Infect Dis Clin N Am 16 (2002) 377392

Diagnostic methods
Current best practices and guidelines
for identication of dicult-to-culture
pathogens in infective endocarditis
Pierre Houpikian, MDa, Didier Raoult, MD, PhDb,*
a

Unite des Rickettsies, CNRS-UPRES-A 6020 Faculte de Medecine de Marseille,

27 Boulevard Jean Moulin, 13385 Marseille Cedex, France
b
Unite des Rickettsies, Faculte de Medecine, 27 Boulevard Jean Moulin,
13006 Marseille, France

Because infective endocarditis (IE) frequently gives rise to continuous

bacteremia, an etiologic diagnosis is often easy to make by means of positive
blood cultures. This approach fails to identify an etiologic agent in from
2.5% to 31% of cases, however [1]; these are usually termed culturenegative cases. Administration of antibiotics before blood culture and
right-sided, mural, or prosthetic valve endocarditis account for many of
these cases, but slow-growing or fastidious organisms may also be responsible
for culture-negative IE [2].
Compared with culture-positive cases, the etiologic diagnosis of culturenegative IE is delayed, resulting in an increased risk of valve destruction,
septic emboli, and higher mortality. Moreover, Van Scoy et al. [3] showed
that 92% of patients whose fever resolved during the rst week of antibiotic therapy survived; only 50% of those who remained febrile for more
than a week survived. Rapid etiologic diagnosis leading to the correct choice
of a curative antibiotic treatment regimen is therefore crucial in this lifethreatening disease.
Traditional techniques such as histology, electron microscopy, and serology have been applied to identify dicult-to-culture agents of IE. Serology
is particularly important because it allows rapid identication of Coxiella
burnetii and Bartonella spp, both of which cause culture-negative endocarditis. Immunohistochemistry has signicantly enhanced the ability to detect

* Corresponding author.
E-mail address: Didier.Raoult@medecine.univ-mrs.fr (D. Raoult).
0891-5520/02/$ - see front matter
2002, Elsevier Science (USA). All rights reserved.
PII: S 0 8 9 1 - 5 5 2 0 ( 0 1 ) 0 0 0 1 0 - 1

378

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

microorganisms in heart valves. Growth-based diagnostic methods have

beneted from the development of new mediaespecially cell linesbut
also from the use of novel inoculation, incubation, and detection techniques
[4,5]. Finally, PCR-based molecular tools have considerably improved the
ability to detect and identify fastidious causative agents of IE, especially
in excised vegetations and infected valve tissues [6].

Morphologic methods
Histology
Proper histologic examination of the excised valve is critical. It can conrm the diagnosis of IE by demonstrating compatible tissue changes. Histologic parameters are included among the Duke diagnostic criteria for
endocarditis [7,8]. Moreover, direct visualization of organisms in valvular
sections can be a crucial element in diagnosis. It should be noted, however,
that such specimens are potentially infectious to the examiner; this is especially true for Q fever endocarditis because C. burnetii is a highly infectious
pathogen. Biosafety level 3 laboratories should therefore be used and only
experienced personnel should process valvular material [9]. The histologic
stains that are used to detect infectious agents in valvular biopsies are listed
in Table 1.
Among the standard stains, hematoxylin and eosin (H&E) can allow
recognition of a consistent pattern of inammation, but individual bacteria
are generally not detected with this stain. Nevertheless, examination of
H&E-stained tissue sections during the course of undiagnosed IE may lead
to hypotheses about the nature of the etiologic agent. The tissue Gram
stains allow the dierentiation of gram-positive (Brown-Brenn technique)
and gram-negative (Brown-Hopps technique) organisms and, in the hands
of a skilled observer, rapid preliminary identication of the organisms based

Table 1
Main histologic stains used for the diagnosis of infectious endocarditis
Tissue stain

Detected microorganism

Acridine orange
Giemsa
Tissue Gram
Brown-Hopps
Brown-Brenn
Periodic acid-Schi
Warthin-Starry
Ziehl-Nielsen
Gimenez
Kinyoun, Machiavello
Gomori-Grocott

Any bacterium
Any bacterium
Gram-positive bacteria
Gram-negative bacteria
Tropheryma whipplei, fungi
Bartonella spp
Acid-fast bacilli
Coxiella burnetii, Legionella spp
Chlamydia spp
Fungi

