A tetra-primer amplification refractory mutation system polymerase chain

reaction for the evaluation of rs12979860 IL28B genotype

Enrico Galmozzi, Benedetta Del Menico, Raffaela Rametta, Paola Dongiovanni, Anna Ludovica
Fracanzani, Luca Benedan, Vittorio Borroni, Paolo Maggioni, Silvia Fargion, Luca Valenti.

Department of Internal Medicine, Universit degli Studi, Ospedale Maggiore Policlinico Ca

Granda IRCCS, Via F Sforza 35, 20122 Milano, Italy

There is no conflict of interest to disclose.

Short title: T-ARMS-PCR for IL28B genotypization

Correspondence address:
Dr. Luca Valenti, Centro Malattie Metaboliche del Fegato,
Department of Internal Medicine, Universit degli Studi,
Ospedale Maggiore Policlinico Ca Granda IRCCS, Milano
Via F Sforza 35, 20122 Milano, Italy
E-mail: luca.valenti@unimi.it, tel:+390255033301 fax.+390250320296

Abstract
Recently, genome-wide association studies in patients affected by HCV infection have
identified a strong association between sustained virological response to peg-interferon/ribavirin
and spontaneous viral clearance and common single nucleotide polymorphisms (SNPs) near the
IL28B gene, encoding for interferon-lambda-3. Thus, it is anticipated that IL28B genotype
determination will be integrated in clinical practice to guide treatment decisions. Here we describe a
simple tetra-primer amplification refractory mutation system polymerase chain reaction (T-ARMSPCR) for the evaluation of the rs12979860 C>T IL28B SNP, for which strong evidence of
association with clinical outcomes have been collected in subjects of European descent. Valid
genotypic data were obtained for over 99% of subjects analyzed, and T-ARMS-PCR procedures
were validated by analysis of DNA samples of 164 patients with chronic HCV infection. In
conclusion, this method allows rapid, reproducible, inexpensive, and accurate detection of
rs12979860 polymorphism without need of any special equipment, and is also suitable for
evaluation of a low number of samples on a routine basis.

Introduction
Chronic hepatitis C (CHC) infecting more than 170 million people is a leading cause of liver
related mortality worldwide. Hepatitis C virus (HCV) induces chronic infection in 50% to 80% of
infected persons, and, although the presently recommended treatment for chronic infection involves
a variable duration course of peg-interferon (PEG-IFN) combined with ribavirin (RBV), many
patients will not be cured by treatment, especially if affected by genotype 1 strains.
Recently, genome-wide association studies have linked response to PEG-IFN/RBV with
common single nucleotide polymorphisms near the IL28B gene, encoding for interferon-lambda-3
(IL28B), associated with an approximately two-fold change in response to treatment. The
association with treatment response was more evident in genotype 1 patients (1, 2), and linked to a
more favorable kinetic of viral load decrease after exposure to PEG-IFN/RBV (2). IL28B has been
implicated in the regulation of the immune response against viral infections, and is known to be
upregulated by interferons and by RNA virus infection (3). Interestingly, data are accumulating
indicating that IL28B genotype also predicts HCV infection chronicization after acute exposure (4).
Thus, it is anticipated that IL28B genotype determination will be integrated in clinical practice to
guide treatment decisions in patients with acute and chronic HCV infection.
Until now, IL28 genotype has been determined by custom designed Taqman assays, which are
suitable for high-throughput genotyping of large series of patients for research purposes, but are
relatively expensive and less practical for routine utilization on small number of samples.
Here we describe a simple tetra-primer amplification refractory mutation system polymerase
chain reaction (T-ARMS-PCR) for the evaluation of the rs12979860 C>T single nucleotide
polymorphism (SNP) localized 3 kilobases upstream of the IL28B gene, for which strong evidence
of association with clinical outcomes have been collected in subjects of European descent (1, 4, 5).

