Вы находитесь на странице: 1из 6

1.

2.
3.
4.
5.
6.
7.

El gen del factor de transcripcin FOXC1Exhibe un papel limitado


en la Primariacongnito Glaucoma
Subhabrata Chakrabarti 1 ,
Kiranpreet Kaur 1 ,
Kollu Nageswara Rao 1 ,
Anil K. Mandal 2 ,
Inderjeet Kaur 1 ,
Rajul S. Parikh 2 y
Ravi Thomas 2 , 3, 4
+Afiliaciones de los autores
1.
1 Desde la Fundacin de Investigacin Ocular Hyderabad y el
2.
2 Hyderabad Eye Institute, LV Prasad Eye Institute, Hyderabad, India, el
3.
3 Eye Institute Queensland, Brisbane, Australia, y la
4.
4 Facultad de Ciencias de la Salud, Facultad de Medicina de la Universidad de Queensland, Brisbane, Australia
Siguiente seccin

Abstracto
PROPSITO. primaria congnita glaucoma (PCG)

es
un
trastorno
autosmico
recesivo
que
se
ha
relacionado
con CYP1B1 mutaciones. Este estudio se realiz para explorar el papel de FOXC1 , que est implicado en disgenesia del segmento
anterior, en PCG.
MTODOS. Un pruebas de deteccin antes de CYP1B1 en una cohorte clnicamente bien caracterizado PCG ( n = 301) revel casos que
eran homocigticos ( n = 73), heterocigoto compuesto ( n = 18), o heterocigtico ( n = 41) para el mutante alelo, mientras que el
resto ( n = 169) no albergar ninguna mutacin. Por lo tanto,FOXC1 se proyect en 210 casos de ACV que fueron ya sea heterocigota
( n = 41) o no albergar ninguna CYP1B1 mutacin ( n = 169), junto con tnicamente los sujetos de control normales ( n = 157) por
resequencing toda la regin de codificacin.
RESULTADOS. Dos heterocigotos missense (H128R y C135Y) y tres mutaciones de cambio de marco (g.1086delC, g.1155del9bp, y
g.1947dup25bp) se observaron enFOXC1 en 5 (2,38%) de 210 casos. Las mutaciones de sentido errneo tenan un origen de novo en
dos casos espordicos, mientras que los FOXC1 deleciones se observ en dos casos que tambin eran heterocigotos para
el CYP1B1 alelo (R368H). Los padres de los probandos con g.1086delC fueron heterocigotos para cualquiera de
los Foxc1 o CYP1B1 alelos. La madre afectada del probando con el g.1155del9bp era heterocigoto para ambos Foxc1 y CYP1B1 alelos,
el padre slo albergaba la FOXC1 alelo. Segregacin familiar de la g.1947dup25bp no se pudo realizar debido a la falta de
disponibilidad de ADN de uno de los padres. Excepto por la g.1155del9bp (0,95% cromosomas normales), todas las otras variaciones
estaban ausentes en los sujetos de control.
CONCLUSIONES. Este estudio indica un papel limitado de FOXC1 PCG en la patognesis.
Seccin anteriorSeccin siguiente

