Вы находитесь на странице: 1из 23

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Tabla de contenido
Medio de cultivo Luria Bertani (LB) slido y lquido..................................................3
Consideraciones.................................................................................................... 3
Preparacin........................................................................................................... 3
Medio de cultivo Lactosa-extracto de Levadura-Agar (LLA) solido...........................5
Consideraciones.................................................................................................... 5
Preparacin........................................................................................................... 5
Crecimiento de Agrobacterium tumefaciens y Escherichia coli en medio de cultivo
Luria Bertani (LB) slido........................................................................................... 6
Consideraciones.................................................................................................... 6
Precauciones......................................................................................................... 6
Siembra................................................................................................................. 6
Crecimiento de Agrobacterium tumefaciens y Escherichia coli en medio de cultivo
Luria Bertani (LB) lquido........................................................................................ 11
Consideraciones.................................................................................................. 11
Precauciones....................................................................................................... 11
Siembra............................................................................................................... 11
Preparacin de stocks de glicerol de Agrobacteruim tumefaciens o Escherichia coli
............................................................................................................................... 13
Consideraciones.................................................................................................. 13
Procedimiento..................................................................................................... 13
Prueba de cetolactosa para Agrobacterium tumefaciens.......................................14
Consideraciones.................................................................................................. 14
Procedimiento..................................................................................................... 14
Solucin de Benedict........................................................................................... 15
Lisis de bacterias en cultivo................................................................................... 16
Consideraciones.................................................................................................. 16
Procedimiento..................................................................................................... 16
Extraccin de ADN plasmdico de Agrobacterium tumefaciens..............................17
Consideraciones.................................................................................................. 17
Procedimiento..................................................................................................... 17
Preparacin de soluciones...................................................................................18
Solucin 1........................................................................................................ 18
Solucin 2........................................................................................................ 18
Solucin 3........................................................................................................ 18
1

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Solucin 4........................................................................................................ 19
HCl 1N.............................................................................................................. 19
Amplificacin mediante reaccin en cadena de la polimerasa en punto final........20
Consideraciones.................................................................................................. 20
Procedimiento..................................................................................................... 20
ANEXO 1................................................................................................................. 22

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Medio de cultivo Luria Bertani (LB) slido y


lquido
(Basado en Sambrook y Rusell, 2001)

Consideraciones
La nica diferencia entre el medio de cultivo LB solido y liquido es que el primero
contiene agar mientras que el segundo no.

Preparacin
1) En un vaso de precipitado del doble de volumen de la cantidad total de
medio a preparar, agregar los reactivos ya pesados excepto el agar o agar
bacteriolgico (Tabla 1). Aforar con ddH 2O al volumen total del medio a
preparar, y homogeneizar los reactivos mediante un agitador magntico
sobre una plancha de agitacin.
2) Ajustar el pH a 7.5 con NaOH (J.T. Baker, 3722-01) 1M.
3) Vaciar el medio a un matraz del doble de volumen de la cantidad total de
medio a preparar y agregar el agar o agar bacteriolgico (BD Bioxon,
BD215000), en este momento si as se requiere. Cubrir la boca del matraz
con papel aluminio que cubra hasta el cuello, y se sella con un par de
vueltas de cinta plstica.
4) Colocar cinta testigo y esterilizar en autoclave 15 min a 121 C y 15 psi.
5) Para agregarle antibitico al medio dejar enfriarlo dentro de una campana
de flujo laminar debidamente limpia (ver protocolo referido). Cuando la
temperatura del medio pueda ser soportada con la mano, agregar el
antibitico requerido (ver Tabla 2) flameando la boca del recipiente con
medio LB y la tapa antes y despus de agregarle el antibitico. Mezclar de
forma circular el liquido contenido en el matraz con ayuda de la la mano.
NOTA: Si el medio se va a utilizar en ese momento, agregar antibitico,
pero si se va a almacenar por un periodo mayor de 15 das, se recomienda
guardar el medio sin antibitico.
6) Para el caso de medio LB slido, vaciar en cajas Petri bajas (90 x 15 mm)
(Phoen, 01118) llenndolas hasta la mitad de la altura de la caja sin que se
formen burbujas en el medio. Una vez solidificado el medio, las cajas Petri
se etiquetan debidamente (medio de cultivo, fecha de preparacin, nombre
de quien prepar). Estas cajas Petri pueden ser usadas inmediatamente o se
pueden almacenar a 4C por un periodo de 30 das (si el medio tiene
antibitico) a 60 das (si el medio no tiene antibitico). Sellar las cajas con
dos vueltas de cinta plstica y guardarlas dentro de una bolsa de plstico.
Para el caso de medio LB lquido, almacenarlo a 4C por un periodo de 30
das (si el medio tiene antibitico) a 60 das (si el medio no tiene
antibitico). Vaciar a tubos o matraces justo antes de utilizarlos. Notese que
el vaciado deber ser dentro de una campana de flujo laminar

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

TABLA 1. MEDIO LB
Reactivo
LB Broth (Sigma, L3022)
Agar (Sigma, A7002) o Agar
bacteriolgico
(BD
Bioxon,
BD215000)