Materials and methods

Conventional ARMS-PCR amplifies the two alternative alleles at a specific locus by two
different PCR reactions (6, 7). In contrast, T-ARMS-PCR amplifies both wild type and mutant
alleles, together with a control fragment, in a single tube PCR reaction. The region flanking the
locus of interest is amplified by two common (outer) primers, producing a non allele-specific
control amplicon. Two allele-specific (inner) primers are designed in opposite orientation and, in
combination with the common primers, can simultaneously amplify both the wild type and the
mutant amplicons (supplementary figure 1A). The specificity of allele-specific primers is conferred
by the match of the terminal 3 nucleotide with either the wild-type or the mutant allele, and it is
enhanced by the introduction of a deliberate mismatch near the primer 3 end (6, 7). The two allelespecific amplicons have different lengths and can be easily separated by standard gel
electrophoresis because the mutation is asymmetrically located with respect to the common primers.
Since the control amplicon and at least 1 of the 2 allele-specific amplicons are always present, TARMS-PCR provides an internal control with respect to false negatives as well as amplification
failure.
We designed the primers on the basis of the published rs12979860 genomic sequence. The
primers sequences were as follows. OUTER FW: 5 AACTCAACGCCTCTTCCTCCT 3; OUTER
RV: 5 TTCCCATACACCCGTTCCTGT 3; INNER FW (T), 5AGGAGCTCCCCGAAGGAGT
3; INNER RV (G), 5GTGCCATTCAACCCTGGTACG 3.
The PCR reactions were performed in a volume of 10 l, containing 10 to 30 ng of genomic
DNA extracted by the phenol-chloroform method, 10 pmol of each of the four primers, 0.2 mM of
each dNTP, 2.5 U of BIOTAQ DNA polymerase (Bioline, London, UK), 1 NH 4 reaction buffer
(Bioline), and 1.5 mM MgCl2. PCR was conducted with 5 min of denaturation at 95C, 34 cycles of
95C for 45 s, annealing at 58C for 45 s, 72C for 1 min, and a final extension at 72C for 5 min.
PCR products were separated by standard electrophoresis on 2% agarose gels containing ethidium
bromide.

Results and discussion

T-ARMS-PCR method was tested on peripheral blood DNA samples previously analyzed by
direct sequencing. Both homozygous (CC and TT) and heterozygous genotypes (CT) were easily
detected on 2% agarose gel (supplementary Figure 1B). Direct sequencing provided concordant
results in all cases, controls were included in all batches analyzed, and quality controls were
performed to verify the reproducibility of the results. Valid genotypic data were obtained for over
99% of subjects analyzed.
T-ARMS-PCR procedures were validated by analysis of DNA samples of 164 patients with
CHC followed at the Department of Internal Medicine, diagnosed between 2004-2008, whose DNA
samples and outcome of standard treatment with PEG-IFN/RBV were available (Table 1). Other
causes of liver disease were excluded, including excessive alcohol intake, HBsAg positivity, HIV
infection, autoimmune hepatitis, hereditary hemochromatosis and alpha1-antitrypsin deficiency.
Informed written consent was obtained from each subject included.
In conclusion, the present method allows rapid, reproducible, inexpensive, and accurate
detection of rs12979860 polymorphism without need of any special equipment, thus improving
the accessibility to SNP genotyping for all minimally equipped laboratories. The method is also
suitable for evaluation of a low number of samples on a routine basis, thereby allowing the
implementation of IL28B genotype evaluation in clinical practice.

References
1
Ge D, Fellay J, Thompson AJ, et al. Genetic variation in IL28B predicts hepatitis C
treatment-induced viral clearance. Nature. 2009; 461(7262):399-401.
2
Rauch A, Kutalik Z, Descombes P, et al. Genetic variation in IL28B is associated with
chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology.
2010; 138(4):1338-45, 45 e1-7.
3
Dellgren C, Gad HH, Hamming OJ, Melchjorsen J, Hartmann R. Human interferon-lambda3
is a potent member of the type III interferon family. Genes Immun. 2009; 10(2):125-31.
4
Thomas DL, Thio CL, Martin MP, et al. Genetic variation in IL28B and spontaneous
clearance of hepatitis C virus. Nature. 2009; 461(7265):798-801.
5
Thompson AJ, Muir AJ, Sulkowski MS, et al. IL28B Polymorphism Improves Viral
Kinetics and Is the Strongest Pre-treatment Predictor of SVR in HCV-1 Patients.
Gastroenterology. 2010.
6
Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA. The
amplification refractory mutation system (ARMS). Nucleic Acids Res. 1989; 17(7):2503-16.
7
Ye S, Dhillon S, Ke X, Collins AR, Day IN. An efficient procedure for genotyping single
nucleotide polymorphisms. Nucleic Acids Res. 2001; 29(17):E88-8.

Table 1. Clinical features of 164 patients with CHC and outcome of standard treatment with
PEG-IFN/RBV, accocding to rs12979860 genotype.

rs12979860 genotype

p-value

CC

TT or CT

Number

56 (34)

108 (56)

Age

54.314

53.012

ns

Sex

24 (43)

38 (34)

ns

BMI

25.14.5

25.23.3

ns

Diabetes

10 (18)

16 (15)

ns

SVR

38 (68)

53 (49)

0.03

SVR genotype 1

18/29 (62)

24/63 (38)

0.04

SVR cirrhosis

7/10 (70)

5/18 (28)

0.049

(): % values; SVR: sustained virological response; p-value: at Chi-square test; ns: not
significant.