Вы находитесь на странице: 1из 207

INTRODUCCIN

El aprendizaje de la Qumica constituye un reto al que se enfrentan cada ao los, cada vez ms
escasos, estudiantes de 2 de bachillerato que eligen las opciones de Ciencias, Ciencias de la
Salud e Ingeniera y Arquitectura. Esto tambin constituye un reto para los profesores que, no
solo deben ser capaces de buscar la forma ms eficaz para explicar esta disciplina, sino adems,
inculcar el inters que nace del reconocimiento del papel que juega la Qumica en la vida y en el
desarrollo de las sociedades humanas.

En este contexto, las Olimpiadas de Qumica suponen una herramienta muy importante ya que
ofrecen un estmulo, al fomentar la competicin entre estudiantes procedentes de diferentes
centros y con distintos profesores y estilos o estrategias didcticas.

Esta coleccin de cuestiones y problemas surgi del inters por parte de los autores de realizar
una recopilacin de las pruebas propuestas en diferentes pruebas de Olimpiadas de Qumica, con
el fin de utilizarlos como material de apoyo en sus clases de Qumica. Una vez inmersos en esta
labor, y a la vista del volumen de cuestiones y problemas reunidos, la Comisin de Olimpiadas de
Qumica de la Asociacin de Qumicos de la Comunidad Valenciana consider que poda resultar
interesante su publicacin para ponerlo a disposicin de todos los profesores y estudiantes de
Qumica a los que les pudiera resultar de utilidad. De esta manera, el presente trabajo se
propuso como un posible material de apoyo para la enseanza de la Qumica en los cursos de
bachillerato, as como en los primeros cursos de grados del rea de Ciencia e Ingeniera.
Desgraciadamente, no ha sido posible por cuestiones que no vienen al caso la publicacin del
material. No obstante, la puesta en comn de la coleccin de cuestiones y problemas resueltos
puede servir de germen para el desarrollo de un proyecto ms amplio, en el que el dilogo, el
intercambio de ideas y la comparticin de material entre profesores de Qumica con distinta
formacin, origen y metodologa, pero con objetivos e intereses comunes, contribuya a impulsar
el estudio de la Qumica.





En el material original se presentan las pruebas correspondientes a las ltimas Olimpiadas
Nacionales de Qumica (19962012) as como otras pruebas correspondientes a fases locales de
diferentes Comunidades Autnomas. En este ltimo caso, se han incluido slo las cuestiones y
problemas que respondieron al mismo formato que las pruebas de la Fase Nacional. Se pretende
ampliar el material con las contribuciones que realicen los profesores interesados en impulsar
este proyecto, en cuyo caso se har mencin explcita de la persona que haya realizado la
aportacin.

Las cuestiones que son de respuestas mltiples y los problemas se han clasificado por materias,
se presentan completamente resueltos y en todos ellos se ha indicado la procedencia y el ao. Los
problemas, en la mayor parte de los casos constan de varios apartados, que en muchas ocasiones
se podran considerar como problemas independientes. Es por ello que en el caso de las
Olimpiadas Nacionales se ha optado por presentar la resolucin de los mismos planteando el
enunciado de cada apartado y, a continuacin, la resolucin del mismo, en lugar de presentar el
enunciado completo y despus la resolucin de todo el problema.

Los problemas y cuestiones recogidos en este trabajo han sido enviados por:
Juan A. Domnguez (Canarias), Juan Rubio (Murcia), Luis F. R. Vzquez y Cristina Pastoriza
(Galicia), Jos A. Cruz, Nieves Gonzlez, Gonzalo Isabel (Castilla y Len), Ana Tejero (Castilla
La Mancha), Pedro Mrquez (Extremadura), Pilar Gonzlez (Cdiz), ngel F. Senz de la Torre
(La Rioja), Jos Luis Rodrguez (Asturias), Matilde Fernndez (Baleares), Fernando Nogales
(Mlaga).

Finalmente, los autores agradecen a Humberto Bueno su ayuda en la realizacin de algunas de
las figuras incluidas en este trabajo.

Los autores

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

PROBLEMAS DE LAS OLIMPIADAS DE QUMICA (FASE NACIONAL)


1. Se prepara una disolucin disolviendo 9,1 g de cocana (
) en 50 mL de agua y se
obtiene un pH de 11,09. Teniendo en cuenta que el equilibrio de disociacin de la cocana puede
representarse esquemticamente segn la ecuacin:
+


a) Calcular el pKb de la cocana.

La constante de equilibrio correspondiente es:


Kb =

[C H NO ] [OH ]

[C H NO ]

Haciendo los correspondientes balances en el equilibrio se tiene que:


[C H NO ] = [OH ]
[C H NO ] = c
Kb =

[OH ]

[OH

c [OH ]

La concentracin de la disolucin es:


c =

9,1 g C H NO 1 mol C H NO 103 mL disolucio n




= 0,6 M
50 mL disolucio n 303 g C H NO
1 L disolucio n

Si el pH de la disolucin es 11,09:
pH = 11,09

[H O ] = 10

pH

= 8,1310

[OH ] = 1,2310 M

Sustituyendo valores:
Kb =

1,2310
0,6 1,2310

= 2,5310

pKb = log Kb = log 2,5310

= 5,6

b) Cuntos mililitros de cido clorhdrico 0,4 M hay que aadir a la disolucin anterior para que
el pH sea de 8,10?
Si el pH de la disolucin resultante es 8,10:
pH = 8,10

[H O ] = 10

pH

= 7,9410 9 M

[OH ] = 1,2610 6 M

Sean x los mL de HCl 0,4 M aadidos. Los H O aadidos con el HCl consumen OH , con lo que
para que el equilibro se mantenga, se forma cloruro de cocana y se consume la misma
cantidad de cocana. Si [Coca]anterior y [Coca ]anterior se refieren a las concentraciones en el
equilibrio calculadas en el apartado a), y suponiendo volmenes aditivos:
[Coca] = [Coca]anterior [Coca]gastada
[Coca] =

50 mL

0,4 mmol
0,6 mmol
x mL
mL = 300,4 x mmmol
mL
50+x mL disolucio n
50+x mL disolucio n

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

[Coca ] = [Coca ]anterior [Coca ]formada


0,4 mmol
0,4 x mmmol
mL
[Coca ] =
=

50+x mL disolucio n
50+x mL disolucio n
x mL

ya que, como se ha podido observar en el apartado a), al alcanzarse el equilibrio, [Coca ] es


despreciable frente a [Coca y, si el valor de x es lo suficientemente elevado, tambin lo ser
frente a [Coca ]formada .
La mezcla formada por cloruro de cocana, [Coca ], y la cocana sobrante es una disolucin
tampn. Sustituyendo en la expresin de K :
0,4 x
50 + x
2,5310 =
1,2610 6
30 0,4 x
50 + x
6

x = 50 mL HCl 0,4 M

(Obsrvese que, efectivamente, [Coca ]anterior = 1,26106 M es despreciable frente a


[Coca ]formada = 0,2 M).
c) Calcular el pH si a la disolucin del apartado b) se le aaden 0,16 g de hidrxido sdico.
El NaOH aadido se neutraliza con el HCl introducido en el apartado anterior:
0,16 g NaOH

103 mg NaOH 1 mmol NaOH



= 4 mmol NaOH
40 mg NaOH
1 g NaOH

4 mmol NaOH

1 mmol HCl
= 4 mmol HCl
1 mmol NaOH

Haciendo un balance de materia para el HCl:


50 mL HCl 0,4 M

0,4 mmol HCl


= 20 mmol HCl
mL HCl 0,4 M

20 mmol HCl (inicial) 4 mmol HCl (neutralizado) = 16 mmol HCl (exceso)


Considerando volmenes aditivos:
16 mmol HCl
= 0,16 M
(50 + 50) mL disolucio n
Con esta nueva cantidad de HCl, las cantidades en el equilibrio son:
[Coca] = [Coca]anterior [Coca]gastada con HCl
[Coca] =

50 mL

0,16 mmol
0,6 mmol
100 mL
mL
mL
= 0,14 M
100 mL disolucio n

Si x representa la [Coca ]formada en el nuevo equilibrio y se tiene en cuenta que [Coca]anterior es


igual a [Coca]gastada con HCl
[Coca ] = [Coca ]anterior [Coca ]formada = x + 0,16 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

Sustituyendo en K :
2,5310 6 =

x + 0,16 x

0,14

x = [OH ] = 2,2110 6 M

pOH = log (2,2110 6 ) = 5,66

pH = 8,35

Para determinar el porcentaje de cocana contenido en un alijo de droga se disolvieron en agua


10 g de la sustancia encontrada hasta completar 100 mL, y la disolucin as obtenida se valor
con cido clorhdrico 0,5 M, en presencia de un indicador, observndose que el viraje del
indicador se produca al aadir 8 mL de la disolucin de cido clorhdrico.
d) Determinar el porcentaje en peso de cocana presente en la sustancia analizada.
El HCl reacciona con la cocana mol a mol:
810 3 L HCl 0,5 M

0,5 mol HCl 1 mol C H NO 303 g C H NO




= 1,213 g C H NO
1 L HCl 0,5 M
1 mol HCl
1 mol C H NO

1,213 g C H NO
100 = 12,13% cocana
10 g alijo
e) Calcular el pH en el punto de equivalencia de la valoracin anterior.
En el punto de equivalencia slo hay cloruro de cocana:
C H NO + Cl
C H ClNO + H O
Esta sustancia en disolucin acuosa se hidroliza segn:
C H NO + H O

C H NO + H O

El Cl no sufre hidrlisis por proceder de un cido fuerte (HCl).


Aplicando la ley del equilibrio qumico a la reaccin anterior y haciendo los oportunos
balances de materia y carga se obtiene:
[Coca] = [H O ]
Kh =

Coca

= [Coca+ ] + [Coca]

[H O

Coca [H O ]

Para obtener el valor de K :


K =

K
Kb (cocana)

10

14

2,5310

6 = 3,9510

El valor de [Coca ] es:


[Coca ] =

4 mmol cocana
= 0,037 M
100+8 mL disolucio n

Sustituyendo todos estos valores en la expresin de la constante de equilibrio:


3,9510 9 =

[H O

0,037 [H O ]

[H O ] = 1,2110 5 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

pH = log [H O ] = log 1,2110

= 4,92
(O.Q.N. Navacerrada 1996)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

2. Si el producto de solubilidad del ioduro de plomo a 25C es 110 9 . Calcule:


a) Su solubilidad expresada en gramos por 100 mL.
La ecuacin qumica correspondiente a la disolucin del PbI es:
PbI (s)

Pb (aq) + 2 I (aq)

La constante de equilibrio del proceso de solubilidad es:


K = Pb

Si la solubilidad molar del PbI es s, las solubilidades de los iones son:


= s [I ] = 2s

Pb

Sustituyendo en la expresin de K :
K = s 2s = 4 s3
La solubilidad en agua es:
s =

3
K
110
=
4
4

= 6,310 4 M

La solubilidad en g/100 mL es:


100 mL disolucio n

g
6,310 4 mol PbI 461 g PbI

= 0,029

3
100 mL disolucin
10 mL disolucio n 1 mol PbI

b) Los gramos de iones y


0,5 L disolucio n

en 500 mL de disolucin saturada.

6,310 4 mol Pb
1 L disolucio n

2 6,310 4 mol I
0,5 L disolucio n
1 L disolucio n

207,2 g Pb
1 mol Pb

= 0,065 g

126,9 g I
= 0,080 g
1 mol I

c) La concentracin de los iones ioduro y plomo en el equilibrio as como los gramos de sal que
precipitan cuando se mezclan 50 mL de una disolucin 10 4 M de ioduro sdico con otros 50 mL
de disolucin 10 3 M de nitrato de plomo.
Al mezclar disoluciones de Pb NO
2 NaI (aq) + Pb NO

(aq)

y NaI se produce la reaccin:


PbI (aq) + 2 NaNO (aq)

Considerando volmenes aditivos las concentraciones inicas son:


10 4 mmol NaI
mL NaI 10 4 M 1 mmol I = 5,010 5 M
50+50 mL disolucio n
1 mmol NaI

50 mL NaI 10 4 M
[I ] =

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

10 3 mmol Pb NO
1 mmol Pb
mL Pb NO 103 M

50+50 mL disolucio n
1 mmol Pb NO3
10 3 M

50 mL Pb NO
[Pb ] =

= 5,010 4 M

Para que se forme un precipitado es preciso que se cumpla que el producto inico sea mayor
que K :
Pb

5,010

> K
5

5,010

= 1,2510

10


, por tanto, NO se forma

Como se observa, el producto inico es menor que


precipitado.

d) La concentracin de los iones ioduro y plomo y los gramos de sal que precipitan cuando a la
disolucin formada en el apartado anterior le aadimos 3,32 g de ioduro potsico (Se supone
que no existe variacin apreciable en el volumen).
Al aadir KI, aumenta la concentracin de iones I , mientras que permanece igual la
concentracin de iones Pb . La nueva concentracin inica es:
1 mol KI
3
166 g KI 1 mol I 10 mL disolucio n


0,2 M
[I ] = 5,010 M +
100 mL disolucio n 1 mol KI 1 L disolucio n
3,22 g KI

Para que se forme un precipitado es preciso que se cumpla que el producto inico sea mayor
que K :
Pb

5,010

> K
0,2 = 2,010 5

Como se observa, el producto inico es mayor que

, por tanto, S se forma precipitado.

Llamando x a la cantidad de sustancia, en mol/L, que precipita:


1,010 9 = 5,010 4 x 0,2 x

x = 5,010 4 M

Las concentraciones inicas en el equilibrio y la masa de precipitado son:


[I ] = (0,2 5,0104 ) M = 0,19905
Pb

K
I

1,010 9
= 2,510
0,19905

5,010 4 mol PbI 461 g PbI



= 2,310
0,1 L disolucio n
L disolucio n
1 mol PbI


(O.Q.N. Navacerrada 1996)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

3. La descomposicin trmica del hidrgenocarbonato de sodio (slido) produce carbonato de


sodio (slido), dixido de carbono (gas) y agua (gas). Por eso se utiliza en la fabricacin del pan,
ya que, el dixido de carbono que se desprende produce pequeas burbujas en la masa, haciendo
que sta "suba" al hornear el pan.
Suponer en todos los casos un comportamiento ideal de los gases.
a) Ajustar la reaccin, escribiendo las frmulas de todos los compuestos que intervienen en la
misma.
La ecuacin qumica ajustada correspondiente a la reaccin propuesta es:
2

(s)

(s) +

(g) +

(g)

b) Calcular el calor de reaccin en condiciones estndar y el intervalo de temperaturas en el que


la reaccin ser espontnea, a partir de los siguientes datos termodinmicos:
Compuesto
Hidrgenocarbonato de sodio (s)
Carbonato de sodio (s)
Dixido de carbono (g)
Agua (g)

Hf (kJ/mol)
947,7
1131,0
393,5
241,8

S (J/molK)
102,1
136,0
213,6
188,7

La entalpa de reaccin puede calcularse a partir de las entalpas de formacin de productos y


reactivos.
r H = i H

productos

r H = 1 mol H O

i H

reactivos

241,8 kJ
393,5 kJ
1131,0 kJ

+ 1 mol CO
+ 1 mol Na CO
mol H O
mol CO
mol Na CO

2 mol NaHCO

947,7 kJ
mol NaHCO

= 129,1 kJ

Para saber si se trata o no de un proceso espontneo es necesario calcular G:


r G = r H Tr S
Como rH ya es conocido, se calcula rS a partir de las entropas molares de productos y
reactivos:
r S = i S

productos

r S = 1 mol H O

i S

reactivos

188,7 J
213,6 J
1 mol CO
K mol H O
K mol CO

2 mol NaHCO

102,1 J
K mol NaHCO

1 mol Na CO

136,0 J
K mol Na CO

J
= 334,1
K

La variacin de energa libre de Gibbs:


r G = 129,1 kJ 298 K

334,1 J 1 kJ
3 = 29,5 kJ
K
10 J

Se trata de un proceso no espontneo a 25C ya que el valor de r G > 0. En este tipo de


reacciones en las que r H < 0 y r S > 0, la reaccin se hace espontnea a temperaturas altas.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

Para determinar a partir de qu temperatura ocurre esto es preciso determinar la


temperatura de equilibrio (r G = 0):
T =

r H
129,1 kJ
=
= 386,4 K 113,3C
r S 334,110 3 kJ/K

La reaccin se vuelve espontnea por encima de 113,3C.


c) Determinar los valores de las constantes de equilibrio

a 25C.

A partir del valor de rG se puede obtener el valor de la constante de equilibrio mediante la


ecuacin:
r G = RT ln K
Sustituyendo se obtiene el valor de la constante de equilibrio a 25C:
K = exp

29,5 kJ
r G
= exp
= 6,710
3
RT
8,31410 kJK 1 (25+273) K

La relacin entre las constantes K y K viene dada por la expresin:


K = K RT

donde
= coef. esteq. productos gaseosos coef. esteq. reactivos gaseosos = 2 0 = 2
K = 6,710 6 [0,082 25+273

= 1,110

d) Si se calientan a 125C 100 g de hidrgeno carbonato de sodio en un recipiente cerrado de 2 L


de capacidad:
d1) qu valor tendr la presin parcial de cada uno de los gases y la presin total en dicho
recipiente cuando se alcance el equilibrio?
d2) qu masa de hidrgeno carbonato sdico se habr descompuesto a esa temperatura y qu
masa total de slido quedar en el recipiente?
La ecuacin de vant Hoff que indica la dependencia de la constante de equilibrio con la
temperatura y permite calcular el valor de K a 125C:
ln
ln

K
K
K

6,710

H 1
1

R T1 T2
6 =

129,1
8,31410

1
1


298 398

d1) Construyendo la tabla de moles correspondiente al equilibrio:



ninicial
ntransformado
nformado
nequilibrio

NaHCO3
n
2x

n 2x

Na2 CO3

x
x

CO2

x
x

H2 O

x
x

= 3,25

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

La expresin de la constante K es:


K = p

De acuerdo con la estequiometra de la reaccin, las cantidades de CO y H O en el equilibrio


son iguales:
p

= p

= p

Sustituyendo en K :
K = p2
p = p

p = K = 3,25 = 1,80 atm

+ p

= 2p

p = 2 1,80 atm = 3,60 atm

d2) Considerando comportamiento ideal, a partir de la presin del gas se obtiene el nmero
de moles:
n

1,80 atm 2 L
0,082 atmLmol 1 K

125+273 K

= 0,11 mol CO2

La masa de NaHCO3 que se descompone es:


0,11 mol CO

2 mol NaHCO3 84 g NaHCO3



= 18,48 g NaHCO3
1 mol CO
1 mol NaHCO3

La masa de NaHCO que queda sin descomponer en el equilibrio es:


100 g NaHCO (inicial) 18,48 g NaHCO (transformado) = 81,52 g NaHCO3 (equilibrio)
La masa de Na CO que se forma es:
0,11 mol CO

1 mol Na CO 106 g Na CO

= 11,66 g
1 mol CO
1 mol Na CO

La masa total de slidos (NaHCO y Na CO ) en el equilibrio es:


81,52 g NaHCO3

11,66 g Na CO

93,18 g slidos

e) Si a una temperatura T se obtiene una presin total de 5,0 atm al alcanzar el equilibrio, cul
ser el valor de dicha temperatura?
Para determinar la temperatura del nuevo equilibrio se utiliza la ecuacin la ecuacin que
relaciona K y rG:
r G = r H Tr S
r G = RT ln K

T =

r H

r S R ln K

Si a una temperatura T la presin es 5,0 atm, el valor de la constante K es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

K = p2 =

p2

4

K =

2,5
4

10

= 6,25

Sustituyendo en la expresin de T:
T =

129,1 kJ
3

334,110 kJK 8,314103 kJK

ln 6,25

= 405 K 132C
(O.Q.N. Navacerrada 1996)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

11

4. Un estudiante de Qumica observ en el laboratorio que al aadir 500 mL de cido clorhdrico


0,05 M a 0,2790 g de limaduras de Fe metlico, este ltimo se disolva:
a) Escribir la reaccin de disolucin del Fe metlico con el cido clorhdrico.
La ecuacin qumica ajustada correspondiente a la reaccin propuesta es:
Fe (s) + 2 HCl (aq)

(aq) +

(g)

b) Cul es el pH de la disolucin obtenida al disolver el Fe metlico en cido clorhdrico?


La cuestin planteada supone calcular el pH de la disolucin resultante. Por tanto, se est
dando por supuesto que el Fe es el reactivo limitante y que el HCl se encuentra en exceso. En
primer lugar es preciso determinar las cantidades de HCl iniciales y consumidas:
500 mL HCl 0,05 M
0,2790 g Fe
[HCl] =

0,05 mol HCl


3

10 mL HCl 0,05 M

= 0,025 mol HCl

1 mol Fe 2 mol HCl



= 0,010 mol HCl
55,8 g Fe 1 mol Fe

0,025 mmol HCl (inicial) 0,010 mmol HCl (gastado) 103 mL



= 0,03 M
500 mL
1 L

Como el HCl es un cido fuerte, est totalmente disociado en iones Cl y H O , por lo tanto:
[HCl] = [H O ] = 0,03 M
pH = log 0,03 = 1,52
c) Si a la disolucin anterior se aaden 0,2409 g de
de equilibrio de la disolucin resultante?
Potencial normal de reduccin: E (
/
) = 0,77 V.
El Fe inicial se oxida todo a Fe
0,2790 g Fe
[Fe ] =
500 mL

cul ser el potencial

cuya concentracin resultante es:

1 mol Fe

55,8 g Fe

103 mL

= 0,01 M
1 L

El Fe lo proporciona el hidrato, FeNH SO


[Fe ] =

12

12 H O, disuelto y su concentracin es:

0,2409 g hidrato 1 mol hidrato 1 mol Fe


103 mL



= 0,001 M
500 mL
481,8 g hidrato 1 mol hidrato 1 L

La semirreaccin de reduccin del Fe es:


Fe + e

Fe

Aplicando la ecuacin de Nernst:


E

= E

0,0592
[red]
log

n
[oxd]

Sustituyendo:
E

= 0,77

0,0592
0,01
log
= 0,711 V
1
0,001

= E

0,0592
[Fe ]
log

1
[Fe ]

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

12

El estudiante pens en la posibilidad de construir una pila, en la que uno de los electrodos
estuviese constituido por una barra de Pt sumergida en la disolucin resultante del apartado c),
y el otro electrodo fuese una barra de Zn sumergida en una disolucin que contiene 5,748 g/L de
7
.
d) Al unir los electrodos mediante un puente salino y conectarse un voltmetro entre ambos
electrodos, qu diferencia de potencial debera observarse?
Escribir la semirreaccin que se produce en el ctodo y la que se produce en el nodo.
Potenciales normales de reduccin: E (
/
) = 0,77 V; E (
/Fe) = 0,44 V;
E ( / ) = 0 V; E (
/Zn) = 0,76 V.
La concentracin resultante de Zn es:
[Zn ] =

5,748 g ZnSO 7 H O 1 mol ZnSO 7 H O


1 mol Zn


= 0,02 M
1 L
287,4 g ZnSO 7 H O 1 mol ZnSO 7 H O

La semirreaccin de reduccin del Zn es:


Zn + 2 e

Zn

Aplicando la ecuacin de Nernst:


E

/Zn = E

/Zn

0,0592
[red]
log

n
[oxd]

/Zn = E

/Zn

0,0592
1
log

2
[Zn ]

Sustituyendo:
E

/Zn = 0,76

0,0592
1
log
= 0,81 V
2
0,02

La reaccin entre Zn y Fe es:


Ctodo (reduccin): 2

+ e

nodo (oxidacin): Zn

+ 2 e

Zn + 2

+ 2

El potencial de la pila es:


Epila = E

/Zn =

0,711 V 0,81 V = 1,521 V


(O.Q.N. Navacerrada 1996)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

13

5. La reaccin en fase gaseosa, que a continuacin se describe:


+ Ciclopenteno
Ciclopentadieno + 2 HI
presenta una constante de equilibrio entre 450 y 700 K, que viene dada por la ecuacin:
11200

17,39

a) Calcule la energa libre de Gibbs, normal G, para la reaccin a 575 K.
Combinando las expresiones de K y G:
ln K = 17,39

11200
T

G = RT 17,39

G = RT ln K

11200

T

Sustituyendo:
G = 8,31410 3 kJK

mol

575 K 17,39

11200
= 9,98 kJmol
575

b) Calcule la presin parcial de equilibrio del yodo cuando se mezclan cantidades equimolares de
yodo y ciclopenteno a una presin inicial total de 10 atm y 460 K.
En primer lugar se calcula K a 460 K:
ln K = 17,39

11200

460

K = 9,5110 4

Como las cantidades iniciales de yodo y ciclopenteno son equimolares:


pI = pC
2

5 H8

pt
= 5 atm
2

Construyendo la tabla de presiones:



pinicial
ptransformado
pformado
pequilibrio

I
5
p

5 p

C H
5
p

5 p

HI


2p
2p

C H


p
p

La expresin de la constante de equilibrio de la reaccin es:


Kp =

pHI
p

p
p

Sustituyendo:
9,5110 4 =

2p
p

5 p

Al ser Kp << 1 se puede suponer que 5 p 5, con esta aproximacin:


9,5110 4 =

4 p

25

p = 0,181 atm

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

p = 5 p

14

p = 5 0,181 atm = 4,819 atm

c) Si el ciclopentadieno se trata con hidrxido potsico, se produce una desprotonacin sobre el


carbono saturado, obtenindose ciclopentadienuro potsico. Escriba y ajuste esta reaccin.
La ecuacin qumica ajustada correspondiente a la reaccin es:
+ KOH

d) Cuando a este ciclopentadienuro se le adiciona cloruro ferroso tetrahidratado se obtiene, por


precipitacin en fro, un complejo de tipo "sandwich"(un centro metlico entre dos anillos
aromticos paralelos) que es el ferrocenobis(ciclopentadienil) hierro (II). Escriba y ajuste esta
reaccin.
La ecuacin qumica ajustada correspondiente a la reaccin es:
2 K

Fe

+ 2 KCl + 4

e) Si en el proceso del apartado anterior partimos de 10 g de cloruro ferroso tetrahidratado,


qu rendimiento se alcanzara si se obtuviesen 3,5 g de ferroceno?
Para calcular el rendimiento es necesario previamente determinar la cantidad terica de
ferroceno a obtener:
10 g FeCl 4 H O

1 mol FeCl 4 H O
= 0,05 mol FeCl 4 H O
198,8 g FeCl 4 H O

0,05 mol FeCl 4 H O

1 mol Fe C H
185,5 g Fe C H

1 mol FeCl 4 H O 1 mol Fe C H

= 9,3 g Fe C H

Relacionando la cantidad obtenida con la cantidad terica:


=

3,5 g Fe C H (real)
100 = 37,6%
9,3 g Fe C H (teo rico)
(O.Q.N. Ciudad Real 1997)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

15

6. A) Calcula el pH de las siguientes disoluciones:


a1) La que se obtiene al disolver 2,3 g de
en agua desionizada hasta conseguir 150 mL de
disolucin. (El
est totalmente disociado).
El HNO es un cido fuerte por que se encuentra totalmente disociado en iones:
HNO (aq) + H O (l)

NO (aq) + H O (aq)

La concentracin de la disolucin es:


2,3 g HNO
1 mol HNO 103 mL disolucio n


= 0,243 M
150 mL disolucio n 63 g HNO
1 L

[H O ] = [HNO ] =

pH = log 0,243 = 0,61


a2) Una disolucin saturada de
(

= 7,910 . El

disuelto est totalmente disociado).

La ecuacin qumica correspondiente a la disolucin del Ca OH es:


Ca OH (s)

Ca (aq) + 2 OH (aq)

La constante de equilibrio del proceso de solubilidad es:


K = [Ca ] [OH

Si la solubilidad molar del Ca OH es s, las solubilidades de los iones son:


[Ca ] = s [OH ] = 2s
Sustituyendo en la expresin de K :
K = s 2s = 4 s3
La solubilidad en agua es:
s =

3
K
7,910
=
4
4

= 0,0125 M

La concentracin de OH es:
[OH ] = 2 0,0125 M = 0,025 M
pOH = log 0,025 = 1,6

pH = 14 pOH = 12,4

a3) Una disolucin de HCl cuya concentracin es 2,010 9 M.


(Dato.

= 1,010

14

El HCl es un cido fuerte que se encuentra totalmente disociado en iones y las ecuaciones
qumicas correspondientes a las ionizaciones existentes son:
HCl (aq) + H O (l)

Cl (aq) + H O (aq)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

2 H O (l)

16

OH (aq) + H O (aq)

Las constantes de equilibrio de ambas reacciones son:


K =
K = [H O ] [OH ]
El balance de materia correspondiente al HCl es:
[HCl = [Cl ] = c
El balance de cargas (condicin de electroneutralidad) en la disolucin es:
[H O ] = [OH ] + [Cl ]
Sustituyendo el valor de [OH ] en la expresin de K se obtiene:
[OH ]=c [H O ]
K = [H O ] c [H O ]
1,010

14

= [H O ] 2,010 9 [H O ]

[H O

210

[H O ] 10

14

= 0

Se obtiene:
[H O ] = 1,0110 7 M

pH = log 1,0110

a4) Una disolucin 0,4 M de metilamina,


tomando un del
.
(Dato.

= 6,99

. La metilamina se comporta como base dbil,

= 1,910 5 )

La metilamina es una base dbil que se encuentra parcialmente disociado en iones segn la
ecuacin:
CH NH (aq) + H O (l)

CH NH (aq) + OH (aq)

La expresin de la constante de basicidad K es:


Kb =

CH NH OH

CH NH

Aplicando los correspondientes balances y aproximaciones se obtiene:


[CH NH ] = [OH ]

[CH NH ] = c [OH ]

siendo c la concentracin inicial de CH NH . Sustituyendo estos valores en la expresin de la


constante queda:
K =

OH ]2

c [OH ]

Cuando se d la circunstancia de que:


c
> 100 se puede realizar la aproximacio n c [OH ] c
Kb

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

17

con lo que la ecuacin anterior queda como:


K =

OH
c

1,910 5 =


OH
0,4

pOH = log 2,7510

OH = 2,7510 3 M

= 2,56

pH = 14 pOH = 11,44

B) Indica razonadamente si en los siguientes casos se formaran precipitados:


b1) Al aadir 1,0 g de
a 50 mL de
0,1 M suponiendo que no vara el volumen
total.
(Datos: (
) = 1,810 5 ; (
) = 2,010 3 )
Al mezclar disoluciones de AgNO y CH COOH se produce la reaccin:
CH COOH (aq) + AgNO (aq)

CH COOAg (s) + HNO (aq)

La ecuacin qumica correspondiente a la disolucin del CH3 COOAg es:


CH COOAg (s)

Ag (aq) + CH COO (aq)

La constante de equilibrio del proceso de solubilidad es:


K = [Ag ] [CH COO ]
Para que se forme precipitado es preciso que el producto inico sea mayor que K :
[Ag ] [CH COO ] >K
Considerando que la adicin del slido no afecta al volumen, las concentraciones inicas son:
[Ag ] =

1 mol AgNO
103 mL disolucio n
170 g AgNO 1 mol Ag


= 0,117 M
1 L
50 mL disolucio n
1 mol AgNO

1 g AgNO

El cido actico es un cido dbil que se encuentra parcialmente disociado en iones segn la
ecuacin:
CH COOH (aq) + H2O (l)

CH COO (aq) + H O (aq)

La expresin de la constante de acidez K es:


K =

CH COO H O

CH COOH

Las concentraciones en el equilibrio son:


[CH COO ] = [H O ]

[CH COOH] = c [H O ]

Cuando se d la circunstancia de que:


c
> 100 se puede realizar la aproximacio n c [H O ] c
Ka

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

18

con lo que la ecuacin anterior queda como:


K =

CH COO
c

1,810 5 =

CH COO
0,1

CH COO = 1,310 3 M

Calculando el producto inico:


0,117 1,310

= 1,610 4

Como se observa, el producto inico es menor que


precipitado.

, por tanto, NO se forma

b2) Cuando se mezclan volmenes idnticos de una disolucin de


1,010 3 M.
(Dato:

) = 8,010

10

1,010 4 M con otra de

Al mezclar disoluciones de Na CO y BaCl se produce la reaccin:


Na CO (aq) + BaCl (aq)

BaCO (s) + 2 NaCl (aq)

La ecuacin qumica correspondiente a la disolucin del BaCO es:


BaCO (s)

Ba (aq) + CO (aq)

La constante de equilibrio del proceso de solubilidad es:


K = [Ba ] [CO ]
Para que se forme precipitado es preciso que el producto inico sea mayor que K :
[Ba ] [CO ] > Kps
Las concentraciones inicas son:
10 3 mmol BaCl
mL BaCl 10 3 M 1 mmol Ba

= 5,010 4 M
V+V mL disolucio n
1 mmol BaCl

V mL BaCl 10 3 M
[Ba ] =

10 4 mmol Na CO
mL Na CO 10 4 M 1 mmol CO

= 5,010 5 M
V+V mL disolucio n
1 mmol Na CO

V mL Na CO 10 4 M
[CO ] =

Calculando el producto inico:


5,010

5,010

= 2,510 8

Como se observa, el producto inico es mayor que Kps , por tanto, S se forma precipitado.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

19

C) El potencial de reduccin del permanganato potsico en una disolucin en la que las


concentraciones de permanganato y de Mn (II) son iguales depende nicamente del pH. Si el
potencial de reduccin del semisistema
/
es 1,52 V partiendo de la ecuacin de
Nernst que establece que:
0,059

= +

donde los valores de x, y, z y n se determinan al ajustar el semisistema de reduccin.


c1) Calcula como vara el potencial de reduccin del semisistema
/
en funcin del
pH.
La semirreaccin de reduccin del MnO es:
MnO + 8 H + 5 e

Mn + 4 H O

La expresin del potencial queda como:


E = E +

[MnO ] [H
0,059
log
[Mn ]
5

Como [MnO ] = [Mn ], la expresin anterior se simplifica y queda como:


E = E +

0,059
log [H
5

E = 1,52 0,0944 pH

c2) Determina a partir de qu valor de pH el permanganato no ser capaz de oxidar los iones
a , considerando que el potencial normal del semisistema /
es de 1,07 V.
Para se produzca la reaccin es necesario que E > 1,07 V:
1,52 0,0944 pH > 1,07
pH < 4,77
(O.Q.N. Ciudad Real 1997)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

7. Se introdujo en un recipiente una mezcla de 11,02 mmol de


y 5,48 mmol de
un catalizador de Pt, establecindose el siguiente equilibrio, a 700C y 762 Torr:

20

, junto con

2
(g) +
(g)
4 (g) +
(g)
La mezcla de reaccin se separ del catalizador y se enfri rpidamente hasta temperatura
ambiente, a la cual las velocidades de las reacciones directa e inversa son despreciables. Al
analizar la mezcla se encontraron 0,711 mmol de
.
a) Calcular y y a 700C.
a) La tabla correspondiente expresada en mmol:

ninicial
ntransformado
nformado
nequilibrio

H2 S
11,02
2x

11,02 2x

CH4
5,48
x

3,48 x

4x
4x

CS2

x
x

Como x = 0,711 mmol, las cantidades en el equilibrio son:



nequilibrio

H2 S
9,598

CH4
4,769

H2
2,844

CS2
0,711

El total de moles en el equilibrio es:


n = 9,598 + 4,769 + 2,844 + 0,711 = 17,922 mmol
y las respectivas fracciones molares:
xH2 S =
xH2 =

n H2 S
nCH4
9,598 mmol
4,769 mmol
=
= 0,536 xCH4 =
=
= 0,266
n
n
17,922 mmol
17,922 mmol

nH2
nCS
2,844 mmol
0,711 mmol
=
= 0,159 xCS2 = 2 =
= 0,040
n
n
17,922 mmol
17,922 mmol

La constante de equilibrio de la reaccin en funcin de las fracciones molares (K ), mejor


llamarle K , ya que se trata de una mezcla en fase gasesosa:
K =

yCS y
2

yCH y
4

0,040 0,159
0,266 0,536

= 3,3510

De acuerdo con la ley de Dalton, las presiones parciales en el equilibrio son:


pCS = pyCS = 762 Torr 0,040
2

pH = pyH = 762 Torr 0,159


2

1 atm
= 0,040 atm
760 Torr

1 atm
= 0,159 atm
760 Torr

pCH = pyCH = 762 Torr 0,266


4

pH S = pyH S = 762 Torr 0,536


2

1 atm
= 0,266 atm
760 Torr

1 atm
= 0,536 atm
760 Torr

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

21

La constante de equilibrio de la reaccin en funcin de las presiones parciales, K , es:


K =

(pCS ) (pH )4
2

(pCH ) (pH S )
4

0,040 0,159
0,266 0,536

= 3,3510

La relacin entre las constantes K y K viene dada por la expresin:


K = K RT

donde
= coef. Esteq. Productos gaseosos coef. Esteq. Reactivos gaseosos = 5 3 = 2
Sustituyendo:
K = 3,3510 4 [0,082 700+273

= 5,2610

b) Determinar si el proceso es espontneo o no a esa temperatura.


Para saber si el proceso es o no espontneo se calcula el valor de G:
r G = RT ln Kp
Sustituyendo:
r G = 8,31410 3 kJK

700+273 K ln 3,3510

= 66 kJ

Como r G > 0 se trata de un proceso NO espontneo.


c) Explica como afectara al equilibrio cada una de las siguientes variaciones:
c1) Aumento de la presin total.
c2) Disminucin de la concentracin de CH4 .
c3) Aumento de la temperatura si el proceso es exotrmico a 700C.
El principio de Le Chtelier dice:
cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
c1) Si se aumenta la presin, de acuerdo con el principio de Le Chtelier, el sistema se
desplaza en el sentido en el que la presin disminuya, es decir, hacia donde se formen menos
moles de gas, en este caso hacia la formacin de CH4 y H2 .
c2) Si disminuye la concentracin de CH4 , de acuerdo con el principio de Le Chtelier, el
sistema se desplazar en el sentido en el que aumente la concentracin de CH , es decir, hacia
la formacin de CH4 y H2 .
c3) Si se aumenta la temperatura, de acuerdo con el principio de Le Chtelier, el sistema se
desplazar en el sentido en el que descienda la temperatura, es decir, en el sentido en el que
se consuma calor y como se trata de un proceso exotrmico, el sistema se desplaza hacia la
formacin de CH4 y H2 .
(O.Q.N. Ciudad Real 1997)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

22

8. Treinta gramos de un compuesto orgnico, formado por C, H y O, se queman en exceso de


oxgeno y se producen 66 g de dixido de carbono y 21,6 g de agua.
a) Calcula el nmero de tomosgramo de cada uno de los elementos que lo forman.
Teniendo en cuenta que en la combustin del compuesto orgnico (X) todo el C se transforma
en CO y el H en H O, los moles de tomos en la muestra del compuesto X son:
66,0 g CO

1 mol CO 1 mol C

= 1,5 mol C
44 g CO 1 mol CO

21,6 g H O

1 mol H O 2 mol H

= 2,4 mol H
18 g H O 1 mol H O

El oxgeno contenido en el compuesto X se calcula por diferencia:


30 g X 1,5 mol C
9,6 g O

12 g C
1 g H
= 9,6 g O
+ 2,4 mol H
1 mol C
1 mol H

1 mol O
= 0,6 mol O
16 g O

b) Cul es la frmula molecular del compuesto, si la masa molecular es 100?


Para obtener la frmula molecular se relacionan los moles de tomos de cada elemento con la
masa molar del compuesto X:
mol C
1,5 mol C 100 g X

= 5
mol X
30 g X 1 mol X
mol H
2,4 mol H 100 g X

= 8

mol X
30 g X 1 mol X

fo rmula molecular: C5 H8 O2

mol O
0,6 mol O 100 g X

= 2
mol X
30 g X 1 mol X
c) Considerando que dicha frmula molecular corresponde a un cido monocarboxlico aliftico.
c1) Escribir las frmulas estructurales y nombrar todos los ismeros posibles.
COOHCH=CH

COOHC CH3 =CH


COOH

COOH

cido 2pentenoico

cido 2metil2butenoico

cido 3pentenoico

CH=

cido 2metil3butenoico

CH=

cido 4pentenoico

cido 3metil2butenoico

COOHCH=C
COOHC

CH=CH

COOHCH
COOH

cido 2etilpropenoico

cido 3metil3butenoico

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

23

c2) Cules de dichos ismeros presentan isomera geomtrica? Escribe los ismeros cistrans.


cido cis2pentenoico


cido trans2pentenoico

cido cis3pentenoico


cido trans3pentenoico


cido cis2metil2butenoico


cido trans2metil2butenoico

d) De todos los ismeros solo uno de ellos presenta actividad ptica.


d1) Indica cul es y seala el carbono asimtrico.

Se trata del cido 2metil3butenoico


d2) Qu hibridacin presenta cada tomo de carbono?
Si el tomo de carbono presenta:
enlaces sencillos hibridacin sp
enlaces dobles hibridacin sp

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

24

d3) Indica el nmero de enlaces y el nmero de electrones de valencia no enlazantes.


Si el tomo de carbono presenta enlaces dobles: uno de los enlaces
es y el otro es .
Al existir en la molcula dos tomos de carbono con enlace doble,
sta presenta 2 enlaces .
Como se observa en la figura, la molcula presenta 8 electrones
no enlazantes, cuatro sobre cada tomo de oxgeno.

d4) Qu hidrgeno presenta caractersticas cidas? Escribe la reaccin del compuesto con
hidrxido de sodio.
Se trata del tomo de hidrgeno del grupo carboxilo.
La reaccin con NaOH es:
=CHCH

COOH + NaOH

=CHCH

COONa +

(O.Q.N. Ciudad Real 1997)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

25

9. La obtencin de carbonato sdico (


) mediante el mtodo Solvay utiliza sal de roca
(NaCl) y caliza (
) como materias primas, sin embargo el proceso de sntesis se realiza en
varias etapas y no por reaccin directa de cloruro sdico y carbonato de calcio. Estas etapas
pueden quedar esquematizadas con los comentarios que a continuacin se detallan:
Primera etapa: Descomposicin trmica del carbonato de calcio a unos 1000C generando
dixido de carbono.
Segunda etapa: Paso de una corriente de
(g) a travs de una disolucin de
(g) en agua,
obteniendo as un carbonato cido.
Tercera etapa: Reaccin del carbonato cido, obtenido en la etapa anterior, con NaCl (ac) que
permite obtener
.
Cuarta etapa: La descomposicin trmica del carbonato cido de sodio conduce a la formacin
del producto deseado, as como a un gas que se utiliza en una de las etapas ya comentadas del
proceso.
Adems, mediante una quinta etapa, el mtodo Solvay permite que en el proceso global slo
quede como producto residual
(s), haciendo reaccionar los productos residuales de las
etapas anteriores.
Contestar las siguientes preguntas:
a) Si se desea obtener 3 t/da de carbonato sdico qu cantidades de caliza y sal de roca sern
necesarias diariamente si su contenido en
y NaCl es el 85% y 95% respectivamente?
En primer lugar se escriben las ecuaciones qumicas de las cuatro etapas del proceso,
debidamente ajustadas con el fin de obtener la reaccin global del mtodo Solvay.
Primera etapa:
CaCO

CaO + CO

Segunda etapa:
2 [CO + NH + H O

NH HCO ]

Tercera etapa:
2 [NH HCO + NaCl

NaHCO + NH Cl]

Cuarta etapa:
2 NaHCO

Na CO + CO + H O

Quinta etapa:
CaO + H O

Ca OH

Ca OH + 2 NH Cl

CaCl + 2 NH + 2 H O

Reaccin global:
+ 2 NaCl

+ Na2 CO3

El nmero de moles de Na CO a obtener es:


3

t Na CO 106 g Na CO 1 mol Na CO
g Na CO


= 2,83104

da
1 t Na CO 106 g Na CO
da

Relacionando Na CO con NaCl:


2,83104

Na CO 2 mol NaCl 58,5 g NaCl


g NaCl


= 3,31106

da 1 mol Na CO 1 mol NaCl
da

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

26

Como se trata de sal de roca con 95% de NaCl:


3,31106

t sal de roca
g NaCl 100 g sal de roca 1 t sal de roca

6
= 3,48

95 g NaCl

da
10 g sal de roca

Relacionando Na CO con CaCO :


2,83104

g Na CO 1 mol CaCO 100 g CaCO


g CaCO


= 2,83106

da
1 mol Na CO 1 mol CaCO
da

Como se trata de caliza con 85% de CaCO :


2,83106

t caliza
g CaCO 100 g caliza 1 t caliza

6
= 3,33

da
85 g CaCO 10 g caliza

b) La disolucin acuosa de cloruro sdico que se utiliza es saturada y se denomina salmuera.