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

379

on their morphology [10]. Bacteria can be detected with this technique even
after prolonged prior antibiotic coverage, as shown by a recent report of two
cases of blood culture-negative endocarditiscaused by Staphylococcus
aureus and Streptococcus salivarius respectivelyin drug abusers [11]. In
one report, a case of endocarditis due to Clostridium perfringens was diagnosed by visualization of gram-positive bacilli on a blood smear [12]. Gram
stain has limitations, however, since the causative bacteria may lack a cell
wall, as in Mycoplasma species.
The periodic acid-Schi (PAS) stain is especially valuable for detection of
Tropheryma whipplei. In this infection, PAS demonstrates foamy histiocytes
surrounded by inltrates of mixed neutrophils, lymphocytes, and mononuclear cells [13]. The PAS stain may also be used to detect fungi. The Giemsa
stain allows not only the detection of some bacteria, including Bartonella spp,
but also stains white blood cells, thereby highlighting the inammatory inltrate in vegetations [10]. The Warthin-Starry technique, a silver impregnation
method, is among the most sensitive methods for detection of bacteria, even
those that stain weakly with a tissue Gram stain, such as Bartonella spp.
Using this method, numerous bacteria have been observed in the valvular tissue of patients with Bartonella endocarditis [14]. Finally, the acridine orange
stain is a non-specic uorescent diagnostic technique that can be used to
detect any living organism, including bacteria, yeasts, and molds in biopsies.
Specic stains also play an important role in establishing an etiological
diagnosis in culture-negative IE. The Ziehl-Nielsen stain is used for detecting acid-fast bacteria, namely mycobacteria. The Gimenez stain is a good
method for detecting C. burnetii and Legionella spp [10]. During Q fever
endocarditis vegetations are often inltrated with mononuclear leukocytes
lled with C. burnetii cells [15]. Among other stains that can be used occasionally, the Kinyoun stain or the Machiavello stain may show large macrophages containing dark red granules in Chlamydia endocarditis. Among the
various special stains for fungi, the Gomori-Grocotts methamine silver
stain provides the best contrast [10].
Immunohistologic testing
Many specic antibodies have been developed for immunochemical detection of pathogenic organisms in tissues. Samples can be tested fresh or after
formalin xation. Several techniques are available including immunoperoxidase stains, enzyme-linked immunosorbent (ELISA) or immunouorescent
(ELIFA) assays, and direct immunouorecence using uorescein-conjugated
monoclonal antibodies [15,16]. Direct immunouorecence using uoresceinconjugated monoclonal antibodies has also been employed for antigen detection in paran-embedded tissues [17]. Thus, C. burnetii has been visualized in
the valves of 10 of 14 culture-conrmed Q fever endocarditis patients [18].
This method has also been used for the detection of Bartonella spp and
T. whipplei in valvular biopsies [14,19]. In patients with suspected Chlamydia

380

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

endocarditis, direct identication of microorganisms by monoclonal antibody immunohistochemistry may help, but the sensitivity and specicity of
this technique has not yet been evaluated adequately [5].
Electron microscopy
Electron microscopy (EM) has signicant advantages derived from its
characteristics of high exibility and sensitivity. By resolving details many
hundreds of times smaller than can be seen with light microscopes, it can
identify taxonomically signicant features and help to characterize new
microorganisms [20]. Nevertheless, EM has limitations because it is expensive, tedious, time-consuming, and requires experienced sta. EM should
therefore be reserved only for those cases in which other techniques have
failed to detect a microorganism [9].

Serologic testing
C. burnetii and Bartonella spp appear to be the most common etiological
agents of culture-negative IE caused by fastidious or dicult-to-grow organisms. To date, about 400 cases of C. burnetii endocarditis have been reported,
as well as more than 100 cases of Bartonella endocarditis [21]. As reliable serologic tools are available for rapid identication of these two species, these
tests should be performed systematically when investigating culture-negative
IE. On the other hand, although serologic assays are also available for other
microorganisms implicated in IE, namely Mycoplasma, Legionella, Chlamydia, and Brucella species, cases of endocarditis due to these agents are now
very rare. As a result, positive serologic results should be interpreted
cautiously because of their low positive predictive value and frequent crossreactions [9]. All these serologic tests, however, are included as diagnostic
parameters for IE in the Duke criteria [7] and the modied Duke criteria [22].
C. burnetii serology
In the authors area (southern France), C. burnetii is the leading cause of
endocarditis in men younger than 65 years with a valvular prosthesis
(unpublished data). Q fever should therefore be considered in all patients
with culture-negative IE. This diagnosis can be conrmed easily by serologic
testing. The most reliable and commonly used methods are indirect immunouorescence (IFA), complement xation, and ELISA [23]. Only the rst
two methods are commercially available. Currently, the reference technique
is IFA. The microimmunouorescence test has the advantage of requiring
only small amounts of antigen. Both Phase I and Phase II C. burnetii Nine
Mile strain are used as antigens. Phase II antigen is obtained by growing
C. burnetii in a cell culture while Phase I antigen is obtained from the spleens
of infected mice. Antibodies to Phases I and II can be determined in the IgG,

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

381

IgM, and IgA fractions. Q fever endocarditis is characterized by a very high

titer of anti-Phase I antibodies; an IgG anti-Phase I antibody titer of
1:1600 is considered to be highly predictive and sensitive, with a 98% positive predictive value (Table 2), whereas anti-Phase I IgA and IgM titers do
not contribute usefully to diagnosis [24]. During acute Q fever the titer of
anti-Phase I IgG antibodies does not usually reach that level, which allows
a distinction to be made between chronic and acute infection. In these situations, a single serum sample is sucient for the diagnosis of Q fever endocarditis. Demonstration of the diagnostic signicance of an anti-Phase I IgG
titer of 1:1600 has led to the inclusion of this serologic parameter in the
Duke criteria for the diagnosis of IE as a major criterion [22]. Cross-reactions, however, may be a source of confusion when interpreting serological
results. These vary according the serological technique employed. They have
been described between C. burnetii and either Legionella [25] or Bartonella
species [26], but a dierential diagnosis is easily established when quantitative antibody titers against both anti-Phase I and anti-Phase II C. burnetii
antigens are determined.
Bartonella serology
Currently, both indirect IFA and ELISA are used in the diagnosis of Bartonella infection to detect specic antibodies. Using the microimmunouorescence assay, a titer of 1:1600 has a positive predictive value for Bartonella
endocarditis of 88% in the authors laboratory (see Table 2) [14]. The titer to
which antibodies are detected, however, appears to depend on the strain
used as the antigen and the method by which the antigen is prepared
[14,27]; even dierent batches of the same antigen preparation can yield different results [28]. This may be related to the high genetic and antigenic heterogeneity of Bartonella spp, as suggested by Drancourt et al. [27], who
characterized a new Bartonella henselae serogroup isolated from French
patients with endocarditis. Subsequently, the same authors showed that
Table 2
Serologic tests routinely used in the authors laboratory for the diagnosis of infectious
endocarditis
Microorganism