Cantidad total de medio a preparar


100 mL
200 mL
500 mL
1000 mL
2g
4g
10 g
20 g
1.5 g
3g
7.5 g
15 g

Nota: En caso de no contar con el medio ya preparado de fbrica, pesar las


siguientes cantidades de reactivos de acuerdo a la cantidad total de medio a
preparar:
Reactivo
Triptona de casena o Bacto
triptona
Extracto de levadura (USB, 23547)
NaCl (Sigma, S7653)
Agar (Sigma, A7002) o Agar
bacteriolgico
(BD
Bioxon,
BD215000)

Cantidad total de medio a preparar


100 mL
200 mL
500 mL
1000 mL
1g
2g
5g
10 g
0.5 g
1g
1.5 g

1g
2g
3g

2.5 g
5g
7.5 g

5g
10 g
15 g

TABLA 2. ANTIBIOTICOS USADOS POR CEPA-CONSTRUCCIN PARA EL


CRECIMIENTO DE COLONIAS BACTERIANAS.
Construccin

Plsmid
o

35s-AVP1D-bar
35s-AVP1-bar
35s-AVP1-nptII

pRG523
pRG522
pRG229

35s-AVP1D-nptII

pRG391

35s-tps1-tps2nptII
rd29a-tps1-tps2nptII
35s-pdf1.2-nptII

pBIN19

Antibitico y cantidad
recomendados
(mg/L)
Kanamicina (Sigma, K1876) 100 mg
Kanamicina (Sigma, K1876) 100 mg
Espectinomicina (Sigma, S4014) 100
mg
Espectinomicina (Sigma, S4014) 100
mg
Kanamicina (Sigma, K1876) 100 mg

pBIN19

Kanamicina (Sigma, K1876) 100 mg

pKYL80

Kanamicina (Sigma, K1876) 50 mg y/o


Ampicilina (Sigma, A0166) 100 mg

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Medio de cultivo Lactosa-extracto de LevaduraAgar (LLA) solido


(Basado en Bernaerts y De Ley, 1963)

Consideraciones
Este medio de cultivo se usa para realizar la prueba de cetolactosa, la cual sirve
para verificar que se est trabajando con Agrobacterium tumefaciens (ver
protocolo referido)

Preparacin
1. En un vaso de precipitado del doble de volumen de la cantidad total de
medio a preparar, agregar todos los reactivos ya pesados (Tabla 3). Aforar
con ddH2O al volumen total del medio a preparar, y homogeneizar los
reactivos mediante un agitador magntico sobre una plancha de agitacin.
No es necesario ajustar el pH.
2. Vaciar el medio a un matraz del doble de volumen de la cantidad total de
medio a preparar. Cubrir la boca del matraz con papel aluminio hasta el
cuello. Esterilizar en autoclave 15 min a 121 C y 15 psi.
3. Dejar enfriar el medio dentro de una campana de flujo laminar limpiada
previamente (ver protocolo). Cuando la temperatura del medio sea
soportable al tacto, vaciar a cajas Petri (90 x 15 mm) (Phoen, 01118). El
medio debe ocupar la mitad de la altura de la caja.
4. Una vez solidificado el medio, las cajas Petri se etiquetan debidamente
(identificacin de la muestra, fecha de vaciado, responsable de la
preparacin). Estas cajas Petri pueden ser usadas inmediatamente o se
pueden almacenar a 4C hasta por 30 das.
TABLA 3. MEDIO LLA SOLIDO
[ ] Final
Reactivo
Lactosa
(USB,
18185)
Extracto
de
levadura
(USB,
23547)
Agar
(Sigma,
A7002) o Agar
bacteriolgico
(BD
Bioxon,
BD215000)

1.0%

Volumen total de medio a


preparar
250
500
750
1000
mL
mL
mL
mL
2.5 g
5.0 g
7.5 g
10 g

0.1%

0.25 g

0.50 g

0.75 g

1g

2.0%

5g

10 g

15 g

20 g

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Crecimiento de Agrobacterium tumefaciens

Escherichia coli en medio de cultivo Luria


Bertani (LB) slido
Consideraciones

Este protocolo se usa para A) reactivar bacterias que estn almacenadas en


stocks de glicerol a -80C; y B) aislar, crecer o resembrar colonias que estn
creciendo en medio de cultivo slido o lquido.
Preparar previamente cajas Petri (90 x 15 mm) (Phoen, 01118) con medio
de cultivo LB solido (ver protocolo referido).
Una vez sembradas las cajas Petri, incubar a 28C en el caso de A.
tumefaciens o a 37 C en el caso de E. coli, durante 1 o 2 das que es el
tiempo que tardan en verse colonias claramente formadas.

Precauciones
1) Encender y limpiar la campana de flujo laminar donde se vaya a trabajar
(ver protocolo de limpieza de campana). Prender un mechero de alcohol y
trabajar cerca de ste, en un radio de 15 a 20 cm.
2) Para la muestra de bacterias a sembrar, considerar las siguientes
observaciones.
a. Si es de un stock a -80C, sacarlo del ultracongelador y colocarlo en
un recipiente con hielo dentro de la campana. Si solo se va a tomar
una muestra del stock, hacerlo lo ms rpido posible. En caso
contrario, se puede dejar el tubo en el hielo y esperar a que se lice
todo el medio de cultivo con glicerol. Mezclar el tubo suavemente por
inversin de 6 a 8 veces y volver a dejarlo en hielo.
b. Si es de cultivo en medio lquido, homogeneizar antes de sembrar.
Esto se puede hacer manualmente, por inversin o mediante vortex
fuera de la campana.