Sabiendo que la solubilidad en agua de NaCl a 100C es de 39,12 g por cada 100 cm3, calcule la
cantidad de agua/da a esa temperatura que sera necesaria para preparar la cantidad de
salmuera requerida en el proceso.
Relacionando NaCl con agua:
3,3110

m3
g NaCl 100 cm3 H O 1 m3 H O

6
= 8,46
da 39,12 g NaCl 10 cm3 H O

c) El
(g) utilizado puede ser sintetizado mediante el proceso Haber, por reaccin directa
entre hidrgeno y nitrgeno en fase gaseosa a 450C y presin elevada. Sabiendo que se trata de
un equilibrio que puede ser modificado utilizando diferentes condiciones de reaccin, justifquese
la presin utilizada.
La reaccin del proceso Haber es:
N (g) + 3 H (g)

2 NH (g)

El principio de Le Chtelier dice:


cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
Si se aumenta la presin, de acuerdo con el principio de Le Chtelier, el sistema se desplaza
en el sentido en el que la presin disminuya, es decir, hacia donde se formen menos moles de
gas, en este caso hacia la formacin de
.
d) En el mtodo Solvay descrito anteriormente se producen, en diferentes etapas, dos compuestos
qumicos, que por reaccin directa nos permiten generar
(g) de forma diferente al proceso
Haber. Indique el proceso qumico que origina el
(g) en el mtodo Solvay.
Se trata de la reaccin entre el Ca OH obtenido en la quinta etapa y el NH Cl obtenido en la
tercera etapa:
+ 2 NH4

CaCl2 + 2

+ 2 H2
(O.Q.N. Burgos 1998)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

27

10. Se analiz una aleacin de plomo y plata disolviendo una muestra de 0,5000 g en 50 mL de
cido ntrico de concentracin 5 M. La disolucin resultante se dividi en dos porciones alcuotas
de igual volumen. La primera de ellas se trat con yodato potsico en exceso y el precipitado
obtenido alcanz un peso constante de 0,6605 g.
a) Determinar el porcentaje de cada metal en la aleacin.
Al disolver la aleacin en HNO todo el plomo se transforma en Pb
(aq):
Pb (s) + Ag (s) + HNO (aq)

(aq) y la plata en Ag

Pb (aq) + Ag (aq)

Al dividir en dos partes la disolucin resultante de la muestra cada una contendr la mitad de
la muestra, es decir, 0,25 g de ambos metales.
El tratamiento con KIO en exceso de una las porciones alcuota produce la precipitacin de
ambos metales:
Pb (aq) + Ag (aq) + KIO (aq)

Pb IO

(s) + AgIO (s)

Llamando x e y a los gramos de Ag y de Pb que contiene cada una de las porciones,


respectivamente, se puede plantear un sistema de ecuaciones.
Ecuacin con la mezcla inicial:
x g Ag + y g Pb = 0,25 g aleacin
Ecuacin con el precipitado obtenido:
x g Ag

1 mol Ag 1 mol AgIO 282,9 g AgIO




= 2,622 x g AgIO
107,9 g Ag 1 mol Ag 1 mol AgIO

y g Pb

1 mol Pb 1 mol Pb IO

1 mol Pb
207,2 g Pb

2,622 x g AgIO + 2,689 y g Pb IO

557,2 g Pb IO
1 mol Pb IO

= 2,689 y g Pb IO

= 0,6605 g precipitado

Resolviendo el sistema se obtiene para cada alcuota:


x =

0,1742 g Ag 2 alcuota 0,3484 g Ag



=

muestra
muestra
alcuota

y =

0,0758 g Pb 2 alcuota 0,1516 g Pb



=

muestra
muestra
alcuota

Expresando el resultado en forma de porcentaje en masa:


0,3484 g Ag
0,1516 g Pb
100 = 69,7% Ag
100 = 30,3% Pb
0,5 g aleacio n
0,5 g aleacio n
b) Cul es la concentracin de cada catin en la disolucin de partida?
[Ag ] =

0,3484 g Ag
1 mol Ag 103 mL disolucio n


= 6,4610
1 L disolucio n
50 mL disolucio n 107,9 g Ag

0,1516 g Pb
1 mol Pb

[Pb ] =
50 mL disolucio n 207,2 g Pb

103 mL disolucio n

= 1,4610
1 L disolucio n

M
2

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

28

En la otra porcin alcuota se pretendi separar ambos metales precipitando la mayor cantidad
posible de uno de ellos mientras el otro permanece en disolucin en su totalidad. Para ello se
dispone de los siguientes reactivos precipitantes: yoduro, tiocianato y bromuro.
c) Cul de los dos metales quedar en el precipitado y cul en el filtrado?
Razonar la respuesta.
Constantes de solubilidad de los yoduros, tiocianatos y bromuros de plata y de plomo:




Plata
Plomo
10

Yoduro


3,2010
8,4910 9

Tiocianato (sulfocianuro)
2,5010 12
2,1110 5
13

Bromuro


5,3510
6,6010 6

Yodato


3,1610 8
3,1610 13
Para que se forme un precipitado es preciso que se cumpla que el producto inico sea mayor
que K . Como el producto de solubilidad de las correspondientes sales de plata es menor que
el de las sales plomo (II), aqullas precipitan antes.
Agente precipitante bromuro
Las ecuaciones qumicas correspondientes a la disolucin del AgBr y del PbBr spn,
respectivamente:
Ag (aq) + Br (aq)

AgBr (s)
PbBr (s)

Pb (aq) + 2 Br (aq)

A partir de las constantes K se obtiene la concentracin de iones Br necesaria para la


precipitacin de los iones Ag y Pb de la disolucin:
K = [Ag ] [Br ]

K
5,3510
[Br ] =
=
[Ag ]
6,4610

K = [Pb ] [Br

K
[Br ] =
[Pb

Por tanto, precipita antes

13
2

= 8,2810

6,6010
1,4610

12

6
2 = 2,1310

ya que precisa una menor cantidad de Br .

La concentracin de Ag cuando comienza a precipitar Pb es:


[Ag ] =

K
2,1310
=
[Br ]
2,1310

2
2 = 2,5110

11

Agente precipitante tiocianato


Las ecuaciones qumicas correspondientes a la disolucin del AgSCN y del Pb SCN spn,
respectivamente:
AgSCN (s)
Pb SCN (s)

Ag (aq) + SCN (aq)


Pb (aq) + 2 SCN (aq)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

29

A partir de las constantes K se obtiene la concentracin de iones SCN necesaria para la


precipitacin de los iones Ag y Pb de la disolucin:
K = [Ag ] [SCN ]

[SCN ] =

K = [Pb ] [SCN

[SCN ] =

Por tanto, precipita antes

K
2,5010
=
[Ag ]
6,4610
K
[Pb

12
2

= 3,8710

2,1110

1,4610

11

5
2 = 3,8010

ya que precisa una menor cantidad de SCN .

La concentracin de Ag cuando comienza a precipitar Pb es:


[Ag ] =

K
2,5010
=
[SCN ]
3,8010

12
2

11

= 6,5810

Agente precipitante yoduro


Las ecuaciones qumicas correspondientes a la disolucin del AgI y del PbI spn,
respectivamente:
Ag (aq) + I (aq)

AgI (s)
PbI (s)

Pb (aq) + 2 I (aq)

A partir de las constantes K se obtiene la concentracin de iones I necesaria para la


precipitacin de los iones Ag y Pb de la disolucin:
K = [Ag ] [I ]

[I ] =

K = [Pb ] [I

[I ] =

Por tanto, precipita antes

K
3,2010
=
[Ag ]
6,4610
K
[Pb

10
2

= 4,9510 9 M

8,4910
1,4610

9
2 = 7,6310

ya que precisa una menor cantidad de I .

La concentracin de Ag cuando comienza a precipitar Pb es:


[Ag ] =

K
3,201010
=
= 4,1910 7 M
[I ]
7,6310 4

Poniendo los resultados obtenidos en forma de tabla:


Agente precipitante
Bromuro
Tiocianato
Yoduro

[Ag ] / M cuando comienza a precipitar Pb


2,5110

11

6,5810

11

4,1910

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

30

El bromuro es el mejor agente separador ya que, segn se ve en la tabla, consigue que


cuando comienza a precipitar Pb la cantidad de Ag en disolucin sea menor.
d) Qu porcentaje de metal precipitado sera imposible separar utilizando como reactivo el
yoduro, que es el menos apropiado?
50 mL disolucio n

4,1910 7 mmol Ag 107,9 mg Ag


1 g Ag

3
= 2,2610 6 g Ag
mL disolucio n
1 mmol Ag 10 mg Ag

% pe rdidas Ag =

2,2610 6 g Ag (disolucio n)
100 = 6,5104
0,3482 g Ag (muestra)
(O.Q.N. Burgos 1998)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

31

11. Las reacciones de combustin son aquellas en las que se produce la oxidacin de una
sustancia, por reaccin de sta con oxgeno molecular acompaada de gran desprendimiento de
calor y a veces de llama, lo que justifica su nombre.
Para medir los calores de combustin se emplea la bomba calorimtrica que es un recipiente de
paredes metlicas resistentes, que se puede cerrar hermticamente, y donde se introduce una
muestra de masa conocida de la sustancia, mezclada con oxgeno a una presin de varias
atmsferas, despus de eliminar el aire, para garantizar la total combustin de la muestra. La
bomba va instalada en un calormetro de agua, perfectamente termostatizado, y la combustin
se inicia mediante ignicin con un conductor elctrico en cortocircuito. El calor desprendido se
mide por la elevacin de la temperatura del agua del calormetro, tras realizar los ajustes
necesarios para relacionar esta variacin de temperatura con el calor desprendido en el proceso.
Se queman en una bomba calorimtrica 0,2840 g de acetona lquida. La capacidad calorfica
total de la bomba es de 2817 JK . Durante el experimento se observa una elevacin de la
temperatura desde 18,57 a 20,26C.
a) Calcular el calor de combustin en la bomba calorimtrica expresado en J/g de sustancia.
La bomba se comporta como un sistema aislado, Q
+ Q

= Q

= 0, luego:

= 0
= Q = k T

donde k es la capacidad calorfica total de la bomba.


Q = 2817 JK 1 (20,26 18,57) K = 4761 J
Relacionando el calor con la masa de acetona quemada:
Q =

4761 J
= 16763 Jg
0,2840 g

Puesto que la bomba calorimtrica, dentro de la cual se produce la combustin, es un recipiente


de paredes rgidas,
b) qu propiedad termodinmica se mide directamente a partir del calor de combustin?
En una bomba calorimtrica se mide el calor desprendido a V constante, que es igual a la
variacin de energa interna, = E.
c) Calcular la variacin de energa interna por mol de acetona. (Justificar el signo, + , que
corresponde a esta variacin).
El signo () correspondiente a la variacin de energa interna quiere decir que se trata de un
proceso exotrmico en el que se desprende calor.
E =

16763 J 58 g C3 H6 O 1 kJ


= 972,3 kJmol
g C3 H6 O 1 mol C3 H6 O 103 J

d) Escribir la reaccin que ocurre en el interior de la bomba calorimtrica, indicando el estado


fsico de reactivos y productos a 293,41 K.
La ecuacin qumica ajustada correspondiente a la combustin de la acetona es:
(l) + 4

(g)

(g) + 3

(l)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

32

e) Hay variacin de presin en el interior de la bomba calorimtrica? Por qu?


En la combustin de 1 mol de acetona se produce un descenso de presin en el interior
de la bomba ya que se pasa de 4 moles de gas (O ) a 3 moles de gas (CO ).
La relacin que existe entre los calores de reaccin a volumen y a presin constantes se puede
establecer si se parte de la propia definicin de entalpa como funcin transformada de Legendre
respecto a la energa interna, que una vez integrada entre el estado inicial y el final de la
reaccin, resulta:
H = U + (PV)
Despreciando el volumen ocupado por las sustancias lquidas presentes en el sistema y
admitiendo comportamiento ideal para las gaseosas:
f) Calcular la entalpa molar de la reaccin de combustin, cH para T = 293,41 K .
La ecuacin de Kirchhoff permite el clculo de la entalpa de reaccin a si se conoce a y se
dispone de datos de la capacidad calorfica de reactivos y productos en funcin de la
temperatura, que en este caso son de la forma = a + bT + cT JK mol (ver tabla de
datos).
H =

H +

dT donde

= i

, (productos)

, (reactivos)

siendo i los coeficientes estequiomtricos de los productos y reactivos, respectivamente.


Aplicando la ecuacin dada:
H = U + (PV) = U + nRT
Sustituyendo:
H = 972,3 kJmol 1 + 3 4 8,31410 3 kJmol 1 K

293,41 K = 974,7 kJmol

g) Calcular la expresin de
, para esta reaccin.
Datos: Constantes a, b, c de la funcin = a + bT + cT JK 1 mol 1
Sustancias
a
(g)
29,96
(g)
44,23
(l)
74,48
CO
(l)

b103
4,18
8,79

99,32

c105
1,67
8,62

Teniendo en cuenta la reaccin de combustin:


C H O (l) + 4 O (g)

3 CO (g) + 3 H O (l)

Los valores de i C para cada componente son:


3 C

= 3 44,23 + 8,7910 3 T 8,6210 5 T Jmol 1 K 1

3 C

= 3 74,48 = 233,44 Jmol 1 K 1

4 C
C

= 3 29,96 + 4,1810 3 T 1,6710 5 T Jmol 1 K 1


= 99,32 Jmol 1 K 1

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

33

Sustituyendo en la ecuacin dada:


r Cop,i = i Cop,i (productos) i Cop,i (reactivos)
Se obtiene
r Cop,i = 136,97 + 9,6510

T 1,9210

T JK


(O.Q.N. Burgos 1998)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

34

12. La reaccin del alqueno terminal A (


) con cido bromhdrico concentrado conduce a la
adicin de HBr al doble enlace generando un compuesto B, que presenta un grupo tercbutilo en
su estructura. La reaccin de B con cianuro potsico en medio cido diluido produce el nitrilo C
(
), a partir del cual se puede obtener el cido 2,2dimetilpropanoico D (
).
a) Escribir las frmulas y dar el nombre sistemtico de todos los posibles ismeros estructurales
y geomtricos de A.


cis2buteno


trans2buteno


1buteno

metilpropeno

b) Calcular la frmula emprica de B sabiendo que contiene 35,04% de carbono, 6,57 % de


hidrgeno y 58,39 % de bromo.
Para calcular la frmula emprica se calcula el nmero de moles de tomos de todos los
elementos. Tomando como base de clculo 100 g de B y relacionando el nmero de moles del
elemento que est presente en menor cantidad con el resto de los elementos se obtiene la
frmula emprica o sencilla:
35,04 g C

6,57 g H

58,39 g Br

1 mol C
= 2,92 mol C
12 g C

1 mol H
= 6,57 mol H dividiendo por 0,73
1 g H

1 mol Br
= 0,73 mol Br
79,9 g Br

mol C
2,92 mol C
= 4
mol Br
0,73 mol Br
mol H
4,58 mol H
= 9
mol Br
0,73 mol Br

La frmula emprica del compuesto B es C4 H9 Br.


c) Dibujar las estructuras de A, B, C y D.
Si en la reaccin entre el hidrocarburo A y el HBr se forma B que contiene el grupo tbutilo,
necesariamente, A ha de ser el metilpropeno. De acuerdo con la regla de Markovnikov, que
dice que el tomo de H es adicionado por el tomo de C ms hidrogenado, por lo que el
compuesto B es el 2bromo2metilpropano:


Compuesto A

Compuesto B

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

35

Los nitrilos se obtienen por reaccin entre halogenuros de alquilo y cianuro de potasio:


Compuesto B

Compuesto C

A partir del 2,2dimetilpropanonitrilo se obtiene el cido 2,2dimetilpropanoico:


Compuesto C

Compuesto D

Un estudiante que llev a cabo la anterior secuencia de reacciones comenzando con 5,6 litros de
A, medidos en condiciones normales de presin y temperatura, obtuvo 8,5 g de D.
d) Calcular el rendimiento global del proceso.
Para obtener el rendimiento del proceso es necesario calcular previamente la cantidad terica
de compuesto D que debera haber sido obtenida:
5,6 L C4 H8
=

1 mol C H 1 mol C H O 102 g C H O




= 25,5 g C H O
22,4 L C H
1 mol C H
1 mol C H O

8,5 g C H O (real)
100 = 33,3%
25,5 g C H O (teo rico)

Usando una serie similar de reacciones es posible obtener el cido 2metilbutanoico E (


).
e) Dar la estructura de los hidrocarburos de partida que podran ser utilizados para producir el
cido E.
Partiendo del 1buteno y siguiendo el mismo esquema de reacciones:


(O.Q.N. Burgos 1998)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

36

13. Calcule el pH de las siguientes disoluciones:


a) Una disolucin acuosa de cido actico de concentracin 0,2 M.
(Dato.

cido actico = 1,810 5 )

El cido actico (CH COOH), abreviadamente AcH, es un cido dbil que se disocia
parcialmente segn el equilibrio:
AcH (aq) + H O (l)

Ac (aq) + H O (aq)

cuya constante de acidez es:


K =

[Ac ] [H O ]

[HAc]

Aplicando los correspondientes balances y aproximaciones se obtiene:


[Ac ] = [H O ]

[AcH] = c [H O ]

siendo c la concentracin inicial de AcH. Sustituyendo estos valores en la expresin de la


constante queda:
K =

[H O

c [H O ]

Cuando se d la circunstancia de que:


c
> 100 se puede realizar la aproximacio n c [H O ] c
K

con lo que la ecuacin anterior queda como:


K =

[H O
c

Se obtiene
[H O ] = K c
pH = log 1,910

1,810 5 0,2 = 1,910 3 M


3

= 2,72

b) Una disolucin preparada disolviendo 8,2 g de acetato sdico en agua destilada hasta obtener
500 mL de disolucin.
El acetato de sodio, NaCH COO, abreviadamente NaAc, se disuelve en agua:
NaAc (aq) + H O (l)

Ac (aq) + Na (aq)

La concentracin de esta disolucin es:


c =

1 mol NaAc
8,2 g NaAc

= 0,2 M
0,5 L disolucio n 82 g NaAc

El ion Na no se hidroliza ya que procede del NaOH (base fuerte).

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

37

El ion Ac se hidroliza produciendo iones OH segn la reaccin:


Ac + H O

HAc + OH

Aplicando los correspondientes balances y aproximaciones se puede escribir:


[HAc] = [OH ] = x

[Ac ] = c [OH ] = c x

La expresin de la constante queda como:


K =

[HAc] [OH ]

[Ac ]

El valor de la constante de basicidad (hidrlisis) del cianuro se calcula mediante la siguiente


expresin:
K

Kw
K

10

14

1,810

= 5,610

10

Como se cumple que:


c
> 100 se puede realizar la aproximacio n c [OH ] c
K

con lo que la ecuacin anterior queda como:


K =

[OH
c

pOH = log 1,0610

[OH ] = K c = 5,610
5

= 4,97

10

0,2 = 1,0610 5 M

pH = 14 pOH = 14 4,97 = 9,03

Una disolucin formada por un cido dbil cualquiera (HA) y una sal del cido con una base
fuerte (NaA), se denomina disolucin amortiguadora de pH y tiene la propiedad caracterstica
de manifestar pequeas variaciones de pH por efecto de la dilucin o de la adicin de cantidades
moderadas de cidos o bases. El pH de este tipo de disoluciones se calcula a partir de la frmula:
pH=
+ log [sal]/[cido]
Siendo Ka la constante de acidez del cido HA.
c) Calcule el pH de una disolucin obtenida al mezclar 500 mL de la disolucin del apartado a)
con los 500 mL de la disolucin del apartado b)
Al mezclar las disoluciones de los apartados a) y b) se obtiene una disolucin amortiguadora
en la que las concentraciones de sal y cido son, suponiendo volmenes aditivos:
HAc = [NaAc] =

500 mL NaAc 0,2 M


0,2 mol NaAc
103 mL
3

= 0,1 M
500+500 mL 10 mL NaAc 0,2 M 1 L

El pK del HAc es:


pK = log K = log 1,810

= 4,74

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

38

Aplicando la ecuacin del enunciado se obtiene:


pH = 4,74 + log

0,1
= 4,74
0,1

La adicin de un cido fuerte (por ejemplo HCl), en cantidad moderada, a esta disolucin,
provoca la reaccin:
NaA + HCl
HA + NaCl
Es decir, aumenta un poco la concentracin del cido dbil, y disminuye la concentracin de la
sal.
La adicin de una base fuerte (por ejemplo NaOH), en cantidad moderada, provoca la reaccin:
HA + NaOH
NaA +

Que aumenta un poco la concentracin de la sal y disminuye en otro tanto la del cido dbil.
d) Calcule el pH de:
d1) Una disolucin preparada al agregar 10 mL de cido clorhdrico 1 M a la disolucin del
apartado c).
10 mL de HCl 1 M proporcionan:
10 mL HCl 1 M

1 mmol HCl
= 10 mmol HCl
1 mL HCl 1 M

Segn el equilibrio propuesto en el apartado a) el HCl aadido reacciona con los iones Ac
formando AcH:
10 mmol HCl

1 mmol HAc
= 10 mmol HAc
1 mmol HCl

10 mmol HCl

1 mmol NaAc
= 10 mmol NaAc
1 mmol HCl

Suponiendo volmenes aditivos, las nuevas concentraciones al recuperarse el equilibrio son:


1 L HAc 1 M
HAc =

1 mol HAc
0,1 mol HAc
+ 10 mmol HAc 3
1 L HAc 0,1 M
10 mmol HAc = 0,1089 M
1 L
1 L + 10 mL 3
10 mL

1 L NaAc 1 M
[NaAc] =

1 mol NaAc
0,1 mol NaAc
10 mmol NaAc 3
1 L NaAc 0,1 M
10 mmol NaAc = 0,0891 M
1 L
1 L + 10 mL 3
10 mL

Aplicando la ecuacin del enunciado se obtiene:


pH = 4,74 + log

0,0891
= 4,65
0,1089

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

39

d2) Una disolucin obtenida al agregar 10 mL de cido clorhdrico 1 M a un litro de agua


destilada.
Al aadir 10 mL de HCl 1 M a 1 L de agua destilada se obtiene una disolucin de HCl cuya
concentracin, suponiendo volmenes aditivos, es:
1 mol HCl
1 mmol HCl

1 mL HCl 1 M 103 mmol HCl
= 9,910 3 M
1 L
1 L + 10 mL 3
10 mL

10 mL HCl 1 M
HCl =

Como el HCl es un cido fuerte se encuentra totalmente disociado en iones:


HCl (aq) + H O (l)

Cl (aq) + H O (aq)

Por tanto, [HCl] = [H O ] = 9,910 3 M

pH = log 9,910

= 2,004
(O.Q.N. Almera 1999)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

40

14. El contenido en hierro de una muestra determinada, se puede conocer mediante una
valoracin de oxidacinreduccin. Para ello, en primer lugar, se disuelve la muestra en un cido
fuerte, reduciendo despus todo el hierro (III) a in ferroso, utilizando un reductor adecuado.
Esta disolucin, se valora utilizando como reactivo un oxidante, por ejemplo dicromato potsico
(disolucin patrn) que vuelve a pasar todo el ion ferroso a frrico, aadiendo un indicador que
nos avise de la finalizacin de la valoracin.
a) Exprese las semirreacciones de estos procesos, indicando la oxidacin y la reduccin, as como
la reaccin inica de la valoracin.
En la disolucin del Fe en cido las semirreacciones son:
reduccin: 2

+ 2 e

+ 3 e

oxidacin: Fe

2 Fe + 6

+ 3

Reducido el Fe a Fe , a continuacin, se hace reaccionar este con Cr O de acuerdo con la


reaccin:
reduccin:

+ 14

oxidacin: 6

+ 14

+ 6

+ 7

+ 6

+ 6

+ 7

b) Se prepara una disolucin patrn que contiene 4,90 g de dicromato potsico en un litro de
disolucin acuosa, con el fin de llevar a cabo una dicromatometra en medio cido. Una muestra
de mineral de hierro que pesaba exactamente 500 mg se disolvi en medio cido fuerte y
posteriormente se trat con un reductor de Jones para reducir el hierro (III) a ion ferroso. La
disolucin resultante se valor exactamente con 35,0 mL de la disolucin patrn de dicromato
potsico en presencia de un indicador adecuado. Exprese el resultado del anlisis, en porcentaje
de hierro en la muestra.
La masa de Fe contenida en la muestra es:
35 mL

4,9 g Cr O
10 mL

1 mol Cr O
294 g Cr O

6 mol Fe
1 mol Cr O

55,8 g Fe
1 mol Fe

= 0,196 g Fe

El porcentaje de hierro que contiene el mineral es:


0,196 g Fe
100 =
0,5 g muestra

, % Fe

c) Sabiendo que el potencial de reduccin del sistema


/
es 1,33 V, deducir la frmula
que determina como afecta el pH en medio cido al potencial redox de Nernst del sistema
dicromato/ion crmico.
La semirreaccin de reduccin del dicromato:
Cr O + 14 H + 6 e
Aplicando la ecuacin de Nernst:

2 Cr

+ 7 H O

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

E = Eo
E

41

0,0592
[red]
log

n
[oxd]
= E

0,0592
[Cr
log
6
[Cr O ] [H

Considerando que se trata del estado tipo o de referencia:


[Cr O ] = [Cr
E

] = 1 M

= 1,33

0,0592
1
log
6
[H

= 1,33 0,138 pH

d) En cuanto vara el potencial del sistema dicromato/ion crmico, al aumentar el pH en una


unidad?
El potencial (E ) para un pH determinado es:
E = 1,33 0,138 pH
El potencial (E ) para un pH = pH + 1 es:
E = 1,33 0,138 pH + 1
La variacin del potencial E es:
E = [1,33 0,138 pH + 1 ] [1,33 0,138 pH]

E = 0,138 V
(O.Q.N. Almera 1999)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

15. En un matraz de un litro de capacidad, se introducen 4,4 g de


La reaccin que tiene lugar es:

42

y 0,6 g de C (s) a 1000C.

C (s) +
(g)
2 CO (g)
Cuando el sistema reaccionante alcanza el equilibrio, la presin en el interior del matraz es de
13,9 atm.
a) Con los datos anteriores, calcule el valor de la constante de equilibrio, G de la reaccin a
1000C y los gramos de C (s),
(g) y CO (g) que hay contenidos en el matraz.
a) El nmero de moles iniciales de cada especie es:
0,6 g C

1 mol C
1 mol CO
= 0,05 mol C 4,4 g CO
= 0,10 mol CO2
44 g CO
12 g C

Para obtener el valor de G es necesario calcular previamente el valor de la constante K .


Construyendo la tabla de moles correspondiente:

ninicial
ntransformado
nformado
nequilibrio

C
CO
0,05
0,10
x
x

0,05 x
0,10 x
nt = 0,10 x + 2x = 0,10 + x

CO

2x
2x

Considerando comportamiento ideal se obtiene el nmero de moles transformados en el


equilibrio:
13,9 atm 1 L = 0,10+x mol 0,082 atmLmol 1 K

1000+273 K

Se obtiene, x = 3,3210 2 mol


Las presiones parciales en el equilibrio son:
pCO =
p

2 3,3210

mol 0,082 atmLmol 1 K


1 L

0,10 3,3210

1000+273 K

mol 0,082 atmLmol 1 K


1 L

1000+273 K

Sustituyendo en la expresin de la constante K :


K =

pCO
p

6,93
= 6,9
6,97

La relacin entre K y r G viene dada por la expresin


r G = RT ln K
Sustituyendo se obtiene:
r G = 8,314103 kJK

= 6,93 atm

1000+273 K ln 6,9 = 20,4 kJ

= 6,97 atm

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

43

La composicin del equilibrio es:


0,6 g C 3,3210 2 mol C

12 g C
= 0,202 g C
1 mol C

4,4 g CO 3,3210 2 mol CO


2 3,3210 2 mol CO

44 g CO
= 2,939 mol
1 mol CO

28 g CO
= 1,859 g CO
1 mol CO

La suma de estas masas coincide con la suma de las masas de las sustancias introducidas
inicialmente en el reactor.
b) Qu cantidad de
tendra que haber introducido en el matraz para que en el equilibrio
slo queden trazas de carbono, (10 5 g)?
Previamente, es necesario obtener el valor de la constante K .
K =

[CO
nCO
=
[CO ] Vn

4x2

V n x

Sustituyendo:
K =

4 3,3210

1 0,10 3,3210

= 6,610

Si al alcanzarse el equilibrio slo deben quedar 10 5 g de C:


0,6 g C x mol C

12 g C
= 10 5 g C
1 mol C

x 0,05 mol C

Sustituyendo en la expresin de la constante K se obtiene el valor de n que es la cantidad


inicial de CO que se debera haber introducido en el matraz
4 0,05
= 6,610 2
1 n 0,05
0,202 mol CO

44 g CO
= 8,9 g
1 mol CO

n = 0,202 mol CO

c) Cuando se alcanza el equilibrio en el apartado a), qu cantidad de CO tendra que


introducirse en el matraz para que queden 0,36 g de carbono en equilibrio?
Al alcanzarse el equilibrio del apartado a) las cantidades presentes son:

nformado
nequilibrio

C
CO
0,05 x
0,10 x
x = 3,3210 2 mol
1,6810 2
6,6810 2

CO
2x
6,6410

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

44

Al aadir CO, de acuerdo con el principio de Le Chtelier, el equilibrio se desplaza hacia la


izquierda de tal manera que la nueva cantidad de C en el equilibrio sea 0,36 g.
Sea n la cantidad, en moles, de CO que se aade al sistema en equilibrio. La nueva tabla de
moles es:

ninicial
ntransformado
nformado
nequilibrio

C
1,6810 2

x
1,6810 2 + x

CO
6,6810 2

x
6,6810 2 + x

CO
6,6410 2 + n
2x

6,6410 2 + n 2x

El nmero de moles de C en el equilibrio es:


0,36 g C

12 g C
= 3,0010 2 mol C
1 mol C

Permite calcular el nmero de moles transformados:


1,6810 2 + x mol C = 3,0010 2 mol C

nequilibrio

C
3,0010 2

CO
8,0010

x = 1,3210 2 mol C

CO
4,0010 2 + n

Sustituyendo en la expresin de la constante K :


4,0010 2 + n
1 8,0010

= 6,610 2

3,2510 2 mol CO

n = 3,2510 2 mol CO

28 g CO
= 0,911 g CO
1 mol CO

d) Si una vez alcanzado el equilibrio en el apartado a) aumentamos al doble el volumen del


matraz, cul ser la presin total de equilibrio y la composicin en las nuevas condiciones?
El principio de Le Chtelier dice: cualquier cambio en una de las variables que determinan el
estado de equilibrio de un sistema, causa un desplazamiento del equilibrio en el sentido que
tiende a oponerse al cambio en la variable modificada.
Segn la ley de Boyle, al duplicar el volumen del matraz a temperatura constante, la presin se
hace la mitad. De acuerdo con el principio de Le Chtelier, el equilibrio se desplaza hacia la
formacin de CO, donde hay ms moles de gas, de tal manera que se recupere la presin.
La nueva tabla de moles es:

ninicial
ntransformado
nformado
nequilibrio

C
1,6810 2
x

1,6810 2 x

CO
6,6810 2
x

6,6810 2 x

CO
6,6410 2

2x
6,6410 2 + 2x

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

45

Sustituyendo en la expresin de la constante K :


6,6410 2 + 2x
2 6,6810 2 x

= 6,610 2

x = 0,01 mol CO

El nmero de moles de gas en el equilibrio es:



nequilibrio
ntotal

CO
CO
5,6810 2 8,6410
0,1432

Considerando comportamiento ideal la presin que ejerce la mezcla gaseosa en el equilibrio


es:
0,1432 mol 0,082 atmLmol 1 K 1 1000+273 K
ptotal =
= 7,5 atm
2 L
e) Si una vez alcanzado el equilibrio en el apartado a), se introducen 4 g de He (gas inerte) y 2 g
de C (s), cul ser la nueva composicin de equilibrio y la presin total?
El efecto sobre el equilibrio:
Al aadir 2 g C, no se ejerce ningn efecto sobre el equilibrio, ya que como se observa en
la expresin de la constante de equilibrio, el C no interviene en la misma.
Al aadir 4 g de He (sustancia inerte) a volumen y temperatura constantes, slo aumenta
la presin del sistema en equilibrio por adicin del nuevo componente gaseoso.
Considerando comportamiento ideal la presin que ejerce el He es:
pHe =

4 g He 0,082 atmLmol 1 K
1 L

1000+273 K 1 mol He

= 104,39 atm
4 g He

De acuerdo con la ley de Dalton, la presin de la mezcla gaseosa en el equilibrio es:


ptotal = pCO + p

+ pHe = 6,93 + 6,97 + 104,39 atm = 118,3 atm


(O.Q.N. Almera 1999)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

46

16. M. Faraday en 1825, al realizar la destilacin fraccionada de un subproducto obtenido en la


fabricacin de gas de alumbrado a partir de aceite de ballena, obtuvo un hidrocarburo, que es
una de las sustancias ms importantes de la industria qumica orgnica. Actualmente, se
obtiene, en primer lugar, a partir de petrleo y, en menor proporcin a partir del alquitrn de
hulla. Este compuesto se utiliza en la produccin de polmeros y otras sustancias orgnicas.
Responda a los siguientes apartados:
a) La combustin de 1,482 g de este hidrocarburo produjo 1,026 g de agua y un gas que al ser
absorbido en una disolucin de hidrxido clcico, se formaron 11,400 g de carbonato clcico. Por
otra parte, se determin su masa molecular mediante el mtodo de Dumas. Llevado a cabo el
procedimiento operatorio, se obtuvo que 0,620 g del hidrocarburo en estado de vapor contenido
en un matraz de 246,3 mL de capacidad, ejercieron una presin de 748 mmHg, a la temperatura
de 100C. Determine la frmula molecular del compuesto.
Para evitar errores de redondeo resulta ms til calcular primero la frmula molecular del
hidrocarburo X a partir de su masa molar. Suponiendo que en estado gaseoso este se
comporta como gas ideal, por medio de la ecuacin de estado se obtiene su masa molar:
M =

0,620 g 0,082 atmLmol 1 K 1 100+273 K 760 mmHg 10 mL




= 78 gmol 1
1 atm
748 mmHg 246,3 mL
1 L

El H contenido en el hidrocarburo X se determina en forma de H O:


1,026 g H O 1 mol H O 2 mol H 78 g X
mol H

= 6



mol X
1,482 g X 18 g H O 1 mol H O 1 mol X
El C contenido en el hidrocarburo X se transforma en CO2 en la combustin y por reaccin
posterior con Ca OH 2 produce CaCO .
11,400 g CaCO 1 mol CaCO
1 mol C
78 g X
mol C



= 6

1,482 g X
100 g CaCO 1 mol CaCO 1 mol X
mol X
La frmula molecular o verdadera del hidrocarburo es C6 H6 .
La destilacin del alquitrn de hulla produce cinco fracciones: 1) Petrleo ligero" formado por
una mezcla de benceno y tolueno (metilbenceno); 2) Aceite intermedio" (fenol, cresoles y
naftaleno); 3) Aceite pesado" (cresoles impuros y fenoles); 4) Aceite verde" (antraceno y
fenantreno); y 5) Brea.
b) Se toma una muestra de Petrleo ligero" y se lleva a un recipiente cerrado, a 20C de
temperatura. Alcanzado el equilibrio entre la mezcla lquida y su vapor, se analiza el lquido e
indica un contenido en benceno del 86,5% (en peso). Calcule la fraccin molar del benceno en la
mezcla vapor a dicha temperatura.
Considere al sistema bencenotolueno como una mezcla ideal.
Datos (20C):
= 75 mmHg;
= 22 mmHg.
Previamente, se calcula la fraccin molar de la mezcla lquida:
86,5 g C H

= 1 0,883 = 0,117

86,5 g C H

1 mol C H
78 g C H

1 mol C H
1 mol C H
+ 13,5 g C H
78 g C H
92 g C H

= 0,883

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

47

Si se considera que la mezcla lquida es ideal, se cumple la ley de Raoult:


pi = poi xi
pC

6 H6

pC

7 H8

= 75 mmHg (0,833) = 66,225 mmHg


= 22 mmHg (0,117) = 2,574 mmHg

De acuerdo con la ley de Dalton, la presin total que ejerce la fase vapor es:
ptotal = pC

6 H6

+ pC

7 H8

= 66,225 + 2,574 = 68,799 mmHg

Como en la mezcla gaseosa se cumple la ley de Dalton:


pi = pyi
de donde se obtiene la composicin de la fase vapor:
yC

6 H6

pC

6 H6

66,225 mmHg
= 0,963
68,799 mmHg

La estructura de rayos X de los cristales de benceno slido pone de manifiesto que la molcula es
hexagonal plana, con longitud de enlace CC de 140 pm, intermedia entre el enlace sencillo
(154 pm) y doble (133 pm).
c) A partir de los siguientes datos de entalpas de hidrogenacin, calcule la energa de
resonancia de la molcula de benceno:
c1) La hidrogenacin es el proceso de adicin de H a un doble enlace. La entalpa de
hidrogenacin del doble enlace en el ciclohexeno es de 118,8 kJ/mol y el de un doble enlace en el
1,3ciclohexadieno es 110,9 kJ/mol.
c2) El valor de la entalpa de hidrogenacin del 1,3,5ciclohexatrieno (de uno de sus tres dobles
enlaces) puede ser estimado por extrapolacin de los dos valores de las entalpas de
hidrogenacin anteriores.
c3) La entalpa de la hidrogenacin experimental del benceno a ciclohexano es de 206,3 kJ/mol.
La entalpa de resonancia del benceno:


Ciclohexatrieno Benceno

H = ?

La determinacin de la entalpa de hidrogenacin del 1,3,5ciclohexatrieno se hace por


extrapolacin entre las entalpas de hidrogenacin del ciclohexeno y del ciclohexadieno.
Suponiendo una variacin lineal en las entalpas de hidrogenacin:
H

118,8 = EC=C + b

2 110,9 = 2 EC=C + b

= 3 E

EC=C = 103 kJ/mol



b = 15,8 kJ/mol

+ b = 3 103 15,8 = 342,8 kJ/mol

Dados los siguientes datos de entalpas de hidrogenacin:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

48


Ciclohexatrieno

Ciclohexano

H = 324,8 kJ/mol


Benceno

Ciclohexano

H = 206,3 kJ/mol

La entalpa de la reaccin problema es:


H = H H

H = 324,8 kJ/mol 206,3 kJ/mol = 118,5 kJ/mol


(O.Q.N. Almera 1999)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

49

17. Las reacciones de fusin nuclear consisten en la combinacin de dos ncleos para formar
otro ncleo con una masa mayor. Muchas reacciones de fusin liberan grandes cantidades de
energa. Estas reacciones son diferentes a las de fisin nuclear utilizadas en las centrales
nucleares actuales en las cuales el proceso es el contrario, es decir, un ncleo se rompe para dar
varios ncleos ms pequeos, aunque tienen en comn con las anteriores que en algunos casos la
cantidad de energa liberada tambin es muy alta.
Si se consiguiera controlar el proceso de fusin, se producira un avance cientfico y tecnolgico
gigantesco, ya que los reactores de fusin nuclear prometen energa virtualmente ilimitada para
el futuro. La razn est en que el combustible, es decir, los istopos del hidrgeno, existen en una
cantidad prcticamente ilimitada en la Tierra.
Las investigaciones llevan desarrollndose ms de 40 aos pero hasta el momento,
desgraciadamente, el xito no ha sido el deseado.
Entre las reacciones utilizadas, una de las ms prometedoras como posible fuente de energa es
la que hace reaccionar un tomo de deuterio y otro de tritio para dar un tomo de helio y un
neutrn:
+

+ + 17,6


Si fusemos capaces de aprovechar toda la energa liberada en esta reaccin, un slo kg de
combustible sera suficiente para proveer de energa elctrica a todos los hogares de la Regin
de Murcia durante algo ms de un mes (*).
(*) Estimacin aproximada tomando 1.100.000 habitantes y 300.000 hogares, cada uno con un
consumo medio de 300 kWh al mes.
Datos: E = 13,6 / (eV), donde E representa la energa del electrn, Z es el nmero atmico y
n el nivel energtico correspondiente.
Suponiendo que fuese aplicable el modelo atmico de Bohr para la descripcin de todos los
electrones implicados, determine:
a) La diferencia entre el momento angular del electrn de los istopos de hidrgeno y el de los
electrones del tomo de helio.
Segn el 1er postulado de Bohr:
L = m v r = n

h

2

En todas las especies n = 1, en cualquier caso se cumple que para el momento angular, L:
L = L

L =

h
h
= 0
2 2

b) De toda la energa desprendida, cul es el porcentaje debido a la energa electrnica?


Aplicando el modelo de Bohr la energa para cada electrn de los componentes de la reaccin
es:
2
ZHe
22
E = 13,6 2 = 13,6 2 = 54,4 eV
n
1
E = 13,6

ZH2
12
= 13,6
= 13,6 eV
n2
12

La variacin de energa electrnica del proceso de fusin es:


E

= E E

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

50

= 2 54,4 eV 2 54,4 eV = 81,6 eV

La energa desprendida en el proceso de fusin es:


E

= 17,6 106 eV

La relacin entre ambas es:


E
E

81,6 eV
17,610 eV

= 4,610

c) Qu relacin existe entre la velocidad de los electrones en el helio y la que poseen el electrn
del deuterio y del tritio? Calcule cuantitativamente dicha relacin.
En el modelo de Bohr la velocidad del electrn se calcula mediante la siguiente expresin:
1 Ze
m v
=

r
4 r
m v r = n

v =

h
2

Z e

2 h n

No existe diferencia entre las velocidades de los electrones de cualquiera de los istopos del
H. La relacin entre dichas velocidades en los dos tomos viene dada por:
Z e
v
2 h n
=

Z e
v
2 h n

v
Z
=
= 2
v
Z

d) Qu relacin existe entre el radio de la rbita de los electrones en los tomos de helio,
deuterio y tritio?
Sustituyendo el valor obtenido para v en el apartado anterior en la expresin del primer
postulado de Bohr se obtiene:
v =

Z e
2 h n

m v r = n

r =

h
2

h n

Z m e

No existe diferencia entre los radios de cualquiera de los istopos del H, ya que todos poseen
idntico valor de Z. La relacin entre los radios de las rbitas en el tomo de He y el de H viene
dado por:
h n
r
Z m e
=

h n
r
Z m e

r
Z
=
=
r
Z
(O.Q.N. Murcia 2000)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

51

18. El cido sulfrico puede obtenerse a partir de la tostacin de la blenda (mineral cuyo
principal componente es sulfuro de cinc), segn el proceso:
sulfuro de cinc + oxgeno
xido de cinc + dixido de azufre [1]
dixido de azufre + oxgeno
trixido de azufre [2]
trixido de azufre + agua
cido sulfrico [3]
Cuntos kilogramos de blenda, con un 53 % de sulfuro de cinc se necesitan para obtener 200 kg
de cido sulfrico 3,15 M?
Densidad del cido sulfrico: 1,19 g
.
Las ecuaciones qumicas correspondientes a las reacciones del proceso y la reaccin global
son:
2 ZnS (s) + 3 O2 (g)
2 SO2 (g) + O2 (g)

2 ZnO (s) + 2 SO2 (g)


2 SO3 (g)

2 SO3 (g) + 2 H2 O (l)

2 H2 SO4 (aq)

ZnS (s) + 2 O2 (g) + H2 O (l)


ZnO (s) + H2 SO4 (aq)

El nmero de moles de H2 SO4 que contiene la disolucin cida es:


200 kg H2 SO4 3,15 M

103 g H2 SO4 3,15 M 1 cm3 H2 SO4 3,15 M


1 L H2 SO4 3,15 M

3

1 kg H2 SO4 3,15 M 1,19 g H2 SO4 3,15 M 10 cm3 H2 SO4 3,15 M
3,15 mol H2 SO4
= 529,4 mol H2 SO4

1 L H2 SO4 3,15 M

Relacionando H2 SO4 con ZnS:


529,4 mol H2 SO4

1 mol ZnS 97,4 g ZnS 1 kg ZnS




= 51,6 kg ZnS
1 mol H2 SO4 1 mol ZnS 103 g ZnS

Relacionando con ZnS blenda del 53% de riqueza:


51,6 kg ZnS

100 kg blenda
= 97,3 kg blenda
53 kg ZnS

b) Qu volumen ocupa el oxgeno necesario en la primera etapa, o de tostacin, medido a 20C y


3 atm?
Relacionando ZnS con O2 :
51,6 kg ZnS

103 g ZnS 1 mol ZnS 3 mol O2




= 794,7 mol O2
1 kg ZnS 97,4 g ZnS 2 mol ZnS

El volumen de gas consumido, considerando comportamiento ideal, es:


794,7 mol 0,082 atmLmol 1 K
V =
3 atm

20+273 K

= 6364 L O2

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

52

c) Cul es la molalidad y tanto por ciento en peso del cido sulfrico obtenido?
Tomando como base de clculo 1 L de disolucin:
3,15 mol H2 SO4
1 L H2 SO4 3,15 M
1 cm3 H2 SO4 3,15 M 98 g H2 SO4

3


100 = 25,9%
1 L H2 SO4 3,15 M 10 cm3 H2 SO4 3,15 M 1,19 g H2 SO4 3,15 M 1 mol H2 SO4
La cantidad de H2 O contenida en 1 L de disolucin es:
1 L H2 SO4 3,15 M
3,15 mol H2 SO4

103 cm3 H2 SO4 3,15 M 1,19 g H2 SO4 3,15 M



= 1190 g H2 SO4 3,15 M
1 L H2 SO4 3,15 M
1 cm3 H2 SO4 3,15 M

98 g H2 SO4
= 308,7 g H2 SO4
1 mol H2 SO4

1190 g H2 SO4 3,15 M 308,7 g H2 SO4 = 881,3 g H2 O


La cantidad de H2 O contenida en 1 L de disolucin es:
3,15 mol H2 SO4 103 g H2 O

= 3,57 molkg
881,3 g H2 O
1 kg H2 O

d) En la reaccin [2] se observa que si la concentracin inicial de dixido de azufre se duplica,


manteniendo constante la de oxgeno, la velocidad de reaccin se multiplica por 8, mientras que
si se mantiene constante la de dixido de azufre y se triplica la de oxgeno, la velocidad de
reaccin se triplica. Calcule el orden de la reaccin.
La ecuacin general de velocidad para la reaccin [2] viene dada por la expresin:
r = k SO

llamando x = [SO ] e y = [O ] se pueden escribir las ecuaciones de los diferentes


experimentos:
r r = k x y r2 8r = k 2x y r3 3r = k x 3y
Relacionando los experimentos 1 y 2 se obtiene:
8r k 2x y
r2
=
se obtiene 2 = 2
r
r
k x y

a = 3

Relacionando los experimentos 1 y 3 se obtiene:


3r k x 3y
r3
=
r
r
k x y

se obtiene 3 = 3

El orden total de la reaccin es:


a + b = 3 + 1 = 4

b = 1

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

53

e) Si los valores de las constantes de velocidad de la reaccin [2] son 0,55 a 600 K y 1,5 a 625 K,
respectivamente, expresadas en las mismas unidades, cul es la energa de activacin de la
reaccin en el intervalo de temperaturas considerado?
La ecuacin de Arrhenius indica la dependencia de la constante de velocidad de una reaccin
con la temperatura:
ln

E 1
1
k

=

T
k
R T

Considerando que los valores dados son (T1 = 600 K, k1 = 0,55) y (T2 = 625 K, k2 = 1,5), a partir
de los mismos se puede calcular el valor de la energa de activacin de la reaccin, E :
ln

E
0,55
=
3
1,5
8,31410 kJmol 1 K

1
1


625 K 600 K

= 125,1 kJmol

(O.Q.N. Murcia 2000)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

54

19. El fosgeno (
) nombre trivial del cloruro de carbonilo, es un gas incoloro, de olor
sofocante, que licua a 8C. Fue descubierto por Davy en 1812. Debido a su gran reactividad
resulta extremadamente txico por inhalacin (reacciona con el agua dando cloruro de
hidrgeno y dixido de carbono) aunque no parezca inmediatamente irritante, provocando
edemas pulmonares, caracterstica que lo hace muy apropiado como arma qumica, de ah su
empleo como gas de combate durante la 1 Guerra Mundial. Tambin presenta aplicaciones
industriales; as, se emplea para la preparacin de isocianatos, destinados a la fabricacin de
poliuretanos, y para la sntesis de colorantes derivados del trifenilmetano.
A 900C de temperatura y 1,3 atmsferas de presin, el fosgeno contenido en un recipiente
hermticamente cerrado est parcialmente disociado, coexistiendo en equilibrio con monxido
de carbono y cloro molecular. En esas condiciones la densidad del fosgeno es 0,725 g .
Determine:
a) El grado de disociacin en las condiciones de presin y temperatura dadas.
La ecuacin qumica correspondiente a la reaccin de disociacin del fosgeno es:
COCl (g)

CO (g) + Cl (g)

Escribiendo la tabla de moles correspondiente en funcin del grado de disociacin, :



ninicial
ntransformado
nformado
nequilibrio

COCl
CO
n

n


n
n
n n = n 1
n = n 1 + n + n = n 1 +

Cl


n
n

La presin y la densidad de la mezcla gaseosa permiten obtener el grado de disociacin del


fosgeno. Considerando comportamiento ideal:
pV = n 1+ RT

m
n =
M
=

1,3 atm 99 gmol


0,725 gL

pM
1
RT

0,082 atmLmol 1 K

900+273 K

1 = 0,846 =

, %

b) Las concentraciones de cada una de las especies qumicas presentes en la mezcla gaseosa.
Aplicando la ley de Dalton se calculan las presiones parciales en el equilibrio:
p
p

= p

= p y

= p y

n

n 1+

n 1

n 1+

= p
= p

= p

= 1,3 atm

= 1,3 atm

0,864
= 0,60 atm
1+0,864

1 0,864
= 0,10 atm
1+0,864

Considerando comportamiento ideal se obtienen las concentraciones de las especies en el


equilibrio:
CO = Cl2 =

pCO
0,60 atm
=
= 6,210
RT
0,082 atmLmol 1 K 1 900+273 K

molL

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

COCl2 =

p
RT

0,10 atm

0,082 atmLmol 1 K

c) El valor de la constante

900+273 K

= 1,010

55

molL

, suponiendo comportamiento ideal de la mezcla gaseosa.