Introduccin
Primaria congnita glaucoma (PCG, OMIM 231300) es una enfermedad autosmica recesiva del ojo, causada por un defecto en el
desarrollo en la malla trabecular y el ngulo de la cmara anterior. Esta condicin lleva a la presin intraocular (PIO) elevada debido a
la obstruccin de la salida del humor acuoso y el dao resultante del nervio ptico, que si no se trata, resulta en ceguera
irreversible. 1 2 Los signos y sntomas de la PCG se observan generalmente en el nacimiento o en la infancia temprana. 3 La
prevalencia de PCG es muy alta entre las poblaciones endogmicas como la gitana de Eslovaquia (1:1250), 4 saudes (1:2500) 5 y los
habitantes indios de Andhra Pradesh (1:3300) 6 , es relativamente ms bajo en el oeste de poblaciones (1:20,000-1:10,000). 3
Heterogeneidad gentica es el sello distintivo de la PCG y tres loci cromosmicos en 2p21 ( GLC3A ; OMIM 231300 lnea Herencia
Mendeliana en el Hombre http://www.ncbi.nlm.nih.gov/Omim/ previsto en el dominio pblico por el Centro Nacional de Biotecnologa
Informacin, Bethesda, MD), 7 (1p36 GLC3B ; OMIM 600975), 8 y 14q24.3 ( GLC3C ; Stoilov IR, et al. IOVS 2002; 43: ARVO E-Abstract
3015) han sido mapeados por el anlisis de ligamiento, de los cuales slo laGLC3A locus que alberga el gen de citocromo P450
humano CYP1B1 (OMIM 601771) ha sido caracterizada. 9 CYP1B1 exhibe un alto grado de heterogeneidad allica, y ms de 70
mutaciones diferentes causales para PCG han sido identificados. 10 La proporcin de casos atribuibles a ACV CYP1B1 mutaciones
varan ampliamente entre la poblacin y son ms altas entre los gitanos eslovacos endogmica 4 y Arabia Saudita 5 poblaciones, que
presentan homogeneidad allica. La frecuencia de CYP1B1 mutaciones en otras poblaciones vara ampliamente de ~ 14% a 70% en
todo el mundo, y las mutaciones comunes estn fuertemente agrupadas en los fondos de haplotipos especficos, con independencia
de su ubicacin geogrfica, lo que indica un fuerte efecto fundador. 11 12
Anteriormente, se mostr que una pequea proporcin de casos PCG que no albergan CYP1B1 mutaciones muestran una mutacin
heterocigota en el gen miocilina ( MYOC ; OMIM 601652), que causa primaria de ngulo abiertoglaucoma . 13 dignica herencia del
mutante MYOC y CYP1B1 alelos Tambin se ha demostrado en inicio juvenil GPAA y CYP1B1 se ha sugerido que es un modificador
de MYOC expresin. 14
El F orkhead B buey C1 gen ( FOXC1 ; OMIM 601090) es un miembro de la hlice alada / forkhead familia de factores de transcripcin y
tiene una muy conservadas 110-amino-cido-dominio de unin a ADN, conocida como el dominio forkhead (FHD). Se encuentra en
6p25 y tiene un solo exn que codifica para una protena de 553 aminocidos. 15 La protena se expresa en FOXC1 ocular y tejidos no
oculares. 16 17 18 19 20 21 Se encuentra en las clulas del mesnquima periocular que dan lugar a estructuras de drenaje ocular tales
como el iris, la crnea y TM. 22Tanto el FOXC1 null ( Foxc1 - / - ) y los heterocigotos ( Foxc1 + / - ) ratones se encontr que tenan
anomalas del segmento anterior similares a los de los seres humanos con segmento anterior disgenesia (ASD)
y congnita glaucoma , como pequeo o ausencia del canal de Schlemm, aberrantemente desarrollado TM, hipoplasia del iris,
pupilas excntricas severamente, y la lnea de Schwalbe desplazada. 23
Adems, FOXC1 mutaciones han sido implicados en ASD, tales como iridogoniodysgenesis, Axenfeld-Rieger sndrome (ARS), y la
anomala de Peter de que el progreso de glaucoma en 50% a 75% de los casos afectados. 17 18 24 25Algunos de estos casos ASD son
asociado con congnita o de inicio tempranoglaucoma s, mientras que algunos tienen glaucoma secundario a anomalas del
segmento anterior. 15 18 25 Estos resultados indican un papel potencial del factor de transcripcin FOXC1 en el desarrollo de los tejidos
oculares, incluyendo las estructuras de drenaje. Pero, a lo mejor de nuestro conocimiento, ninguno de estos estudios incluyeron
clsicos casos de ACV que no estn asociados con anomalas del segmento anterior. Adems, puesto que ni CYP1B1 ni MYOC podra
explicar la contribucin gentica en general a PCG en estudios anteriores, 11 12 13se trat de cribar FOXC1 como un gen candidato en
una cohorte PCG de la India que eran heterocigotos para un mutante de CYP1B1 alelo o no albergaba ninguna mutacin.
Seccin anteriorSeccin siguiente