Siembra
El mtodo de siembra se determina dependiendo del objetivo de la siembra y de
donde proviene la muestra a sembrar, como muestra la siguiente tabla.
Objetivo de la siembra

Estado de la
muestra a
sembrar

Equipo Y MATERIAL
USADO para sembrar

Tipo de
siembra a
realizar

Para reactivar bacterias


provenientes de un stock
en
glicerol,
crecer
bacterias o aislar colonias

En medio de
cultivo lquido

Micropipeta con puntas


desechables y estriles.
Soporte giratorio para
caja Petri (opcional).

Con
Micropipeta

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica


Tringulo de metal.

Preservar colonias aisladas

En medio de
cultivo lquido o
slido

Un asa bacteriolgica

Estrado

En medio de
cultivo lquido o
slido

Puntas desechables y
estriles de 20 L y una
micropipeta solo para
sostener la punta

Punteado
(Picado)

CON MICROPIPETA
1) Tomar una alcuota de la muestra a sembrar con la micropipeta. Para crecer
bacterias, usar alcuotas de 50 a 1000 L. Para aislar colonias, usar alcuotas
de 10 a 50L. Dispensar el contenido en medio de la caja Petri (90 x 15
mm) (Phoen, 01118) a sembrar (Figura 1a).
2) Colocar la caja Petri a sembrar sobre el soporte giratorio (Figura 1b). Tomar
el tringulo de metal, sumergirlo en alcohol al 70% en un vaso de
precipitado, sacarlo y colocarlo a la flama del mechero. Con esta accin el
tringulo se prender debido a los residuos de alcohol que quedaron en la
superficie. Verificar que se encuentra frio antes de esparcir la muestra
colocndolo suavemente en la orilla de la caja Petri sobre el medio de
cultivo. Si el tringulo no deja marca alguna en el medio, es seal de que
est lo suficientemente frio para ser usado.
3) Girar el soporte donde se ubica la caja Petri a sembrar, mientras que se
esparce la muestra moviendo el tringulo de metal hacia adelante y hacia
atrs (Figura 1c). En caso de no contar con un soporte giratorio, se puede
dar vuelta a la caja Petri manualmente. Seguir esparciendo la muestra de
esta forma hasta que el medio de cultivo LB absorba la mayor parte de la
muestra.
4) Cerrar la caja Petri y etiquetarla debidamente (identificacin de la muestra,
fecha de siembra, responsable de la siembra).

Figura 1.Siembra en caja Petri mediante alcuota tomada con micropipeta.


ESTRIADO

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

1) Tomar el asa y colocarla en la llama del mechero. El metal del asa debe
tornarse rojo intenso y este color debe ser uniforme a lo largo del asa para
asegurar una correcta esterilizacin.
2) Retirar el asa del mechero y esperar unos segundos a que se enfre.
Verificar que ya est fra colocando la horquilla sobre el medio de cultivo LB
slido de la caja Petri. Si an est caliente, el medio se derretir enfriando el
asa.
3) Tomar la muestra de bacterias a sembrar del medio lquido o slido con la
horquilla del asa.
4) Sembrar la muestra en la caja Petri por estra simple para crecer
bacterias, o por estra mltiple para aislar colonias.
ESTRIA SIMPLE para crecimiento de bacterias
Sembrar moviendo el asa en forma de zig-zag hasta cubrir toda la superficie
del medio de cultivo LB slido como muestra la figura 2.

Figura 2. Siembra con asa por estra simple.


ESTRIA MULTIPLE para aislamiento de bacterias
A. Estra mltiple simple. Sembrar realizando un rayado en zig-zag por
cuadrante (Figura 3). Entre el rayado de un cuadrante y el siguiente, no
se esteriliza el asa en el mechero. De esta manera, la cantidad de
bacterias original se va diluyendo en el proceso, de manera que permite
obtener colonias aisladas al menos en el cuarto cuadrante.

Figura 3. Siembra con asa por estra mltiple simple

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

B. Estra mltiple cruzada por cuadrante. Modalidad 1.Sembrar realizando


un rayado en zig-zag en el primer cuadrante (Figura 4a). Se esteriliza el
asa en el mechero y se realiza un rayado en el segundo cuadrante, en el
sentido de las manecillas del reloj, invadiendo un poco del primer
cuadrante (Figura 4b). Los cuadrantes 3 y 4 se rayan de la misma
manera que el cuadrante 2 esterilizando el asa entre la siembra de cada
cuadrante (Figura 4c y 4d, respectivamente). Las colonias aisladas se
pueden obtener entre el tercer y cuarto cuadrante (Figura 4e).

Figura 4. Siembra con asa por estra multiple cruzada por cuadrante.
Modalidad 1
C. Estra mltiple cruzada por cuadrante. Modalidad 2. Se realiza un rayado
en el primer cuadrante (Figura 5a) y despus en el segundo cuadrante
en el sentido de las manecillas del reloj (Figura 5b) sin esterilizar el asa
entre ambos cuadrantes. Se esteriliza el asa en el mechero y se jala el
asa sobre el medio, del primer al tercer cuadrante (Figura 5c). Se
esteriliza el asa en el mechero y se jala el asa sobre el medio, del
segundo al cuarto cuadrante (Figura 5d). Se esteriliza el asa en el
mechero y se realiza un rayado en el tercer cuadrante para esparcir las
bacterias (Figura 5e). Este ltimo paso se realiza tambin con el cuarto
cuadrante (Figura 5f, 5g).