La constante K es:
K =

p
p

0,60 0,60
= 3,6
0,10

d) Si estando la mezcla en equilibrio se reduce el volumen del sistema hasta un tercio de su valor
inicial (sin que resulte afectada la temperatura), qu concentracin le corresponder a cada
una de las especies en el nuevo equilibrio?
El principio de Le Chtelier dice:
cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
Segn la ley de Boyle, si se reduce el volumen a la tercera parte a temperatura constante, la
presin se triplica. De acuerdo con el principio de Le Chtelier el sistema se desplazar en el
sentido en el que baje la presin, es decir, en el sentido en el que descienda el nmero de
molculas de gas presentes en el equilibrio, hacia la formacin de COCl2 .
La constante K es:
K =

CO Cl2
6,210 3 6,210
=
COCl2
1,010 3

= 3,810

Debido a la reduccin del volumen a un tercio del anterior, los valores iniciales de
concentracin son el triple que los obtenidos en el apartado b):

cinicial
ctransformado
cformado
cequilibrio

COCl2
3,010 3

x
3,010 3 + x

CO
1,910 2
x

1,910 2 x

Cl2
1,910 2
x

1,910 2 x

Sustituyendo en la expresin de K :
3,810 2 =

1,910 2 x 1,910 2 x
3,010 3 + x

x = 3,410 3 mol

Las concentraciones en el nuevo equilibrio son:


CO = Cl2 = 1,910 2 3,410
COCl2 = 3,010 3 + 3,410

molL 1 = 1,610

molL 1 = 6,410

molL

molL

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

56

e) Cmo afectara, a este nuevo equilibrio, la adicin al sistema de 1 mol de He, manteniendo
constantes tanto su volumen como su temperatura?
Al aadir 1 mol de He (sustancia inerte) a volumen y temperatura constantes, slo aumenta
la presin del sistema en equilibrio por adicin del nuevo componente gaseoso,
permaneciendo inalterable el equilibrio.
(O.Q.N. Murcia 2000)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

57

20. En la vida diaria son muy diversos los procesos que implican un flujo de electrones, desde el
fenmeno de un relmpago hasta la pilas que hacen funcionar radios, relojes o marcapasos.
Tambin un flujo de cargas hace posible el funcionamiento del sistema nervioso en los animales.
La electroqumica es la rama de la qumica que estudia la interaccin entre la electricidad y la
materia.
En base a sus conocimientos de electroqumica y por aplicacin de la ecuacin de Nernst y leyes
de Faraday, conteste a las siguientes cuestiones:
a) A concentraciones equimoleculares de
(aq) y
(aq), cul debe ser la concentracin
de
(aq) para que el potencial de la pila galvnica formada por los pares
(aq)/Ag (s) y
(aq)/
(aq) sea igual a cero?
Datos: E (
/Ag) = 0,799 V; E (
/
) = 0,771 V.
La notacin abreviada de la pila es:
Fe (aq) / Fe (aq) // Ag (aq) / Ag (s)
nodo ctodo
ctodo (reduccin): Ag + e
nodo (oxidacin): Fe

Ag
Fe + e

Ag + Fe

Ag + Fe

Aplicando la ecuacin de Nernst:


E
E = Eo

0,0592
[red]
log

n
[oxd]

/Ag = 0,799

0,0592
1
log

1
[Ag ]


0,0592
[Fe ]
= 0,771
log
1
[Fe ]

El potencial de la pila se calcula mediante la expresin:


Epila = Ectodo Enodo

Epila = E

/Ag E

Si en este caso, Epila = 0 y [Fe ] = [Fe ]:


0,799 0,0592 log

1
= 0,771
[Ag ]

] = 0,337 M

b) Determine la constante de equilibrio a 25C para la reaccin:


(aq) +

(aq)

Ag (s) +

(aq)

Cuando Epila = 0, la reaccin se encuentra en equilibrio, por tanto en este caso se cumple que:
K =

1
1
=
= 2,97
[Ag ] 0,337

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

58

c) Cuando se aade mercurio lquido en exceso a una disolucin acidificada de


(aq) de
concentracin 1 mM se comprueba que, una vez alcanzado el equilibrio, el 94,6% del hierro
inicial se ha reducido hasta
(aq). Calcule E para el par
(aq)/Hg (l) suponiendo que
la disolucin se encuentra a 25C y que la nica reaccin que se produce es:
Hg (l) +

(aq)

(aq) +

(aq)

La ecuacin qumica ajustada es:


2 Hg (l) + 2 Fe (aq)

Hg

(aq) + 2 Fe (aq)

La notacin abreviada de la pila es:


Hg (l) / Hg

(aq) // Fe (aq) / Fe (aq)

nodo ctodo
ctodo (reduccin): Fe + e

Fe

nodo (oxidacin): 2 Hg

+ 2 e

Hg

2 Hg (l) + 2 Fe (aq)

Hg


(aq) + 2 Fe (aq)

Las cantidades en el equilibrio son:



ninicial
ntransformado
nformado
nequilibrio

Fe
Hg
3
10
1,910 2
x


x
x
10 3 x
x = 0,94610 3
0,5410 4
4,7310 4

nequilibrio

Fe
1,910 2

x
x
9,4610

La constante de equilibrio es:


K =

[Hg

] [Fe
[Fe

4,7310

9,4610

0,5410

= 0,145

Aplicando la ecuacin de Nernst a la pila:


o
Epila = Epila

0,0592
log K
2

El potencial estndar de la pila se calcula mediante la expresin:


o
o
o
= Ectodo
Enodo

Epila

Epila = E o

E o

/Hg

En el equilibrio Epila = 0, sustituyendo se obtiene el potencial estndar del par Hg


0,771 Eo

/Hg =

0,0592
log 0,145
2

Eo

/Hg

= 0,796 V

/Hg:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

59

d) Sabiendo que en medio cido el par


(aq)/
(aq) tiene un potencial E =0,56 V,
qu fuerza electromotriz estndar tendr esta semipila en medio bsico?
La semirreaccin de oxidacin es:
MnO

MnO + e

Como se observa, la reaccin no depende de la acidez del medio, luego el potencial


permanece constante.
e) Un electrodo de hidrgeno ( = 0,9 atm) se sumerge en una disolucin en la que existe un
electrodo de referencia cuyo potencial es de 0,3 V; al conectar ambos electrodos a travs de un
puente salino se obtiene una pila de 0,689 V de fem. Calcular el pH de la disolucin.
La pila es:
H (g, 0,9 atm) / H (x M) // M

(aq) / M (s)

nodo ctodo
ctodo (reduccin): 2 M + e
nodo (oxidacin): H

2 H + 2 e

H (g) + 2 M (aq)

2 H (aq) + 2 M (s)

El potencial de la pila se calcula mediante la expresin:


Epila = Ectodo Enodo
E

= E o

0,0592
[H
log
2
p

Teniendo en cuenta que Eo


como:
pH =

Epila = Eref E

o
Epila Eref
1
log p
0,0592
2

= 0 y el concepto de pH las ecuaciones anteriores quedan

pH =

0,689 0,3 1
log (0,9) = 6,62
0,0592
2
(O.Q.N. Murcia 2000)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

60

21. En la qumica del nitrgeno, y en general, en la qumica de los compuestos covalentes, el


concepto de estado de oxidacin constituye slo un formalismo til para, entre otras cosas,
igualar reacciones qumicas pero al que no se le puede atribuir una realidad fsica. Existen
compuestos de nitrgeno en todos los estados de oxidacin formales entre 3 y +5, y xidos de
nitrgeno en cada uno de los cinco estados de oxidacin de +1 a +5.
El xido de nitrgeno (I) (tambin conocido como xido nitroso o protxido de nitrgeno fue el
primer anestsico sinttico que se descubri y el primer propulsor para aerosoles comerciales;
sus propiedades beneficiosas contrastan con las de otros xidos como el de nitrgeno (II)
(tambin conocido como xido ntrico) y el de nitrgeno (IV) que son contaminantes
atmosfricos a concentraciones elevadas.
A 25C y 1 atm, el xido ntrico es termodinmicamente inestable. A presiones elevadas, se
descompone rpidamente en el intervalo entre 30 y 50C, segn la siguiente reaccin en la que
intervienen los tres xidos de nitrgeno mencionados:
3 NO (g)

(g) +
(g)
a) Dibuje las estructuras de Lewis correspondientes a estos tres xidos de nitrgeno.
Las estructuras de Lewis correspondientes a los compuestos dados son:

b) Indique y justifique la geometra molecular del xido nitroso y del dixido de nitrgeno.
De acuerdo con modelo de repulsiones de pares de electrones de la capa de valencia
(MRPECV) que dice que dichos pares de electrones deben disponerse lo ms separados
posible con el fin de minimizar la repulsin entre ellos:
El N2 O posee una forma geomtrica que se corresponde con
una estructura del tipo AX E (A = tomo central, X = ligando
unido al tomo central, E = par solitario sobre el tomo central),
que tiene un nmero estrico de 2 + 0 = 2. Con ese valor le
corresponde una distribucin lineal de ligandos y pares
solitarios alrededor del tomo central. Al no existir pares
solitarios sobre el tomo central, la geometra molecular es
lineal.
El NO2 posee una forma geomtrica que se corresponde con
una estructura del tipo AX E que tiene un nmero estrico de
2 + 1 = 3. Con ese valor le corresponde una distribucin
triangular de ligandos y pares solitarios alrededor del tomo
central. Al existir un par solitario sobre el tomo central, la
geometra molecular es angular.

c) Indique y justifique el momento dipolar que presentan estos tres xidos de nitrgeno.
Tanto el NO como el N2 O poseen un nico dipolo entre los tomos de N y O debido a la
diferente electronegatividad que presentan dichos elementos. Como el O es ms
electronegativo de que el N el correspondiente vector momento dipolar se encuentra dirigido
hacia el O. Ambas molculas son polares.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

61


El NO2 posee dos dipolos iguales entre el tomo de N y los
tomos de O debido a la diferente electronegatividad que
presentan dichos elementos. Como el O es ms
electronegativo de que el N el correspondiente vector
momento dipolar se encuentra dirigido hacia el O. Como la
molcula presenta geometra molecular angular la resultante
de dichos vectores es distinta de cero. La molcula es polar.

d) Determine la de la reaccin a 25C suponiendo un comportamiento ideal de la mezcla


gaseosa.
Datos (25C)
NO (g)
(g)
(g)
Hf (kJ
)
90,2
82,0
33,2
S (J

)
210,6
219,7
235,0
Suponga que los valores de H y S no varan con la temperatura.
A partir del valor de r G se puede obtener el valor de la constante de equilibrio mediante la
ecuacin:
r G = RT ln K
El valor de r G se calcula mediante la siguiente expresin:
r G = r H Tr S
La entalpa de reaccin, r H,puede calcularse a partir de las entalpas de formacin de
productos y reactivos.
r H = i Hi

productos

r H = 1 mol N2 O

i Hi

reactivos

90,2 kJ
82,0 kJ
33,2 kJ
3 mol NO
= 155,4 kJ
+ 1 mol NO2
mol NO
mol N2 O
mol NO2

La entalpa de reaccin, r S,se calcula a partir de las entropas molares de productos y


reactivos:
r S = i Si

productos

r S = 1 mol N2 O

i Si

reactivos

210,6 J
J
219,7 J
235,0 J
3 mol NO
= 177,1
+ 1 mol NO2
K mol NO
K
K mol N2 O
K mol NO2

La variacin de energa libre de Gibbs:


r G = 155,4 kJ 298 K

177,1 J 1 kJ
3 = 102,6 kJ
K
10 J

Se trata de un proceso espontneo a 25C ya que el valor de r G < 0.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

62

El valor de la constante de equilibrio a 25C es:


K = exp

102,6 kJ
r G
= exp
= 9,810
3
RT
8,31410 kJK 1 25+273 K

El elevado valor de la constante K confirma la espontaneidad del proceso a 25C.


e) Calcule la presin total, una vez alcanzado el equilibrio, despus de introducir 1 mol de xido
ntrico en un reactor cerrado de 2 litros a 25C.
Como K es muy grande, quiere decir que el equilibrio se encuentra desplazado
completamente hacia la derecha. Por cada mol de NO que se transforma, se forman mol de
N2 O y mol de NO2 , por lo que nmero de moles de mezcla es 2.
Considerando comportamiento ideal el valor de presin es:
2 mol 0,082 atmLmol 1 K
p =
2 L

25+273 K

= 8,15 atm

f) Razone cualitativamente cmo influiran en la descomposicin del xido ntrico el volumen y


temperatura del reactor del caso anterior.
El principio de Le Chtelier dice:
cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
Segn la ley de Boyle, si aumenta el volumen del reactor a temperatura constante,
disminuye la presin. De acuerdo con el principio de Le Chtelier, el sistema se desplaza en
el sentido en el que suba la presin, es decir, desplazndose en el sentido en el aumente el
nmero de molculas gaseosas presentes en el equilibrio. El equilibrio se desplaza hacia la
formacin de NO.
Si aumenta la temperatura, de acuerdo con el principio de Le Chtelier, el sistema se
desplaza en el sentido en el que descienda la temperatura. Como se trata de un proceso
exotrmico (H < 0), el equilibrio se desplaza en el sentido en el que se consuma calor, es
decir, el equilibrio se desplaza hacia la formacin de NO.
Ambas modificaciones NO favorecen la descomposicin del NO.
g) Para esta reaccin se encuentra experimentalmente que, en el intervalo de 0 a 1000C, existe
una relacin lineal entre el log y la inversa de la temperatura absoluta segn la ecuacin:
log

= m (1/T) + c

donde m y c son constantes, siendo m = H/(2,303 R), R la constante de los gases y H la


variacin de entalpa estndar de la reaccin.
Calcule el valor de a 800C.
Dato: R= 8,314 J

Planteando la ecuacin dada para dos temperaturas diferentes se obtiene la siguiente


expresin:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

log

K
K

63

r H 1
1


2,303 R T1 T2

Sustituyendo los valores dados:


log

K
9,810

17 =

155,4
2,303 8,31410

1
1


25+273
800+273

K = 2,1102

Este valor es concordante con lo justificado en el apartado anterior al considerar un aumento


de la temperatura.
(O.Q.N. Barcelona 2001)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

64

22. El cido lctico es un cido monocarboxlico aliftico de masa molecular 90 constituido por
carbono, hidrgeno y oxgeno, con una funcin alcohol en su estructura y que presenta isomera
ptica. Se encuentra ampliamente distribuido en la naturaleza y su nombre vulgar proviene de
su existencia en la leche agria. En la dcada de 1920, Meyerhoff demostr que en la contraccin
de los msculos de los seres vivos para realizar un trabajo en condiciones anaerobias, se
transforma el glucgeno en cido lctico. Su determinacin en los deportistas es de gran inters
al existir una relacin causal entre la acumulacin del mismo y la fatiga de los msculos
humanos.
Una muestra de 3,52 mg de cido lctico se quem en un tubo de combustin en presencia de
una corriente de oxgeno seco. De los incrementos de peso en los tubos de adsorcin se dedujo
que se haban formado 5,15 mg de dixido de carbono y 2,11 mg de agua.
a) Deduzca la frmula molecular del cido lctico.
Para obtener la frmula molecular del cido lctico (AcL):
El C contenido en el cido lctico se determina en forma de CO2 .
5,15 mg CO2 1 mmol CO2 1 mmol C 90 mg AcL
mmol C



= 3

mmol AcL
3,52 mg AcL 44 mg CO2 1 mmol CO2 1 mmol AcL
El H contenido en el cido lctico se determina en forma de H2 O:
2,11 mg H2 O 1 mmol H2 O 2 mmol H 90 mg AcL
mmol H

= 6



mmol AcL
3,52 mg AcL 18 mg H2 O 1 mmol H2 O 1 mmol AcL
El O contenido en el cido lctico se determina por diferencia:
1 mg H
12 mg C
6 mmol H
1 mmol H g O 1 mmol O = 3 mmol O
1 mmol C
1 mmol AcL
16 mg O
mmol AcL

90 mg AcL 3 mmol C

La frmula molecular o verdadera es C3 H6 O3 .


b) Indique razonadamente la hibridacin y los tipos de enlace que presentan cada uno de los
tomos de carbono de la molcula del cido lctico.
El tomo de C del grupo
:
y tiene 4 enlaces
Presenta hibridacin
El tomo de C del grupo OH:
y tiene 4 enlaces
Presenta hibridacin
El tomo de C del grupo COOH:
y tiene 3 enlaces y 1 enlace
Presenta hibridacin

c) Si el cido lctico se hace reaccionar con un compuesto A en medio anhidro se obtiene el


lactato de 2propenilo (lactato de alilo). Represente y nombre el compuesto A.
Se trata de una reaccin de esterificacin, por tanto el compuesto A que reacciona con el cido
lctico debe ser un alcohol:
cido lctico + compuesto A

lactato de 2propenilo + agua

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

65

La frmula del lactato de 2propenilo es:


CH CHOHCOOCH CH=CH
Y la del alcohol 2propen1ol es:
CH=

d) Represente y nombre todos los ismeros del compuesto A, indicando cules presentan
isomera geomtrica y cules isomera ptica.
Ismeros del 2propen1ol (C H O):
1propen1ol

CHOH=CH

(S presenta isomera geomtrica)

cis1propen1ol

trans1propen1ol

1propen2ol

=COH

metoxieteno

OCH=CH2

propanal

acetona

CHO
CO

ciclopropanol

NINGUNO de los compuestos anteriores presenta isomera ptica ya que no tienen tomos
de carbono con los cuatro sustituyentes distintos.
e) En los hidroxicidos, la presencia de grupos carboxilo e hidroxilo en la misma molcula puede
dar lugar a la formacin de steres cclicos intramoleculares (lactonas) e intermoleculares
(lactidas) dependiendo de la posicin de los grupos hidroxilo y carboxilo. En el caso del cido
lctico, se puede obtener un dister cclico intermolecular por reaccin de dos molculas de
cido lctico entre s.
Escriba y ajuste la reaccin correspondiente.


(O.Q.N. Barcelona 2001)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

66

23. La mayora de los nutrientes alimenticios bsicos provienen directa o indirectamente de las
plantas, siendo stas, por tanto, la fuente primaria de energa de todo el mundo animal. El ciclo
alimenticio depende de la asimilacin por las plantas de dixido de carbono, agua, minerales y
energa solar, y su posterior transformacin en compuestos orgnicos. Las reacciones
responsables de la transformacin compleja de energa radiante en energa qumica son
conocidas con el nombre de fotosntesis, la cual es realizada por organismos fotosintticos como
las plantas superiores. Los pigmentos fotosintticos, como la clorofila de las plantas verdes,
absorben la energa solar que se emplea para sintetizar glucosa (
) a partir de dixido de
carbono y agua, liberndose oxgeno como producto de la reaccin.
a) La molcula de clorofila es un complejo de coordinacin en la que un nico tomo de
magnesio est unido a un anillo tetrapirrlico de clorina. Cul es la masa molecular de una
clorofila que contiene un 2,72% de magnesio?
100 g clorofila 24,3 g Mg 1 mol Mg


= 893,4 g
2,72 g Mg
1 mol Mg 1 mol clorofila

b) Escriba y ajuste la reaccin de obtencin de la glucosa que tiene lugar en la fotosntesis de las
plantas verdes.
La ecuacin qumica ajustada de la fotosntesis es:
6 CO2 (g) + 6 H2

C6 H12 O6 (s) + 6 O2 (g)

c) Calcule la energa, en kJ, necesaria para la produccin de 1 g de glucosa teniendo en cuenta


que el rendimiento energtico del proceso es de un 70%.
Datos (25C)
(g)
(l)
(s)
Hf (kJ/mol)
393,5
285,5
1274,4
La entalpa de reaccin, r H, puede calcularse a partir de las entalpas de formacin de
productos y reactivos.
r H = i Hi

productos

r H = 1 mol C H O

i Hi

reactivos

1274,4 kJ
mol C H O

Se obtiene, r H = 2801,4 kJmol

6 mol H O

285,8 kJ
393,5 kJ

+ 6 mol CO2
mol H O
mol CO2

La energa necesaria para producir 1 g de glucosa es:


1 g C H O

1 mol C H O
2801,4 kJ

= 15,6 kJ
180 g C H O 1 mol C H O

Como el rendimiento energtico es del 70%:


15,6 kJ (real)

100 kJ (teo rico)


= 22,2 kJ
70 kJ (real)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

67

Los enfermos de diabetes sufren una alteracin del metabolismo normal de la glucosa que les
impide utilizarla como fuente principal de energa. Presentan, por tanto, unos niveles
anormalmente elevados de glucosa en sus fluidos biolgicos tenindose que controlar
frecuentemente la concentracin de glucosa en sangre. Dicho control puede realizarse, de
manera continua, mediante un biosensor miniaturizado implantado en la piel basado en la
reaccin enzimtica siguiente en la que la glucosa se transforma en cido glucnico:

C6 H12 O6 + H2 + O2
C6 H12 O7 + H2 O2
El perxido de hidrgeno formado se descompone en el nodo de platino de una celda
electroltica en la que se mantiene un potencial constante de +0,6 V, medido frente a un
electrodo de referencia de Ag/AgCl.
La intensidad de la corriente elctrica que circula en la celda electroltica es directamente
proporcional a la concentracin de glucosa presente.
d) Escriba y ajuste la semirreaccin que se produce en el nodo de la celda electroltica.
La reaccin que tiene lugar siempre en el nodo de una celda es una oxidacin:
H2 O2

O2 + 2

+ 2

e) Calcule la cantidad de glucosa que reacciona en el biosensor si durante una hora la intensidad
circulante en la celda electroltica se mantuviera constante a 1,5 A.
Dato: 1 Faraday = 96485 C.
La cantidad de corriente que atraviesa el biosensor es:
1,5 A

3600 s
1 mol e
10 A
1 h

= 5,610 mol e
1 h 96485 C (As)
1 A

Relacionando electrones y glucosa:


5,6108 mol e

1 mol H2 O2 1 mol C H O 180 g C H O




= 5,610
2 mol e
1 mol H2 O2 1 mol C H O

(O.Q.N. Barcelona 2001)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

68

24. Los elementos alcalinotrreos estn ampliamente distribuidos en la corteza terrestre


formando grandes depsitos minerales como la dolomita, compuesta principalmente por
carbonato de magnesio y carbonato de calcio. El anlisis de los componentes minoritarios y
mayoritarios de una muestra de dolomita implica un conjunto de etapas de disolucin y
precipitacin selectivas. Para la determinacin del calcio, una vez separada la slice y los iones
metlicos trivalentes, se procede a la precipitacin de dicho ion como oxalato de calcio, pudiendo
utilizar para ello una disolucin de oxalato de sodio y ajustando adecuadamente el pH del medio.
El oxalato de calcio se disuelve a continuacin en un medio cido fuerte de sulfrico, y se valora
la disolucin final resultante con permanganato de potasio.
a) Calcule el pH de una disolucin de oxalato de sodio 0,1 M.
En los apartados a), b) y c) puede despreciarse la concentracin de la especie totalmente
protonada del cido oxlico dado que sus dos constantes de disociacin cida son
suficientemente distintas.
Datos. cido oxlico (etanodioico):
= 1,3;
= 4,3.
Los equilibrios de disociacin del cido oxlico son:
H2 C2 O4 + H2 O

HC2 O4 + H3 O+ K = 10

1,3

HC2 O4 + H2 O

C2 O4 + H3 O+ K = 10

4,3

= 5,010 2

= 5,010 5

El Na2 C2 O4 se disuelve en agua y se disocia segn:


Na2 C2 O4 (s) + H2 O (l)

C2 O4 (aq) + 2 Na+ (aq)

El ion sodio no se hidroliza por ser el cido conjugado la base fuerte NaOH, mientras que el
ion oxalato de hidroliza segn las ecuaciones:
C2 O4 + H2 O

HC2 O4 + OH K = K /5,010 5 = 2,010

10

HC2 O4 + H2 O

H2 C2 O4 + OH K = K /5,010 2 = 2,010

13

Segn dice el enunciado, los OH producidos en la hidrlisis del HC2 O4 pueden despreciarse
frente a los obtenidos en la hidrlisis del C2 O4 . Despus de aplicar los correspondientes
balances y aproximaciones se obtiene:
HC2 O4 = OH
Por otro lado, teniendo en cuenta que el valor de K es muy pequeo puede considerarse que
la cantidad de HC2 O4 formado es despreciable frente a la cantidad de C2 O4 inicial. As pues,
en el equilibrio:
C2 O4

C2 O4

Por tanto, se obtiene que la expresin de K queda de la forma:


K =

HC2 O4 OH
C2 O4

OH
C2 O4

Sustituyendo
210

10

OH

0,1

OH = 4,510 6 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

pOH = log 4,510

= 5,35

b) Determine la solubilidad, en mg
Dato. Oxalato de calcio:
= 8,6.

69

pH = 14 5,35 = 8,65

, del oxalato de calcio en agua.

Si s es la solubilidad, en mol/L, del CaC2 O4 , en el equilibrio:


CaC2 O4 (s)

C2 O4 (aq) + Ca (aq) K

= 10

8,6

= 2,510 9

La constante de equilibrio del proceso de solubilidad es:


K = [C2 O4 ] [Ca

Si la solubilidad molar del CaC2 O4 es s, las solubilidades de los iones son:


[C2 O4 ] = s [Ca ] = s
Sustituyendo en la expresin de K :
K = s2

s = K = 2,510 9 = 5,010 5 M

La solubilidad en agua expresada en mg/L es:


mg CaC2 O4
5,010 5 mol CaC2 O4 128 g CaC2 O4 103 mg CaC2 O4


= 6,4

1 L disolucio n
1 mol CaC2 O4 1 g CaC2 O4
L disolucin
c) Cul debe ser el pH mximo de una disolucin acuosa para poder disolver completamente 10
mg de oxalato de calcio en 1 litro de dicha disolucin?
Cuando se disuelven 10 mg de CaC2 O4 en agua las concentraciones inicas son:
[C2 O4 ] = [Ca ] =

10 mg CaC2 O4 1 g CaC2 O4 1 mol CaC2 O4




= 7,810 5 M
1 L disolucio n 103 mg CaC2 O4 128 g CaC2 O4

Con estos valores el producto inico es:


5

[C2 O4 ] [Ca ] = 7,810

7,810

= 6,110 9

Como se observa, el producto inico es mayor que K , por tanto, el CaC O no se disolver a
menos que se aada un cido que permita eliminar iones C2 O4 del medio, con formacin de
iones HC2 O4 .
La mxima cantidad de C2 O4 que puede existir en disolucin se obtiene por medio del
producto de solubilidad del CaC2 O4 :
[C2 O4 ] =

Kps
Ca

2,510

7,810

= 3,210 5 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

70

El valor de [HC2 O4 ] se obtiene realizando un balance de materia:


C2 O4

= C2 O4 + [HC2 O4 ]

[HC2 O4 ] = 7,8105 3,2105 = 4,6105 M


Segn dice el enunciado, los OH producidos en la hidrlisis del HC2 O4 pueden despreciarse
frente a los obtenidos en la hidrlisis del C2 O4 , por tanto, se considera el equilibrio:
C2 O4 + H2 O
K =

HC2 O4 + OH K = 2,010

HC2 O4 OH

C2 O4

OH

10

C2 O4

Sustituyendo
210

10

OH
4,610

pOH = log 1,410


10

OH = 1,410

= 9,86

10

pH = 14 9,86 = 4,14

d) Un oxalato se valora, en un medio cido fuerte de sulfrico, con permanganato de potasio


mediante una reaccin de oxidacinreduccin en la que se forma dixido de carbono y
manganeso (II). Escriba y ajuste la reaccin qumica.
Las semirreacciones son:
reduccin: 2 (MnO4 + 8 H + 5 e
oxidacin: 5 ( C2 O4

Mn + 4 H2 O)

2 CO2 + 2 e )

Reaccin global:
5 C2 O4 + 2 MnO4 + 16 H

10 CO2 + 2 Mn


+ 8 H2 O +

e) Una muestra de 0,2342 g de dolomita se analiza siguiendo el procedimiento arriba indicado.


En la valoracin final se consumen 22,3 mL de una disolucin de permanganato de potasio
0,0212 M. Calcule el contenido de calcio en la muestra, expresado como porcentaje de carbonato
de calcio.
Relacionando MnO4 con C2 O4 :
22,3 mL MnO4 0,0212 M

0,0212 mmol MnO4 5 mmol C2 O4



= 1,18 mmol C2 O4
1 mL MnO4 0,0212 M 2 mmol MnO4

Relacionando C2 O4 con CaCO3 :


1,18 mmol C2 O4

1 mmol Ca
1 mmol C2 O4

1 mmol CaCO3 100 mg CaCO3



= 118 mg CaCO3
1 mmol CaCO3
1 mmol Ca

El porcentaje de CaCO3 en la muestra de dolomita es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

71

1 g CaCO3
118 mg CaCO3

100 = 50,5% CaCO3
0,2342 g dolomita 10 mg CaCO3
f) Una disolucin, ajustada a pH = 7, contiene Ca (II) 0,01 M y Mg (II) 0,01 M. Justifique si es
posible precipitar el 99,9% del calcio sin que lo haga el magnesio, cuando se utiliza oxalato de
amonio como agente precipitante (considere que el volumen total de la disolucin no vara
significativamente).
Dato. Oxalato de magnesio:
= 4,1.
En primer lugar se calcula el valor de [Ca ] en disolucin:
[Ca ] =

0,1 M (disolucio n)
0,01 M = 105 M
100 M (total)

El valor de [C2 O4 ] en ese instante es:


[C2 O4 ] =

K
Ca

2,510
10

= 2,510 4 M

El equilibrio correspondiente a la disolucin del MgC2 O4 es:


MgC2 O4 (s)

C2 O4 (aq) + Mg (aq) K = 10

4,1

= 7,910 5

La constante de equilibrio del proceso de solubilidad es:


Kps = [C2 O4 ] [Mg

Para que se forme un precipitado de MgC2 O4 es preciso que se cumpla que el producto inico
sea mayor que el correspondiente K :
2,510

0,01 = 2,510 6

Como se observa, el producto inico es menor que el valor del K del MgC O , lo que quiere
sin que
decir que con ese valor de [C O ], es posible precipitar el 99,9% de
precipite el Mg .
(O.Q.N. Barcelona 2001)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

72

25. El sistema amortiguador


/ HCO3 controla eficazmente las variaciones de pH en sangre.
Este sistema amortiguador de tanta importancia para mantener el valor fisiolgico del pH se
puede expresar de acuerdo con el equilibrio:
(disuelto) +




+

La mayora del cido presente en la sangre y en el citoplasma se encuentra como
, no como
H2 CO3 . La capacidad amortiguadora de este sistema se debe a que un porcentaje elevado del
mismo se encuentra en forma de sal (
) y la cantidad relativamente baja de la forma cida
aumenta con rapidez cuando el medio se hace bsico. Existe, adems, un equilibrio entre el

disuelto en sangre y el C 2 presente en el aire alveolar del pulmn que viene dado por:
[C

2]

donde k = 3,0110 (factor de solubilidad) cuando las concentraciones se expresan en mM y la


presin parcial de
(
) en mm Hg.
Sabiendo que una sangre de pH 7,4 tiene una reserva alcalina de 27,1 mM de
total, calcular
la concentracin de las formas cida y bsica del amortiguador.
Datos: Para el cido carbnico en sangre pKa = 6,1.
Se denomina reserva alcalina a la suma de las concentraciones de las formas cida y bsica,
expresadas como concentracin total de
.
La expresin de la constante de equilibrio es:
K =

HCO H O
CO dis

= 10

6,1

= 7,910 7

La reserva alcalina es:


CO

total =

CO

dis +

HCO3

HCO3 = 2,710 2 CO

dis

Como el pH de la disolucin es 7,4:


H O = 10

7,4

= 4,010 8 M

Sustituyendo estos valores de en la expresin de la constante de equilibrio:


2,7110 2 CO
7,910 =
CO
7

dis
dis

4,010 8

2 dis = 1,310

De la expresin de la reserva alcalina:


3

HCO3 = 2,910

b) Calcular para la sangre anterior, la presin parcial de

disuelto en el alveolo pulmonar.

Partiendo de la expresin:
CO
p

dis = k


1,310 3 M

3,0110 2 mMmmHg

103 mM
= 43 mmHg
1 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

73

c) Un deportista realiza un esfuerzo fsico, como consecuencia del cual la presin alveolar de

desciende a 34 mmHg. Averiguar en estas condiciones el pH de su sangre si su reserva alcalina es
de 27,1 mM de
total.
Cuando el valor de p = 34 mmHg:
CO

dis = k

= 3,0110

1 M
mM
34 mmHg 3
= 1,0210 3 M
mmHg
10 mM

El valor de HCO3 que se obtiene a partir de la reserva alcalina es:


HCO3 = 2,7110 2 1,0210

M = 2,6110 2 M

Sustituyendo estos valores en la expresin de la constante de equilibrio:


7

7,910 =

2,6110 2
1,0210

pH = log 3,110

H O

H O = 3,110 8 M

= 7,5

d) Algunos frmacos provocan un aumento en la frecuencia de la respiracin (hiperventilacin),


lo que da lugar a una condicin conocida como alcalosis respiratoria (pH de la sangre superior a
7,45). En primeros auxilios se hace respirar al paciente dentro de una bolsa de papel. Explicar
por qu este tratamiento es efectivo, qu equilibrios estn involucrados e indicar su efecto sobre
el pH de la sangre.
Al respirar dentro de una bolsa de papel aumenta la presin parcial del CO , y por tanto,
aumenta C 2 dis . De acuerdo con el principio de Le Chtelier y segn el equilibrio:
CO (disuelto) + H O

H2 CO3

HCO3 + H O

el sistema se desplaza en el sentido en el que disminuya CO dis . Este valor se hace menor si
. Por tanto, el pH de la sangre
la reaccin se desplaza hacia la formacin de HCO3 y
se hace menor y la alcalosis desaparece.
(O.Q.N. Oviedo 2002)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

74

26. El Texaco es un proceso de oxidacin parcial, destinado a la produccin de hidrgeno para


sntesis de amonaco, en el que se hace reaccionar octano gaseoso con oxgeno puro. Las
reacciones que tienen lugar son las siguientes:
+ 4

8 CO + 9

(reaccin A)

+ 8
8
+ 9 (reaccin B)
Con los datos que se indican a continuacin, calcula por cada 100 mol de octano que reaccionan:
a) La cantidad de oxgeno consumido, si el 90% del octano se oxida segn la reaccin A.
La cantidad de O consumido en cada reaccin es:
4 mol O
1 mol C H

Reaccin A 90 mol C H

Reaccin B 10 mol C H

= 360 mol O

8 mol O
1 mol C H

= 80 mol O

b) La composicin de los gases resultantes, si no se emplea exceso de oxgeno.


La cantidad de gas producido en cada reaccin es:
Reaccin A
90 mol C H

8 mol CO
= 720 mol CO
1 mol C H

90 mol C H

9 mol H
1 mol C H

1530 mol gas

= 810 mol H

Reaccin B
10 mol C H

10 mol C H

8 mol CO
1 mol C H

= 80 mol CO

9 mol H
1 mol C H


= 90 mol H

La composicin molar de la mezcla gaseosa es:


720 mol CO
100 = 42,4% CO
1530+170 mol mezcla
810+90 mol H
100 = 52,9% H2
(1530+170) mol mezcla
80 mol CO
100 = 4,7% CO2
1530+170 mol mezcla

170 mol gas

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

75

c) La composicin de los gases resultantes, si la reaccin se realiza con exceso de oxgeno (150%
del oxgeno necesario).
Para calcular el exceso de O se utiliza la reaccin en la que se consume mayor cantidad de
esta sustancia:
Por cada 100 moles de C H :
100 mol C H

8 mol O
1 mol C H

800 mol O2 (necesario)

= 800 mol O

250 mol O2 (total)


= 2000 mol O2 (total)
100 mol O2 (necesario)

El O2 en exceso es:
2000 mol O2 (total) 440 mol O2 (necesario) = 1560 mol O2 (total)
La composicin molar de la mezcla gaseosa es:
720 mol CO
100 = 22,1% CO
1530+170+1560 mol mezcla
810+90 mol H
100 = 27,6% H2
1530+170+1560 mol mezcla
80 mol CO
100 = 2,5% CO2
1530+170+1560 mol mezcla
1560 mol O
100 = 47,9% O2
1530+170+1560 mol mezcla
d) El calor total desprendido en el apartado a), si el proceso ocurriese a 25C.
Datos. Entalpas de formacin estndar a 25C, fHm (kcal/mol):
= 59,740; CO = 26,416;
= 94,052.
La entalpa de reaccin, r H, puede calcularse a partir de las entalpas de formacin de
productos y reactivos.
r H = i Hi

productos

r HAo = 8 mol CO
r HBo = 8 mol CO

i Hi

reactivos

26,416 kcal
1 mol C H
mol CO
94,052 kcal
1 mol C H
mol CO

kcal
59,740 kcal
= 151,588

mol C H
mol C H
kcal
59,740 kcal
= 692,676

mol C H
mol C H

Considerando 100 moles de mezcla:


90 mol C H

151,588 kcal
= 13643 kcal
mol C H

10 mol C H

692,676 kcal
= 6927 kcal
mol C H

Qtotal = 20570 kcal

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

76

e) La temperatura de los gases finales, si el reactor en el que se realizan funciona


adiabticamente, de forma que las prdidas de calor a travs de sus paredes se pueden
considerar despreciables. El octano entra en el reactor a 500C y el oxgeno a 25C.
Datos. Capacidades calorficas molares, , (cal

):


CO


(l)
(g)
42,0
11,5
7,5
7,8
7,4
75,24
37,67
Un esquema del proceso sera:

En un reactor adiabtico, el calor intercambiado


con el entorno es cero. En este caso, el balance
de energa puede aplicarse considerando que el
calor sensible necesario para llevar los
reactivos hasta la temperatura de reaccin
(25C) es igual al calor sensible necesario para
llevar los productos desde la temperatura de
reaccin hasta a temperatura final.

Para los 100 moles de C H :


= nC8 H18 f HCo8 H18 + Cp

o
+ Cp
+ nCO2 f HCO
2

CO2

C8 H18

T nO2 f HOo 2 + Cp

T + nH2 f HHo 2 + Cp

H2

O2

T +

o
T + nCO f HCO
+ Cp

CO

T = 0

Sustituyendo
Q

= 100 mol C8 H18

59,740 kcal 103 cal 42,0 cal



+
50025 K
mol
mol K
1 kcal

440 mol O2

94,052 kcal 103 cal 11,5 cal


7,8 cal

+
2525 K + 80 mol CO2
T25 K
mol
mol K
mol K
1 kcal

+ 900 mol H2

7,4 cal
26,416 kcal 103 cal 7,5 cal

+
T25 K + 720 mol CO
T25 K
mol K
mol K
1 kcal
mol


= 0

Se obtiene, T = 1763C.
f) La temperatura de los gases finales, si la reaccin se realiza con exceso de oxgeno (150% del
oxgeno necesario). El octano entra en el reactor a 500C y el oxgeno a 25C.
Este apartado es igual al anterior, teniendo en cuenta que al final sobra O2 :

= 100 mol C8 H18

2000 mol O2

59,740 kcal 103 cal 42,0 cal



+
50025 K
mol
mol K
1 kcal

94,052 kcal 103 cal 11,5 cal


7,8 cal

+
2525 K + 80 mol CO2
T25 K
mol
mol K
mol K
1 kcal

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

+ 900 mol H2

26,416 kcal 103 cal 7,5 cal


7,4 cal

+
T25 K + 720 mol CO2
T25 K
mol
mol K
mol K
1 kcal

+ 1560 mol O2

77

7,8 cal
T25 K = 0
mol K

Se obtiene, T = 922C.
g) A efectos de ahorro energtico, el calor de los gases del apartado e) se aprovecha en una
caldera para producir vapor de agua. En la caldera, que opera a presin de 1 bar, se introducen
32 kg de agua a 10C y los gases se enfran hasta 200C. Se produce vapor saturado o
sobrecalentado? Justifica la respuesta numricamente.
Vapor saturado =
(g) +
(l) a 100C
Vapor sobrecalentado = H2 O (g) a ms de 100C
Dato. Calor latente de ebullicin del agua a 100C: vapHm = 540 cal/g.
Hay que comparar el calor desprendido por los gases al enfriarse desde 1763C a 200C con el
absorbido por el H2 O al calentarse desde 10C a 100C y posteriormente vaporizarse.
Calor desprendido por los gases:
Q

= nCO2 Cp

CO2 T

+ nH2 Cp

H2

T + nCO Cp

CO

siendo, T = 1763C 200C = 1563C = 1563 K


Q

= 80 mol CO2

11,5 cal
7,4 cal
1563 K + 900 mol H2
1563 K +
mol K
mol K

+ 720 mol CO

7,5 cal
1563 K = 2,03107 cal
molK

Calor absorbido por el H2 O:


Q H2 O = mH2 O Cp

H2 O

T + mH2 O vap H

siendo, T = 100C 10C = 90C = 90 K


Q H2 O = 32 kg H2 O

103 g H2 O 1 cal
103 g H2 O 540 cal

90 K + 32 kg H2 O

= 2,02107 cal
1 kg H2 O g H2 O K
1 kg H2 O g H2 O

Como se observa,
> H2 O , lo que quiere decir que todo el H2 O (l) se ha convertido en
vapor, por tanto, se tiene vapor sobrecalentado.
h) Cul sera el estado del vapor, si la reaccin se realiza con exceso de oxgeno (150% del
oxgeno necesario)? Justifica la respuesta numricamente.
Este apartado es idntico al anterior, pero considerando tambin el O2 en exceso.
Calor desprendido por los gases:
Q

= nCO2 Cp

CO2 T

+ nH2 Cp

H2

T + nCO Cp

siendo, T = 922C 200C = 722C = 722 K

CO

T + nO2 Cp

O2

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

78

= 80 mol CO2

11,5 cal
7,4 cal
722 K + 900 mol H2
722 K +
mol K
mol K

+ 720 mol CO

7,8 cal
7,5 cal
722 K + 1560 mol O2
722 K = 1,82107 cal
mol K
molK

El calor absorbido por el H2 O es el mismo que el calculado en el apartado anterior.


