Natural Resources Institute (NR I), UK
Conservation, Food and Health Foundation, Inc.
Wageningen University
Ministerio de Agricultura - Peru
Centro Internacional de Agricultura Tropical (CIAT)
CGIAR - IFAR- International Fund for Agricultural Research
Government of Brazil
Government of Mexico
International Plant Genetic Resources Institute (IPGRI)
Centro de lnvestigaci6n Agricola Tropical (CIAT - Bolivia)
Inter-American Institute for Cooperation
on Agriculture (llCA)
Servicio Nacional de Sanidad Agraria (SENASA)
Pioneer Hi-Bred International, Inc
Syngenta Foundation

TOTAL

1,029

Restricted' Total
1,214
1,904
762
442

2,243
1,904
1,891
1,642

448
962

458
1,453
864
287

1,628
1,453
1,31 2
1,249

247
968

880
91

1, 127
1,059

763
561
487
73
384
366

763
56 1
487
400
384
366

143

359

1, 129
1,200
1,170

<t
0
0
N

......
0

c.
QI

a::

"'

::I

c
c

<t:

327

216

(J)

c
(J)

...ro
...
0

{)_

328
197
294
117

328
111
274
156
266
258
181
156
145
125

120
60

56
104

98
89
79
57
S6
37
37

30
21
19
15
14
10
10
10
10
10
7

4
2

8,957

308
294
274
273
266
258
181
156
145
125
120
116
104
98
89
79
57
56
37
37

30
21
19
15
14
10
10
10
10
10
7
5
4
2

13,440 22,397

Restricted revenues are recognized if the funds are received and spent. For this reason,
some restricted revenues may differ from the amount committed or transferred by donors.

ro

c
0

...ro
c

...c
(J)

69

Financial report
<I'
0
0
N

.....
0

Q.
GI

a:

<lJ

--"
0
0

Q..

"'0

70

In 2004 the International

Potato Center achieved a
net surplus of US$1 .1
million. The result exceeded
the budget by US$0.7
million, or 163 percent,
increasing the Center's
financial reserves from
US$4.5 million to US$5.6
million by the end of 2004.
CIP's total revenues in 2004
were US$22.7 million, 24
percent greater than 2003
revenue s. Total revenues
included US$9 million of
unrestricted donations and
US$13.4 million of restricted
donations. At the end of
2004, US$3 .6 million of
grants approved (15 percent
of total revenues) had not
been released .
The increase in donations
from Canada and United
Kingdom and the new
contribution from New
Zealand helped to expand
unrestricted revenues in
2004. In addition, the
continued weakening of the
US Dollar in 2004 increased
CIP's unrestricted and
earmarked revenues by
US$0.76 million. CIP's
revenues are received in
US Dollars, Euros and in
several other currencies, but
they are booked in US
Dollars.
Accumulated expenditures
reached US$21.6 million in
2004, representing a 24
percent growth with respect
to 2003 .

Expenditures grew in all categories. Specifically restricted

expenditures grew by 36 percent,
due to the success in fund raising
during the previous years, thereby
expanding project-based contribution~ In addWon, duringtheyeaG
steps were taken to improve cost
recovery from ongoing and new
restricted projects, which resulted
in additional resources that
contributed to project development and implementation.
CIP's financial health continued to
strengthen during the year. The
current ratio grew from 1.4 in 2003
to 1.6 and net working capital
measured as the number of days of
expenditures excluding
depreciation grew from 97 days in
2003 to 99 days in 2004. However,
the financial stability index, which
measures the number of days of
unrestricted net assets, fell from 97
days to 95 days. Financial indicators
are within the acceptable range
established by the CGIAR providing
flexibility to deal with short-term
negative effects from
unanticipated events.
During the year, 90 new project
proposals for US$53.0 million were
submitted to donor agencies and
51 were approved for total
commitment of US$12.S million.
The average donation approved
per project declined from USS0.29
million in 2003 to US$0.25 million
in 2004. By the end of the year, the
backlog of projects pending
approval increased by US$18.6
million to US$51.7 million .
Austere and prudent policies and
programmatic growth reduced the
share of CIP's indirect expenses.
Following the CGIAR indirect cost
ratio guidelines, the indirect cost
ratio declined from 13 percent in
2003 to 12 percent in 2004. The
Center plans to continue
exercising prudent policies to
strengthen even further CIP's
financial health.
The statement here summarizes
CIP's financial position as of
December 2004. A copy of the
complete audited financial
statements may be requested from
the office of the Director General,
at CIP headquarters in Lima, Peru.

Statement of financial position

Year ending 31 December 2004

(compared w ith

2003-USSOOO)

(US$000)
2004

2003

Cash and cash equivalent 10,561

8,151

ASSETS
Current Assets

Investments

99

Account Receivable:
Donor
Employees

3,582

4,268

259

283

215

316

Inventories

385

436

Advances

154

475

Prepaid Expenses

179

261

Others

-- -

Total Current Assets

15,434 14,190

Non-Current Assets
Investments non-current

Furnishing and
Equipment, Net

369

1,039

2,745

2,596

-- --

Total Non-Current assets

TotalAssets

3,114

3,635

18,548 17,825

Liabilities and Net Assets

Current Liabilities
Accounts Payable
Donor

3,508

4,290

Others

6,295

6,278

243

125

Provisions
Total Current Liabilities

10,046 10,693

Non-Current Liabilities
Long -term loan

250

Total Non-current Liabilities 250

Total Liabilities

10,296 10,693

Net Assets
Designated

2,598

2,596

Undesignated

5,654

4,536

Total Net Assets

8,252

7,132

Totalliabilities
and Net Assets

18,548 17,825

Training highlights
Cl P's Training Depart ment is
designed to support Cl P's
research divisions and
partnership programs in their
efforts to share knowledge
and expertise for enhancing
the performance of national
agricultural research and
related institutions. The
Department assists CIP
scientists in developing and
making accessible guidelines
and training materials,
together with strengthening
the capacities of research and
related institutions to provide
training and institutional
development. Further, the
Department provides support
in organizing specialized
training for technical and
professional staff of partner
organizations in areas where
CIP has specific expertise and
comparative advantage.
CIP leads training sessions and
workshops, organizes and
sponsors international
conferences and develops
training materials. Participants

from more than 60 countries

attended the 25 main grouptraining events conducted across
the world in 2004. These events
focused on issues such as potato
seed production, integrated crop
management, agricultural
economics, statistical packages and
natural resources management,
targeted at NGOs, government
organizations and development
agencies.

Summary of training events

(by type of training)

Events Duration Participants

(number)

With the opening of the

Multimedia Training Lab at CIP's
Headquarters in 2004, CIP's
Training Department now offers
space for multimedia production
and software-related training
courses at eight workstations.

(number)

Group training & conferences

25

95

592

......

0
0..

la

:::s
345

22

c:
c:

<C

Total
44

440

614

c
QJ

Summary of training events

(by type of degree)

.,,
0

ro

a..

Male

Female

Total

"'c0

MSc
22

15

37

PhD

71
0

Interns (BSc)
49

53

102

Total
72

68

140

Participating countries

(number of part1c1pants m parentheses)

0
0
N

Ql

Principle group training events

Event

.,.

a:

Individual training
19

At CIP headquarters, individual

training was provided for
participants from 11 countries . CIP
also supported training in distant
locations by distributing
publications and manuals, as well as
via electronic media, including
downloads of manuals, articles and
reports from CIP's training website
(www.cipotato.org/training), and
electronic conferences and
workshops. During 2004, CIP's
training department became the
technical coordinator of CGIAR's
ICT/KM Online Learning Resources
(OLR) project, leading to the
development of an online
repository of training materials.

(days )

2nd Global Meeting of the Mountain Partnership (135)

Argentina, Austria, Belgium, Bolivia, Bulgaria, Cuba,

France, Ghana, India, Indonesia, Iran (Islamic Republic
of), Italy, Jamaica, Kyrgyzstan, Lesotho, Mexico, Nepal,
Pakistan, Peru, Philippines, Poland, Romania, Russian
Federation, Slovenia, Spain, Sri Lanka, Switzerland,
Tunisia, United Kingdom, USA

3rd meeting of NAR!s in Latin America (32)

Argentina, Chile, Brazil, Colombia, Costa Rica,

Dominican Republic, Ecuador, Guatemala, Honduras,
Mexico, Panama, Peru, Portugal, Spain, Uruguay,
Venezuela

Course on advanced methods for the diagnosis and

identification of fungi, straminopiles and bacteria
affecting plants (14)

Peru

Event

<t
0
0
N

...,,_
0

c.
a:
GI

"'::s
t:
t:

number

of parttopants

Participating countries

m parentheses

Course on molecular virology techniques (11)

Peru

East Africa tradeoff analysis workshop (26)

Kenya, Netherlands, Uganda, USA

ICM potato seed production training course (37)

Afghanistan

Identify research and development needs to

increase potato production in central Asia (30)

Afghanistan, Azerbaijan, Georgia, India, Kazakhstan,

Kyrgyzstan, Peru, Tajikistan, Turkmenistan, Uzbekistan

Late blight management training course (6)

Bhutan, China, Vietnam

Mini-Symposium on late blight (S7)

Peru

Participatory breeding and decentralized

production of Andean crop seeds (18)

Peru

SIG training course - Teledetection (11)

Peru

Stakeholders workshop of IFAD-funded project (18)

Bolivia, Ethiopia, Netherlands, Peru, Uganda, USA

Statistics for agricultural and genetic resources

applications with R. (11)

Peru

TAVERNA web service workshop (5)

Peru

Training course on marketing of seed potatoes (3)

Afghanistan, India

Training course on potato variety development,

seed production, integrated disease management
and processing (16)

Angola, Burundi, Cameroon, Eritrea, Ethiopia,

Kenya, Madagascar, Mozambique, Nigeria,
Rwanda, Tanzania, Uganda

Training course on the use of ELISA (enzyme-linked

immunosorbent assay) techniques for detection of
latent infection of bacterial wilt and viruses in potato
seed (6)

Burundi, Cameroon, Ethiopia, Madagascar,

Rwanda, Uganda

Training workshop introducing the farmer field

school methodology (31)

Peru

Workshop on gene flow in originating centers

and diversity impact (35)

Belgium, Peru

Workshop on Late Blight simulation (9)

Denmark, Ecuador, Peru

Workshop on potato SSR analysis and database

development (32)

Argentina, Belgium, Bolivia, Colombia, Ecuador,

France, Peru

Workshop on the development and dissemination

of improved varieties (32)