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Figura 5. Siembra con asa por estra multiple cruzada por cuadrante. Modalidad 2
5) Cerrar la caja Petri y etiquetarla debidamente (identificacin de la muestra,
fecha de siembra, responsable de la siembra).
PUNTEADO
1) Enumerar en la base de la caja Petri, las colonias que se vayan a sembrar
(Figura 6a). Se recomienda sembrar como mximo 20 colonias por caja.
2) Con la punta desechable remover una de las colonias en caso de que la
muestra se encuentre en medio slido (Figura 6b), o humedecer
aproximadamente 1mm en el medio lquido (Figura 6c) y retirar de ste.
3) Abrir la caja Petri a sembrar y picar el medio LB superficialmente sobre el
nmero que corresponda (Figura 6d). Si se desea tener una repeticin de
sta colonia, con la misma punta y sin tomar de nuevo muestra, sembrar de
la misma manera una segunda caja Petri debidamente etiquetada.
4) Cambiar la punta desechable por una nueva y estril, y realizar el paso 3
tantas veces como colonias se deseen sembrar (Figura 6e)..
5) Cerrar la caja Petri. Etiquetar debidamente (identificacin de la muestra,
fecha de siembra, responsable de la siembra) (Figura 6f).

10

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Figura 6. Siembra usando una micropipeta y puntas de 20 L


estriles.

11

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Crecimiento de Agrobacterium tumefaciens y


Escherichia coli en medio

de cultivo Luria

Bertani (LB) lquido


Consideraciones

Este protocolo se usa para crecer A. tumefaciens y E. coli para realizar


posteriormente pruebas de cetolactosa y extraccin de plsmido, as como
para preparar stocks en glicerol.
Preparar previamente medio de cultivo LB lquido (ver protocolo referido).
Llenar los recipientes que se vayan a utilizar (tubos corning, matraces, etc.)
justo antes de usar.
Una vez sembradas las bacterias, incubar a 28C y 125 rpm en el caso de
A. tumefaciens o a 37 C y 125 rpm en el caso de E. coli, ambas hasta una
densidad ptica de 0.8.

Precauciones
1) Encender y limpiar la campana de flujo laminar donde se vaya a trabajar
(ver protocolo de limpieza de campana). Prender un mechero de alcohol y
trabajar cerca de ste, en un radio de 15 a 20 cm.
2) Si la muestra proviene de medio de cultivo lquido, homogeneizar antes
de sembrar. Esto se puede hacer manualmente, por inversin o mediante
vortex fuera de la campana.

Siembra
SI LA MUESTRA A SEMBRAR PROVIENE DE MEDIO DE CULTIVO LQUIDO:
SIEMBRA CON MICROPIPETA
1) Tomar una alcuota (de 10 a 50 L) de la muestra a sembrar con una punta
desechable y estril de una micropipeta de 100 o 200 L.
2) Dispensar la alcuota en el medio de cultivo LB a sembrar. Flamear y cerrar
el recipiente (tubo, matraz, etc.) La punta desechable se cambia entre la
siembra de una muestra y otra.
3) Etiquetar el recipiente debidamente (identificacin de la muestra, fecha de
siembra, responsable de la siembra).
SIEMBRA CON ASA BACTERIOLICA
1) Tomar el asa y colocarla en la llama del mechero. El metal del asa debe
tornarse rojo intenso y este color debe ser uniforme a lo largo del asa para
asegurar una correcta esterilizacin.

12

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

2) Retirar el asa del mechero y esperar unos segundos a que se enfre.


Verificar que ya est fra colocando la horquilla sobre el medio de cultivo LB
lquido a sembrar. Si an est caliente, el medio lquido enfriar el asa.
3) Tomar con la horquilla del asa un poco del medio de cultivo lquido de la
muestra a sembrar. Pasar el asa al recipiente con el medio de cultivo LB a
sembrar y agitar el asa dentro del medio para depositar la muestra. Flamear
y cerrar el recipiente (tubo, matraz, etc.) El asa se flamea entre la siembra
de una muestra y otra.
4) Etiquetar el recipiente debidamente (identificacin de la muestra, fecha de
siembra, responsable de la siembra).
SI LA MUESTRA A SEMBRAR PROVIENE DE MEDIO DE CULTIVO SOLIDO:
1) Tomar un asa bacteriolgica y colocarla en la llama del mechero. El metal
del asa debe tornarse rojo intenso y este color debe ser uniforme a lo largo
del asa para asegurar una correcta esterilizacin.
2) Retirar el asa del mechero y esperar unos segundos a que se enfre.
Verificar que ya est fra colocando la horquilla sobre el medio de cultivo LB
lquido a sembrar. Si an est caliente, el medio lquido enfriar el asa.
3) Tomar con la horquilla del asa una colonia aislada del medio de cultivo LB
slido (muestra a sembrar). Pasar el asa al recipiente con el medio de
cultivo LB a sembrar y agitar el asa dentro del medio para depositar la
muestra. Flamear y cerrar el recipiente (tubo, matraz, etc.) El asa se flamea
entre la siembra de una muestra y otra.
4) Etiquetar el recipiente debidamente (identificacin de la muestra, fecha de
siembra, responsable de la siembra).