Mtodos
La seleccin de casos
El protocolo de estudio se adhirieron a las directrices de la Declaracin de Helsinki y fue aprobado por la Junta de Revisin
Institucional. Nuestra evaluacin en curso de CYP1B1 en una cohorte grande PCG clnicamente bien caracterizado y sin relacin ( n =
301) revel mutaciones en 132 (43,8%) casos. El grupo compuesto casos que o bien eran homocigotos ( n = 73), heterocigotos
compuesto ( n = 18), o heterocigotos ( n = 41) para el alelo mutante. Los casos restantes ( n = 169) no albergaba
ninguna CYP1B1 mutacin. Por lo tanto, se opt por defender FOXC1 en 210 casos de ACV que tenan tanto no ( n = 169) o uno ( n=
41) copia del mutante CYP1B1 alelo. tnicamente emparejado y no relacionadas voluntarios normales sin ningn signo o sntomas
de glaucoma ocular o otras enfermedades sistmicas o se inscribieron como sujetos de control ( n = 157). 11
El diagnstico clnico de los casos y los controles se bas en un examen completo de los ojos que incluy biomicroscopa con lmpara
de hendidura, tonometra de aplanacin, y gonioscopia (donde la claridad corneal permitido).Cada caso PCG tena al menos dos de las
siguientes caractersticas clnicas: aumento del dimetro corneal (> 12,0 mm) con una PIO elevada (> 21 mm Hg) y / o estras de
Haab, edema corneal / cicatriz, y los cambios de la papila ptica. El patrn de iris era normal con la configuracin del desarrollo en el
ngulo debido a la insercin anterior del iris; sntomas de epfora y fotofobia fueron corroborando caractersticas. El inicio en todos los
pacientes fue dentro de 0 a 1 ao de nacimiento. En especial, busc oculares y no oculares caractersticas que se consideran signos
diagnsticos de pesos en la cohorte de pacientes. Los pacientes que presentan caractersticas oculares, tales como embriotoxon
posterior (un prominente, desplazado anteriormente Schwalbe lnea), la adherencia de los filamentos del iris a la lnea de Schwalbe,
hipoplasia del iris, focal atrofia del iris con la formacin de agujeros, corectopia, o uveal ectropin, con resultados no oculares
incluyendo defectos en el desarrollo de los dientes y los huesos faciales, anomalas hipofisarias y cardiaca, albinismo oculocutneo y
piel periumbilical redundante fueron excluidos. No se observaron signos de secundaria glaucoma u otras caractersticas sistmicas en
estos pacientes.Todos los casos y los controles fueron evaluados de forma independiente y el diagnstico acordado por dos clnicos
basados en los criterios de inclusin-exclusin.
Los casos y controles fueron emparejados con respecto a su origen tnico y la regin geogrfica de su hbitat. Dos de las muestras de
sangre de 4 ml de los sujetos de prueba, junto con sus familiares afectados y normales (cuando estn disponibles) se obtuvieron por
puncin venosa con el consentimiento fundamentado previo.
Proyeccin de la FOXC1 Gene
El ADN genmico se extrajo de las muestras de sangre de acuerdo con protocolos estndar. 26 La regin codificante entera
de FOXC1 (Ensembl Gene ID: ENSG00000054598 / http://www.ensembl.org/ 27 ) se amplific con ocho conjuntos de cebadores de
superposicin como se describe en la Tabla 1 . Los primers fueron diseados utilizando el Web-based software Primer 3
((http://frodo.wi.mit.edu/ 28 ). Una reaccin de 25 l de PCR fue creado en un sistema de PCR GeneAmp 9700 (Applied Biosystems, Inc.
[ABI] Foster City, CA), utilizando de 50 a 100 ng de ADN genmico, 10 tampn de PCR, 200 mM de dNTPs, 5 a 12,5 picomoles de
cada cebador y 1 unidad de Taq polimerasa (Banglore Genei, Bangalore, India) . DMSO (10%) se aadi a la mezcla de reaccin
cuando sea necesario Los amplicones fueron purificados con PCR Clean-Up columnas (ultra limpia; Mo Laboratorios Bio, Carlsbad, CA).
y sometido a secuenciacin bidireccional en un secuenciador automtico de ADN (modelo 3100 ;. ABI), de acuerdo con las
instrucciones del fabricante Los datos fueron analizados con el software comercial (Sequencing Analysis) tambin por ABI.