< H2 O, lo que quiere decir que todo el H2 O (l) no se ha convertido en
Como se observa,
vapor, por tanto, se tiene vapor saturado.
(O.Q.N. Oviedo 2002)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

27. El

79

(g) se descompone en fase gaseosa, segn la reaccin:

(g)

(g) +
(g)
se han obtenido los siguientes datos cinticos:
Temperatura
25C
55C
Experimento
1
2
3
Tiempo
0 h
6,1 h
0 h
6,1 h
0 min
8,2 min
0 min
350
175
500
250
350
175
500
/Torr
Observando los datos de la tabla, conteste a las siguientes cuestiones:

4
8,2 min
250

Para una reaccin genrica a A + b B +


Productos
la velocidad de reaccin instantnea viene dada por la expresin:
1
1
=
=
=
Para calcularla es preciso conocer la variacin de la concentracin de reactivo con el tiempo. Sin
embargo, desde un punto de vista prctico, se suele utilizar la denominada velocidad de reaccin
promedio en un intervalo de tiempo t, definida como:
1
=
=
a) Calcule la velocidad de reaccin promedio para los cuatro experimentos, expresndola en
mol
.
En primer lugar, utilizando la ecuacin de estado de los gases ideales, se convierten las
presiones parciales en concentraciones:
N2 O5 =

RT

350 Torr
1

0,082 atmLmol K

1 atm
= 1,8810 2 molL 1
760 Torr
25+273 K

Repitiendo el clculo con el resto de los experimentos se obtiene:

Exp
t / min
] 10 /mol

0
18,8

2
366
9,42

0
26,9

3
366
13,5

0
17,1

8,2
8,56

0
24,5

8,2
12,2

Aplicando la ecuacin:
r =

1 N2 O5
(9,4210 3 18,810 3 ) molL
=
a t
(366 0) min

= 2,5710

molL

min

Repitiendo el clculo con el resto de los experimentos se obtiene:


Temperatura
Experimento
r/ mol

25C
1
2,5710

2
3,6810

55C
5

3
1,0410

4
1,4910

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

80

b) La dependencia de la velocidad de reaccin con la concentracin de los reactivos se suele


expresar mediante leyes empricas de velocidad. Una ecuacin cintica de este tipo expresa la
velocidad de reaccin (r) en funcin de las concentraciones de los reactivos y de una constante
denominada constante cintica o constante de velocidad (k).
Para nuestra reaccin, los datos cinticos indican que se trata de una reaccin de orden 1.
Escrbase la ley emprica de velocidad e indquese justificadamente las unidades que tendr la
constante de velocidad.
Si se trata de una reaccin de orden 1, la ley de velocidad viene dada por la expresin:
r = k [N2 O5 ]
Las unidades de la constante de velocidad k en este caso son:
k =

molL 1 min
r
=
N2 O5
molL 1

= min

c) A partir de dicha ley, sustituyendo la velocidad de reaccin por r = d[A]/dt se obtiene una
ecuacin cintica diferencial.
La ecuacin diferencial es:
k[A]=

d[A]
[A]
d[A]

= kdt integrando se obtiene ln
= k t
[A]
[A 0
dt

d) Calcule el valor de la constante de velocidad a 25C y 55C, utilizando los valores de las
velocidades promedio.
Las constantes son:
k

2,5710 5 molL 1 min

(9,4210 3 +18,810 3 )
molL
2
1,0410 3 molL 1 min
3

= 1,810

min

= 8,110

min

(17,110 +8,5610 )
molL
2

Ms correcto sera obtener el valor de la constante de velocidad a partir de la ecuacin de


velocidad:
3
A 0 ln 18,810
A
9,4210 3
=
=
= 1,910
t t 0
(3660) min

3
A 0 ln 17,110
ln
A
8,5610 3
=
=
= 8,410
t t 0
(8,20) min

ln

min

min

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

81

e) La ley de Arrhenius recoge la dependencia de la constante de velocidad (k) con la


temperatura:

=

Teniendo en cuenta esta ley, calcule la energa de activacin, el factor de frecuencia y la
constante de velocidad a 85C.
(Dato. R = 8,314 J

Aplicando logaritmos a la ecuacin dada:


EA

RT
Sustituyendo en la ecuacin los valores de k y T y resolviendo el correspondiente sistema:
k = Ae

ln k = ln A

T = 25C = 298 K

k = 1,910 3 min 1

ln 1,910

= ln A

T = 55C = 328 K

k = 8,410 2 min 1

ln 8,410

= ln A

se obtienen, EA =

, kJmol

y A = 1,861015 min

EA
8,31410 3 298
EA

8,31410 3 328

Sustituyendo estos valores en la ecuacin de Arrhenius se obtiene la constante de velocidad a


85C:
102,6
= 2,0 min1
k = 1,8610 min 1 exp
3
8,31410 85+273
(O.Q.N. Oviedo 2002)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

82

28. El hidrgeno se puede obtener por reaccin de un metal activo con cido clorhdrico. Para
ello se tratan 327 g de cinc del 90% de pureza con una disolucin de cido clorhdrico del 40%
de riqueza en peso y densidad 1,198 g/mL. Para estar seguros de la completa disolucin del cinc,
el cido clorhdrico se utiliza en un 25% en exceso sobre el tericamente necesario.
a) Escribir y ajustar la reaccin que tiene lugar.
La ecuacin qumica ajustada es:
ZnCl2 (aq) + H2 (g)

2 HCl (aq) + Zn (s)

b) Calcular el volumen de disolucin de cido clorhdrico que se ha utilizado y el que ha


reaccionado con el cinc.
El nmero de moles de Zn puro contenidos en la muestra es:
327 g muestra

90 g Zn
1 mol Zn

= 4,5 mol Zn
100 g muestra 65,4 g Zn

Relacionando Zn con disolucin de HCl del 40%:


4,5 mol Zn

2 mol HCl 36,5 g HCl 100 g HCl 40% 1 mL HCl 40%





= 686 mL HCl 40%
1 mol Zn 1 mol HCl
40 g HCl
1,198 g HCl 40%

Teniendo en cuenta que se utiliza un exceso del 25% de:


686 mL HCl 40% (teo rico)

25 mL HCl 40% (exceso)


= 171 mL HCl 40% (exceso)
100 mL HCl 40% (teo rico)

686 mL HCl 40% (teo rico) + 171 mL HCl 40% (exceso) = 857 mL HCl 40% (total)
c) El hidrgeno obtenido en el proceso anterior se recoge en un recipiente indeformable, en el
que previamente se ha hecho vaco, a 27C y 684 mmHg. Calcular el volumen del recipiente.
Relacionando Zn con H2 :
4,5 mol Zn

1 mol H2
= 4,5 mol H2
1 mol Zn

El volumen del recipiente ser el volumen que ocupe el gas y se calcula por medio de la
ecuacin de estado de los gases ideales:
V =

4,5 mol 0,082 atmLmol 1 K


684 mmHg

27+273 K 760 mmHg



= 123 L
1 atm

d) En el mismo recipiente que contiene el hidrgeno se introducen 4,2 moles de selenio y se


calienta la mezcla a 1000 K producindose el siguiente equilibrio:
Se (g) +

(g)

(g)

cuya

= 5,0 a 1000 K.

Determinar las presiones parciales de los gases y la presin total del recipiente en el equilibrio.
Construyendo la tabla de moles correspondiente:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)


ninicial
ntransformado
nformado
nequilibrio

Se
4,2
x

4,2 x

H2
4,5
x

4,5 x

83

H2 Se

x
x

La relacin entre las constantes K y K viene dada por la expresin:


K = K RT

donde
= coef. esteq. productos gaseosos coef. esteq. reactivos gaseosos = 1 2 = 1
K = 5,010 6 (0,082 1000) = 410
Sustituyendo en la expresin de la constante Kc:
x
H2 Se
x
V
=
=
V
K =
4,2 x
4,5 x
(4,2 x) (4,5 x)
Se H2

V
V
410 =

123 x

4,2 x 4,5 x

x = 3,34 mol

Considerando comporamiento ideal, las presiones en el equilibrio son:


4,2 3,34 mol 0,082 atmLmol 1 K
pSe =
123 L

4,5 3,34 mol 0,082 atmLmol 1 K


pH =
2
123 L

pH

3,34 mol 0,082 atmLmol 1 K


=

123 L

1000 K
1000 K

1000 K

= 0,575 atm
= 0,775 atm

= 2,225 atm

De acuerdo con la ley de Dalton la presin total es:


ptotal = pSe + pH + pH
2

= 0,575 + 0,775 + 2,225 atm = 3,575 atm


(O.Q.N. Tarazona 2003) (O.Q.L. Crdoba 2011)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

84

29. El
se obtiene mediante el proceso de HaberBosch segn la reaccin:
1
3
(g) + (g)

(g) = 46,91 kJ

2
2
a) Completa el siguiente cuadro, indicando el efecto que producirn sobre el sistema los
siguientes cambios:
Cambio
Cantidad de
Cantidad de
Cantidad de

Aumento de temperatura



Aumento de presin



Adicin de



Adicin de




Adicin de catalizador



El principio de Le Chtelier dice:
cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
Al aumentar la temperatura y de acuerdo con el principio de Le Chtelier, el sistema se
desplaza en el sentido en el que disminuya la temperatura. Por tratarse de un proceso
exotrmico el sistema se desplaza hacia la formacin de N2 y H2 . Al alcanzarse de nuevo el
equilibrio las cantidades de N2 y H2 aumentan mientras que la cantidad de NH3
disminuye.
Al aumentar la presin y de acuerdo con el principio de Le Chtelier, el sistema se desplaza
en el sentido en el que disminuya la presin. El sistema se desplaza en el sentido en el
disminuya el nmero de molculas de gas presentes en el equilibrio. Se desplaza hacia la
formacin de NH3 . Al alcanzarse de nuevo el equilibrio las cantidades de N2 y H2
disminuyen mientras que la cantidad de NH3 aumenta.
Al aadir N2 y de acuerdo con el principio de Le Chtelier, el sistema se desplaza en el
sentido en el que se consuma N2 aadido. El sistema se desplaza hacia la formacin NH3 . Al
alcanzarse de nuevo el equilibrio la cantidad de N2 aumenta y la de H2 disminuye mientras
que la cantidad de NH3 aumenta.
Adicin de H2 , suponiendo que se trata de H2 O (g) a volumen constante, se comporta
como un inerte que no interviene en el equilibrio y el sistema no se desplaza en ningn
sentido. El nico efecto visible es un aumento de la presin total por adicin de un nuevo
componente gaseoso.
Otra posibilidad es que se trate de H2 O (l) con lo que el NH3 se disuelve en el agua y para que
se recupere el equilibrio, de acuerdo con el principio de Le Chtelier, el sistema se desplaza
hacia la formacin de NH3 .
Al aadir un catalizador se aceleran tanto la reaccin directa como la reaccin inversa por
lo que se alcanza el equilibrio antes pero el sistema no se desplaza en ningn sentido.
Cambio
Aumento de temperatura
Aumento de presin
Adicin de
Adicin de

Adicin de catalizador

Cantidad de
aumenta
disminuye
aumenta
constante
constante

Cantidad de
aumenta
disminuye
disminuye
constante
constante

Cantidad de

disminuye
aumenta
aumenta
constante
constante

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

b) Si

= 656 a 723 K Cul es el valor de

85

para la reaccin a 723 K?

La relacin entre las constantes K y K viene dada por la expresin:


K = K RT

donde
= coef. esteq. productos gaseosos coef. esteq. reactivos gaseosos = 1 2 = 1
K = 656 0,082723 = 3,9104
c) Aumentar o disminuir el valor de

si la temperatura baja a 500 K?

Al disminuir la temperatura y de acuerdo con el principio de Le Chtelier, el sistema se


desplaza en el sentido en el que aumente la temperatura. Por tratarse de un proceso
exotrmico el sistema se desplaza hacia la formacin de NH3 . Al alcanzarse de nuevo el
equilibrio las cantidades (presiones) de N y H disminuyen mientras que la cantidad
(presin) de NH3 aumenta. Como:
Kp =

pNH3
, p
H2

pN2

de acuerdo con lo expuesto, aumenta el valor de la constante de equilibrio.


d) Calcula el valor de

(g) +

(g)

a 723 K, para la reaccin:


2

(g)

La constante K 'p es:


K 'p =

pNH3
pNH3
=
pN2 pH2
pN2 , pH2

K'p = K

= K

= 656 2 = 4,3105

El nitrato de amonio es un slido blanco cristalino, obtenido por reaccin entre el


(aq) y el
(aq) a temperatura ambiente, que se utiliza como fertilizante nitrogenado y explosivo. Se
disuelven 2,00 g de nitrato de amonio en agua, enrasando en un matraz aforado de 500 mL.
e) Calcula la molaridad de la disolucin.
1 mol NH4 NO3 103 mL disolucio n
2 g NH4 NO3


= 0,05 M
1 L disolucio n
500 mL disolucio n 80 g NH4 NO3
f) Escribe la reaccin que se produce.
La ecuacin qumica ajustada es:
(aq) +

(aq)

(aq)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

86

g) Calcula el pH de la disolucin.
(amonaco) = 1,810 ).

(Dato. Constante de basicidad:

El nitrato de amonio (NH NO ) se disuelve en agua de acuerdo con la ecuacin:


NH NO (aq)

NH (aq) + NO (aq)

El ion NO no se hidroliza ya que procede del HNO (cido fuerte).


El ion NH se hidroliza produciendo iones H O segn la reaccin:
NH (aq) + H O (l)

NH (l) + H O (aq)

Aplicando los correspondientes balances y aproximaciones se puede escribir:


[NH3 ] = [H3 O ] = x
[NH ] = c [H3 O ] = c x
siendo c la concentracin inicial de NH4Cl.
La constante de acidez del amonio es:
Ka =

[NH3 ] [H3 O ]
x2
=

[NH ]
c x

El valor de la constante de acidez (hidrlisis) del amonio se calcula mediante la siguiente


expresin:
Ka (

) =

Kw
Kb (NH3 )

Ka (

) =

10

14

1,810

= 5,810

10

Como se cumple que:


c
> 100 se puede realizar la aproximacio n c [H3 O ] c
Ka

con lo que la ecuacin anterior queda como:


2

[H3 O+ ]
Ka =

c

[H3 O ] = Ka c = 5,810

pH = log 5,310

10

0,05 = 5,310 6 M

= 5,3

En la descomposicin trmica del nitrato de amonio fundido, a 250260C, se obtiene agua y un


gas incoloro, xido de nitrgeno (I) (tambin llamado xido de dinitrgeno u xido nitroso),
caracterizado por sus leves propiedades anestsicas.
h) Escribe y ajusta la reaccin que tiene lugar.
La ecuacin qumica ajustada es:
(l)

O (g) +

O (g)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

87

i) Indica los estados de oxidacin del nitrgeno de todos los compuestos que intervienen en la
reaccin.
Teniendo en cuenta que los nmeros de oxidacin del oxgeno y del hidrgeno son,
respectivamente, 2 y +1, los estados de oxidacin del nitrgeno en las siguientes especies
son:
NH

x + 4 +1 = +1

NO

x + 3 2 = 1

x = +5

N O

2x + 1 2 = 0

x = +1

x = 3

(O.Q.N. Tarazona 2003)


Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

88

30. En una reciente actuacin, el equipo de polica forense de la serie televisiva C.S.I., fue
requerido para investigar y aclarar la muerte de una vctima presuntamente ahogada en alta
mar durante un crucero vacacional. Entre las pruebas periciales realizadas al cadver se le
practic un completo anlisis de sangre que mostr la presencia de un compuesto A que
normalmente suele estar ausente.
Mediante un anlisis cualitativo se detect que el compuesto contena carbono e hidrgeno y dio
pruebas negativas de halgenos, nitrgeno y azufre. Por razones de rapidez en la solucin del
caso no se lleg a realizar ensayo alguno para el oxgeno.
Por otra parte, en la determinacin cuantitativa a partir de la combustin de 33 mg del
compuesto se obtuvieron 63 mg de dixido de carbono y 39,1 mg de agua.
a) Cul es la frmula emprica del compuesto?
Para determinar la frmula emprica se calcula el nmero de mmoles de tomos de cada uno
de los elementos que forman el compuesto.
Teniendo en cuenta que en la combustin del compuesto todo el C se transforma en CO2 y el H
en H2 O, los mmoles de tomos en la muestra son:
63 mg CO2

1 mmol CO2 1 mmol C



= 1,43 mmol C
44 mg CO2 1 mmol CO2

39,1 mg H2 O

1 mmol H2 O 2 mmol H

= 4,34 mmol H
18 mg H2 O 1 mmol H2 O

El posible oxgeno contenido en el compuesto se calcula por diferencia:


33 mg compuesto 1,43 mmol C
11,5 mg O

12 mg C
1 mg H
= 11,5 mg O
+ 4,34 mmol H
1 mmol C
1 mmol H

1 mmol O
= 0,72 mmol O
16 mg O

Relacionando el nmero de moles del elemento que est presente en menor cantidad con el
resto de los elementos se obtiene la frmula emprica o sencilla:
1,43 mol C
2 mol C

0,72 mol O
1 mol O

6 mol H
4,34 mol H

1 mol O
0,72 mol O

fo rmula emprica: C2 H6 O

La determinacin de la masa molecular del compuesto por Espectrometra de Masas, indic que
la frmula molecular es la misma que la emprica.
b) Escribir todos los ismeros del compuesto y nombrarlos, indicando el tipo de funcin orgnica
que representan.
Al ser las frmulas molecular y emprica idnticas quiere decir que n = 1.
Con la frmula molecular C2 H6 O existen dos ismeros:

Etanol o alcohol etlico

Metoximetano o dimetilter

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

Presenta el grupo funcional:

Presenta el grupo funcional:

OH (hidroxi)

O (oxi)

89

El compuesto A se someti a los siguientes ensayos:


Con sodio metlico reaccion violentamente desprendindose un gas que en un futuro
prximo ser la alternativa energtica al petrleo.
Su oxidacin con dicromato de potasio en medio cido (H2SO4) lo transform en otro
compuesto, B, que es soluble en disolucin de hidrgenocarbonato de sodio.
La reaccin, en medio cido y calentando, de los compuestos A y B origin otro nuevo
compuesto, C, que no posee propiedades cidas ni bsicas y cuya frmula molecular es
.
c) Escribir las reacciones que tienen lugar en los tres ensayos anteriores e indicar cul es la
estructura del compuesto A de acuerdo con la interpretacin de los procesos a los que ha sido
sometido.
El gas desprendido que ser la alternativa energtica del petrleo en un futuro prximo es el
hidrgeno. De los dos posibles compuestos del apartado anterior, el nico que reacciona
violentamente con sodio y desprende hidrgeno es el etanol (compuesto A), luego en el
primer ensayo la reaccin es:
2 CH3 CH2 OH (l) + 2 Na (s)

2 CH3 CH2 ONa (l) + H2 (g)

La reaccin de oxidacin del etanol (A) con dicromato en medio cido produce el
correspondiente cido carboxlico, cido actico (compuesto B), que por ser cido es capaz
de reaccionar con el bicarbonato de sodio que es una base. En este ensayo las reacciones son:
CH3 CH2 OH (l) + K2 Cr2 O7 (aq) + H2 SO4 (aq)
CH3 COOH (l) + NaHCO3 (aq)

CH3 COOH (l) + Cr3+ (aq)

CH3 COONa (aq) + CO2 (g) + H2 (l)

Teniendo en cuenta que el compuesto A es el etanol y el compuesto B es el cido actico, la


reaccin entre ambos es una reaccin de esterificacin en la que se obtiene el acetato de etilo
(compuesto C) que no posee propiedades cidas ni bsicas ya que insoluble en agua. En el
tercer ensayo la reaccin es:
CH3 CH2 OH (l) + CH3 COOH (aq) + H+ (aq)

CH3 COOCH2 CH3 (l) + H2 (l)

La estructura del etanol (compuesto A) es:


(O.Q.N. Tarazona 2003)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

90

31. En la produccin de gas de agua (mezcla de CO y ), un gas trmico industrial, se pasa


vapor de agua a travs de coque a elevada temperatura, producindose la siguiente reaccin:
C (s) +
(g)
CO (g) + (g)
a) Cul es la entalpa estndar de esta reaccin? Indicar si la reaccin es exotrmica o
endotrmica.
Datos termodinmicos a 298 K:
Sustancia
fH (kJ/mol)
S (J/molK)
C (s)
0
43,5

(g)
241,6
188,7

(g)
393,7
213,6
CO (g)
110,5
197,5

(l)
285,8
69,91
(g)
0
130,6
La entalpa de reaccin, r H, puede calcularse a partir de las entalpas de formacin de
productos y reactivos.
r H = i Hi

productos

r H = 1 mol CO

i Hi

reactivos

110,5 kJ
241,6 kJ
1 mol H O
= 131,1 kJmol
mol CO
mol H O

Al ser r H > 0 se trata de una reaccin endotrmica.


b) Determinar el cambio de entropa y el valor de la energa Gibbs estndar de la reaccin a
298 K. Explicar si la reaccin es espontnea o no, a esta temperatura.
La variacin de entropa de la reaccin puede calcularse a partir de las entropas molares de
productos y reactivos:
r S = i Si

productos

r S = 1 mol CO
1 mol C

i Si

reactivos

197,5 J
130,6 J

+ 1 mol H2
K mol CO
K mol H2

43,5 J
188,7 J
= 95,9 JK
+ 1 mol H2 O
K mol C
K mol H2 O

mol

Para saber si se trata o no de un proceso espontneo es necesario calcular la variacin de


energa libre de Gibbs:
r G = r H Tr S
r G = 131,1 kJ 298 K

95,9 J 1 kJ

= 102,4 kJmol
K 103 J

Al ser r G > 0 se trata de una reaccin NO espontnea a 298 K.


Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

91

c) Escribir las reacciones que tienen lugar en la combustin del gas de agua y calcular la energa
que se desprende cuando se quema gas de agua, que contiene un mol de CO y otro de , para
dar
y agua lquida.
Las reacciones de combustin del gas de agua son:
1
CO (g) + O2 (g)
2

CO2 (g)

1
H2 (g) + O2 (g)
2

H2 O (l)

c1) Combustin de CO:


H = 1 mol CO

110,5 kJ
393,7 kJ
1 mol CO
= 283,2 kJ/mol
mol CO
mol CO

c2) Combustin de H2 :
H = 285,8 kJ/mol H2 O
El calor desprendido al quemarse una mezcla de gas de agua que contiene un mol, de CO y un
mol de H2 es:
total H = (283,2 kJ) + (285,8 kJ) = 569,0 kJ/mol H2 O y CO
d) Cunto calor se desprende cuando se queman 100 litros de gas de agua (medidos a 1 atm de
presin y 298 K)?
El gas de agua est formado por un mol de cada uno de los componentes, luego el nmero de
moles de cada uno de ellos en los 100 L de gas de agua ser el mismo. Considerando
comportamiento ideal:
n =

1 atm 100 L
0,082 atmLmol 1 K

298 K

= 4,1 mol H2 O y CO

De acuerdo con la estequiometra de la reaccin hay 2,05 mol de cada reactivo, por lo tanto, el
calor desprendido al quemarse 100 L de mezcla de gas de agua es:
4,1 mol H2 O y CO

569,0 kJ
= 1167 kJ
2 mol H2 O y CO

(O.Q.N. Tarazona 2003) (O.Q.L. Extremadura 2005) (O.Q.L. Crdoba 2007) (O.Q.L. Crdoba 2011)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

92

32. El cido ntrico es uno de los cidos inorgnicos ms importantes siendo muy utilizado en la
industria qumica en la fabricacin de colorantes, explosivos, frmacos y fertilizantes. Se
comporta como un cido fuerte, siendo una de sus sales, el nitrato de plata, uno de los reactivos
ms importantes en las volumetras de precipitacin. Es adems un poderoso agente oxidante
tanto en disoluciones diluidas como concentradas. Conteste a las siguientes cuestiones
relacionadas con dicho cido.
Calcule el pH de las siguientes disoluciones:
a1) cido ntrico 1,010 M.
(Dato:

= 1,010

El HNO es un cido fuerte que se encuentra totalmente disociado en iones y las ecuaciones
qumicas correspondientes a las ionizaciones existentes son:
HNO (aq) + H O (l)
2 H O (l)

NO (aq) + H O (aq)

OH (aq) + H3 O+ (aq)

Las constantes de equilibrio de ambas reacciones son:


K =
K = [H O ] [OH ]
El balance de materia correspondiente al HNO es:
[HNO ]0 = [NO ] = c
El balance de cargas (condicin de electroneutralidad) en la disolucin es:
[H O ] = [OH ] + [NO ]
Sustituyendo el valor de [OH ] en la expresin de K se obtiene:
[OH ]=c [H O ]
K = [H O ] c [H O ]
= [H O ] 10 8 [H O ] [H O

10

10

[H O ] 10

= 0

Se obtiene:
[H O ] = 1,0510 M pH = log (1,0510

) = 6,98

a2) Una mezcla de volmenes iguales de dimetilamina 0,10 M y cido ntrico 0,05 M.
(Datos.

(dimetilamina) = 7,410

= 1,010

Tomando 1 L de cada una de las disoluciones y sabiendo que la reaccin de neutralizacin que
tiene lugar entre HNO y dietilamina, CH NH, es:
HNO (aq) + CH

NH (l)

NO (aq) + CH

NH (aq)

0,05 mol 0,10 mol


El HNO es el reactivo limitante de la reaccin por lo que slo reaccionarn 0,05 moles de
CH NH sobrando 0,05 moles de este reactivo. Al final de la reaccin se tiene una mezcla

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

formada por 0,05 moles de CH NH y 0,05 moles de su cido conjugado, CH


constituye una disolucin reguladora bsica.

93

NH , lo que

Teniendo en cuenta que el volumen final es 2 L las concentraciones molares de ambas


sustancias son:
[ CH

NH] = [ CH

NH ] =

0,05 mol
= 0,025 M
2 L

Aplicando el equilibrio:
NH (aq) + H O (l)

CH

CH

NH (aq) + OH (aq)

La constante de basicidad es:


Kb =

CH
CH

NH
NH

OH = Kb = 7,410 M

OH

pOH = log 7,410 = 3,13

pH = 14 pOH = 14 3,13 = 10,87

Razone si se formar o no precipitado en los siguientes casos:


b1) Si a 1 L de disolucin de pH 11, se le aaden 0,1 moles de cloruro de magnesio.
(Dato.

(hidrxido de magnesio) = 1,510

Al mezclar disoluciones de MgCl2 y disolucin alcalina (OH ) se produce la reaccin:


MgCl2 (aq) + 2 OH (aq)

Mg OH + 2 Cl (aq)

La ecuacin qumica correspondiente a la disolucin del Mg OH es:


Mg OH (s)

Mg

(aq) + 2 OH (aq)

La constante de equilibrio del proceso de solubilidad es:


Kps = [Mg

] [OH

Para que se forme precipitado es preciso que el producto inico sea mayor que K :
[Mg

] [OH

>K

Una disolucin acuosa de pH = 11 tiene un pOH =3 y una [OH ] = 10

= 10 M.

El producto inico es:


0,1 10

= 10 7

Como se observa, el producto inico es mayor que Kps = 1,510


precipitado.

11

, por tanto, S se forma

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

94

b2) Al mezclar volmenes iguales de bromuro potsico 0,01 M y nitrato de plata 0,02 M. Calcule
las concentraciones finales de
y
.
(Dato:

(bromuro de plata) = 5,210

Al mezclar disoluciones de AgNO3 y KBr se produce la reaccin:


AgNO3 (aq) + KBr (aq)

AgBr (s) + KNO3 (aq)

La ecuacin qumica correspondiente a la disolucin del AgBr es:


AgBr (s)

Ag (aq) + Br (aq)

La constante de equilibrio del proceso de solubilidad es:


K = [Ag ] [Br ]
Para que se forme precipitado es preciso que el producto inico sea mayor que K :
[Ag ] [Br ] > K
Las concentraciones inicas son:
[Ag ] =

[Br ] =

0,02 mmol AgNO3


mL AgNO3 0,02 M 1 mmol Ag

= 0,01 M
V+V mL disolucio n
1 mmol AgNO3

V mL AgNO3 0,02 M

0,01 mmol KBr


mL KBr 0,01 M 1 mmol Br

= 5,010 3 M
V+V mL disolucio n
1 mmol KBr

V mL KBr 0,01 M

El producto inico es:


0,01 5,010

= 5,010 5

Como se observa, el producto inico es mayor que


de AgBr.

, por tanto, S se forma precipitado

Llamando x a la cantidad de AgBr que precipita, se pueden calcular las concentraciones


inicas en la disolucin:
0,01 x 5,010 3 x = 5,210
[Ag ] = 0,01 5,010
[Br ] =

K
5,210
=
[Ag ]
5,010

13

M = 5,010
13
3

= 1,010

10

5,010 3 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

95

Dada la reaccin:
(aq) + 3 Ag (s) + 4 (aq)
3
(aq) + NO (g) + 2
(l)
en la que el pH = 3,6 y la [
] = [
] = 1 M y
= 1 atm.
c1) Calcule el valor del potencial de Nernst y determine si la reaccin es espontnea a ese pH.
(Datos. E (
/NO) = 0,96 V; E (
/Ag) = 0,80 V)
Las semirreacciones que tienen lugar son:
ctodo (reduccin): NO + 4 H + 3 e

NO + 2 H O

Ag + e

nodo (oxidacin): Ag

Una disolucin acuosa de pH = 3,6 tiene una [H3 O+ ] = 10

= 10

M.

Aplicando la ecuacin de Nernst:


E = Eo

0,0592
[red]
log

n
[oxd]

/NO = E

/Ag = E

/NO

/Ag

0,0592
p
log
[NO ] [H
3

= 0,96

0,0592
1
log
3
[10 3,6

= 0,676 V

0,0592
1
log
= 0,80 V
1
[Ag ]

El potencial de la pila se calcula mediante la expresin:


Epila = Ectodo Enodo
Epila = E

/NO E

/Ag

Epila = 0,676 V 0,80 V = 0,124 V

Para que una reaccin sea espontnea debe cumplirse que:


G < 0
La relacin entre G y el potencial de la pila, Epila , viene dado por la expresin:
G = nFEpila
se deduce que una reaccin de oxidacinreduccin ser espontnea siempre que se cumpla
que E > 0, en estas condiciones se observa que E < 0 luego la reaccin estudiada es NO
espontnea.
c2) Calcule el pH para que la reaccin alcance el estado de equilibrio.
Si el sistema se encuentra en equilibrio se cumple que Epila = 0:
0 = Ectodo Enodo
0,96

1
0,0592
log
3
[10 pH

/NO = E

= 0,80 V

/Ag

pH = 2,03
(O.Q.N. Valencia de D. Juan 2004)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

96

33. Una disolucin acuosa acidificada se electroliz utilizando electrodos de Cu. Despus de
pasar una corriente constante de 1,18 A durante 1,52103 s, se encontr que el nodo haba
perdido 0,584 g. Considere que el Cu se oxida a
.
a) Cul es el gas que se produce en el ctodo y cul es el volumen producido a 25C y 1 atm?
El H O acidulada se disocia parcialmente segn la ecuacin:
H O (g)

H (aq) + OH (aq)

Considerando que el Cu se oxida a Cu


produce en el nodo:
nodo (oxidacin): Cu

y teniendo en cuenta que la reaccin de oxidacin se

Cu + 2 e

En el ctodo se produce la reduccin y la nica reaccin de este tipo posible es la que sufre el
H :
ctodo (reduccin): 2 H (aq) + 2 e
H (g)
por tanto, el gas desprendido en el ctodo es H2 .
La cantidad de H desprendido se calcula a partir de la masa de sustancia oxidada en el nodo.
Teniendo en cuenta que la reaccin global es:
Cu (s) + 2 H (aq)
0,584 g Cu

Cu (aq) + H (g)

1 mol Cu 1 mol H

= 9,210 3 mol H
63,5 g Cu 1 mol Cu

Considerando comportamiento ideal el volumen de gas desprendido es:


V =

9,210 3 mol 0,082 atmLmol 1 K


1 atm

25+273 K

= 0,225 L

b) Con los datos anteriores se puede calcular el valor de la constante de Faraday. Cul sera su
valor?
A partir del nmero de moles de sustancia electrolizada:
0,584 g Cu

1 mol Cu 2 mol e

= 1,8410 2 mol e
63,5 g Cu 1 mol Cu

y de la cantidad de corriente que atraviesa la cuba:


Q = 1,18 A 1,5103 s = 1794 C
se obtiene el valor de la constante de Faraday:
1794 C
2

1,8410 mol e

= 97500 Cmol

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

19

c) Sabiendo que la carga del electrn es 1,602210

97

C, calcule la constante de Avogadro.

Un Faraday es la carga de un mol de electrones, luego:


L =

97500 Cmol
19

1,602210

= 6,0851023 mol

Ce

d) Escriba las reacciones que tendrn lugar en cada electrodo as como la reaccin global.
Las reacciones en los electrodos son:
(aq) + 2

ctodo (reduccin): 2
nodo (oxidacin): Cu

Reaccin global: Cu (s) + 2

+ 2

(g)

(aq)

(aq) +


(g)

e) Justifique la espontaneidad del proceso.


(Dato. E (
/Cu) = 0,34 V)
Para que una reaccin sea espontnea debe cumplirse que:
G < 0
La relacin entre G y el potencial de la pila, E
G = nFE

, viene dado por la expresin:

El potencial de la pila se calcula mediante la expresin:


E

= E

= E


/Cu

= 0,00 V 0,34 V = 0,34 V

se deduce que una reaccin de oxidacinreduccin ser espontnea siempre que se cumpla
que E > 0, en estas condiciones se observa que E < 0 luego la reaccin estudiada es NO
espontnea.
f) Cunto valdra la fuerza electromotriz de la pila formada por un electrodo de Cu (s) en una
disolucin de iones
y el electrodo normal de hidrgeno?
Puesto que, tal y como se ha visto en el apartado anterior, la reaccin propuesta en el
enunciado es no espontnea, se concluye que ser espontnea la reaccin inversa. As pues, en
este caso el ctodo estara formado por el electrodo de Cu sumergido en una disolucin de
Cu , mientras que el nodo sera el electrodo normal de hidrgeno. Si [Cu ] = 1 M, el
potencial de la pila viene dado por la expresin:
E

= E

/Cu E

= 0,34 V 0,00 V = 0,34 V


(O.Q.N. Valencia de D. Juan 2004)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

98

34. En la reaccin de un hidrocarburo desconocido con yodo se obtiene un nico producto cuya
densidad es 8,322 veces mayor que la densidad del aire. Determinar la frmula estructural del
hidrocarburo.
Considere que la composicin del aire es 79% de nitrgeno y 21% de oxgeno.
Para determinar la masa del hidrocarburo es necesario determinar previamente la masa
molar del aire. Sabiendo que la composicin volumtrica del aire es 79% de N2 y 21% de O2,
de acuerdo con la ley de Avogadro, esta composicin coincide con la composicin molar, por lo
que las respectivas fracciones molares sern:
yN2 = 0,79 yO2 = 0,21
La masa molar del aire ser:
Maire =

0,79 mol N2

28 g N2
32 g O2
+ 0,21 mol O2
1 mol N2
1 mol O2
= 28,84 gmol 1
1 mol aire

La masa molar del derivado halogenado X se puede calcular a partir de la densidad relativa:
MX
X
MX
Vmolar
=
=

d =
Maire
aire
Maire
Vmolar
M = 8,322 28,84 gmol

= 240 gmol 1

Al ser masa molar del yodo 127 gmol 1 , el derivado halogenado formado solo puede contener
un tomo de yodo, lo que pone de manifiesto que la reaccin que ha tenido lugar ha sido una
reaccin de sustitucin y por tanto, se trata de un derivado de un hidrocarburo saturado
).
(C H
Descontando la masa del yodo de la del derivado halogenado se obtiene la masa molar del
) que permite calcular el nmero de tomos de carbono de
radical del hidrocarburo (C H
dicho hidrocarburo:
240 g X 127 g I = 113 g hidrocarburo
n mol C

1 g H
12 g C
+ 2n + 1 mol H
= 113 g
1 mol H
1 mol C

n = 8

La frmula molecular del hidrocarburo es C8 H18 y como se forma un nico derivado


halogenado la frmula estructural podra ser:

que corresponde al 2,2,3,3tetrametilyodobutano.



(O.Q.N. Valencia de D. Juan 2004)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

99

35. En el diseo de una pila de combustible para producir energa elctrica se ha utilizado una
mezcla 1:1 en masa de fuel:oxidante de 2,576 kg a 117C. El fuel es una mezcla de H4 N2
(hidracina) y
(metilhidracina) en la proporcin adecuada para que se agote
completamente el oxidante que es
.
Las reacciones de la pila son:
(g) +

(g)

(g) +
(g)
a) Ajuste ambas reacciones.

(g) +
(g) +

(g) +

(g) (1)

(g) (2)

Reaccin (1)
Reduccin :5 N2 O4 + 8 H + 8 e
Oxidacin: 4 H6 CN2 + 2 H O

N2 + 4 H O
CO2 + N2 + 10 H + 10 e


4 CO2 (g) + 9 N2 (g) + 12 H2O (g)

4 H6 CN2 (g) + 5 N2 O4 (g)


Reaccin (2)
Reduccin: N2 O4 + 8 H + 8 e
Oxidacin:2 H4 N2

N2 + 4 H O

N2 + 4 H + 4 e


3 N2 (g) + 4 H2 (g)

2 H4 N2 (g) + N2 O4 (g)

b) Dibuje la estructura de Lewis de las molculas:


N2 O4

CO2

H6 CN2

H4 N2


c) Determine G a 25C de las dos reacciones que tienen lugar.
Datos a 25C:
Sustancia
H (kJ/mol) S (kJ/molK)
(J/molK)
(g)
241,8
0,1888
37,7
(g)
95,4
0,2385
48,4
(g)
11,1
0,3044
79,25
(g)
94,7
0,2786
71,1
(g)
393,5
0,2138
37,1
(g)

0,1916
29,1
La ecuacin que permite calcular la variacin de energa libre de Gibbs es:
r G = r H Tr S
La entalpa de reaccin, r H, puede calcularse a partir de las entalpas de formacin de
productos y reactivos.
r H = i Hi

productos

i Hi

reactivos

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

100

La variacin de entropa de la reaccin puede calcularse a partir de las entropas molares de


productos y reactivos:
r S = i Si

productos

i Si

reactivos

Reaccin (1)
241,8 kJ
393,5 kJ

+ 12 mol H O
mol H O
mol CO2

r H = 4 mol CO2

4 mol H6 CN2

94,7 kJ
11,1 kJ
= 4909,9 kJ
+ 5 mol N2 O4
mol H6 CN2
mol N2 O4

0,1888 kJ
0,2138 kJ
0,1916 kJ

+ 12 mol H O
+ 9 mol N
K mol H O
K mol CO2
K mol N

r S = 4 mol CO2

4 mol H6 CN2

0,2786 kJ
0,3044 kJ
= 2,2088 kJK1
+ 5 mol N2 O4
K mol H6 CN2
K mol N2 O4

r G = 4909,9 kJ (298 K 2,2088 kJK 1 ) = 5568,1 kJ


Reaccin (2)
r H = 4 mol H O

241,8 kJ
95,4 kJ
11,1 kJ
2 mol H4 N2

+ 1 mol N2 O4
mol H O
mol H4 N2
mol N2 O4

r H = 1169,1 kJ
r S = 4 mol H O

0,1888 kJ
0,1916 kJ

+ 3 mol N
K mol H O
K mol N

2 mol H4 N2

0,2786 kJ
0,3044 kJ
= 0,5486 kJK 1
+ 1 mol N2 O4
K mol H4 N2
K mol N2 O4

r G = 4909,9 kJ (298 K 0,5486 kJK 1 ) = 1332,6 kJ


d) Determine la variacin de energa libre de Gibbs total de la pila, sabiendo que el 37,5% de la
mezcla se consume en la reaccin (1).
En primer lugar se calcula la composicin de la mezcla de fuel/oxidante = 1/1 :
50 g N2 O4
2576 g mezcla = 996 g N2 O4
100 g mezcla
50 g fuel
2576 g mezcla = 1288 g fuel
100 g mezcla
Llamando:
x = g H6 CN2

y = g H4 N2

z = g N2 O4

y teniendo en cuenta que el 37,5% de la mezcla se consume en la reaccin (1), esta cantidad
correspondera a todo el H6 CN2 y al N2 O4 que reaccionaran por esta va:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

101

37,5 g mezcla (reaccio n 1)


2576 g mezcla (total) = 996 g mezcla (reaccio n 1)
100 g mezcla (total)
2576 g 966 g = 1610 g mezcla (reaccin 2)
1 mol H6 CN2 5 mol N2 O4 92 g N2 O4


= 996 g mezcla
46 g H6 CN2 4 mol H6 CN2 1 mol N2 O4

x g H6 CN2 + x g H6 CN2
Se obtiene, x = 276 g H6 CN2

La masa de oxidante, N2 O4 , consumido en la reaccin 1 es:


966 g mezcla 276 g H4 N2 = 690 g N2 O4
Sabiendo la masa total de oxidante se puede calcular el consumido en la reaccin 2:
1288 g N2 O4 (total) 690 g N2 O4 (reaccin 1) = 598 g N2 O4
A partir de esta masa de oxidante se obtiene la masa de fuel consumido en la reaccin 2:
598 g N2 O4

1 mol N2 O4 2 mol H4 N2 32 g H4 N2


= 416 g H4 N2
92 g N2 O4 1 mol N2 O4 1 mol H4 N2

Como se observa la cantidad de fuel correspondiente a ambas reacciones es:


276 g H6 CN2 + 416 g H4 N2 1288 g mezcla
lo que significa que queda fuel sin reaccionar.
La energa libre de Gibbs a 25C es:
Reaccin 1 276 g H6 CN2

1 mol H6 CN2 5568,1 kJ



= 8352 kJ
46 g H6 CN2 1 mol H6 CN2

1 mol H4 N2 1332,6 kJ
Reaccin 2 416 g H4 N2

= 8662 kJ
46 g H4 N2 1 mol H4 N2

r G = 17014 kJ

e) Determine G a 117C para cada reaccin.