Argentina, Bolivia, Brazil, Canada, Chile, Colombia,

Costa Rica, Ecuador, Panama, Peru, Venezuela

Workshop on the homologation of potato and

Andean roots and tubers genetic resources
collections - Part II (6)

Bolivia, Ecuador, Peru

Workshop on the participatory development

of productive chains and platform consultations (17)

Bolivia, Ecuador, Peru, Switzerland

Workshop on the politics impacting waste land

ecosystems: Analysis and proposals (18)

Bolivia, Ecuador, Peru

ct

"'0
c

"'c
<l!
~

72

Selected publications
Institutional publications
International Potato Center.
2004. The CIP Vision: Preserving the
Core, Stimulating
Progress. Interna tion al Potato
Center, Lima, Peru. 72p.
International Potato Center.
2004. Science for People and the
Planet: International Potato Center
Annual Report 2003. International
Potato Center, Lima, Peru. 103p.
Centro Internacional de la papa.
2004. Ciencia para las Personas y el
Planeta: Centro Internacional de la
Papa lnforme Anual 2003. Centro
Internacional de la Papa, Lima,
Peru. 103p.
Fuglie, KO and M Hermann, eds.
2004. Sweetpotato Post-Harvest
Research and Development in
China. Proceedings of an
International Workshop held in
Chengdu, Sichuan, PR China, Nov.
7-8, 200 1. Internationa l Potato
Center, Bogor, Indonesia. 160p.
Garcia, W y X Cadima, eds. 2004.
Manejo sostenible de la
agrobiodiversidad de tuberculos
and inos: Sfntesis de in vestigaciones
y experiencias en Bolivia. Serie:
Conservaci6n y uso de la
biodiversidad de rafces y
tuberculos andinos: Una decada de
investigaci6n para el desarrollo
(7 993-2003), No. 1. Internatio nal
Potato Center, Lima, Peru. 197p.
(A lso avai lable in CD).
Holle, M y R Valdivia, 2004.
Conservaci6n in situ de la
agrobiodiversidad de la oca en el
altipfano peruano. Centro
Internacional de la Papa, Lima, Peru
y CIRNMA, Puno, Peru.
Holle, M y R Valdivia. 2004.
Con servaci6n in situ de la
agrob iodiversidad
de la oca en el altiplano Peruano
(CD). Serie: Conservaci6n y uso de la
biodiversidad de rafces y
tuberculos andinos: Una decada de
investigaci6n para el d esarrollo
(7993-2003), No. 2. International
Potato Center, Lima, Peru.
Lizarraga, C, ed. 2004. Proceedings
of the Regional Workshop on

Potato Late Blight for East and

Southeast Asia and the Pacific,
Yezin, Myanmar, 24-25 Aug ust
2004. GILB, International Potato
Center, Lima, Peru. 87pp.
Lopez, G y M Hermann, eds. 2004.
El cu ltivo del ulluco en la sierra
central del Peru. Serie:
Conservaci6n y uso de la
biodiversidad de rafces y
tuberculos andinos: Una decada de
investigaci6n para el desarrollo
(7 993-2003), No. 3. Internationa l
Potato Center, Lima, Peru. 133p.
Barrera, VH, CG Tapia y AR
Monteros, eds. 2004. Rafces y
Tuberculos Andinos : Alternativas
para la conservaci6n y uso
sostenible en el Ecuador. Serie:
Conservaci6n y uso de la
biodiversidad de rafces y
tubercu/os andinos: Una decada de
investigaci6n para el desarrollo
(7 993-2003), No. 4. International
Potato Center, Lim a, Peru. 176p.
Merino, R, J Carballo, F Vargas,
N Ortiz, P Vargas, E Rodriguez,
M Ortiz, V Torrez, F Ca rballo y
D. Vargas. 2004. Catalogo de
variedades locales de papa y oca de
la zona de Candelaria. Serie:
Conservaci6n y uso de la
biodiversidad de rafces y
tuberculos andinos: Una decada de
investigaci6n para el desarrollo
(7 993-2003), No. 5. Internation al
Potato Center, Lim a, Peru. l 13p.
Seminario, J, ed. 2004. Ra fces
Andinas : Contribuciones al
conocimiento y a la capacitaci6n.
Serie: Conservaci6n y uso de la
biodiversidad de rafces y
tuberculos andinos: Una decada de
investigaci6n para el desarrollo
(7 993-2003), No. 6. International
Potato Center, Lim a, Peru. 376p.
Espin osa, Py D Yanggen. 2004. El
poten cial econ6mico de
tecnologfas de producci6n y
comercializaci6n del ulluco. Serie:
Conservaci6n y uso de la
biodiversidad de rafces y
tubercu/os andinos: Una decada de
investigaci6n para el desarrollo
(7 993-2003), No. 7. In terna ti ona l
Potato Center, Lima, Peru. 38p.

Peer-reviewed publications
Adler NE, LJ Erselius, MG Chacon, WG
Flier, ME Ordon ez, LPNM Kroon and
GA Forbes. 2004. Genetic diversity
of Phytophthora infestans sensu Jato
in Ecuador provides new insight into
the origin of this important plant
pathogen. Phytopathology
94: 154-162.

'<!'
0
0
N

...
0

Q.
Cll

Cl:

Anderson, PK, AA Cunningham,

NG Patel, FJ Morales, PR Epstein and P
Daszak. 2004. Em erging infectiou s
di seases of plants: pathogen
pollution, climate change and
agrotechnology drivers. Trends in
Ecology and Evolution 19(10): 535544.
Baigorria, G, E Villegas, I Trebejo,
J Carlos and R Quiroz. 2004.
Atmospheric transmissivity:
distribution an empirical estimation
around the Central Andes.
International Journal of Climatology
24: 1121-1136.
Barrera, VH, JE Grijalva and
CU Leon-Velarde. 2004.
Improvement of milk production
systems in the Andean ecoreg ion
of Ecuador. Archivos
Latinoamericanos de Producci6n
Animal 12(2): 43 -51.
Butl er, GP, T Bernet and
K Manrique. 2004. Mechanization of
potato grading on sma ll sca le farms: a
case study from Peru. Experimental
Agriculture 41: 1- 12.
Canedo, V and F Cisneros. 2004.
Clones de papa transformados con la
toxin a de Bacillus thuringiencis
(Berliner) contra la polilla de la papa,
Phthorimaea operculella (Zeller). I.
Transformaci6n de clones de papa y
verificaci6n de la presencia del gen
cry7A(b). Revista Peruana de
Entomologfa 44: 89-93.
Canedo, V and F Cisneros. 2004.
Clones de papa transformados con la
toxina de Bacillus thuringiencis
(Berlin er) contra la polilla de la papa,
Phthorimaea operculella (Ze ller). II
Selecci6n y evaluaci6n de la
expresi6n del gen cry7A(b) en el
desa rrollo de la polilla. Revista
Peruana de Entomologfa 44: 95- 100.

Ill

:I

c:
c:

c:(
~

Q)

c
Q)

.,,0
.,,"'
0

Q..

"'c

.,,

"'c
.,,
Q)

73

<!'
0
0
N

...
~

0..
QI

ex:

Danielsen, S and L Munk. 2004.

Evaluation of disease assessment
methods in quinoa for their ability
to predict yield loss caused by
downy mildew. Crop Protection
23(3): 219-228.
Fuglie, K. 2004. Challenging
Bennet's Law: the new economics
of starchy staples in Asia. Food
Policy 29(2): 187-202.
Fuglie, K. 2004. Productivity
growth in Indonesian agriculture,
1961-2000. Bulletin of Indonesian
Economic Studies 40(2): 209-225.
Ghislain, M , DM Spooner,
F Rodriguez, F Villaman, J Nunez,
C Vasquez, R Waugh and
M Bonierbale. 2004. Selection of
highly informative and userfriendly microsatellites. (SS Rs) for
genotyping of cultivated potato.
Theoretical and Applied Genetics
108(5): 881-890.

74

Godtland, E, E Sadoulet, A de Janvry,

R Murgai and 0 Ortiz. 2004. The
impact of farmer field schools on
knowledge and productivity: a
study of potato farmers in the
Peruvian Andes. Economic
Development and Cultural Change
53(1): 63-92.

3-terminal structures among

members of the genus Crinivirus.
Journal of General Virology
85: 2065-2075.

Phytophthora infestans on the leaf

surface of Solanum phureja. Journal
of Phytopathology. 152(11 / 12):
651 -657 1-7.

Manrique K and C Fonseca. 2004.

Chuno blanco, tunta o moraya: un
proceso natural de conservaci6n.
LEISA, Revista de Agroecologfa
20(3): 29-31.

Peters, D and Do Due Ngai. 2004.

Agro-processing waste assessment
and management in peri-urban
Hanoi, Vietnam. Journal of
Sustainable Agriculture. 25(1 ):69-95.

Namanda, S, OM Olanya , E Adipala,

JJ Hakiza, R El-Bedewy, AS Baghsari
and P Ewell. 2004. Fungicide
application and host-resistance for
potato late blight manag ement:
benefits assessment from on-farm
studies in S.W. Uganda. Crop
Protection 23(11 ): 7-13.

Peters, D, NT Son, NB Mui and PN

Thach. 2004. Piglet Enterprise
Assessment and Improve ment in
Cat Que Commune, Vietnam.
Livestock Research for Rural
Development. 16, Art 8.
http:www.cipav.org.co/ lrrdl 6/02/
pete 1602.htm.

Namutebi, A, H Natabirwa,
B Lemaga, R Kapinga, M Matovu,
S Tumwegamire, J Nsumba and J
Ocom. 2004. Long-term storage of
sweetpotatoes by small-scale
farmers through improved post
harvest technologies. Uganda
Journal of Agricultural Sciences 9
(1 ):922-930.

Roca, W, C Espinoza and A Panta.

2004. Agricultural applications of
biotechnology and potential for
biodiversity va lorization in Latin
America and the Caribbean.
AgBioForum 7(1 &2): 1-10.

Nduguru, J, SC Jeremiah and

R Kapinga. 2004. Incidence and
severity of virus-like symptoms on
yam in northwestern
Tanzania. African Journal of Root
and Tuber Crops 5: 6-9.

Golmirzaie, AM, S Buendia,

J Espinoza and R Ortiz. 2004.

Open pollinated offspring for
producing potatoes from true
seed. Tropicultura 22 (4): 191-198.
Graefe, S, M Hermann, I Manrique,
S Golombek and A Buerkert. 2004.
Effects of post-harvest treatments
on the carbohydrate composition
of yacon roots in the Peruvian
Andes. Field Crops Research 86:
157-65.