Serologic technique

Cut-o value

Coxiella burnetii
Bartonella spp
Mycoplasma pneumoniae

Indirect immunouorescence
Indirect immunouorescence
IgM enzyme immunoassay
Complement xation
Indirect immunouorescence
Indirect immunouorescence
Wrights serum agglutination
test
Card test

IgG to Phase I 1:1600

IgC 1:1600
Optical density > control
1:64
1:128
1:128
1:80

Chlamydia spp
Legionella pneumophila
Brucella melitensis

Qualitative result: positive

or negative

382

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

signicant reactivity was observed in 18 of 113 apparently negative serum

specimens when a strain of the new serogroup was incorporated as the antigen into a diagnostic IFA [27]. Moreover, the specicity of serologic tests for
the diagnosis of Bartonella-induced endocarditis has been questioned due to
cross-reactivity among the organisms. Current serological tests may not reliably distinguish between antibody responses to Bartonella quintana and
B. henselae [29], although antibody cross-absorption and Western immunoblotting allow dierentiation of the serological reponses to these two species
(unpublished data). Furthermore, cross-reactions may occur at a low level
with C. burnetii [26] and signicantly with Chlamydia spp [30]. Drancourt
et al. [29] reported that patients with B. quintana endocarditis had IgG titers
of >1:256 against Chlamydia pneumoniae and titers of 1:64 against Chlamydia trachomatis and Chlamydia psittaci. Absorption of the sera with C. pneumoniae did not reduce the high antibody titers against B. quintana, but
absorption with B. quintana eliminated reactivity with the C. pneumoniae
antigen. This cross-reactivity was conrmed using immunoblotting [29].
Other serologic tests
The serologic methods most commonly used for Chlamydia spp are complement xation, ELISA, or indirect IFA. In a series of ten patients reported
to have chlamydial endocarditis, however, eight were nally diagnosed with
Bartonella endocarditis after their sera were tested by cross-absorption procedures and Western immunoblotting [14]. This shows that serologic results
should be interpreted cautiously [30]. In patients with suspected Chlamydia
endocarditis, Bartonella spp should be excluded by careful serologic analysis,
including cross-absorption assays and attempts at isolation. Mycoplasma serologic testing is an immuno-enzymatic assay that needs further evaluation, as
does the indirect IFA used for Legionella pneumophila [21]. Although several
methods such as IFA, ELISA, and Western blot analysis have been developed to detect specic antibodies to Brucella spp, the tube agglutination test
is still the reference test. It can be used to make a presumptive diagnosis in the
absence of bacteriologic conrmation because most cases of active infection
will be associated with titers 1:160 [31]. The physician should be aware of
serologic cross-reactions that exist between Brucella, Yersinia, and Francisella
species which may lead to confusion in etiologic diagnosis [32]. The leading
serologic tests that the authors use to diagnose culture-negative endocarditis
and their interpretations are listed in Table 2.

Culture methods
Because several studies suggest that the number of bacteria per milliliter
of venous blood remains relatively constant during the course of many cases
of IE [33], culture of three sets of blood drawn within a 24- to 48-hour
period are normally sucient to establish a diagnosis of culture-positive

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

383

endocarditis, and, conversely, to indicate a possible diagnosis of culturenegative endocarditis [34]. Although endocarditis caused by anaerobes is
uncommon, blood cultures should be incubated in both aerobic and anaerobic atmospheres to detect organisms such as Bacteroides spp or Clostridium
spp, which can, rarely, infect the heart valves [12]. Because of the approximately linear relationship between the yield of bacteria from blood and the
volume of blood drawn, it has been recommend that at least 10 mL of blood
(preferably 20 mL in an adult) be obtained for each culture [35]. If a history
of prior antibiotic therapy has been elicited, neutralization or diminution of
the presence of the antibiotic in blood may be accomplished by diluting the
blood in broth in a ratio of 1:10 and by incorporating sodium polyanetholsulfonate, which inactivates aminoglycosides in the broth. Another approach
to improve the growth of bacteria from the blood of previously treated patients is to process the blood in the presence of an antimicrobial agent
removal device, usually cationic and polymeric adsorbent resins with
sodium polyanetholsulfonate [35]. If previous antibiotic therapy has not
been administered and the blood cultures are negative, fastidious organisms
should be suspected. Some of them, mainly the HACEK group bacteria,
grow on standard, routinely used media given sucient incubation time.
Others, mainly intracellular bacteria among which C. burnetii and Bartonella
spp are the most common, require special cultivation methods such as
growth in a tissue culture. For these species, culture of the resected valve
is particularly ecient, probably because of the large number of organisms
in the tissue; this method should be performed whenever possible.
To delineate the appropriate medium to be employed, the medical history, clinical examination, and echocardiographic ndings of patients can
be helpful because they may suggest a specic causative agent. Positive serologic test results for agents such as C. burnetii, Brucella spp, Legionella spp,
or Mycoplasma spp may also provide invaluable clues [21].
Extracellular (or facultative intracellular) fastidious bacteria
Some extracellular bacteria require an extended incubation time and are
therefore considered to be dicult to culture, even though they will grow in
conventional, automated blood culture systems. Thus, in one case of IE due
to Francisella tularensis, the organism was detected in blood only after 9
days of incubation [36]. For HACEK group bacteria, including Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, and Kingella spp, the
mean duration for incubation of blood cultures until detection of growth
is 3 to 5 days, although Actinobacillus actinomycetemcomitans may require
up to 30 days [37]. Most Haemophilus spp grow well on conventional chocolate agar, but all require either exogenous hemin (X factor) or NAD
(V factor) [38]. Abiotrophia species, formerly known as nutritionally decient streptococci, can be detected in routine blood cultures in 2 or 3 days,
but subcultures usually require supplementation of blood agar or broth with