Las ecuaciones que proporcionan el valor de G a 117C son:
r H117 = r H + (ni Cpi T)
r G117 = r H 117 Tr S 117

117

r S

T117
= r S + ni Cpi ln
T25

Reaccin (1)
El valor de (ni Cpi ) es:
(ni Cpi ) = 4 mol CO2

0,0377 kJ
0,0371 kJ
0,0291 kJ

+ 12 mol H O
+ 9 mol N
K mol H O
K mol CO2
K mol N

4 mol H6 CN2

0,0711 kJ
0,07925 kJ
= 0,182 kJK 1
+ 5 mol N2 O4
K mol H6 CN2
K mol N2 O4

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

102

siendo, T = 117C 25C = 92C = 92 K


r H117 = 4909,9 kJ + 0,182 kJK 1 92 K = 4893,2 kJ
r S117 = 2,2088 kJK 1 + 0,182

kJ
117+273 K
= 2,258 kJK 1
ln
K
25+273 K

r G117 = 4893,2 kJ + 117+273 K 2,258

kJ
= 5773,7 kJ
K

Reaccin (2)
El valor de (ni Cpi ) es:
(ni Cpi ) = 4 mol H O

0,0377 kJ
0,0291 kJ

+ 3 mol N
K mol H O
K mol N

2 mol H4 N2

0,0484 kJ
0,07925 kJ
= 0,062 kJK 1
+ 1 mol N2 O4
K mol H4 N2
K mol N2 O4

siendo, T = 117C 25C = 92C = 92 K


r H117 = 1169,1 kJ + 0,062 kJK 1 92 K = 1163,4 kJ
r S117 = 0,5486 kJK 1 + 0,062

kJ
117+273 K
= 0,565 kJK1
ln
K
25+273 K

r G117 = 1163,4 kJ + 117+273 K 0,565

kJ
= 1383,9 kJ
K

La energa libre de Gibbs a 117C es:


Reaccin 1 276 g H6 CN2

1 mol H6 CN2 5773,7 kJ



= 8661 kJ
46 g H6 CN2 1 mol H6 CN2

Reaccin 2 416 g H4 N2

1 mol H4 N2 1383,9 kJ

= 8995 kJ
46 g H4 N2 1 mol H4 N2

r G117 = 17656 kJ

f) Suponiendo que el rendimiento total de la pila es del 70%, determine la energa elctrica que
puede obtenerse.
La energa til que puede obtenerse de pila es suponiendo un rendimiento del 70% es:
17656 kJ

1 mol H6 CN2
70 kJ (u til)

= 12359 kJ
46 g H6 CN2 1000 kJ (teo rico)
(O.Q.N. Valencia de D. Juan 2004)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

103

36. El cido lctico es un cido monocarboxlico aliftico constituido por carbono, hidrgeno y
oxgeno, con una funcin alcohol en su estructura y que presenta isomera ptica. Al quemar
completamente 8 g del mencionado cido se producen 11,7 g de dixido de carbono y 4,8 g de
agua. Si la misma cantidad de cido se vaporiza a 150C en un recipiente de 300 mL, en el que se
ha hecho el vaco, la presin ejercida es de 7810 mm Hg.
a) Calcular las frmulas emprica y molecular del cido lctico.
(Dato. R= 0,082 atmL/Kmol)
Para obtener las frmulas emprica y molecular del previamente se calcula la masa molar del
mismo:
Para evitar errores de redondeo resulta ms til calcular primero la frmula molecular del
cido lctico (AcL) a partir de su masa molar. Suponiendo que en estado gaseoso este se
comporta como gas ideal, por medio de la ecuacin de estado se obtiene su masa molar:
M =

8,0 g 0,082 atmLmol 1 K 1 150+273 K 760 mmHg 103 mL




= 90 gmol 1
1 atm
7810 mmHg 300 mL
1 L

El C contenido en el cido lctico se determina en forma de CO2 .


11,7 g CO2 1 mol CO2 1 mol C 90 g AcL
mol C



= 3

mol AcL
8,0 g AcL 44 g CO2 1 mol CO2 1 mol AcL
El H contenido en el cido lctico se determina en forma de H2 O:
mol H
4,8 g H2 O 1 mol H2 O 2 mol H 90 g AcL

= 6



mol AcL
8,0 mg AcL 18 g H2 O 1 mol H2 O 1 mol AcL
El O contenido en el cido lctico se determina por diferencia:
12 g C
1 g H
6 mol H
1 mol C
1 mol H g O 1 mol O = 3 mol O
16 g O
mol AcL
1 mol AcL

90 g AcL 3 mol C

La frmula molecular o verdadera es C3 H6 O3 , y simplificando se obtiene que la emprica o


sencilla es CH2

b) Ajustar la reaccin de combustin.
La reaccin de combustin del cido lctico es:
C3 H6 O3 (l) + 3 O2 (g)

3 CO2 (g) + 3 H2 (l)

c) Escribir su frmula estructural desarrollada.

Si el cido lctico presenta actividad ptica,


debe tener un C asimtrico. Teniendo en
cuenta que tambin debe tener un grupo
carboxilo, su frmula estructural es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

104

d) Indicar razonadamente la hibridacin y los tipos de enlace ( y ) que se presentan en cada


uno de los tomos de carbono.
El tomo de C del grupo
:
y tiene 4 enlaces
Presenta hibridacin
El tomo de C del grupo OH:
y tiene 4 enlaces
Presenta hibridacin
El tomo de C del grupo COOH:
y tiene 3 enlaces y 1 enlace
Presenta hibridacin

e) Calcular el grado de disociacin y el valor de la constante de disociacin cuando se disuelven


0,6257 g cido lctico (slido puro) hasta un volumen total de disolucin de 100 mL. Como dato
adicional se utiliza un pHmetro que da una lectura de pH= 2,14.
En primer lugar se calcula la concentracin de la disolucin acuosa de cido lctico:
0,6257 g C3 H6 O3 90 g C3 H6 O3 103 mL disolucio n

= 6,9510 2 M

100 mL disolucio n 1 mol C3 H6 O3 1 L disolucio n
Si pH = 2,14; el valor de [H O ] = 10

pH

= 7,2410 3 M

El cido lctico es un cido dbil que se disocia de acuerdo con la siguiente ecuacin:
C3 H6 O3 (aq) + H2O (l)

C3 H5 O (aq) + H O (aq)

La tabla de concentraciones correspondiente a este equilibrio es:



cinicial
ctransformado
cformado
cequilibrio

C3 H6 O3
c
x

c x

C3 H5 O


x
x

H O

x
x

La constante de disociacin es:


[C3 H5 O ] [H O ]
x2
7,2310 3 2
K =
=
=
c x
[C3 H6 O3 ]
6,9510 2 7,2410

= 8,410

El grado de disociacin del cido es:


[C3 H5 O ] x 7,2310
=
= =
[C3 H6 O3 ] c 6,9510

3
2 = 0,104

10,4%
(O.Q.N. Luarca 2005)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

37. El

105

puede utilizarse para obtener yodo en un proceso en dos etapas en medio cido:
(aq) +

(aq)

(aq) +

(aq)

[1]

(aq) +
(aq)
(s) +
(l)

[2]
Una muestra de 10 mL de disolucin de
cuya concentracin es 10 g/L se trata con una
cantidad estequiomtrica de
(s). A continuacin se aade a la mezcla de la reaccin
anterior otra cantidad estequiomtrica de
(aq) para producir la segunda reaccin. Se
pide:
a) Ajustar las dos reacciones redox.
La reaccin [1]
reduccin: IO + 6 H + 6 e
oxidacin: 3 (HSO + H O
+ 3

I + 3 H O
SO + 3 H + 2 e

I + 3
+ 3

La reaccin [2]
reduccin: 2 IO + 12 H + 10 e
oxidacin: 5 (2 I +
2

I2 + 6 H O

I2 + 2 e )

+ 10 I + 12


6 I2 + 6

b) El potencial estndar de la reaccin [2] indicando qu especie se reduce y cul se oxida.


Datos: E (
/ ) = 1,2 V; E ( / ) = 0,535 V.
La especie que se reduce es el

(ctodo) y la especie que se oxida es el I (nodo).

El potencial estndar para la reaccin [2] es:


E

= E

c) La masa de

= E

/I2 EI2 /I

= 1,2 V 0,535 V = 0,665 V

(s) que hace falta aadir en la primera etapa.

El nmero de moles de NaIO contenidos en la disolucin de concentracin 10 g/L es:


10 mL disolucio n

10 g NaIO
1 mol NaIO 1 L disolucio n

= 5,0510 4 mol NaIO

1 L disolucio n 198 g NaIO 103 mL disolucio n

Relacionando NaIO con NaHSO :


5,0510 4 mol NaIO

3 mol NaHSO 104 mol NaHSO



= 0,16 g
1 mol NaIO
1 mol NaHSO

d) El volumen de disolucin de

que es necesario aadir en la segunda etapa.

Relacionando la etapa 1 con la 2:


5,0510 4 mol IO (etapa 1)

1 mol I (etapa 1) 2 mol IO (etapa 2)


= 1,0110 4 mol IO (etapa 2)

1 mol IO
10 mol I (etapa 1)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

106

Relacionando IO con la disolucin:


1,0110 4 mol IO

1 mol NaIO 198 g NaIO 1 L disolucio n



= 210

1 mol NaIO
10 g NaIO
1 mol IO

L disolucin

e) Razonar si en la segunda reaccin la entropa aumenta o disminuye.


Como se observa en la reaccin [2]
2 IO (aq) + 10 I (aq) + 12 H (aq)

6 I2 (s) + 6 H O (l)

se pasa de una disolucin acuosa a la formacin de un slido, el sistema se ordena, por tanto,
la entropa en esta reaccin disminuye.
f) Calcular G de la reaccin [2] indicando el significado de esta variable.
Dato. F = 96500 C/mol.
La relacin entre G y el potencial de la pila, E

G = nFE
G = 10 mol

, viene dado por la expresin:

96500 C
1 kJ
= 641,7 kJ
0,665 V
mol
103 J

G representa la fraccin de energa del sistema que puede ser convertida en trabajo til.
g) Calcular
Datos.

G de la especie

en kJ/mol.

G (aq) = 51,57 kJ/mol;

(l) = 237,1 kJ/mol.

La energa libre de reaccin, r G, puede calcularse a partir de las energas libres de formacin
de productos y reactivos.
r G = i Gi

productos

i Gi

reactivos

Aplicado a la reaccin [2]:


641,7 kJ = 6 mol H O
Se obtiene, f G (

237,1 kJ
2 mol IO
mol H O

) = 132,6 kJmol

f G + 10 mol I

51,57 kJ

mol I


(O.Q.N. Luarca 2005)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

107

38. El
(g) se disocia a 127C mediante un proceso endotrmico, en
(g) y (g),
establecindose un equilibrio. En un recipiente de 20 litros a 127C se introducen 4 moles de

producindose una disociacin del 30%. Se pide:
a) Las concentraciones molares de cada gas en el equilibrio.
El SO3 se disocia segn el equilibrio:
2 SO3 (g)

2 SO2 (g) + O2 (g)

Planteando la tabla de moles correspondiente en funcin del grado de disociacin, :



ninicial
ntransformado
nformado
nequilibrio

SO3
n
n

n 1

SO2

n
n

O2

n
n

Las concentraciones en el equilibrio son:


SO3 =

n 1
4 mol 1 0,3
=
= 0,14 M
V
20 L

SO2 =

n 4 mol 0,3
=
= 0,06 M
V
20 L

O2 =

n 4 mol 0,3
=
= 0,03 M
2V
2 20 L

b) La presin total y parcial de cada gas.


Dato. R = 0,082 atmLmol1K1.
Considerando comporamiento ideal, las presiones en el equilibrio son:
pSO = 0,14 molL

0,082 atmLmol 1 K

127+273 K = 4,59 atm

pSO = 0,06 molL

0,082 atmLmol 1 K

127+273 K = 1,97 atm

pO = 0,03 molL

0,082 atmLmol 1 K

127+273 K = 0,98 atm

De acuerdo con la ley de Dalton la presin total de la mezcla es:


pt = pSO + pSO + pO = 4,59+1,97+0,98 atm = 7,45 atm
3

c) Las constantes

a 127C.

La constante K :
K =

SO2 O2
0,06 0,03
=
= 5,510
SO3
0,14

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

108

La constante K :
K =

pSO

pO

pSO

1,97 0,98
= 0,181
4,59

d) Si estando la mezcla en equilibrio se reduce el volumen del sistema hasta un tercio de su valor
inicial (sin que resulte afectada la temperatura). Qu concentracin le corresponder a cada
una de las especies en el nuevo equilibrio?
El principio de Le Chtelier dice:
cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
Segn Boyle, al reducir el volumen a un tercio del valor inicial (20/3 = 6,67 L) la presin se
hace el triple. De acuerdo con el principio de Le Chtelier el sistema se desplaza en el sentido
en el que disminuya el nmero de molculas de gas para que as disminuya la presin. El
equilibrio se desplaza hacia la formacin de SO3.
La nueva tabla de moles es:

ninicial
ntransformado
nformado
nequilibrio

SO3
4 1 0,3

x
2,8 + x

SO2
40,3
x

1,2 x

O2
40,3
x

0,6 x

Sustituyendo en la expresin de la constante Kc:


5,510 3 =

1,2 x 0,6 0,5x


6,67
2,8 + x

Como se observa, se trata se obtiene un polinomio de grado 3, en el que una solucin


aceptable es x = 0,308 mol.
Las nuevas concentraciones en el equilibrio cuando V = 6,67 L son:
SO3 =

2,8 + 0,308 mol


= 0,466 M
6,67 L

SO2 =

1,2 0,308 mol


= 0,134 M
6,67 L

O2 =

0,6 0,154 mol


= 0,067 M
6,67 L

e) Razonar que condicin debe cumplir la temperatura para que la reaccin de disociacin
tenga lugar de forma espontnea.
Para saber si se trata o no de un proceso espontneo es necesario calcular el valor de la
energa libre de Gibbs:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

109

r G = r H Tr S
Se trata de una reaccin endotrmica (r H > 0) en la que aumenta el desorden (r S > 0) ya
que hay ms moles de gas en los productos que en los reactivos. La reaccin se hace
espontnea a temperaturas altas, ya entonces se cumple que:
Tr S > r H

T >

r H

r S

r G < 0 (proceso espontneo)

f) Deducir el orden de reaccin a partir de los siguientes datos:


Si la concentracin de
aumenta 4 veces (manteniendo constantes las concentraciones de
y ) la velocidad de reaccin disminuye a la mitad.
Si la concentracin de
aumenta 4 veces (manteniendo constantes las concentraciones de
y ) la velocidad de reaccin aumenta cuatro veces.
Si la concentracin de aumenta 4 veces (manteniendo constantes las concentraciones de
y
) la velocidad de reaccin no cambia.
La ecuacin general de velocidad del proceso es:
r = k SO3 SO2 O2
Experimento 1 r = k 4 SO3 SO2 O2 = r
Experimento 2 r = k SO3 4 SO2 O2 = 4 r
Experimento 3 r = k SO3 SO2 4 O2 = r
Relacionando el experimento 1 con la ecuacin general se obtiene:
k [4 SO3 [SO2 [O2
r
r

=

r
r
k [SO3 [SO2 [O2

Relacionando el experimento 2 con la ecuacin general se obtiene:


k [SO3 [4 SO2 [O2
r
4 r

=

r
r
k [SO3 [SO2 [O2

= 1

Relacionando el experimento 3 con la ecuacin general se obtiene:


k [SO3 [SO2 [4 O2
r
r

=
r
k [SO3 [SO2 [O2
r

= 0

El orden de reaccin es:


x + y+ z = + 1 + 0 =
g) Dibuje las estructuras de Lewis de los xidos de azufre, indicando y justificando la geometra
molecular de cada uno de ellos.
Las estructuras de Lewis del SO2 y SO3 son, respectivamente:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

De acuerdo con la notacin del modelo de RPECV el SO2 es


una sustancia cuya distribucin de ligandos y pares de
electrones solitarios alrededor del tomo central se ajusta a
la frmula AX2E a la que corresponde un nmero estrico
(m+n) = 3 por lo que su disposicin es triangular y su
geometra es ANGULAR ya que slo hay dos ligandos unidos
al tomo central. El ngulo de enlace es algo menor de 120
debido a la repulsin que provoca el par de electrones
solitario que hay sobre el tomo de azufre.

110

De acuerdo con la notacin del modelo de RPECV el SO3 es


una sustancia cuya distribucin de ligandos y pares de
electrones solitarios alrededor del tomo central se ajusta a
la frmula AX3 a la que corresponde un nmero estrico
(m+n) = 3 por lo que su disposicin y su geometra es
TRIANGULAR. Los ngulos de enlace son de 120.

(O.Q.N. Luarca 2005)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

111

39. En 1959 el bioqumico espaol Severo Ochoa (19051993), recibi el premio Nobel de
Fisiologa y Medicina por su contribucin al desciframiento del cdigo gentico.
a) El cdigo gentico se puede equiparar a un diccionario molecular que establece una
equivalencia entre los nucletidos del ARN y los aminocidos que componen las protenas. Es un
cdigo universal que est organizado en tripletes o codones, de forma que cada aminocido est
codificado por tres nucletidos. Teniendo en cuenta que existen 4 nucletidos diferentes
(adenina, A; citosina, C; guanina, G y uracilo, U) y que su combinacin en grupos de 3 genera 64
tripletes diferentes que codifican 20 aminocidos, el cdigo gentico est degenerado: un mismo
aminocido puede estar codificado por ms de un triplete.
Supongamos que en un planeta de nuestra galaxia se han encontrado protenas que contienen
216 aminocidos diferentes, que los cidos nucleicos estn formados por 5 nucletidos diferentes
y que el cdigo gentico est organizado en tripletes. Bastar con 5 nucletidos diferentes para
codificar los 216 aminocidos?
Existen 5 nucletidos diferentes y el cdigo gentico est organizado en tripletes, por lo que 3
nucletidos codifican un aminocido. Por tanto, tendramos 53 = 125 tripletes diferentes. Si
tenemos 216 aminocidos diferentes, el nmero de tripletes es inferior al de aminocidos, por
lo que con 5 nucletidos no podramos codificar los 216 aminocidos.
b) Severo Ochoa descubri el enzima ARN polimerasa (llamada inicialmente polinucletido
fosforilasa), que cataliza la sntesis de ARN, molcula intermediaria entre el ADN y las protenas.
Dado el siguiente fragmento de ADN:
3 TACGATAATGGCCCTTTTATC 5
5 ATGCTATTACCGGGAAAATAG 3
b1) Deducir la secuencia de ribonucletidos del ARN mensajero (ARNm) que se obtiene de cada
una de las hebras de ADN, teniendo en cuenta que la sntesis de ARNm se produce en la direccin
5 3 y que el apareamiento de bases es A U, T A y C G.
ARNm 5


AUGCUAUUACCGGGAAAAUAG 3

3 TACGATAATGGCCCTTTTATC 5
5 ATGCTATTACCGGGAAAATAG 3

ARNm 3


UACGAUAAUGGCCCUUUUAUC 5
b2) A partir de las secuencias de ARNm obtenidas en el apartado anterior y utilizando el cdigo
gentico, escribir la secuencia de aminocidos de los polipptidos que se obtienen, teniendo en
cuenta que el proceso de traduccin se produce en la direccin 5 3, que al extremo 5 le
corresponde el extremo amino terminal (NH2) y al 3, el carboxi terminal (COOH).
ARNm

5 AUGCUAUUACCGGGAAAAUAG 3


Polipptido NH2 Met Leu Leu Pro Gly Lys COOH

ARNm
3 UACGAUAAUGGCCCUUUUAUC 5

Polipptido COOH Arg Ser Phe Leu NH2

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

112

b3) En la sntesis del ARNm, una de las hebras de ADN acta como molde y se transcribe (hebra
codificadora), mientras que la otra acta como hebra estabilizadora. Sabiendo que la secuencia
de ADN propuesta se traduce a un polipptido de 6 aminocidos, escribir el polipptido correcto
e indicar cul es la hebra de ADN que se transcribe.
El polipptido correcto es:
NH2 Met Leu Leu Pro Gly Lys COOH
Por tanto, la hebra que acta como molde y que se transcribe es:
3 TACGATAATGGCCCTTTTATC 5
hebra que se transcribe
5 ATGCTATTACCGGGAAAATAG 3
Cdigo gentico
Primera base Segunda base
U

U
C
A
G
U
C
A
G
U
C
A
G
U
C
A
G

U
Phe
Ser
Tyr
Cys
Leu
Pro
His
Arg
Ile
Thr
Asn
Ser
Val
Ala
Asp
Gly

Tercera base
C
A
Phe
Leu
Ser
Ser
Tyr
STOP
Cys
STOP
Leu
Leu
Pro
Pro
His
Gln
Arg
Arg
Ile
Ile
Thr
Thr
Asn
Lys
Ser
Arg
Val
Val
Ala
Ala
Asp
Glu
Gly
Gly

G
Leu
Ser
STOP
Trp
Leu
Pro
Gln
Arg
Met
Thr
Lys
Arg
Val
Ala
Glu
Gly

Codn iniciacin: AUG


Codones finalizacin: UAA, UAG, UGA
Cdigos aminocidos:
Phe: fenilalanina; Leu: leucina; Ser: serina; Tyr: tirosina; Cys: cistena; Trp: triptfano; Pro:
prolina; His: histidina; Gln: glutamina; Arg: arginina; Ile: isoleucina; Met: metionina; Thr:
treonina; Asn: asparragina; Lys: lisina; Val: valina; Ala: alanina; Asp: aspartato; Glu: glutamato;
Gly: glicina
(O.Q.N. Luarca 2005)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

113

40. Considrese el siguiente equilibrio qumico, a 1259,15 K:


(g) +

(g)

(g) + CO (g)

= 51,5 kJ

a) Explique el efecto que tendran sobre dicho equilibrio los siguientes efectos:
a1) Una disminucin de la temperatura:

se desplaza a la derecha.
se desplaza a la izquierda.
no se altera.
no puede saberse con estos datos.

a2) Un aumento del volumen:

se desplaza a la derecha.
se desplaza a la izquierda.
no se altera.
no puede saberse con estos datos.

a3) Un aumento de la presin:

se desplaza a la derecha.
se desplaza a la izquierda.
no se altera.
no puede saberse con estos datos.

a4) La presencia de un catalizador:

se desplaza a la derecha.
se desplaza a la izquierda.
no se altera.
no puede saberse con estos datos.

El principio de Le Chtelier dice:


cualquier cambio en una de las variables que determinan el estado de equilibrio de un
sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
a1) Si se produce una disminucin de la temperatura de acuerdo con el principio de Le
Chtelier el sistema se desplaza en el sentido en el que aumente la temperatura, es decir en el
sentido en el que produzca calor. Como se trata de un proceso endotrmico el equilibrio se
desplaza a la izquierda.
a2) Segn Boyle, al aumentar el volumen la presin se hace menor. De acuerdo con el
principio de Le Chtelier el sistema se desplaza en el sentido en el que aumente el nmero de
molculas de gas para que as suba la presin. Como existe el mismo nmero de molculas
gaseosas en reactivos y productos el sistema no se ve afectado por los cambios de volumen o
presin. El equilibrio no se altera.
a3) Si se produce un aumento de presin de acuerdo con el principio de Le Chtelier el
sistema se desplaza en el sentido en el que disminuya el nmero de molculas de gas para que
as suba la presin. Como existe el mismo nmero de molculas gaseosas en reactivos y
productos el sistema no se ve afectado por los cambios de volumen o presin. El equilibrio
no se altera.
a4) La presencia de un catalizador disminuye la energa de acticacin tanto de la reaccin
directa como la inversa lo que hace que el equilibrio se alcance en menos tiempo sin que el
sistema se vea afectado. El equilibrio no se altera.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

114

b) Si se mezclan 1 mol de y 1 mol de


, a 1259,15 K y, una vez alcanzado el equilibrio, el
anlisis revela que la mezcla contiene 0,557 mol de
y 0,557 mol de CO. Cul sera el valor
de la constante de equilibrio? Tendra el mismo valor a una temperatura de 958 K? Razone la
respuesta.
Construyendo la tabla de moles correspondiente:

ninicial
ntransformado
nformado
nequilibrio

H2
1
x

1 x

CO2
1
x

1 x

H2 O

x
x

CO

x
x

Si la mezcla en equilibrio contiene 0,557 moles de H2 O y de CO:


1 x = 0,443 mol H2 y CO2

x = 0,557 mol

Sustituyendo en la expresin de la constante K :


0,557 2
H2 O CO
V2
=
= 1,58
K =
0,443 2
H2 CO2

V2
Si desciende la temperatura hasta 958 K, de acuerdo con el principio de Le Chtelier el sistema
se desplaza en el sentido en el que aumente la temperatura, es decir en el sentido en el que
produzca calor. Como se trata de un proceso endotrmico el equilibrio se desplaza a la
formacin de H2 y CO2 . Por este motivo, las cantidades de H2 y CO2 se harn mayores y las
de H2 O y CO menores. La constante de equilibrio disminuye.
Como en este equilibrio se cumple que K = K ya que = 0, otra forma de calcularlo es
mediante la ecuacin de vant Hoff:
ln

K p2
K p1

r H 1
1


R T1 T2

Sustituyendo los valores dados:


ln

1,58
51,5
=
Kp 1
8,31410

1
1


958 1259,15

Kp1 = 0,337

c) Explique cualitativa, y cuantitativamente, qu ocurrira si se mezclasen 3 mol de


de , a 1259,15 K. Cul sera la composicin de la mezcla en el equilibrio?

y 1 mol

Como solo hay reactivos el sistema debe desplazarse hacia la derecha para que estn
presentes todas las especies y se alcance el equilibrio:

ninicial
ntransformado
nformado
nequilibrio

H2
1
x

1 x

CO2
3
x

3 x

H2 O


x
x

CO


x
x

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

115

Sustituyendo en la expresin de la constante K :


x2
V2
1,58 =

1 x 3 x

V2

x = 0,81 mol

La mezcla en equilibrio est formada por:


0,810 mol de CO y 0,810 mol H2 O
3 0,810 mol = 2,190 mol CO2
1 0,810 mol = 0,190 mol H2
d) Si la reaccin se explica considerando un mecanismo concertado en una sola etapa, y la
entalpa de activacin fuera, H = 58,3 kcal
, represente grficamente el perfil de la
reaccin. Calcule la entalpa de activacin de la reaccin inversa.
Teniendo en cuenta que se trata de un proceso endotrmico (r H = 51,5 kJ = 12,4 kcal), la
representacin grfica correspondiente a las energas de activacin de la reaccin propuesta
es la siguiente:


Como se observa:
r H = EA

directa

EA

inversa

12,4 kcal = 58,3 kcal EA

inversa

EA (inversa) = 45,9 kcal


(O.Q.N. Vigo 2006)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

41. El cido frmico,


, tiene una constante de disociacin,
a) Calcule el
del cido frmico.

116

= 2,010 4

El pK de un cido se define como:


pK = log K

pK = log 2,010

= 3,70

b) Cul es el pH de una disolucin acuosa 0,10 M de cido frmico?


La ecuacin qumica correspondiente a la ionizacin del cido frmico en disolucin acuosa
es:
HCO H (aq) + H O (l)

HCO (aq) + H O (aq)

Aplicando los correspondientes balances y aproximaciones se puede escribir:


[HCO ] = [H3 O ] = x
[HCO2 H] = c [H3 O ] = c x
siendo c la concentracin inicial de HCO2 H.
La constante de acidez del cido frmico es:
K =

[HCO ] [H3 O ]
x2
=

c x
[HCO2 H]

Como se cumple que:


c
> 100 se puede realizar la aproximacio n c [H O ] c
K

con lo que la ecuacin anterior queda como:


K =

[H O
c

[H O ] = K c = 2,010 4 0,1 = 4,510 3 M

pH = log 4,510

= 2,35

c) Si se aaden 4 litros de agua a 1 litro de esta disolucin, cul ser el nuevo valor del pH?
Despus de aadir 4 L de H2 O a la disolucin anterior, suponiendo volmenes aditivos, la
nueva concentracin de la disolucin es:
c =

1 L HCO2 H 0,1 M 0,1 mol HCO2 H


= 0,02 M

1+4 L disolucio n 1 L HCO2 H 0,1 M

Procediendo de forma idntica al apartado anterior, se obtiene:


[H O ] = K c = 2,010 4 0,02 = 2,010 3 M
pH = log 2,010

= 2,70

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

117

d) Si se aaden 5 mL de sosa 1,0 M, a 20 mL de una disolucin 0,50 M de cido frmico cul ser
el pH de la disolucin obtenida?
Si se aade disolucin de NaOH tiene lugar la reaccin cuya ecuacin qumica es:
HCO H (aq) + NaOH (aq)

NaHCO (aq) + H O (l)

El pH despus de la reaccin depende de cules sean las sustancias existentes en ese instante.
El nmero de mmoles de ambos reactivos es:
20 mL HCO2 H 0,5 M

0,5 mmol HCO2 H


= 10 mmol HCO2 H
1 mL HCO2 H 0,5 M

5 mL NaOH 1,0 M

1,0 mmol NaOH


= 5 mmol NaOH
1 mL NaOH 1,0 M

10 mmol HCO2 H
= 2
5 mmol NaOH

Como se observa, la relacin molar es mayor que 1, lo cual quiere decir que reactivo
limitante es el NaOH y que sobra HCO2 H. Adems, se forma NaHCO2 , por tanto, en el punto
final se tiene una mezcla formada por un cido dbil (HCO2 H) y una sal de dicho cido
(NaHCO2 ), es decir, una disolucin reguladora cida.
Considerando volmenes aditivos, las concentraciones en la disolucin resultante son:
C =

C =

1 mmol HCO2 H
1 mmol NaOH = 0,2 M
20+5 mL disolucio n

10 mmol HCO2 H 5 mmol NaOH

1 mmol NaHCO2
1 mmol NaOH = 0,2 M
20+5 mL disolucio n

5 mmol NaOH

Las ecuaciones correspondientes a las disociaciones de las sustancias en la disolucin son:


HCO H (aq) + H O (l)

HCO (aq) + H O (aq)

NaHCO (aq) + H O (l)

HCO (aq) + Na (aq)

La tabla de concentraciones en el equilibrio es:



cinicial
ctransformado
cformado
cequilibrio

HCO2 H
C
x

C x

HCO
C

x
C +x

H3 O+

x
x

En el equilibrio se pueden hacer las siguientes aproximaciones:


(C x) C y (C + x) C
Teniendo en cuenta ambas aproximaciones, la expresin de la constante de equilibrio queda
como:
K =

[HCO ] [H3 O ]

[HCO2 H]

K =

C
[H3 O ]
C

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

118

Sustituyendo los valores dados:


[H O ] = 2,010

4 0,2

0,2

= 2,010 4 M

pH = log 2,010

= 3,70

e) Si a la disolucin del apartado 4, se le aaden otros 5 mL de sosa 1,0 M, cul ser el nuevo
valor del pH? Escribir el equilibrio que se produce.
En este caso la cantidad de NaOH aadida es:
10 mL NaOH 1,0 M

1,0 mmol NaOH


= 10 mmol NaOH
1 mL NaOH 1,0 M

El nmero de mmoles de ambos reactivos es:


20 mL HCO2 H 0,5 M

0,5 mmol HCO2 H


= 10 mmol HCO2 H
1 mL HCO2 H 0,5 M

5 mL NaOH 1,0 M

1,0 mmol NaOH


= 5 mmol NaOH
1 mL NaOH 1,0 M

10 mmol HCO2 H
= 1
10 mmol NaOH

Como se observa, se trata de cantidades estequiomtricas, es decir, que reaccionan


completamente y no sobra nada de ninguno de los reactivos. El pH de la disolucin lo
proporciona la sustancia formada, NaHCO2 , una sal de cido dbil y base fuerte, por tanto se
tiene una hidrlisis bsica.
Considerando volmenes aditivos, la concentracin de la disolucin resultante es:
1 mmol NaHCO2
1 mmol NaOH = 0,333 M
20+10 mL disolucio n

10 mmol NaOH

El ion Na no se hidroliza ya que procede del NaOH (base fuerte).


El ion HCO se hidroliza produciendo iones OH segn la reaccin:
HCO (aq) + H2 O (l)

HCO2 H (aq) + OH (aq)

Aplicando los correspondientes balances y aproximaciones se puede escribir:


[HCO2 H] = [OH ] = x
[HCO ] = c [OH ] = c x
siendo c la concentracin inicial de NaHCO2 .
La constante de basicidad del ion formiato es:
K =

[HCO2 H] [OH ]
x2
=

c x
[HCO ]

El valor de la constante de basicidad (hidrlisis) del formiato se calcula mediante la siguiente


expresin:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

K
K

HCO2 H

10

14

2,010

4 = 5,010

11

119

Como se cumple que:


c
> 100 se puede realizar la aproximacio n c [OH ] c
K

con lo que la ecuacin anterior queda como:


K =

[OH ]2

c

pOH = log 4,110

[OH ] = K c = 5,010
6

= 5,39

11

0,333 = 4,110 6 M

pH = 14 pOH = 14 5,39 = 8,61


(O.Q.N. Vigo 2006)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

120

42. El diazometano,
N=N
, se descompone en etano,

, y nitrgeno,
presin inicial es 360 mmHg y, transcurridos 400 s, asciende a 363,6 mm Hg.
a) Cul es la fraccin de diazometano descompuesta?

. Si la

La ecuacin qumica correspondiente a la descomposicin del diazometano es:


CH N=NCH (g)

CH CH (g) + N (g)

Las presiones son:


CH CH

CH N=NCH
360
360 x


p t = 0 s
p t = 400 s

De acuerdo con la ley de Dalton de las mezclas gaseosas, la presin total para t = 400 s es:
pt = pCH3

N=N CH3 + pCH3 CH3 + pN2

Sustituyendo las presiones dadas:


363,6 = 360 x + x +x

x = 3,6 mmHg

La fraccin de diazometano descompuesta viene dada por la relacin entre las presiones de
diazometano transformado al cabo de 400 s y la presin inicial:
pCH

N=N CH3

pCH

(transformado)

N=N CH3

(inicial)

3,6 mmHg
= 0,01 1%
360 mmHg

b) Calcule la constante de velocidad de la reaccin de descomposicin, supuesta de primer orden.


La ecuacin de velocidad correspondiente a una cintica de primer orden es:
k[A]=

d[A]
[A]
d[A]

= kdt integrando se obtiene ln
= k t
[A]
[A 0
dt

Escribiendo la ecuacin en trminos presiones:


ln

p
= k t
p0

Se obtiene, k = 2,510

ln
5

3663,6 mmHg
= k (400 s)
366 mmHg

c) Cul es el periodo de vida media,

, del diazometano?

El periodo de vida media, t , es el tiempo que transcurre hasta la muestra inicial, p0, se hace la
mitad, p /2.
Aplicado a la ecuacin de velocidad:
ln

p
= k t
p0 /2

t =

ln 2

k

t =

ln 2
2,5105 s1

= 2,810

(O.Q.N. Vigo 2006)


Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

121

43. Teniendo en cuenta que en la estructura molecular del benceno, todos los tomos de carbono
son equivalentes, (eje de simetra de orden seis):
a1) Cuntos ismeros se pueden formular para el compuesto de frmula emprica:
?
Dibjense sus estructuras moleculares. Qu simetra conserva cada ismero?
Existen 3 ismeros:


1,2diclorobenceno


1,3diclorobenceno


1,4diclorobenceno

a2) Cuntos ismeros se pueden formular para el compuesto de frmula emprica:


Dibjense sus estructuras moleculares. Cul es el de mayor simetra?

Existen 3 ismeros:


1,2,3triclorobenceno


1,2,4triclorobenceno


1,3,5triclorobenceno

a3) Cuntos ismeros se pueden formular para el compuesto de frmula emprica:


Dibjense sus estructuras moleculares. Cul es el de mayor simetra?

Existen 2 ismeros:


1,2,3,4tetraclorobenceno


1,2,3,5tetraclorobenceno

a4) Cuntos ismeros se pueden formular para el compuesto de frmula emprica:


Dibjense sus estructuras moleculares. Cul es su orden de simetra?

No presenta ismeros ya que el tomo de hidrgeno puede estar unido a cualquiera de los
tomos de carbono del anillo.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

122

a5) Cuntos ismeros se pueden formular para el compuesto de frmula emprica:


Dibjense sus estructuras moleculares. Cul es su orden de simetra?

No presenta ismeros ya que todos los tomos unidos a los tomos de carbono de anillo son
tomos de cloro.
a6) A partir de qu orbitales atmicos deben ser construidos los orbitales del benceno?
De los orbitales 2p de los tomos de carbono.
b) Considrese la molcula del aldehdo:
=CHCH=O
b1) Qu ncleos atmicos se encuentran en el mismo plano?
Los tomos de carbono y el tomo de oxgeno
lo que hace que
tienen hibridacin
tengan disposicin triangular con ngulos de
aproximadamente 120.

Esta disposicin triangular obligada po los


dobles enlaces hace que la geometra global
del compuesto sea plana lo que motiva que
todos los ncleos se encuentren en el
mismo plano.

b2) Qu hibridacin debe considerarse para cada uno de los tomos de carbono? Y para el
tomo de oxgeno?
Como se observa en la figura anterior, la geometra triangular de los tomos de carbono
que presentan.
viene determinada por la hibridacin
El tomo de oxgeno al formar un enlace doble tambin presenta hibridacin
b3) Si se adiciona una molcula de
dibjese la estructura del mismo.

sobre el enlace C=C, qu compuesto se obtiene? Nombre y

La adicin de una molcula de H2 al enlace C=C hace que se forme


un aldehdo saturado:
CH2 =CH CHO + H2

CH3 CH2 CHO

El compuesto formado es el propanal cuya estructura es:

b4) Si se adiciona una molcula de sobre el enlace C=O, Qu compuesto se obtiene?


Nmbrese y dibjese la estructura del mismo.
La adicin de una molcula de H2 al enlace C=O hace que se forme
un alcohol insaturado:
CH2 =CH CHO + H2

CH2 =CH CH2 OH

El compuesto formado es el 2propen1ol cuya estructura es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

123

c) Con los datos de la tabla adjunta, calclese la entalpa de reaccin de las dos reacciones
precedentes.
Datos. Energas medias de enlace:
Enlace

C=C CC C=O CO CH OH HH

Energa (kJ
)
612 348 743 360 413 391 436
Reaccin de hidrogenacin del enlace C=C:
CH2 =CH CHO + H2

CH3 CH2 CHO

A la vista de las estructuras anteriormente expuestas y considerando que las energas de


enlaces son negativas (se desprende energa al formar un enlace y se absorbe para romperlo),
la variacin de entalpa asociada a dicha reaccin es:
La variacin de entalpa asociada a una reaccin tambin se puede calcular a partir de las
energas de enlace mediante la expresin:
r H = i H

enlaces formados

i H

enlaces rotos

Los enlaces formados en los productos y los rotos en los reactivos son:
r H = 2 EC C + 6 EC H + EC=O EC C + EC=C + 4 EC H + EC=O + EH
= EC C + 2 EC H ) (EC=C + EH
r H = 1 mol CC

348 kJ
413 kJ
+ 2 mol CH
mol CC
mol CH

1 mol C=C

436 kJ
612 kJ
= 126 kJ
+ 1 mol HH
mol HH
mol C=C

Reaccin de hidrogenacin del enlace C=O:


CH2 =CHCHO + H2

CH2 =CHCH2 OH

Los enlaces formados en los productos y los rotos en los reactivos son:
r H = EC C + EC=C + 5 EC H + EC O + EO

EC C + EC=C + 4 EC H + EC=O + EH

= EC H + EC O + EO H ) (EC=O + EH

r H = 1 mol CH

1 mol C=O

413 kJ
360 kJ
391 kJ
+ 1 mol CO
+ 1 mol OH
mol CH
mol CO
mol OH

743 kJ
436 kJ
= 15 kJ
+ 1 mol HH
mol C=O
mol HH
(O.Q.N. Vigo 2006)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

124

44. Una muestra de un hidrocarburo, que pes 25,93 mg y ocupaba 11,25


a 25C y 1 atm, se
mezcl con 102,5
de oxgeno en las mismas condiciones. Se hizo saltar una chispa y, tras la
combustin, el gas residual resultante fue una mezcla de oxgeno y dixido de carbono, ocupando
un volumen de 80
, en las mismas condiciones de presin y temperatura que la mezcla
inicial. Al pasar la mezcla gaseosa a travs de un absorbente, que elimin totalmente el dixido
de carbono, el volumen se redujo a 35
.
a) Calcule la composicin molar porcentual de la mezcla inicial y de la mezcla gaseosa
resultante de la combustin.
La mezcla inicial est formada por:
11,25 cm hidrocarburo y 102,5 cm de oxgeno. De acuerdo con la ley de Avogadro, en una
mezcla gaseosa la composicin volumtrica coincide con la composicin molar. Por tanto, la
composicin molar porcentual de la mezcla inicial es:
11,25 cm3 hidrocarburo
100 = 9,9% hidrocarburo
11,25 cm3 hidrocarburo + 102,5 cm3 O2
102,5 cm3 O2
100 = 90,1% O2
11,25 cm3 hidrocarburo + 102,5 cm3 O2
La ecuacin qumica correspondiente a la combustin del hidrocarburo es:
Cx Hy (g) + x +

y
O (g)
4 2

y
x CO2 (g) + H2 O (l)
2

La mezcla gaseosa resultante est formada por CO2 y el O2 en exceso. Al pasarla por un
absorbente se elimina el CO2 , por tanto, se puede escribir que:
VCO2 + VO2 (exceso) = 80 cm3
VO2 (exceso) = 35 cm3

VCO2 = 45 cm3

La composicin molar porcentual de la mezcla resultante es:


45 cm3 CO2
100 = 56,3% CO2
80 cm3 mezcla
35 cm3 O2
100 = 43,7% O2
80 cm3 mezcla
b) Calcule la cantidad de agua formada.
El volumen de O2 consumido determina la cantidad de H2 O formada:
VO2 (total) = VO2

consumido

+ VO2

exceso

VO2

consumido

= 102,5 35 cm3 = 67,5 cm3

VO2

consumido

= VO2

VO2

consumido H2 O

consumido CO2

+ VO2

consumido H2 O

= 67,5 45 cm3 = 22,5 cm3

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

125

Considerando comportamiento ideal, el nmero de moles de O2 gastado en formar H2 O es:


1 atm 22,5 cm3

n =

0,082 atmLmol K

1 L

25+273 K 10

cm3

= 9,210 4 mol O2

La masa de H2 O formada es:


9,210 4 mol O2

2 mol H2 O
= 1,8410 4 mol H2 O
1 mol O2

1,8410 4 mol H2 O

18 g H2 O
= 0,033 g H2 O
1 mol H2 O

c) Halle la frmula molecular del hidrocarburo.


Considerando comportamiento ideal, el nmero de moles de CO2 formado es:
1 atm 45 cm3

n =

0,082 atmLmol K

1 L

25+273 K 10

cm3

= 1,8410 3 mol CO2

La relacin entre el nmero de moles de CO2 y de H2 O formados permite obtener la relacin


molar entre C e H:
2 mol H
1,8410 4 mol H2 O 1 mol CO2 2 mol H


=

4
1,8410 mol CO2 1 mol C 1 mol H2 O 1 mol C

frmula emprica:

Para obtener el valor de n es necesario calcular la masa molar de hidrocarburo. Considerando


comportamiento ideal:
M =
n =

25,93 mg 0,082 atmLmol 1 K 1 25+273 K 1 g 103 cm3


3
= 56,3 gmol 1
1 atm 11,25 cm3
10 mg 1 L

56,3 g hidrocaburo
= 4
1 g H
12 g C
+ 2 mol H
1 mol C
1 mol H
1 mol C

frmula molecular: C4 H8

d) Proponga cuatro compuestos que respondan a dicha frmula.


1buteno


2buteno


isobuteno

ciclobutano

(O.Q.N. Crdoba 2007)


Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

126

45. Se introduce 1 mol de


en una cmara vaca establecindose el equilibrio a 250C y 2
atm. El gas en el equilibrio contiene 40,7 % de en volumen.
a) Cules son las presiones parciales, expresadas en bar, de
y
en el equilibrio?
Dato. 1 atm = 1,013 bar.
La ecuacin qumica correspondiente al equilibrio es:
PCl5 (g)

PCl3 (g) + Cl2 (g)

De acuerdo con la ley de Avogadro, en una mezcla gaseosa la composicin volumtrica


coincide con la composicin molar lo que permite obtener la correspondiente fraccin molar.
Por tanto, segn la estequiometra de la reaccin, las fracciones molares de la mezcla en
equilibrio son:
yPCl3 = yCl2 = 0,407
yPCl5 = 1 yCl2 + yPCl3 = 0,407

yPCl5 = 0,186

De acuerdo con la ley de Dalton de las mezclas gaseosas:


pPCl3 = pCl2 = p yCl2 = 2 atm
pPCl5 = p yPCl5 = 2 atm
b) Calcule

1,013 bar
0,407 = 0,825 bar
1 atm

1,013 bar
0,186 = 0,377 bar
1 atm

a 250C.