Gruneberg, W, E Abidin, P Ndolo,

CA Pereira and M Hermann . 2004.
Variance component estimations
and allocation of resources for
breeding sweetpotato under East
African conditions. Plant Breeding
123: 311-315.
Livieratos, IC, E Eliasco, G Miiller,
RCL Olsthoorn, LF Salazar,
CWA Pleij and RHA Coutts. 2004.
Analysis of the RNA of potato
yellow vein virus: evidence for a
tripartite genome and conserved

Offei, SK, N Arciniegas, G Miiller,

M Guzman, LF Salazar and RHA
Coutts. 2004. Molecular variation
of potato ye llow vein virus
isolates. Archives of Virology
149: 821-827.

Olanya, OM, JJ Hakiza and

CC Crissman . 2004. Potato
production in the tropical
highlands: constraints, fungicide
use and the impact of IPM
strategies. Outlooks on Pest
Management, 15(4): 181-184.

Sporleder, M, J Kroschel,
MR Gutierrez Quispe and A
Lagnaoui. 2004. A temperaturebased simulation model for the
potato tuberwo rm, Phthorimaea
operculel/a Zeller. Lepidoptera
Gelechiidae. Environmental
Entomology 33(3): 477-486.
Stoorvogel, JJ, JM Antle and
CC Crissman. 2004. Tradeoff
analysis in the northern Andes to
study the dynamics in agricultural
land use. Journal of Environmental
Management 72(1-2): 23-33.
Stoorvogel, JJ, JM Antle,
CC Crissman and W Bowen. 2004.
The tradeoff analysis model:
integrated bio-physical and
economic modeling of agricultural
production systems. Agricultural
Systems 80(1 ): 43-66.

Ortiz, 0 , KA Garret, JJ Heath,

R Orrego and R Nelson. 2004.
Management of potato late blight
in the Peru vian highlands:
evaluating the benefits of farmer
field schools and farmer
participatory research . Plant
Disease 88(5): 565-571.

Tomlins, Kl, E Rwiza, A Nyango,

R Armour, T Ngendello, R Kapinga,
D Rees and F Jolliffe. 2004. Th e use
of sensory evaluation and
consumer acceptability for the
selection of sw eetpotato cultivars
in East Africa. Journal of the
Science of Food and Agriculture
84: 791-799.

Oyarzun, P, J Yanez and GA Forbes.

2004. Evidence for host mediation
of pre-infection stages of

Tumwegamire, S, R Kapinga,
D Zhang, C Crissman and S Agili.
2004. Opportunities for promoting

orange-fleshed sweetpotato as a
mechanism to combat vitamin-A
deficiency in sub-Saharan Africa.
African Crop Science Journal
12(3): 241-252.
Verastegui, J, V Martinez, W Roca,
M de Pena and L Gil. 2004. The
multinational biosafety project of
the Organization of American
States. Electronic Journal of
Biotechnology 7(1):47 -54.
www.ejbiotechnology.info/
content/vol? /issue 1/full/6.
Winters, P, CC Crissman and
P Espinosa. 2004. Inducing the
adoption of conservation
technologies: lessons from the
Ecuadorian Andes . Environmental
and Development Economics 9
(5): 695-719.

Yanggen, D, DC Cole, CC Crissman

and S Sherwood. 2004. Pesticide
Use in Commercial Potato
Production: Reflections on
Research and Intervention Efforts
towards Greater Ecosystems Health
in Northern Ecuador. EcoHealth 1
(suppl. 2): 72-83.
Zhang, D, G Rossel, A Kriegner
and R Hijmans. 2004. AFLP
assessment of diversity in
sweetpotato from Latin America
and the Pacific region: its
implications on the dispersal of the
crop. Genetic Resources and Crop
Evolution 51 (2): 115-120.

Books, chapters and

papers
Gandarillas, A, J Blajos, G Aguirre,
A Devaux and G Thiele. 2004.
Fundaci6n PROINPA: Una nueva
opci6n institucional para promover
la innovaci6n tecnol6gica agrfcola
en Bolivia. Revista de Desarrollo
Rural: PROCAMPO 92(abril -mayo).
Bentley, J, G Thiele, R Oros and
C Velasco. 2004. Cinderella's
slipper: sondeo surveys and
technology fairs for gauging
demand. Network paper Agricultural Research and
Extension (ODI, London). No. 138.

Leon-Velarde, CU and R Quiroz.

2004. The development of
livestock production systems in the

Andean region: Implications for

smallholder producers. World
Association of Animal Production
Yearbook. 233-240.
Loebenstein, G., S. Fuentes,
J. Cohen and L. F Salazar. 2004.
Sweet Potato. In: G. Loebenstein
and G. Thottappilly (eds). Virus and
Virus-like Diseases of Major Crops
in Developing Countries, 223-248.
Kluwer Academic Publishers, The
Netherlands.

<t
0
0
N

.......
0
Q,

QI

a:

'

:I

c
C(

White, D., M Arca, J Alegre,

D Yanggen, R Labarta, J Weber,
C Sotelo and H Vidaurre. 2004.
Alternatives to Slash-and-Burn
(ASB) in Peru: Challenges, Research,
and Impact. In: Slash and Burn: The
Search for Alternatives. Columbia
University Press, New York.

0
Cl..

"'c
0

75

Partners
<t
0
0
N

......
0

c.

<II
0::
Ill

::l

c:
c:

C(

"'

u
0

ro
~

76

AARI Aegean Agricultural Research Institute AARI Ayub Agricultural Research Institute AAS Academy of Agricultural
Sciences ACIAR Australian Centre for International Agricultural Research ADB Asian Development Bank ADT
Akukuranut Development Trust AFRENA African Resource Network in Agro-Forestry, Uganda AFRICARE AGERI
Agriculture Genetic Engineering Research Institute Austrian Agency for Health and Food Safety Agricultural
Research Council Agricultural Research Institute AHi African Highland Initiative - convened by the World Agroforestry
Center Ainshams University, Faculty of Agriculture AIAT-WS Agricultural Technology Assessment Institute West
Sumatra AIT Asian Institute of Technology A lemaya University of Agriculture A ngola Seeds of Freedom Project
A nhui Academy of Agricultural Science APPRI Agricultural Plant Protection Research Institute APROSEPA Asociaci6n
de Productores de Semilla de Papa A rapai College Association for Andean Technical-Cultural Promotion ARC
Agriculture Research Centre ARC Agricultural Research Corporation ARC Agricultural Research Council ARCsr
Agriculture Research Centre, Seibersdorf ARDC Agricultural Research and Development Centre AREA Agricultural
Research and Extension Authority ARI Agricultural Research Institute ARI Agricultural Research Institute ARO
Agricultural Research Organization ASAR Asociaci6n de Servicios Artesanales y Rurales ASARECA Association for
Strengthening Agricultural Research in Eastern and Central Africa ASPADERUC Asociaci6n para el Desarrollo Rural
de Cajamarca ATDTP Agricultural Technology Development and Transfer Project AT- Uganda Appropriate
Technology Uganda AVRDC Asian Vegetable Research and Development Center Awasa Research Centre BADC
Bangladesh Agricultural Development Corporation BAR Bureau of Agricultural Research, Department of Agriculture
BARI Bangladesh Agricultural Research Institute Baguio City Nutrition Council, Philippines Beratungsgruppe
Entwicklungsorientierte Agrarforschung Biodiversidad y Genetica Bangladesh Rural Advancement Committee
BRC Biotechnology Research Center, Vietnan BRRI Bangladesh Rice Research Institute Benguet State University
Biotecnologfa Agropecuaria SA Buganda Cultural Development Foundation Bvumbwe Research Station CAAS
Chinese Academy of Agricultural Sciences CAB International College for Agriculture and Forestry CARDI
Caribbean Agricultural Research and Development Institute CARE-Bangladesh CARE-Kenya CARE-Peru CARERwanda China Agricultural University CavSU Cavite State University CBC Centro Bartolome de las Casas Chinese
Center for Agricultural Policy Central de Cooperativas Agrarias de Canete y Mala Centro Ecumenico de la Promoci6n
y Acci6n Social CEMOR Cemor Editores & Promotores CENA Civil Engineers Network Africa Cendrawasih
University Centro de lnvestigaci6n Agricola Tropical, Bolivia Centro de lnvestigaci6n en Biotecnologfa Centros de
Reproducci6n de Entom6genos y Entomopat6genos CERGETYR Centro Regional de Recursos Geneticos de Tuberosas
y Rakes CFC Common Funds for Commodities Chiang Mai University Christian AID CIAAB Centro de lnvestigaciones
Agrfcolas A. Boerger CIAO Center for Integrated Agricultural Development CICA Centro de lnvestigaci6n en
Cultivos Andinos CIDA Canadian International Development Agency CIED Centro de lnvestigaci6n, Educaci6n y
Desarrollo CIPDER Consorcio lnterinstitucional para el Desarrollo Regional Cajamarca CIRNMA Centro de
lnvestigaci6n de Recursos Naturales y Medio Ambiente CLADES Consorcio Latinoamericano de Agroecologfa y
Desarrollo CLSU Central Luzon State University CNCQS Chinese National Centre for Quality Supervision and Test
of Feed CNPH Centro Nacional de Pesquisa de Hortali<;:as CODESE Comite de Semilleristas Comunite de Yaounde
CONAM Consejo Nacional del Ambiente CONCYTEC Consejo Nacional de Ciencia y Tecnologfa CFHF Conservation,
Food and Health Foundation Consorcio Surandino COPASA Cooperaci6n Peruano Alemana de Seguridad
Alimentaria CORPOICA Corporaci6n del lnstituto Colombiano Agropecuario CPPS Chongqing Plant Protection
Station Centre de perfectionnement et de recyclage agricole de Sa"ida CPRI Central Potato Research Institute
CPRS Central Potato Research Station Centro Regional de lnvestigaci6n en Biodiversidad Andina CRIFC Central
Research Institute for Food Crops CRIH Central Research Institute for Horticulture CRP -Gabriel Lippmann,
Luxembourg CRS Catholic Relief Services, Kenya, Uganda, Sudan, Indonesia CTCRI Central Tuber Crops Research
Institute DAE Department of Agricultural Extension DANIDA Danish International Development Agency DARHRD
Department of Agricultural Research and Human Resource Development Department of Agriculture Department
of Agriculture Department of Agriculture, Phichit Horticultural Research Center DFID Department for International
Development DINAREN Direcci6n Nacional de Recursos Naturales Renovables, Ecuador Dinas Peternakan Wamena
D irecci6n Nacional de Sanidad Vegetal Directorate of Root Crop Production, Ministry of Agriculture OPP Department
of Plant Protection, Ministry of Agriculture and Rural Development DPKR AAS Academy of Agricultural Sciences of
the DPRK DRCFC Dalat Research Center for Food Crops OROS Department of Research and Development
Services DRUK Seed Corporation of Bhutan IAR Ethiopian Agricultural Research Organization EARRNET Eastern
Africa Root Crops Research Network EC European Commission ECABREN Eastern and Central Africa Bean Research
Network ECAPAPA Eastern and Central Africa Programme for Agricultural Pol icy Analysis EMBRAPA Empresa
Brasileira de Pesquisa Agropecuaria Empresas de Cultivos Varios del Ministerio de Agricultura ESH Ecole superieure
d'horticulture ETH Swiss Federal Institute of Technology Zurich FAO Food and Agriculture Organization of The
United Nations FAPESP Fundac;:ao de Amparo a Pesquisa do Estado de Sao Paulo FCRI Food Crops Research Institute,