384

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

pyridoxal hydrochloride or L-cysteine under an aerobic or anaerobic atmosphere. Alternatively, a coagulase-positive Staphylococcus strain can be used
as a helper to induce satellite growth [39]. For HACEK group bacteria as
well as Abiotrophia spp or Gemella spp, identication to the species level relies
mainly on biochemical properties, which can be tested with several commercially available systems [38,40]. Despite these phenotypic tools, denite identication of these species is sometimes dicult, and molecular techniques
using 16S rRNA gene amplication and sequencing may be useful [41,42].
Specic media are required for some species. For example, buered charcoal yeast extract (BCYE) is recommended for Legionella spp [1]. For Mycoplasma spp, inoculation should be made onto specic media such as SP4
glucose at pH 4.5, which can be used for both Mycoplasma pneumoniae and
Mycoplasma hominis provided that arginine is added for the latter organism
[21]. Although most Mycobacterium spp have been isolated in conventional
blood culture systems with a prolonged incubation, the use of Bactec 13A
bottles (Becton Dickinson, Sparks, MD) containing Middlebrook 7H13
broth (Coger, Paris, France) should be considered, especially for Mycobacterium tuberculosis [21,43,44]. Middlebrook solid culture medium and the
nonradiometric Bactec 9000MB system (Becton Dickinson, Sparks, MD)
have been shown to be equally eective in isolation of nontuberculous
mycobacteria from blood [45]. Similarly, although blood culture for Brucella
spp has been historically achieved on standard laboratory media with a
prolonged incubation, current practices include both lysis centrifugation
(Isolator; Merck-Clevenot, Nogent sun Marne, France) blood cultures and
the use of automated, continuous monitoring blood culture instrumentation
such as EPS, BacTec, or BacT/Alert (Becton Dickinson, Sparks, MD). These
systems may yield positive cultures in 4 to 10 days, but extended incubation
for four or more weeks may be needed, particularly in patients who have been
treated with antimicrobial agents. A shorter isolation time for Brucella spp
was obtained by the lysis concentration technique than using BacTec [46].
Q fever
C. burnetii may be isolated from heparinized blood in 53% of untreated
patients [47] and from resected valves even in antibiotic-treated patients
[48]. Since C. burnetii is a strict intracellular bacterium, a culture cannot
be obtained in an axenic medium. Isolation of C. burnetii in cell culture
should be restricted to laboratories equipped for isolation of dangerous
pathogens (biosafety level 3). A number of cell lines can be used, including
L929, Vero, and human embryonic lung broblasts (HEL cells) (Table 3). In
the authors laboratory HEL cells grown in shell vials are used routinely
because of their high susceptibility to C. burnetii infection and easy maintenance [4]. Cell monolayers in shell vials are inoculated with 200 lL of
leukocyte-rich plasma or a portion of the infected valve and centrifuged (700 g at 20C) for 1 hour to enhance attachment and penetration

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

385

Table 3
Cell lines used in the authors laboratory for cultivation if intracellular agents of infectious IE
Microorganisms

Cell line

Coxiella burnetii
Bartonella spp
Tropheryma whipplei
Chlamydia psittaci

Veroa, HELb, L929c

ECVd, HeLae, L929c
HELb, MRC 5f
L 929c

African green monkey cells.

Human embryonic lung broblasts.
c
Mouse broblasts.
d
Human endothelial cells.
e
Human cervix cells.
f
Human lung broblasts.
b

of C. burnetii into cells. After this step the remaining plasma is removed and
replaced with fresh culture medium, and the monolayers are incubated
at 37C in 5% CO2. Detection of growing bacteria is performed on days
3, 6, and 15. Microorganisms are revealed by acridine orange or Gimenez
staining, or by IFA with rabbit polyclonal antibodies or mouse monoclonal
antibodies [21]. PCR-based techniques are also used to detect C. burnetii
DNA within infected cultures in shell vial supernatants [47].
Bartonella species
For these facultative intracellular bacteria, the two most widely used
methods of culture are either direct plating onto solid media or co-cultivation in cell cultures [29]. Cell culture systems are reportedly more sensitive
and allow more rapid growth of Bartonella spp than the blood agar technique [49]. In a few cases, however, only the blood agar technique allowed
isolation of the bacteria. A combination of both methods is probably most
useful for optimizing recovery of Bartonella spp [29]. Moreover, with both
methods the sensitivity of culture was shown to be higher when performed
with valvular biopsy specimens than with peripheral blood samples; despite
previous antibiotic administration, the organism was recovered from valves
while blood cultures remained negative [49].
On blood-enriched agar, Bartonella spp are best cultivated in a humid,
5% CO2-enriched atmosphere [50]. Primary isolation from the blood of
infected patients may require up to 45 days of incubation before colonies
become apparent. Horse and rabbit blood are more eective supplements
than sheep blood [51]. The use of lysis centrifugation has been shown to
enhance the recovery of Bartonella spp from blood [52]. Detection of Bartonella in conventional automated blood culture systems remains dicult
because the organisms produce only a small amount of CO2, which fails
to trigger the alert system. Thus, both acridine orange and Gimenez staining
of the blood should be systematically performed if cultures remain negative
after three weeks [53]. Moreover, Bartonella spp can be grown in vitro in a