Ver esta tabla:


En esta ventana

En una nueva ventana

T CAPACES DE 1.
Primer secuencias utilizadas para amplificar la FOXC1 regin codificante
Validacin de los resultados
Las variaciones observadas fueron confirmados por resequencing realizado por un investigador independiente que fue enmascarado
con el genotipo. Cuatro de los cinco variaciones tambin se confirmaron en los casos y controles por digestin de restriccin basada
en PCR de los amplicones durante la noche a 37 C, usando enzimas de restriccin apropiadas. Los digestos se fragmenta entonces
en geles de poliacrilamida no desnaturalizante y se visualizaron por tincin con bromuro de etidio.
Seccin anteriorSeccin siguiente

Resultados
Foxc1 Las mutaciones en el PCG
Cinco diferentes Foxc1 mutaciones se observaron en 5 (2,38%) de los 210 casos (95% intervalo de confianza [IC]: 1,02 a 5,45). Una
representacin esquemtica de la localizacin de estas mutaciones en FOXC1 se proporciona en la Figura 1 , y las caractersticas
clnicas detalladas de los pacientes con estas mutaciones se proporcionan en la Tabla 2 (los electroferogramas de todas las
mutaciones observadas se proporcionan en la figura complementario. S1, http :/ / www.iovs.org/cgi/content/full/50/1/75/DC1). Todas
las mutaciones eran nuevos y no se haba observado en los TEA. Las dos mutaciones de sentido errneo y la duplicacin 25-bp se
observ en tres casos espordicos, mientras que el 1 - y 9-bp supresiones estaban presentes en dos casos familiares que tambin
eran heterocigotos para un CYP1B1 mutacin.

Ver una versin ms grande:

En esta pgina

En una nueva ventana

F IGURA 1.
Una representacin esquemtica de la ubicacin de las mutaciones observadas en diferentes dominios de las regiones codificantes
(FOXC1 Ensembl 27 Identificacin de genes humanos: ENSG00000054598: AD-1: dominio de activacin -1; AD-2: activacin de
dominio-2; NLS-1: nuclear localizacin de la seal 1; NLS-2: seal de localizacin nuclear 2.

Ver esta tabla:


En esta ventana
En una nueva ventana

T CAPAZ 2.
Caractersticas clnicas de los pacientes con Foxc1 Las mutaciones en la Presentacin

Ms detalles sobre los observados FOXC1 mutaciones se presentan en las siguientes secciones.
His128Arg.
Un cambio de sentido errneo heterocigotos en la posicin g.1457 lugar a la sustitucin de histidina (CAC) por arginina (CGC) en el
codn 128 (H128R) en el FHD de FOXC1 en un caso espordico (PCG209). Los padres no afectados no albergaba el
mutante FOXC1 alelo y la mutacin en el caso ndice parece haber ocurrido de novo (Fig. Complementario. S2,
http://www.iovs.org/cgi/content/full/50/1/75/ DC1). El paciente tena bilateral manifestacin de la enfermedad desde su
nacimiento (Tabla 2) y, en comparacin con los pacientes en los otros casos, tuvieron una reduccin relativamente mejor de la PIO en
ambos ojos.
Cys135Tyr.
Otro cambio de heterocigotos en la FHD de FOXC1 se observ en g.2713 posicin que dieron lugar a la sustitucin de cistena (TGC)
por tirosina (TAC) en el codn 135 (C135Y) en un caso espordico (PCG216). Este cambio gener una ganancia de sitio de restriccin
para la Rsa I enzima. Similar a la familia PCG209, los padres no afectados no albergaba el mutante FOXC1 alelo, y la mutacin en los
probandos parece haber ocurrido de novo (Fig. suplementaria. S3, http://www.iovs.org/cgi/content/full / 50/1/75/DC1). El proband tena
bilateral manifestacin de la enfermedad desde su nacimiento (Tabla 2) y tuvo un mal resultado quirrgico con las OIA, de 28 y 34 mm
Hg en los ojos derecho e izquierdo, respectivamente.
g.1086delC.
Una delecin heterocigtica de una sola base (C) en la posicin g.1086 result en un cambio de marco en el cuarto aminocido que
condujo a una terminacin prematura en el cido amino 43a en el dominio de activacin (AD) -1 de FOXC1 en un consanguneo PCG
familia (PCG100). Este cambio dio como resultado la prdida del sitio de restriccin para la Pau enzima I y cosegregaron en un
probando que tambin era heterocigoto para una CYP1B1 mutacin (R368H). Su padre y dos hermanos afectados eran heterocigotos
para el CYP1B1 alelo, mientras que su madre albergaba el heterocigoto FOXC1 alelo (Fig. 2) . Tena atrofia ptica que lleva a slo
percepcin de luz en la proyeccin inexacta, as como la parlisis del oblicuo superior del ojo derecho y el ojo izquierdo result ser
normal. Ella no manifiestan ninguna otra mutacin en MYOC o CYP1B1 . El proband tena bilateral manifestacin de la enfermedad
desde su nacimiento, con PIO elevada y slo percepcin de luz con proyeccin inexacta en ambos ojos (Tabla 2) . En la actualidad, su
ojo derecho tena una agudeza visual de 20/60 y la PIO de 16 mm Hg.