La expresin de la constante K es:


K =

pPCl

pCl

pPCl

bar =

0,825 2
= 1,81 K
0,377

atm =

20,407 2
= 1,78
20,186

c) Si la mezcla gaseosa se expansiona hasta 0,2 atm manteniendo constante la temperatura,


calcule:
c1) El % de
que se disociar en el equilibrio.
La tabla de moles correspondiente al equilibrio en funcin del nmero de moles iniciales y del
grado de disociacin es:

PCl5
PCl3
ninicial
n

ntransformado
n

nformado

n
nequilibrio
n n
n
n = n n + n + n = n 1 +

Cl2

n
n

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

127

De acuerdo con la ley de Dalton de las presiones parciales la expresin anterior queda como:
K =

pyPCl pyCl
3

pyPCl

n
n

2
n 1+ n 1+
= p
= p

n 1
12
n 1+

Sustituyendo
1,78 = 0,2

2
1 2

c2) La presin parcial de

= 0,984 98,4%
en equilibrio tras aadir 1 mol de

Si a la mezcla en equilibrio se le aade 1 mol de PCl3 , de acuerdo con el principio de


Le Chtelier, el sistema se desplaza en el sentido en el que se consuma el PCl3 aadido, es
decir, hacia la formacin de PCl5 .
Como inicialmente exista 1 mol de PCl5 y el grado de disociacin es 0,948 el nmero de moles
de cada componente de la mezcla es:
nCl2 = 1 mol 0,984 = 0,984 mol
nPCl3 = 1 mol 0,984 + 1 mol = 1,984 mol
nPCl5 = 1 mol 10,984 = 0,052 mol
La tabla de moles correspondiente al nuevo equilibrio es:

PCl5
PCl3
Cl2
ninicial
0,052
1,948
0,948
ntransformado

x
x
nformado
x

nequilibrio
0,052 + x
1,948 x
0,948 x
n = 0,52 +x + 1,948 x + 0,948 x = 2,948 x
Sustituyendo en la expresin de K :
1,948x 0,948x

2,948x 2,948x

1,78 = 0,2
0,052+x
2,948x

x = 0,017 mol

La presin parcial del Cl2 es:


pCl2 = 0,2 atm

0,9480,017 mol
= 0,064 atm
2,9480,017 mol

d) Si la mezcla gaseosa, correspondiente al equilibrio inicial, se mantiene a la presin de 2 atm y


se eleva la temperatura a 487C, cul ser la nueva composicin de la mezcla en equilibrio?
(H = 172,2 kJ
, e independiente de la temperatura)
(Dato. R = 8,314 kJ

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

128

Previamente, mediante la ecuacin de vant Hoff, es preciso calcular el valor de la constante de


equilibrio a la temperatura de 487C:
ln

K p2 H 1
1
=

K p1
R T1 T2

Sustituyendo:
ln

K p2
172,2
=
1,78 8,31410

1
1


250+273
487+273

K p2 = 4,11105

Sustituyendo en la expresin de K :
4,11105 = 2

2
1 2

1 100%

Al elevar la temperatura y tratarse de un proceso endotrmico, de acuerdo con el principio


de Le Chtelier, el sistema se desplaza en el sentido en el que disminuya la temperatura, es
decir hacia la formacin de PCl3 y Cl2 lo que hace que la constante de equilibrio sea muy
elevada. Por este motivo, como se observa, el PCl5 se disocia totalmente y no se alcanza el
equilibrio.
(O.Q.N. Crdoba 2007)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

129

46. Calcular el pH de:


a) Una disolucin (500 mL) de cido actico (
) 0,1 M que contiene 2 g de acetato
sdico (
) y 410 moles de cido clorhdrico.
(Datos:

) = 1,810 ; masa molecular del

= 82)

El HCl reacciona con el NaCH3 COO segn la siguiente ecuacin qumica:


HCl (aq) + NaCH3 COO (aq)

NaCl (aq) + CH3 COOH (aq)

Los mmoles en la disolucin son:


2 g NaCH3 COO

1 mol NaCH3 COO 103 mmol NaCH3 COO



= 24,4 mmol NaCH3 COO
82 g NaCH3 COO
1 mol NaCH3 COO

500 mL CH3 COOH 0,1 M


4,0103 mol HCl

0,1 mmol CH3 COOH


= 50 mmol CH3 COOH
1 mL CH3 COOH 0,1 M

103 mmol HCl


= 4,0 mmol HCl
1 mmol HCl

La relacin molar es:


4,0 mmol HCl
= 0,16
24,4 mmol NaCH3 COO
Como se observa, la relacin molar es menor que 1, lo cual quiere decir que reactivo
limitante es el HCl y que sobra NaCH3 COO. Adems, se forma CH3 COOH, por tanto, en el
punto final se tiene una mezcla formada por un cido dbil (CH3 COOH) y una sal de dicho
cido (NaCH3 COO), es decir, una disolucin reguladora cida.
Considerando que en la mezcla no se produce variacin apreciable de volumen, las
concentraciones en la disolucin resultante son:
C =

C =

24,4 mmol NaCH3 COO 4,0 mmol HCl


500 mL disolucio n

1 mmol NaCH3 COO


1 mmol HCl
= 0,041 M

1 mmol CH3 COOH


1 mmol HCl
= 0,108 M
500 mL disolucio n

50 mmol CH3 COOH + 4,0 mmol HCl

Las ecuaciones correspondientes a las disociaciones de las sustancias en la disolucin son:


CH3 COOH (aq) + H2 O (l)

CH3 COO (aq) + H3 O (aq)

NaCH3 COO (aq) + H2 O (l)

CH3 COO (aq) + Na (aq)

La tabla de concentraciones en el equilibrio es:



cinicial
ctransformado
cformado
cequilibrio

CH3 COOH
C
x

C x

CH3 COO
C

x
C +x

H3 O+


x
x

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

130

En el equilibrio se pueden hacer las siguientes aproximaciones:


(C x) C y (C + x) C
Teniendo en cuenta ambas aproximaciones, la expresin de la constante de equilibrio queda
como:
K =

[CH3 COO ] [H3 O ]



[CH3 COOH]

K =

C
[H3 O ]
C

Sustituyendo los valores dados:


[H3 O ] = 1,810

5 0,108

0,041

= 4,7410 5 M

pH = log 4,7410

b) Una disolucin obtenida mediante la mezcla de 30 mL de


0,5 M y diluida con agua a 100 mL.
(Datos.
= 2,16;
= 7,13;
= 12,3)

= 4,32

0,3 M con 40 mL de

Las ecuaciones correspondientes a las disociaciones de las sustancias en la disolucin son:


H3 PO4 (aq) + H2 O (l)

H2 PO (aq) + H3 O (aq)

Na3 PO4 (aq) + H2 O (l)

PO (aq) + 3 Na (aq)

El PO procedente del Na3 PO4 reacciona con el H3 PO4 de acuerdo con la ecuacin:
PO (aq) + H3 PO4 (aq)

H2 PO (aq) + HPO

(aq)

Los mmoles en la disolucin son:


30 mL H3 PO4 0,3 M

0,3 mmol H3 PO4


= 9 mmol H3 PO4
1 mL H3 PO4 0,3 M

40 mL Na3 PO4 0,5 M

0,5 mmol Na3 PO4


= 20 mmol Na3 PO4
1 mL Na3 PO4 0,5 M

La relacin molar es:


20 mmol Na3 PO4
= 2,2
9 mmol H3 PO4
Como se observa, la relacin molar es mayor que 1, lo cual quiere decir que reactivo
limitante es el H3 PO4 y que sobra Na3 PO4 .

mmolinicial
mmolfinal

H3 PO4
9

PO
20
11

H2 PO

HPO

Se vuelve a tener una reaccin cidobase entre el PO sobrante (base) y el H2 PO formado


(cido) cuya ecuacin es:
PO (aq) + H2 PO (aq)

2 HPO

(aq)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

131

La relacin molar es:


11 mmol PO
= 1,2
9 mmol H2 PO
Como se observa, la relacin molar es mayor que 1, lo cual quiere decir que reactivo
limitante es el H2
y que sobra PO .

mmolinicial
mmolfinal

H2 PO
9

PO
11
2

HPO
9
9+18

Considerando el equilibrio:
HPO (aq) + H2 O (l)

PO (aq) + H3 O (aq)

Puesto que todos los reactantes se encuentran en el mismo volumen final, pueden utilizarse
milimoles en lugar de concentraciones finales para sustituirlos en la expresin:
K3 =

[PO ] [H3 O ]

[HPO ]

[H3 O ] = K3

[HPO ]

[PO ]

Aplicando logaritmos y multiplicando por (1) se obtiene la siguiente expresin:


pH = pK3 + log

[PO ]

[HPO ]

c) Una disolucin 10 M de
(Dato.

= 6,410

pH = 12,3 + log

2
= 11,17
27

Se trata de una disolucin acuosa de un cido muy dbil y diluido por lo que es necesario
tener en cuenta los H3 O suministrados por el H2 O.
El equilibrio correspondiente a la disociacin del HBO2 viene dado por la siguiente ecuacin:
HBO2 (aq) + H2 O (l)

BO (aq) + H3 O (aq)

cuya constante de ionizacin es:


K =

[BO ] [H3 O ]

[HBO2 ]

Anlogamente, para el H2 O se tiene:


2 H2 O (l)

H3 O (aq) + OH (aq)

K = [H3 O ] [OH ]
El balance de materia para el HBO2 es:
[HBO2 = [HBO2 ] + [BO ]
El balance de cargas (condicin de electroneutralidad) es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

132

[H3 O ] = [OH ] + [BO ]


Del balance de cargas y del producto inico del agua se obtiene:
[H3 O ] = [OH ] + [BO

[BO = [H3 O ]

Kw = [H3 O ] [OH

Kw


[H3 O ]

Del balance de materia y la ecuacin anterior se obtiene:


[HBO2 = [HBO2 ] + [BO

[BO = [H3 O ]

Kw

[HBO2 ] = [HBO2

H3 O +

[H3 O ]

Kw
H3 O

Teniendo en cuenta que la siguiente aproximacin no conduce a un error significativo:


[HBO2 >> [H3 O ] +

Kw
[H3 O ]

[HBO2 ] [HBO2

Sustituyendo en la expresin de K se obtiene:


Kw
[H3 O ]
H3 O ]

[HBO2 ]

H3 O ]
K =

K =

H3 O K w

[HBO2 ]

Sustituyendo:
6,410

10

H3 O

pH = log 1,310

10
10
7

14

H3 O ] = 1,310 7 M

= 6,89

d) Una disolucin acuosa (900 mL) en la que se ha recogido el amoniaco producido al tratar una
disolucin que contena 1,5 g de cloruro amnico con exceso de hidrxido sdico.
(Dato.

= 1,810 )

La ecuacin qumica correspondiente a la reaccin entre NH4 Cl y NaOH es:


NH4 Cl (aq) + NaOH (aq)

NH3 (g) + H O (l) + NaCl (aq)

Como existe exceso de NaOH el NH4 es el reactivo limitante que determina la cantidad de
NH3 formado. Por tanto, la concentracin de la disolucin acuosa de NH3 obtenida es:
1,5 g NH4 Cl
1 mol NH4 Cl 1 mol NH3 103 mL disolucin



= 0,031 M
900 mL disolucin 53,5 g NH4 Cl 1 mol NH4 Cl 1 L disolucin
El NH3 en disolucin acuosa est disociado segn la siguiente ecuacin:
NH3 (aq) + H2O (l)

NH4 (aq) + OH (aq)

La constante de equilibrio correspondiente es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

K =

133

[NH4 ] [OH ]

[NH3 ]

Haciendo los correspondientes balances en el equilibrio se tiene que:


[NH4 ] = [OH ]
[NH3 ] = c

[OH ]

Como se cumple que:


c
> 100 se puede realizar la aproximacio n c [OH ] c
K

con lo que la ecuacin de la constante de equilibrio queda como:


K =

[OH
c

[OH ] = K c = 1,810 5 0,031 = 7,510 4 M

pOH = log 7,510

= 3,13

pH = 14 pOH = 14 3,13 = 10,87


(O.Q.N. Crdoba 2007)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

134

47. Para los pares redox: E (


/Cu) = 0,521 V; E (
/
) = 0,68 V. Calclese:
a) La reaccin espontnea que tendr lugar en la pila formada uniendo ambos electrodos.
Para que una reaccin sea espontnea debe cumplirse que:
G < 0
La relacin entre G y el potencial de la pila, Epila , viene dado por la expresin:
G = nFEpila
Las semirreacciones que tienen lugar son:
Ca todo (reduccio n): PtCl + 2 e

PtCl + 2 Cl

Cu+ + e ]

Anodo (oxidacio n): 2 Cu


Reaccin global:
+ 2 Cu

+ 2 Cl + 2 Cu+

El potencial de la pila se calcula mediante la expresin:


E

= E

= E

Como E


ECu+ /Cu E

= 0,68 V 0,521 V = 0,159 V

> 0, la reaccin propuesta es espontnea.

b) La constante de equilibrio de dicha reaccin a 25C.


La variacin de energa libre de Gibbs para una reaccin viene dado por la siguiente expresin:
G = G + RT ln K
Cuando el sistema est en equilibrio, se cumple que G = 0, por tanto:
G = RT ln K
La relacin entre G y E
G = nFE

viene dada por la siguiente expresin:

Combinando ambas expresiones se obtiene:


G = nFE

ln K =

G = RT ln K

nFE
RT

Sustituyendo:
ln K =

2 96485 Cmol
8,314 JK

mol

0,159 V
25+273 K

= 12,38

K = 2,4105

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

135

c) Epila y G a 25C, cuando las concentraciones de las diferentes especies son:


[
] = 10 M; [
] = 10 M; [Cl ] = 10 M; [
Es espontnea la reaccin en estas condiciones?
La ecuacin de Nernst permite calcular E
E = Eo
E

] = 210

M.

en condiciones diferentes a las estndar

0,0592
[red]
log

n
[oxd]
= E

0,0592
[PtCl ] [Cl
log
2
[PtCl ]

(210 5 ) (10 3 )
0,0592
log
= 0,937 V
= 0,68 V
2
10 2
E

/Cu = E

El valor de E
E

/Cu

0,0592
1
0,0592
1
log
= 0,521 V
log
= 0,343 V
1
[Cu ]
1
10 3

es:

= E

/Cu

= 0,937 V 0,343 V = 0,594 V

La variacin de energa libre es:


G = nFE

G = 2 96485 Cmol

0,594 V = 1,15105 J

Como G < 0, la reaccin es espontnea en esas condiciones.


d) Los valores de H y S en el rango de temperatura 0 a 100C.
T (C)
0
50
75 100
K 10
4,8
1,368 0,838 0,548
Dato. R = 8,314 J

Cuando el sistema est en equilibrio, se cumple que G = 0, por tanto:


G = RT ln K
La relacin entre G y H y S viene dada por la siguiente expresin:
G = H TS
Combinando ambas expresiones se obtiene:
G = RT ln K

G = H TS

ln K =

H S
+

R
RT

Representando grficamente ln K frente a 1/T se obtiene una recta cuya pendiente


proporciona el valor de H y cuya ordenada el valor de S.
ln K
1/T

ln 4,8105
1/ 0+273

ln 1,368105
1/ 50+273

ln 0,838105
1/ 75+273

ln 0,548105
1/ 100+273

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

136


De la representacin grfica se obtiene que:
pendiente =

H
= 2210 K
R

S
= 4,9855
ordenada =
R
e) Cantidad de
corriente.
Dato. F = 96485 C

H = 2210 K

8,314 10 3 kJ
= 18,4 kJmol
K mol

8,314 J
S = 4,9855
= 41,4 JK
K mol

mol

, en gramos, que se habr formado cuando hayan pasado 8 faradays de


.

De acuerdo con la ley de Faraday y teniendo en cuenta la semirreaccin del apartado a)


correspondiente a la reduccin del PtCl :
8 F

1 mol e 1 mol PtCl 337 g PtCl




=
1 F
2 mol e
1 mol PtCl


(O.Q.N. Crdoba 2007)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

137

48. En las tablas de potenciales estndar de reduccin de los diferentes pares redox (en medio
cido) se encuentran los siguientes valores: E (
/
) = 1,77 V E ( /
) = 0,68 V.
a) Escribe las semirreacciones ajustadas que muestran el comportamiento del agua oxigenada
como oxidante y como reductora.
Como oxidante, el H O se reduce a H2 O:
+ 2 H + 2

2 H2 O

Como reductor, el H O se oxida a O :


+ 2 H + 2

b) Es espontnea la descomposicin del

? Justifcalo.

A partir de las reacciones:


H O + 2 H + 2 e
H O

2 H2 O

O + 2 H + 2 e

E = 1,77 V

E = 0,68 V

se obtiene la reaccin de descomposicin del H O :


2 H O

2 H2 O + O

E = 1,77 V + 0,68 V = 1,09 V

Para que una reaccin sea espontnea debe cumplirse que G < 0 y la relacin entre G y
E viene dada por la siguiente expresin:

G = nFE

Como en la reaccin propuesta E > 0, entonces G < 0, por tanto, la reaccin de


es espontnea.
descomposicin del
c) Cmo puede explicarse que el agua oxigenada sea un producto corriente, que permanece sin
descomponerse durante tiempos bastante largos?
El agua oxigenada se descompone naturalmente, pero la reaccin es muy lenta:
metaestable.

es

2. El potencial estndar del par


/
es 0,77 V. Demuestra que la presencia de iones

puede favorecer la descomposicin del agua oxigenada mediante otra reaccin, y que
posteriormente, la especie reducida formada pueda regenerar Fe3+ por accin de otra molcula
de
, actuando el
como catalizador.
Teniendo en cuenta que el potencial estndar del par O2/H2O2, E = 0,68 V, es menor que el
correspondiente al par Fe3+/Fe2+, E = 0,77 V, el H2O2 es capaz de reducir al Fe3+ a Fe2+ de
acuerdo con la reaccin:
H O

O + 2 H + 2 e

2 Fe3 + 2 e
3+

+ 2 Fe

2 Fe

E = 0,68 V

E = 0,77 V

2+

+ 2 H + 2 Fe


E = 0,09 V

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

138

Por otra parte, como el potencial estndar del par H O /H2 O, E= 1,77 V, es mayor que el
correspondiente al par Fe /Fe , E = 0,77 V, si se aade ms H O , esta sustancia es capaz
de oxidar al Fe formado en la reaccin anterior a Fe de acuerdo con la reaccin:
H O + 2 H + 2 e
2 Fe2

2 H2 O

2 Fe + 2 e
2+

E = 1,77 V

E = 0,77 V

3+

+ 2 H + 2 Fe

2 H2 O + 2 Fe

E = 1,00 V

Sumando las dos reacciones, se obtiene la reaccin global:


H O + 2 H + 2 Fe
H O + 2 Fe

2 H2 O + 2 Fe

E = 1,00 V

O + 2 H + 2 Fe

E = 0,09 V

2 H2 O +

E = 1,09 V

Como se puede observar, el Fe formado en la primera reaccin se consume en la segunda


por lo que no afecta a la reaccin global y se puede decir que el Fe3+ acta como catalizador
en la descomposicin del H O .
3. Se ha realizado la descomposicin del agua oxigenada en presencia de iones Fe a
temperatura constante. Para ello se utiliz una muestra de 10,0 mL de una concentracin
[
] = 6,010 mol (se considera que el volumen V de la disolucin acuosa de perxido de
hidrogeno se mantiene constante y que el volumen molar de un gas a esa temperatura es =
24,0 L
). Se aadi el catalizador y se anotaron a diversos instantes t el volumen de
oxgeno V( ) desprendido. Los resultados se recogen en la tabla siguiente:
t / min

0 5 10 15 20 30
V( ) formado / mL 0 1,56 2,74 3,65 4,42 5,26
a) Obtn la concentracin de [
] restante (mol ) a partir de los volmenes de oxgeno de
la tabla, para cada uno de los valores de t.
Relacionando el volumen de O formado con los moles de H O descompuestos para un
tiempo de 5 min:
1 L O
2 mol H O
0,013 mol H O
1 mol O
1,56 mL O
3

=


0,01 L disolucio n 24,0 L O 10 mL O 1 mol O
L disolucio n
La concentracin de H O sobrante es:
[H O

= [H O

[H O

[H O

= 0,060 0,013 molL = 0,047 molL

Procediendo de igual forma con los tiempos restantes se obtiene la siguiente tabla:
t/min
[

]/ molL

10

15

20

25

0,0600

0,0470

0,0372

0,0296

0,0232

0,0162

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

139

b) Representa los valores de [


] restante en funcin del tiempo en el papel cuadriculado.
Comentario: Las escalas de ambos ejes deben ser claramente legibles y su tamao debe permitir
una cmoda lectura.
[H 2O2 ] vs. t

[H2O2] / molL1

0,07
0,06
0,05
0,04
0,03
0,02
0,01
0
0

10

15

20

25

30

t / min


c) Escribe la definicin de la velocidad de descomposicin del
diferencial).

(velocidad instantnea o

La velocidad de descomposicin del H O se define como la cantidad de esta sustancia que


desaparece por unidad de tiempo:
r =

d[
dt

d) Deduce de la curva anterior el valor de la velocidad de desaparicin del


mol
) a = 0 y a = 15 min.

(expresada en

La velocidad de desaparicin a un tiempo dado se obtiene calculando la pendiente de la recta


tangente a la curva en ese punto en la grfica [H O ] vs. t.
[H2 O2]vs.t
0,07

(0; 0,06)
0,06

[H2O2]/molL1

0,05

0,04
(15; 0,0296)

(9; 0,035)
0,03

0,02
(22; 0,020)
0,01

0
0

10

15
t/min

20

25

30

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

140

Mirando la grfica, la pendiente de la recta que pasa por el punto t = 0 min es:
r0 =

0,035 0,060 molL


9 0 min

= 0,0278 molL 1 min 1

Anlogamente, velocidad a t = 15 min es:


0,020 0,0296 molL
r15 =
22 15 min

= 0,0137 molL 1 min 1

e) Determina el tiempo o periodo de semirreaccin.


El tiempo de semirreaccin se define como el tiempo necesario para que la concentracin
inicial (0,06 molL 1 ) se reduzca a la mitad (0,03 molL 1 ).
[H2 O2]vs.t
0,07

0,06

[H 2O2]/molL1

0,05

0,04

0,03

0,02

0,01

0
0

10

15
t/min

20

25

30

A partir de la grfica puede observarse que la concentracin de H O se reduce a la mitad


(0,03 molL 1 ) cuando t = 15 min.
(O.Q.N. Castelln 2008)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

141

49. Desde el momento en que se pone en marcha la sntesis de HaberBosch para la fabricacin
del amonaco, el cido ntrico se prepara por el mtodo Ostwald. El proceso consta de tres
etapas:
a) Combustin cataltica del amonaco para formar NO. El amonaco mezclado con aire, se pone
en contacto con el catalizador slido, que es una malla de platino con un 10% de rodio, a 800C y
1 atm.
a)
(g) + (g)
NO (g) +
(g)
b) Oxidacin del NO a
. Con nuevo aporte de aire el NO se oxida a
.
b) NO (g) + (g)

(g)
c) En presencia de agua el
se dismuta en
y NO. El proceso tiene lugar al ponerse en
contacto con agua el
, en torres de lavado. El NO producido se oxida a
y sigue las
mismas transformaciones.
c)
(g) +
(l)

(aq) + NO (g)
El diagrama de flujo simplificado es el siguiente:


a) Escribe las reacciones ajustadas (a), (b) y (c) correspondientes a cada una de las tres etapas.
Se trata de reacciones de oxidacinreduccin. El ajuste de la ecuacin correspondiente a la
reaccin a) es:
reduccin: 5 O + 4 H + 4 e
oxidacin: 4 NH3 + H2 O
4 NH3 (g) + 5

(g)

2 H2 O

NO + 5 H + 5 e

4 NO (g) + 6 H2 O (g)

El ajuste de la ecuacin correspondiente a la reaccin b) es:


2 NO (g) +

(g)

(g)

El ajuste de la ecuacin correspondiente a la reaccin c) es:


Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

reduccin: NO + 2 H + 2 e
oxidacin: 2 NO + H2 O
3

(g) + H2 O (l)

142

NO + H2 O

NO + 2 H + e

2 HNO3 (aq) + NO (g)

b) Escribe una reaccin qumica global ajustada para las etapas (b) y (c).
Las ecuaciones qumicas correspondientes a las etapas b) y c) son:
2 NO + O

2 NO

3 NO + H2 O

2 HNO3 + NO

Como la especie NO producida en la reaccin b) se consume en la reaccin c) si se multiplica


cada una de las ecuaciones por el coeficiente adecuado se puede eliminar esta especie de la
reaccin global:
3 (2 NO + O

2 NO )

2 (3 NO + H2 O

2 HNO3 + NO)

Sumando ambas ecuaciones y simplificando se obtiene:


4 NO (g) + 3

(g) + 2 H2 O (l)

4 HNO3 (aq)

c) Escribe una reaccin qumica ajustada correspondiente al proceso global. Considera que el
vapor de agua producido en la etapa (a) condensa en la torre de lavado y toda el agua es lquida.
Teniendo en cuenta que la ecuacin qumica correspondiente a la reaccin global de las etapas
b) y c) es:
4 NO + 3 O + 2 H2 O

4 HNO3

y la correspondiente a la etapa a) es:


4 NH3 + 5 O

4 NO + 6 H2 O

Sumando ambas ecuaciones y simplificando se obtiene:


NH3 (g) + 2

(g)

HNO3 (aq) + H2 O (l)

2. Contesta a las siguientes preguntas:


a) Indica el estado de oxidacin del nitrgeno en los compuestos:

, NO,

En todos los compuestos el nmero de oxidacin del H es +1 y del O es 2, de acuerdo con esto
el estado de oxidacin de N en ellos es:
NH3
NO
NO2
HNO3

x + 3 +1 = 0

x = 3

x = +2

x + 2 2 = 0

x = +4

x = +5

x + 2 = 0

+1 + x + 3 2 = 0

Cuestiones y Problem
mas de las Olim
mpiadas de Qumica. Volumen
n 6. (S. Menargu
ues & F. Latre)

143

b) Diibuja las esttructuras dee Lewis de los


l compuestos anteriorres y su form
ma, justifica
ando los
ngullos de enlacee.
Las estructuras d
de Lewis de llas especies propuestas son:


De accuerdo con lla notacin del modelo de RPECV el NH3 es un
na
sustaancia cuya d
distribucin de ligando
os y pares de electron
nes
solitaarios alreded
dor del tom
mo central see ajusta a la frmula AX E
a la q
que correspo
onde un nm
mero estrico (m+n) = 4
4 por lo que su
dispo
osicin es teetradrica yy su geomeetra es PIR
RAMIDAL co
on
ngu
ulos de enlace inferiore
es a 109,5 debido a la repulsin qu
ue
ejercee el par de electrones solitario sittuado sobree el tomo d
de
nitrggeno.
De accuerdo con la notacin del modelo
o de RPECV el NO es un
na
sustaancia cuya d
distribucin de ligando
os y pares de electron
nes
solitaarios alreded
dor del tom
mo central see ajusta a la frmula AXE
a la q
que correspo
onde un nm
mero estrico (m+n) = 4
4 por lo que su
dispo
osicin es teetradrica y su geometrra es LINEA
AL ya que so
olo
hay d
dos tomos een la especiee. El ngulo de enlace e
es de 180.
De accuerdo con lla notacin del modelo de RPECV el NO2 es un
na
sustaancia cuya d
distribucin de ligando
os y pares de electron
nes
solitaarios alreded
dor del tom
mo central see ajusta a la frmula AX E
a la q
que correspo
onde un nm
mero estrico (m+n) = 3
3 por lo que su
dispo
osicin es triiangular y su
u geometra es ANGULA
AR ya que so
olo
hay d
dos tomos u
unidos al ttomo centrall. El ngulo de enlace es
superior a 120 debido a la pequeaa repulsin que ejerce el
omo de nitr
geno.
electrrn despareado situado sobre el to

De accuerdo con la notacin d


del modelo d
de RPECV el HNO3 es
una sustancia ccuya distribucin de liigandos y pares
p
de
electrrones solitarrios alreded
dor del tom
mo central see ajusta a
la frrmula AX a la que co
orresponde un nmero
o estrico
(m+n
n) = 3 porr lo que su disposicin y geom
metra es
TRIA
ANGULAR. Los nguloss de enlace son de 120
0.

3. En un proceso industrial, la
a corriente g
gaseosa (1), mezcla de a
amonaco y a
aire, que enttra en el
reacttor, tiene un ccaudal de 81
118,0 /h yy una densid
dad de 1020,7
7 g/ a 1 a
atm y 57C.
a) Calcula la massa molecular
r media de essta corriente gaseosa.
Consiiderando comportamien
nto ideal, la masa moleccular media se puede caalcular apliccando la
ecuaccin de estad
do modificad
da de los gasses ideales:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

M =

1020,7 gm

0,082 atmLmol 1 K
1 atm

57+273 K 1 m3
3 = 27,6 gmol
10 L

144

b) Expresa la composicin de esta corriente gaseosa (1) (amonaco, oxgeno y nitrgeno) en


% en volumen y en % en masa. Aire: 80% y 20% en volumen.
x moles de NH
Considerando que la mezcla contiene 100 moles contiene 0,8 100 x moles de N
0,2 100 x moles de O
y aplicando el concepto de masa molar:
x mol NH3

17 g
28 g
32 g
+ 0,8 100 x mol N2
+ 0,8 100 x mol O2

mol
mol
mol = 27,6 g
mol
100 mol

Se obtiene, x = 10 mol
10 moles de NH
La composicin de la mezcla es 72 moles de N
18 moles de O
Por tratarse de una mezcla gaseosa, el porcentaje en moles coincide con el porcentaje en
volumen:
composicin volumtrica de la mezcla

%
%
%

Las masas de los gases en la mezcla son:


10 mol NH3

17 g NH3
= 170 g NH3
mol NH3

72 mol N2

28 g N2
= 2016 g N2
mol N2

18 mol O2

mtotal = 2762 g

32 g
= 576 g O2
mol

La composicin de la mezcla expresada como porcentaje en masa es:


170 g NH3
100 = 6,15% NH3
2762 g mezcla
2016 g N2
100 = 72,99% N2
2762 g mezcla
576 g O2
100 = 20,85% O2
2762 g mezcla

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

c) Calcula los moles/h de

145

de la corriente gaseosa (1) que entran en el reactor.

Considerando comportamiento ideal, aplicando la ecuacin de estado se calculan los moles de


gas que entran al reactor:
n =

0,082 atmLmol 1 K

103 L
= 3105 molh 1
3
1 m
57+273 K

1 atm 8118 m3 h

A partir del caudal molar de la corriente gaseosa (1) y de la composicin molar de la misma se
pueden calcular los moles/h de cada gas que entran en el reactor:
3105

mol gas 10 mol NH3


mol NH3

= 30000

100 mol gas
h
h

3105

mol N2
mol gas 72 mol N2

= 216000

100 mol gas
h
h

3105

mol O2
mol gas 18 mol O2

= 54000

100 mol gas
h
h

4. Suponiendo la total conversin del


a NO, calcula la composicin de la corriente gaseosa
(2) a la salida del reactor y exprsala en % en peso y volumen.
Como existen cantidades de ambos reactivos, NH3 y O2 , previamente es necesario determinar
cul de ellos es el reactivo limitante.
5
54000 mol O2
= 1,8 >
30000 mol NH3
4
Lo cual quiere decir que el reactivo limitante es el NH3 que se consume totalmente y que
queda O2 sin reaccionar que sale del reactor con el N2 del aire (inerte) y el resto de los
productos gaseosos formados.
La cantidad de O2 consumido es:
30000

mol O2
mol NH3 5 mol O2

= 37500

h
4 mol NH3
h

La cantidad de O2 sobrante es:


37500

mol O2 (gastado)
mol O2 (exceso)
mol O2 (inicial)
37500
= 16500

h
h
h

Las cantidades de producto formado son:


30000

mol NO
mol NH3 4 mol NO

= 30000

h
4 mol NH3
h

30000

mol NH3 6 mol H2 O


mol H2 O

= 45000

h
4 mol NH3
h

El nmero total de moles de gas en la corriente de salida es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

16500

146

mol O2
mol N2
mol NO
mol H2 O
mol gas
+ 216000
+ 30000
+ 45000
= 307500

h
h
h
h
h

De acuerdo con la ley de Avogadro, por tratarse de una mezcla gaseosa la composicin molar
coincide con la composicin volumtrica:
216000 mol N2 /h
16500 mol O2 /h
100 = 5,37% O2
100 = 70,24% N2
307500 mol gas /h
307500 mol gas /h
45000 mol H2 O/h
30000 mol NO/h
100 = 9,76% NO
100 = 14,63% H2 O
307500 mol gas /h
307500 mol gas /h
Las masas de los gases en la corriente gaseosa de salida son:
16500

216000

30000

45000

mol O2 32 g O2 1 kg O2
kg O2


= 528
h
1 mol O2 103 g O2
h

mol N2 28 g N2 1 kg N2
kg N2

3
= 6048
h
1 mol N2 10 g N2
h

mol NO 30 g NO 1 kg NO
kg NO

3
= 900

h
1 mol NO 10 g NO
h

mtotal = 8286

kg gas

h

mol H2 O 18 g H2 O 1 kg H2 O
kg H2 O


= 810
h
1 mol H2 O 103 g H2 O
h

La composicin en masa de la corriente gaseosa de salida es:


528 kg O2 /h
6048 kg N2 /h
100 = 6,37% O2
100 = 72,99% N2
8286 kg gas /h
8286 kg gas /h
810 kg H2 O/h
900 kg NO/h
100 = 10,86% NO
100 = 9,78% H2 O
8286 kg gas /h
8286 kg gas /h
(O.Q.N. Castelln 2008)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

147

50. El sulfuro de hidrgeno es un gas incoloro que se puede producir durante procesos biolgicos
e industriales, siendo el ms venenoso de los gases naturales (seis veces ms letal que el
monxido de carbono). Este gas puede ser identificado en pequeas concentraciones por su
caracterstico olor a huevos podridos (< 1 mg/kg). Sin embargo, a concentraciones superiores a
150 mg/kg produce una parlisis temporal de los nervios olfativos de la nariz, de manera que no
se percibe su olor pudiendo dar lugar a un envenenamiento instantneo y la muerte.
De entre sus caractersticas fsicoqumicas cabe destacar que el sulfuro de hidrgeno es ms
denso que el aire y que su solubilidad en agua es del orden de 0,1 mol/L a 20C, mostrando un
comportamiento cido (cido sulfhdrico).
Calcula el pH de una disolucin saturada de
en agua (Nota: debido al pequeo valor de las
constantes de acidez se pueden realizar simplificaciones).
Datos. cido sulfhdrico

= 9,610 ;

= 1,310

En el caso del H2 S se pueden escribir los siguientes equilibrios:


H2 S (aq) + H2 O (l)

HS (aq) + H3 O (aq)

HS (aq) + H2 O (l)

(aq) + H3 O (aq)

Las respectivas constantes de acidez son:


K =
K =

HS [H3 O ]

[H2 S ]
S

[H3 O ]

[HS ]

La tabla de concentraciones para el primer equilibrio es:



cinicial
ctransformado
cformado
cequilibrio

H2 S
0,1
x

0,1 x

HS

x
x

H3 O

x
x

Consideraciones para realizar simplificaciones:


Como K >> K se puede considerar que prcticamente, todos los H3 O se forman en la 1
ionizacin, por tanto:
[H3 O ] [HS ]
Como H2 S es un cido dbil:
[H2 S]0 >> [H3 O ]
Sustituyendo estas aproximaciones en la expresin de la constante K se tiene que:
9,610 8 =

x2

0,1 x

pH = log 9,910

= 4,00

x = H O = 9,910 5 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

148

2. Las sales del cido sulfhdrico (sulfuros) se utilizan en numerosas aplicaciones, tanto
industriales (pinturas, semiconductores,) como clnicas (tratamientos dermatolgicos). Uno de
los usos conocidos del sulfuro de sodio es la eliminacin del pelo de las pieles de vacuno en los
procesos tradicionales de curtido. Las concentraciones de sulfuro requeridas para esta operacin
varan entre 2 y 3% del peso de la piel. El coste medioambiental de estos procesos comporta unos
vertidos de aguas residuales con un alto contenido en slidos suspendidos, en materia orgnica y
concentraciones elevadas de sulfuro. La normativa de vertido de aguas, que regula en cada
cuenca los niveles mximos que pueden contener las aguas de vertido, establece valores mximos
de concentracin para el sulfuro en aguas de 10 mg/L.
Un mtodo clsico para la determinacin de la concentracin de sulfuro en aguas se basa en la
oxidacin del sulfuro a azufre elemental, mediante la adicin de un exceso de iodo en medio
cido (tamponado a pH 5,5 con HAc/NaAc) y posterior valoracin del exceso de iodo con
tiosulfato sdico (
que se oxida a tetrationato,
) utilizando almidn como
indicador.
a) Escribe y ajusta todas las reacciones que tienen lugar en el mtodo de determinacin
indicado.
El ajuste de la ecuacin correspondiente a la primera reaccin es:
H2 S + I2

S + I
2 I

reduccin: I2 + 2 e

oxidacin: S
S

+ I2

S + 2 e

S + 2 I

Aadiendo los iones que faltan (2 H ):


H2 S (aq) + I2 (s)

S (s) + 2 HI (aq)

El ajuste de la ecuacin correspondiente a la segunda reaccin es:


Na2 S2 O3 + I2

S4 O + I

reduccin: I2 + 2 e

2 I

oxidacin: 2 S2 O
2 S2 O + I2

S4 O + 2 e

S4 O + 2 I

Aadiendo los iones que faltan (4 Na ):


2 Na2 S2 O3 (aq) + I2 (s)

Na2 S4 O6 (aq) + 2 NaI (aq)

b) Calcula la concentracin de
en un agua residual procedente de una curtidura que se ha
analizado segn el siguiente procedimiento: a 200 mL de muestra de agua acidificada a pH 5,5
se le aaden 20 mL de disolucin de 0,015 M, se agita un momento y se aaden 5 gotas de
disolucin de almidn al 0,5%; la disolucin se valora con tiosulfato sdico 0,02 M hasta
desaparicin del color azul, consumindose 17,8 mL.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

149

La cantidad de I2 aadido al agua residual es:


20 mL I2 0,015 M

0,015 mmol I2
= 0,3 mmol I2
1 mL I2 0,015 M

que reacciona con H2 S y con Na2 S2 O3 .


I2 que se consume con Na2 S2 O3 :
17,8 mL Na2 S2 O3 0,02 M

0,02 mmol Na2 S2 O3


1 mmol I2

= 0,178 mmol I2
1 mL Na2 S2 O3 0,02 M 2 mmol Na2 S2 O3

I2 que se consume con H2 S:


0,3 mmol I2 (total) 0,178 mmol I2 (consumido) = 0,122 mmol I2
0,122 mmol I2

1 mol H2 S
= 0,122 mmol H2 S
1 mol I2

La concentracin molar de H2 S en el agua residual es:


0,122 mmol H2 S
= 6,110
200 mL disolucio n

c) Indica si el agua residual analizada cumple con la normativa de vertidos en cuanto al


contenido de sulfuros.
La concentracin de sulfuro en el agua expresada en mg/L es:
32 mg S
6,110 4 mmol H2 S 1 mmol S


1 mL disolucio n 1 mmol H2 S 1 mmol S

= 19,52

mg

L

Como el valor es superior a 10 mg/L el agua residual no cumple la normativa respecto al


contenido de sulfuros.
3. La marcha analtica del sulfhdrico, que se ha utilizado durante ms de un siglo para realizar
la determinacin cualitativa de cationes, se basa en las propiedades precipitantes del ion sulfuro,
que dependen del pH del medio. A modo de ejemplo, se puede indicar que los iones
y

se encuentran en el grupo III de dicha marcha donde precipitan ambos como sulfuros, para
posteriormente redisolver uno de ellos en medio cido.
Es posible la separacin directa de Co (II) y Mn (II), ambos con concentracin 0,01 M, por
precipitacin de sus correspondientes sulfuros en una disolucin acuosa saturada de

ajustando el pH con una disolucin amortiguadora cido actico 1 M / acetato de sodio 1 M
(pH=4,74)?
(Datos. Sulfuro de cobalto (II)

= 4,610

; sulfuro de manganeso (II)

De las respectivas constantes de acidez del H2 S se puede despejar [HS ]:


K =
K =

HS [H3 O ]
se obtiene HS = K
[H2 S]
S

[H3 O ]
S
se obtiene HS =
[HS ]

[H2 S]
[H3 O ]

[H3 O ]

K

= 9,710

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

150

Igualando ambos valores se obtiene:


=

K K [H2 S]
[H3 O ]2

Para una disolucin tamponada a pH = 4,74 la concentracin de iones H3 O es:


[H3 O ] = 10

pH

= 10

4,74

en la disolucin tamponada es:

La concentracin de iones S
=

= 1,810 5 M

1,3 10 14 0,1
= 3,8 10
1,8 10 5 2

9,6 10

13

Los equilibrios de solubilidad correspondientes a CoS y MnS son, respectivamente:


CoS (s)

(aq) + Co (aq)

MnS (s)

(aq) + Mn

(aq)

y los respectivos productos de solubilidad son, respectivamente:


K

= [S

] [Co ]

= [S

] [Mn ]

Para que se forme precipitado de estas sustancias es preciso que el producto inico sea mayor
que el producto de solubilidad, K .
En el caso del CoS:
[S

] [Co ] = 3,810

13

0,01 = 3,810

15

Como el producto inico es mayor que el producto de solubilidad del CoS 4,610
forma precipitado de CoS.

21

, s se

En el caso del MnS:


[S

] [Mn ] = 3,810

13

0,01 = 3,810

15

Como el producto inico es menor que el producto de solubilidad del MnS 9,710
forma precipitado de MnS.

14

, no se

S es posible separar los iones Co y Mn con una disolucin saturada de H2 S tamponada a


un pH de 4,74.
(O.Q.N. Castelln 2008)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

151

51. El biodisel es un biocombustible sinttico lquido que se obtiene a partir de aceites vegetales
o grasas animales naturales, y que se aplica en la preparacin de sustitutos totales o parciales
del gasleo obtenido del petrleo. El biodisel est formado por los steres metlicos que se
obtienen en la reaccin de transesterificacin de las grasas con metanol, como se indica en la
siguiente reaccin, que se lleva a cabo en presencia de cantidades catalticas de hidrxido
potsico.


1. Ajusta la reaccin anterior y calcula la masa de biodisel que se obtendr a partir de 1250 kg
de grasa.
La ecuacin qumica ajustada correspondiente a la formacin de biodisel es:


Relacionando la grasa (GR) con el biodisel (BD):
103 g GR 1 mol GR 3 mol BD 270 g BDl 1 kg BD




= 1256,2 kg BD
1250 kg GR
1 kg GR 806 g GR 1 mol GR 1 mol BD 103 g BD
2. Cuando se emplea KOH como catalizador se obtiene un subproducto de naturaleza jabonosa.
Cul es la estructura qumica de este compuesto? Cmo se forma?

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

152

3. La preparacin del biodisel se puede llevar a cabo por reaccin con metanol en presencia de
cantidades catalticas de metxido sdico (NaOCH3). El metxido de sodio se puede generar por
adicin de sodio metlico en metanol, en un proceso qumico en el que se produce la oxidacin
del sodio y se forma hidrgeno molecular. Escribe la reaccin ajustada de este proceso y calcula
la cantidad de hidrgeno gas que se formar en condiciones normales cuando 50 g de sodio se
hacen reaccionar con 300 mL de metanol.
Dato. Densidad metanol= 0,79 g/mL.
La ecuacin qumica correspondiente a la reaccin entre CH3 OH y Na es:
reduccin: 2 H + 2 CH3 O + 2 e
oxidacin: 2 (Na

2 CH3 O + H2

Na + e )

2 CH3 OH (l) + 2 Na (s)


2 NaCH3 O (l) + H2 (g)

Como existen cantidades de ambos reactivos, CH3 OH y Na, previamente es necesario


determinar cul de ellos es el reactivo limitante.
300 mL CH3 OH 0,79 g CH3 OH 1 mol CH3 OH 23 g Na



= 3,4
50 g Na
1 mL CH3 OH 32 g CH3 OH 1 mol Na
Como la relacin molar es > 1 quiere decir que queda CH3 OH sin reaccionar y que el reactivo
limitante es Na que determina la cantidad de H2 desprendido.
Relacionando Na con H2 se obtiene el volumen de gas medido en condiciones normales:
50 g Na

1 mol Na 1 mol H2 22,4 L H2




= 24,3 L H2
23 g Na 2 mol Na 1 mol H2
(O.Q.N. Castelln 2008)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

153

52. El uso de hidrgeno como combustible para los coches esta fuertemente promovido por los
gobiernos de diferentes pases y por la Unin Europea. Este tipo de combustible evita la
generacin de dixido de carbono por parte de los coches y por ello es motivo de estudio en
muchos grupos de investigacin. Para poder usar el hidrgeno como combustible hacen falta
unos dispositivos capaces de convertir la energa qumica que almacena el hidrgeno en energa
til, este dispositivo es la pila de combustible.
Una pila de combustible es un dispositivo electroqumico que produce energa de forma
continua, es decir, los reactivos se regeneran de forma continua.
El esquema tpico de una pila de combustible es el siguiente. El dispositivo tiene una entrada de
hidrgeno y otra de aire y sus respectivas salidas (donde salen los productos de la reaccin
qumica que se produce y el reactivo que queda sin reaccionar). El nodo y el ctodo estn
conectados por una membrana polimrica conductora similar a un electrlito. El rango de
temperaturas de trabajo es elevado, pero en la pila modelo que proponemos en este problema la
temperatura es constante e igual a 200C.


1. Indique cual es el nodo y cual es el ctodo de la pila de combustible. Indique la especie
qumica que pasa a travs de la membrana. Indique el sentido en el que fluyen los electrones.
Seale cual es el producto que se forma en la salida de la corriente del aire. Nota, contestar
segn la numeracin de la figura. (10 puntos)
2. Ajuste la semireaccin qumica que tiene lugar en el nodo y la semireaccin qumica que
tiene lugar en el ctodo. Indique en cada caso de que tipo de reaccin se trata. Escriba la
reaccin global ajustada y calcule el potencial redox de dicha reaccin. Nota, indicar el estado de
cada una de las especies qumicas que intervienen en la reaccin. (20 puntos)
Datos. Los potenciales estndar de reduccin de los diferentes pares redox son: E ( /
) =
1,23 V, E ( / ) = 0,00 V (suponer que no varan con la temperatura).
El nodo (1) es siempre el electrodo en el que tiene lugar la oxidacin:
2 [H2 (g)

2 H (aq) + 2

y el ctodo (2) es siempre el electrodo en el que tiene lugar la reduccin.