386

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

number of cell culture systems, including endothelial cells (ECV), L 929, and
HeLa cells (Table 3). Endothelial cell cultures are considered most eective
and have reportedly supported growth of Bartonella spp more eciently
[29]. After inoculation in shell vials as previously described, infected monolayers can be detected using acridine orange or Gimenez staining. Identication of cultured Bartonella at the species level can be achieved using IFA
with polyclonal rabbit antisera raised against type strains of each species.
Because cross-reactions can occur, use of a monoclonal antibody is preferable to clearly identify these species [30]. PCR-based dierentiation methods, determination of partial sequences of 16S rRNA or citrate synthase
encoding genes [50], and various PCR-RFLP analyses of the same genes
have proven useful in demonstrating intraspecies dierences [54].
Other obligate intracellular bacteria
The shell vial technique has been used successfully for isolation of
T. whipplei and Chlamydia psittaci, which have been implicated in rare cases
of IE [5,19]. The Whipples bacillus has been cultured using human broblast cell lines (HEL and MRC5) that are grown in minimal essential medium with 10% fetal calf serum and 2 mm L-glutamine without antibiotics.
By observing the ask monolayer under an inverted microscope, a cytopathic
eect could be observed at day 65 after inoculation; small, coarse, dark
inclusions and large, coarse, round structures were detected within cells. The
cultured bacterium can be identied by PCR and sequencing of 16S rRNA
[19]. In the only reported case involving isolation of C. psittaci in a patient
with IE, whole blood was collected in the absence of anticoagulant, the serum was removed, and the clot was liqueed in a vortex in the presence of
glass beads before the suspension was centrifuged to remove debris. The suspension was inoculated onto L929 cells in a shell vial and the organisms
were detected with a rabbit polyclonal antibody directed against C. psittaci
[5]. However, it is important to note that cross-reactions of Chlamydia spp
with Bartonella spp may preclude denitive identication. Monoclonal antibodies, cross-absorption of sera with Western immunoblots, and molecular
techniques such as PCR with hybridization (which is now commercially
available) should be used to clearly identify Chlamydia spp in patients with
endocarditis [21].

PCR amplication in clinical specimens

Broad-range PCR
Using universal primers that recognize highly conservative loci such as
the 16S rRNA encoding gene, species-specic sequences can be amplied
directly from diseased host tissues and compared with a referencesequence
database to identify the organism from which amplied DNA is derived [55].

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

387

Goldenberger et al. have shown that this technique is both easy and reliable
when applied to surgically removed heart valves from patients with IE [26].
Its main advantages are that it is culture independent and that almost all
bacteria can be detected in a single reaction [9]. Thus, T. whipplei, C. burnetii,
B. henselae, and B. quintana have been identied with broad-range PCR in
valvular biopsy specimens [14,18,56,57]. For C. burnetii and T. whipplei, this
technique has been used successfully in paran-embedded infected heart
valves [21,58]. Further, Bartonella vinsonii subspecies berkhoi has been
implicated as a new agent of IE in humans solely on the basis of 16S rDNA
amplication and sequencing [59].
Cases of culture-negative endocarditis resulting from intensive antibiotic
therapy are increasingly common and represent an excellent indication for
application of PCR in the clinical laboratory [11]. In some instances detection of bacterial DNA from resected valves using 16S rDNA amplication
and sequencing can help rectify the etiological diagnosis of endocarditis
when a second, concomitant septic event is responsible for positive blood
cultures with another organism [60]. A limitation of this system is the number and quality of DNA sequences available in databases, which are not
peer-reviewed [11]. Some of the reference sequences available in Genebank
and the EMBL databases are too short or contain too many undetermined
nucleotides for condent assignment of clinically derived sequences. The
microheterogeneity of amplied microbial sequences is therefore dicult
to interpret. Furthermore, some clinical materials, especially blood, may
contain substances that limit the sensitivity of PCR [9]. Microbial DNA
contamination can also occur, even after rigorous technical precautions are
taken; caution must therefore be exercised in the interpretation of PCRbased sequence analyses when the organism has not been observed in
stained valve tissues [55].
Species-specic PCR
Species-specic PCR can also be useful, especially when a particular diagnosis is already suspected. Thus, C. burnetii genes such as superoxide dismutase (Sod) and citrate synthetase (gltA) may be amplied. An open reading
frame encoding a polypeptide of 367 amino acids and located downstream
of the heat shock proteins genes (htpAB) has been recently identied, and
primers have been labeled to amplify this gene. This element exists in at least
19 copies in the genome of C. burnetii strain Nine Mile I, making the PCR
very sensitive [23,61]. For the diagnosis of Bartonella infections, eorts have
been focused on the 16S23S rRNA intergenic spacer region and the citrate
synthase gene in attempts to develop specic PCR-based assays [14,54,62].
An alternative approach based on PCR amplication of a heat-shock gene
fragment (groEL) has also been described and has exhibited greater sensitivity for detection of Bartonella spp [63]. A semi-nested PCR has recently
been designated to amplify the gene of a 31-kDa major protein (Pap31)

Primers

fD1
rP2

W3FE
W2RB

CB1
CB2

Trans1
Trans2

QHVE2
QHVE3
BE1
BE2

CSBAR240
CSBAR720

HSPps1
HSPps2
HSPps4

PAPn1
PAPn2
PAPns2

Gene coding for

16S rRNA

16S rRNA

Superoxide dismutase

HtpAB-associated
repetitive element

16S-23S intergenic
spacer region

Citrate synthase

60-kDa heat shock

protein

31-kDa major
protein

Any bacterium
Tropheryma whipplei
Coxiella burnetii
Coxiella burnetii
Bartonella spp