Ver una versin ms grande:

En esta pgina

En una nueva ventana

F IGURA 2.
La segregacin de Foxc1 yCYP1B1 mutaciones en familia PCG100. El pedigr detallada de PCG100 ( A ) indica el genotipo de los
individuos por debajo de sus smbolos en las FOXC1 yCYP1B1 loci. El ADN de los abuelos maternos de los probandos (III: 3 y III: 4) no
estaba disponible para el anlisis. ( B ) La segregacin de la FOXC1 alelo basada en una digestin de restriccin basada en PCR en un
gel de poliacrilamida al 9% no desnaturalizante. La mutacin g.1086delC aboli un sitio de restriccin para Pau I que result en la
generacin de tres fragmentos (428, 328, y pb 100) en el probando (V: 2) y su madre (IV: 2) que eran heterocigotos para esta
mutacin. El amplicn escinde en dos fragmentos (328 y 100 pb) en los de tipo salvaje (wt) en el padre (IV: 1) y dos hermanos (V 1 y
V: 3) de los probandos y (en un control normal sin relacin C ). El patrn de segregacin de la mutacin heterocigota Arg368His que
aboli un sitio de restriccin para la Taa I enzima en el probando, su padre y hermanos no afectados fueron descritos como
antes. 13 M, 100-pb escalera del ADN (GeneRuler; MBI Fermentas, Vilnius, Lituania ).
g.1155delCGCGGCGGC.
En otra familia consangunea PCG (PCG196), una delecin heterocigota de una pb 9 (CGCGGCGGC) en la posicin g.1155 dio lugar a
un cambio de marco en el aminocido 28 y condujo a la eliminacin de los residuos de alanina en el dominio AD-1 de FOXC1. Este
cambio dio como resultado la prdida del sitio de restriccin para la No enzima I y se observ en el probando que tambin era
heterocigoto para un mutante de CYP1B1 alelo (R368H). Sus padres no afectados y una hermana tambin albergaba el
heterocigoto FOXC1 alelo (Fig. 3) . Adems, la madre era heterocigtico para el CYP1B1 alelo (R368H), similar a la proband, pero no
manifiestan signos de glaucoma o de otro ocular o enfermedades sistmicas.El cambio g.1155del9bp tambin se observ en 0,95%
(3/314) cromosomas normales. El caso ndice tuvo una manifestacin unilateral de la enfermedad en el ojo derecho desde su
nacimiento (Tabla 2) y tenan una agudeza visual de no percepcin de luz y ninguna reduccin de la PIO.

Ver una versin ms grande:

En esta pgina

En una nueva ventana

F IGURA 3.
La segregacin de FOXC1 yCYP1B1 mutaciones en PCG196 familia. El pedigr detallada de PCG196 familia ( A ) indica el genotipo de
los individuos por debajo de sus smbolos en lasFOXC1 y CYP1B1 loci. El ADN de los abuelos maternos del probando (II: 2 y II: 3) y su
sib afectados (IV: 3) no estaban disponibles para el anlisis. ( B) Muestra la segregacin de laFOXC1 alelo basada en una digestin de
restriccin basada en PCR en un gel de poliacrilamida al 9% no desnaturalizante. La mutacin g.1155del9bp aboli un sitio para la No I
enzima y gener tres fragmentos de 428, 249, y 179 pb en el probando (IV: 2), sus padres no afectados (II: 1 y III: 1), y un sib (IV: 1)
que eran heterocigotos para la mutacin. El amplicn se escinde para dos fragmentos (249 y 179 pb) en el. Tipo salvaje (wt) en un
control no relacionado normal (C) El patrn de segregacin de la mutacin heterocigota Arg368His que aboli un sitio de restriccin
para Taaenzima que en los sujetos de prueba y su madre fueron descritos como anteriormente 13 ( C ). M, 100 pares de bases de ADN
escalera (GeneRuler; MBI Fermentas, Vilnius, Lituania).
g.1927dupTCAGCCTGGACGGTGCGGATTCCGC.
Una duplicacin heterocigtica de 25 pb (TCAGCCTGGACGGTGCGGATTCCGC) en la posicin g.1927 result en un cambio de marco en
el cido amino 291a que conduce a la terminacin prematura despus de los cidos aminados en la 313 dominio inhibitorio de
FOXC1 en un caso espordico PCG (PCG044). La cosegregacin de la mutacin en esta familia no pudieron ser analizados, como una
muestra de ADN de la madre del proband no estaba disponible para anlisis;. Su padre no albergaba el alelo mutante (Fig.
Suplementaria S4, http://www.iovs.org/ cgi/content/full/50/1/75/DC1). El proband tena bilateral manifestacin de la enfermedad desde
1 mes de edad (Tabla 2) . La agudeza visual ltima fue 20/20 en ambos ojos con PIO de 12 mm Hg y 10 en los ojos derecho e
izquierdo, respectivamente.
Excepto por g.1155del9bp, ninguno de los FOXC1 mutaciones se observaron en los 157 sujetos de control no afectados. Mltiples
secuencia alineacin indica que los residuos de tipo salvaje de los cambios missense (His128Arg y Cys135Tyr) fueron altamente
conservadas entre las diferentes familias de FOX en diferentes especies (Fig. 4) . Tanto las mutaciones missense pareca haberse
originado de novo y estuvieron ausentes en los padres de los probandos en los PCG209 y PCG216 familias. La posibilidad de la
paternidad en disputa se descart mediante el cribado de los padres y de los probandos de estas dos familias con 48 marcadores
microsatlites seleccionados al azar a partir de ocho cromosomas.Estas compuesto dinucleotide marcadores altamente polimrficos se
repiten del Genethon vinculacin mapa (www.genethon.fr, siempre en el dominio pblico de la Asociacin Francesa contra las
Miopatas, Evry, Francia), que fueron seleccionados desde el panel de Vinculacin ABI MD-10 y el genotipo como por el protocolo del
fabricante (ABI). Todos los marcadores mostraron una segregacin mendeliana perfecto en estas dos familias (datos no mostrados).

Ver una versin ms grande:

En esta pgina

En una nueva ventana

F IGURA 4.
Alineacin de secuencias mltiples de protenas FOX diferentes a travs de los seres humanos y otras especies indica un alto grado de
conservacin en las H128 y C135 residuos.
Foxc1 polimorfismos en PCG
Dos polimorfismos que conducen a una insercin de una copia de "GGC" en las posiciones g.2197 (GGC375ins) y g.2413 (GGC447ins)
en los dominios de activacin y segundo reportado en estudios anteriores 29 30 se observaron entre los casos y los controles. En el
polimorfismo GGC375ins, haba una insercin de una repeticin adicional GGC (GGC 7 ) del alelo de tipo salvaje (GGC 6 ), y en los
GGC475ins polimorfismo segundo, hubo una adicin de GGC (GGC 8 ) de la silvestre Tipo (GGC 7 ) alelos. No hubo diferencias en la
distribucin de frecuencias de genotipo para estos dos polimorfismos travs de los casos de ACV y controles (Tabla 3) . Tambin
haplotipos generado con estas dos variantes en los casos y controles y sus frecuencias estimadas se proporcionan en la Tabla 4 .No
hubo asociacin significativa de cualquiera de los cuatro haplotipos con PCG.
Ver esta tabla:

En esta ventana
En una nueva ventana

T CAPAZ 3.
Distribucin de los genotipos y los odds ratios para los dosFoxc1 Polimorfismos en los casos de ACV y los sujetos control

Ver esta tabla:


En esta ventana
En una nueva ventana

T CAPAZ 4.
Las frecuencias de haplotipos estimados para los dos FOXC1SNPs entre los casos de ACV y los sujetos control
Seccin anteriorSeccin siguiente