13

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Preparacin

de

stocks

de

glicerol

de

Agrobacteruim tumefaciens o Escherichia coli


Consideraciones
Este procedimiento se usa para almacenar y mantener una muestra de bacterias
en ultracongelador a -80 C por tiempo indefinido.

Procedimiento
1) Se dispensan tubos criognicos o crioviales de 2 mL con 250 L de glicerol
(SIGMA, G5516-500ML) al 100% y se cierran. El nmero de tubos depender
del nmero de muestras a procesar.
2) Los crioviales se esterilizan en autoclave 15 min a 121 C y 15 psi.
3) Se crecen las bacterias en medio Luria Bertani (LB) lquido (ver protocolo
referido) hasta una DO600: 0.8.
4) En una campana de flujo laminar limpia (ver protocolo referido), vaciar 750
L del medio LB con las bacterias al criovial con 250 L de glicerol estril.
Flamear el criovial y su tapa y cerrarlo. Etiquetalo adecuadamente (ver
ejemplo de etiquetado en la Figura 7).

Figura 7. Ejemplo de etiquetas usadas para los stocks de bacterias en


glicerol.
5) Se homogeniza el tubo mediante vortex por 2 a 3 segundos.
6) Los crioviales se sumergen en nitrgeno lquido para enfriarlos y se
almacenan
inmediatamente a -80 C en una caja etiquetada
adecuadamente (Figura 8).

Figura 8. Ejemplo de etiquetas usadas para las cajas donde se guardan los
stocks de bacterias en glicerol.

14

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Prueba de cetolactosa para Agrobacterium


tumefaciens
(Basado en Bernaerts y De Ley, 1963)

Consideraciones
Mediante esta prueba se verifica que las bacterias son Agrobacterium tumefaciens
biovar 1 debido a que esta cepa transforma la lactosa del medio en 3-cetolactosa.
En un medio alcalino, el in Cu 2+ (otorgado por el CuSO4) es capaz de reducirse por
efecto del grupo aldehdo de la 3-cetolactosa (CHO) a su forma de Cu +. Este nuevo
in forma un precipitado amarillo de CuO2. No todas las especies ni biovares de
Agrobacterium dan positivo a esta prueba. A. tumefaciens biovar 2, A. vitis, A. rubi
y A. radiobacter son negativos a la prueba.

Procedimiento
1. Preparar cajas Petri (90 x 15 mm) (Phoen, 01118) con medio LactosaExtracto de Levadura-Agar (LLA) (ver protocolo referido) e incubarlas a 37C
toda la noche. Esto verificar que no hay contaminacin y disminuir la
humedad de las placas.
2. Al da siguiente, sembrar las cajas Petri con las colonias de A. tumefaciens a
las que se les realizar la prueba as como los controles positivo (A.
tumefaciens), negativo (Escherichia coli) y ambiental (caja abierta en
campana). Si el medio de las muestras a sembrar es slido, se recomienda
sembrar mediante estra simple (ver protocolo relacionado); si es lquido, se
recomienda sembrar usando una micropipeta y una alcuota de al menos
300 L (ver protocolo relacionado). Etiquetar las cajas adecuadamente
(identificacin de la muestra, fecha de siembra, responsable de la siembra).
3. Incubar las placas a 28C para A. tumefaciens y 37C para E. coli por 48-72
horas (hasta que en la caja Petri se observe un crecimiento denso de
bacterias). El tiempo ptimo para el crecimiento depender de la cantidad
y el mtodo de siembra de las bacterias.
4. Abrir las cajas Petri sobre la mesa de trabajo fuera de la campana de
extraccin y agregar la solucin de Benedict hasta cubrir las colonias
(aprox. 7 mL) e incubar a temperatura ambiente de 15 a 60 min. La rapidez
de la prueba es inversamente proporcional a la cantidad de bacterias en la
caja Petri.
5. La prueba es positiva si la bacteria se pone de color amarillo fuerte
fluorescente. E. coli se mantendr de color azul (Figura 9).

15

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Figura 9. Resultados esperados de la prueba de cetolactosa para A. tumefaciens.


a) Control positivo (A. tumefaciens). b) Muestra con un resultado positivo.
c) Control negativo (E. coli)

Solucin de Benedict
Esta solucin se prepara en dos partes que luego se mezclan (solucin A y solucin
B, Tabla 4).
1. Agregar en un vaso de precipitado el citrato de sodio, el carbonato de sodio
y el agua para la solucin A. Homogeneizar usando un agitador magntico
y una plancha de agitacin.
2. En otro vaso de precipitado, agregar el sulfato de cobre y el agua para la
solucin B. Homogeneizar usando un agitador magntico y una plancha de
agitacin.
3. Mezclar ambas soluciones. No se esteriliza. Almacenar a temperatura
ambiente y utilizar mientras mantenga su coloracin azul y transparente.
Desechar si se ve turbio o cambia su coloracin.
TABLA 4. SOLUCION DE BENEDICT
Reactivos