Bartonella spp
Bartonella spp

Bartonella henselae
Bartonella quintana

AGAGATACGCCCCCCGCAA
ATTCGCTCCACCTTGCGA

ACTCAACGCACTGGAACGGC
TAGCTGAAGCCAATTCGCC

TATGTATCCACCGTAGCCAGTC
CCCAACAACACCTCCTTATTC

TTGGGATCATCATCTGAA
GATATATTCAGACATGTT
ATCTCATTACGCTTATCAAA
TTTGATAAGCGTAATGAGAT

CTATCGACCAATTGGCTGAAA
TTTTGTTCGTGATCTGCATG

CAGAAGTTGAAGTGAAAGAAAA
GCNGCTTCTTCACCNGCATT
GCTGGNGGTGTTGCNGTTA

TTCTAGGAGTTGAAACCGAT
GAAACACCACCAGCAACATA
GCACCAGACCATTTTTCCTT

Detected
microorganisms

AGAGTTTGATCCTGGCTCAG
ACGGCTACCTTGTTACGACTT

Nucleotide sequence (53)

Table 4
Polymerase chain reaction primers used for amplication of bacterial DNA from valvular biopsy specimens

Semi-nested PCR; very high

sensitivity; useful for subtyping

Semi-nested PCR; high sensitivity;

useful for subtyping

Discriminant to the species level

Discriminant to the species level

Multicopy in the gene; high sensitivity

Lacks sensitivity

Universal

Comments

388
P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

389

associated with the bacteriophage harbored in B. henselae [64]. This highly

sensitive test is now used in the authors laboratory to detect B. henselae at
the sub-species level and B. quintana directly in clinical specimens (Z. Zeaiter,
unpublished data). Specic primers are currently available for most bacterial
genera including T. whipplei [65], Chlamydia spp [66], Brucella spp [67],
Legionella spp [68], Mycoplasma spp [69], and mycobacteria [70]. The PCR
primers that the authors use to amplify bacterial DNA [71] from valvular
biopsies are listed in Table 4.

Conclusion
IE is a serious, life-threatening disease. Because treatment must often be
adapted to the pathogen involved, rapid identication of the etiologic agent
is critical to successful management of each patient. When dicult-toculture pathogens are involved, routine microbiologic tests, including blood
culture, may remain negative. Because such cases may account for up to
31% of all IE cases, alternative diagnostic approaches are necessary. Among
the etiologic agents of culture-negative endocarditis, C. burnetii and Bartonella spp play a major role; each is responsible for up to 3% of episodes
of IE. The authors therefore recommend the systematic use of specic serologies in all cases of clinically suspected endocarditis. The cross-reactivity
between C. burnetii, Bartonella spp, and Chlamydia spp is of diagnostic
importance because all are potential etiologic agents of endocarditis. However, given that the levels of specic antibodies observed in Bartonella endocarditis are extremely high, low-level cross-reactions with other antigens
should not lead to misdiagnosis, provided serology for all suspected agents
is performed.
When serologic test results are negative for both Bartonella spp and
C. burnetii, special staining by the Gram, Giemsa, Gimenez, PAS,
Warthin-Starry, and Grocott methods may guide the use of new diagnostic
tools such as PCR and tissue culture for isolation and identication of the
causative agent. Such novel approaches may lead to more comprehensive
patient evaluations and the discovery of new etiologic agents of IE.

References
[1] Berbari EF, Cockerill FR, Steckelberg JM. Infective endocarditis due to unusual or
fastidious microorganisms. Mayo Clin Proc 1997;72(6):53242.
[2] Barnes PD, Crook DWM. Culture negative endocarditis. J Infect 1997;35:20913.
[3] Van Scoy RE. Culture negative endocarditis. Mayo Clin Proc 1982;57:14954.
[4] Raoult D, Vestris G, Enea M. Isolation of 16 strains of Coxiella burnetii from patients by
using sensitive centrifugation cell culture system and establishment of strains in HEL cells.
J Clin Microbiol 1990;28:24824.
[5] Shapiro DS, Kenney SC, Johnson M, et al. Brief report: Chlamydia psittaci endocarditis
diagnosed by blood culture. N Engl J Med 1992;326:11925.

390

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

[6] Fredericks DN, Relman DA. Sequence-based identication of microbial pathogens: a