Vietnam FDR Fundaci6n para el Desarrollo Rural, Peru FIELD Farmer Initiatives for Ecological Livelihood and
Democracy FOFIFA/FIFAMANOR Centre national de la recherche appliquee au developpement rural Food Crop
Resea rch Institute Fonda Regional de Tecnologfa Agropecuaria/ Red Internacional de Metodologfa de lnvestigaci6n
de Sistemas de Producci6n FOODNET (ASARECA network implemented by llTA) FORD Foundation Fortalecimiento
de la lnvestigaci6n y Producci6n de Semilla de Papa FOVIDA Fomento de la Vida FUNDAGRO Fundaci6n para el
Desarrollo Agropecuario FUNDANDES Fundaci6n para el Ambiente Natural y el Desarrollo GAAS Guangdong
Academy of Agricultural Sciences GKF Grameen Krishi Foundation Government of Belgium Government of
China Government of Denm ark Government of France Government of Germany Government of India
Government of Italy Government of Mexico Government of Norway Government of Peru Government of South
Africa Government of Spain Government of the Islamic Republic of Iran Government of Luxembourg Government
of the Netherlands Government of the Republic of Korea Government of South Africa Government of Spain GTZ
Deutsche Gesellschaft fur Technishce Zusammenarbeit HAAS Heilongjiang Academy of Agricultural Sciences
HARi Humeng Agricultural Research Institute HAU Hanoi Agriculture University Hong Doc University Hong Kong
University HORDI Horticultural Research and Developm ent Institute HRI Horticulture Resea rch Institute HUAF
Hue University for Agriculture and Forestry Huanzhong Agricultural University Hubei Agricultural University
Hung Loe Agriculture Research Center Hasanuddin University IAl-ISP Inter-American Institute for Global Change
Resea rch, Initial Science Program IAN lnstituto Agron6mico Nacional IAS Institute of Agricultural Sciences,
Mini stry of Agriculture and Rural Development IASA lnstituto Agrop ecua rio Superior Andino IAV lnstitut
agronomique et veterinaire Hassa n II ICA lnstituto Colombiano Agropecuaria ICAR Indian Council of Agricultural
Research ICO CEDEC lnstituto de Capacitaci6n del Oriente IDEA lnstituto Internacio nal de Estudios Avanzados
IDIAP lnstituto de lnvestigaci6n Agropecuaria de Panama IDRC International Deve lopment Research Centre
CBNRM Community-Based Natural Resources Management Programme IEBR Institute of Ecology and Biological
Resources IESR/INTA lnstituto de Economfa y Sociologfa Rural del INTA IFAD International Fund for Agriculture
Development INN ln stituto de lnvestigaci6n Nutricional llRR International Institute of Rural Reconstruction IMA
lnstituto d e Manejo de Agua y Medio Ambi ente INAMHI lnstituto Nacional de Meteorologfa e Hidrolog fa
INCAGRO lnnovaci6n y Competitividad para el Agro Peruano INERA lnstitut nationale d'etudes et de recherches
agricoles INIA lnstituto Nacional de lnvestigacao Agron6mica INIA ln stituto Nacional de lnvestigaci6n Agraria
INIA lnstituto Nacional de lnvestigaciones Agropecuarias INIA lnstituto Nacional de lnvestigaciones Agropecuarias
INIA lnstituto Nacional de lnvestigaciones Agrfcolas INIA lnstituto Nacional de lnvestigaciones Agropecuarias
INIFAP lnstituto Nacional de lnvestigaciones Foresta les y Agropecu arias INIVIT ln stituto Nacional de lnvestigaci6n
de Viandas Tropicales IMPOFOS lnstituto de la Potasa y el F6sforo INRA ln stitut national de la rech erche
agronomique INRA lnstitut national de la recherche ag ronomique INRAT lnstitut national de la recherche
agronomique de Tunisie l nstituto Rural Valle Grande, Canete, Peru INTA ln sti tuto Nacional de Tecnologfa
Agropecuaria IPAC lnstituto de Promoci6n Agropecuaria y Comunal IPB lnstitut Pertanian Bogar Indonesia IPDA
lnstituto de Promoci6n y Desarrollo Agrario IRA lnstitut de rech erche agronomique IRAD lnstitut de recherche
agricole pour le developpement IRD ln stitut de rech erche pour le developpement IRI International Research
Institute for Climate Prediction ISABU ln stitut des sciences agronomiques du Burundi ISAR lnstitut des sc iences
agronomiques du Rwanda ISTPC lnstituto Superior Tecnol6gico Publico de Canete JAAS Jiangsu Acad emy of
Agricultural Science s Jerusalen de Porcon Cooperative JKUAT Joma Kenyatta University of Agriculture and
Technology JTTK Jaringan Tani Tanah Karo, Indonesia KARI Kenyan Agricultural Research Institute Kaugu &
Katheri Farmers KEPHIS Kenya Plant Hea lth Inspectorate Service La Habana University, Chemistry Faculty, Cuba
Lake Basin Development Authority LOI Land scape Development Intervention Makerere University MANRECUR
Manejo Colaborativo de Recursos Naturales en la Subcuenca del Rfo el Angel MARDI Malaysia Agriculture Research
Development Institute MARS Mwara Agricultural Research Institute M ianning Agriculture Bureau Ministerio de
Agricultura Ministerio Presid encia M ini sterio Relaciones Exteriores Mini stry of Agriculture, China Ministry of
Agriculture, Ecuador M inistry of Agriculture, Eritrea Ministry of Agriculture and Cooperatives, Division of Research
and Development M ini stry of Agriculture and Land Reclamation Mariano Marcos State University MSIRI Mauritius
Sugar Industry Research Institute M unicipalidad Distrital Banos del Inca Peru Namulonge Agricultural and Animal
Resea rch Institute Nanchang Agricultural Research Institute NARC National Agricultural Resea rch Centre NARC
Nepal Agricultural Research Council NARO National Agricultural Research Organization NRI Natural Resources
Institute NCVESC National Center for Variety Evaluation and Seed Certification NIAH National Institute of Animal
Husbandry Nkozi University NOAA National Oceanic and Atmospheric Administration NOMIARC Northern
Mindanao Agricultural Research Center Nomorionteetab Kibagenge NPRC National Potato Research Centre
Tigoni NPRP National Potato Research Program NUS National University of Singapore ODER Oficina de Desa rrollo
Rural-C halaco PCARRD Philippine Coun cil for Agriculture, Forestry and Natural Re so urces Research and

<t
0
0
N

.......
0

c.
<II

a:

c
<l.J

...,0

0
CL

m
c
0

77

<I'
0
0

...

c..
<II

c::

Ill

::::

s:
s:

ct

78

Development Red Estrategica para el Desarrollo de Cadena Agroalimentaria de la Papa Philippine Root Crops
Research and Training Center PICTIPAPA Programa Internacional de Cooperacion del Tizon Tardio de la Papa Plan
International PNS- PRODISE Programa Nacional de Semillas del Proyecto de Desarrollo Integral de Semillas
Pontificia Universidad Catolica del Ecuador PPD Plant Protection Department, Ministry of Agriculture and Rural
Development PPRI Plant Pathology Research Institute Programme regional de !'amelioration de la culture de la
pomme de terre et de la patate douce en Afrique PRAPACE centrale et de l'est Philippine Root Crop Research and
Training Center PRECODEPA Programa Regional Cooperativo de Papa PREDUZA Proyecto de Mejoramiento para
Resistencia Duradera en Cultivos Altos en la Zona Andina PROINPA Fundacion para la Promocion e lnvestigacion de
Productos Andinos PROMETAS Promocion y Mercadeo de Tuberculos Andinos, Universidad Mayor de San Simon
Programa de Modernizacion de Servicios Agropecuarios PRONAMACHCS Proyecto Nacional de Manejo de Cuencas
Hidrograficas y Conservacion de Suelos PROSHIKA A Centre for Human Development PRP Potato Research
Programme RANTIK Ltd RAU Rajendra Agricultural University RDA Rural Development Agency REFSO Rural
Energy and Food Security Organization Regional Agricultural Research and Development Centre RIAP Research
Institute for Animal Production RIFAV Research Institute for Fruits and Vegetables Research Institute for Food
Crops Biotechnology RILET Research Institute for Legume and Tuber Crops RIV Research Institute for Vegetables
RCRC- VASI Root Crop Research Center, Vietnam Agricultural Science Institute RNC - RC Jakar Rockefeller
Foundation SAAS Shangdong Academy of Agricultural Sciences SARDl-UMCOR Sustainable Agricultural and Rural
Development Initiative-United Methodist Committee on Relief SARIF Sukamandi Research Institute for Food Crops
SARRNET Southern Africa Root Crops Research Network UK Ltd Save the Children SOC Swiss Agency for Development
and Cooperation SEAG Servicio de Extension Agricola y Ganadera SEAMEO Southeast Asian Ministers of Education
Organization Regional Center for Graduate Study and Research in Agriculture SEMTA Servicios Multiples de
Tecnologfas Apropiadas SENASA Servicio Nacional de Sanidad Agraria SENASAG Servicio Nacional de Sanidad
Agropecuaria e lnocuidad Alimentaria SENASEM Service National de Semences, DR Congo Unidad de Produccion
de Semilla de Papa SESA Servicio Ecuatoriano de Sanidad Agropecuaria ShAAS Shandong Academy of Agricultural
Sciences SHDI Self-Help Development International SiAAS Sichuan Academy of Agricultural Sciences SIDA
Swedish International Development Cooperation Agency SINITTA Sistema Nacional de lnvestigacion y Transferencia
de Tecnologfa Agraria SITIOS Servicios lnteligentes y Tecnologfas Complejas Superiores Ltd SLART Sociedad
Latinoamericana de Rakes y Tuberculos SNSA Service National des Statistiques Agricoles SOCADIDO Soroti
Catholic Diocese Development Organization Sokoine University of Agriculture South China Agricultural University
South China Potato Center Southern Regional Agricultural Bureau, Ministry of Agriculture Southwest Agricultural
University SPDA Sociedad Peruana de Derecho Ambiental SPG Sociedad Peruana de Genetica Centro de
lnvestigacion de Semilla de Papa Sukarami Agricultural Technology Assessment Institute TAAS Tianjing Academy
of Agricultural Sciences TALPUY Grupo de lnvestigacion y Desarrollo de Ciencias y Tecnologfa Andina TARI Taiwan
Agricultural Research Institute TCA Tarlac College of Agriculture TCRC Tuber Crops Research Centre Teso
Community Development Project TFNC Tanzania Food and Nutrition Centre Thai Nguyen University Thang Binh
District Agriculture and Rural Development Bureau The International Foundation The McKnight Foundation The
Micronutrient Initiative The OPEC Fund for International Development Tibetan Academy of Agricultural and
Animal Science TP4 Tim Petani Pemandu PHT Pengalengan UANRDEN Urban Agriculture National Research,
Development and Extension Network Ugunja Community Resource Centre UNEP United Nations Environment
Programme UNHAS Hasanudin University Universidad Austral Universidad Nacional de Cajamarca Universidad
Catolica de Santa Maria Universidad Central Universidad Central de las Villas Universidad de Ambato Universidad
de Caldas Universidad de los Andes Universidad Federal Rio de Janeiro Universidad Jorge Basadre Grohmann de
Tama U niversidad Jujuy U niversidad Mayor de San Simon Universidad Nacional Agraria Universidad Nacional
Daniel Alcides Carrion Universidad Nacional de Bogota Universidad Nacional de Cajamarca Universidad Nacional
del Centro del Peru Universidad Nacional Hermilio Valdizan Universidad Nacional Mayor de San Marcos Universidad
Nacional San Antonio Abad de Cusco Universidad Nacional San Cristobal de Huamanga de Ayacucho Universidad
Peruana Cayetano Heredia U niversidad Politecnica del Ejercito Universidad Privada Huanuco Universidad Ricardo
Palma Universidad San Luis Gonzaga de lea Universidad Tecnologica Equinoccial University of Asmara University
of the Philippines-Los Banos University of Yaounde, Cameroon UNSPPA Uganda National Seed Potato Producers'
Association UPM University Putra Malaysia VASI Vietnam Agricultural Science Institute VECO/FADO, Indonesia
V irus-free Potato Tubers and Cutting Production Centers of Yunnan Agricultural Department VISCA Visayas State
College of Agriculture VSSP Vegetable Seed and Seed Potato Wallace Genetic Foundation, Inc. Winrock
International World Vision, Angola, Burundi, Kenya, Rwanda WRC Wheat Research Centre XSPRC Xuzhou Sweet
Potato Research Center YPPP Yemeni Plant Protection Project Foundation for Socio-Economic Development
Yunnan Agricultural University Swiss Centre for International Agriculture IFPRI International Food Policy Research