Solucion A
Na3C3H5O (COO)3 (J.T.
Baker, 3646-01)
Na2CO3 (J.T. Baker, 49719-8)
ddH2O
Solucin B
CuSO4.5H2O
(Phyto
Technoloy, C375)
ddH2O

Volumen total de solucin de Benedict


118.75
237.5
356.25
475
mL
mL
mL
mL

21.625 g

43.25 g

64.875 g

86.5 g
50.0 g

12.5 g
106.25
mL

25 g
212.5
mL

37.5 g
318.75
mL

425 mL

2.175 g
12.5 mL

4.35 g
25 mL

6.525 g
37.5 mL

8.7 g
50 mL

16

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Lisis de bacterias en cultivo


(Modificado de Hoisington, D., Khairallah, m. and Gonzalez de Len, D. 1994.
Laboratory Protocols: CIMMYT Applied Molecular Genetics Laboratory. Second
Edition. Mxico, D. F. p. 17)

Consideraciones
Este protocolo se usa para amplificar un segmento de inters que se encuentre
dentro del ADN genmico o plasmdico de bacterias transformadas y crecidas en
medio LB slido o lquido, sin hacer extraccin de ADN plasmdico.

Procedimiento
1) Trabajar dentro de una campana de flujo laminar limpia protocolo referido) y
cerca de un mechero de alcohol para asegurar las condiciones aspticas
adecuadas.
2) Limpiar superficialmente una micropipeta de 100 o 200 L con alcohol al
70% y secarla con una sanita.
3) Dispensar en un tubo de PCR nuevo y estril, 50 mL de H 2O (Sigma, 18645).
Tomar con una punta desechable estril una colonia crecida durante 2 das
en caja Petri y resuspenderla en los 50 L de H2O estril del tubo subiendo y
bajando cuidadosamente el mbolo de la micropipeta.
4) Incubar los tubos a 95C por 10 min. en un termociclador. Se obtendr un
lisado.
5) Centrifugar los tubos 5 min. a 13000 rpm.
6) Usar 2.5 L del sobrenadante para la amplificacin de PCR de acuerdo al
protocolo de amplificacin.
7) El lisado de clulas se puede almacenar a 4C si se va a usar en corto plazo
(una semana), o almacenarse a -20C.
NOTA: En caso de que no amplifique por PCR el segmento esperado con sta
tcnica, realizar la extraccin de ADN genmico o plasmdico y realizar
nuevamente la PCR.

Extraccin
de
ADN
Agrobacterium tumefaciens

plasmdico

de

17

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Consideraciones
En todo el protocolo, la velocidad de centrifugacin es de 13000 rpm.

Procedimiento
1) Crecer las bacterias de A. tumefaciens en 50 mL de medio de cultivo LB
lquido con antibitico (ver protocolo referido) hasta una DO 600 de 0.5 a 0.8.
(10 mL si la DO600=0.5 o 5mL si la DO600= 0.8).
2)
3) Llenar un tubo Eppendorf de 2.0 mL con las bacterias crecidas en medio de
cultivo LB y centrifugar 5 min a temperatura ambiente. Descartar el
sobrenadante en un vaso de precipitado. Repetir este paso hasta procesar
toda la muestra (10 mL si la DO600=0.5 o 5mL si la DO600= 0.8).
4) Agregar 100 L de solucin 1 fra (4 C) y resuspender las clulas
mediante vortex.
5) Incubar 10 min. a temperatura ambiente.
6) Agregar al tubo 30 L de fenol equilibrado (USB, 75829) con dos volmenes
(60 L) de solucion 2 (preparar esta mezcla de fenol y solucin 2 antes de
agregarla). Mezclar mediante vortex suavemente por unos pocos segundos.
En este paso se observa viscosidad.
7) Agregar 150 L de solucin 3 al tubo. Agitar el tubo en vortex de 2 a 3
segundos.
8) Incubar el tubo a -20C 15 min.
9) Centrifugar el tubo 5 min. Colocar el sobrenadante en un tubo nuevo de 1.5
mL.
10)
Llenar el tubo con etanol frio al 95%. Mezclar por inversin de 6 a 8
veces. Incubar a -20C al menos 25 min.
11)
Centrifugar 5 min. Descartar el sobrenadante.
12)
Agregar 0.5 mL de solucin 4 y resuspender la pastilla mediante
vortex. Agregar al tubo 1 mL de etanol 95% frio (almacenado a -20C) y
mezclar por inversin de 6 a 8 veces. Incubar a -20C al menos 25 min.
13)
Centrifugar 5 min. Decantar el sobrenadante y colocar el tubo
brevemente en posicin invertida sobre una sanita para que sta absorba el
sobrenadante que quede en el tubo.
14)
Agregar 1mL de etanol 75% frio (almacenado a -20C). Mezclar por
inversin de 6 a 8 veces y centrifugar 3 min. Descartar el sobrenadante.
Secar la pastilla colocando el tubo en posicin invertida sobre una sanita
durante 20-30 min.
15)
Resuspender la pastilla en 50 L de ddH2O (Sigma, 18645) estril o
buffer TE.
16)
Verificar la integridad del ADN en un gel de agarosa con buffer TAE al
1%.