Discusin
El FOXC1 gen ha sido implicado en ASD, particularmente en ARS en todo el mundo, y un amplio espectro de mutaciones se han
reportado en mltiples estudios. 29 30 31 32 33 34 Algunos de estos estudios demostraron la implicacin de FOXC1 en unos pocos casos
de congnita o
principios
-aparicin glaucomaasociado
con
ASD
y
/
o
otros
enfermedades
oculares
y
no
oculares. quincedieciocho veinticinco 29 treinta treinta y uno 32 33 34 FOXC1 null ( Foxc1 - / - ) y ratones heterocigotos ( Foxc1 + / - ) ratones
(de ciertos antecedentes genticos) exhiben malformaciones en el segmento anterior de diversos grados de gravedad. Estas
malformaciones tambin dar lugar a anomalas en las estructuras de drenaje ocular. 23 A pesar de estas indicaciones, FOXC1 ha sido
poco explorado como un gen candidato en los casos de PCG clsico. A lo mejor de nuestro conocimiento, este es quizs el primer
estudio que reporta la participacin de FOXC1 en gran cohorte de PCG ( n = 210) de los casos.
La frecuencia de FOXC1 mutaciones en la cohorte PCG presente y en estudios anteriores sobre el Ars se proporciona en la Tabla
5 . Aunque la proporcin deFoxc1 mutaciones en el presente estudio es menor que en ARS, 29 30 31 32 33 34algunas nuevas
mutaciones se identificaron en el PCG. En un estudio anterior que proyect FOXC1 en un pequeo nmero de casos de ACV ( n = 6)
por un solo captulo conformacin polimorfismo (SSCP) no se identific ninguna mutacin (95% CI, 0-39,0). 15 Esta incapacidad podra
ser atribuible a la baja tasa de deteccin de mutaciones por SSCP. 35 Aparte de las mutaciones, los dos FOXC1GGC375ins
polimorfismos y GGC447ins estaban presentes en frecuencias casi iguales entre los casos de ACV y controles (Tabla 3) similares a
estudios anteriores sobre ARS. 29 30

Ver esta tabla:


En esta ventana

En una nueva ventana

T CAPACES 5.
Distribucin de Foxc1mutaciones en ARS y otrosGlaucoma Fenotipos en el mundo
El espectro general de Foxc1 mutaciones en todo el mundo indica una fuerte asociacin con TEA en particular con ARS (Tabla
6) . Antes de este estudio, ~ 37 se identificaron mutaciones en FOXC1 , destacando an ms su heterogeneidad
allica. 15 29 30 31 32 33 34 36 37 38 39 40 41 42 43 44 La mayora (26; 70,3%) de estas mutaciones se localizaron en el FHD . Once
mutaciones result en marco desplaza conduce al truncamiento de la protena. Los pacientes portadores de estas mutaciones
presentaron caractersticas similares a ARS oculares, algunos de ellos tambin se manifiesta ciertas caractersticas no oculares (Tabla
6) .

Ver esta tabla:


En esta ventana

En una nueva ventana

T CAPACES 6.
El espectro de Foxc1mutaciones identificadas en diferentes fenotipos de segmentos en el mundo Anteriores
Los cinco casos PCG que albergaba el mutante FOXC1 alelo ni manifiesta signos oculares sugestivos de anomalas del segmento
anterior (Fig. 5) ni tena caractersticas de extraoculares otros (Tabla 6) . Tambin se analiz una cohorte de pacientes con ARS ( n =
28), a quienes se diagnostica basndose en los criterios de inclusin descritos anteriormente, 32 para estos cinco asociados
PCG- Foxc1 mutaciones. Ninguno de los pacientes con ARS albergaba cualquiera de estas mutaciones (95% CI, 0-12,1). Ya sea que
estas mutaciones son especficas de PCG, necesita una evaluacin adicional en cohortes ACV grandes y extensas de diferentes
orgenes tnicos.

Ver una versin ms grande:

En esta pgina

En una nueva ventana

F IGURA 5.
Izquierda : fotografa clnica del ojo derecho de un paciente con PCG (familia PCG100) con elFOXC1 . g.1086delC mutacin, que
muestra el patrn de iris posquirrgica Derecha : vista ampliada del mismo ojo mostrando las ubicaciones de iridectomas quirrgicos
realizados en mltiples ocasiones. Paquimetra en este ojo revel un espesor corneal central de 540 m.
Se ha demostrado a travs de experimentos in vitro que FOXC1 funcionalmente interacta con otro factor de transcripcin PITX2 en
una va bioqumica comn y que PITX2 regula FOXC1 dosis de genes que puede ser la base fenotipos ASD. 45En base a esto, es
tentador especular que FOXC1 cambios de dosificacin gnica tambin puede contribuir a la patognesis PCG a travs de algunos
mecanismos comunes.
Una perfecta correlacin genotipo-fenotipo no se pudo establecer, ya que las manifestaciones clnicas entre los pacientes con GCP
albergar Foxc1 mutaciones no fueron significativamente diferentes de los que no los protegen. En comparacin con nuestros estudios