reconsideration of Kochs postulates. Clin Microbiol Rev 1996;9:1833.
[7] Durack DT, Lukes AS, Bright DK. New criteria for diagnosis of infective endocarditis:
utilization of specic echocardiographic ndings. Am J Med 1994;96:20022.
[8] Li JS, Sexton DJ, Mick N, et al. Proposed modications to the Duke criteria for the
diagnosis of infective endocarditis. Clin Infect Dis 2000;30:6338.
[9] Fournier PE, Raoult D. Nonculture laboratory methods for the diagnosis of infectious
endocarditis. Curr Infect Dis Rep 1999;1:13641.
[10] Woods GL, Walker DH. Detection of infection or infectious agents by use of cytoogic and
histologic stains. Clin Microbiol Rev 1996;9:382404.
[11] Wilck MB, Wu Y, Howe JG, et al. Endocarditis caused by culture-negative organisms
visible by Brown and Brenn staining: utility of PCR and DNA sequencing for diagnosis.
J Clin Microbiol 2001;39(5):20257.
[12] Alvarez-Elcoro S, Sifuentes-Osorio J. Clostridium perfringens bacteremia in prosthetic valve
endocarditis. Diagnosis by peripheral blood smear. Arch Intern Med 1984;144:84950.
[13] Eck M, Kreipe H, Harmsen D. Invasion and destruction of mucosal plasma cells by
Tropheryma whipplei. Hum Pathol 1997;28:14248.
[14] Raoult D, Fournier PE, Drancourt M, et al. Diagnosis of 22 new cases of Bartonella
endocarditis. Ann Intern Med 1996;125:64652.
[15] Brouqui P, Dumler JS, Raoult D. Immunohistologic demonstration of Coxiella burnetii in
the valves of patients with Q fever endocarditis. Am J Med 1994;97:4518.
[16] Thiele D, Karo M, Krauss H. Monoclonal antibody based capture Elisa/Elifa for detection
of Coxiella burnetii in clinical specimens. Eur J Epidemiol 1992;8:56874.
[17] Raoult D, Laurent JC, Mutillod M. Monoclonal antibodies to Coxiella burnetii for
antigenic detection in cell cultures and in paran embedded tissues. Am J Clin Pathol
1994;101:31820.
[18] Stein A, Raoult D. Detection of Coxiella burnetii by DNA amplication using polylerase
chain reaction. J Clin Microbiol 1992;30:24626.
[19] Raoult D, Birg ML, La Scola B, et al. Cultivation of the bacillus of Whipples disease.
N Engl J Med 2000;342:6205.
[20] Curry A. Electron microscopy as a tool for identifying new pathogens. J Infect 2000;40:
10715.
[21] Brouqui P, Raoult D. Endocarditis due to rare and fastidious bacteria. Clin Microbiol Rev
2001;14(1):177207.
[22] Fournier PE, Casalta JP, Habib G, et al. Modication of the diagnostic criteria proposed
by the Duke Endocarditis Service to permit improved diagnosis of Q fever endocarditis.
Am J Med 1996;100:62933.
[23] Fournier PE, Marrie TJ, Raoult D. Diagnosis of Q fever. J Clin Microbiol 1998;36(7):182334.
[24] Tissot-Dupont H, Thirion X, Raoult D. Q fever serology: cuto determination for
microimmunouorescence. Clin Diag Lab Immunol 1994;1:18996.
[25] Musso D, Raoult D. Serological cross-reactions between Coxiella burnetii and Legionella
micdadei. Clin Diag Lab Immunol 1997;4:20812.
[26] La Scola B, Raoult D. Serological cross-reactions between Bartonella quintana, Bartonella
henselae, and Coxiella burnetii. J Clin Microbiol 1996;34:22704.
[27] Drancourt M, Birtles RJ, Chaumentin G, et al. New serotype of Bartonella henselae in
endocarditis and cat-scratch disease. Lancet 1996;347:4413.
[28] Amerein MP, De Briel D, Jaulhac B, et al. Diagnostic value of the indirect IFA in cat
scratch disease with Bartonella henselae and Apia felis antigens. Clin Diag Lab Immunol
1996;3:2004.
[29] Drancourt M, Mainardi JL, Brouqui P, et al. Bartonella (Rochalimaea) quintana
endocarditis in three homeless men. N Engl J Med 1995;332:41923.
[30] Maurin M, Eb F, Etienne J, et al. Serological cross-reactions between Bartonella and
Chlamydia species: implications for diagnosis. J Clin Microbiol 1997;35:22837.

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

391

[31] Young EJ. Serologic diagnosis of human brucellosis: analysis of 214 cases by agglutination
tests and review of the literature. Rev Infect Dis 1991;13:35972.
[32] Drancourt M, Brouqui P, Raoult D. Apia clevelandensis antibodies and cross-reactivity
with Brucella spp. and Yersinia enterocolitica O:9. Clin Diag Lab Immunol 1997;4:74852.
[33] Werner AS, Cobbs CG, Kaye D, et al. Studies on the bacteremia of bacterial endocarditis.
JAMA 1967;202:199203.
[34] Cannady PB, Sanford JP. Negative blood cultures in infective endocarditis: a review. South
Med J 1976;69:14204.
[35] Washington JA. The role of the microbiology laboratory in the diagnosis and antimicrobial
treatment of infective endocarditis. Mayo Clin Proc 1982;57:2232.
[36] Tancik CA, Dillaha JA. Francisella tularensis endocarditis. Clin Infect Dis 2000;30:399
400.
[37] Grand A, Laye JM, Etienne J, et al. Endocardite infectieuse a` Actinobacillus actinomycetemcomitans. Huit nouvelles observations. Arch Mal Coeur Vaiss 1994;87:17219.
[38] Campos JM. Haemophilus. In: Murray PR, Baron EJ, Pfaller MA, et al., editors. Manual
of clinical microbiology, 7th edition. Washington DC: ASM Press; 1999. p. 60411
[39] Bouvet A. Human endocarditis due to nutritionally variant streptococci: Streptococcus
adjacens and Streptococcus defectivus. Eur Heart J 1995;16(Suppl B):247.
[40] Mutters R. Actinobacillus, Capnocytophaga, Eikenella, Kingella, and other fastidious or
rarely encountered Gram-negative rods. In: Murray PR, Baron EJ, Pfaller MA, et al., editors.
Manual of clinical microbiology, 7th edition. Washington DC: ASM Press; 1999. p. 5619.
[41] Das I, DeGiovanni JV, Gray J. Endocarditis caused by Haemophilus parainuenzae
identied by 16S ribosomal RNA sequencing. J Clin Pathol 1997;50:724.
[42] La Scola B, Raoult D. Molecular identication of Gemella species from three patients with
endocarditis. J Clin Microbiol 1998;36:86671.
[43] Galil K, Thurer R, Glatter K, et al. Disseminated Mycobacterium chelonae infection
resulting in endocarditis. Clin Infect Dis 1996;23:13223.
[44] Singh M, Bonger A, Cave G, et al. Mycobacterium fortuitum endocarditis in a patient with
chronic renal failure on hemodialysis. Pathology 1992;24:197200.
[45] Jacomo V, Musso D, Gevaudan MJ, et al. Isolation of blood-borne Mycobacterium avium
by using the nonradioactive BACTEC 9000 MB system and comparison with a solidculture system. J Clin Microbiol 1998;36:37036.
[46] Navas E, Guerrero A, Cobo J, et al. Faster isolation of Brucella spp. from blood by isolator
copared with Bactec NR. Diag Microbiol Infect Dis 1993;16:7981.
[47] Musso D, Raoult D. Coxiella burnetii blood cultures from acute and chronic Q fever
patients. J Clin Microbiol 1995;33:312932.
[48] Muhlemann K, Matter L, Meyer B, et al. Isolation of Coxiella burnetii from heart valves of
patients treated for Q fever endocarditis. J Clin Microbiol 1995;33:42831.
[49] La Scola B, Raoult D. Culture of Bartonella quintana and Bartonella henselae from human
samples: a 5-year experience (1993 to 1998). J Clin Microbiol 1999;37:1899905.
[50] Regnery RL, Anderson BE, Clarridge JE, et al. Characterization of a novel Rochalimaea
species, R. henselae sp. nov., isolated from blood of a febrile, HIV-positive patient. J Clin
Microbiol 1992;30:26574.
[51] Maurin M, Birtles R, Raoult D. Current knowledge of Bartonella species. Eur J Clin
Microbiol Infect Dis 1997;16:487506.
[52] Slater LN, Welch DF, Hensel D, et al. A newly recognized fastidious gram-negative
pathogen as a cause of fever and bacteremia. N Engl J Med 1990;323:158793.
[53] Tierno PM, Inglima K, Parisi MT. Detection of Bartonella (Rochalimaea) henselae
bacteremia using BacT/Alert blood culture system. Am J Clin Pathol 1995;104:5306.
[54] Matar GM, Swaminathan B, Hunter SB, et al. PCR-RFLP analysis of a fragment of the
ribosomal operon from Rochalimaea species for subtyping. J Clin Microbiol 1993;31:
17304.
[55] Relman DA. The search for unrecognized pathogens. Science 1999;284:130810.