Institute PICTIPAPA Centro Internacional de Agricultura Tropical ILRI International Livestock Research Institute
WAU Wageningen Agricultural University The University of California, Davis Waseda University CENARGEN
USDA United States Department of Agriculture Cornell University Gross Lusewitz University of Wisconsin
Catholic University of Leuven A gencia Sueca de Cooperaci6n Internacional para el Desarrollo NRI Natural Resources
Institute University of Wageninen Cornell University CIRAD Texas A&M University ASDl-SAREC Agencia Sueca
de Cooperaci6n Internacional para el Desarrollo INTA lnstituto Nacional de Tecnologfa Agropecuaria University of
Buenos Aires Catholic University of Leuven EMBRAPA ER, Agropolis, Montpellier v on Mikroorganismen und Zellkulturen GmbH A gricultural University of Norway Pontificia Universidad Cat61ica del Peru Cornel l University
Texas A&M University U niversity of Colorado University of Wisconsin US Potato Genebank,Stuegeon Bay, Wi
University of Queensland ARCS MPI Cologne Centre de Recherche Public Gabriel Lippman CPRO-IPO-WAU
Rothamsted Sainsbury Laboratory SCRI Scottish Crop Research Institute NCSU North Carolina State University
LSU Louissiana State University USAID United States Agency for International Development BBA University of
Gottingen U niversity of Hohenheim W ageningen Agricultural University MSU Montana State University
U niversity of Missouri, Columbia U niversity of British Co lum bia University of Edinburgh IFDC International
Fertilizer Development Center University of Toronto M ontana State University Harvard University, School of
Public Health and Medical School University of Wisconsin WSU Washington State University ARC Austria Research
Centre M icronutrient Initiative Chalmers University of Technology International Center for Research on Women
M ichigan State University, Mozambique Program National Institute of Agricultural Research and Technology of
Spain International Development Research Centre, Cities Feeding People Program University of Toronto CIRAD
WAU Wageningen University Universidad Politecnica de Madrid Plant Research International ZIL Swiss Centre for
International Agriculture ARO, The Volcani Center, Department of Plant Pathology A griculture and Agri -Food
Canada, Plant Pathology M ichigan State University, Department of Crop and Soil Sciences Dundee Scottish Crop
Research In st itute IDRC Internationa l Development Research Centre Community-Based Natural Resources
Management CBNRM Programme A delaide University Queensland University NEIKER Swedish Agricultural
University University of Helsinski University of Nairobi HRDI Horticultural Research and Development Institute,
Sri Lanka MOA University of California, Berkeley Virginia Tech University Uzbek Scientific Research Institute of
Potato and Vegetable Tajiki stan Academy of Agricultural Sciences Scientific Research In stitute of Potato and
Vegetable Agha Khan Development Network Bangladesh Agricultural Research Council CARE Georgia Research
Institute of Horticulture BMZ Regional Center of Central Tuber Crops Research Institute Participatory Rural
Development Foundation n do-Swiss Natural Resource Management Programme Western Orissa Rural Livelihood
Project United Nations Development Programme Bogor Agricultural University Department of Agriculture
Dompu District M ataram University Research Institute of Agriculture Tribhuvan University CARE , Nepal Pakistan
Agricultural Research Council l nstituto de lnnovaci6n Tecnol6gica y Promoci6n del Desarrollo Asoc iaci6n para el
Forta lecimiento del Desarrollo Regional Centro Regional de ln vestigac i6n en Biodiversidad Andina Polytechnic
University Zurich University of Taikik Academy of Agricultural Sciences Researc h Institute of Crop Husbandry
University of Florida Tashkent State Agrarian University Research Institute on Vegetables, Melon and Potatoes
International Center for Agricultural Research in the Dry Areas Servicio Nacional de Metereologia e Hidrologia de
Peru y Bolivia University of Utrecht Escuela Politecnica de Chimborazo International Center for Research in
Agroforestry International Centre for Integrated Mountain Development National Institutes of Health M edical
Research Institute Wye Co llege Programa Nacional de Raices y Tuberculos Universidad Mayor de San Simon
Sistema Boliviano de Tecnologfa Agropecuario Kenya Industrial Research and Development Institute Kenya
Medical Research Institute Foodlink Resources German Agro Action Kenyatta University Kirinyaga Flour Millers
Women for Improved Rural Health and Nutrition MRC Medical Research Counsil Nutritional Intervention Research
Unit ARC-Roodeplaat Vegetable and Ornamental Plant Institute Tanzania Home Economics Association, Mwanza
Soko ine University of Agriculture Tanzania Comm ission for Science and Technology, Dar es Sa leem Ukiriguru
Research Institute, Mwanza Sugarcane Research Institute, Kibaha Bugando Hospital, Mwanza M uhimbili Hospita l,
Dar es Sa leem UNICEF , Dar es Saleem Kawanda Agricultural Research Station Volunteer Efforts for Development
Concerns M aganjo Grain Millers Ltd. House of Quality Spices Med-Biotech Lab. Hellen Keller International Globa l
Forum on Agricultural Research M inistry of Health, Nutrition Divi sion ARDAP Appropriate Rural Development
Agriculture Programme A sian Vegetable Research and Development Center, Taiwan International Institute of
Tropica l Agriculture International Water Managament Institute Ryerson University University of the PhilippinesDiliman Nairobi City Council Kampala City Council Resource Centre on Urban Agriculture and Forestry The Urban
Agriculture Network Programa de gesti6n urbana para Latinoamerica y El Caribe International Institute for GeoInformation Science and Earth Observation Centro Panamericano de lngenieria y Ciencias del Ambiente Agencia
Suiza para el Desarrollo y la Cooperaci6n Gates Foundation Government of Japan Government of Sweden

<t
0
0
"I
~

....
0
c.

QI

0::

c
<lJ

0
~

"'0

CL

"'c
0

79

Staff
Director General's Office

""

0
0

...

a.
QI
ex:

QJ

.....
c

QJ

u
0

.....
rJ
.....
0

CL

"'c0

80

Director General-Hubert Zandstra

Mariella Altet, External Relations
Manager
Erika Garcia, Office Auxiliary
Gladys Neyra, Administrative
Assistant
Deputy Director General for
Corporate Development-Hector
Hugo Li Pun
Kirsten Johnson, Chief of Resource
Mobilization Unit'
Veronica Stewart, Chief of
Resource Mobilization Unit 2
Amalia Lanatta, Administrative
Assistant
Maria Ines Rios, Business
Development Associate
Haydee Zelaya, Administrative
Assistant
Deputy Director General for
Research-Pamela Anderson
Carmen Dyer, Administrative
Assistant
Bertha Ferreyros, Information
System Analyst
Lilia Salinas, Administrative
Assistant
Director, Development
Partnerships-Roger Cortbaoui
Rosario Marcovich, Administrative
Assistant

Administration
Aldo Tang, Head of Administration
Silvia Cordova, Bilingual Secretary
Ana Maria Secada, Head, Travel
Office
Gloria Solis, Administrative
Assistant

Human Resources
Lucas Reano, Human Resources
Manager
Genaro Bruno, Receptionist
Monica Ferreyros, Auxiliary
Services Supervisor
Viviana lnfantas, Receptionist
Sor Lapouble, Auxiliary Services
Assistant
Roxana Leon, Social Worker, Social
Welfare and Health Supervisor'
Sofia Martin, Receptionist'
Gicela Olivera, Human Resources
Assistant
Martha Pierola, Social Worker,
Supervisor 2
William Polo, Human Resources
Assistant

Lucero Schmidt, Nurse

Maria Amelia Tavara, Bilingual
Secretary
Yoner Varas, Salary Administrator
Juana Zamudio, Auxiliary Services
Assistant