18

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Preparacin de soluciones
Solucin 1
1) En un vaso de precipitado, se disuelve la glucosa, el EDTA y el Tris base en
el ddH2O (Tabla 5) usando un agitador magntico y una plancha de
agitacin.
2) Se ajusta el pH a 8.0 con HCl 1N.
3) Al momento de usar esta solucin, se agrega la lisozima. Disolver mediante
agitacin manual.
4) La solucin se puede almacenar a 4 C por 15 das. Se usa fra.
TABLA 5. REACTIVOS PARA LA SOLUCIN 1
Reactivo
Glucosa
(Sigma,
G7520)
EDTA (Sigma, E5134)
Tris
base
(Sigma,
93362
Lisozima
(USB,
18645; Sigma, L6876)

[ ] Final

Volumen total de solucin 1 a


preparar
10 mL
20 mL
30 mL
0.09 g
0.18 g
0.27 g

50 mM
10 mM
25 mM

0.0372 g
0.0146 g

0.0744 g
0.0292 g

0.1116 g
0.0438 g

4 mg/mL

0.04 g

0.08 g

0.12 g

Solucin 2
Preparar en el momento de realizar la extraccin.
1. En un vaso de precipitado, se disuelven los reactivos (Tabla 6) en ddH 2O
usando un agitador magntico a velocidad baja (ya que el SDS es un
detergente y crea burbujas) y una plancha de agitacin.
TABLA 6. REACTIVOS PARA LA SOLUCION 2
Reactivo
SDS
(Sigma,
L4390)
NaOH (J.T. Baker,
3722)

[ ] Final

Volumen total de solucin 2 a


preparar
2.5 mL
5 mL
10 mL
0.025 g
0.05 g
0.1 g

1%
0.2 N

0.02 g

0.04 g

0.08 g

Solucin 3
1) Disolver el acetato de sodio (Tabla 7) en ddH 2O usando un agitador
magntico y una plancha de agitacin.
2) Ajustar el pH a 4.8 con cido actico (J. T. Baker, 9507-05) concentrado.
3) La solucin se almacena a 4 C o a temperatura ambiente, si se usa
inmediatamente o se guarda para uso posterior, respectivamente.
TABLA 7. REACTIVO PARA LA SOLUCION 3
Reactivo

[ ] Ffinal

Volumen total de solucin 3 a


preparar

19

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

CH3COONa
(Sigma,
S2889)

3M

5 mL
1.2 g

10 mL
2.4 g

15 mL
3.7 g

Solucin 4
1) Disolver el acetato de sodio (Tabla 8) en ddH 2O usando un agitador
magntico y una plancha de agitacin.
2) Ajustar el pH a 7.2 con cido actico (J. T. Baker, 9507-05) concentrado.
3) La solucin se almacena a 4 C o a temperatura ambiente si se usa
inmediatamente o se guarda para uso posterior, respectivamente.
TABLA 8. REACTIVO PARA LA SOLUCION 4
Reactivo
CH3COONa
(Sigma,
S2889)

[ ] Final
0.3M

Volumen total de solucin 4 a


preparar
5 mL
10 mL
15 mL
0.123 g
0.246 g
0.3691 g

HCl 1N

Reactivo
HCl (Sigma, 258148)

Volumen total de HCl a preparar


10 mL
20 mL
30 mL
0.8798
1.7596
2.6394 mL
mL
mL

20

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

Amplificacin mediante reaccin en cadena de


la polimerasa en punto final
(PCR por sus siglas en ingls)

Consideraciones
En el caso de trabajar con ADN plasmdico o de planta, se recomienda preparar
stocks con concentraciones de 50 ng/L. Trabajar en una campana o extractor de
flujo laminar debidamente limpiada (ver protocolo referido) y verificar que no haya
corrientes de aire. Los tubos (de 200 L o de PCR) y las puntas desechables deben
ser nuevos y estriles. Usar un nico juego de micropipetas para preparar la
reaccin de PCR. Al momento de preparar la mezcla de reaccin, mantener los
tubos tapados la mayor parte del tiempo posible, as como las cajas de puntas
desechables para evitar contaminacin. Por este mtodo se han amplificado los
genes 35s, rd29a, AVP, tps1-tps2, bar y nptII de las diferentes construcciones que
se tienen en el laboratorio, tanto de ADN preparado directamente de cultivo de
bacterias, ADN plasmdico y ADN de planta transformada (ver protocolos
referidos).

Procedimiento
1. En un recipiente con hielo, colocar los reactivos y la muestra de ADN a usar.
Si estn congelados, permitir que se descongelen en el hielo. Los iniciadores
a usar dependern del gen a amplificar de acuerdo con la tabla 1 del Anexo.
2. Realizar los clculos necesarios con base en la siguiente tabla. Para preparar
la mezcla de reaccin considerar las siguientes reacciones.
a. Control positivo. Muestra de ADN que amplifica el gen bajo estudio.
b. Control negativo. Muestra de ADN que no amplifica el gen bajo
estudio.
c. Muestras a determinar.
d. Control sin ADN. Una reaccin donde se agregan todos los
componentes excepto ADN (en lugar de ADN se pone agua).
Al nmero total de reacciones a usar sumarle de 1 a 3 reacciones ms por
correccin de volumen.
MEZCLA DE REACCION
Reactivo
Agua
(Sigma,
18645)
Buffer
MgCl2
dNTPs
(Invitrogen,
18427088)
Iniciador
Forward