392

P. Houpikian, D. Raoult / Infect Dis Clin N Am 16 (2002) 377392

[56] Jalava J, Kotilainen P, Nikkari M, et al. Use of the PCR and DNA sequencing for
detection of Bartonella quintana in the aortic valve of a patient with culture-negative
infective endocarditis. Clin Infect Dis 1995;21:8916.
[57] Wendler D, Mendoza E, Schleier T, et al. Tropheryma whipplei endocarditis conrmed by
PCR. Eur Heart J 1995;16:4245.
[58] Stein A, Raoult D. A simple method for amplication of DNA from paran-embedded
tissues. Nucleic Acids Res 1992;20:52378.
[59] Roux V, Eykyn SJ, Wyllie S, et al. Bartonella vinsonii subsp. berkhoi as an agent of afebrile
blood culture-negative endocarditis in a human. J Clin Microbiol 2000;38(4):1698700.
[60] Gauduchon V, Benito Y, Celard M, et al. Molecular diagnosis of reccurent Streptococcus
mutans endocarditis by PCR amplication and sequencing. Clin Microbiol Infect 2001;7:367.
[61] Willems H, Thiele D, Frolich-Ritter R, et al. Detection of Coxiella burnetii in cows milk
using the polymerase chain reaction. J Vet Med B 1994;41:5807.
[62] Roux V, Raoult D. Inter- and intraspecies identication of Bartonella (Rochalimaea)
species. J Clin Microbiol 1995;33:15739.
[63] Anderson B, Sims K, Regnery R. Detection of the Rochalimaea henselae DNA in specimens
from cat-scratch disease patients by PCR. J Clin Microbiol 1994;32:9428.
[64] Bowers TJ, Sweger D, Jue D, et al. Isolation, sequencing and expression of the gene
encoding a major protein from the bakteriophage associated with Bartonella henselae. Gene
1998;206(1):4952.
[65] Ramzan NN, Loftus E, Burgart LJ, et al. Diagnosis and monitoring of Whipple disease by
PCR. Ann Intern Med 1997;126:5207.
[66] Meijer A, Kwakkel GJ, De Vries A, et al. Species identication of Chlamydia isolates by
analyzing restriction fragment length polymorphism of the 16S23S rRNA spacer region.
J Clin Microbiol 1997;35:117983.
[67] Morata P, Queipo-Ortuno MI, De Dios Colmenero J. Strategy for optimizing DNA
amplication in a peripheral blood PCR assay used for diagnosis of human brucellosis.
J Clin Microbiol 1998;36:24436.
[68] Jaulhac B, Reyrolle M, Sodahlon YK, et al. Comparison of sample preparation methods
for detection of Legionella pneumophila in culture-positive bronchoalveolar lavage uids by
PCR. J Clin Microbiol 1998;36:21202.
[69] Dorigo-Zetsma JW, Zaat SA, Wertheim-Van Dillen PME, et al. Comparison of PCR,
culture, and serological tests for diagnosis of Mycoplasma pneumoniae respiratory tract
infection. J Clin Microbiol 1998;36(7):182334.
[70] Ginesu F, Pirina P, Sechi LA, et al. Microbiological diagnosis of tuberculosis: a comparison of old and new methods. J Chemother 1998;10:295300.
[71] Goldenberger D, Kunzli A, Vogt P, et al. Molecular diagnosis of bacterial endocarditis by
broad-range PCR amplication and direct sequencing. J Clin Microbiol 1997;35:27339.