Logistics
Jorge Locatelli, Logistics
Administrator
Willy Alarcon, Maintenance
Technician
Ignacio Anglas, Maintenance
Technician
Tito Arellano, Warehouse
Supervisor
Filomeno Auqui, Purchasing
Assistant
Pilar Bernui, Bilingual Secretary
Antolin Briceno, Security Officer
Leoncio Ccenta, Warehouse
Assistant
Guillermo Corzo, Purchasing
Assistant
Hugo Davis, Vehicle Maintenance
Officer 2
Javier Duenas, General Services
Assistant
Ximena Ganoza, Purchasing
Supervisor
Raul Garcia, Purchasing Assistant
Jose Gorvenia, Security Driver
Atilio Guerrero, Vehicle
Programmer
Victor Huambachano, Security
Officer
Luis Lopez, Warehouse Assistant
Jorge Luque, Warehouse
Supervisor 2
Julio Mendoza, Security Driver
Antonio Morillo, Maintenance
Chief
Hugo Montalvo, Security Officer
Juan Palomino, Maintenance
Technician
Pedro Pelaez, Maintenance
Technician
Angel Pozada, Logistics Assistant
Carlos Reyes, Security Driver
Teofilo Tintaya, Security Officer
Carlos Uribe, Maintenance
Technician
Lisardo Vasquez, Safety Officer
Jose Yancce, Maintenance
Technician
Saturnino Zapata, Maintenance
Technician

Finances
Carlos Alonso, Chief Financial
Officer
Edgardo De los Rios, Senior
Accountant

Andres Garcia, Assistant

Accountant
Denise Giacoma, Budget
Supervisor
Rodmel Guzman, Assistant
Accountant
Willy Hermoza, Assistant
Accountant
Alberto Monteblanco, Budget
Supervisor 2
Ruth Paredes, Assistant
Accountant'
Milagros Patino, Treasurer
Eduardo Peralta, Accountant
Miguel Saavedra, General
Accountant
Sonnia Solari, Cashier
Martina Solis Rosas, Bilingual
Secretary
Cesar Tapia, Assistant Accountant
Rosa Maria Vasquez, Project
Supervisor'
Ernesto Villanueva, Assistant
Accountant'
Mamerto Zambrano, Office
Auxiliary

Impact Enhancement
Division
Keith Fuglie, Economist, Division
Leader (CIP-Bogor)
Thomas Bernet, Agricultural
Economist, Swiss Associate Expert'
Charles Crissman, Economist,
CIP-SSA Regional Representative
(CIP-Nairobi)
David Yanggen, Agricultural
Economist, Associate Scientist
(Montana State University)
Marfa Lozano, Database Auxiliary
Ivan Manrique, Research Assistant
Zandra Vasquez, Bilingual
Secretary
Sonia Salas, Food Technologist,
Research Associate'
Victor Suarez, Statistics Assistant

Genetic Resources
Conservation and
Characterization Division
William Roca, Plant Cell
Physiologist, Division Leader
Michael Potts, Sweetpotato
Production Specialist
Walter Roder, Regional Seed
Potato Specialist (Bhutan)''
Roland Schafleitner, Biotechnology
Research Scientist'
Fengyi Wang, Potato Production
Specialist (CIP-Beijing) '"
Mercedes Ames, Biologist,
Research Assistant'

Daniel Andrade, Research

Assistant 12
Carlos Arbizu, Andean Crops
Specialist
Carolina Bastos, Agronomist,
Research Assistant
Miguel Blancas, Systems Assistant
Catherine Espinoza, Research
Assistant
Rene Gomez, Agronomist,
Research Assistant
Roberto Gonzales, Laboratory
Auxiliary
Ana Panta, Biologist, Research
Assistant
Daniel Reynoso, Agronomi st,
Research Assistant
Genoveva Rossel, Biologist,
Research Assistant
Alberto Salas, Agronomist,
Research Associate
Mariana Martin, Bilingual Secretary
Fanny Vargas, Agronomist,
Research Assistant
Francisco Vivanco, Research
Assistant
Cecilia Ynouye, Research Assistant
Cinthya Zorrilla, Biologist, Research
Assistant '

Germplasm Enhancement
and Crop Improvement
Division
Merideth Bonierbale, Senior
Potato Breeder, Division Leader
Mohammad Arif, Seed Specialist
(Afghanistan) '
Jasper Buijs, Associate Expert in
Bioinformatics, JP0 2
Carlo Carli, Regional Seed
Production Specialist, Liaison
Scientist Uzbekistan 1
Hyun-Mook Cho, Potato Breeder,
Visiting Scientist
Enrique Chujoy, Geneticist
Stefan De Haan, Associate Expert in
Breeding / Agronomy, JPO
Sander De Vries, Associate Expert
in Breeding/Agronomy, JPO
Marc Ghislain, Molecular Biologist
Peter Gildemacher, Potato
Breeder/ Agronomist, JPO
Wolfgang J. Gruneberg,
Sweetpotato Breeder Geneticist'
Michael Hermann, Andean Crops
Specialist'
Jan Kreuze, Molecular Virologist,
JPO
Hannelle Kreuze, Molecular
Breeding, Fellow'
Juan Landeo, Plant Breeder
Carlos Ochoa, Taxonomist, Scientist
Emeritus

Walter Amoros, Agronomist,

Research Associate
Ida Bartolini, Biochemist, Research
Assistant
Arnaldo Beltran, Research
Technician
Jorge Benavides, Biologist,
Research Assistant
Gabriela Burgos, Biologist,
Research Assistant
Rolando Cabello, Agronomist,
Research Assistant
Jose Condori, Research Assistant
Lorena Danessi, Bilingual Secretary
Luis Diaz, Agronomist, Research
Assistant
Jorge Espinoza, Agronomist,
Research Assistant
Rosario Falcon, Biologist, Research
Assistant
Paulo Garcfa, Research Technician
Manuel Gastelo, Agronomist,
Research Assistant
Felix Gomez, Research Technician
Walter Gomez, Research
Technician
Enrique Grande, Research
Technician
Rosario Herrera, Biologist,
Research Assistant
Giuliana Medrano, Veterinary,
Research Assistant'
Isabel Mel, Bilingual Secretary
Elisa Mihovilovich, Biologist,
Research Assistant
Marfa Miki, Research Assistant'
Susan Munive, Research
Technician 1
Rosa Salazar, Bilingu al Secretary
Jorge Nunez, Research Assistant '
Matilde Orrillo, Biologist, Research
Assistant
Giovana Perazzo, Biologist,
Research Assistant
Leticia Portal, Biologist, Research
Assistant
Elisa Romero, Agronomist,
Research Assistant '
Elisa Salas, Research Assistant'
Guillermo Trujillo, Biologist,
Research Assistant '
Jessica Yactayo, Research Assistant

Integrated Crop
Management Division
Oscar Ortiz, Agricultural Extension
Specialist, Division Leader
Paul Demo, Regional Potato
Expert'
Edward French, Scientist Emeritus
Peter Kromann, Plant Pathologist,
JPO
Jurgen Kroschel, Entomologist'

Magnus Kuhne, Entomologist,

Associate Scientist
Sylvie Priou, Bacteriologist
Luis Salazar, Virologist, Principal
Scientist
Marc Sporleder, Entomologist Post Doctoral'
Yi Wang, Plant Physiologist, Liaison
Scientist (CIP-Beijing)
Jesus Alcazar, Agronomist,
Research Ass istant
Pedro Aley, Plant Pathologist,
Research Assistant
Jaime Arellano, Research
Technician
Monica Blanco, Bilingual Secretary
Veronica Canedo, Biologist,
Research Assistant
Jorge Caycho, Research Assistant'
Carlos Chuquillanqui, Agronomist,
Research Assistant
Hugo Espinoza, Research
Technician
Cristina Fonseca, Agronomist,
Research Assistant
Segundo Fuentes, Plant
Pathologist, Research Assistant
Soledad Gamboa, Biologist,
Research Assistant
Liliam Gutarra, Agronomist,
Research Assistant
Eva Huaman, Research Technician
Carlos Mendoza, Research
Technician
Marco Meza, Research Technician
Norma Mujica, Agronomist,
Research Assistant
Giovanna Muller, Biologist,
Research Assistant
Francisco Ochoa, Research
Technician
Ricardo Orrego, Agronomist,
Research Assistant
Catalina Paredes, Research
Technician
Wilmer Perez, Plant Pathologist,
Research Assistant
Willy Pradel, Zoologist, Research
Assistant'
Magnolia Santa Cruz, Biologist,
Research Assistant 2
Jorge Tenorio, Biologist, Research
Assistant
Roger Torres, Research Assistant'
Marcelo Trebejo, Research
Technician
Antonio Trillo, Research Technician
Melisa Vargas, Biologist, Research
Assistant'
Adan Vega, Research Technician
Julia Zamudio, Bilingual Secretary
Octavio Zegarra, Biologist,
Research Assistant
Rocio Zevallos, Research Assistant 2

.,.
0
0
N

....

0
fl.
QI

a:

"'c

::J

c
<t
c
<J.I

0
._,

"'0
Cl..