O2 (g) + 4

(aq)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

154

La reaccin global que tiene lugar en la pila es:


2 H2 (g) + O2 (g)

2 H2 O (g)

Junto con el aire queda sin reaccionar sale el producto de la reaccin (4) H2 O (g).
Los electrones fluyen por el circuito exterior en el sentido de potenciales crecientes, desde el
nodo hacia el ctodo.
Por el interior de la pila, a travs de la membrana polimrica que a hace las veces de
electrlito fluyen los iones H (3) de forma que se cierre el circuito.
El potencial de la pila se calcula mediante la expresin:
Eopila = Eoca todo Eoa nodo
Eopila = EoO2 /H2 O EoH

/H2 =

1,23 V 0,00 V = 1,23 V

El rendimiento de las pilas de combustible (), a diferencia de los motores de combustin, no est
limitado por el ciclo de Carnot y su rendimiento es elevado. Dicho rendimiento est limitado
por el cociente entre G y H.
3. Calcule el rendimiento terico de la pila de combustible a 200C. Expresar dicho resultado en
tanto por ciento. (25 puntos)
Datos. La entalpa estndar de formacin estndar del agua lquida a 25C es 284,67 kJ

Calor latente de vaporizacin del agua = 540,67Kcal/kg (40,68 kJ
); 1 cal = 4,18 J.
= 6,02210

Carga del electrn = 1,60210 C
La variacin de energa libre de Gibbs, G, se calcula mediante la expresin:
G = nFE
donde n es el nmero de electrones intercambiados en la reaccin, E es el potencial o fuerza
electromotriz de la pila y F es la constante de Faraday (la carga de un mol de electrones).
F = 1,60210

19

C 6,0221023 mol

= 96472 Cmol 1

Si se intercambia 4 moles de electrones para obtener 2 moles de agua, para un mol ser la
mitad:
G = 2

1 kJ
96472 C
1,23 V 3 = 237,32 kJmol 1
mol
10 J

De acuerdo con la ley de Hess se puede calcular la variacin de entalpa de la reaccin, H:


H2 (g) + O2 (g)
H2 O (l)

H2 O (g)

H2 O (l)

H = 284,67 kJmol 1
H = +40,68 kJmol 1

Sumando ambas ecuaciones termoqumicas se obtiene:


H2 (g) + O2 (g)

H2 O (g)

H = 243,99 kJmol 1

Segn el enunciado del problema, el rendimiento () se calcula mediante la expresin:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

G 237,32 kJmol
=
=
H 243,99 kJmol

155

1
1 100 = 97,27%

4. Si el rendimiento real de la pila es del 50%, calcule la energa terica que producirn la
reaccin completa de 200 L de (g) y 400 L de aire sabiendo que el trabajo mximo que se
puede obtener en una reaccin qumica es igual a G multiplicado por el rendimiento en tanto
por uno. Los volmenes de los gases estn medidos en condiciones normales. (20 puntos)
Datos. Composicin aproximada del aire: 1% Ar, 21% , 78% .
R = 0,082 atm L

.
Al existir cantidades de ambos reactivos es necesario determinar previamente cul de ellos es
el reactivo limitante. El nmero de moles de cada reactivo es:
200 L H2
400 L aire

1 mol H2
= 8,93 mol H2
22,4 g H2

21 L O2 1 mol O2

= 3,75 mol O2
100 L aire 22,4 L O2

8,93 mol H2
= 2,4
3,75 mol O2

Como la relacin molar es > 2 quiere decir que sobra H2 , por lo que O2 es el reactivo
limitante que determina la cantidad de H2 O (g) formada:
3,75 mol O2

1 mol H2 O
= 7,50 mol H2 O
0,5 mol O2

El trabajo mximo obtenido en una reaccin qumica es G. Suponiendo un rendimiento del


50%:
7,50 mol H2 O

237,32 kJ 50 kJ (reales)

= 889,95 kJ
1 mol H2 O 100 kJ (teo ricos)

El signo menos indica que la pila produce energa.


En dicha pila se hicieron medidas cinticas a diferentes temperaturas para obtener la constante
de velocidad k del proceso global que tiene lugar en la pila electroqumica mediante el
seguimiento de la concentracin del compuesto que se forma en la corriente de aire. Dichos
datos se resumen en la siguiente tabla:
T (C)
k (mmol
)
150
3,1810
350
1,1510
550
2,5210
750
6,7610
5. Calcule la energa de activacin y el factor de frecuencia para el proceso que tiene lugar en la
pila electroqumica. Utilice representaciones grficas para calcular dichos parmetros.
(25 puntos)
Dato. R = 8,314 J

.
A partir de las constantes a diferentes temperaturas, usando la ecuacin de Arrhenius:
k = k exp E /RT

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

156

tomando logaritmos neperianos:


ln k = ln k

E

RT

Al representar ln k frente a 1/T se obtiene una recta cuya pendiente es E /R y ordenada en


el origen ln k .
Cambiando las unidades de los datos iniciales:
3,1810

103 L
= 3,1810
Lh 103 mmol 1 m3

10 mmol

1 mol

T (K)
423,15
623,15
823,15
1023,15

k (mol

)
10
3,1810
1,1510 5
2,5210 3
6,7610 2

10

mol

m3 h

1/T (
2,3610
1,6010
1,2110
9,7710

)

3

3

4

3

ln k
21,87
11,37
5,98
2,69

La grfica que se obtiene es:


La pendiente de la recta es 13835 de la que se obtiene el valor de E (energa de activacin):
pte =

E

R

E = 13835 K

8,314 J 1 kJ
kJ
3 = 115

molK 10 J
mol

La ordenada en el origen es 10,82 de la cual se obtiene el valor de k (factor de frecuencia):


ordenada = ln k

k = exp 10,82 = 5,03104

mol

m3 h
(O.Q.N. vila 2009)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

157

53. El complejo conocido como cisplatino es un potente anticancergeno, y es el componente


principal de la quimioterapia empleada en el tratamiento de varios tipos de cncer, incluyendo
algunos sarcomas y carcinomas muy agresivos. Acta insertndose en medio del DNA celular e
induciendo la apoptosis de las clulas cancergenas. El nombre cientfico del cisplatino es cis
diamminodicloroplatino (II), y es un complejo plano cuadrado, como se muestra en la figura.


El cisplatino se puede obtener fcilmente a partir de platino metlico siguiendo el siguiente
esquema de sntesis:
Primera etapa: Oxidacin de platino metlico con agua regia (una mezcla 4:1 de cidos
clorhdrico y ntrico concentrados) para dar el anin hexacloroplatinato (IV) segn la reaccin
1 (sin ajustar), que puede ser precipitado como hexacloroplatinato (IV) de potasio por adicin
de KCl.
El

Pt +
+ HCl
H [PtCl ] +
+


resultante sufre una reaccin de dimerizacin para dar

(reaccin 1)
. Para el equilibrio:


2






(reaccin 2)
1
1
se han medido los valores de H = 57,20 kJmol y S = 175,7 JK mol1.
Segunda etapa: Reduccin del hexacloroplatinato(IV) de potasio a tetracloroplatinato(II) de
potasio con hidracina,
. En las condiciones de reaccin la hidracina se encuentra
protonada formando el catin hidrazonio,
, que es quien acta como reductor (reaccin 3)
segn las semireacciones:
[PtCl ]
+ 5

+ 2 e

[PtCl ] + 2

+ 4 e

2 K [PtCl ] +

2 K [PtCl ] +

E = +0,726 V
E = 0,23 V
+ 4 HCl

(reaccin 3)

Tercera etapa: Sustitucin parcial de los cloruros del tetracloroplatinato (II) de potasio por
amoniaco, para dar cis[
] en forma de prismas amarillos (reaccin 4). El ismero
trans es inactivo en la curacin del cncer. La reaccin de isomerizacin (reaccin 5) sigue una
cintica de primer orden.
K [PtCl ] + 2

(aq)

cis[

cis[
]
trans[
Contestar las siguientes preguntas:
1. Ajuste la reaccin 1. (20 puntos)

] + 2 KCl
]

La ecuacin inica es:


Pt + H NO + H Cl

2 H PtCl + NO2 + H2 O

Las semirreacciones son:


reduccin: 4 NO + 2 H + e

NO2 + H2 O

(reaccin 4)
(reaccin 5)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

oxidacin: Pt + 6 Cl

158

PtCl + 4 e

La reaccin inica ajustada es:


Pt + 6 Cl +4 NO + 8 H

PtCl + 4 NO2 + 4 H2 O

Aadiendo los iones que faltan en ambos miembros (2 H ) se obtiene la ecuacin molecular
final:
Pt + 6 HCl +4 HNO3

H2 [PtCl6 ] + 4 NO2 + 4 H2 O

2. Suponiendo que se toman 10,0 g de platino y se disuelven en un exceso de agua regia. Qu


volumen, medido a presin atmosfrica y 25C, se debera producir de
si no se produjera la
dimerizacin expresada en la reaccin 2? (20 puntos)
Dato. R = 0,082 atm L

.
Relacionando Pt y NO2 :
10 g Pt

1 mol Pt 4 mol NO2



= 0,205 mol NO2
195,1 g Pt 1 mol Pt

Considerando comportamiento ideal, el volumen ocupado por el gas es:


V =

0,205 mol 0,082 atmLmol 1 K


1 atm

25+273 K

= 5,0 L NO2

3. Qu volumen de gas se desprende si se tiene en cuenta la reaccin 2? (20 puntos)


Dato. R = 8,314 J

.
Es necesario previamente calcular el valor de la constante de equilibrio de la reaccin a 25C y
1 at.
La variacin de energa libre de Gibbs, G, se calcula mediante la expresin:
G = H TS
Sustituyendo:
G = 57,20

175,7 J 1 kJ
kJ
298 K

= 4,84 kJmol
molK 103 J
mol

La relacin entre la variacin de energa libre de Gibbs, G, y la constante de equilibrio, K ,


viene dada por la expresin:
G = RT ln K
Sustituyendo se obtiene el valor de K :
K = exp

4,84
G
= exp
= 0,142
RT
8,31410 3 298

El equilibrio de dimerizacin es:


N2 O4 (g)

2 NO2 (g)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

159

Partiendo del nmero de moles de NO obtenidos en el apartado anterior, la tabla de moles


correspondiente al equilibrio es:

N O
NO
ninicial

0,205
ntransformado

2x
nformado
x

x
nequilibrio
0,205 2x
n = x + 0,205 2x = 0,205 x
La expresin de la constante de equilibrio K es:
K

p
p

Las presiones parciales en el equilibrio son:


p
p

= 1 atm
= 1 atm

x
x
=
atm
0,205 x 0,205 x

0,205 2x 0,205 2x
=
atm
0,205 x
0,205 x

Sustituyendo en la expresin de K :
0,205 2x
0,205 x
0,142 =
x
0,205 x

x = 0,0786 mol

El nmero de moles de gas en el equilibrio es:


n = 0,205 0,0786 mol = 0,1264 mol
Considerando comportamiento ideal, el volumen ocupado por los gases en el equilibrio es:
V =

0,1264 mol 0,082 atmLmol 1 K


1 atm

25+273 K

= 3,09 L gas

4. Calcule el potencial normal de la reaccin 3. (20 puntos)


La reaccin 3 se obtiene a partir de las semirreacciones:
reduccin: 2 PtCl + 2 e
oxidacin: N H

PtCl + 2 Cl

N2 + 5 H + 4 e

E = +0,726 V
E = +0,23 V

Sumando ambas semirreacciones y aadiendo los iones que faltan (4 K ) se obtiene:


2 K 2 [PtCl6 ] + N2 H4

2 K 2 [PtCl4 ] + N2 + 4 HCl

E = +0,956 V

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

5. Supuesta para la reaccin 5 una constante de velocidad de 10


del ismero cis en disolucin? (20 puntos)

160

. Cul ser la vida media

En una reaccin de primer orden la relacin entre la constante de velocidad y la vida media
viene dada por la expresin:
ln 2 = kt

t =

ln 2

k

Sustituyendo:
t =

ln 2
10 8 s

= 6,93107 s
(O.Q.N. vila 2009)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

161

54. En la elaboracin del vinagre se produce cido actico como producto de la fermentacin
actica del vino por la accin de acetobacterias que combinan el alcohol del vino y el oxgeno del
ambiente para producir cido actico y agua. La norma que establece la calidad del vinagre
establece un mnimo de acidez expresado en cido actico: 6 g/100 mL en el vinagre de vino.
1. Si se analiza una muestra de vinagre y se obtiene un pH de 3, estar nuestro vinagre dentro
de la norma? (30 puntos)
Datos. Frmula del cido actico:

Constante de disociacin del cido actico, = 1,7810 .
Masa molar del cido actico 60 g/mol.
Si la disolucin tiene pH = 3, la concentracin de H3 O es:
[H3 O ] = 10

pH

= 10 3 M

El cido actico es un cido dbil que se encuentra parcialmente disociado de acuerdo con la
ecuacin:
CH3 COOH (aq) + H2 O (l)

CH3 COO (aq) + H3 O (aq)

Suponiendo una concentracin inicial c M la tabla de concentraciones en el equilibrio es:



cinicial
ctransformado
cformado
cequilibrio

CH3 COOH
c
x

c x

CH3 COO

x
x

H3 O

x
x

Sustituyendo en la expresin de la constante K :


K =

CH3 COO [H3 O ]


x2
=

[CH3 COOH]
c x

1,7810 5 =

10

c 10

c = 0,0572 M

La concentracin de la disolucin expresada en g/100 mL es:


g CH3 COOH
0,0572 mol CH3 COOH 60 g CH3 COOH 0,1 L vinagre


=0,34

1 L vinagre
1 mol CH3 COOH 100 mL vinagre
100 mL vinagre
El vinagre analizado contiene menos de 6 g/100 mL por lo que no cumple la norma.
2. Cmo preparara 100 mL de disolucin de cido actico a partir del cido actico comercial
para obtener la misma concentracin de cido actico? (30 puntos)
Datos. Pureza del cido actico comercial (glacial): 100%
Densidad del cido actico: 1,049 g/
.
Teniendo en cuenta que 100 mL de la disolucin anterior contienen 0,34 g de CH3 COOH, el
volumen de disolucin comercial de riqueza 100% necesaria para preparar 100 mL de
disolucin con la concentracin del apartado anterior es:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

0,34 g CH3 COOH glacial

162

1 mL CH3 COOH glacial


= 0,32 mL CH3 COOH glacial
1,049 g CH3 COOH glacial

El procedimiento experimental para preparar la disolucin es:


Pesar 0,34 g o medir 0,32 mL de CH3 COOH glacial e introducirlos en un matraz
aforado de 100 mL
Aadir H2 O destilada hasta casi el aforo del matraz y agitar la mezcla
Con ayuda de un cuentagotas enrasar a 100 mL.
3. Se toma una disolucin de NaOH 0,01 M para valorar la disolucin que de actico preparado
anteriormente. Si se parte de 10 mL de cido actico, qu volumen de NaOH se necesitara para
neutralizar el cido? (40 puntos)
La ecuacin qumica correspondiente a la reaccin de neutralizacin del CH3 COOH con NaOH
es:
CH3 COOH (aq) + NaOH (aq)

NaCH3 COO (aq) + H2O (aq)

Relacionando CH3 COOH con NaOH:


10 mL CH3 COOH 0,0572 M
0,572 mmol CH3 COOH

0,0572 mmol CH3 COOH


= 0,572 mmol CH3 COOH
1 mL CH3COOH 0,0572 M

1 mmol NaOH 1 mL NaOH 0,01 M



= 57,2 mL NaOH 0,01 M
1 mmol CH3 COOH 0,01 mmol NaOH
(O.Q.N. vila 2009)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

163

55. El sulfato de hierro (II) heptahidratado, tambin llamado vitriolo verde, es la materia prima
para la obtencin, en el laboratorio, de sales dobles como la denominada alumbre de hierro,
Fe
12
.
1. La reaccin de cido sulfrico diluido con hierro elemental conduce a la formacin de una
disolucin de sulfato de hierro (II) de color verde.
a) Escriba la reaccin de obtencin del sulfato de hierro (II) y determine el valor de G para
dicha reaccin. (10 puntos)
Datos. E (
/
)= 0,77 V; E (
/Fe)= 0,44 V; E (
/
)= 0,80 V; E ( /
)=
1,23 V. Constante F=96485 C
.
La ecuacin qumica correspondiente a la formacin del sulfato de hierro (II) es:
H2 SO4 (aq) + Fe (s)

FeSO4 (aq) + H2 (g)

Las semirreacciones correspondientes son:


reduccin: 2 H (aq) + 2 e
oxidacin: Fe (aq)

H2 (g)

E = 0,00 V

Fe (aq) + 2 e

E = 0,44 V

Aadiendo los iones que faltan (SO ) la ecuacin global ajustada es:
H2 SO4 (aq) + Fe (s)

FeSO4 (aq) + H2 (g)

E = 0,44 V

La variacin de energa libre de Gibbs, G, se calcula mediante la expresin:


G = nFE
donde n es el nmero de electrones intercambiados en la reaccin, E es el potencial o fuerza
electromotriz de la pila y F es la constante de Faraday (la carga de un mol de electrones).
G = 2

1 kJ
96485 C
0,44 V 3 = 84,91 kJmol
mol
10 J

La espontaneidad del proceso queda confirmada por los valores de E > 0 y de G < 0.
b) Identifique el gas que se desprende durante la reaccin y calcule el volumen que ocupara
dicho gas, recogido a la temperatura de 25C y 700 mmHg, cuando reaccionan 10 g de hierro del
93% de pureza con la cantidad estequiomtrica de cido sulfrico diluido. (10 puntos)
Dato. Constante R= 0,082 atmL

.
El gas desprendido en la reaccin es el hidrgeno, H2 (g), ya que si se produce la oxidacin
del Fe, la nica especie susceptible de reduccin es el H liberado por el cido.
Relacionando Fe con H2 :
10 g Fe 93%

93 g Fe
1 mol Fe 1 mol H2


= 0,167 mol H2
100 g Fe 93% 55,85 g Fe 1 mol Fe

Considerando comportamiento ideal, el volumen ocupado por el gas es:


V =

0,167 mol 0,082 atmLmol 1 K


700 mmHg

25+273 K 760 mmHg



= 4,42 L H2
1 atm

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

164

c) Determine la cantidad de cido sulfrico del 95% y densidad 1,84 g/


que hay que tomar y
como se debe proceder, para preparar la cantidad de cido sulfrico del 20% y densidad 1,15
g/
necesaria para reaccionar estequiomtricamente con el hierro del apartado b.
(10 puntos)
Relacionando Fe y H2 SO4 :
10 g Fe 93%

1 mol Fe 1 mol H2 SO4 98 g H2 SO4


93 g Fe



= 16,3 g H2 SO4
100 g Fe 93% 55,85 g Fe 1 mol Fe 1 mol H2 SO4

Si el H2 SO4 que reacciona estequiomtricamente con el Fe es una disolucin del 20% y


densidad 1,15 gcm , la cantidad de esta disolucin que se necesita es:
16,3 g H2 SO4

100 g H2 SO4 20% 1 cm H2 SO4 20%



= 71
20 g H2 SO4
1,15 g H2 SO4 20%

H2 SO4 20%

Si esta disolucin se prepara a partir de H2 SO4 comercial de riqueza 95% y densidad 1,84
gcm , la cantidad de esta disolucin que se necesita es:
16,3 g H2 SO4

100 g H2 SO4 95%


= 17,2 g H2 SO4 95%
95 g H2 SO4

El volumen correspondiente es:


17,2 g H2 SO4 95%

1 cm H2 SO4 95%
= 9,3
1,84 g H2 SO4 95%

H2 SO4 95%

El procedimiento experimental para preparar la disolucin es:


Tarar un vaso de precipitados de 100 mL y aadir unos 50 g de H2O destilada
A continuacin, y lentamente, aadir los 17,2 g de H2 SO4 del 95% (9,3 cm ) y remover
con ayuda de una varilla de vidrio. Realizar esta operacin con precaucin, aadiendo
siempre el cido sulfrico sobre el agua, ya que se forma un hidrato de cido
sulfrico y por tanto, se desprende una gran cantidad de calor que eleva
considerablemente la temperatura de la disolucin
Aadir la cantidad de H O destilada que falta hasta completar los 81,6 g de disolucin
de riqueza 20%.
d) Con el paso del tiempo, sino se toman las medidas adecuadas, la disolucin de color verde, en
contacto con el aire, se vuelve amarilla como consecuencia de la oxidacin de Fe (II) a Fe (III).
Justifique la viabilidad de este proceso. (10 puntos)
Datos. E (
/
)= 0,77 V; E (
/Fe)= 0,44 V; E (
/
)= 0,80 V; E ( /
)=
1,23 V. Constante F = 96485 C
.
Las semirreacciones que tienen lugar son la oxidacin del Fe (verde) a Fe (amarillo) por
accin del O del aire que se reduce a H O:
reduccin: O (g) + 4 H (aq) + 4 e
oxidacin: 4 [Fe (aq)
La ecuacin global ajustada es:

2 H O (l)

Fe (aq) + e ]

E = 1,23 V

E = 0,77 V

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

O (g) + 4 H (aq) + 4 Fe (aq)

165

2 H O (l) + 4 Fe (aq) E = 0,46 V

La variacin de energa libre de Gibbs, G, del proceso es:


G = 4

1 kJ
96485 C
0,46 V 3 = 177,53 kJmol
mol
10 J

La espontaneidad del proceso queda confirmada por los valores de E > 0 y de G < 0.
e) Si a la disolucin amarilla se le aade un clavo de hierro, an en presencia de aire, la
disolucin se vuelve otra vez verde. Justifique la viabilidad de este proceso de reduccin.
(10 puntos)
Datos. E (
/
)= 0,77 V; E (
/Fe)= 0,44 V; E (
/
)= 0,80 V; E ( /
)=
1,23 V. Constante F = 96485 C
.
Las semirreacciones que tienen lugar ahora son la reduccin del Fe (amarillo) a Fe
(verde) por accin del Fe que se oxida a Fe (verde)
reduccin: 2 [Fe (aq) + e
oxidacin: Fe (aq)

Fe (aq)

Fe (aq) + 2 e

E = 0,77 V

E = 0,44 V

E = 1,21 V

La ecuacin global ajustada es:


Fe (s) + 2 Fe (aq)

3 Fe (aq)

La variacin de energa libre de Gibbs, G, del proceso es:


G = 2

1 kJ
96485 C
1,21 V 3 = 233,49 kJmol
mol
10 J

La espontaneidad del proceso queda confirmada por los valores de E > 0 y de G < 0.
f) La eliminacin lenta del disolvente conduce a la cristalizacin de la sal sulfato de hierro (II)
heptahidratado. Calcule la masa terica de sal hidratada que se podra obtener a partir de la
cantidad de hierro del apartado b. (20 puntos)
Relacionando Fe y FeSO4 7 H O:
10 g Fe 93%

1 mol Fe 1 mol FeSO4


93 g Fe


= 0,167 mol FeSO4
100 g Fe 93% 55,85 g Fe 1 mol Fe

Como se trata de una sustancia hidratada:


0,167 mol FeSO4

1 mol FeSO4 7 H O 277,92 g FeSO4 7 H O



= 46,28 g FeSO4 7
1 mol FeSO4
1 mol FeSO4 7 H O

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

166

2. En la obtencin de alumbre de hierro, para la oxidacin del Fe (II) a Fe (III), en medio cido
sulfrico, se utiliza cido ntrico concentrado. A la disolucin de sulfato de hierro (III) resultante,
una vez eliminado el exceso de los reactivos que no hayan reaccionado, por calentamiento a
sequedad y posterior disolucin del slido en 50 cm3 de agua, se le aade una segunda disolucin
de sulfato amnico obtenindose por cristalizacin el alumbre de hierro.
a) Justifique la viabilidad de este proceso suponiendo que el producto de reduccin del cido
ntrico es el dixido de nitrgeno. (10 puntos)
Datos. E (
/
)= 0,77 V; E (
/Fe)= 0,44 V; E (
/
)= 0,80 V; E ( /
)=
1,23 V. Constante F = 96485 C
.
Las semirreacciones que tienen lugar en este nuevo proceso son la oxidacin del Fe (verde)
a Fe (amarillo) por accin del HNO que se reduce a NO (g):
reduccin: NO (aq) + 2 H (aq) + e
oxidacin: Fe (aq)

Fe (aq) + e

NO (g) + H O

E = 0,80 V

E = 0,77 V

La ecuacin global ajustada es:


NO (aq) + 2 H + Fe (aq)

NO (g) + Fe (aq) + H O (l)

E = 0,03 V

La variacin de energa libre de Gibbs, G, del proceso es:


G=1

1 kJ
96485 C
0,03 V 3 =2,89 kJmol
mol
10 J

La espontaneidad del proceso queda confirmada por los valores de E > 0 y de G < 0.
b) Escriba la reaccin de obtencin del alumbre de hierro a partir del sulfato de hierro (III) y de
sulfato amnico. (10 puntos)
(aq) +

(aq) + 12

(l)

12

(s)

c) Si el rendimiento de la cristalizacin del producto final es del 75%, determine la masa de


alumbre de hierro que se obtendra. (10 puntos)
Partiendo de la cantidad de FeSO4 del apartado f), la cantidad de alumbre de hierro,
FeNH4 SO4 2 12 H2 O, que se obtiene es:
0,167 mol FeSO4

1 mol Fe 1 mol FeNH4 SO4 2 12 H2 O



= 0,167 mol FeNH4 SO4
1 mol FeSO4
1 mol Fe

0,167 mol FeNH4 SO4

12 H2 O

482 g FeNH4 SO4


1 mol FeNH4 SO4

2
2

12 H2 O
= 80,5 g FeNH4 SO4
12 H2 O

12 H2 O

12 H2 O

Teniendo en cuenta un rendimiento del 75%, la masa de alumbre obtenida es:


80,5 g FeNH4 SO4

12 H2 O

75 g reales
= 60,4 g FeNH4 SO4
100 g tericos

12 H2 O
(O.Q.N. vila 2009)

Cuestiones y Problem
mas de las Olim
mpiadas de Qumica. Volumen
n 6. (S. Menargu
ues & F. Latre)

167

56. LO
OS XIDOS D
DE NITRGE
ENO. IMPACT
TO AMBIENT
TAL
El oxxgeno y el nitrgeno
n
see combinan formando varios comp
puestos qum
micos gaseossos que
recibeen el nombrre genrico d
de "xidos dee nitrgeno"", a menudo abreviado ccon el trmin
no NOx.
Algun
nas de las rea
acciones en llas que se prroducen xid
dos de nitrgenos son las siguientes:
(g) +

(g)

2 N
NO (g)

NO (g) + (g)

(g)
Algun
nos de estos compuestoss, principalm
mente el mo
onxido de n
nitrgeno (N
NO), y sobre todo el
dixid
do de nitrg
geno (
), producen im
mportantes impactos a
ambientaless y en la sa
alud. La
accin humana eest incremeentando la emisin de este tipo dee gases, med
diante el esccape de
vehculos motorizzados, sobree todo de ttipo disel, lla combustin del carb
bn, petrleo
o o gas
naturral, el uso dee fertilizantees, el incremeento de resid
duos de origen humano yy animal, y d
durante
diverssos procesoss industrialees. Conocer eel comporta
amiento de los
l xidos dee nitrgeno es vital
para evaluar su ef
efecto ambien
ntal y en la ssalud.
Las m
molculas pa
aramagnticcas de
een fase gas sse asocian (d
(dimerizan) p
para dar mo
olculas
diama
agnticas dee
segn
n el equilibrio
o siguiente:
2
(g)

(g)
a) T
Teniendo en
n cuenta que la molcula de
tien
ne un elecctrn desap
pareado
(es p
paramagntiica) mientra
as que la molcula
m
no pressenta electrrones desapa
areados
(es diiamagntica
a), establezca
a las estructturas de Lew
wis usando eel concepto de resonanccia para
repreesentar los en
nlaces preseentes en la m
molcula
. Ilustre, mediante diag
gramas de o
orbitales
atmicos y moleculares, cmo
o dos molcu
ulas de
((g) se combinan para geenerar una m
molcula
de
(g).




(1 punto)
La molcula de N
NO tiene un nmero im
mpar de eleectrones, (5 + 26 = 17)), lo que exp
plica su
d
n. Las estru
ucturas de Lewis del NO y N O son,
color intenso y su fcil dimerizacin
respeectivamente (solo se dib
buja una de las formas reesonantes):


La reaaccin de diimerizacin se represen
nta como:


Tamb
bin, median
nte la teora de Orbitaales Molecullares se puede explicar la formaccin del
N O :

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

168

b) A 298 K, el valor de G de formacin para el


(g) es de + 98,28 kJ
, mientras que
para el
(g) es +51,84 kJ
. Partiendo de un mol de
(g) a 1,0 atm y 298 K, calcule
la fraccin de
(g) que se habr descompuesto si se mantiene constante la presin total a
1,0 atm y la temperatura a 298 K.






(3 puntos)
Dato. Constante R = 8,314 J

.
La variacin de energa de Gibbs asociada al proceso puede calcularse a partir de la expresin:
G = (i Goi )productos (i Goi )reactivos
Sustituyendo:
G = 2 mol NO

51,84 kJ
98,28 kJ
1 mol N O
= 5,4 kJmol 1
mol NO
mol N O

La expresin que relaciona K con G es:


K = exp

G

RT

Sustituyendo:
K = exp

5,4 kJ mol
3
8,314 10 kJ mol 1 K

1
1

25+273 K

= 0,113

La tabla de moles de la reaccin es:



N O
NO
ninicial
1

ntransformado
x
nformado
2x

nequilibrio
1 x
2x
ntotal =(1 x) + 2x = 1 + x
La expresin de la constante K es:
K =

p
p

De acuerdo con la ley de Dalton de las presiones parciales, stas son:


p

= p

2x
p
1 + x

= p

1 x

1 + x

sustituyendo
2x 2
K = 1 + x
1 x
1 + x

0,113 =

4x

1 x

x = 0,17

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

169

c) Si el valor de H para la reaccin:


(g)
2
(g) es 53,03 kJ

Para qu valor de la temperatura la fraccin descompuesta de
calculado en el apartado anterior (b)?



Dato. Constante R = 8,314 J

(g) sera doble del valor




(3 puntos)

Si el valor de x para la nueva temperatura es 0,34, el valor de K ahora es:


K =

4x

1 x

K =

4 0,34
= 0,523
1 0,34

La ecuacin de vant Hoff relaciona la dependencia de la constante K con la temperatura:


ln

K
K

H 1
1

R T1 T2

Sustituyendo:
ln

0,523
53,03
=
0,113 8,314 10

1
1


298 T2

T2 = 321 K

d) La disociacin de
(g) para dar
(g) es una reaccin de primer orden con una
constante especfica de velocidad de 5,310
a 298 K, mientras que la reaccin de asociacin
de
(g) para dar
(g) es de segundo orden con una constante de velocidad especfica de
9,810 L

a 298 K. Calcule el valor de la constante a 298 K para el equilibrio:
2
(g)

(g)
Cul es el valor de la constante para este mismo equilibrio a 298 K?
Dato. R = 0,082 atm L

(3 puntos)

Las ecuaciones de velocidad correspondientes a la disociacin del N O y a la asociacin del


NO son, respectivamente:
r = k [N O ] r = k [NO

Cuando se igualan ambas velocidades se alcanza el equilibrio:


k [N O ] = k [NO

se obtiene el valor de la constante K :


K =

k
[N O ]
=

[NO
k

K =

9,8 10
= 185
5,3 10

La relacin entre las constantes K y K viene dada por la expresin:


K = K RT

siendo
= coef. esteq. productos gas coef. esteq. reactivos gas = 1 2 = 1
Sustituyendo:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

K = 185 0,082 25+273

170

= 7,57
(O.Q.N. Sevilla 2010)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

171

57. LA QUMICA EN LA IDENTIFICACIN DE ESTUPEFACIENTES


Una de las reas de la Qumica Aplicada es la identificacin de estupefacientes. Con tecnologa y
personal especializado en los anlisis, pone sus servicios a disposicin de las autoridades
judiciales en el estudio tcnico y cientfico de los elementos materia de prueba. Las muestras son
recolectadas en el lugar de los hechos mediante inspeccin judicial y luego de realizada la
prueba preliminar, estas muestras junto con su registro de cadena de custodia son enviadas al
rea de qumica aplicada para su plena identificacin, la cual se realiza mediante la aplicacin
de pruebas fsicas (pH, color, apariencia, solubilidad), qumicas y anlisis instrumental.
a) En un registro de aduana fue intervenido un paquete conteniendo una sustancia cuyo anlisis
revel que contena una cierta cantidad de una sustancia pura que estaba formada por C, H, O y
N. Este hecho y la apariencia de la sustancia, hizo suponer a la polica cientfica que dicha
sustancia podra ser cocana (
). En la combustin completa de 5,00 g de dicho
compuesto orgnico se obtiene 6,294 L de
, 0,185 L de (ambos medidos en condiciones
normales) y 3,123 g de
. Sabiendo que la masa molecular de la cocana es 303,35 g

determine la frmula emprica y la frmula molecular de dicha sustancia y demuestre con ello
que efectivamente es cocana.






(4 puntos)
El C se determina en forma de CO :
6,294 L CO 1 mol CO
1 mol C 303,35 g droga
mol C



= 17

5,00 g droga 22,4 L CO 1 mol CO
1 mol droga
mol droga
El H se determina en forma de H O:
mol H
3,123 g H O 1 mol H O 2 mol H 303,35 g droga



= 21

mol droga
5,00 g droga 18 g H O 1 mol H O 1 mol droga
El N se determina en forma de N2 :
mol N
0,185 L N2 1 mol N2 2 mol N 303,35 g droga



= 1

5,00 g droga 22,4 L N2 1 mol N2 1 mol droga
mol droga
El O se determina por diferencia.
303,35 g droga

17 mol C

12 g C
1 g H
21 mol H
1 mol C
1 mol H
1 mol droga

1 mol N

14 g N
1 mol N = 64,35 g O
mol droga

mol O
64,35 g O 1 mol O

= 4

mol droga
mol droga 16 g O
La frmula molecular o verdadera de la droga es C17 H21 NO4 . Como esta frmula no se puede
simplificar, la frmula emprica o sencilla es la misma.
Como se observa, la frmula obtenida coincide con la de la cocana.
b) Se prepara una disolucin disolviendo 9,1 g de cocana en 50 mL de agua y se obtiene un pH
de 11,09. Teniendo en cuenta que el equilibrio de disociacin de la cocana puede representarse
esquemticamente segn la ecuacin:
Calcule el

+


de la cocana.

(3 puntos)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

172

La constante de equilibrio correspondiente es:


K =

[C H NO ] [OH ]

[C H NO ]

Haciendo los correspondientes balances en el equilibrio se tiene que:


[C H NO ] = [OH ]
[C H NO ] = c [OH ]
K =

[OH

c [OH ]

La concentracin de la disolucin es:


c =

9,1 g C H NO 1 mol C H NO 103 mL disolucio n




= 0,6 M
50 mL disolucio n 303 g C H NO
1 L disolucio n

Si el pH de la disolucin es 11,09:
[H O ] = 10

pH = 11,09

pH

= 8,1310

12

[OH ] = 1,2310 3 M

Sustituyendo valores:
K =

1,2310

3 2

0,6 1,2310

= 2,5310

pK = log K = log 2,5310

= 5,6

(Este apartado coincide con el propuesto en el a) del problema 1 de Navacerrada1996).


c) Para determinar el porcentaje de cocana contenido en el alijo de droga intervenida se
disolvieron en agua 10 g de la sustancia encontrada hasta completar 100 mL, y la disolucin as
obtenida se valor con cido clorhdrico 0,5 M, en presencia de un indicador, observndose que
el viraje del indicador se produca al aadir 8 mL de la disolucin de cido clorhdrico.
Determine el porcentaje en peso de cocana presente en la muestra analizada, teniendo en
cuenta que las impurezas presentes en el alijo no presentan propiedades cidobase.
(3 puntos)
El HCl reacciona con la cocana mol a mol:
8103 L HCl 0,5 M

0,5 mol HCl 1 mol C H NO 303 g C H NO




= 1,213 g C H NO
1 mol HCl
1 mol C H NO
1 L HCl 0,5 M

1,213 g C H NO
100 = 12,13% cocana
10 g alijo
(Este apartado coincide con el propuesto en el d) del problema 1 de Navacerrada1996).
(O.Q.N. Sevilla 2010)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

173

58. LAS APLICACIONES DE LAS REACCIONES ELECTROQUMICAS: DESDE LA OBTENCIN DE


ENERGA HASTA LA GENERACIN DE PRODUCTOS
Las reacciones de oxidacinreduccin son procesos de gran importancia por sus variadas
aplicaciones. As, mientras las pilas y las bateras transforman en energa elctrica la energa
qumica que se obtiene en un proceso redox, en las cubas electrolticas se emplea la corriente
elctrica para provocar un proceso redox no espontneo, como por ejemplo la electrlisis del
agua. Los procesos redox encuentran tambin aplicaciones en el anlisis cuantitativo de
minerales.
a) El dicromato de potasio (heptaoxodicromato(VI) de potasio), en presencia de cido
clorhdrico, oxida el
a
, reducindose a
. Ajuste, por el mtodo del inelectrn, la
ecuacin inica de este proceso.






(1 punto)
Las semirreacciones que tienen lugar son:
reduccin: Cr O + 14 H + 6 e
oxidacin: 6 Fe

2 Cr

+ 7 H O

Fe + e

La ecuacin inica final se obtiene sumando ambas semirreacciones:


+ 14

+ 6

+6

+ 7

b) ANLISIS DE MINERALES
Una muestra de un mineral de hierro que pesa 2,0000 g, se disuelve en cido clorhdrico y todo el
hierro se transforma en
(aq), ajustando el volumen de la disolucin resultante hasta unos
50 mL, que se colocan en un matraz Erlenmeyer para su valoracin con una disolucin acuosa de
dicromato de potasio 0,1 M. En el proceso de valoracin el punto final se alcanza cuando se han
consumido 35 mL del reactivo valorante. Calcule la riqueza de hierro (porcentaje en masa de
hierro) en el mineral analizado.






(2 puntos)
El nmero de mmoles de dicromato consumidos es:
35 mL Cr2 O27 0,1 M

0,1 mmol Cr2 O27


= 3,5 mmol Cr2 O27
1 mL Cr2 O27 0,1 M

Relacionando dicromato con Fe2+:


3,5 mmol Cr2 O27

55,8 mg Fe
6 mmol Fe
2 1 mmol Fe
1 mmol Cr2 O7

= 1172 mg Fe

El porcentaje de hierro que contiene la muestra es:


1 g Fe
1172 mg Fe
3
2,0000 g mineral 10 mg Fe

100 = 58,6% Fe

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

174

c) PILAS ELECTROQUMICAS
Se desea construir una pila electroqumica utilizando el proceso redox descrito en el apartado
(a). Teniendo en cuenta los potenciales estndar de reduccin de los semipares que intervienen
en el proceso:
1) Haga una representacin esquemtica de dicha pila, indicando razonadamente el nodo, el
ctodo y el sentido del movimiento de los electrones en la pila, teniendo en cuenta que se utilizan
electrodos inertes.








(1 punto)
Datos. Potenciales estndar de reduccin: (
/
) = + 1,33 V; (
/
) = + 0,77
V
El ctodo se sita a la derecha de la pila y es el electrodo con mayor potencial,
Cr2 O27 /
.
El nodo se sita a la izquierda de la pila y es el electrodo con menor potencial,
/
.
Los electrones, en el circuito exterior, se dirigen en el sentido de potenciales crecientes,
desde el nodo al ctodo.
Un equema de la pila es:


2) Establezca la notacin de la pila.

La notacin de la pila es, nodo, puente salino (//) y ctodo:


Pt /

//

, Cr2 O27 / Pt

(0,5 puntos)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

175

3) Calcule la f.e.m. de la pila que podra formarse si sta opera en condiciones estndar.











(1 punto)
La fuerza electromotriz de la pila (Eopila ) se calcula mediante la expresin:
Eopila = Eoca todo Eoa nodo
Eopila = Eo

Eo

= 1,33 V 0,77 V = 0,56 V

d) ELECTRLISIS DEL AGUA


Si en un recipiente que contiene agua ligeramente acidulada se introducen dos electrodos
conectados a una fuente de corriente continua, se producir la transformacin de agua en
hidrgeno y oxgeno (electrlisis del agua).
1) Escriba las correspondientes semirreaciones de reduccin y de oxidacin as como la reaccin
global que tiene lugar en la cuba electroltica.




(1 punto)
Las semirreacciones que tienen lugar en los electrodos son:
ctodo (reduccin): 4 H2 O (l) + 4
nodo (oxidacin): 2 H2 O (l)

2 H2 (g) + 4

O2 (g) +

(aq) + 4

(aq)

La reaccin global es:


2 H2 O (l)

2 H2 (g) + O2 (g)

2) A partir de los potenciales estndar de reduccin de los semipares que intervienen en el


proceso, calcule la energa mnima (en kJ) necesaria para electrolizar 100 g de agua. (1 punto)
Datos. Potenciales estndar de reduccin: ( /
) = +1,23 V; E(
/ ) = 0,83 V;
Constante de Faraday = 96500 C

El potencial de la pila se calcula mediante la expresin:
Eopila = Eoca todo Eoa nodo
Eopila = Eo

Eo

= 0,83 V 1,23 V = 2,06 V

El valor negativo de Eopila que se obtiene indica que se trata de un proceso no espontneo.
La energa necesaria para que tenga lugar el proceso se calcula mediante la expresin:
rG = nFEopila
Sustituyendo:
rG = 4 mol
100 g H2 O

96500 C
1 kJ
2,06 V
= 795,2 kJ
mol
103 J

1 mol H2 O 795,2 kJ

= 2208,9 kJ
18 g H2 O 2 mol H2 O

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

176

e) OBTENCIN ELECTROQUMICA DEL CLORO


A una cuba electroltica que contiene agua se le aade cloruro de sodio.
1) Qu tiempo habr tenido que estar circulando una corriente de 0,5 A para descargar 1 litro
de cloro, en estado gaseoso medido en condiciones normales en la electrlisis del cloruro de sodio
en disolucin acuosa?







(1 punto)
El cloruro de sodio en disolucin acuosa se encuentra disociado de acuerdo con la ecuacin:
NaCl (aq)

Cl (aq) + Na (aq)

Tambin se tiene la ionizacin del agua:


H2 O (l)

2 H (aq) + OH (aq)

Consultando en la bibliografa los potenciales normales de electrodo, las semirreacciones que


tienen lugar en los electrodos son:
ctodo (reduccin): 2 H2 O (l) + 2 e

H2 (g) + 2 OH (aq) E = 0,83 V

ctodo (reduccin): Na (aq) + e

Na (s)

E = 2,71 V

[1]
[2]

de ambas, se puede descartar la semirreaccin [2] ya que H es ms fcil de reducir por tener
un potencial de reduccin mayor.
nodo (oxidacin): 2 Cl (aq)

Cl2 (g) + 2 e

nodo (oxidacin): 2 H2 O (l)

O2 (g) + 4 H (aq) + 4 e

E = 1,36 V

[3]

E = 1,23 V

[4]

El potencial de la reaccin entre [1] y [3] es:


2 Cl (aq) + 2 H2 O (l)
Eopila = Eoca todo Eoa nodo = Eo

Cl2 (g) + H2 (g) + 2 OH (aq)


/

Eo

= 0,83 V 1,36 V = 2,19 V

El potencial de la reaccin entre [1] y [4] es:


2 H2 O (l)

2 H2 (g) + O2 (g)

Eopila = Eoca todo Eoa nodo = Eo

Eo

= 0,83 V 1,23 V = 2,06 V

Como ambos valores son similares es de esperar que en el nodo se obtenga una mezcla de Cl2
y O2 . En la prctica, predomina Cl2 debido a la alta sobretensin (voltaje adicional necesario
para que tenga lugar la reaccin en un electrodo) del O2 comparada con la del Cl2 .
Por tanto, se puede considerar que la reaccin global es:
2 H2 O (l) + 2 NaCl (aq)

H2 (g) + Cl2 (g) + 2 NaOH (aq)

El NaOH (aq) se forma con los iones Na (aq) y OH (aq) presentes en la disolucin
resultante.
El nmero de moles de Cl2 desprendidos en el nodo son:
1 L Cl2

1 mol Cl2
= 4,4610 mol Cl2
22,4 L Cl2

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

177

Relacionando moles de Cl2 y de electrones:


4,4610 mol Cl2

96500
2 mol e

= 8616 C
1 mol Cl2 1 mol e

Relacionando la cantidad de corriente con su intensidad:


t =

8618 C 1 h

= 4,79 h
0,5 A 3600 s

2) Qu masa de hidrgeno se habr obtenido en el mismo tiempo?

(0,5 puntos)

Relacionando moles de Cl2 y de H2 :


4,4610 mol Cl2

1 mol H2 2 g H2

= 0,089 g H2
1 mol Cl2 1 mol H2

3) Se hace circular una corriente elctrica de 3,5 V y 0,5 A, Que coste supone la produccin de
1 de cloro si el precio industrial del kWh es de 3 cntimos de euro?

(1 punto)
Dato. 1 kWh = 3,610 J
Relacionando la cantidad de corriente para obtener 1 L deCl2 con la cantidad total de este:
8616 C 10 L Cl2
C

= 8,61610 3
1 L Cl2 1 m Cl2
m
La cantidad de energa necesaria es:
E = 8,61610

C
1 kWh
kW h
3,5 V
= 8,38 3
6
3
m
m
3,610 J

El precio a pagar es.