anteriores de pacientes con PCG que albergaba CYP1B1 mutaciones, 11 no se observan grandes diferencias en la severidad de la
enfermedad y la progresin entre los pacientes que manifestaronFoxc1 mutaciones en la cohorte actual. Con base en una extensa
correlacin genotipo-fenotipo, se sugiri que los pacientes con ARS con FOXC1 mutaciones tuvieron una incidencia relativamente baja
de glaucoma de desarrollo que aquellos con duplicaciones en la FOXC1 gen. 18 25 Aunque esta distincin no se observ en el
presente estudio, todos los pacientes con Foxc1 mutaciones tenan PCG clsico con un fenotipo grave de la elevacin de la PIO y
megalocrnea en la presentacin (Tabla 2) .
La participacin de FOXC1 en casos PCG disociados de CYP1B1 solos en la presente cohorte (2,4%) fue relativamente menor en
comparacin con nuestro estudio anterior en esta categora en MYOC (5,5%). Aunque nuestra cohorte de pacientes antes tena un
tamao de muestra pequeo ( n = 72), la frecuencia de mutacin de MYOC en PCG era casi similar a la frecuencia global de GPAA. 13
Habamos demostrado tambin una de las posibles interacciones dignicos MYOCy CYP1B1 en PCG 13 similar a la observada en los
juveniles de ngulo abiertoglaucoma . 14 Una situacin similar se observ en la cohorte actual con respecto a la presencia de dobles
heterocigotos en FOXC1 y CYP1B1 en la probando de una familia consangunea PCG100. Sus padres eran heterocigotos para
cualquiera de los alelos mutantes, sus hermanos no afectados tambin albergaba la R368H ( CYP1B1 ) alelo y no manifest ningn
signo de glaucoma (Fig. 2) . La asociacin de los heterocigotos FOXC1 alelo (g.1086delC) con atrofia ptica en su madre requiere ms
investigacin. Del mismo modo, el probando de la familia consangunea otro (PCG196) fue el doble heterocigoto para ambos
el FOXC1 yCYP1B1 alelo, similar a su madre no afectada (Fig. 3) . Su padre y su hermano no afectado tambin se manifiesta el
heterocigoto FOXC1 alelo (g.1155del9bp).Aunque el CYP1B1 alelo (R368H) no se observ entre los 157 controles no afectados,
la FOXC1 alelo se encontr en 0,95% de los cromosomas de control.As, una herencia dignica claro de FOXC1 y CYP1B1 no se puede
establecer en estos casos ACV a diferencia de nuestro estudio anterior sobre MYOC . 13
En todo el mundo Mltiples estudios han ARS asociada, un trastorno dominante autosmico, con un solo alelo mutante
de FOXC1 . 15 29 30 31 32 33 34 35 36 37 3839 40 41 42 43 44 Ya sea un heterocigoto FOXC1 mutacin es suficiente para causar PCG
autosmico recesivo ( como se observ en el presente estudio) es especulativo. Sin embargo, tales especulaciones pueden abordarse
slo cuando haya ms datos sobre FOXC1 mutaciones de cohortes PCG diversas estn disponibles en todo el mundo, seguido por la
caracterizacin funcional de la protena mutante.
En resumen, el presente estudio proporciona una visin general de la participacin de FOXC1 en una cohorte PCG grande que es, ya
sea parcial (heterocigoto) o completamente disociados de CYP1B1 . Cinco nuevas mutaciones se observaron en PCG aumentando as
el espectro de mutacin total de FOXC1 .La participacin de las variantes dobles heterocigotos Foxc1 y CYP1B1 en dos casos era
interesante, pero su papel en la etiologa de la enfermedad an no se ha establecido. Por ltimo, nuestros datos indican un papel
limitado de FOXC1 en GCP sugiere que otros loci causales, que son todava no caracterizados en la patognesis de la enfermedad.