"'c

._,
ra

<J.I
._,

81

.,.
0
0
N

...
0

a.
QI
a:
Ill

:I

c:
c:

C(
QJ

+-'

QJ

u
0
+-'

"'0

+-'

Q_

"'c0

82

Natural Resources
Management Division

Urban Harvest Partnership

Program

Roberto Quiroz, Land Use Systems

Specialist, Division Leader
Fernando Ezeta, Agronomist,
Regional Leader, CIP ESEAP
Kumari Gurusamy, GIS
Specialist, JPO
Sarath llangantileke, Postharvest
Specialist, CIP-SWA Regional
Representative (CIP-Delhi)
Carlos Leon -Ve larde, Agricultural
Systems Analysis Specialist
Guillermo Baigorria, Climatologist,
Research Assistant
Carolina Barreda, Agronomist,
Research Assistant
Jimena Bazoalto, Research
Assistant
Mariana Cruz, Biologist, Research
Assistant'
Jorge De la Cruz, Assistant
Programmer '
Jorge del Carpio, Database
Technician
Rebeca Fri sa ncho, Agronomist,
Research Assistant'
Alex Garcia, Assistant Programmer
Alberto Garcia, Photographic
Design Techn ician
Jose Guerrero, Systems Assistant
Hilda Loayza, Research Assistant'
Adolfo Posadas, Physicist, Research
Associate
Yasmin Raygada, Bilingual
Secretary
Ivonne Valdizan, Bilingual
Secretary
Guido Yactayo, Research Assistant '
Percy Zorogastua, Agronomist,
Research Assistant

Gordon Prain, Social

Anthropologist, Program
Coordinator
Diana Lee-Smith, Sociologist, Urban
Harvest Regional Coordinator for
SSA (CIP-Nairobi)
Blanca Arce, Zoologist, Research
Associate 1
Luis Maldonado, Economist,
Research Assistant
Ana Luisa Munoz, Bilingual
Secretary

Berga Lemaga, Agronomist,

Program Coordinator (CIPKampala)3
James Nsumba, Agronomist,
Program Assistant
Rachel N. Wakulla, Accountant
Martha Amery, Secretary
Amos Wander, Driver

VITAA Partnership
Program

Papa Andina Partnership

Program

Regina Kapinga, Sweetpotato

Breeder (CIP-Kampala), Program
Coordinator

Andre Devaux, Agronomist,

Program Coordinator
Graham Thiele, Anthropologist,
Andean Potato Project (CIP-Quito) 3
Marfa Elena Alva, Information
Assistant'
Rocio Cruz Saco, Bilingual
Secretary
Kurt Manrique, Agronomist,
Research Assistant

UPWARD Partnership
Program
Dindo Campilan, Sociologist, (CIPLos Banos), Program Coordinator
Keith Fahrney, Agronomist, PRDU
Project Coordinator (based at
CIAT-Vientiane)
Carlos Basilio, Research Fellow
Raul Boncodin, Program Associate
Hideliza de Chavez, Research
Fellow
Mylene Aquino, Administrative
Officer
Marietta Nadal, Office Manager

Global Mountain Program

Partnership Program
Peter Trutmann, Program
Coordinator'
Luciana Rivera, Bilingual Secretary

GILB Partnership Program

Gregory Forbes, Plant Pathologist,
Program Coordinator
Charlotte Lizarraga, Plant
Pathologist, GILB Assistant
Coordinator

PRAPACE Partnership
Program

CONDESAN Partnership
Program
Hector Cisneros, Forestry, Program
Coordinator
Ruben Darfo Estrada, Natural
Resources Economist (based at
CIAT) 4

Elias Mujica, Anthropologist,

Adjunct Scientist'
Musuq Briceno, Research Assistant
Connie Hernandez, Bilingual
Secretary
Ana Marfa Ponce, lnfoAndina,
CON DESAN

Communication and Public

Awareness Department
Paul Stapleton, Head '
Christine Graves, Head'
Anne Moorhead, Writer-Editor'
Jean Pierre Carre, Systems
Development Support
Ruth Delgado, Exhibits/ Display
Assistant
Nini Fernandez Concha, Graphic
Designer
Milton Hidalgo, Graphic Designer
Cecilia Lafosse, Chief Designer
Marfa Elena Lanatta, Administrative
Assistant
Paul Moncada, Webmaster
Anselmo Morales, Graphic
Designer
Zoraida Portillo, Spanish WriterEditor/ Media
Alfredo Puccini, Graphic Designer

Training Department
Thomas Zschocke, Head
Roque Alberco, Audio-visual
Technician
Pilar Byrne, Training and Events
Assistant'
Edda Echeandia, Multimedia
De ve loper
Martha Huanes, Training
Coordinator
Mercedes Suito, Bilingual
Secretary

Library
Cecilia Ferreyra, Head Librarian
Rosa Ghilardi, Bilingual Secretary
Griselda Lay, Library Assistant
Luis Valencia, Library Auxiliary

Information Technology
Unit
Anthony Collins, Head
Liliana Bravo, Server Administrator
Andrea Caceres, Systems
Development Support'
Roberto del Villar, Server
Administrator
Erika Orozco, Server Administrator
Dante Palacios, Helpdesk
Administrator

Ja cque line Puchuri, Admini st ra ti ve

Systems An alyst
Saul Rodriguez, Web Syst ems
Analyst
Milton Sandova l, Helpdesk
As sist ant '
Edg ard o Torres, Systems
Deve lopmen t Admini strator
Pet er Valdivieso, Helpdesk
Assista nt'
Alberto Velez, Systems and
Network Administrator'
Diana Zeva ll os, Administrative
Systems An alyst

Field Research Support

Vi ctor Otazu, Expe rim ental
Stations Superintendent
Carlos Ag uirre, Agronomi st, Fi eld/
Greenh ouse Supervisor '
Walter Blas, Mechanic
Mario Carhuamaca, Administrative
Au xili ary
Anastacio Cosme, Dri ver (Tract or)
Roberto Duarte, Agronomi st, Fi eld/
Greenhou se Supervisor (La Molina)
Hugo Goyas, Agronomi st, Field/
Greenhouse Supervi sor
(Huancayo) 2
Carmen Lara, Secretary
Jenny Limaylla, Administrative
As sistant
Vann a Pi ana, Administrative
Assi stant
Miguel Quino, Research Technici an
Fredy Silva, Security Chief

Research Informatics Unit

Reinhard Simon, Head, Resea rch
Informatics Unit
Lui s Avila, Systems Assistant'
Felipe De Mendiburu, St atistician,
Resea rch Assistant
Henry Juarez, Agronomi st,
Research Assistant
Edwin Rojas, Systems An alyst
Magna Schmitt, Systems Ass istant'
Enver Tarazona, Systems Assistant'
Sara Villanueva, Systems Assist ant'

Regional Offices
Latin America and the Caribbean
(LAC)
Ecuador Liaison Office
Magaly Aspiazu, Admini strative
Assistant
Soffa Ayala, Administrative
As sista nt

Juan Delgado, Vehicle

Maintenance and Messenger
Su sa na Barriga, Accountant
Peter Kromann, Plant Pathol og ist JPO
Ri cardo Oliva, PhD Stud ent
Franci sco Jarrfn, Research
Tec hnician
Marcelo Vinu eza, Research
Tec hn ician
Robert Hofstede, Program
Coordinator Paramu s Project '
Di ana Jimenez, Resea rch Assistant
Paramu s Project'
Jose Jimenez, Network
Management and Systems
M ai ntenance
Sub-Saharan Africa (SSA)
Regional Office Kenya
Emil y Ndoho, Admini strative
Assist ant
Elijah lgunza, Purchasin g Officer
Geo rg e Maine, Driver
Simon Obaga, Accountant
Gibso n Guvheya, Agricultural
Eco nom ist, Post-doctoral Fellow"'
Peter Kingori, Research Assistan t '
Mary Njenga, Resea rch Assistant 3
Sammy Agili, Breeder, Research
Ass ista nt
Wachira Kaguongo, Agricultural
Eco nomi st, Research Ass istant''
Liaison Office Uganda
Stella Nagujja, Impact and Policy
Coordinator, Harvest Plu s
Silver Tum weg amire, Breeder,
Resea rch Ass istant
Sam Namanda, Agronomist,
Resea rch Assistant
South, West and Central Asia
(SWCA)
Regional Office India
M S Kadian, Agronomist
Sreekanth Attaluri , Sweetpotato
Scienti st, Liaison Scienti stBubaneshwar, India
B H Giri sh, Potato Scienti st
NT Lotha, Agronomist and Li aison
Scienti st -NE India
Muhammad Arif 1, Seed Specialist
(CIP-SWCA, Kabul, Afghan ista n)
Carlo Carli ', Seed Specialist (CIPSWCA, Tas hkent, Uzbekistan)
Walter Roder ', Coord in ator, CIPCFC, Bhutan
Sushma Arya, Accountant/ Program
Coordinator
L Mony, Secretary

Romi Verma, Program Associate

Durbek Khalikov 1, Assistant
Agronomist
Marat Abdullayev 1, Interpret er/
Translator
Moeen-ud-Din, Nation al/ Local
Coordinator (CIP-SWCA-Kabul,
Afghanistan)

<I'
0

.....

East and Southeast Asia and the

Pacific (ESEAP)
Regional Office Indonesia
Talent Hidayat, Faciliti es Manager
Dessy Kusbandi, Secreta ry
Kusye Nawawi, Accountant
Rini Asmunati, Research Assistant
Luth er Kosay, Research Assistant 3
Su kendra Mahalaya, Researcher
Ase p Setiawan, Sweetpotato
Breeder
Koko Tjintokohadi, Research
Ass ista nt
Warsito Tantow ijoyo, Resea rch er
Colin Cargill, Animal Scienti st
(Au stralia)'
Liaison Office China
Zhou Pei, Secretary and
Accountant
Wang Xue-fei, Administrative
Assista nt
Liu Shi-an, Office Assistant and
Driv er
Zhu Dian-ping Yanqing, Station
Manager and Tech nician
Consulting Agencies in the
Provinces
Bi Yu-ping, Pathogen Diagnosi s and
Trai nin g, Biotechnol ogy Center,
Shandong Academy of Agri culture
Sciences, Shandong Province
Yao Min-s huang, Potato Seed
Techn ology, Breeding and Training,
Pengzhou Potato Unit, Sichuan
Agriculture Burea u, Sichuan
Pr ov inc e
Liaison Office Vietnam
Nguyen Thi Tinh, Animal Scientist,
CIP-Liaison Scientist
Tran Thi Bich Ngoc, Research
Assistant
Liaison Office Korea
Feng yi Wang, Project Coordinator

1
2
3
4

Joined CIP in 2004

Left CIP in 2004
Fund ed by special project
Joint appointment

Q.
QI

Cl:

ra
c

:I

<
:;
._,,
c
QJ

u
0
._,,
._,,

"'0

Q_

"'c0

._,,

"'c
QJ
._,,

83

Global contact points

CIP Headquarters

.,.
0
0
N

......
0

0..
QJ

er

International Potato Center (CIP)

Avenida La Molina 1895, La Molina
P.O. Box 1558
Lima 12, Peru
Tel: +51 1 349 6017
Fax: +51 1 317 5326
email: cip@cgiar.org
Website: www.cipotato.org

Latin America and the

Caribbean (LAC)
~

<1J

c
<1J

0
~

"'0

0...