8,38

kWh 0,03


= 0,25 3
3
m 1 kWh
m
(O.Q.N. Sevilla 2010)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

178

59. Considere la siguiente reaccin:


C (s) +

(g)

2 CO (g)

a) A partir de qu temperatura es espontnea o dejar de serlo? Suponga que


dependen de la temperatura.

y no

Datos.

(kJ
S (J

(Datos. R = 8,314 J

C (s)
(g)
0,0
393,5
5,7
213,6
= 0,082 atmL

)
)

CO (g)
110,5
197,9
)

La ecuacin que relaciona G , H y S es:


G = H T S
Una reaccin es espontnea cuando G < 0, es decir cuando H < TS . Para determinar la
espontaneidad es preciso calcular previamente los valores de H y S .
La variacin de entalpa asociada al proceso puede calcularse a partir de la expresin:
r H = (i Hoi )productos (i Hoi )reactivos
Sustituyendo:
110,5 kJ
103 J
393,5 kJ
r H = 2 mol CO
1 mol CO2
= 172,5 kJ
= 1,725105 J
mol CO
mol CO2
1 kJ
La variacin de entropa asociada al proceso puede calcularse a partir de la expresin:
r S = (i Soi )productos (i Soi )reactivos
Sustituyendo:
r S = 2 mol CO

J
197,9 J
5,7 J
213,6 J
1 mol CO2
= 176,5
+ 1 mol C
K
K mol CO
K mol C
K mol CO2

En el equilibrio se cumple que G = 0:


T =

r H 1,725105 J
=
= 977,3 K
r S 176,5 JK

b) Calcule el valor de

Reaccio n espontnea para T > 977,3 K

a 1200 K.

El valor de G a 1200 K es:


J 1 kJ
r G = 172,5 kJ 1200 K 176,5 3 = 39,3 kJ
K 10 J
La relacin entre G y K viene dado por la expresin:
G = RT ln K

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

K = exp

179

39,3 kJ mol 1
= 51,4
8,314 10 3 kJ mol 1 K 1 1200 K

La relacin entre las constantes K y K viene dada por la expresin:


K = K RT

= coef. esteq. productos gaseosos coef. esteq. reactivos gaseosos = 2 1 = 1


51,4
0,082 atmLmol 1 K

K =

1200 K

= 0,522

c) En un recipiente de 1 L se introducen 20,83 g de C (s), 26,8 g de


(g) y 21,36 g de CO (g) y
se calienta a 1200 K. En qu sentido se producir la reaccin? Calcule el valor de la presin
parcial de cada uno de los gases y la masa de C (s) presente en el recipiente cuando se alcance el
equilibrio.
Si inicialmente el sistema contiene las siguientes cantidades:
20,83 g C

1 mol C
1 mol CO
= 1,736 mol C 26,8 g CO
= 0,609 mol CO
44 g CO
12 g C

21,36 g CO

1 mol CO
= 0,763 mol CO
28 g CO

Al existir inicialmente todas las especies del equilibrio, es preciso calcular el valor del cociente
de reaccin Q para saber en que sentido evoluciona el sistema para alcanzar el equilibrio:
Q =

[CO]20
nCO
=
[CO ]0 V n

2
0
0

0,763 2
= 0,956
1 0,609

Como se observa, Q > K por lo que para que se alcance el equilibrio Q debe hacerse menor,
por ese motivo el sistema se desplaza hacia la izquierda. La tabla de moles es:

ninicial
ntransformado
nformado
nequilibrio

C
1,736

x
1,736 + x

CO
0,609

x
0,609 + x

CO
0,763
2x

0,763 2x

Sustituyendo en la expresin de la constante K y teniendo en cuenta que V = 1 L:


K

CO
nCO


CO
Vn

0,522 =

0,763 2x
0,609 + x

x = 0,081 mol

Considerando comportamiento ideal, las presiones parciales de la mezcla en equilibrio son:


pCO =
2

0,609+0,081 mol 0,082 atmLmol


1 L

1200 K

= 67,90 atm

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

pCO =

0,763 20,081 mol 0,082 atmLmol


1 L

1200 K

180

= 59,14 atm

La masa de C que queda en el equilibrio es:


20,83 g C + 0,081 mol C

12 g C
= 21,80 g C
1 mol C

d) En un recipiente de 1 L se introducen 2 g de C (s) y 22 g de


(g) y se calienta a 1200 K. Qu
suceder? Calcule la cantidad (en gramos) de todas las sustancias presentes en el recipiente.
Si inicialmente el sistema contiene las siguientes cantidades:
2 g C

1 mol C
1 mol CO2
= 0,167 mol C 22 g CO2
= 0,500 mol CO2
12 g C
44 g CO2

Como falta la especie CO para que se alcance el equilibrio el sistema se desplaza hacia la
derecha. La tabla de moles es:

ninicial
ntransformado
nformado
nequilibrio

C
0,167
x

0,167 x

CO2
0,500
x

0,500 x

CO

2x
2x

Sustituyendo en la expresin de la constante K y teniendo en cuenta que V = 1 L:


0,522 =

2x

0,500 x

x = 0,198 mol

Como este valor es superior a la cantidad inicial de C (0,167 mol), se consume toda esta
especie y la reaccin no alcanza el equilibrio. De acuerdo con la estequiometra de la
reaccin, las masas de todas las sustancias presentes en el recipiente son:
22 g CO2 0,167 mol C
20,167 mol CO

44 g CO2
= 14,55 g CO2
1 mol CO2

28 g CO
= 9,35 g CO
1 mol CO

e) Si en las condiciones anteriores se aaden otros 3 g de C (s), calcule la cantidad (en gramos)
de todas las sustancias presentes en el recipiente cuando se alcance el equilibrio.
Si inicialmente la cantidad de carbono que contiene el sistema es:
5 g C

1 mol C
= 0,417 mol C
12 g C

Como esta cantidad es superior a la mnima necesaria para que se alcance el equilibrio (0,167
mol), la reaccin ahora s evoluciona hasta el equilibrio calculado anteriormente y las masas
de todas las especies en el equilibrio son:
22 g CO2 0,198 mol C

44 g CO2
= 13,29 g CO2
1 mol CO2

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

20,198 mol CO

181

28 g CO
= 11,09 g CO
1 mol CO

5 g C 0,198 mol C

12 g C
= 2,62 g C
1 mol C
(O.Q.N. Valencia 2011)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

182

60. Los sulfitos, en bajas concentraciones, forman parte de la composicin natural de los vinos.
No obstante, dicho componente se aade con frecuencia desde hace siglos, en forma de dixido
de azufre, para potenciar su efecto conservante y/o antioxidante, que preserva el aroma y
frescor al vino; ello permite garantizar la calidad del producto. Sin embargo, por indicacin de la
Directiva Comunitaria desde 2003, en la etiqueta del vino debe figurar la leyenda contiene
sulfitos, cuando el dixido de azufre se encuentre en una concentracin superior a 10 ppm (ppm
significa partes por milln y equivale a mg por litro). Esta informacin es necesaria porque la
presencia del aditivo puede ocasionar riesgos para la salud, principalmente por su capacidad
alergnica, especialmente en personas que padecen asma. As pues, determinar su concentracin
en los vinos comercializados constituye una tarea obligada en enologa. Uno de los
procedimientos para su anlisis se basa en la reaccin del sulfito con yodo que produce sulfato y
yoduro.
a) Para disponer de la disolucin de yodo como reactivo, se parte de una mezcla de yodato de
potasio y de yoduro de potasio que reaccionan entre s, en medio cido (HCl), para formar yodo
molecular. Escriba y ajuste la reaccin que tiene lugar.
Las semirreacciones que tienen lugar son:
reduccin: IO + 6 H + 5 e
oxidacin: 5 I

I + 3 H O

I + e

La ecuacin inica final se obtiene sumando ambas semirreacciones:


IO + 6 H + 5 I

3 I + 3 H O

Aadiendo los iones que faltan (6 Cl y 6 K ) se obtiene la ecuacin molecular final:


KIO3 + 5 KI + 6 HCl

3 I2 + 3 H2 + 6 KCl

b) Para solubilizar el yodo insoluble se aade un exceso de yoduro de potasio a la disolucin, con
lo que se forma el in triyoduro ( +
) que es fcilmente soluble. Teniendo en cuenta
esta informacin, escriba la reaccin (en forma inica) entre el sulfito y el triyoduro ( )
debidamente ajustada.
Las semirreacciones que tienen lugar son:
reduccin: I + 2 e

oxidacin: S O + H O

SO + 2 H + 2 e

La ecuacin inica final se obtiene sumando ambas semirreacciones:


+

3 +

+ 2

c) Calcule las cantidades de yodato y de yoduro de potasio necesarios para obtener 500 mL de
disolucin de de concentracin 0,005 M.
Para calcular las cantidades yodato de potasio y el yoduro de potasio necesarias para formar
in triyoduro se escribe la ecuacin qumica global sumando la ecuacin entre estas
sustancias para producir yodo y la correspondiente entre yodo y el yoduro de potasio para
formar ion triyoduro:
KIO3 + 5 KI + 6 HCl

3 I2 + 3 H2 O + 6 KCl

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

183

3 I2 + 3 KI
3 I + 3 K
_______________________________________________________________
KIO3 + 8 KI + 6 HCl

+ 3 H2 + 6 KCl

Los mmoles de triyoduro que se necesitan son:


500 mL I 0,005 M

0,005 mmol I
= 2,5 mmol I
1 mL I 0,005 M

Relacionando triyoduro con yodato y yoduro de potasio:


2,5 mmol I

1 g KIO3
1 mmol KIO3 214 mg KIO3

3
= 0,178 g KIO3
3 mmol I
1 mol KIO3 10 mg KIO3

2,5 mmol I

8 mmol KI 166 mg KI 1 g KI


= 1,107 g KI
3 mmol I 1 mmol KI 103 mg KI

d) Con el fin de determinar el contenido en sulfitos que posee un vino embotellado, se tom una
muestra de 10 mL del mismo y despus de la debida preparacin de la muestra, se necesit un
volumen de 2,25 mL de la disolucin de anterior hasta el final de la reaccin de valoracin
cuando se utiliza almidn como indicador. Otra muestra de vino que no contiene sulfitos, tras el
mismo tratamiento, requiri 0,15 mL de la misma disolucin de para producir idntico
cambio de color del indicador (ensayo en blanco). Calcule la cantidad de sulfito (en gramos)
encontrado en la muestra analizada y exprese dicho resultado en ppm de dixido de azufre.
Relacionando triyoduro con sulfito, descontando previamente la cantidad de triyoduro
correspondiente al ensayo en blanco se obtiene la masa de sulfito en la muestra de vino:
2,25 0,15 mL I 0,005 M
0,0105 mmol I

1 mmol SO
1 mmol I

0,005 mmol I
= 0,0105 mmol I
1 mL I 0,005 M

80 mg SO
1 mmol SO

= 0,84 mg

La concentracin de dixido de azufre existente en el vino expresada en ppm:


0,0105 mmol I

1 mmol SO
1 mmol I

1 mmol SO2 64 mg SO2



= 0,672 mg SO2
1 mmol SO 1 mmol SO2

0,672 mg SO2 103 mL vino



= 67,2 ppm
10 mL vino
1 L vino

(O.Q.N. Valencia 2011)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

184

61. Una pila galvnica consta de dos electrodos: el primero est formado por una lmina de
platino sumergida en una disolucin 1 M de dicromato potsico, 1 M de cloruro de cromo (III) y
de pH = 0; y el segundo electrodo es una lmina de cobalto sumergida en una disolucin 1 M de
nitrato de cobalto (II). Entre las dos disoluciones se coloca un puente salino.
Datos. E (
/
) = 1,33 V; E (
/Co) = 0,28 V
F = 96485 C
; R = 8,314 J


a) Dibuje el esquema completo de la pila que funciona en condiciones estndar.
Un esquema de la clula galvnica es:

Los electrones de la
clula se dirigen de
forma espontnea hacia
potenciales crecientes,
por tanto:

Polo positivo (ctodo):

Cr2 O27 /
Polo negativo (nodo):
/Co

Cr2 O27 es el oxidante, la
especie que se reduce.
Co es el reductor, la
especie que se oxida.

b) Escriba las dos semirreacciones y la reaccin global de dicha pila.
Las semirreacciones que tienen lugar son:
reduccin: Cr O + 14 H + 6 e
oxidacin: 3 Co

2 Cr

+ 7 H O

Co + 2 e

La ecuacin inica final se obtiene sumando ambas semirreacciones:


+ 14

+ 6 Co

+3

+ 7

c) Calcule la variacin de la energa libre de Gibbs estndar, G de la reaccin global.


La relacin entre G y el potencial o fuerza electromotriz (f.e.m.) de la pila, Eopila , viene dado
por la expresin, G = nFEopila , de donde se deduce que una reaccin de oxidacinreduccin
ser espontnea siempre que se cumpla que Eopila > 0.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

185

La f.e.m. de la pila se calcula mediante la expresin:


Eopila = Eoca todo Eoa nodo
Eopila = Eo

Eo

= 1,33 V 0,28 V = 1,61 V

La variacin de energa libre de Gibbs del proceso es:


1 kJ
96485 C
1,61 V 3 = 932 kJ
mol
10 J

G = 6 mol

En otro experimento, se sumerge la lmina de platino en una disolucin 0,05 M de dicromato


potsico, 0,1 M de cloruro de cromo (III) y de pH = 3; y la lmina de cobalto en una disolucin
0,001 M de nitrato de cobalto(II).
d) Calcule la fuerza electromotriz de la pila (f.e.m.) a 25C.
Se trata de una pila en condiciones no estndar:
[K 2 Cr2 O7 ] = [Cr2 O27 ] = 0,05 M

[CrCl3 ] = [Cr

pH = 3 [H ] = 10 3 M

[Co NO3 2 ] = [Co ] = 0,001 M

] = 0,1 M

Al tratarse de disoluciones que no estn en estado tipo o estndar es preciso aplicar la


ecuacin de Nernst:
E = Eo

0,0592
[red]
log

n
[oxd]

Eca todo = Eoca todo


Eca todo = 1,33

0,0592
[red]
log
Eca todo = Eo
n
[oxd]

0,0592
10 1
log
6
510 2 10

Ea nodo = Eoa nodo


Ea nodo = 0,28

0,0592
[Cr
log
6
[Cr2 O27 ] [H

= 0,923 V

0,0592
[red]
log
Ea nodo = Eo
n
[oxd]

0,0592
1
log

2
[Co ]

0,0592
1
log
= 0,369 V
2
10 3

La f.e.m. de la pila es:


Epila = Eca todo Ea nodo = 0,923 V 0,369 V = 1,292 V
e) Calcule la variacin de la energa libre de Gibbs, G, en estas nuevas condiciones.
La variacin de energa libre de Gibbs del proceso es:
G = 6 mol

1 kJ
96485 C
1,292 V 3 = 748 kJ
mol
10 J

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

186

f) Si la disolucin de
(aq) se sustituye por otra de concentracin desconocida, la fuerza
electromotriz de la pila vale 1,41 V. Qu concentracin de
(aq) habr en esta nueva
disolucin.
El valor de Ea nodo es:
Ea nodo = Eca todo Epila = 0,923 V 1,41 V = 0487 V
A partir de la expresin de Ea nodo :
Ea nodo = Eo

/Co

0,0592
1
log

2
[Co ]

0487 V = 0,28 V

0,0592
1
log

2
[Co ]

] = 9,910

(O.Q.N. Valencia 2011)


Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

187

62. La solubilidad del hidrxido de calcio en agua cambia mucho con la temperatura, teniendo
un valor de 1,85 g a 0C y de 0,77 g a 100C.
a) La reaccin de disolucin del
, es exotrmica o endotrmica? Justifique su respuesta.
El hidrxido de calcio, Ca OH 2 , es un compuesto poco soluble de M = 74 gmol .
A la temperatura T = 273 K, su solubilidad es s = 1,85 gL , y el valor de la solubilidad molar
es:
1,85 g Ca OH 2 1 mol Ca OH 2

= 0,025 M
L
74 g Ca OH 2
mientras que a la temperatura T = 373 K, su solubilidad es s = 0,77 gL y la solubilidad
molar es:
0,77 g Ca OH 2 1 mol Ca OH 2

= 0,0104 M
L
74 g Ca OH 2
Una disminucin de la solubilidad al aumentar la temperatura denota un proceso que se
desfavorece al calentar, es decir un proceso en el que el calor de reaccin aparece en los
productos. Por tanto, se trata de un proceso exotrmico.
b) Calcule el valor de

a ambas temperaturas.

El equilibrio correspondiente al Ca OH 2 es:


Ca OH 2 (s)

Ca

(aq) + 2 OH (aq)

y su producto de solubilidad:
K = [Ca ] [OH

las solubilidades de los iones son:


[Ca

] = s [OH ] = 2s

Sustituyendo en la expresin de Kps se obtienen los valores de los productos de solubilidad:


4s3

K = s 2s
K

= 4 0,025 = 6,2510

c) Calcule el H.
Dato. R = 8,314 J

= 4 0,0104 = 4,5010

La ecuacin de vant Hoff relaciona la dependencia de la constante K con la temperatura:


ln

Kps2
Kps1

r H 1
1


R T1 T2

Sustituyendo:
ln

4,5010

6,2510

r H
8,31410

1
1


273 373

r H = 22,3 kJmol

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

188

Este valor es concordante con lo que predice el apartado a.


d) Calcule el pH de la disolucin saturada de este hidrxido a 25C.
Para este clculo es necesario calcular previamente el valor de K a 298 K. Aplicando la
ecuacin de vant Hoff:
ln

6,2510

r H
8,31410

1
1


273 298

= 2,7510 5

Sustituyendo en la expresin de K se obtiene la solubilidad molar:


2,7510 5 = 4s3

s = 0,019 M

Los valores de [OH ], pOH y pH de la disolucin son:


[OH ] = 2s = 2 0,019 M = 0,038 M
pH + pOH = 14

e) Si se mezclan 40,0 mL de
?
Dato.

pOH = log 0,038 = 1,42

pH = 14 1,42 = 12,58

1,5 M con 10,0 mL de

0,1 M a 25 C Precipitar

) = 1,8110

Para que se forme precipitado, es preciso que el producto inico:


[Ca ] [OH

> K

El NH3 es una base dbil y la ecuacin qumica correspondiente a su ionizacin en disolucin


acuosa es:
NH3 (aq) + H2 O (l)

NH (aq) + OH (aq)

Aplicando los correspondientes balances y aproximaciones se puede escribir:


[NH ] = [OH ] = x
[NH3 ] = c [OH ] = c x
siendo c la concentracin inicial de NH3 despus de la mezcla:
c =

0,1 mmol NH3


1 mL NH3 1,5 M
= 1,2 M
10+40 mL disolucio n

40 mL NH3 1,5 M

La expresin de la constante queda como:


K =

[NH ] [OH ]

[NH3 ]

Como se cumple que:


c
> 100 se puede realizar la aproximacio n c [OH ] c
K

con lo que la ecuacin anterior queda como:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

[OH ]2
K =

c

189

[OH ] = K c = 1,8110 5 1,2 = 4,710 3 M

Considerando volmenes aditivos, la concentracin de [Ca ] una vez efectuada la mezcla es:
[Ca ] =

0,1 mmol Ca
1 mL Ca 0,1 M
= 0,02 M
10+40 mL disolucio n

10 mL Ca 0,1 M

El valor del producto inico es:


0,02 4,710

= 4,3410 8

Como se observa, el producto inico es menor K , por tanto, no se forma precipitado de


Ca(OH)2.
(O.Q.N. Valencia 2011)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

190

63. APLICACIONES DEL CROMO Y DEL ANIN DICROMATO


Parte A. Control de alcoholemia. (5 puntos)
El etanol ingerido con las bebidas alcohlicas pasa a la sangre desde el estmago e intestino. La
sangre se oxigena en los pulmones liberando dixido de carbono y el etanol consumido con las
bebidas y que se emiten en la respiracin. La concentracin de etanol en la sangre es unas 2000
veces ms alta que en el aire espirado.
La deteccin del alcohol consiste en la reaccin del etanol con el dicromato de potasio
[heptaoxodicromato (VI) de dipotasio] en medio cido, formndose cido etanoico (actico),
incoloro, e iones
, de color verde. El aparato medidor (alcoholmetro) del etanol espirado
por una persona consta de un globo de 1 L de volumen donde se produce la reaccin anterior. La
medida del alcohol espirado al soplar en el globo se basa en comparar la intensidad de
coloracin debida a los iones
producidos en la reaccin anterior frente a una disolucin
patrn, que se registra en un valor numrico referido a gramos de alcohol por litro de sangre
(g/L).
A1) Escriba la reaccin ajustada entre los aniones dicromato, en medio cido, y el etanol.
(1 punto)
Las semirreacciones que tienen lugar son:
reduccin: 2 Cr O + 14 H + 6 e
oxidacin: 3 C H OH + H O

2 Cr

+ 7 H O

C H O + 4 H + e

La ecuacin inica final se obtiene sumando ambas semirreacciones:


2

+ 16

+ 3

+ 3

+ 11 H2

A2) Determine a partir de los cambios en los estados de oxidacin, cul es el agente oxidante y
cul es el agente reductor.







(1 punto)
El agente oxidante debe ser la la especie que se reduce, es decir, que disminuye su estado de
. El cambio en el estado de oxidacin del cromo es:
oxidacin. En este caso, se trata del
Cr O : 2x + 7 (2) = 2

x = +6

El agente reductor debe ser la la especie que se oxida, es decir, que aumenta su estado de
. El cambio en el estado de oxidacin se produce
oxidacin. En este caso, se trata del
solo en los tomos de carbono que contienen el grupo hidroxilo y carboxilo, respectivamente:
CH OH: x + 3 (+1) + (2) = 1

x = 2

COOH: x + 1 + 2 (2) = 1

x = +2

A3) Indique el nombre y la polaridad del electrodo (nodo o ctodo) en el que se produce la
oxidacin y la reduccin en una celda voltaica.




(1 punto)
El ctodo (+) es el electrodo en el que se produce la semirreaccin de reduccin. En este
caso, se trata del par Cr O /Cr .
El nodo ( ) es el electrodo en el que se produce la semirreaccin de oxidacin. En este

caso, se trata del par C H OH/C H O .

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

191

A4) Calcule la cantidad (moles) de etanol espirado por litro de aire cuando el alcoholmetro
seale una lectura de 0,5 g/L.






(1 punto)
Relacionando etanol en sangre con etanol en aire:
5,410 6 mol
0,5 g C H OH 1 mol C H OH 1 L sangre


=
L sangre
46 g C H OH 2000 L aire
L aire

A5) Calcule qu masa (mg) de dicromato de potasioreacciona cuando la lectura del


alcoholmetro es de 0,5 g/L sangre.





(1 punto)
Relacionando etanol en sangre/aire con dicromato:
5,410 6 mol C H OH

2 mol K Cr O 294 g K Cr O 10 mg K Cr O


= 1,07 mg
3 mol C H OH 1 mol K Cr O
1 g K Cr O

Parte B. Cromado de metales. (5 puntos)


El recubrimiento electroltico con cromo se usa para proteger las superficiers metlicas contra
la corrosin, mejorar su resistencia, reducir su coeficiente de rozamiento e incluso se usa con
fines ornamentales. El llamado cromo duro es un depsito electroltico de espesor igual o mayor
de 0,1 mm. El producto de partida se obtiene disolviendo trixido de cromo en agua, en una
concentracin de 300 g/L, al que se aaden unos 2 g/L de cido sulfrico. Deben adoptarse
normas de seguridad estrictas porque el cromo hexavalente es extremadamente txico.
B1) Si se parte de un litro de la disolucin anterior y admitiendo que la especie predominante es
el anin dicromato
2
+


calcule la concentracin (mol

+ 2
) de la disolucin de anin dicromato obtenido.

(1 punto)

La concentracin molar de la disolucin de partida es:


300 g CrO 1 mol CrO 1 mol Cr O


L
100 g CrO 2 mol CrO

= 1,5 molL1

B2) Para realizar el depsito de cromo sobre una placa metlica, sta se utiliza como uno de los
electrodos y el otro electrodo es de grsfito o plomo; indique el nombre de cada electrodo y su
signo, y el proceso que se producen cada uno (oxidacin o reduccin).

(1 punto)
El ctodo ( ) es el electrodo en el que se produce la semirreaccin de reduccin. En este
caso, la placa de metlica.
El nodo (+) es el electrodo en el que se produce la semirreaccin de oxidacin. En este
caso, el grafito o plomo.
B3) Calcule la cantidad de electricidad (C) necesaria para depositar sobre la placa metlica 10 g
de cromo metal.
Dato. F = 96500 C








(1 punto)
La semireaccin de reduccin del cromo es:
Cr

+ 6 e

2 Cr

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

192

Relacionando sustancia y corriente elctrica:


10 g Cr

1 mol Cr 6 mol e 96500 C




= 1,1110 C
52 g Cr 1 mol Cr 1 mol e

B4) Si el rendimiento (eficacia) real del proceso es del 60%, determine el tiempo necesario para
depositar esos 10 g de cromo sobre la placa metlica, al pasar una corriente de 50 A. (1 punto)
Si el rendimiento del proceso es del 60%:
1,1110 C

100 C reales
= 1,8510 C
60 C tericos

Relacionando la cantidad de corriente con su intensidad:


1,8510 C
= 3700 s
50 A Cs 1
B5) Calcule el espesor (mm) del depsito de cromo sobre las caras de una lmina metlica
cuadrada de 7,5 cm de lado (el espesor de la placa es despreciable). Se ha obtenido cromo duro?
Dato. Densidad del cromo = 7,2 g






(1 punto)
De los 10 g de cromo depositados, corresponden 5 g a cada cara de la lmina.
5 g Cr

1 cm Cr
= 0,694 cm Cr
7,2 g Cr

La superficie de la lmina es:


7,5cm = 56,25 cm
El espesor del depsito es:
0,694 cm Cr 10 mm

= 0,123 mm Cr
56,25 cm Cr 1 cm
S que se trata de cromo duro ya que el espesor es mayor de 0,1 mm.
(O.Q.N. El Escorial 2012)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

193

64. ANLISIS DEL AGUA DE UN ACUARIO


La calidad del agua de un acuario para mantener con vida a los peces se puede observar
analizando la concentracin de iones cloruro. Para ello se realiza una valoracin con nitrato de
plata en presencia de cromato de potasio que permite detectar el punto final por un cambio de
color. La concentracin de iones cloruro necesaria para mantener con vida a los peces de un
acuario es de 8 ppm (1 ppm = 1 mg ). Se realiza el anlisis de los iones cloruro del agua de un
acuario, tomando una muestra de 50 mL, a la que se aaden unas gotas de disolucin de
cromato de potasio y se valora con disolucin de nitrato de plata de concentracin
1,6410 mol . Cuando se han aadido 16,16 mL de la disolucin de nitrato de plata aparece
un color rojonaranja.
Datos. Productos de solubilidad, : cromato de plata = 1,0010
cloruro de plata = 1,7810

a) Escriba las dos reacciones ajustadas de precipitacin que tienen lugar al realizar el anlisis de
los iones cloruro, una con la especie valorante y otra con la responsable del cambio de color en el
punto final de la valoracin. Indique el orden en el que se producen las reacciones. (1 punto)
Los iones plata reaccionan con los iones cloruro y cromato. La reaccin que se produce en
primer lugar es la correspondiente a la sustancia que tenga un producto de solubilidad ms
fcil de alcanzar. Como los iones cloruro (Cl ) se encuentran en mayor cantidad en la
disolucin que los los iones cromato (CrO ) se alcanza antes el producto de solubilidad del
cloruro de plata (AgCl), y posteriormente, el del cromato de plata (Ag CrO ).
La primera reaccin de precipitacin es:
(aq) +

(aq)

AgCl (s)

La segunda reaccin de precipitacin es:


2

(aq) +

(aq)

(s)

b) Cul es la concentracin molar de iones cloruro en la muestra?

(1 punto)

Relacionando la cantidad de Ag con la de Cl :


3

16,16 mL AgNO 1,6410 M

1,64103 mmol AgNO

1 mmol Ag
= 0,0265 mmol Ag
1 mL AgNO 1,6410 M 1 mmol AgNO
3

La concentracin molar de Cl en la muestra de 50 mL de agua es:


0,0265 mmol Ag 1 mmol Cl

= 5,30104 M
50 mL agua
1 mmol Ag
c) La muestra de agua contiene suficiente cantidad de iones cloruro para mantener vivos los
peces del acuario?








(1 punto)
Cambiando la concentracin molar a ppm:
5,30104 mmol Cl 35,5 mg Cl 103 mL agua


= 18,8 ppm
1 mL agua
1 mmol Cl
1 L agua
Como Cl

> 8 ppm, los peces s pueden vivir en el acuario.

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

194

d) Si la concentracin de cromato de potasio en el punto final de la valoracin realizada es de


0,020 mol . Calcule la concentracin de iones cloruro en la disolucin cuando se forma el
precipitado rojonaranja.







(2 puntos)
Con el equilibrio de solubilidad del Ag CrO se puede calcular la concentracin de iones Ag
en el instante en el que precipita esta sustancia:
2 Ag (aq) + CrO (aq)
K = [Ag

Ag CrO (s)

[CrO ]

[CrO2
4 ] = 0,020 M [Ag =

1,001012

0,020

[Ag = 7,07106 M

Con el equilibrio de solubilidad del AgCl se puede calcular la concentracin de iones Cl en el


instante en el que precipita el Ag CrO :
Ag (aq) + Cl (aq)

AgCl (s)

K = [Ag [Cl ]
[Ag ] = 7,07106 M

[Cl =

1,781010
7,07106 M

= 2,52105

e) Para que esta valoracin funcione correctamente, la disolucin que se quiere valorar debe ser
neutra o ligeramente bsica, para ello se utiliza una disolucin reguladora que fije el pH
deseado. Seleccione de la lista de disoluciones reguladoras contenidas en en la siguiente tabla,
aquella que haga posible mantener el pH de la disolucin a un valor 7,2. Escriba los clculos que
permiten justificar esta seleccin.






(1 punto)
Tabla de disoluciones reguladoras


Disolucin








cido lctico 0,1 mol /Lactato de sodio 0,1 mol


1,410
cido actico 0,1 mol /Acetato de sodio 0,1 mol


1,810
Dihidrgenofosfato de sodio 0,1 mol /Hidrgenofosfato de disodio 0,1 mol 6,210
Cloruro de amonio 0,1 mol /Amoniaco 0,1 mol


5,610
El pH de una disolucin reguladora formada por un cido HA y una sal NaA se calcula a partir
del siguiente equilibrio:
HA (aq) + H2 O (l)

A (aq) + H3 O (aq)

La expresin de la constante K es:


K =

A [H3 O ]

[HA]

K =

C
[H3 O ]
C

Siendo C la concentracin del cido y C la concentracin de la sal.


La mxima capacidad de regulacin de una de estas disoluciones se obtiene cuando C = C .
Con estos valores la expresin anterior queda como:
[H3 O ] = K

pH = pK

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

195

Aplicado a las disoluciones reguladoras de la tabla:



Disolucin





cido lctico / Lactato de sodio



cido actico / Acetato de sodio



Dihidrgenofosfato de sodio / Hidrgenofosfato de disodio
Cloruro de amonio / Amoniaco




3,85
4,75
7,20
9,25

La disolucin reguladora a emplear es dihidrgenofosfato de sodio/hidrgenofosfato de


disodio.
f) Utilizando la disolucin reguladora elegida, calcule la masa en gramos, de cido dbil y base
conjugada que se necesitan disolver en agua destilada para preparar 500 mL de una disolucin
de pH = 7,2.








(1 punto)
La masa de cido dbil (dihidrgenofosfato de sodio) necesaria para preparar la disolucin es:
500 mL NaH2 PO 0,1 M

119,98 g NaH2 PO
1 L NaH2 PO 0,1 M
3
= 6,0 g
1 L NaH2 PO 0,1 M 10 mL NaH2 PO 0,1 M

H2

La masa de base conjugada (hidrgenofosfato de disodio) necesaria para preparar la


disolucin es:
500 mL Na2 HPO 0,1 M

141,96 g Na2 HPO


1 L Na2 HPO 0,1 M
3
= 7,1 g Na2
1 L Na2 HPO 0,1 M 10 mL Na2 HPO 0,1 M

g) Para determinar la concentracin de iones cloruro en otra muestra de agua se utiliza el


mtodo de Volhard. Este mtodo consiste en aadir un exceso de nitrato de plata a la muestra y
el exceso de
se valora con una disolucin de patrn de KSCN (tiocianato de potasio). El
punto final se detecta por formacin del ion
de color rojo parduzco. Si se aaden 50
mL de nitrato de plata 1,2910 mol a la muestra de agua y el exceso requiere 27,46 mL de
KSCN 1,4110 mol para su valoracin, calcule la concentracin de iones cloruro en la
muestra de agua.








(3 puntos)
Las reacciones que tienen lugar son:
Ag (aq) + Cl (aq)

AgCl (s)

Fe (aq) + SCN (aq)

FeSCN

Ag (aq) + SCN (aq)

AgSCN (s)

(aq)

mmoles totales de Ag aadidos a la muestra de agua:


3

50 mL AgNO 1,2910 M

1,29103 mmol AgNO

1 mmol Ag
= 0,0645 mmol Ag
1 mmol AgNO
1 mL AgNO 1,2910 M
3

mmoles de Ag en exceso (reaccionan con KSCN):


3

27,46 mL KSCN 1,4110 M


1,41103 mmol SCN

1 mmol Ag
= 0,0387 mmol Ag
1 mmol SCN
1 mL KSCN 1,4110 M
3

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

196

mmoles de Ag que reaccionan con Cl :


0,0645 mmol Ag total 0,0387 mmol Ag exceso = 0,0285 mmol Ag
La concentracin molar de iones Cl en la muestra de agua es:
0,0285 mmol Ag 1 mmol Cl

= 5,16104 M
50 mL agua
1 mmol Ag
(O.Q.N. El Escorial 2012)

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

197

65. ESTUDIO DEL EQUILIBRIO DEL FOSGENO


El gas fosgeno (
) es un importante componente qumico industrial utilizado para hacer
plsticos, tinturas, frmacos y pesticidas. En bajas concentraciones tiene un olor agradable como
a heno recin cortado a maz verde. Sin embargo, a latas concentraciones y a temperatura
ambiente es un gas venenoso. El fosgeno fue utilizado ampliamente durante la Primera Guerra
Mundial como un agente asfixiante.
La reaccin de disociacin del fosgeno abajo indicada tiene una constante de equilibrio = 22,0
a 298 K. La reaccin se inicia cuando se aade
a un recipiente y posteriomente se alcanza
el equilibrio, La presin total del equilibrio es 6,90 atm.


+
Datos.

(298 K) / J

283,5 197,7 223,1


R = 8,314 J

= 0,082 atmL

a) Calcule las presiones parciales de

y CO en el equilibrio.

(2 puntos)

Escribiendo la tabla de moles correspondiente en funcin del grado de disociacin, :



ninicial
ntransformado
nformado
nequilibrio

COCl
CO
n


n
n
n n = n 1
n = n 1 + n + n = n 1 +

Cl

n
n

La expresin de la constante K es:


K =

Aplicando la ley de Dalton se calculan las presiones parciales en el equilibrio:


p

= p

= p y

= p y

Para la mezcla gaseosa se cumple que :


y

+ y

+ y

= 1

Llamando y a la fraccin molar del y


y

la expresin anterior queda como:

= 1 2y

Sustituyendo en la expresin de K se obtiene:


K = p
p
p

y
1 2y

22,0 = 6,90

y
1 2y

= 6,9 atm 0,466 = 3,215 atm


= 6,9 atm 1 2 0,466 = 0,469 atm

y = 0,466

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

b) Calcule la fraccin molar de

en el equilibrio.

Segn se ha visto en el aparado anterior, y


c) Calcule el grado de disociacin del

198

(1 punto)

(1 punto)

= 0,466.

Sustituyendo las presiones en la expresin de K se obtiene:


K = p

22,0 = 6,90

d) Calcule el valor de la entalpa para la reaccin a 298 K.

= ,

, %
(2 puntos)

A partir del valor de la constante de equilibrio se puede obtener el valor de la energa libre de
Gibbs. La relacin entre G y K viene dado por la expresin:
rG = RT ln K
El valor de G a 298 K es:
r G = 8,314 10 3 kJ mol

298 K ln 22 = 7,66 kJ mol 1

La variacin de entropa asociada al proceso puede calcularse a partir de la expresin:


r S = (i Soi )productos (i Soi )reactivos
Sustituyendo:
r S = 1 mol Cl2
r S = 137,3

197,7 J
223,1 J
283,5 J
1 mol COCl2

+ 1 mol CO
K mol CO
K mol Cl2
K mol COCl2

J
1 kJ
kJ
3 = 0,137

Kmol 10 J
Kmol

La ecuacin que relaciona G , H y S es:


rG = rH T rS
Sustituyendo:
r H =

7,66 kJ
0,137 kJ
+ 298 K

mol
Kmol

r H = 33,26 kJ mol 1

e) Sin usar los datos de la tabla de entropas, podra predecir el signo de la variacin de
entropa estndar de la reaccin?






(1 punto)
Como existen ms moles de gas en los productos que en los reactivos, se registra un aumento
de entropa en la reaccin, rS > 0.
f) Si se aumenta la temperatura del sistema, hacia dnde se desplazara el equilibrio? (1 punto)
El principio de Le Chtelier dice:

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

199

cualquier cambio en una de las variables que determinan el estado de equilibrio de un


sistema, causa un desplazamiento del equilibrio en el sentido que tiende a oponerse al
cambio en la variable modificada.
Si se aumenta la temperatura del sistema, este se desplaza en el sentido en el que se
consuma el calor aportado. Como se trata de un proceso endotrmico el equilibrio se desplaza
hacia los productos, es decir, hacia la formacin de COCl2 .
g) En un recipiente de 1 L se introducen 2,0 g de
(g), 2,9 g de (g) y 5,6 g de CO (g) a
298 K, qu conclusin se puede extraer acerca del sentido de la reaccin bajo estas condiciones?











(2 puntos)
Las presiones parciales ejercidas por cada uno de los gases son:
p

2,0 g 0,082 atmLmol 1 K

298 K

1 L 99 gmol

2,9 g 0,082 atmLmol 1 K

298 K

1 L 71 gmol

5,6 g 0,082 atmLmol 1 K


1 L 71 gmol

298 K

= 0,494 atm

= 0,998 atm

= 4,887 atm

El valor del cociente de reaccin Q es:


Q =

(0,498) (4,887)
= 9,9
(0,494)

Q < K

El sistema se desplaza en el sentidoen el que aumente el cociente de reaccin. Debe hacerse


mayor el numerador y menor el denominador. El sistema se desplaza hacia los productos, es
decir, hacia la formacin de COCl2 .
(O.Q.N. El Escorial 2012)

Cuestiones y Problem
mas de las Olim
mpiadas de Qumica. Volumen
n 6. (S. Menargu
ues & F. Latre)

200

66. RE
EGULACIN DEL pH EN LA SANGRE
La sangre es el flu
uido que tran
nsporta los g
gases de la rrespiracin, llos nutrientees y los produ
uctos de
desheecho entre loos diversos rganos y tej

ejidos. El pH de la sangrre se mantien


ne alrededorr de 7,4
con u
una fluctuaciin mnima d
de tan solo u
una dcima d
de pH. Las a
alteraciones de la concen
ntracin
de se atenan
n gracias a llos sistemas de amortigu
uacin o reg
gulacin del organismo, que son
de su
uma importa
ancia para loos seres vivoos. Uno de llos principalles amortigu
uadores fisioolgicos,
junto con el fosfatto, las protenas o la hem
moglobina ess el sistema
/
. C
Como la produccin
diaria
a de in hid
drgeno ( ) en el org
rganismo hu
umano es en
norme (entrre 10.000 y 15.000
mmolles), los pulm
mones y los riiones participan tambin de manerra fundamen
ntal en la reg
gulacin
del eq
quilibrio cid
dobase.
La grran mayora
a de esta produccin d
de
proceede de la disociacin d
del cido carbnico
resulttante del dixido de carb
bono del mettabolismo celular y del ag
gua.
Los eq
quilibrios prresentes en el plasma san
nguneo se reesumen en ell esquema sig
guiente:


El
gaseoso see encuentra en equilibrioo con el
disuelto en agua o en ell plasma san
nguneo,
y su ccomportamieento se rige p
por la ley de Henry (k = 2
2,2610 mool
)).
El
de la sangre se combin
na con los flu
uidos acuosos del organissmo para forrmar
, el cul
a su vvez est ionizzado en
y . Ad
dems, el plasma sangun
neo contienee una concen
ntracin
total de carbonatto (suma de [[
] y dee [
]) de 2,,5210 mool .
Dato.
(
/
) =
= 6,1.
a) Ca
alcule la con
ncentracin (mol
(
ees 5,332 kPa..

) dee dixido dee carbono dis


isuelto, si la presin parrcial del


(1 p
punto)

La exxpresin de lla ley de Hen


nry es:
CO

k
dis = k

CO

dis =

2,2610 7 m
molL 1 Pa

5,33210
0 Pa = 1,210

molL
L

b) C
Cul es la reelacin entree las concen
ntraciones dee in hidrg
genocarbona
ato y de dixido de
carbo
ono ([
]] / [
]) en un sistema amortiguado a un pH = 7,4 como el d
de la sangre?
(1
1 punto)
El equ
uilibrio corrrespondientee a la formaccin del in hidrgenocarbonato ess:
CO (dis) +
+ H O (l)

HCO (aaq) + H (aq


q)

La exxpresin de lla constante de equilibriio es:


K =

HCO H
CO
O dis

H
HCO
K
=

CO
O dis
H

Los v
valores expriimentales daados son:
pK = 6,1

K = 10

6,1

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

pH = 7,1

H = 10

7,4

201

Sustituyendo en la expresin de la constante de equilibrio:


10
HCO
=
CO dis 10

6,1
7,4 = 20

c) Calcule la concentracin (mol ) de cada componente,


amortiguado o regulado, como el de la sangre, a un pH = 7,4.

, del sistema
(1 punto)

A partir de las relaciones:


HCO
= 20
CO dis
CO

dis +

HCO3 = 2,5210 2

Se obtienen las concentraciones de ambas especies:


HCO = 2,410

molL

CO

dis = 1,210

molL

d) Calcule el pH del sistema anterior, si se aade una concentracin de de 10 mol , en


unas condiciones en las que el dixido de carbono generado al restablecerse el equilibrio no se
libere
en forma de gas.






(2 puntos)
Al aadir protones al equilibrio se consume hidrgenocarbonato y se forma dixido de
carbono. Las concentraciones de las especies en el equilibrio son:
HCO3 = 2,410 2 10
CO

dis =

1,210 3 + 10

2
2

M = 1,410 2 M
M = 1,1210 2 M

Sustituyendo estos valores en la expresin de la constante de equilibrio:


10

6,1

1,1210 2
1,410

pH = log 6,3510

H
7

H = 6,3510 7 M

= 6,2

e) Calcule el pH del sistema inicial, si se aade una concentracin de de 10 mol , en


unas condiciones en las que el dixido de carbono generado al restablecerse el equilibrio se
pudiera liberar en forma de gas (debido al proceso de espiracin), mantenindose constante la
concentracin de
del sistema inicial.





(2 puntos)
Nota. Si no ha conseguido calcular la concentracin de
del apartado c, puede usar como
dato el resultado del apartado a.
Al aadir protones al equilibrio se consume hidrgenocarbonato y se forma dixido de
carbono, pero esta concentracin permanece constante ya que el gas formado se libera en la
espiracin. Las concentraciones de las especies en el equilibrio son:
HCO3 = 2,410 2 10
CO

dis = 1,210

M = 1,410 2 M

Cuestiones y Problemas de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

202

Sustituyendo estos valores en la expresin de la constante de equilibrio:


10

6,1

1,210 3
1,410

pH = log 6,8110

H = 6,8110 8 M

= 7,17

f) En el metabolismo, las personas generan dixido de carbono que favorece el aumento de la


concentracin de in
en la sangre . Indique cmo contribuye el sistema amortiguador
/
, para mantener el pH de la sangre a un valor de 7,4 y conseguir que la concentracin
de
se mantenga constante.






(1 punto)
Segn el apartado d) cuando el sistema es cerrado y no se puede liberar el CO formado, la
concentracin del mismo en la sangre aumenta y el pH de esta se vuelve ms cido,
Segn el apartado e) cuando el sistema es abierto y se puede liberar el CO formado
mediante la espiracin, la concentracin del mismo en la sangre se mantiene constante y el pH
no cambia.
g) Si una persona realiza un ejercicio fsico la presin parcial del dixido de carbono aumenta
debido al metabolismo. Calcule la concentracin (mol ) de dixido de carbono disuelto, si la
presin parcial del
se cuadruplica en las condiciones de ejercicio fsico, e indique como acta
el organismo para reducir la concentracin de
y evitar la fatiga.

(1 punto)
CO

dis = 4

1,210

= 4,810

molL

Para reducir la concentracin de CO se debe aumentar el volumen de aire espirado, para ello
se debe aumentar la frecuencia de la respiracin durante la realizacin del ejercicio fsico.
(O.Q.N. El Escorial 2012)

Problemas y Cuestiones de las Olimpiadas de Qumica. Volumen 6. (S. Menargues & F. Latre)

203