[ ] Inicial

[ ] final
-

Volumen a
tomar para 1
reaccin (L)
11.5

Ejemplo del volumen


a tomar para 21
reacciones (L)
241.5

10X
50mM
10mM

1X
2 mM
0.25mM

2
0.8
0.5

42
16.8
10.5

2 M

0.2 M

42

21

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica


Iniciador
Reverse
Taq
Polimerasa
(Invitrogen,
11615-010)
DNA
Total

2 M

0.2 M

42

5U/L

1U

0.2

4.2

50 ng/L

50ng/reaccin
*

20

399

* Para amplificar el gen nptII de ADN plasmdico, se usan 25 ng totales de


ADN por reaccin.
3. Homogenizar cada uno de los reactivos a usar mediante vortex y dar un
pulso en la centrfuga.
4. Preparar la mezcla de acuerdo al nmero total de reacciones a utilizar
agregando los reactivos (excepto el ADN) en el orden de la tabla anterior en
un tubo Eppendorf de tamao apropiado. Mantener en hielo.
5. Homogeneizar usando vortex de 2 a 3 segundos y dar un pulso en la
centrfuga.
6. Dispensar 19 L de la mezcla de reaccin en cada tubo individual (de PCR o
200 L).
7. Dispensar 1 L de ADN (50ng/L) o agua a cada tubo de acuerdo a las
muestras a amplificar. Enjuagar la punta subiendo y bajando el mbolo un
par de veces. Se recomienda agregar las muestras en el siguiente orden.
a. Control sin ADN.
b. Control negativo.
c. Muestras a determinar.
d. Control positivo.
Se debe cambiar de punta desechable entre cada muestra.
8. Homogeneizar los tubos usando vortex de 2 a 3 segundos y dar un pulso en
la centrfuga.
9. Agregar una gota de aceite mineral (Sigma, M5904) estril y cerrar el tubo.
Dar un pulso en la centrfuga.
10.Colocar los tubos en el termociclador y correr el programa de acuerdo al gen
que se desea amplificar. (Ver tabla 2 del Anexo)
11.Verificar la amplificacin en un gel de agarosa con buffer TAE al 1% (genes
avp1, avp1d, tps1-tps2 y nptII) o al 1.2 % (genes 35s, rd29a y bar).

22

LCT&IG

Laboratorio de Cultivo de Tejidos & Ingeniera Gentica

ANEXO 1
TABLA 1. GENES, TAMAO DE AMPLICN ESPERADO E INICIADORES
USADOS
Gen a
amplificar
35 s

Tamao del
amplicn
esperado (pb)
400

35 S

195

rd29a

458

avp1,
avp1d

630

Nombre del
iniciador forward
y reverse
35s-F (CENAM)
35-R (CENAM)
35-S F
35SR
RD29-AF, RD29A-F
RD29-AR, RD29A-R
AVP1F AJ, AVG1 F

2900

AVP1R AJ, AVG1 R


Treha 1F, TPS F

tps1-tps2
bar

307

nptII

700

Treha 1R, TPS R


BAR1/BAR2F
BAR1/BAR2R
NPT II F
NTP II R

Secuencia
CGTCTTCAAAGCAAGTGGATTG
TCTTGCGAAGGATAGTGGGATT
CAAATGCCATCATTGCGATAA
GATAGTGGGATTGTGCGTCA
AGATCATACCTATTAGAACGATT
TCCAATAGAAGTAATCAAACCCT
ACTGGTTATGGTCTTGGTGGGT
GGCAACATCTTGCACAGGGCTGT
CCGCTCGAGGGTACTCACATACAG
AC
CGGGGTACCATGGTGGGTTGAGAC
TGCACCATCGTCAACCACTA
CACGCGACCACGCTCTTGAA
TCGGCTATGACTGGGCACAACAGA
AAGAAGGCGATAGAAGGCGATGC
G

TABLA 2. CONDICIONES DE AMPLIFICACION


Gen
a
amplificar
35s
rd29a
AVP1,
AVP1D
tps1-tps2
bar
nptII

Programa

1 ciclo inicial a 94 C 3 min; 35 ciclos a


94C 1 min, 55 C 1 min, 72 C 2 min;
1 ciclo final a 72 C 7 min
1 ciclo inicial a 94 C 3 min; 35 ciclos a
94C 1 min, 54 C 1 min, 72 C 2 min;
1 ciclo final a 72 C 7 min
1 ciclo inicial a 95 C 4 min; 40 ciclos a
95C 1 min, 57 C 1 min, 72 C 1 min;
1 ciclo final a 72 C 7 min
1 ciclo inicial a 95 C 4 min; 40 ciclos a
95C 1 min, 65 C 1 min, 72 C 2 min;
1 ciclo final a 72 C 7 min
1 ciclo inicial a 94 C 3 min; 35 ciclos a
94C 1 min, 67 C 1 min, 72 C 2 min;
1 ciclo final a 72 C 7 min
1 ciclo inicial a 94 C 3 min; 30 ciclos a
94C 1 min, 59 C 1 min, 72 C 2 min;
1 ciclo final a 72 C 7 min

Nombre del programa en el


termociclador Verity (Applied
Biosystems)
(Usuario: vicky)
35S Yola
RD29A Yola
AVPD
TPS1-TPS2
bar Yola
nptII 59 25ng Yola

23