"'c
0
'-'

"'c
<1J
'-'

Regional Office Peru

(same address, telephone and fax as
CIP Headquarters)
All regional matters except Peru
Contact: Enrique Chujoy
Geneticist
email: e.chujoy@cgiar.org
Peru
Contact: Hugo Li-Pun
Deputy Director General for
Corporate Development
email: cip-ddg-cd @cg iar.org

P.O. Box 22274

Kampala, Uganda
Tel: +256 41 287 571
Fax: +256 41 286 947
email: r.kapinga@cgiar.org
Contact: Regina Kapinga, Liaison
Scientist

South, West and Central

Asia (SWCA)
Regional Office India
International Potato Center
NASC Complex
DPS Marg, Pusa Campus
New Delhi, 110012, India
Tel: +91 11 2584 0201 / 2584 3734
Fax: +91 11 2584 7481
email: cip-delhi@cgiar.org
Contact: Sarath llangantileke,
SWCA Regional Representative

East and Southeast Asia

and the Pacific (ESEAP)

84

Ecuador Liaison Office

International Potato Center
Santa Catalina Experimental
Station
Km. 17 Panamericana Sur
Sector Cutuglagua Canton Mejfa
Apartado 17-21-1977
Quito, Ecuador
Tel: +593 2 2690 362/ 363
Fax: +593 2 2692 604
email: cip-quito@cgiar.org
Website: www.quito.cipotato.org
Contact: Graham Thiele, Liaison
Scientist

Sub-Saharan Africa (SSA)

Regional Office Kenya
International Potato Center
P.O. Box 25171
Nairobi 00603, Kenya
Tel: +254 20 632 054
Fax: +254 20 630-005/ 631 559
IVDN: 660 4937
email: cip-nbo@cgiar.org
Contact: Charles Crissman, SSA
Regional Representative
Liaison Office Uganda
International Potato Center
c/o PRAPACE
Plot 106, Katarima Road, Naguru

Regional Office Indonesia

International Potato Center
Kebun Percobaan Muara, Jalan Raya
Ciapus
Bog or 16610, Indonesia
Tel: +62 251 317 951
Fax: +62 251 316 264
email: cip-bogor@cgiar.org
Website: www.eseap.cipotato.org
Contact: Keith Fuglie, ESEAP
Regional Representative
Liaison Office China
I nternationa I Potato Center
c/ o The Chinese Academy of
Agricultural Sciences
Zhong Guan Cun South Street 12
West Suburbs of Beijing,
Beijing, People's Republic of China
Tel: +86 10 6897 5504
Fax: +86 10 6897 5503
email: cip-china@cgiar.org
Website: www.eseap.cipotato.org/
cip-china
Contact: Yi Wang, Liaison Scientist
Liaison Office Vietnam
International Potato Center
36A/48 Tay Ho
Tay Ho District
Hanoi, Vietnam
Tel: +84 4 829 0537
email: tnguyen @cgiar.org
Contact: Thi Tinh Nguyen

Global, Regional and

Systemwide Initiative
Andean Potato Project (Papa
Andina)
Bolivia, Ecuador, Peru
Peru
Avenida La Molina 1895, La Molina
P.O. Box 1558
Lima 12, Peru
Tel: +51 1 349-6017
Fax: +51 1 317 5326
email: papa-andina@cgiar.org or
a.devaux@cgiar.org
Website: www.cipotato.org/
papandina
Contact: Andre Devaux, Project
Coordinator

Ecuador
(same address, telephone and fax as
Ecuador Liaison Office)
e-mail: g.thiele@cgiar.org
Contact: Graham Thiele,
Participatory Research and
Training Specialist
CONDESAN (Consortium for the
Sustainable Development of the
Andean Ecoregion)
(same address, telephone and fax as
CIP headquarters)
email: condesan@cgiar.org
Website: www.condesan.org
Contact: Hector Cisneros,
Coordinator
GILB (Global Initiative on Late
Blight)
(same address, telephone and fax as
CIP headquarters)
email: gilb@cgiar.org
Website: www.cipotato.org/gilb
GMP (Global Mountain Program)
(same address, telephone and fax as
CIP headquarters)
email: p.trutmann@cgiar.org
Contact: Peter Trutmann, Program
Coordinator
PRAPACE (Regional Potato and
Sweet Potato
Improvement Program for East
and Central Africa)
Plot 106, Katarima Road, Naguru
P.O. Box 22274
Kampala, Uganda
Tel: +256 41 286 209
Fax: +256 41 286 947
email: prapace@prapace.co.ug
Contact: Berga Lemaga, PRAPACE
Coordinator

UPWARD (Users' Perspectives

with Agricultural
Research and Development)
Physical address:
PCARRD Complex
Los Barios, Laguna 4030,
Philippines
Postal address:
c/ o IRRI DAPO Box 7777
Metro Manila, Philippines

Tel: +63 49 536 8185

Fax: +63 49 536 1662
emai l: cip-manila@cgiar.org
Contact: Dindo Campilan, UPWARD
Coordinato r
Web site: www.eseap.cipotato.org/
upward

.,..
0
0
N

.......
0

a.
QI

IX
Ill

::s
c:
c:

cc
~

<1J

......

CIP in the world

<1J

u
0

......
ro

......
0

a_

South and West and Central Asia

(SWCA)

ro

c
0

ro

<1J

......

85

Latin America
andthe
Caribbean
(LAC)

East and
Southeast Asia
andthe
Pacific (ESEAP)
Sub-Saharan Africa
(SSA)

Io

Liaison Office

Regional Office

Future Harvest
.,.
0
0
N

.....
0

a.
41

a:

'I.I

....0
...."'
0

G..

"'
0

....

"'c

86

CIP is one of 15 food and

environmental research
centers located around the
world that make up the Future
Harvest Alliance. The Future
Harvest Centers receive their
principal funding through the
Consultative Group on
International Ag ricu ltura I
Research (CGIAR), a strategic
global partnership of
countries, international and
regional organizations, and
private foundations. Working
with national agricultural
research systems, the private
sector and civil society, the
CGIAR mobilizes agricultural
science to reduce poverty,
foster human wellbeing,
promote agricultural growth,
and protect the environment.
The Centers collaborate
among themselves and with
their diverse partners through
numerous projects and
system-wide programs. The
CGIAR is also creating a series
of independently governed
partnerships among a wide
range of institutions for highimpact research that targets
complex issues of
overwhelming global and/ or
regional significance. CIP has
substantial participation in
each of these Challenge
Programs, and intends to
extend this involvement to
the Sub-Saharan Africa
Challenge Program, currently
being formulated . Over the
past two years, three
Challenge Programs have
been established:
The Challenge Program on
Water and Food, The
HarvestPlus Challenge
Program, The Generation
Challenge Program

Future Harvest Center

I CARDA

Syria

CIMMYT

WORLD
AGROFORESTRY
CENTRE AND ILRI

ICRISAT
India

_
IR_RI _ _ _.....,
Philippines

Kenya

CIP
Peru

CIFOR
Indonesia

CIAT

Centro Internacional de Ag ricultura Tropical

CIFOR

Center for International Fo restry Research

CIMMYT

Centro Internacional de Mejoramiento de Maizy Trigo

CIP

Centro Internacional de la Papa

!CARDA

International Center for Agricu ltural Research in the Dry Areas

ICRISAT

Internationa l Crops Research Institute for the Semi-Arid Tropics

IFPRI

Internationa l Food Policy Research Institute

llTA

Internationa l Institute ofTropical Agricu lture

ILRI

Internationa l Livestock Research Institute

IPGRI

International Plant Genetic Resources Institute

IRRI

Internationa l Rice Re sea rch In stitute

IWMI

International Water Management Institute

WARDA

West Africa Rice Development Association

World Agroforestry Centre
World Fish Center

=
INTERNACIONAL

'

G\.

CIP A)

FUTURE

HA R\t(EST

~b~
CCllAR

The International Potato Center

(CIP) seeks to reduce poverty
and achieve food security on a
sustained basis in developing
countriesthrough scientific
research and related activities on
potato,sweetpotato,and other
root and tuber crops, and on the
improved management of
natural resources in the Andes
and other mountain areas.
The CIP Vision
The International Potato Center
(CIP) will contribute to reducing
poverty and hunger; improving
human health; developing
resilient, sustainable rural and
urban livelihood systems; and
improving access to the benefits
of new and appropriate
knowledge and technologies.
CIP, a World Center, will address
these challenges by convening
and conducting research and
supporting partnerships on root
andtubercropsandon natural
resources management in
mountain systems and other
less-favored areas where CIP
can contribute to the
achievement of healthy and
sustainable human
development.
www.cipotato.org
CIP is a Future Harvest Center
and receives its principal funding
from a group of governments,
privatefoundations,and
international and regional
organizations known as the
Consultative Group on
International Agricultural
Research (CGIAR).
www.futureharvest.org
www.cgiar.org

International Potato Center

CIP. 2004. Food, livelihood and

health
In ternational Potato Center
Annual Report 2004
2005, Internationa l Potato
Center
ISSN 0256-6311

CIP publications contribute

important development
information to the public arena.
Readers are encouraged to quote
or reproduce material from them
in the ir own publications. As
copy right holder CIP requests
acknowledgement and a
copy of t he pub lication where the
cit ation or materia l appears.
Please send this to the
Commun icat ion and Public
Aware ness Department at the
address below.
International Potato Center
Apartado 1558, Lima 12, Peru
cip@cg iar.org

www.cipotato.org
August 2005

Ed itor
Pau l Stapleton
Writers
John Reader, Christine Graves,
Lisa Wing
Produ ction coordinator
Ceci li a Lafosse
Design and layout
Nini Fernandez-Concha
Photo Credits
Cover: K. Zinser p3 A. Ba laguer
p9 0. Ortiz p61 A. Ba laguer p67
CIP Archives

The international community has emphasized its intention to support the Millennium Development Goals (MDG)
and we in the Consultative Group on International Agricultural Research (CGIAR) can contribute to many of the
targets set within those goals. Currently the Science Council of the CGIAR is setting priorities for the CGIAR System
to address them in a systematic manner, with the intention that the donor community will support them and
give a strong foundation for long term research to prosper and produce Global Public Goods. The International
Potato Center (CIP) has agreed on a new vision which addresses these MDGs, but vision in itself is not enough,
we are now actively embedding this within the institution both in programs and with our staff.
The Board of Trustees has been active in ensuring we have the highest standards of governance. In 2004 the
Board of the Alliance of the Future Harvest Centers of the CGIAR initiated board orientation and training courses
to improve standards of governance at all centers, CIP has been an active participant in this. It is through good
governance that the Board exercises its responsibilities to provide leadership, direction and oversight that are
rightly required by our stakeholders. Indeed in 2004 this leadership was demonstrated when the Board selected
a new Director General, Dr. Pamela K. Anderson to succeed Dr. HubertZandstra when he retires in 2005. A planned
and controlled change of Director General creates a stable environment in which our work can flourish. The Center
has again achieved its financial targets whilst at the same time ensuring our research output is both relevant
and productive.
This Annual Report will give you an insight into the high quality of work that takes place at CIP and demonstrates
we have real outputs and outcomes that improve the lives of many of the poorest people in the world.

Jim Godfrey
Chairman

International Potato Center Av. La Molina 1895 La Molina Apartado 1558 Lima 12, Peru